Pershing, L K; Bakhtian, S; Wright, E D; Rallis, T M
1995-08-01
Uninvolved skin of psoriasis may not be entirely normal. The object was to characterize healthy, uninvolved psoriatic skin and lesional skin by biophysical methods. Involved and uninvolved psoriatic and age-gender matched healthy skin was measured objectively with a colorimeter and evaporimeter and subjectively with visual assessment in 14 subjects. Visual assessment of erythema (E), scaling (S) and induration (I) as well as the target lesion score at the involved psoriatic skin sites were significantly elevated (puninvolved psoriatic skin >healthy skin (pcolorimeter L* and a* scale values at uninvolved psoriatic skin sites were lower and higher (pcolorimeter description (L*× b*)/a* significantly differentiated healthy skin from both involved and uninvolved psoriatic skin. These collective data highlight that even visually appearing uninvolved psoriatic skin is compromised compared with healthy skin. These objective, noninvasive but differential capabilities of the colorimeter and evaporimeter will aid in the mechanistic quantification of new psoriatic drug therapies and in conjuction with biochemical studies, add to understanding of the multifactorial pathogenesis of psoriasis.
Maintaining Healthy Skin -- Part 1
... with no breaks in the surface. It is warm (not hot or red) and neither dry and flaky nor moist and wrinkled. Healthy skin is a mirror of a healthy body. How to take care of your skin NUTRITION: To keep your skin healthy, eat a well- ...
Maintaining Healthy Skin -- Part 2
... and SCI • Depression and SCI • Taking Care of Pressure Sores • Maintaining Healthy Skin (Part I) • Maintaining Healthy Skin ( ... For information on establishing skin tolerance, see our “Pressure Sores” pamphlet.) Pressure releases in a wheelchair can be ...
Morphology and epidermal thickness of normal skin imaged by optical coherence tomography
DEFF Research Database (Denmark)
Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars
2008-01-01
colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults......Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...
Small Demodex populations colonize most parts of the skin of healthy dogs.
Ravera, Iván; Altet, Laura; Francino, Olga; Sánchez, Armand; Roldán, Wendy; Villanueva, Sergio; Bardagí, Mar; Ferrer, Lluís
2013-02-01
It is unproven that all dogs harbour Demodex mites in their skin. In fact, several microscopic studies have failed to demonstrate mites in healthy dogs. Demodex canis is a normal inhabitant of the skin of most, if not all, dogs. This hypothesis was tested using a sensitive real-time PCR to detect Demodex DNA in the skin of dogs. One hundred dogs living in a humane society shelter, 20 privately owned and healthy dogs and eight dogs receiving immunosuppressive or antineoplastic therapy. Hair samples (250-300 hairs with their hair bulbs) were taken from five or 20 skin locations. A real-time PCR that amplifies a 166 bp sequence of the D. canis chitin synthase gene was used. The percentage of positive dogs increased with the number of sampling points. When a large canine population was sampled at five cutaneous locations, 18% of dogs were positive for Demodex DNA. When 20 skin locations were sampled, all dogs tested positive for mite DNA. Our study indicates that Demodex colonization of the skin is present in all dogs, independent of age, sex, breed or coat. Nevertheless, the population of mites in a healthy dog appears to be small. Demodex DNA was amplified from all 20 cutaneous points investigated, without statistically significant differences. Using a real-time PCR technique, Demodex mites, albeit in very low numbers, were found to be normal inhabitants of haired areas of the skin of healthy dogs. © 2013 The Authors. Veterinary Dermatology © 2013 ESVD and ACVD.
Reproducible pattern of microRNA in normal human skin
DEFF Research Database (Denmark)
Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert
2010-01-01
RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....
Reproducible pattern of microRNA in normal human skin
DEFF Research Database (Denmark)
Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert
2010-01-01
RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease.......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...
Ceramides and barrier function in healthy skin
DEFF Research Database (Denmark)
Jungerstedt, J; Hellgren, Lars; Drachmann, Tue
2010-01-01
Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...
Ceramides and barrier function in healthy skin
DEFF Research Database (Denmark)
Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae
2010-01-01
Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...
Reflectance spectrometry of normal and bruised human skins: experiments and modeling
International Nuclear Information System (INIS)
Kim, Oleg; Alber, Mark; McMurdy, John; Lines, Collin; Crawford, Gregory; Duffy, Susan
2012-01-01
A stochastic photon transport model in multilayer skin tissue combined with reflectance spectroscopy measurements is used to study normal and bruised skins. The model is shown to provide a very good approximation to both normal and bruised real skin tissues by comparing experimental and simulated reflectance spectra. The sensitivity analysis of the skin reflectance spectrum to variations of skin layer thicknesses, blood oxygenation parameter and concentrations of main chromophores is performed to optimize model parameters. The reflectance spectrum of a developed bruise in a healthy adult is simulated, and the concentrations of bilirubin, blood volume fraction and blood oxygenation parameter are determined for different times as the bruise progresses. It is shown that bilirubin and blood volume fraction reach their peak values at 80 and 55 h after contusion, respectively, and the oxygenation parameter is lower than its normal value during 80 h after contusion occurred. The obtained time correlations of chromophore concentrations in developing contusions are shown to be consistent with previous studies. The developed model uses a detailed seven-layer skin approximation for contusion and allows one to obtain more biologically relevant results than those obtained with previous models using one- to three-layer skin approximations. A combination of modeling with spectroscopy measurements provides a new tool for detailed biomedical studies of human skin tissue and for age determination of contusions. (paper)
Confocal laser-scanning microscopy of capillaries in normal and psoriatic skin
Archid, Rami; Patzelt, Alexa; Lange-Asschenfeldt, Bernhard; Ahmad, Sufian S.; Ulrich, Martina; Stockfleth, Eggert; Philipp, Sandra; Sterry, Wolfram; Lademann, Juergen
2012-10-01
An important and most likely active role in the pathogenesis of psoriasis has been attributed to changes in cutaneous blood vessels. The purpose of this study was to use confocal laser-scanning microscopy (CLSM) to investigate dermal capillaries in psoriatic and normal skin. The structures of the capillary loops in 5 healthy participants were compared with those in affected skin of 13 psoriasis patients. The diameters of the capillaries and papillae were measured for each group with CLSM. All investigated psoriasis patients showed elongated, widened, and tortuous microvessels in the papillary dermis, whereas all healthy controls showed a single capillary loop in each dermal papilla. The capillaries of the papillary loop and the dermal papilla were significantly enlarged in the psoriatic skin lesions (diameters 24.39±2.34 and 146.46±28.52 μm, respectively) in comparison to healthy skin (diameters 9.53±1.8 and 69.48±17.16 μm, respectively) (P<0.001). CLSM appears to represent a promising noninvasive technique for evaluating dermal capillaries in patients with psoriasis. The diameter of the vessels could be seen as a well-quantifiable indicator for the state of psoriatic skin. CLSM could be useful for therapeutic monitoring to delay possible recurrences.
... skin. If you’re helping out in the kitchen, make sure you use hot pads or wear ... in humans, plants, and animals, while others are essential for a healthy life. Propionibacterium acnes (P. acnes) ( ...
Touch Receptors Undergo Rapid Remodeling in Healthy Skin
Directory of Open Access Journals (Sweden)
Kara L. Marshall
2016-11-01
Full Text Available Sensory tissues exposed to the environment, such as skin, olfactory epithelia, and taste buds, continuously renew; therefore, peripheral neurons must have mechanisms to maintain appropriate innervation patterns. Although somatosensory neurons regenerate after injury, little is known about how these neurons cope with normal target organ changes. To elucidate neuronal plasticity in healthy skin, we analyzed the structure of Merkel-cell afferents, which are gentle touch receptors, during skin remodeling that accompanies mouse hair-follicle regeneration. The number of Merkel cells is reduced by 90% and axonal arbors are simplified during active hair growth. These structures rebound within just days. Computational modeling predicts that Merkel-cell changes are probabilistic, but myelinated branch stability depends on Merkel-cell inputs. Electrophysiology and behavior demonstrate that tactile responsiveness is less reliable during active growth than in resting skin. These results reveal that somatosensory neurons display structural plasticity at the cost of impairment in the reliability of encoding gentle touch.
The skin microbiome in healthy and allergic dogs.
Directory of Open Access Journals (Sweden)
Aline Rodrigues Hoffmann
Full Text Available BACKGROUND: Changes in the microbial populations on the skin of animals have traditionally been evaluated using conventional microbiology techniques. The sequencing of bacterial 16S rRNA genes has revealed that the human skin is inhabited by a highly diverse and variable microbiome that had previously not been demonstrated by culture-based methods. The goals of this study were to describe the microbiome inhabiting different areas of the canine skin, and to compare the skin microbiome of healthy and allergic dogs. METHODOLOGY/PRINCIPAL FINDINGS: DNA extracted from superficial skin swabs from healthy (n = 12 and allergic dogs (n = 6 from different regions of haired skin and mucosal surfaces were used for 454-pyrosequencing of the 16S rRNA gene. Principal coordinates analysis revealed clustering for the different skin sites across all dogs, with some mucosal sites and the perianal regions clustering separately from the haired skin sites. The rarefaction analysis revealed high individual variability between samples collected from healthy dogs and between the different skin sites. Higher species richness and microbial diversity were observed in the samples from haired skin when compared to mucosal surfaces or mucocutaneous junctions. In all examined regions, the most abundant phylum and family identified in the different regions of skin and mucosal surfaces were Proteobacteria and Oxalobacteriaceae. The skin of allergic dogs had lower species richness when compared to the healthy dogs. The allergic dogs had lower proportions of the Betaproteobacteria Ralstonia spp. when compared to the healthy dogs. CONCLUSIONS/SIGNIFICANCE: The study demonstrates that the skin of dogs is inhabited by much more rich and diverse microbial communities than previously thought using culture-based methods. Our sequence data reveal high individual variability between samples collected from different patients. Differences in species richness was also seen between
Evaluation of trace elements contents in healthy and seborrhoeic skin samples by SRTXRF
International Nuclear Information System (INIS)
Soares, Julio C.A.C.; Anjos, Marcelino J.; Lopes, Ricardo T.
2009-01-01
The aim of this work is to evaluate the concentrations of trace elements content in seborrhoeic keratosis (SK) skin lesions as well in normal skin and compare them. These data was acquired by Synchrotron Radiation Total Reflection X-ray Fluorescence (SRTXRF). It focused elements with atomic number greater than 14. This stage of research was supported by LNLS - Brazilian Synchrotron Light Laboratory in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, from the same patient, has involved 5 males and females with ages varying from 34 to 80 years old. The results have shown the presence of P, S, Cl, K, Ca, Ti, Cr, Fe, Ni, Cu, and Zn in healthy skin. The comparison with lesion contents has revealed significant differences in contents of Fe, K, Cr, and Zn. (author)
Evaluation of trace elements contents in healthy and seborrhoeic skin samples by SRTXRF
Energy Technology Data Exchange (ETDEWEB)
Soares, Julio C.A.C.; Anjos, Marcelino J.; Lopes, Ricardo T., E-mail: marcelin@lin.ufrj.b, E-mail: ricardo@lin.ufrj.b [Federal University of Rio de Janeiro (UFRJ/COPPE), Rio de Janeiro, RJ (Brazil). Nuclear Engineering Program. Nuclear Instrumentation Lab.
2009-07-01
The aim of this work is to evaluate the concentrations of trace elements content in seborrhoeic keratosis (SK) skin lesions as well in normal skin and compare them. These data was acquired by Synchrotron Radiation Total Reflection X-ray Fluorescence (SRTXRF). It focused elements with atomic number greater than 14. This stage of research was supported by LNLS - Brazilian Synchrotron Light Laboratory in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, from the same patient, has involved 5 males and females with ages varying from 34 to 80 years old. The results have shown the presence of P, S, Cl, K, Ca, Ti, Cr, Fe, Ni, Cu, and Zn in healthy skin. The comparison with lesion contents has revealed significant differences in contents of Fe, K, Cr, and Zn. (author)
Schaffler, Klaus; Nicolas, Laurent B; Borta, Andreas; Brand, Tobias; Reitmeir, Peter; Roebling, Robert; Scholpp, Joachim
2017-07-01
The aim of the present study was to assess the predictivity of laser-(radiant-heat)-evoked potentials (LEPs) from the vertex electroencephalogram, using an algesimetric procedure, testing the anti-nociceptive/anti-hyperalgesic effects of single oral doses of four marketed analgesics (of different compound classes) vs. placebo, in healthy volunteers with three skin types. This was a randomized, placebo-controlled, single-blind, five-way-crossover trial. Twenty-five healthy male/female Caucasians were included (receiving celecoxib 200 mg, pregabalin 150 mg, duloxetine 60 mg, lacosamide 100 mg or placebo) in a Williams design, with CO 2 laser-induced painful stimuli to normal, ultraviolet (UV) B-inflamed and capsaicin-irritated skin. LEPs and visual analogue scale ratings were taken at baseline and hourly for 6 h postdose from all three skin types. In normal skin, the averaged postdose LEP peak-to-peak-(PtP)-amplitudes were reduced by pregabalin (-2.68 μV; 95% confidence interval (CI) -4.16, 1.19) and duloxetine (-1.73 μV; 95% CI -3.21, -0.26) but not by lacosamide and celecoxib vs. placebo. On UVB-irradiated skin, reflecting inflammatory pain, celecoxib induced a pronounced reduction in LEP PtP amplitudes vs. placebo (-6.2 μV; 95% CI -7.88, -4.51), with a smaller reduction by duloxetine (-4.54 μV; 95% CI -6.21, -2.87) and pregabalin (-3.72 μV; 95% CI -5.40, -2.04), whereas lacosamide was inactive. LEP PtP amplitudes on capsaicin-irritated skin, reflecting peripheral/spinal sensitization, as in neuropathic pain, were reduced by pregabalin (-3.78 μV; 95% CI -5.31, -2.25) and duloxetine (-2.32 μV; 95% CI -3.82, -0.82) but not by celecoxib or lacosamide vs. placebo, which was in agreement with known clinical profiles. Overall, PtP amplitude reductions were in agreement with subjective ratings. LEP algesimetry is sensitive to analgesics with different modes of action and may enable the effects of novel analgesics to be assessed during early clinical
The feline skin microbiota: The bacteria inhabiting the skin of healthy and allergic cats
Diesel, Alison; Patterson, Adam P.; Meason-Smith, Courtney; Johnson, Timothy J.; Mansell, Joanne; Suchodolski, Jan S.; Rodrigues Hoffmann, Aline
2017-01-01
Background The skin is inhabited by a multitude of microorganisms. An imbalance of these microorganisms is associated with disease, however, the causal relationship between skin microbiota and disease remains unknown. To describe the cutaneous bacterial microbiota of cats and determine whether bacterial dysbiosis occurs on the skin of allergic cats, the skin surfaces on various regions of 11 healthy cats and 10 allergic cats were sampled. Methodology/Principal findings Genomic DNA was extracted from skin swabs and sequenced using primers that target the V4 region of the bacterial 16S rRNA. The bacterial sequences from healthy cats revealed that there are differences in species diversity and richness between body sites and different epithelial surfaces. Bacterial communities preferred body site niches in the healthy cats, however, the bacterial communities on allergic cat skin tended to be more unique to the individual cat. Overall, the number of bacterial species was not significantly different between the two health status groups, however, the abundances of these bacterial species were different between healthy and allergic skin. Staphylococcus, in addition to other taxa, was more abundant on allergic skin. Conclusions/Significance This study reveals that there are more bacterial species inhabiting the skin of cats than previously thought and provide some evidence of an association between dysbiosis and skin disease. PMID:28575016
Individual signatures and environmental factors shape skin microbiota in healthy dogs.
Cuscó, Anna; Belanger, Janelle M; Gershony, Liza; Islas-Trejo, Alma; Levy, Kerinne; Medrano, Juan F; Sánchez, Armand; Oberbauer, Anita M; Francino, Olga
2017-10-13
The individual, together with its environment, has been reported as the main force driving composition and structure of skin microbiota in healthy dogs. Therefore, one of the major concerns when analyzing canine skin microbiota is the likely influence of the environment. Despite the dense fur covering, certain skin diseases exhibit differential prevalence among skin sites, dog breeds, and individuals. We have characterized the normal variability of dog skin microbiota in a well-controlled cohort of a large number of Golden-Labrador Retriever crossed dogs (N = 35) with similar ages, related genetic background, and a shared environment. We found that the individual drives the skin microbiota composition and structure followed by the skin site. The main bacterial classes inhabiting dog skin in this cohort are Gammaproteobacteria and Bacilli. We also detected bacteria associated to the environment on different dog skin sites that could be reflecting the different degrees of exposure of each skin site and each dog. Network analyses elucidated bacterial interactions within and between skin sites, especially in the chin, abdomen, axilla, and perianal region, with the highly shared interactions probably representing an anatomical, behavioral, or environmental component. When analyzing each skin site independently to assess host-specific factors, we found that temporality (season of birth and time spent in the kennel) affected all the skin sites and specially the inner pinna. The most abundant taxon driving this difference was Sphingomonas. We also found taxonomic differences among male and female dogs on the abdomen, axilla, and back. We observed a large inter-individual variability and differences among skin sites. Host-specific variables, such as temporality or sex, were also shaping skin microbiota of healthy dogs, even in an environmental homogenous cohort.
Hashida, Yumiko; Nakajima, Kimiko; Nakajima, Hideki; Shiga, Takeo; Tanaka, Moe; Murakami, Masanao; Matsuzaki, Shigenobu; Naganuma, Seiji; Kuroda, Naoki; Seki, Yasutaka; Katano, Harutaka; Sano, Shigetoshi; Daibata, Masanori
2016-09-01
Although Merkel cell polyomavirus (MCPyV) has the potential to cause Merkel cell carcinoma (MCC), it is also found in the normal skin of healthy individuals. However, the mechanism for transformation of MCPyV to an oncogenic form is unknown. To investigate the levels of MCPyV infection in the normal skin patients with MCC compared with those in a control cohort. We studied a total of six Japanese patients with cutaneous MCC. Sun-exposed and sun-unexposed skin swabs were obtained and analyzed for MCPyV loads using quantitative real-time polymerase chain reaction. At first, we found a patient with MCC carrying an extremely high load of MCPyV DNA in normal skin. This unique case prompted us to further explore the levels of MCPyV as skin microbiota in patients with MCC. We showed that MCPyV DNA levels were significantly higher in swabs obtained from normal skin samples of six patients with MCC compared with those from 30 age-matched healthy individuals and 19 patients with other cutaneous cancers. Whereas MCPyV strains obtained from the normal skin of patients with MCC had gene sequences without structural alterations, sequences of the tumor-derived strains showed truncating mutations or deletions. Although the number of patients with MCC studied was small, our findings suggest that MCC may occur with a background of high MCPyV load in the skin, and are expected to stimulate further studies on whether such skin virome levels could be one of predictive markers for the development of MCC. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt
1997-01-01
Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... yielded the following results: (1) in atopic dermatitis lesional skin an increased number of mast cell profiles was found as compared with nonlesional skin, (2) comparing atopic dermatitis skin with normal skin, a significantly increased number of mast cell profiles per millimetre squared was found...
Skin hydration, microrelief and greasiness of normal skin in Antarctica.
Tsankov, N; Mateev, D; Darlenski, R
2018-03-01
The skin is the primary defence of the human body against external factors from physical, chemical, mechanical and biologic origin. Climatic factors together with low temperature and sun radiation affect the skin. The effect of climatic conditions in Antarctica on healthy skin has not been previously addressed. The aim of this study was to evaluate the changes in the skin hydration, greasiness and microrelief due to the extreme climatic environmental factors during the stay of the members of the Bulgarian Antarctic expedition. Fifty-nine Caucasian healthy subjects, 42 men and 17 women with mean age 50.9 years (27-68), were enrolled. The study was performed in five consecutive years from 2011 to 2016 at the Bulgarian Antarctic base camp at Livingston Island. The study protocol consisted of two parts: study A: duration of 15 days with measurement of skin physiology parameters on a daily basis, and study B: five measurements at baseline and at days 14, 30, 45 and 50 upon arrival in Antarctica. We measured three biophysical parameters related to skin physiology at cheek skin by an impedance measuring device. No statistically significant difference between parameters at the different measurement points. There is a variation in skin hydration reaching its lower point at day 11 and then returning to values similar to baseline. Initially, an increase in skin greasiness was witnessed with a sharp depression at day 11 and final values at day 15 resembling the ones at baseline. An increase, although not statistically significant, in skin roughness was observed in the first 15 days of the study. Study B showed no statistically significant variances between values of the three parameters. Our studies show the pioneer results of the effect of Antarctic climate on human skin physiology. © 2017 European Academy of Dermatology and Venereology.
Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.
1987-01-01
The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells
te Hennepe, Mieneke
2014-07-01
The concept of a healthy skin penetrated the lives of many people in late-nineteenth-century Britain. Popular writings on skin and soap advertisements are significant for pointing to the notions of the skin as a symbolic surface: a visual moral ideal. Popular health publications reveal how much contemporary understanding of skin defined and connected ideas of cleanliness and the visual ideals of the healthy body in Victorian Britain. Characterised as a 'sanitary commissioner' of the body, skin represented the organ of drainage for body and society. The importance of keeping the skin clean and purging it of waste materials such as sweat and dirt resonated in a Britain that embraced city sanitation developments, female beauty practices, racial identities and moral reform. By focusing on the popular work by British surgeon and dermatologist Erasmus Wilson (1809-84), this article offers a history of skin through the lens of the sanitary movement and developments in the struggle for control over healthy skin still in place today.
Effect of friction on vibrotactile sensation of normal and dehydrated skin.
Chen, S; Ge, S; Tang, W; Zhang, J
2016-02-01
Vibrotactile sensation mediated is highly dependent on surface mechanical and frictional properties. Dehydration of skin could change these properties. To investigate the relationship between friction and vibrotactile sensation of normal and dehydrated skin. Vibrations were firstly measured during surface exploration using a biomimetic sensor. Piglet skin was used as human skin model to study frictional properties for both normal and dehydrated skin using an atomic force microscope on nanoscale and a pin-on-disk tribometer on macroscale. Effect of vibrational frequency on friction and vibrotactile perception was also observed on nano and macro scale for normal and dehydrated skin. The result indicated that dehydrated skin was less sensitive than normal skin. The coefficient of friction of dehydrated skin is smaller than that of normal skin on both nano and macro scale. The coefficient of friction increases as increasing scanning frequencies. There is a positive correlation between coefficient of friction and vibrotactile sensation on nanoscale and macroscale. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Mast cell distribution in normal adult skin
A.S. Janssens (Artiena Soe); R. Heide (Rogier); J.C. den Hollander (Jan); P.G.M. Mulder (P. G M); B. Tank (Bhupendra); A.P. Oranje (Arnold)
2005-01-01
markdownabstract__AIMS:__ To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. __METHODS:__ Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults.
Bek-Thomsen, Malene; Lomholt, Hans B.; Scavenius, Carsten; Enghild, Jan J.; Brüggemann, Holger
2014-01-01
Acne vulgaris is a very common disease of the pilosebaceous unit of the human skin. The pathological processes of acne are not fully understood. To gain further insight sebaceous follicular casts were extracted from 18 healthy and 20 acne-affected individuals by cyanoacrylate-gel biopsies and further processed for mass spectrometry analysis, aiming at a proteomic analysis of the sebaceous follicular casts. Human as well as bacterial proteins were identified. Human proteins enriched in acne and normal samples were detected, respectively. Normal follicular casts are enriched in proteins such as prohibitins and peroxiredoxins which are involved in the protection from various stresses, including reactive oxygen species. By contrast, follicular casts extracted from acne-affected skin contained proteins involved in inflammation, wound healing and tissue remodeling. Among the most distinguishing proteins were myeloperoxidase, lactotransferrin, neutrophil elastase inhibitor and surprisingly, vimentin. The most significant biological process among all acne-enriched proteins was ‘response to a bacterium’. Identified bacterial proteins were exclusively from Propionibacterium acnes. The most abundant P. acnes proteins were surface-exposed dermatan sulphate adhesins, CAMP factors, and a so far uncharacterized lipase in follicular casts extracted from normal as well as acne-affected skin. This is a first proteomic study that identified human proteins together with proteins of the skin microbiota in sebaceous follicular casts. PMID:25238151
Incorporation of 14C-linoleic acid in lipids of normal and psoriatic human skin
International Nuclear Information System (INIS)
Ruestow, B.; Metz, D.; Kunze, D.; Meffert, H.
1980-01-01
The 14 C-linoleic acid incorporation in lipids of surviving epidermis and corium of normal and psoriatic human skin was investigated. Changes of lipid metabolism were found in both epidermis and corium. Particularly the turnover of phospholipids was increased in the uninvolved psoriatic epidermis in relation to the involved psoriatic epidermis or to healthy controls. Possible reasons of these phenomena and the significance of structural lipids in psoriasis are discussed. (author)
International Nuclear Information System (INIS)
Soares, Julio C.A.C.R.; Canellas, Catarine G.L.; Lopes, Ricardo T.; Anjos, Marcelino J.
2011-01-01
In this work, the concentrations of trace elements were measured in acrochordon, a skin lesion also known as skin tag or fibroepithelial polyp, as well as in normal skin from the same patient. The samples were analysed by Synchrotron Radiation Total Reflection X- ray Fluorescence (SRTXRF) in the Synchrotron Light National Laboratory (LNLS) in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, has involved 17 patients. It was evaluated the presence of P, S, Cl, K, Ca, Cr, Mn, Fe, Cu, Zn, Br and Rb in the paired samples, which were compared, and significant differences were found in some of them. (author)
Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa
DEFF Research Database (Denmark)
Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus
2017-01-01
therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid – fluorescence in situ hybridization probes...... were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...... and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease....
Mast cell distribution in normal adult skin.
Janssens, A S; Heide, R; den Hollander, J C; Mulder, P G M; Tank, B; Oranje, A P
2005-03-01
To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults. There was an uneven distribution of MCs in different body sites using the anti-tryptase monoclonal antibody technique. Numbers of MCs on the trunk, upper arm, and upper leg were similar, but were significantly different from those found on the lower leg and forearm. Two distinct groups were formed--proximal and distal. There were 77.0 MCs/mm2 at proximal body sites and 108.2 MCs/mm2 at distal sites. Adjusted for the adjacent diagnosis and age, this difference was consistent. The numbers of MCs in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders were not different from those in the control group. Differences in the numbers of MCs between the distal and the proximal body sites must be considered when MCs are counted for a reliable diagnosis of mastocytosis. A pilot study in patients with mastocytosis underlined the variation in the numbers of MCs in mastocytosis and normal skin, but showed a considerable overlap. The observed numbers of MCs in adults cannot be extrapolated to children. MC numbers varied significantly between proximal and distal body sites and these differences must be considered when MCs are counted for a reliable diagnosis of mastocytosis. There was a considerable overlap between the numbers of MCs in mastocytosis and normal skin.
Prevalence of Demodex canis-positive healthy dogs at trichoscopic examination.
Fondati, Alessandra; De Lucia, Michela; Furiani, Nicla; Monaco, Moira; Ordeix, Laura; Scarampella, Fabia
2010-04-01
Demodex canis is thought to be present in small numbers in the skin of most healthy dogs; however, available data on the prevalence of normal dogs harbouring D. canis are scarce. The purpose of this study was to investigate, using microscopic examination of plucked hairs, the prevalence of healthy dogs harbouring D. canis. Seventy-eight clinically healthy dogs with no history of dermatological problems and clinically normal skin and hair coat were included in the study. Five areas (perioral skin 2-3mm from both labial commissures, periungual skin of the third digit of both anterior paws and chin) were examined in each dog. Fifty to sixty hairs were plucked from each skin site and microscopically examined. No D. canis mites were observed and only one adult form of Demodex injai was found in the labial commissure of one dog. Based on these results, the estimated prevalence of healthy dogs harbouring D. canis in clinically normal skin should not exceed the threshold of 5.4%, with 95% confidence level. Considering our and previous findings, we propose that, although small numbers of D. canis might inhabit the skin of normal dogs, the probability of finding these mites in normal dogs is low. Consequently, in most cases, the presence of a D. canis mite in the skin should not be considered as indicative of normality.
te Hennepe, Mieneke
2014-01-01
The concept of a healthy skin penetrated the lives of many people in late-nineteenth-century Britain. Popular writings on skin and soap advertisements are significant for pointing to the notions of the skin as a symbolic surface: a visual moral ideal. Popular health publications reveal how much contemporary understanding of skin defined and connected ideas of cleanliness and the visual ideals of the healthy body in Victorian Britain. Characterised as a ‘sanitary commissioner’ of the body, skin represented the organ of drainage for body and society. The importance of keeping the skin clean and purging it of waste materials such as sweat and dirt resonated in a Britain that embraced city sanitation developments, female beauty practices, racial identities and moral reform. By focusing on the popular work by British surgeon and dermatologist Erasmus Wilson (1809–84), this article offers a history of skin through the lens of the sanitary movement and developments in the struggle for control over healthy skin still in place today. PMID:25045181
Neurotrophins in healthy and diseased skin.
Raap, U; Kapp, A
2010-04-01
Understanding the complex mechanism of allergic inflammatory skin diseases has been a main challenge of clinical and experimental research for years. It is well known that the inflammatory response is also controlled by tissue resident cells including neurons and structural cells. Thus, allergic inflammation triggers neuronal dysfunction and structural changes in diseased skin. Prime candidates for the interaction between immune, structural, and neuronal cells are presented by neurotrophins. Neurotrophins have initially been described for their neurotrophic capacity. However, recent evidence emerges that neurotrophins display bidirectional interaction pathways in activating structural cells, immune cells in addition to neurons. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) are upregulated in allergic inflammatory skin diseases. Further, structural cells, neurons and tissue resident cells have not only been shown to be a target but also a source of neurotrophin. In this regard, eosinophil granulocytes which are key target effector cells in chronic inflammatory skin have been identified as a target of neurotrophins but are also capable of neurotrophin production. Thus, neuroimmune interaction mechanisms in allergic inflammatory skin display a novel pathophysiological aspect in which neurotrophins serve as prime candidates for bidirectional interaction mechanisms. In this review, we provide an actual overview of neurotrophins in healthy and diseased skin with special emphasis on atopic dermatitis and therapeutic implications.
DEFF Research Database (Denmark)
Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt
1997-01-01
Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... at the site of each biopsy. After fixation and plastic embedding, the biopsies were cut into 2 microns serial sections. Ten sections, 30 microns apart, from each biopsy were examined and stained alternately with either toluidine blue or Giemsa stain and mast cell profile numbers were determined. The study...
Characterization of oily mature skin by biophysical and skin imaging techniques.
de Melo, M O; Maia Campos, P M B G
2018-02-13
The skin is a complex biological system and may suffer change according to the environmental factors, as higher temperatures can increase sebum excretion, presenting oiliness and acne. These alterations can persist during the aging and provoke more changes in aged skin. In this study we evaluated the mature oily skin characteristics using biophysical and skin imaging techniques. Sixty healthy female subjects, aged between 39 and 55 years old were recruited and separated into 2 groups according to their skin type: normal/dry and oily skin. The skin was evaluated in terms of stratum corneum water content, transepidermal water loss (TEWL) sebum content, dermis thickness and echogenicity, skin microrelief, and pores content. The mature oily skin presented no significant differences when compared to the normal/dry skin on the stratum corneum water content and TEWL parameters. The sebum content was significantly higher on the oily skin group. The microrelief analysis showed an increase of skin roughness values in the oily skin and increase of scaliness in the normal/dry skin. The oily skin showed lower dermis echogenicity mainly in the frontal region and higher dermis thickness when compared to normal/dry skin. The mature oily skin showed different characteristics from normal/dry skin in terms of sebum content, microrelief parameters, and dermis thickness. This way, the characterization of mature oily skin in an objective way is very important to development of dermocosmetic products for more effective treatments focused specially on this type of skin. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Rafat, Z; Hashemi, S J; Ahamdikia, K; Daie Ghazvini, R; Bazvandi, F
2017-12-01
The skin is the body's largest organ that hosts heterogeneous inhabitants. Until now, the diversity of the cutaneous microbiome was mainly investigated for bacteria and there is a little information about the skin fungal flora. Also, among skin fungal flora, Candida is found as a main member whose distribution is affected by sex, age, climate. In this study, differences in Candida community structure associated with 9 different skin sites of 238 healthy people during 10 months from July to March 2016, are described. These subjects were divided by age into 4 groups: infants, children, adults and geriatrics. The collected samples were examined by culture on Sabouraud Chloramphenicol Agar and CHROM-agar Candida. For precise identification of species ITS1-5. 8S-ITS2 rDNA regions were sequenced where needed. The frequency of Candida species was significantly different between age groups. The most Candida isolations were related to the elderly age group and the fewest in the infants. C. parapsilosis virtually, was the predominant isolated species in all age groups. This study showed no statistically significant effect of the subject's sex on Candida population resident on human skin surface. Copyright © 2017. Published by Elsevier Masson SAS.
The follicular skin microbiome in patients with hidradenitis suppurativa and healthy controls
DEFF Research Database (Denmark)
Ring, Hans Christian; Thorsen, Jonathan; Saunte, Ditte M.
2017-01-01
IMPORTANCE: Although the pathogenesis of hidradenitis suppurativa (HS) remains enigmatic, several factors point to potential involvement of the cutaneous microbiome. Insight into the cutaneous microbiome in HS using next-generation sequencing may provide novel data on the microbiological diversity...... of the skin. OBJECTIVE: To investigate the follicular skin microbiome in patients with HS and in healthy controls. DESIGN, SETTING, AND PARTICIPANTS: This case-control study obtained punch biopsy specimens from patients with HS (lesional and nonlesional) and healthy controls between October 1, 2014....... Biopsy specimens from healthy controls were obtained from the axilla only. MAIN OUTCOMES AND MEASURES: The different microbiomes were investigated using next-generation sequencing targeting 16S and 18S ribosomal RNA. RESULTS: The skin microbiome was characterized in 30 patients with HS (mean [SD] age...
Bernat-García, J; Morales Suárez-Varela, M; Vilata-Corell, J J; Marquina-Vila, A
2014-04-01
The influence of human papillomavirus (HPV) on the development of nonmelanoma skin cancer (NMSC) is a topic of debate. HPV types from the beta genus (HPV-β) have been most frequently associated with the development of skin cancer. To analyze the prevalence and range of HPV types in NMSC lesions and healthy perilesional skin in immunodepressed and immunocompetent patients and to evaluate the influence of various clinical factors on the prevalence of HPV in skin cancer. Nested polymerase chain reaction and sequencing were used to detect HPV in 120 NMSC samples obtained by biopsy from 30 kidney transplant recipients and 30 immunocompetent patients. In all cases, a sample was taken from the tumor site and the surrounding healthy skin. Potential confounders were assessed and the data analyzed by multivariate logistic regression. HPV DNA was detected in 44 (73.3%) of the 60 samples from immunodepressed patients and in 32 (53.3%) of the 60 samples from immunocompetent patients (adjusted odds ratio, 3.4; 95% CI, 1.2-9.6). In both groups of patients, HPV was more common in healthy perilesional skin than in lesional skin. HPV-β was the most common type isolated. We found a wide range of HPV types (mostly HPV-β) in the skin of kidney transplant recipients and immunocompetent patients with skin cancer. Copyright © 2013 Elsevier España, S.L. and AEDV. All rights reserved.
DEFF Research Database (Denmark)
Engebretsen, K A; Kezic, S; Jakasa, I
2018-01-01
: To explore the effect of selected exogenous skin stressors on NMF and skin cytokines levels in healthy adult epidermis. MATERIAL AND METHODS: 40 healthy volunteers (18-49 years) were exposed to hard, soft, and chlorinated water, 0.5% SLS, house dust mite, cat allergen, staphylococcal enterotoxin B (SEB...... of various skin cytokines in healthy individuals. Our data highlight environmental factors that might play a role in AD pathophysiology, but needs confirmation in AD patients. This article is protected by copyright. All rights reserved....
Guinot, C; Latreille, J; Tenenhaus, M; Malvy, D J
2001-04-01
Today's classifications of healthy skin are predominantly based on a very limited number of skin characteristics, such as skin oiliness or susceptibility to sun exposure. The aim of the present analysis was to set up a global classification of healthy facial skin, using mathematical models. This classification is based on clinical, biophysical skin characteristics and self-reported information related to the skin, as well as the results of a theoretical skin classification assessed separately for the frontal and the malar zones of the face. In order to maximize the predictive power of the models with a minimum of variables, the Partial Least Square (PLS) discriminant analysis method was used. The resulting PLS components were subjected to clustering analyses to identify the plausible number of clusters and to group the individuals according to their proximities. Using this approach, four PLS components could be constructed and six clusters were found relevant. So, from the 36 hypothetical combinations of the theoretical skin types classification, we tended to a strengthened six classes proposal. Our data suggest that the association of the PLS discriminant analysis and the clustering methods leads to a valid and simple way to classify healthy human skin and represents a potentially useful tool for cosmetic and dermatological research.
In vivo spectroscopy of healthy skin and pathology in terahertz frequency range
International Nuclear Information System (INIS)
Zaytsev, Kirill I; Gavdush, Arseniy A; Chernomyrdin, Nikita V; Karasik, Valeriy E; Yurchenko, Stanislav O; Kudrin, Konstantin G; Reshetov, Igor V
2015-01-01
Biomedical applications of terahertz (THz) technology and, in particular, THz pulsed spectroscopy have attracted considerable interest in the scientific community. A lot of papers have been dedicated to studying the ability for human disease diagnosis, including the diagnosis of human skin cancers. In this paper we have studied the THz material parameters and THz dielectric properties of human skin and pathology in vivo, and THz pulsed spectroscopy has been utilized for this purpose. We have found a contrast between material parameters of basal cell carcinoma and healthy skin, and we have also compared the THz material parameters of dysplastic and non-dysplastic pigmentary nevi in order to study the ability for early melanoma diagnosis. Significant differences between the THz material parameters of healthy skin and pathology have been detected, thus, THz pulsed spectroscopy promises to be become an effective tool for non-invasive diagnosis of skin neoplasms
Kiprono, Samson K; Masenga, John E; Chaula, Baraka M; Naafs, Bernard
2012-07-30
Skin flora varies from one site of the body to another. Individual's health, age and gender determine the type and the density of skin flora. A 1 cm² of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35 °C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and 31 individuals with normal skin pigmentation. Those with normal skin were either relatives or staying with the individuals affected by albinism who were recruited for the study. The mean age of the 97 recruited individuals was 30.6 (SD ± 14.9) years. The mean of the colony forming units was 1580.5 per cm2. Those affected by albinism had a significantly higher mean colony forming units (1680 CFU per cm²) as compared with 453.5 CFU per cm² in those with normally pigmented skin (p = 0.023). The skin type and the severity of sun- damaged skin was significantly associated with a higher number of colony forming units (p = 0.038). Individuals affected by albinism have a higher number of colony forming units which is associated with sun- damaged skin.
Clinical and histological effects of blue light on normal skin.
Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.
2010-01-01
INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and
Skin temperature in the extremities of healthy and neurologically impaired children.
Svedberg, Lena E; Stener-Victorin, Elisabet; Nordahl, Gunnar; Lundeberg, Thomas
2005-01-01
Little emphasis has been accorded to peripheral skin temperature impairments in children with neurological disorders but attention has been paid to the significance of cold extremities (autonomic failure) for well-being and quality of life in adults stroke patients. Therefore, it seems important to investigate skin temperature in children with neurological disorder, especially when their communication is impaired. In the present study, we wanted to objectively verify any skin temperature differences between pre-school children with and without neurological disorders and also ascertain if any correlation existed between skin temperature and physical activity. Skin temperatures in 25 healthy children and 15 children with cerebral or spinal cord damages were assessed using infrared radiation. The temperatures were recorded on the palm and the dorsal surface of the hands and on the sole and dorsal surface of the feet three times at 15-minute intervals over 30min. A significant lower mean skin temperature in all measurement points was seen in non-walking children with cerebral damages compared to healthy controls. Also, the mean skin temperature was significantly lower in all foot measuring points in the children with cerebral damages that were unable to walk compared to those walking. In conclusion, as cold extremities may result in impaired well-being and hypothetically may be associated with other symptoms born by the child, further investigations of thermal dysfunction and autonomic function are of importance and treatment may be warranted.
The role of innate lymphoid cells in healthy and inflamed skin
DEFF Research Database (Denmark)
Bonefeld, Charlotte M.; Geisler, Carsten
2016-01-01
system. During the last years, it has become clear that innate lymphoid cells play a role in homeostasis and inflammation of the skin in humans and mice. In this review, we will discuss the role of innate lymphoid cells in healthy and inflamed skin with special focus on their role in atopic dermatitis.......The skin constitutes the interface between the organism and the environment, and it protects the body from harmful substances in the environment via physical, chemical and immunological barriers. The immunological barrier of the skin comprises both cells from the innate and the adaptive immune...
Filipović, Mila; Gledović, Ana; Lukić, Milica; Tasić-Kostov, Marija; Isailović, Tanja; Pantelić, Ivana; Vuleta, Gordana; Savić, Snežana
2016-11-01
Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. With the employment of noninvasive skin biophysical measurements, skin hydration (EC), transepi-dermal water loss (TEWL), erythema index (EI) and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study) on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031
Directory of Open Access Journals (Sweden)
Filipović Mila
2016-01-01
Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031
Metabolite characterization in serum samples from normal healthy ...
African Journals Online (AJOL)
Metabolite characterization in serum samples from normal healthy human subjects by 1H and 13C NMR spectroscopy. D Misra, U Bajpai. Abstract. One and two dimensional NMR spectroscopy has been employed to characterize the various metabolites of serum control healthy samples. Two dimensional heteronuclear ...
Normal distribution of standing balance for healthy Danish children
DEFF Research Database (Denmark)
Pedersen, Line Kjeldgaard; Ghasemi, Habib; Rahbek, Ole
2013-01-01
Title: Normal distribution of standing balance for healthy Danish children – Reproducibility of parameters of balance. Authors Line Kjeldgaard Pedersen Habib Ghasemi Ole Rahbek Bjarne Møller-Madsen 1800 characters incl. spaces Background Pedobarographic measurements are increasingly used in child......Title: Normal distribution of standing balance for healthy Danish children – Reproducibility of parameters of balance. Authors Line Kjeldgaard Pedersen Habib Ghasemi Ole Rahbek Bjarne Møller-Madsen 1800 characters incl. spaces Background Pedobarographic measurements are increasingly used...
Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y
2010-01-01
Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.
International Nuclear Information System (INIS)
Lohmann, Tania Helena Ochi.
1995-01-01
Cancer, a major death cause in developed countries, has been related to somatic mutations that could be detected by cytogenetic analysis. Among the tools used in these tests, the micronucleus assay has been largely applied at population surveillance, biological dosimetry and early detection of groups with higher risks to developing cancers. In this study, we analysed the chromosome susceptibility of blood lymphocytes from basocellular skin cancer patients and healthy volunteers. The cytogenetic analysis was performed by a micronucleus assay, using progressive doses of ionizing radiation from a 60 Co source as mutagen. Briefly, the blood lymphocytes were irradiated in vitro, as processed by the cytokinesis-blocked method. The micronucleus frequency and distribution, cell cycle kinetics, nucleation index and dose-response relationship were determined in each patient. The results showed that the basocellular skin cancer patients lymphocytes presented higher spontaneous micronucleus frequency as compared with those from healthy young volunteers but lower than healthy now young volunteers . The radiation-induced micronucleus analysis showed that the basocellular skin cancer patients' lymphocytes presented similar proportion of damage lymphocytes as compared with those from healthy volunteers. Nevertheless, the magnitude of this damage was higher in this group with doses. Higher than 400 c Gy, which was not occurred in healthy volunteers. Cell cycle kinetics, as determined by the nucleation index, was lower in basocellular skin cancer patients as compared with healthy volunteers, indicating a more slow cell cycle. Our data showed that the lymphocytes from carcinoma basocellular patients were more radiosensitive as compared with those form healthy volunteers. (author). 159 refs., 21 figs., 16 tabs
DEFF Research Database (Denmark)
Boone, Marc; Jemec, Gregor B E; Del Marmol, Véronique
2012-01-01
High-definition OCT (HD-OCT) is an innovative technique based on the principle of conventional OCT. Our objective was to test the resolution and image quality of HD-OCT in comparison with reflectance confocal microscopy (RCM) of healthy skin. Firstly, images have been made of a ultra-high-resolut......High-definition OCT (HD-OCT) is an innovative technique based on the principle of conventional OCT. Our objective was to test the resolution and image quality of HD-OCT in comparison with reflectance confocal microscopy (RCM) of healthy skin. Firstly, images have been made of a ultra......-high-resolution line-pair phantome with both systems. Secondly, we investigated 21 healthy volunteers of different phototypes with HD-OCT and RCM on volar forearm and compared the generated images. HD-OCT displays also differences depending on the skin phototype and anatomical site. The 3-μm lateral resolution...... of the HD-OCT could be confirmed by the phantom analysis. The identification of cells in the epidermis can be made by both techniques. RCM offers the best lateral resolution, and HD-OCT has the best penetration depth, providing images of individual cells deeper within the dermis. Eccrine ducts and hair...
Kikuchi, K; Tagami, H; Akaraphanth, R; Aiba, S
2011-01-01
Although the nipple and areola of the breast constitute a unique and prominent area on the chest, so far no study has been done on the functional properties of their skin surfaces. To study the stratum corneum (SC) covering the areola using noninvasive methods. Eighteen adult healthy subjects comprising nine men and nine women and 18 age- and sex-matched patients with atopic dermatitis (AD), none of whom had visible skin lesions, participated in the study. Transepidermal water loss (TEWL), skin surface hydration and skin surface lipid levels were measured on the areola and adjacent breast skin. The size of the skin surface corneocytes of these skin regions was assessed. All the healthy subjects showed significantly higher TEWL accompanied by smaller sized corneocytes on the areola than on the adjacent breast skin. Only female subjects revealed a significantly higher skin surface hydration state together with significantly increased skin surface lipid levels on the areola than on the adjacent breast skin. These sex differences were observed even in patients with AD. Comparison between healthy individuals and the patients with AD demonstrated higher TEWL, decreased skin surface hydration state and lower skin surface lipid levels associated with smaller sized corneocytes in the areola in the patients with AD, especially in male patients. In adults, the SC barrier function and SC water-binding capacity of the areola were functionally poorer than in the adjacent skin, being covered by smaller sized corneocytes and lower amounts of skin surface lipids, especially in men and in patients with AD. © 2011 The Authors. BJD © 2011 British Association of Dermatologists 2011.
Lahousen, Theresa; Kupfer, Jörg; Gieler, Uwe; Hofer, Angelika; Linder, M Dennis; Schut, Christina
2016-08-23
Psoriasis is a chronic skin disease associated with high levels of psychological distress and considerable life impact. Feelings of shame and stigmatization can lead to avoidance of social activity and intimacy. In this study, the questionnaire TSD-Q was used to evaluate pleasure in touching oneself and in a partnership, parental touching during childhood and (skin-related) shame and disgust. Skin-related disgust and shame were significantly higher in psoriatic patients than in healthy controls. Moreover, psoriasis-patients scored significantly lower than skin-healthy controls concerning appraisal of self-touching and parental touching. In contrast, psoriasis-patients scored higher concerning appraisal of touching in a partnership. Due to the fact that low self-esteem might enhance the negative evaluation of touch and the feelings of shame and disgust, psychological interventions should be integrated in the treatment of psoriasis.
Normal variants of skin in neonates
Directory of Open Access Journals (Sweden)
Kulkarni M
1996-01-01
Full Text Available 2221 consecutive live births taking place between March 1994 and February 1995 were evaluated for a minimum period of 5 days to note for the occurrence of various normal anatomical variants specially those of skin. Birth weight, gestational age, maternal age, socio-economic status and consanguinity were carefully recorded in all the cases. Mongolian spots (72%, Epstein pearls (43.8%, Milia (26.2% and Erythema toxicum (25.2%, were the common dermatological variants noted. Maturity of the babies and possibly genetic factors (consanguinity are important factors in their causation as ordered in our study.
Malassezia versus Candida in Healthy Dogs
Directory of Open Access Journals (Sweden)
Sihelská Z.
2017-03-01
Full Text Available The genera Malassezia and Candida include yeasts which are members of the normal mycobiota of the skin and mucosal sites of humans and other warm-blooded animals. These yeasts are associated with a variety of dermatological disorders and also systemic diseases in humans and other animals. This study confirms the occurrence of Malassezia and Candida species in healthy dogs. Samples were collected from different body sites: external ear canal, interdigital area, skin of the axilla and of the neck, and the oral and rectal mucosae. The isolates were identified using phenotypic methods (biochemical-physiological and morphological characteristics. The presence of yeasts were investigated in the specimens from 70 healthy dogs. Malassezia species were isolated in 44 dogs from which 84 Malassezia isolates were obtained. Only one Candida isolate was obtained from the dogs examined. It was found that Candida does not occur in dogs normally and Malassezia was the main colonizing yeast in healthy dogs.
Berardesca, Enzo; Mortillo, Susan; Cameli, Norma; Ardigo, Marco; Mariano, Maria
2018-05-10
Atopic dermatitis is a chronic, pruritic inflammatory skin disease that adversely affects quality of life. The current study evaluates the efficacy of a shower cream and a lotion, each with skin-identical lipids and emollients, in the treatment of atopic dry skin of subjects with a history of atopic condition. In all, 40 healthy females with clinically dry skin on the lower legs were enrolled in the study and underwent 4 weeks of daily use of the shower cream and 2 additional weeks of both the shower cream and the body lotion. Subjects were evaluated at day 0, week 4, and week 6. Skin barrier function was assessed by Tewameter ® , skin hydration by Corneometer ® , smoothness and desquamation by Visioscan ® , and stratum corneum architecture by reflectance confocal microscopy (RCM). The investigator assessed the degree of dryness, roughness, redness, cracks, tingling and itch, and subjective self-assessment evaluated the perception of skin soothing, smoothness, and softness. Skin barrier function and skin moisture maintenance were significantly improved using the shower cream. The lotion with physiological lipids, together with the shower cream, also improved skin barrier function and moisture. Both the shower cream and the body lotion reduced clinical dryness, roughness, redness, cracks, tingling and itch, according to the dermatologist, and increased soothing, smoothness, and softness, according to the subjects of the study. The combination of a shower cream and a lotion with physiological lipids efficiently restores skin barrier function and increases skin hydration, becoming an effective skin-care option for patients with atopic dry skin. © 2018 Wiley Periodicals, Inc.
Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin
DEFF Research Database (Denmark)
Kamstrup, M.; Faurschou, A.; Gniadecki, R.
2008-01-01
In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...
Energy Technology Data Exchange (ETDEWEB)
Biswal, N C; Wu, Z; Chu, J [Rush University Medical Center, Chicago, IL (United States); Sun, J [Argonne National Laboratory, Lemont, IL (United States)
2015-06-15
Purpose: To assess the potential of dynamic infrared imaging to evaluate early skin reactions during radiation therapy in cancer patients. Methods: Thermal images were captured by our home-built system consisting of two flash lamps and an infrared (IR) camera. The surface temperature of the skin was first raised by ∼ 6 °C from ∼1 ms short flashes; the camera then captured a series of IR images for 10 seconds. For each image series, a basal temperature was recorded for 0.5 seconds before flash was triggered. The temperature gradients (ε) were calculated between a reference point (immediately after the flash) and at a time point of 2sec, 4sec and 9sec after that. A 1.0 cm region of interest (ROI) on the skin was drawn; the mean and standard deviations of the ROIs were calculated. The standard ε values for normal human skins were evaluated by imaging 3 healthy subjects with different skin colors. All of them were imaged on 3 separate days for consistency checks. Results: The temperature gradient, which is the temperature recovery rate, depends on the thermal properties of underlying tissue, i.e. thermal conductivity. The average ε for three volunteers averaged over 3 measurements were 0.64±0.1, 0.72±0.2 and 0.80±0.3 at 2sec, 4sec and 9sec respectively. The standard deviations were within 1.5%–3.2%. One of the volunteers had a prior small skin burn on the left wrist and the ε values for the burned site were around 9% (at 4sec) and 13% (at 9sec) lower than that from the nearby normal skin. Conclusion: The temperature gradients from the healthy subjects were reproducible within 1.5%–3.2 % and that from a burned skin showed a significant difference (9%–13%) from the normal skin. We have an IRB approved protocol to image head and neck patients scheduled for radiation therapy.
International Nuclear Information System (INIS)
Biswal, N C; Wu, Z; Chu, J; Sun, J
2015-01-01
Purpose: To assess the potential of dynamic infrared imaging to evaluate early skin reactions during radiation therapy in cancer patients. Methods: Thermal images were captured by our home-built system consisting of two flash lamps and an infrared (IR) camera. The surface temperature of the skin was first raised by ∼ 6 °C from ∼1 ms short flashes; the camera then captured a series of IR images for 10 seconds. For each image series, a basal temperature was recorded for 0.5 seconds before flash was triggered. The temperature gradients (ε) were calculated between a reference point (immediately after the flash) and at a time point of 2sec, 4sec and 9sec after that. A 1.0 cm region of interest (ROI) on the skin was drawn; the mean and standard deviations of the ROIs were calculated. The standard ε values for normal human skins were evaluated by imaging 3 healthy subjects with different skin colors. All of them were imaged on 3 separate days for consistency checks. Results: The temperature gradient, which is the temperature recovery rate, depends on the thermal properties of underlying tissue, i.e. thermal conductivity. The average ε for three volunteers averaged over 3 measurements were 0.64±0.1, 0.72±0.2 and 0.80±0.3 at 2sec, 4sec and 9sec respectively. The standard deviations were within 1.5%–3.2%. One of the volunteers had a prior small skin burn on the left wrist and the ε values for the burned site were around 9% (at 4sec) and 13% (at 9sec) lower than that from the nearby normal skin. Conclusion: The temperature gradients from the healthy subjects were reproducible within 1.5%–3.2 % and that from a burned skin showed a significant difference (9%–13%) from the normal skin. We have an IRB approved protocol to image head and neck patients scheduled for radiation therapy
Normal range values for thromboelastography in healthy adult volunteers
Directory of Open Access Journals (Sweden)
S. Scarpelini
2009-12-01
Full Text Available Thromboelastography (TEG® provides a functional evaluation of coagulation. It has characteristics of an ideal coagulation test for trauma, but is not frequently used, partially due to lack of both standardized techniques and normal values. We determined normal values for our population, compared them to those of the manufacturer and evaluated the effect of gender, age, blood type, and ethnicity. The technique was standardized using citrated blood, kaolin and was performed on a Haemoscope 5000 device. Volunteers were interviewed and excluded if pregnant, on anticoagulants or having a bleeding disorder. The TEG® parameters analyzed were R, K, α, MA, LY30, and coagulation index. All volunteers outside the manufacturer’s normal range underwent extensive coagulation investigations. Reference ranges for 95% for 118 healthy volunteers were R: 3.8-9.8 min, K: 0.7-3.4 min, α: 47.8-77.7 degrees, MA: 49.7-72.7 mm, LY30: -2.3-5.77%, coagulation index: -5.1-3.6. Most values were significantly different from those of the manufacturer, which would have diagnosed coagulopathy in 10 volunteers, for whom additional investigation revealed no disease (81% specificity. Healthy women were significantly more hypercoagulable than men. Aging was not associated with hypercoagulability and East Asian ethnicity was not with hypocoagulability. In our population, the manufacturer’s normal values for citrated blood-kaolin had a specificity of 81% and would incorrectly identify 8.5% of the healthy volunteers as coagulopathic. This study supports the manufacturer’s recommendation that each institution should determine its own normal values before adopting TEG®, a procedure which may be impractical. Consideration should be given to a multi-institutional study to establish wide standard values for TEG®.
Efficacy of Phoenix dactylifera L. (Date Palm Creams on Healthy Skin
Directory of Open Access Journals (Sweden)
Sidra Meer
2017-05-01
Full Text Available The date palm fruit (Phoenix dactylifera L. Arecaceae is used in most of the countries of the world and is an essential part of the diet, especially in many Arabian countries. Phoenix dactylifera L. fruits are a rich source of sugars (glucose and fructose, vitamins (A, C, and B complex, fibers, minerals, and phenolic compounds having antioxidant and anti-inflammatory properties. This study is designed to explore the Phoenix dactylifera L. fruit for skin care. A single-blinded, placebo control trial was conducted, including 11 healthy female volunteers after their informed consent. The efficacy of the Phoenix dactylifera L. extract (4% was evaluated in cream form after one, two, three, four, six, and eight weeks of treatment compared with the baseline. Prior to the study, the composition of the extract was analyzed to understand the underlying mechanisms by which the extract affects skin. Treating facial skin with the Phoenix dactylifera L. extract significantly improved all parameters investigated, such as skin elasticity, pigmentation, redness, brightness, and hydration and led to the improvement of the facial skin. There were no adverse reactions noted during the course of the patch test, demonstrating that the extract could be safe to apply on the skin. The Phoenix dactylifera L. fruit extract serves as a skin care ingredient that significantly improves characteristics important for perception of skin ageing and health. The efficacy of the treatment is possibly due to a combination of numerous active substances found in the Phoenix dactylifera L. extract.
In vivo study of human skin using pulsed terahertz radiation
Energy Technology Data Exchange (ETDEWEB)
Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)
2004-05-07
Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.
In vivo study of human skin using pulsed terahertz radiation
International Nuclear Information System (INIS)
Pickwell, E; Cole, B E; Fitzgerald, A J; Pepper, M; Wallace, V P
2004-01-01
Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation
Xie, Qiang; Wang, Hongbei; Heilman, Edward R; Walsh, Michael G; Haseeb, M A; Gupta, Raavi
2014-01-01
Enhancer of Zeste Homolog 2 (EZH2) is a polycomb group protein that has been shown to be involved in the progression of multiple human cancers including melanoma. The expression of EZH2 in normal skin and in pre-malignant and malignant cutaneous squamous cell carcinoma (SCC) has not been studied. We examined the expression of EZH2 in normal skin, actinic keratosis (AK), SCC in situ, well-differentiated (SCC-WD), moderately-differentiated (SCC-MD) and poorly-differentiated SCC (SCC-PD) to ascertain whether EZH2 expression differentiates these conditions. Immunohistochemical staining for EZH2 was performed on formalin-fixed paraffin-embedded biopsies and a tissue microarray containing normal skin, AK, SCC in situ, and SCC of different grades. In comparison to the normal skin, EZH2 expression in actinic keratosis was increased (p=0.03). Similarly, EZH2 expression in all of the neoplastic conditions studied (SCC in situ, SCC-WD, SCC-MD and SCC-PD) was greatly increased in comparison to both the normal skin and actinic keratosis (p≤0.001). EZH2 expression increases incrementally from normal skin to AK and further to SCC, suggesting a role for EZH2 in the progression and differentiation of SCC. EZH2 expression may be used as a diagnostic marker for differentiating SCC from AK or normal skin.
Shah, Saurabh; Chew, Soon-Keong
2017-11-28
Skin hyperpigmentation is the darkening of skin due to the increased production of melanin in the body. To evaluate the efficacy and safety of a botanical-based Rosa E pigmentation serum in healthy fair skin female volunteers with wrinkles, skin tone, and pigmentation. This was a single-arm, open label study conducted in healthy Indian females; 18 subjects aged 30-55, having fair Caucasian-like skin with at least 2 dark skin pigments with facial wrinkles diagnosed by dermatologist were selected. Rosa E pigmentation serum was applied twice a day for 84 days. Effect was evaluated by (i) instrumental technique (spectrophotometer ® 2600D), (ii) clinically by dermatologist regarding product efficacy (skin tone, antiwrinkle, pigmentation), and (iii) volunteers self-evaluation. The L* value of spectrophotometer reading represents lightness in the skin pigment. Reduction in the pigment was reported from day 14, with significant reductions observed till day 84 compared with baseline. Significant (P < .0001) skin pigmentation lightening was seen on day 14 (1.11) vastly improving on day 84 (1.94) based on photographic assessments. The significant reduction in skin pigment was 76.85%, Felix von Luschan skin color score was 30.24% (P < .0001) with a 7.38-fold reduction in skin tone and 57% reduction in facial wrinkles at day 84 from baseline. Rosa E pigmentation serum was found safe and effective in significant reduction in skin pigments, improvement of skin tone, and antiwrinkle properties instrumentally, clinically, and self-evaluation by volunteers. In these evaluations, best results were seen the longer the Rosa E was used. © 2017 Wiley Periodicals, Inc.
Protoporphyrin IX formation and photobleaching in different layers of normal human skin
DEFF Research Database (Denmark)
Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A
2012-01-01
human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...
Schleifer, Sebastian G; Willemse, Ton
2003-06-01
To evaluate skin test reactivity to environmental allergens in healthy cats and in cats with atopic dermatitis (AD). 10 healthy cats and 10 cats with AD. 10 allergens in serial dilutions were injected ID on the lateral aspect of the thorax of sedated cats. Histamine (0.01% solution) and buffer solutions were used as positive and negative controls, respectively. Immediately after the last injection, 10% fluorescein solution was administered IV. Skin test results were evaluated with ultraviolet light after 15 to 30 minutes and at 4 and 6 hours by 2 independent observers. In the control group, skin tests were repeated after 6 weeks. Skin test reactivity and the nature of the immunoglobulin involved were investigated by use of the Prausnitz-Küstner test with untreated and heat-treated cat sera. Intertest and interobserver agreement were high when measurement of the diameter of the fluorescent wheal was used to evaluate skin test responses, compared with assessment of its intensity. In both groups of cats, immediate skin test reactivity was observed as an IgE-mediated reaction, as an IgG-mediated reaction, and as a result of nonspecific mast cell degranulation. There was no correlation between allergen concentration and the type of reaction observed. Skin test reactivity in cats should be evaluated after IV administration of 10% fluorescein solution by means of a Prausnitz-Küstner test to differentiate among IgE-mediated, IgG-mediated, and nonspecific reactions.
Randag, A. C.; Graaff, R.; Dreise, M. M.; Vierkoetter, A.; Werker, P. M. N.; Stenekes, M. W.
Background As life expectancy is increasing and healthy ageing becomes more and more important, skin ageing is a growing topic of interest from both a medical and a commercial point of view. The urgency to unravel the causes of skin ageing is rising. However, there is a lack of objective, simple,
Randag, A. C.; Graaff, R.; Dreise, M. M.; Vierkoetter, A.; Werker, P. M. N.; Stenekes, M. W.
2015-01-01
Background As life expectancy is increasing and healthy ageing becomes more and more important, skin ageing is a growing topic of interest from both a medical and a commercial point of view. The urgency to unravel the causes of skin ageing is rising. However, there is a lack of objective, simple,
Effects of turning on skin-bed interface pressures in healthy adults.
Peterson, Matthew J; Schwab, Wilhelm; van Oostrom, Johannes H; Gravenstein, Nikolaus; Caruso, Lawrence J
2010-07-01
This paper is a report of a study of the effects of lateral turning on skin-bed interface pressures in the sacral, trochanteric and buttock regions, and its effectiveness in unloading at-risk tissue. Minimizing skin-support surface interface pressure is important in pressure ulcer prevention, but the effect of standard patient repositioning on skin interface pressure has not been objectively established. Data were collected from 15 healthy adults from a university-affiliated hospital. Mapped 24-inch x 24-inch (2304 half-inch sensors) interface pressure profiles were obtained in the supine position, followed by lateral turning with pillow or wedge support and subsequent head-of-bed elevation to 30 degrees . Raising the head-of-bed to 30 degrees in the lateral position statistically significantly increased peak interface pressures and total area > or = 32 mmHg. Comparing areas > or = 32 mmHg from all positions, 93% of participants had skin areas with interface pressures > or = 32 mmHg throughout all positions (60 +/- 54 cm(2)), termed 'triple jeopardy areas'. The triple jeopardy area increased statistically significantly with wedges as compared to pillows (153 +/- 99 cm(2) vs. 48 +/- 47 cm(2), P turning by experienced intensive care unit nurses does not reliably unload all areas of high skin-bed interface pressures. These areas remain at risk for skin breakdown, and help to explain why pressure ulcers occur despite the implementation of standard preventive measures. Support materials for maintaining lateral turned positions can also influence tissue unloading and triple jeopardy areas.
DEFF Research Database (Denmark)
Philipsen, P A; Knudsen, L; Gniadecka, M
2013-01-01
and skin tumour diagnostics in vivo. We obtained Raman spectra in vivo from the normal skin of 55 healthy persons with different skin pigmentation (Fitzpatrick skin type I-VI) and in vivo from 25 basal cell carcinomas, 41 pigmented nevi and 15 malignant melanomas. Increased skin pigmentation resulted...
Number of Langerhans cells is decreased in premalignant keratosis and skin cancers.
Shevchuk, Z; Filip, A; Shevchuk, V; Kashuba, E
2014-03-01
It was shown earlier that a number of CD207 positive Langerhans cells was lower in basal cell carcinomas than in the normal epidermis. Moreover, benign skin lesions presented a higher number of Langerhans cells when they were compared to malignant tumors. To count Langerhans cells, assessing expression levels of CD1A and CD207 markers in actinic keratosis, basal and squamous cell carcinomas, compared with the normal skin. Comparison of Langerhans cells might give a valuable prognostic marker for skin cancer. Immunohistochemistry and methods of statistics were used. Expression of CD1A and CD207 markers was assessed in tumor samples of actinic keratosis, cutaneous basal and squamous cell carcinomas, in comparison with the normal skin. In each cohort there were 40 patients (and 11 healthy individuals). We have shown that the number of Langerhans cells is considerably lower in cutaneous basal and squamous cell carcinomas, compared with their number in the normal skin (p keratosis, basal and squamous cell carcinoma. This may suggest an alteration of Langerhans cells phenotype in skin neoplastic diseases, making the number of Langerhans cells a valuable prognostic factor for skin tumors.
Hayashi, M; Okamura, K; Araki, Y; Suzuki, M; Tanaka, T; Abe, Y; Nakano, S; Yoshizawa, J; Hozumi, Y; Inoie, M; Suzuki, T
2018-05-01
Acquired skin hypopigmentation has many etiologies, including autoimmune melanocyte destruction, skin aging, inflammation, and chemical exposure. Distinguishing lesions from normally pigmented skin is clinically important to precisely assess disease severity. However, no gold standard assessment method has been reported. We aimed to investigate whether spectrophotometers are useful for assessing vitiligo and rhododendrol (4-(4-hydroxyphenol)-2-butanol) (Rhododenol ® )-induced leukoderma disease severity by quantifying skin color. Mexameter ® MX18 and CM-700d spectrophotometer were used for assessing vitiligo/leukoderma by measuring melanin index, L*a*b* color space, and ΔE*ab value, which represents the color difference between two subjects and is calculated by the values of L*a*b*. MX18 and CM-700d can quantitatively distinguish vitiligo/leukoderma from normally pigmented skin based on melanin index. CM-700d consistently quantified the color of vitiligo/leukoderma lesions and surrounding normally pigmented skin in L*a*b* color spaces and ΔE*ab. ΔE*ab is well correlated with melanin index and clinical appearance. ΔE*ab has been frequently used in aesthetic dentistry; however, current study is the first to use it in the measurement of skin color. ΔE*ab seems to be a useful parameter to evaluate the color contrast between vitiligo/leukoderma and surrounding normally pigmented skin and can be used to evaluate disease severity and patient's quality of life. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Skin care for healthy babies at term: A systematic review of the evidence.
Cooke, Alison; Bedwell, Carol; Campbell, Malcolm; McGowan, Linda; Ersser, Steven J; Lavender, Tina
2018-01-01
to identify what skin practices are important for the protection of baby skin in healthy term babies (0-6 months) and generate evidence-based conclusions to inform health professionals and parents. eleven databases were searched for all empirical quantitative and qualitative research published between 2000-2015 which explored baby skin care for bathing and cleansing, nappy care, hair and scalp care, management of dry skin or baby massage, for healthy term babies up to 6 months old. Papers not published in English were excluded. A total of 3062 papers were identified. Pairs of reviewers assessed all citations and extracted data independently. There were 26 included papers: 16 RCTs, 3 non-randomised experimental studies, 1 mixed-methods study and 6 qualitative studies. Primary and secondary outcome measures were analysed using meta-analysis or narrative descriptive statistics. Synthesis of qualitative data was not possible due to disparity of the evidence. from the small numbers of studies with comparable data, there was no evidence of any significant differences between tested wash products and water or tested baby wipes and water. There was some evidence to suggest that daily use of full-body emollient therapy may help to reduce the risk of atopic eczema in high risk babies with a genetic predisposition to eczema; however, the use of olive oil or sunflower oil for baby dry skin may adversely affect skin barrier function. There was no evidence about hair/scalp care or baby massage. Qualitative research indicates that parents and health professionals believe that water alone is best. meta-analysis was restricted due to the lack of consistency of study outcome measures. Although there is considerable RCT evidence comparing the use of specific products against water alone, or another product, for bathing, cleansing and nappy care, the power of this evidence is reduced due to inconsistency of outcome measures in terms of outcome, treatment site or time-point. The
Regional outbreak of staphylococcal scalded skin syndrome in healthy children
Directory of Open Access Journals (Sweden)
Hyun Jeong Do
2010-01-01
Full Text Available Purpose : Staphylococcal scalded skin syndrome (SSSS is a relatively uncommon superficial blistering skin disease that is due to Staphylococcus aureus. We had experienced a regional outbreak of SSSS over 3 years in healthy children. Methods : We retrospectively reviewed the medical records of those patients diagnosed as SSSS. Most of neonatal cases were nosocomial infections and excluded from the analysis. The clinical features, laboratory findings, the isolation and antibiotic resistance of S. aureus, the antibiotic management and other supportive treatments were analyzed. Results : Fifty-five patients with SSSS were admitted to our hospital from October 2001 to September 2004. The median age of patients was 3.0 years. Of the 55 patients, 9 were the generalized type, 13 were the intermediate type and 33 were the scarletiniform rash. All the patients were living in neighborhood of the Jinju area. S. aureus were isolated from 9 of the patients and all of the isolated S. aureus were methicillin resistant. All the patients except two were treated with intravenous flocloxacillin or nafcillin and/or cefotaxime. All the patients recovered during the follow-up period of 2 to 3 weeks. Conclusion : We experienced a regional outbreak of SSSS in previous healthy children. Further study for finding the carriers of S. aureus caused SSSS and preventing the spread of this disease is needed. Additionally, guidelines for treating SSSS due to methicillin resistant S. aureus should be established.
Assessment of extent of skin involvement in scleroderma using shear wave elastography
Directory of Open Access Journals (Sweden)
Anupam Wakhlu
2017-01-01
Full Text Available Introduction: Scleroderma (systemic sclerosis [SSc] is a rare autoimmune disease which manifests as fibrosis in the skin and other internal organs. Conventionally, the modified Rodnan skin score (MRSS has been used to quantify the extent of skin fibrosis (resulting in skin tightness in SSc. This technique, although widely validated, is limited by the requirement of a trained, experienced assessor. Recent literature suggests that utilization of the objective ultrasound-based assessment of skin fibrosis utilizing shear wave elastography (SWE may be a more robust technique to detect early skin tightness in SSc. Methods: We evaluated the use of SWE (assessed by an experienced radiologist in 24 patients with SSc compared with 16 healthy controls. Results: Our patients were predominantly females, with median disease duration of 1.5 years and median MRSS of 17. There was minimal intraobserver variation in the assessment of SWE. Patients with SSc had higher SWE values (mean elasticity [Emean] compared to healthy controls at most assessed sites for the MRSS. The Emeancorrelated significantly at all sites with the MRSS scores. At the sites where MRSS was scored as 0 (normal, the Emeanin patients with SSc was higher when compared with similarly clinical normal skin in patients with SSc, suggesting potential early involvement of these areas of the skin with fibrosis. Conclusion: SWE is a promising tool to objectively assess skin fibrosis in SSc and may be useful in detecting early, subclinical skin involvement in this disease.
Nishimura, Meiko; Hayashi, Mitsuhiro; Mizutani, Yu; Takenaka, Kei; Imamura, Yoshinori; Chayahara, Naoko; Toyoda, Masanori; Kiyota, Naomi; Mukohara, Toru; Aikawa, Hiroaki; Fujiwara, Yasuhiro; Hamada, Akinobu; Minami, Hironobu
2018-04-06
The development of skin rashes is the most common adverse event observed in cancer patients treated with epidermal growth factor receptor-tyrosine kinase inhibitors such as erlotinib. However, the pharmacological evidence has not been fully revealed. Erlotinib distribution in the rashes was more heterogeneous than that in the normal skin, and the rashes contained statistically higher concentrations of erlotinib than adjacent normal skin in the superficial skin layer (229 ± 192 vs. 120 ± 103 ions/mm 2 ; P = 0.009 in paired t -test). LC-MS/MS confirmed that the concentration of erlotinib in the skin rashes was higher than that in normal skin in the superficial skin layer (1946 ± 1258 vs. 1174 ± 662 ng/cm 3 ; P = 0.028 in paired t -test). The results of MALDI-MSI and LC-MS/MS were well correlated (coefficient of correlation 0.879, P distribution of erlotinib in the skin tissue was visualized using non-labeled MALDI-MSI. Erlotinib concentration in the superficial layer of the skin rashes was higher than that in the adjacent normal skin. We examined patients with advanced pancreatic cancer who developed skin rashes after treatment with erlotinib and gemcitabine. We biopsied both the rash and adjacent normal skin tissues, and visualized and compared the distribution of erlotinib within the skin using matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI). The tissue concentration of erlotinib was also measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) with laser microdissection.
International Nuclear Information System (INIS)
Iqbal, I.P.; Khan, A.H.; Mehboobali, N.
2007-01-01
Human serum paraoxonase is a high density lipoprotein (HDL)-bound enzyme exhibiting antiatherogenic properties. The aim of this study was to investigate any relationship between serum paraoxonase activity and serum levels of HDL-cholesterol in Pakistani patients with acute myocardial infarction (AMI) compared to normal healthy subjects and to examine possible association between serum paraoxonase activity and AMI in Pakistani population. In a case-control study, serum paraoxonase activity and serum levels of HDL-cholesterol and LDL-cholesterol were monitored in 164 Pakistani patients with AMI and 106 normal healthy adults matched for gender, BMI and age within 10 years. Mean serum concentration of HDL-cholesterol and mean serum paraoxonase activity in AMI patients were not significantly different from the corresponding values in normal healthy subjects. Mean serum paraoxonase activity value was significantly lower in normal healthy subjects with low HDL-cholesterol (serum levels < 40mg/dl) compared to the value in those with normal levels of HDL-cholesterol (P=0.04). In AMI patients, paraoxonase activity was lower in subjects with low HDL-cholesterol compared to those with normal levels of HDL-cholesterol, however, the decrease was not statistically significant. Correlation analyses of the data revealed a moderate association of paraoxonase activity with HDL-cholesterol (Pearson's r= 0.225, P<0.01 for AMI patients and r=0.281, P<0.01 for normal healthy controls). Seventy three percent of normal healthy subjects and 65% of AMI patients in this study had low HDL-cholesterol. Low serum paraoxonase activity and high prevalence of low HDL-cholesterol in Pakistani population could be contributing to the high rates of coronary heart disease in this population. (author)
Schaffler, Klaus; Reeh, Peter; Duan, W Rachel; Best, Andrea E; Othman, Ahmed A; Faltynek, Connie R; Locke, Charles; Nothaft, Wolfram
2013-02-01
Laser (radiant-heat) evoked potentials (LEPs) from vertex-EEG peak-to-peak (PtP) amplitude were used to determine acute antinociceptive/antihyperalgesic efficacy of ABT-102, a novel TRPV1 antagonist efficacious in preclinical pain models, compared with active controls and placebo in normal and UV(B)-inflamed skin. This was a randomized, placebo- and active-controlled, double-blind, intra-individual, crossover trial. Twenty-four healthy subjects received six sequences of single doses of ABT-102 (0.5, 2, 6 mg), etoricoxib 90 mg, tramadol 100 mg and placebo. Painful stimuli were induced by CO(2) -laser on normal and UV(B) -inflamed skin. LEPs and visual analogue scale (VAS-pain) ratings were taken at baseline and hourly up to 8 h post-dose from both skin types. Compared with placebo, significant mean decreases in the primary variable of LEP PtP-amplitude from UV(B)-inflamed skin were observed with ABT-102 6 mg (P < 0.001), ABT-102 2 mg (P = 0.002), tramadol 100 mg (P < 0.001), and etoricoxib 90 mg (P = 0.001) over the 8 h period; ABT-102 0.5 mg was similar to placebo. ABT-102 6 mg was superior to active controls over the 8 h period (P < 0.05) whereas ABT-102 2 mg was comparable. Improvements in VAS scores compared with placebo were observed with ABT-102 6 mg (P < 0.001) and ABT-102 2 mg (P = 0.002). ABT-102 average plasma concentrations were 1.3, 4.4 and 9.4 ng ml(-1) for the 0.5, 2 and 6 mg doses, respectively. There were no clinically significant safety findings. TRPV-1 antagonism appears promising in the management of clinical pain, but requires further investigation. © 2012 Abbott. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.
Ahmad, Iftikhar; Ahmad, Manzoor; Khan, Karim; Ikram, Masroor
2016-06-01
Optical polarimetry was employed for assessment of ex vivo healthy and basal cell carcinoma (BCC) tissue samples from human skin. Polarimetric analyses revealed that depolarization and retardance for healthy tissue group were significantly higher (ppolarimetry together with PLS statistics hold promise for automated pathology classification. Copyright © 2016 Elsevier B.V. All rights reserved.
Lee, Young; Je, Young-Jin; Lee, Sang-Sin; Li, Zheng Jun; Choi, Dae-Kyoung; Kwon, Yoo-Bin; Sohn, Kyung-Cheol; Im, Myung; Seo, Young Joon
2012-01-01
Background Aquaporins (AQPs) are a family of water transporting proteins present in many mammalian epithelial and endothelial cell types. Among the AQPs, AQP3 is known to be a water/glycerol transporter expressed in human skin. Objective The relationship between the expression level of AQP3 and transpidermal water loss (TEWL) in the lesional and peri-lesional skin of psoriasis-affected patients, and skin hydration in the lesional and peri-lesional skin of psoriasis patients, was investigated. Methods The expression of AQP3 in psoriasis-affected and healthy control skin was determined using immunohistochemical and immunofluroscence staining. TEWL and skin hydration were measured using a Tewameter® TM210 (Courage & Khazaka, Cologne, Germany) and a Corneometer® CM 820 (Courage & Khazaka), respectively. Results AQP3 was mainly expressed in the plasma membrane of stratum corneum and the stratum spinosum in normal epidermis. Unlike the normal epidermis, AQP3 showed decreased expression in the lesional and peri-lesional epidermis of psoriasis. TEWL was increased, and skin hydration was decreased, in the lesional and peri-lesional skin of psoriasis patients, compared with the healthy control sample. Conclusion Although various factors contribute to reduced skin hydration in the lesional and peri-lesional skin of psoriasis, AQP3 appears to be a key factor in the skin dehydration of psoriasis-affected skin. PMID:22577267
An echocardiographic study of healthy Border Collies with normal reference ranges for the breed.
Jacobson, Jake H; Boon, June A; Bright, Janice M
2013-06-01
The objectives of this study were to obtain standard echocardiographic measurements from healthy Border Collies and to compare these measurements to those previously reported for a general population of dogs. Standard echocardiographic data were obtained from twenty apparently healthy Border Collie dogs. These data (n = 20) were compared to data obtained from a general population of healthy dogs (n = 69). Border Collies were deemed healthy based on normal history, physical examination, complete blood count, serum biochemical profile, electrocardiogram, and blood pressure, with no evidence of congenital or acquired heart disease on echocardiographic examination. Standard two dimensional, M-mode, and Doppler echocardiographic measurements were obtained and normal ranges determined. The data were compared to data previously obtained at our hospital from a general population of normal dogs. Two dimensional, M-mode, and Doppler reference ranges for healthy Border Collies are presented in tabular form. Comparison of the weight adjusted M-mode echocardiographic means from Border Collies to those from the general population of dogs showed Border Collies to have larger left ventricular systolic and diastolic dimensions, smaller interventricular septal thickness, and lower fractional shortening. There are differences in some echocardiographic parameters between healthy Border Collies and the general dog population, and the echocardiographic reference ranges provided in this study should be used as breed specific reference values for Border Collies. Copyright © 2013 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Henry, R.E.; Malone, J.M.; Daly, M.J.; Hughes, J.H.; Moore, W.S.
1982-01-01
Quantitation of skin perfusion provides objective criteria to determine the optimal amputation level in ischemic limb disease, to assess the maturation of pedicle flaps in reconstructive surgery, and to select appropriate treatment for chronic skin ulcers. A technique for measurement of skin perfusion using intradermal (ID) Xe-133 and a gamma camera/minicomputer system was previously reported. An update of this procedure is now reported, the normal range for the lower extremity in men, observations on the effects of ambient temperature, and an experience using the procedure to determine amputation level
CT Densitometry of the Lung in Healthy Nonsmokers with Normal Pulmonary Function
Energy Technology Data Exchange (ETDEWEB)
Oh, Tack Sun; Chae, Eun Jin; Seo, Joon Beom; Jung, Young Ju; Oh, Yeon Mok; Lee, Sang Do [University of Ulsan College of Medicine, Asan Medical Center, Seoul (Korea, Republic of)
2012-09-15
To investigate the upper normal limit of low attenuation area in healthy nonsmokers. A total of 36 nonsmokers with normal pulmonary function test underwent a CT scan. Six thresholds (-980 --930 HU) on inspiration CT and two thresholds (-950 and -910 HU) on expiration CT were used for obtaining low attenuation area. The mean lung density was obtained on both inspiration CT and expiration CT. Descriptive statistics of low attenuation area and the mean lung density, evaluation of difference of low attenuation area and the mean lung density in both sex and age groups, analysis of the relationship between demographic information and CT parameters were performed. Upper normal limit for low attenuation area was 12.96% on inspiration CT (-950 HU) and 9.48% on expiration CT (-910 HU). Upper normal limit for the mean lung density was -837.58 HU on inspiration CT and 686.82 HU on expiration CT. Low attenuation area and the mean lung density showed no significant differences in both sex and age groups. Body mass index (BMI) was negatively correlated with low attenuation area on inspiration CT (-950 HU, r = -0.398, p = 0.016) and positively correlated with the mean lung density on inspiration CT (r 0.539, p = 0.001) and expiration CT (r = 0.432, p = 0.009). Age and body surface area were not correlated with low attenuation area or the mean lung density. Low attenuation area on CT densitometry of the lung could be found in healthy nonsmokers with normal pulmonary function, and showed negative association with BMI. Reference values, such as range and upper normal limit for low attenuation area in healthy subjects could be helpful in quantitative analysis and follow up of early emphysema, using CT densitometry of the lung.
Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis
International Nuclear Information System (INIS)
Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.
1982-01-01
The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)
Jagielski, Tomasz; Rup, Elżbieta; Ziółkowska, Aleksandra; Roeske, Katarzyna; Macura, Anna B; Bielecki, Jacek
2014-03-07
The Malassezia yeasts which belong to the physiological microflora of human skin have also been implicated in several dermatological disorders, including pityriasis versicolor (PV), atopic dermatitis (AD), and psoriasis (PS). The Malassezia genus has repeatedly been revised and it now accommodates 14 species, all but one being lipid-dependent species. The traditional, phenotype-based identification schemes of Malassezia species are fraught with interpretative ambiguities and inconsistencies, and are thus increasingly being supplemented or replaced by DNA typing methods. The aim of this study was to explore the species composition of Malassezia microflora on the skin of healthy volunteers and patients with AD and PS. Species characterization was performed by conventional, culture-based methods and subsequently molecular techniques: PCR-RFLP and sequencing of the internal transcribed spacer (ITS) 1/2 regions and the D1/D2 domains of the 26S rRNA gene. The Chi-square test and Fisher's exact test were used for statistical analysis. Malassezia sympodialis was the predominant species, having been cultured from 29 (82.9%) skin samples collected from 17 out of 18 subjects under the study. Whereas AD patients yielded exclusively M. sympodialis isolates, M. furfur isolates were observed only in PS patients. The isolation of M. sympodialis was statistically more frequent among AD patients and healthy volunteers than among PS patients (P < 0.03). Whether this mirrors any predilection of particular Malassezia species for certain clinical conditions needs to be further evaluated. The overall concordance between phenotypic and molecular methods was quite high (65%), with the discordant results being rather due to the presence of multiple species in a single culture (co-colonization) than true misidentification. All Malassezia isolates were susceptible to cyclopiroxolamine and azole drugs, with M. furfur isolates being somewhat more drug tolerant than other Malassezia species
Friction coefficient of skin in real-time.
Sivamani, Raja K; Goodman, Jack; Gitis, Norm V; Maibach, Howard I
2003-08-01
Friction studies are useful in quantitatively investigating the skin surface. Previous studies utilized different apparatuses and materials for these investigations but there was no real-time test parameter control or monitoring. Our studies incorporated the commercially available UMT Series Micro-Tribometer, a tribology instrument that permits real-time monitoring and calculation of the important parameters in friction studies, increasing the accuracy over previous tribology and friction measurement devices used on skin. Our friction tests were performed on four healthy volunteers and on abdominal skin samples. A stainless steel ball was pressed on to the skin with at a pre-set load and then moved across the skin at a constant velocity of 5 mm/min. The UMT continuously monitored the friction force of the skin and the normal force of the ball to calculate the friction coefficient in real-time. Tests investigated the applicability of Amonton's law, the impact of increased and decreased hydration, and the effect of the application of moisturizers. The friction coefficient depends on the normal load applied, and Amonton's law does not provide an accurate description for the skin surface. Application of water to the skin increased the friction coefficient and application of isopropyl alcohol decreased it. Fast acting moisturizers immediately increased the friction coefficient, but did not have the prolonged effect of the slow, long lasting moisturizers. The UMT is capable of making real-time measurements on the skin and can be used as an effective tool to study friction properties. Results from the UMT measurements agree closely with theory regarding the skin surface.
Mast cells are dispensable for normal and activin-promoted wound healing and skin carcinogenesis.
Antsiferova, Maria; Martin, Caroline; Huber, Marcel; Feyerabend, Thorsten B; Förster, Anja; Hartmann, Karin; Rodewald, Hans-Reimer; Hohl, Daniel; Werner, Sabine
2013-12-15
The growth and differentiation factor activin A is a key regulator of tissue repair, inflammation, fibrosis, and tumorigenesis. However, the cellular targets, which mediate the different activin functions, are still largely unknown. In this study, we show that activin increases the number of mature mast cells in mouse skin in vivo. To determine the relevance of this finding for wound healing and skin carcinogenesis, we mated activin transgenic mice with CreMaster mice, which are characterized by Cre recombinase-mediated mast cell eradication. Using single- and double-mutant mice, we show that loss of mast cells neither affected the stimulatory effect of overexpressed activin on granulation tissue formation and reepithelialization of skin wounds nor its protumorigenic activity in a model of chemically induced skin carcinogenesis. Furthermore, mast cell deficiency did not alter wounding-induced inflammation and new tissue formation or chemically induced angiogenesis and tumorigenesis in mice with normal activin levels. These findings reveal that mast cells are not major targets of activin during wound healing and skin cancer development and also argue against nonredundant functions of mast cells in wound healing and skin carcinogenesis in general.
Does dietary fluid intake affect skin hydration in healthy humans? A systematic literature review.
Akdeniz, M; Tomova-Simitchieva, T; Dobos, G; Blume-Peytavi, U; Kottner, J
2018-02-02
Associations between daily amounts of drinking water and skin hydration and skin physiology receive increasingly attention in the daily life and in clinical practice. However, there is a lack of evidence of dermatological benefits from drinking increased amounts of water. Pubmed and Web of Science were searched without any restrictions of publication dates. References of included papers and related reviews were checked. Eligibility criteria were primary intervention and observational studies investigating the effects of fluid intake on skin properties in English, German, Spanish or Portuguese language, including subjects being healthy and 18+ years. Searches resulted in 216 records, 23 articles were read in full text, and six were included. The mean age of the samples ranged from 24 to 56 years. Overall the evidence is weak in terms of quantity and methodological quality. Disregarding the methodological limitations a slight increase in stratum corneum and "deep" skin hydration was observed after additional water intake, particularly in individuals with lower prior water consumption. Reductions of clinical signs of dryness and roughness were observed. The extensibility and elasticity of the skin increased slightly. Unclear associations were shown between water intake and transepidermal water loss, sebum content, and skin surface pH. Additional dietary water intake may increase stratum corneum hydration. The underlying biological mechanism for this possible relationship is unknown. Whether this association also exists in aged subjects is unclear. Research is needed to answer the question whether increased fluid intake decreases signs of dry skin. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Zouboulis, Christos C; Elewa, Rana; Ottaviani, Monica; Fluhr, Joachim; Picardo, Mauro; Bernois, Armand; Heusèle, Catherine; Camera, Emanuela
2018-03-01
Skin aging is associated with alterations of surface texture, sebum composition and immune response. Mechanical stress induces repair mechanisms, which may be dependent on the age and quality of the skin. The response to mechanical stress in young and aged individuals, their subjective opinion and the objective effectiveness of skin care products were evaluated by biophysical skin quality parameters (stratum corneum hydration, transepidermal water loss, skin pH, pigmentation and erythema) at baseline, 1, 6, 24h and 7days at the forearms of 2 groups of healthy volunteers, younger than 35 years (n=11) and older than 60 years (n=13). In addition, casual surface lipid composition was studied under the same conditions at the baseline and day 7 after mechanical stress induction. Evaluations were also performed in stressed skin areas treated daily with skin care products and the subjective opinion of the volunteers was additionally documented. The tested groups exhibited age-associated baseline skin functions as well as casual surface lipid composition and different reaction patterns to mechanical stress. Skin care was more effective in normalizing skin reaction to stress in the young than in the aged group. The subjective volunteer opinion correlated with the objective measurements. Copyright © 2017 Elsevier B.V. All rights reserved.
Draelos, Zoe D
2006-07-01
Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.
Contrast-enhanced MRI findings of the knee in healthy children; establishing normal values
Energy Technology Data Exchange (ETDEWEB)
Hemke, Robert; Maas, Mario [University of Amsterdam, Department of Radiology and Nuclear Medicine, Academic Medical Center, Amsterdam (Netherlands); Berg, J.M. van den; Schonenberg-Meinema, Dieneke; Kuijpers, Taco W. [University of Amsterdam, Department of Pediatric Hematology, Immunology, Rheumatology and Infectious Diseases, Emma Children' s Hospital AMC, Amsterdam (Netherlands); Nusman, Charlotte M. [University of Amsterdam, Department of Pediatric Hematology, Immunology, Rheumatology and Infectious Diseases, Emma Children' s Hospital AMC, Amsterdam (Netherlands); Onze Lieve Vrouwe Gasthuis (OLVG), Department of Pediatrics, Amsterdam (Netherlands); Gulik, E.C. van; Barendregt, Anouk M. [University of Amsterdam, Department of Radiology and Nuclear Medicine, Academic Medical Center, Amsterdam (Netherlands); University of Amsterdam, Department of Pediatric Hematology, Immunology, Rheumatology and Infectious Diseases, Emma Children' s Hospital AMC, Amsterdam (Netherlands); Dolman, Koert M. [Onze Lieve Vrouwe Gasthuis (OLVG), Department of Pediatrics, Amsterdam (Netherlands); Reade, Department of Pediatric Rheumatology, Amsterdam (Netherlands)
2018-03-15
To define normative standards for the knee in healthy children using contrast-enhanced MRI, focusing on normal synovial membrane thickness. Secondly, presence of joint fluid and bone marrow oedema was evaluated. For this study, children without disorders potentially resulting in (accompanying) arthritis were included. Patients underwent clinical assessments, followed by contrast-enhanced MRI. MRI features were evaluated in consensus using the Juvenile Arthritis MRI Scoring (JAMRIS) system. Additionally, the presence of joint fluid was evaluated. No cartilage lesions or bone abnormalities were observed. We included 57 healthy children. The overall mean thickness of the normal synovial membrane was 0.4 mm (min-max; 0.0-1.8mm). The synovium was thickest around the cruciate ligaments and retropatellar and suprapatellar regions. The mean overall diameter of the largest pocket of joint fluid was 2.8 mm (min-max; 0.9-8.0mm). Bone marrow changes were observed in three children (all in the apex patellae). The normal synovial membrane was maximally 1.8 mm thick, indicating that the JAMRIS cut-off value of 2 mm can be considered a valid measure for evaluating synovial hypertrophy. Some joint fluid and bone marrow changes suggestive of bone marrow oedema in the apex patellae can be seen in healthy children. (orig.)
Contrast-enhanced MRI findings of the knee in healthy children; establishing normal values
International Nuclear Information System (INIS)
Hemke, Robert; Maas, Mario; Berg, J.M. van den; Schonenberg-Meinema, Dieneke; Kuijpers, Taco W.; Nusman, Charlotte M.; Gulik, E.C. van; Barendregt, Anouk M.; Dolman, Koert M.
2018-01-01
To define normative standards for the knee in healthy children using contrast-enhanced MRI, focusing on normal synovial membrane thickness. Secondly, presence of joint fluid and bone marrow oedema was evaluated. For this study, children without disorders potentially resulting in (accompanying) arthritis were included. Patients underwent clinical assessments, followed by contrast-enhanced MRI. MRI features were evaluated in consensus using the Juvenile Arthritis MRI Scoring (JAMRIS) system. Additionally, the presence of joint fluid was evaluated. No cartilage lesions or bone abnormalities were observed. We included 57 healthy children. The overall mean thickness of the normal synovial membrane was 0.4 mm (min-max; 0.0-1.8mm). The synovium was thickest around the cruciate ligaments and retropatellar and suprapatellar regions. The mean overall diameter of the largest pocket of joint fluid was 2.8 mm (min-max; 0.9-8.0mm). Bone marrow changes were observed in three children (all in the apex patellae). The normal synovial membrane was maximally 1.8 mm thick, indicating that the JAMRIS cut-off value of 2 mm can be considered a valid measure for evaluating synovial hypertrophy. Some joint fluid and bone marrow changes suggestive of bone marrow oedema in the apex patellae can be seen in healthy children. (orig.)
Transforming growth factor-β (TGF-β) signaling in healthy human fetal skin: a descriptive study.
Walraven, M; Beelen, R H J; Ulrich, M M W
2015-05-01
TGF-β plays an important role in growth and development but is also involved in scarring and fibrosis. Differences for this growth factor are known between scarless fetal wound healing and adult wound healing. Nonetheless, most of the data in this area are from animal studies or in vitro studies and, thus, information about the human situation is incomplete and scarce. The aim of this study was to compare the canonical TGF-β signaling in unwounded human fetal and adult skin. Q-PCR, immunohistochemistry, Western Blot and Luminex assays were used to determine gene expression, protein levels and protein localization of components of this pathway in healthy skin. All components of the canonical TGF-β pathway were present in unwounded fetal skin. Compared to adult skin, fetal skin had differential concentrations of the TGF-β isoforms, had high levels of phosphorylated receptor-Smads, especially in the epidermis, and had low expression of several fibrosis-associated target genes. Further, the results indicated that the processes of receptor endocytosis might also differ between fetal and adult skin. This descriptive study showed that there are differences in gene expression, protein concentrations and protein localization for most components of the canonical TGF-β pathway between fetal and adult skin. The findings of this study can be a starting point for further research into the role of TGF-β signaling in scarless healing. Copyright © 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Abbas Rasi
2014-01-01
Full Text Available Background: For many years the association of skin tags and endocrynopathies has been postulated, although many reports are available but it has never been evaluated to mean normal population. Dyslipidemia is a frequent disorder among people and seemed to be necessary for screening within skin tag condition. This study is designed to find any possible association between skin tags and dyslipidemia. Materials and Methods: From April 2009 to June 2011, 168 patients enrolled the study. Among the remaining 152 patients, there were 89 females (58.5% and 63 males (%41.5. Based on the TLGS study 136 men and 220 women enrolled the control group of study. The mean age was 28.4 years. Patients trained to have normal free diet for at least 1 month then referred to the laboratory. Blood samples were taken over 12 hours fasting with 2 hours intervals. Hypertriglyceridemia was defined as plasma level ≥160 mg/dl for men and ≥130 mg/dl for women. Hypercholesterolemia pointed at its value >200 mg/dl. Normal HDL levels was defined as >39 mg/dl for men and >35 mg/dl to women. Results: Mean skin tag number was 12.6 per subject. The most frequent localizations of skin tags were neck and upper chest (mean number: 13.4, 48.9% followed by axilla (mean number: 11.6, 33% and breast (10.2, 10.1% in the patient group. The mean cholesterol level of case group was 192.2 ± 33.1 mg/dl, while it was 187.0 ± 42 mg/dl in the control group. The mean ± SD for triglyceride was 132.1 ± 69 mg/dl in comparison to 129 ± 74 in the control group. Conclusion: The study showed no significant differences between normal population and patients′ lipid profile.
Supplementation with Eskimo Skin Care improves skin elasticity in women. A pilot study.
Segger, Dörte; Matthies, Andreas; Saldeen, Tom
2008-01-01
To investigate the question of whether supplementation with an oral oil formulation rich in natural stable fish oil can alter skin elasticity, transepidermal water loss (TEWL), and skin roughness in healthy women. Twenty-four healthy women aged 40-60 years participated in a single-blind randomized trial for testing the effect of a proprietary oral supplement for skin nutrition (Eskimo Skin Care) on skin elasticity, TEWL, and skin roughness. Skin elasticity was measured by an optical cutometer, TEWL by a water-loss module based upon the vapour gradient principle, and skin roughness with a three-dimensional microtopography imaging system. Skin elasticity increased by 10% after 3 months of treatment with the supplement, a statistically significant increase in comparison with the control group (p=0.0298). There was a trend, though not statistically significant, towards a positive influence on the skin's barrier function. No effect on the skin roughness was observed. Eskimo Skin Care, an oral preparation rich in natural stable fish oil, can improve skin elasticity.
A study of several normal values of Korean healthy adults on chest roentgenograms
Energy Technology Data Exchange (ETDEWEB)
Rhee, Byung Chull [Choong Nam University College of Medicine, Taejeon (Korea, Republic of)
1975-06-15
Determination of several normal values were carried out healthy 1805 cases of Korean adults, 1436 cases of male and 369 cases of female, by the drawing and calculation on chest roentgenograms. In many instances, the change of normal values provides an important clinical values, and often is decisive to evaluate the diagnosis, treatment and prognosis of pulmonary, cardiac and mediastinal disease.
Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.
Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R
1991-12-01
The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.
Villanova, Federica; Flutter, Barry; Tosi, Isabella; Grys, Katarzyna; Sreeneebus, Hemawtee; Perera, Gayathri K; Chapman, Anna; Smith, Catherine H; Di Meglio, Paola; Nestle, Frank O
2014-04-01
Innate lymphoid cells (ILCs) are increasingly appreciated as key regulators of tissue immunity. However, their role in human tissue homeostasis and disease remains to be fully elucidated. Here we characterize the ILCs in human skin from healthy individuals and from the inflammatory skin disease psoriasis. We show that a substantial proportion of IL-17A and IL-22 producing cells in the skin and blood of normal individuals and psoriasis patients are CD3-negative innate lymphocytes. Deep immunophenotyping of human ILC subsets showed a statistically significant increase in the frequency of circulating NKp44+ ILC3 in the blood of psoriasis patients compared with healthy individuals or atopic dermatitis patients. More than 50% of circulating NKp44+ ILC3 expressed cutaneous lymphocyte-associated antigen, indicating their potential for skin homing. Analysis of skin tissue revealed a significantly increased frequency of total ILCs in the skin compared with blood. Moreover, the frequency of NKp44+ ILC3 was significantly increased in non-lesional psoriatic skin compared with normal skin. A detailed time course of a psoriasis patient treated with anti-tumor necrosis factor showed a close association between therapeutic response, decrease in inflammatory skin lesions, and decrease of circulating NKp44+ ILC3. Overall, data from this initial observational study suggest a potential role for NKp44+ ILC3 in psoriasis pathogenesis.
New Mydriasis-Free Electroretinogram Recorded with Skin Electrodes in Healthy Subjects
Directory of Open Access Journals (Sweden)
Ken Asakawa
2017-01-01
Full Text Available Purpose. To evaluate the reproducibility and consistency of the new mydriasis-free electroretinogram (ERG with a skin electrode (RETeval device, to determine the normative values of parameters, and to clarify the usefulness of pupil records to colored-light stimulus. Methods. A total of 100 eyes of 50 healthy subjects (mean age, 21.4 years were enrolled. The diagnostic parameters obtained by the RETeval device were examined under the following conditions. The reproducibility was determined with the coefficient of variation (CV. The consistency was examined by intraclass correlation coefficients (ICCs. The mean value and the normal range were analyzed with a 95% confidence interval as the normative values of parameters. The correlation of parameters to pupil records (area ratio, constriction ratio and flicker ERG was also examined in the diabetic retinopathy assessment protocol. Results. From the CV for each of the two measurements, the amplitude has a low reproducibility compared with the implicit time. Generally good consistency was obtained with both ERG parameters (ICCs = 0.48–0.92. Moderate correlations were found for the white-, red-, and blue-light stimulus in the area ratio and the constriction ratio, respectively (r = 0.44–0.62; P = 0.010–<0.0001. No correlation was observed between pupil and flicker parameters (r = 0.06–0.34; P = 0.646–0.051. Conclusions. The RETeval device was suggested as a possible screening device to detect the visual afferent diseases by evaluating in combination with the ERG recording and the colored-light pupil response.
Diffuse Reflectance Spectroscopy of Human Skin Using a Commercial Fiber Optic Spectrometer
International Nuclear Information System (INIS)
Atencio, J. A. Delgado; Rodriguez, M. Cunill; Montiel, S. Vazquez y; Castro, Jorge; Rodriguez, A. Cornejo; Gutierrez, J. L.; Martinez, F.; Gutierrez, B.; Orozco, E.
2008-01-01
Diffuse reflectance spectroscopy is a reliable and easy to implement technique in human tissue characterization. In this work we evaluate the performance of the commercial USB4000 miniature fiber optic spectrometer in the in-vivo measurement of the diffuse reflectance spectra of different healthy skin sites and lesions in a population of 54 volunteers. Results show, that this spectrometer reproduces well the typical signatures of skin spectra over the 400-1000 nm region. Remarkable spectral differences exist between lesions and normal surrounding skin. A diffusion-based model was used to simulate reflectance spectra collected by the optical probe of the system
Smith, M. Elizabeth; Farah, Martha J.
2011-01-01
Use of prescription stimulants by normal healthy individuals to enhance cognition is said to be on the rise. Who is using these medications for cognitive enhancement, and how prevalent is this practice? Do prescription stimulants in fact enhance cognition for normal healthy people? We review the epidemiological and cognitive neuroscience…
Temperament affects sympathetic nervous function in a normal population.
Kim, Bora; Lee, Jae-Hon; Kang, Eun-Ho; Yu, Bum-Hee
2012-09-01
Although specific temperaments have been known to be related to autonomic nervous function in some psychiatric disorders, there are few studies that have examined the relationship between temperaments and autonomic nervous function in a normal population. In this study, we examined the effect of temperament on the sympathetic nervous function in a normal population. Sixty eight healthy subjects participated in the present study. Temperament was assessed using the Korean version of the Cloninger Temperament and Character Inventory (TCI). Autonomic nervous function was determined by measuring skin temperature in a resting state, which was recorded for 5 minutes from the palmar surface of the left 5th digit using a thermistor secured with a Velcro® band. Pearson's correlation analysis and multiple linear regression were used to examine the relationship between temperament and skin temperature. A higher harm avoidance score was correlated with a lower skin temperature (i.e. an increased sympathetic tone; r=-0.343, p=0.004) whereas a higher persistence score was correlated with a higher skin temperature (r=0.433, p=0.001). Hierarchical linear regression analysis revealed that harm avoidance was able to predict the variance of skin temperature independently, with a variance of 7.1% after controlling for sex, blood pressure and state anxiety and persistence was the factor predicting the variance of skin temperature with a variance of 5.0%. These results suggest that high harm avoidance is related to an increased sympathetic nervous function whereas high persistence is related to decreased sympathetic nervous function in a normal population.
Parkinson disease and progressive supranuclear palsy: protein expression in skin.
Rodríguez-Leyva, Ildefonso; Chi-Ahumada, Erika G; Carrizales, Juan; Rodríguez-Violante, Mayela; Velázquez-Osuna, Salvador; Medina-Mier, Verónica; Martel-Gallegos, María G; Zarazúa, Sergio; Enríquez-Macías, Lourdes; Castro, Adriana; Calderón-Garcidueñas, Ana Laura; Jiménez-Capdeville, María E
2016-03-01
This study characterizes the expression of tau (p-tau) and α-synuclein (α-syn) by immunohistochemistry in the skin of three different populations: healthy control (HC), Parkinson disease (PD), and progressive supranuclear paralysis (PSP) subjects, with the purpose of finding a biomarker that could differentiate between subjects with PD and PSP. We evaluated the presence of p-tau and α-syn in a pilot study in the skin of three distinct groups of patients: 17 healthy subjects, 17 patients with PD, and 10 patients with PSP. Four millimeters punch biopsies were obtained from the occipital area and analyzed by immunohistochemistry using antibodies against α-syn and phosphorylated species of tau. PHF (paired helical filaments) antibody identifies p-tau in both normal and pathological conditions and AT8 recognizes p-tau characteristic of pathological conditions. Differences between the three groups were assessed by quantification of immunopositive areas in the epidermis. The immunopositivity pattern of p-tau and α-syn was significantly different among the three groups. Healthy subjects showed minimal staining using AT8 and α-syn. The PD group showed significantly higher α-syn and AT8 immunopositivity, while the PSP group only expressed higher AT8 immunopositivity than HCs. These data suggest that the skin reflects brain pathology. Therefore, immunohistochemical analysis of p-tau and α-syn in the skin can be useful for further characterization of PD and PSP.
Tosi, Isabella; Grys, Katarzyna; Sreeneebus, Hemawtee; Perera, Gayathri K; Chapman, Anna; Smith, Catherine H; Di Meglio, Paola; Nestle, Frank O
2013-01-01
Innate lymphoid cells (ILC) are increasingly appreciated as key regulators of tissue immunity. However, their role in human tissue homeostasis and disease remains to be fully elucidated. Here we characterise the ILC in human skin from healthy individuals and from the inflammatory skin disease psoriasis. We show that a substantial proportion of IL-17A and IL-22 producing cells in skin and blood of normal individuals and psoriasis patients are CD3 negative innate lymphocytes. Deep immunophenotyping of human ILC subsets showed a statistically significant increase in the frequency of circulating NKp44+ ILC3 in blood of psoriasis patients compared to healthy individuals or atopic dermatitis patients. More than 50% of circulating NKp44+ ILC3 expressed cutaneous lymphocyte-associated antigen indicating their potential for skin homing. Analysis of skin tissue revealed a significantly increased frequency of total ILC in skin compared to blood. Moreover the frequency of NKp44+ ILC3 was significantly increased in non-lesional psoriatic skin compared to normal skin. A detailed time course of a psoriasis patient treated with anti-TNF showed a close association between therapeutic response, decrease in inflammatory skin lesions, and decrease of circulating NKp44+ ILC3. Overall, data from this initial observational study suggest a potential role for NKp44+ ILC3 in psoriasis pathogenesis. PMID:24352038
International Nuclear Information System (INIS)
Hannan, M.A.; Smith, B.P.; Sigut, D.; Sackey, K.
1990-01-01
Fibroblast cells derived from a cafe-au-lait spot and normal-appearing skin of a neurofibromatosis (NF-6) patient were studied for radiosensitivity in comparison with two normal cell lines used as controls. No difference in radiosensitivity was observed between the patient's cell lines and the controls using acute gamma-irradiation. However, a markedly increased radiosensitivity of the fibroblasts obtained from the patient's skin of normal appearance was demonstrated after chronic gamma-irradiation. The cells from the cafe-au-lait spot showed intermediate sensitivity to chronic irradiation as compared with the control cell lines and the fibroblasts derived from the normal skin of the patient. These results showed the usefulness of chronic irradiation in detecting increased cellular radiosensitivity which may result from a unique DNA repair defect in an NF patient. We suggest that enhanced genetic changes in radiosensitive NF patients may lead to formation of cafe-au-lait lesions and certain tumors. Such a transformation may be associated with production of radiotolerant cells
Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells
International Nuclear Information System (INIS)
Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki
2008-01-01
The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)
Institute of Scientific and Technical Information of China (English)
GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui
2007-01-01
The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.
Tolerance of natural baby skin-care products on healthy, full-term infants and toddlers
Coret, Catherine D; Suero, Michael B; Tierney, Neena K
2014-01-01
Catherine D Coret, Michael B Suero, Neena K Tierney Johnson & Johnson Consumer Companies, Inc, Skillman, NJ, USA Purpose: To evaluate the tolerance of baby skin-care products with at least 95% naturally derived ingredients on infants and toddlers. Materials and methods: Healthy, full-term infants and toddlers aged 1–36 months were enrolled. In study 1, a lightly fragranced natural baby hair and body wash (n=30), a lightly fragranced natural baby shampoo (n=30), or a lightly...
International Nuclear Information System (INIS)
Liu Xudong; Zeng Bingfang; Fan Cunyi; Jiang Peizhu; Hu Xiao
2006-01-01
To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable
Defining normal liver stiffness range in a normal healthy Chinese population without liver disease.
Directory of Open Access Journals (Sweden)
James Fung
Full Text Available BACKGROUND: For patients with chronic liver disease, different optimal liver stiffness cut-off values correspond to different stages of fibrosis, which are specific for the underlying liver disease and population. AIMS: To establish the normal ranges of liver stiffness in the healthy Chinese population without underlying liver disease. METHODS: This is a prospective cross sectional study of 2,528 healthy volunteers recruited from the general population and the Red Cross Transfusion Center in Hong Kong. All participants underwent a comprehensive questionnaire survey, measurement of weight, height, and blood pressure. Fasting liver function tests, glucose and cholesterol was performed. Abdominal ultrasound and transient elastography were performed on all participants. RESULTS: Of the 2,528 subjects, 1,998 were excluded with either abnormal liver parenchyma on ultrasound, chronic medical condition, abnormal blood tests including liver enzymes, fasting glucose, fasting cholesterol, high body mass index, high blood pressure, or invalid liver stiffness scan. The reference range for the 530 subjects without known liver disease was 2.3 to 5.9 kPa (mean 4.1, SD 0.89. The median liver stiffness was higher in males compared with females (4.3 vs 4.0 kPa respectively, p55 years (p=0.001. CONCLUSIONS: The healthy reference range for liver stiffness in the Chinese population is 2.3 to 5.9 kPa. Female gender and older age group was associated with a lower median liver stiffness.
DEFF Research Database (Denmark)
Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus
2003-01-01
Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...... activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology...
Ardesjö-Lundgren, Brita; Tengvall, Katarina; Bergvall, Kerstin; Farias, Fabiana H G; Wang, Liya; Hedhammar, Åke; Lindblad-Toh, Kerstin; Andersson, Göran
2017-08-01
Canine atopic dermatitis (CAD) is an inflammatory and pruritic allergic skin disease caused by interactions between genetic and environmental factors. Previously, a genome-wide significant risk locus on canine chromosome 27 for CAD was identified in German shepherd dogs (GSDs) and Plakophilin-2 (PKP2) was defined as the top candidate gene. PKP2 constitutes a crucial component of desmosomes and also is important in signalling, metabolic and transcriptional activities. The main objective was to evaluate the role of PKP2 in CAD by investigating PKP2 expression and desmosome structure in nonlesional skin from CAD-affected (carrying the top GWAS SNP risk allele) and healthy GSDs. We also aimed at defining the cell types in the skin that express PKP2 and its intracellular location. Skin biopsies were collected from nine CAD-affected and five control GSDs. The biopsies were frozen for immunofluorescence and fixed for electron microscopy immunolabelling and morphology. We observed the novel finding of PKP2 expression in dendritic cells and T cells in dog skin. Moreover, we detected that PKP2 was more evenly expressed within keratinocytes compared to its desmosomal binding-partner plakoglobin. PKP2 protein was located in the nucleus and on keratin filaments attached to desmosomes. No difference in PKP2 abundance between CAD cases and controls was observed. Plakophilin-2 protein in dog skin is expressed in both epithelial and immune cells; based on its subcellular location its functional role is implicated in both nuclear and structural processes. © 2017 The Authors. Veterinary Dermatology published by John Wiley & Sons Ltd on behalf of the ESVD and ACVD.
DEFF Research Database (Denmark)
Mollerup, Annette; Veien, Niels K; Johansen, Jeanne D
2014-01-01
BACKGROUND: Hand eczema is a common disease, and continuous preventive skin protection and skin care must be adopted to prevent a chronic course. Hand eczema is not a uniform disease, and counselling must therefore be individually tailored. OBJECTIVES: To evaluate the effectiveness of a nurse-led...... or burden of disease were found between the two groups. CONCLUSION: A tailored nurse-led programme of skin protection counselling may be recommended as an essential part of hand eczema treatment.......BACKGROUND: Hand eczema is a common disease, and continuous preventive skin protection and skin care must be adopted to prevent a chronic course. Hand eczema is not a uniform disease, and counselling must therefore be individually tailored. OBJECTIVES: To evaluate the effectiveness of a nurse......-led counselling programme, the Healthy Skin Clinic, emphasizing the patient's self-management, resources, and risks. PATIENTS AND METHODS: Patients (n = 306) referred for diagnostic work-up and treatment of hand eczema were randomized and allocated either to the programme or to usual care. The primary outcome...
Ambient humidity and the skin: the impact of air humidity in healthy and diseased states.
Goad, N; Gawkrodger, D J
2016-08-01
studies are needed to better delineate the interactions that can occur in normal and diseased states. Therapeutic measures might be forthcoming especially for skin diseases such as eczema, which are regarded as being characterized by 'skin dryness'. Further research examining the interaction between different environmental exposures thought to impact the skin, and indeed the interplay between genetic, environmental and immunological influences, are required. © 2016 European Academy of Dermatology and Venereology.
Normal tissue tolerance to external beam radiation therapy: Skin
International Nuclear Information System (INIS)
Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A.
2010-01-01
Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)
Moinfar, Farid; Beham, Alfred; Friedrich, Gerhard; Deutsch, Alexander; Hrzenjak, Andelko; Luschin, Gero; Tavassoli, Fattaneh A
2008-05-01
Genetic abnormalities in microenvironmental tissues with subsequent alterations of reciprocal interactions between epithelial and mesenchymal cells play a key role in the breast carcinogenesis. Although a few reports have demonstrated abnormal fibroblastic functions in normal-appearing fibroblasts taken from the skins of breast cancer patients, the genetic basis of this phenomenon and its implication for carcinogenesis are unexplored. We analyzed 12 mastectomy specimens showing invasive ductal carcinomas. In each case, morphologically normal epidermis and dermis, carcinoma, normal stroma close to carcinoma, and stroma at a distant from carcinoma were microdissected. Metastatic-free lymphatic tissues from lymph nodes served as a control. Using PCR, DNA extracts were examined with 11 microsatellite markers known for a high frequency of allelic imbalances in breast cancer. Losses of heterozygosity and/or microsatellite instability were detected in 83% of the skin samples occurring either concurrently with or independently from the cancerous tissues. In 80% of these cases at least one microsatellite marker displayed loss of heterozygosity or microsatellite instability in the skin, which was absent in carcinoma. A total of 41% of samples showed alterations of certain loci observed exclusively in the carcinoma but not in the skin compartments. Our study suggests that breast cancer is not just a localized genetic disorder, but rather part of a larger field of genetic alterations/instabilities affecting multiple cell populations in the organ with various cellular elements, ultimately contributing to the manifestation of the more 'localized' carcinoma. These data indicate that more global assessment of tumor micro- and macro-environment is crucial for our understanding of breast carcinogenesis.
Tolerance of natural baby skin-care products on healthy, full-term infants and toddlers.
Coret, Catherine D; Suero, Michael B; Tierney, Neena K
2014-01-01
To evaluate the tolerance of baby skin-care products with at least 95% naturally derived ingredients on infants and toddlers. Healthy, full-term infants and toddlers aged 1-36 months were enrolled. In study 1, a lightly fragranced natural baby hair and body wash (n=30), a lightly fragranced natural baby shampoo (n=30), or a lightly fragranced natural baby lotion (n=32) were assessed over 2 weeks. In study 2, a lightly fragranced natural baby hair and body wash and a lightly fragranced natural baby lotion (n=33) were assessed as a regimen over 4 weeks. The wash and shampoo were used three or more times per week, but not more than once daily. Lotions were applied in the morning or after a bath. Clinicians assessed the arms, legs, torso, or scalp for erythema, dryness, peeling/flakiness (study 1 only), tactile roughness, edema (study 1 only), rash/irritation (study 2 only), and overall skin condition (study 2 only) at baseline, week 1, and weeks 2 or 4. Parents completed skin assessment questionnaires. In study 2, stratum corneum hydration was measured. Subjects were monitored for adverse events. No significant changes in clinical grading scores were observed, indicating that all products were well tolerated. By the end of each study, >90% of parents/caregivers believed each product was mild and gentle. In study 2, improvement in stratum corneum hydration was observed (+37% at week 1 and +48% at week 4, Pproduct-related adverse events. The natural baby skin-care products were well tolerated by infants and toddlers when used alone or as part of a skin-care regimen.
Boelsma, E.; Lamers, R.-J.A.N.; Hendriks, H.F.J.; Nesselrooij, J.H.J. van; Roza, L.
2004-01-01
Ginkgo biloba extract has been advocated for the improvement of blood circulation in circulatory disorders. This study investigated the effect of the Gingko biloba extract EGb 761 on skin blood flow in healthy volunteers and accompanying changes in urinary metabolites. Twenty-seven healthy
Using silicone technology to maintain healthy skin in stoma care.
White, Maddie
The use of silicone in stoma care has grown in recent years and may be considered the next step in the revolutionary development of stoma-care products. Clinical nurse specialists aim to provide evidence-based care at all times, and the same is true for stoma-care nurses. Preventing harm by choosing products that have a sound research base provides the patients with up-to-date, quality care, which enables them to adapt to life with a stoma and return to 'normal' functioning. This article explores the issue of peristomal skin problems and the development of silicone products, and highlights scenarios where it could be an advantage to choose a silicone product.
Xiong, S. Y.; Yang, J. G.; Zhuang, J.
2011-10-01
In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.
Ultrastructural changes in human skin after exposure to a pulsed laser
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, H.; Tan, O.T.; Parrish, J.A.
1985-05-01
Selective vascular injury following irradiation using a pulsed laser source at 577 nm was examined using ultrastructural methods in the skin of 3 fair-skinned healthy human volunteers. This vascular-specific damage was confined to the papillary dermis. Red blood cells were altered in several ways. As well as an increase in the electron density, configurational distortion modified the normal biconcave forms to ameboid structures. The most interesting finding was the appearance within these altered cells of well-defined circular/oval electron-lucent areas of 800 A diameter, possibly representing a heat-fixed record of steam formation within the red blood cell. In addition, considerable degenerative changes were evident in endothelial cells and pericytes, while mast cells, neutrophils, histiocytes, and fibroblasts as well as collagen bundles immediately surrounding most laser-damaged blood vessels appeared normal.
Téllez Soto, Claudio Alberto; Pereira, Liliane; dos Santos, Laurita; Rajasekaran, Ramu; Fávero, Priscila; Martin, Airton Abrahão
2016-12-01
In the confocal Raman spectra of skin dermis, the band area in the spectral region of proline and hydroxyproline varies according to the age and health condition of the volunteers, classified as healthy young women, healthy elderly women, and diabetic elderly women. Another observation refers to the intensity variation and negative Raman shift of the amide I band. To understand these effects, we adopted a model system using the DFT/B3LYP:3-21G procedure, considering the amino acid chain formed by glycine, hydroxyproline, proline, and alanine, which interacts with two and six water molecules. Through these systems, polarizability variations were analyzed to correlate its values with the observed Raman intensities of the three groups of volunteers and to assign the vibrational spectra of the skin dermis. As a way to correlate other experimental trends, we propose a model of chemical reaction of water interchange between the bonding amino acids, in which water molecules are attached with glucose by hydrogen bonds. The theoretical results are in accordance with the observed experimental trends.
Influence of local air velocity from air conditioner evaluated by salivary and skin biomarkers
Energy Technology Data Exchange (ETDEWEB)
Yamaguchi, Masaki; Takahashi, Takayuki; Yoshino, Yuichiro; Sasaki, Makoto [Graduate School of Engineering, Iwate University, 4-3-5 Ueda, Morioka 020-8551 (Japan); Nishimiya, Hajime [Asahi Kasei Homes Corporation, R and D Laboratories, 2-1 Samejima, Fuji, Shizuoka 416-8501 (Japan)
2010-11-15
The purpose of this paper is to reveal both the psychosomatic and the physical effects of local air velocity from an air conditioner using biomarkers which can be collected noninvasively. Salivary {alpha}-amylase activity (SAA) and salivary cortisol were used as the indexes of psychosomatic effects. The total protein (TP) collected from stratum corneum was used as an index of the physical condition of dry skin. A continuous experiment over a 5 days period in summer was conducted using 8 healthy young male adults for 2-types of airflow conditioners, a whole ceiling-type air conditioner (without local air velocity) and a normal-type air conditioner (with local air velocity). The subjects felt cool, windy, dry and uncomfortable when under the normal-type air conditioner as determined in a subjective evaluation. The SAA under the normal-type air conditioner fluctuated more widely than with the whole ceiling-type air conditioner. The level of salivary cortisol decreased more in a day under the normal-type air conditioner than with the whole ceiling-type air conditioner. These results showed that reducing local air velocity may provide more healthy psychosomatic conditions over the long-term. Moreover, the TP of a drying-exposed skin area showed a significant change during this experiment whereas the TP of drying-protected area was relatively unchanged. It was indicated that one week's exposure to local air velocity conditions possibly influences the drying of facial skin. Thus, air movement at low velocity can be provides more comfortable conditions not only psychosomatically but also physically. (author)
Suichies, H.E.; Aarnoudse, J.G.; Okken, A.; Jentink, H.W.; de Mul, F.F.M.; Greve, Jan
1988-01-01
Changes in forehead skin blood flow during active and quiet sleep were determined in 16 healthy neonates using a recently developed semi-conductor laser Doppler flow meter without light conducting fibres. Measurements were carried out at a postnatal age varying from 5 hours to 7 days. The two sleep
Zhao, Miaomiao; Li, Fan; Wang, Guoqing; Zhou, Fengfeng
2013-01-01
Although electrocardiogram (ECG) fluctuates over time and physical activity, some of its intrinsic measurements serve well as biometric features. Considering its constant availability and difficulty in being faked, the ECG signal is becoming a promising factor for biometric authentication. The majority of the currently available algorithms only work well on healthy participants. A novel normalization and interpolation algorithm is proposed to convert an ECG signal into multiple template cycles, which are comparable between any two ECGs, no matter the sampling rates or health status. The overall accuracies reach 100% and 90.11% for healthy participants and cardiovascular disease (CVD) patients, respectively. PMID:23977063
El sol: ¿enemigo de nuestra piel? The sun: enemy of our skin?
Directory of Open Access Journals (Sweden)
Moraima Mora Ochoa
Full Text Available Actualmente existe una elevada mortalidad y morbilidad por cáncer de piel, lo cual representa un grave problema que va en aumento; por tal razón, en el presente estudio se revisó la bibliografía especializada sobre algunos aspectos de interés, tales como: interacción de las radiaciones solares sobre esta parte del organismo, efectos beneficiosos y perjudiciales, respuestas cutáneas normales y anormales, relación entre el cáncer de piel y las radiaciones ultravioletas, así como medidas de protección solar, las cuales permitirán mantener una piel sana y saludable.Currently, there is a high mortality and morbidity due to skin cancer, which represents an increasingly serious problem. Therefore, this study reviewed the specialized literature on some aspects of interest such as interaction of solar radiations on this part of the body, beneficial and harmful effects, normal and abnormal skin responses, relationship between skin cancer and ultraviolet radiations, as well as sun protection measures, which will allow us to maintain a healthy skin.
Multiphoton STED and FRET in human skin: Resolving the skin barrier
DEFF Research Database (Denmark)
Antonescu, Irina; Dreier, Jes; Brewer, Jonathan R.
intercellular spaces. Characterization of the structural and dynamical processes occurring across the skin barrier is essential for understanding healthy and diseased skin and for designing successful transdermal drug delivery strategies. In this study we use Stimulated emission depletion (STED), two photon...
DFD-01 Reduces Transepidermal Water Loss and Improves Skin Hydration and Flexibility.
Jackson, J Mark; Grove, Gary L; Allenby, Kent; Houser, Tim
2017-12-01
In plaque psoriasis, the benefit of topical steroids is well established. The vehicle formulation of topical steroids may also provide benefit in addition to the effects of the steroid itself. DFD-01 (betamethasone dipropionate spray, 0.05%) is a formulation composed of a topical steroid in an emollient-like vehicle that enhances penetration to the target site of inflammation in the skin. The aim of this study was to assess the effect of DFD-01 and its vehicle on skin hydration and barrier function in compromised skin and to evaluate its effect on flexibility in healthy skin. Eighteen healthy white volunteers were enrolled in each of two studies. In Study 1, dry shaving of volar forearms created a compromised skin barrier, through which transepidermal water loss (TEWL) was measured using an evaporimeter. Capacitance, a measure of epidermal hydration, was also measured at baseline and at 1, 2 and 4 h after application of DFD-01 or its vehicle formulation. In Study 2, intact skin flexibility was tested with a cutometer before and at 1, 2 and 4 h after application of DFD-01 or vehicle. In Study 1, both DFD-01 and its vehicle were effective at reducing TEWL through the compromised stratum corneum. Capacitance measurements confirmed this finding; razor-chafed skin treated with either DFD-01 or vehicle exhibited levels of skin hydration similar to unshaved control skin. Study 2 found softening and greater flexibility of normal skin treated with either DFD-01 or vehicle compared with nontreated control skin samples. These tests suggest that the DFD-01 formulation and its vehicle are each effective at retaining moisture within a damaged skin barrier and for softening and increasing the flexibility of intact skin. Dr. Reddy's Laboratories.
Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair
Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.;
1994-01-01
The skin repair studies started to be problematic for the following reasons: (1) It was very difficult to locate the wound and many lesions were not of the same dimensions. A considerable amount of time was devoted to the identification of the wound using polarized light. We understand that this experiment was added on to the overall project. Marking of the wound site and standard dimensions should be recommended for the next flight experiment. (2) The tissue was frozen, therefore thawing and fixation caused problems with some of the immunocytochemical staining for obtaining better special resolution with light microscopy image processing. Despite these problems, we were unable to detect any significant qualitative differences for the following wound markers: (1) Collagen Type 3, (2) Hematotoxylin and Eosin, and (3) Macrophage Factor 13. All protein markers were isolated from rat sources and antibodies prepared and tested for cross reactivity with other molecules at the University of Wisconsin Hybridoma Facility. However, rat skin from the non lesioned site 'normal' showed interesting biochemical results. Skin was prepared for the following measurements: (1) DNA content, (2) Collagen content by hydroxyproline, and (3) uronic acid content and estimation of ground substance. The results indicated there was a non-significant increase (10%) in the DNA concentration of skin from flight animals. However, the data expressed as a ratio DNA/Collagen estimates the cell or nuclear density that supports a given quantity of collagen showed a dramatic increase in the flight group (33%). This means flight conditions may have slowed down collagen secretion and/or increased cell proliferation in adult rat skin. Further biochemical tests are being done to determine the crosslinking of elastin which will enhance the insight to assessing changes in skin turnover.
Skin absorption through atopic dermatitis skin
DEFF Research Database (Denmark)
Halling-Overgaard, A-S; Kezic, S; Jakasa, I
2017-01-01
Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...
Lower corticosteroid skin blanching response is associated with severe COPD.
Directory of Open Access Journals (Sweden)
Susan J M Hoonhorst
Full Text Available Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test.COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography.Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears.In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.
Variation of Biophysical Parameters of the Skin with Age, Gender, and Body Region
Firooz, Alireza; Sadr, Bardia; Babakoohi, Shahab; Sarraf-Yazdy, Maryam; Fanian, Ferial; Kazerouni-Timsar, Ali; Nassiri-Kashani, Mansour; Naghizadeh, Mohammad Mehdi; Dowlati, Yahya
2012-01-01
Background. Understanding the physiological, chemical, and biophysical characteristics of the skin helps us to arrange a proper approach to the management of skin diseases. Objective. The aim of this study was to measure 6 biophysical characteristics of normal skin (sebum content, hydration, transepidermal water loss (TEWL), erythema index, melanin index, and elasticity) in a normal population and assess the effect of sex, age, and body location on them. Methods. Fifty healthy volunteers in 5 age groups (5 males and females in each) were enrolled in this study. A multifunctional skin physiology monitor (Courage & Khazaka electronic GmbH, Germany) was used to measure skin sebum content, hydration, TEWL, erythema index, melanin index, and elasticity in 8 different locations of the body. Results. There were significant differences between the hydration, melanin index, and elasticity of different age groups. Regarding the locations, forehead had the highest melanin index, where as palm had the lowest value. The mean values of erythema index and melanin index and TEWL were significantly higher in males and anatomic location was a significant independent factor for all of 6 measured parameters. Conclusion. Several biophysical properties of the skin vary among different gender, age groups, and body locations. PMID:22536139
Igase, Michiya; Ohara, Maya; Igase, Keiji; Kato, Takeaki; Okada, Yoko; Ochi, Masayuki; Tabara, Yasuharu; Kohara, Katsuhiko; Ohyagi, Yasumasa
2017-01-01
Accumulation of advanced glycation endproducts (AGEs) is thought to be involved in the pathogenesis of dementia, especially Alzheimer's disease. Tissue AGE accumulation can be estimated using the relative simple noninvasive measurement of skin autofluorescence (SAF), a method based on the fluorescent properties of some AGEs. However, possible involvement of tissue AGE accumulation in mild cognitive impairment (MCI) has not been fully investigated. We investigated whether tissue AGE accumulation estimated by SAF is associated with mild cognitive impairment. We analyzed 226 community-dwelling subjects. In addition to several atherosclerosis-related clinical parameters, MCI screening test, assessment of brain atrophy, and SAF were performed on people aged > 40 years. MCI was assessed using the Japanese version of the MCI screening method. Atrophy of the brain was assessed by examining the temporal horn area (THA) by brain MRI. SAF was significantly higher in participants with MCI than in those with normal cognitive function (2.56±0.55 versus 2.10±0.41; p 2.27 was significantly related to the presence of MCI (odds, 6.402; 95% CI, 1.590-25.773, p = 0.009). We found an association between SAF and MCI, which was independent of brain atrophy, in healthy subjects.
Huang, Yuanshen; Wang, Yang; Yu, Jie; Gao, Min; Levings, Megan; Wei, Shencai; Zhang, Shengquan; Xu, Aie; Su, Mingwan; Dutz, Jan; Zhang, Xuejun; Zhou, Youwen
2012-01-01
Background Vitiligo is characterized by the death of melanocytes in the skin. This is associated with the presence of T cell infiltrates in the lesional borders. However, at present, there is no detailed and systematic characterization on whether additional cellular or molecular changes are present inside vitiligo lesions. Further, it is unknown if the normal appearing non-lesional skin of vitiligo patients is in fact normal. The purpose of this study is to systematically characterize the molecular and cellular characteristics of the lesional and non-lesional skin of vitiligo patients. Methods and Materials Paired lesional and non-lesional skin biopsies from twenty-three vitiligo patients and normal skin biopsies from sixteen healthy volunteers were obtained with informed consent. The following aspects were analyzed: (1) transcriptome changes present in vitiligo skin using DNA microarrays and qRT-PCR; (2) abnormal cellular infiltrates in vitiligo skin explant cultures using flow cytometry; and (3) distribution of the abnormal cellular infiltrates in vitiligo skin using immunofluorescence microscopy. Results Compared with normal skin, vitiligo lesional skin contained 17 genes (mostly melanocyte-specific genes) whose expression was decreased or absent. In contrast, the relative expression of 13 genes was up-regulated. The up-regulated genes point to aberrant activity of the innate immune system, especially natural killer cells in vitiligo. Strikingly, the markers of heightened innate immune responses were also found to be up-regulated in the non-lesional skin of vitiligo patients. Conclusions and Clinical Implications As the first systematic transcriptome characterization of the skin in vitiligo patients, this study revealed previously unknown molecular markers that strongly suggest aberrant innate immune activation in the microenvironment of vitiligo skin. Since these changes involve both lesional and non-lesional skin, our results suggest that therapies targeting
Müller, H; Weier, S; Kojouharoff, G; Grez, M; Berger, S; Kappus, R; Shah, P M; Stutte, H J; Schmidts, H L
1993-01-01
The in situ content of cells of the reticuloendothelial system and lymphatic cells was examined in the skin of eight symptom-free HIV-positive individuals, three AIDS patients and eleven healthy immunocompetent volunteers. The epidermis was obtained in vivo by the suction blister technique. The numbers of CD68+, CD3+, CD8+, CD25-(IL2R)+ and HLA-DR+ intraepidermal cells proved to be independent of the number of CD4+ peripheral blood lymphocytes. At the same time, the intraepidermal concentrations of these cells were generally low in symptom-free HIV-infected individuals. The strong inverse correlation between the number of epidermal Langerhans cells (LC) and the severity of immunodeficiency was quantitatively confirmed; an increase in LC in symptom-free HIV-infected individuals was found. Thus, the reduction in these cells which was observed in the epidermis of AIDS patients began at a significantly elevated level. In contrast to results from other studies, in AIDS patients, in the present study, the concentration of epidermal LC did not differ significantly from that of healthy immunocompetent volunteers. The immunohistochemical technique can be as effective as in situ hybridization for the detection of HIV in the skin. Our results suggest that the viral load of the skin is rather low in HIV-infected subjects. HIV was demonstrated in one cell of one AIDS case by in situ techniques and this result was confirmed by a polymerase chain reaction examination using the same amount of tissue as for the in situ techniques.(ABSTRACT TRUNCATED AT 250 WORDS)
Anti-oxidant defence mechanism in vitiliginous skin increases with skin type
Briganti, S.; Caron-Schreinemachers, A.-L. D. B.; Picardo, M.; Westerhof, W.
2012-01-01
Background Vitiligo skin shows different burning capacity in people with different phototype. In normal skin antioxidant status is correlated to skin phototype, but unexpectedly it appears that there is a gradual decrease in burning susceptibility of depigmented skin of individuals with increasing
van Smeden, Jeroen; Bouwstra, Joke A
2016-01-01
Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to
Analysis of assistance procedures to normal birth in primiparous
Directory of Open Access Journals (Sweden)
Joe Luiz Vieira Garcia Novo
2016-04-01
Full Text Available Introduction: Current medical technologies in care in birth increased maternal and fetal benefits persist, despite numerous unnecessary procedures. The purpose of the normal childbirth care is to have healthy women and newborns, using a minimum of safe interventions. Objective: To analyze the assistance to normal delivery in secondary care maternity. Methodology: A total of 100 primiparous mothers who had vaginal delivery were included, in which care practices used were categorized: 1 according to the WHO classification for assistance to normal childbirth: effective, harmful, used with caution and used inappropriately; 2 associating calculations with the Bologna Index parameters: presence of a birth partner, partograph, no stimulation of labor, delivery in non-supine position, and mother-newborn skin-to-skin contact. Results: Birth partners (85%, correctly filled partographs (62%, mother-newborn skin-to-skin contact (36%, use of oxytocin (87%, use of parenteral nutrition during labor (86% and at delivery (74%, episiotomy (94% and uterine fundal pressure in the expulsion stage (58%. The overall average value of the Bologna Index of the mothers analyzed was 1.95. Conclusions: Some effective procedures recommended by WHO (presence of a birth partner, some effective and mandatory practices were not complied with (partograph completely filled, potentially harmful or ineffective procedures were used (oxytocin in labor/post-partum, as well as inadequate procedures (uterine fundal pressure during the expulsion stage, use of forceps and episiotomy. The maternity’s care model did not offer excellence procedures in natural birth to their mothers in primiparity, (BI=1.95.
International Nuclear Information System (INIS)
Keyse, S.M.; Moss, S.H.; Davies, D.J.G.
1983-01-01
Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)
Directory of Open Access Journals (Sweden)
Satya Wydya Yenny
2008-09-01
Full Text Available AbstrakPada pitiriasis versikolor sering timbul kekambuhan, diduga salah satu penyebabnya adalah kelembaban kulit yang tinggi. Kelembaban kulit dipengaruhi oleh skin capacitance dan transepidermal water loss.Mengetahui skin capacitance dan transepidermal water loss kulit pasien pitiriasis versikolor dan perbedaannya dengan non-pitiriasis versikolor.Penelitian ini merupakan studi potong lintang perbandingan antar kelompok, yang dilakukan pada bulan September sampai dengan Nopember 2004 di Rumah Sakit Dr. Cipto Mangunkusumo. Subyek penelitian pasien pitiriasis versikolor dan kontrol non-pitiriasis versikolor yang dipasangkan dalam hal umur dan jenis kelamin dan dilakukan pemeriksaan skin capacitance dan transepidermal water loss pada kulit yang tampak normal di punggung menggunakan alat Tewameter/Corneometer 350.Dalam kurun waktu tersebut telah diperiksa sebanyak 32 pasien pitiriasis versikolor dan 32 kontrol non-pitiriasis versikolor. Skin capacitance pasien pitiriasis versikolor secara statistik tidak berbeda dengan kontrol non-pitiriasis versikolor (p = 0,730. Transepidermal water loss pasien pitiriasis versikolor secara bermakna lebih rendah dari pada kelompok kontrol non-pitiriasis versikolor (p = 0,000.Tidak ada perbedaan skin capacitance kulit pasien pitiriasis versikolor dengan non-pitiriasis versikolor. Transepidermal water loss kulit pasien pitiriasis versikolor lebih rendah daripada non-pitiriasis versikolor.Kata kunci: pitiriasis versikolor, skin capacitance, transepidermal water lossAbstractThe recurrence of pityriasis versicolor is high, it could be caused by high skin hydration. Skin hydration was influenced by skin capacitance and transepidermal water loss.ARTIKEL PENELITIAN168The purpose of this study was to compare the differences of the skin capacitance and transepidermal water loss between the pityriasis versicolor skin and healthy non-pityriasis versicolor skin.The design of this study was comparative cross-sectional study
Directory of Open Access Journals (Sweden)
Yoshiharu Tanaka
2018-01-01
Full Text Available Biomedical properties of hydrogen water have been extensively investigated, but the effect of hydrogen on good healthy subjects remains unclear. This study was designed to explore the hygiene improvement by electrolytically generated hydrogen warm water (40°C on capillary blood streams, skin moisture, and keratin plugs in skin pores in normal good healthy subjects with their informed consents. Fingertip-capillary blood stream was estimated after hand-immersing in hydrogen warm water by videography using a CCD-based microscope, and the blood flow levels increased to about 120% versus normal warm water, after 60 minutes of the hand-immersing termination. Skin moisture of subjects was assessed using an electro-conductivity-based skin moisture meter. Immediately after taking a bath filled with hydrogen warm water, the skin moisture increased by 5–10% as compared to before bathing, which was kept on for the 7-day test, but indistinct, because of lower solubility of hydrogen in “warm” water than in room-temperature water. Cleansing of keratin plugs in skin-pores was assessed by stereoscopic microscopy and scanning electron microscopy. After hydrogen warm water bathing, the numbers of cleansed keratin plugs also increased on cheek of subjects 2.30- to 4.47-fold as many as the control for normal warm water. And areas of cleansed keratin plugs in the cheeks increased about 1.3-fold as much as the control. More marked improvements were observed on cheeks than on nostrils. Hydrogen warm water may thoroughly cleanse even keratin-plugs of residual amounts that could not be cleansed by normal warm water, through its permeability into wide-ranged portions of hair-pores, and promote the fingertip blood streams more markedly than merely through warmness due to normal warm water.
Survival of human diploid skin fibroblasts from normal individuals after X-irradiation
International Nuclear Information System (INIS)
Little, J.B.; Nove, J.; Strong, L.C.; Nichols, W.W.
1988-01-01
The cytotoxic effect of X-rays was measured by a colony formation assay in multiple experiments with fibroblast cell strains derived from 24 presumably normal individuals, received as 65 different coded and blinded samples. Each strain was received on two or more occasions at different times and bearing different codes. The means and standard deviations of the survival curve parameters for the 24 strains were: D 0 = 123 +- 23; D 10 = 273 +- 42 cGy. The D 0 ranged from 89 to 175 and the D 10 from 196 to 372 cGy. The degree of interexperimental variation, though generally minimal, differed considerably among cell strains. There was no systematic effect of passage level, cloning efficiency, serum lot, age or sex of the donor on X-ray survival. These results confirm that the intrinsic radiosensitivity varies significantly among skin fibroblasts isolated from clinically normal individuals, apparently owing to as yet unidentified genetic factors. (Author)
International Nuclear Information System (INIS)
Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan
1995-01-01
Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when
Direct immunofluorescence of normal skin in rheumatoid arthritis.
Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S
1985-11-01
The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.
Role of the vitamin D3 pathway in healthy and diseased skin--facts, contradictions and hypotheses.
Lehmann, Bodo
2009-02-01
Irradiation of human keratinocytes with UVB (280-320 nm) in vitro and in vivo activates the metabolism of 7-dehydrocholesterol to hormonally active calcitriol. The production of calcitriol in the skin strongly depends on the photosynthesis of vitamin D(3) which is biologically inactive in the first instance. Vitamin D(3) serves as the starting substrate for two subsequent enzymatic hydroxylation steps in epidermal keratinocytes. Both the amount of vitamin D(3) and the activity of anabolic and catabolic vitamin D hydroxylases determine the cutaneous level of calcitriol. The hormonally active metabolite of vitamin D(3) regulates a huge number of genes in keratinocytes, and thus acts in an autocrine and/or paracrine manner. This local pathway of vitamin D(3) is unique, but its relevance for healthy and diseased skin is widely unknown, yet. Experimental findings implicate several questions: (1) Is UVB-induced formation of calcitriol involved in regulation of growth and differentaition of epidermal cells as well as immunological and skin protective processes? (2) What endogenous and exogenous factors including drugs affect the cutaneous vitamin D(3) pathway? From a therapeutical point of view, it has been known for a long time that topical application of calcitriol and its analogs can improve hyperproliferative skin diseases like psoriasis. In spite of many encouraging studies in recent years, the fields of the routinely therapeutical application of calcitriol or vitamin D analogs in dermatology (e.g. treatment of immunological, inflammatory, malignancies and infectious skin diseases) have not been intensified. Why is that?
van den Hende, Muriel; van Poelgeest, Mariëtte I. E.; van der Hulst, Jeanette M.; de Jong, Joan; Drijfhout, Jan W.; Fleuren, Gert Jan; Valentijn, A. Rob P. M.; Wafelman, Amon R.; Slappendel, Gijs M.; Melief, Cornelis J. M.; Offringa, Rienk; van der Burg, Sjoerd H.; Kenter, Gemma G.
2008-01-01
We have tested the safety and feasibility of a synthetic long peptide-based HPV16-specific skin test to detect cellular immune responses to HPV16 E2, E6 and E7 in vivo. Women with cervical neoplasia (n = 11) and healthy individuals (n = 19) were intradermally challenged with 8 different pools of
Plants used to treat skin diseases
Tabassum, Nahida; Hamdani, Mariya
2014-01-01
Skin diseases are numerous and a frequently occurring health problem affecting all ages from the neonates to the elderly and cause harm in number of ways. Maintaining healthy skin is important for a healthy body. Many people may develop skin diseases that affect the skin, including cancer, herpes and cellulitis. Some wild plants and their parts are frequently used to treat these diseases. The use of plants is as old as the mankind. Natural treatment is cheap and claimed to be safe. It is also suitable raw material for production of new synthetic agents. A review of some plants for the treatment of skin diseases is provided that summarizes the recent technical advancements that have taken place in this area during the past 17 years. PMID:24600196
International Nuclear Information System (INIS)
Silva, Mario; Nemec, Stefan F.; Dufresne, Valerie; Occhipinti, Mariaelena; Heidinger, Benedikt H.; Bankier, Alexander A.; Chamberlain, Ryan
2016-01-01
Pulmonary parametric response map (PRM) was proposed for quantitative densitometric phenotypization of chronic obstructive pulmonary disease. However, little is known about this technique in healthy subjects. The purpose of this study was to describe the normal spectrum of densitometric classification of pulmonary PRM in a group of healthy adults. 15 healthy volunteers underwent spirometrically monitored chest CT at total lung capacity (TLC) and functional residual capacity (FRC). The paired CT scans were analyzed by PRM for voxel-by-voxel characterization of lung parenchyma according to 4 densitometric classifications: normal lung (TLC ≥ -950 HU, FRC ≥ -856 HU); expiratory low attenuation area (LAA) (TLC ≥ -950 HU, FRC < -856 HU); dual LAA (TLC<-950 HU, FRC < -856 HU); uncharacterized (TLC < -950 HU, FRC ≥ -856 HU). PRM spectrum was 78 % ± 10 % normal lung, 20 % ± 8 % expiratory LAA, and 1 % ± 1 % dual LAA. PRM was similar between genders, there was moderate correlation between dual LAA and spirometrically assessed TLC (R = 0.531; p = 0.042), and between expiratory LAA and Vol Exp/Insp ratio (R = -0.572; p = 0.026). PRM reflects the predominance of normal lung parenchyma in a group of healthy volunteers. However, PRM also confirms the presence of physiological expiratory LAA seemingly related to air trapping and a minimal amount of dual LAA likely reflecting emphysema. (orig.)
Shimizu, Ruka; Kishi, Kazuo
2012-01-01
Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...
Tolerance of natural baby skin-care products on healthy, full-term infants and toddlers
Directory of Open Access Journals (Sweden)
Coret CD
2014-02-01
Full Text Available Catherine D Coret, Michael B Suero, Neena K Tierney Johnson & Johnson Consumer Companies, Inc, Skillman, NJ, USA Purpose: To evaluate the tolerance of baby skin-care products with at least 95% naturally derived ingredients on infants and toddlers. Materials and methods: Healthy, full-term infants and toddlers aged 1–36 months were enrolled. In study 1, a lightly fragranced natural baby hair and body wash (n=30, a lightly fragranced natural baby shampoo (n=30, or a lightly fragranced natural baby lotion (n=32 were assessed over 2 weeks. In study 2, a lightly fragranced natural baby hair and body wash and a lightly fragranced natural baby lotion (n=33 were assessed as a regimen over 4 weeks. The wash and shampoo were used three or more times per week, but not more than once daily. Lotions were applied in the morning or after a bath. Clinicians assessed the arms, legs, torso, or scalp for erythema, dryness, peeling/flakiness (study 1 only, tactile roughness, edema (study 1 only, rash/irritation (study 2 only, and overall skin condition (study 2 only at baseline, week 1, and weeks 2 or 4. Parents completed skin assessment questionnaires. In study 2, stratum corneum hydration was measured. Subjects were monitored for adverse events. Results: No significant changes in clinical grading scores were observed, indicating that all products were well tolerated. By the end of each study, >90% of parents/caregivers believed each product was mild and gentle. In study 2, improvement in stratum corneum hydration was observed (+37% at week 1 and +48% at week 4, P<0.05 for both. In study 1, one baby experienced mild erythema on the neck and scalp after using the shampoo (possibly related to treatment. In study 2, there were no product-related adverse events. Conclusion: The natural baby skin-care products were well tolerated by infants and toddlers when used alone or as part of a skin-care regimen. Keywords: bath, cleanser, natural, infant, lotion, shampoo
Renero-C, Francisco-J
2017-01-01
Background : Thermoregulation is a complex autonomic process to keep or to dissipate heat in the human body. Methods : In this work, by means of the thermogram of the plantar skin, the thermoregulation of healthy individuals, overweight-obese, and diabetic is discussed. Results : The thermograms of the plantar skin, for the healthy individuals, are: (1) symmetrical, the temperature distribution of the right foot being a mirror image of that of the left foot ; (2) the thermograms of women, on average, are 3°C colder than those of the men; and (3) the temperature distributions decrease distally from the medial longitudinal arch. The plantar skin thermograms of overweight-obese individuals show: (1) increased average temperature of both feet and for both genders; (2) no symmetry between the left and right feet thermograms; and (3) the temperature distribution is still decreasing from the medial longitudinal arch to the periphery of the foot. However, the standard deviation, for each averaged temperature of the angiosomes, shows greater uncertainty. Most thermograms of diabetic individuals show temperature increase on the plantar skin, and are mostly symmetric between left and right feet. Conclusions: An asymmetric thermogram of the plantar skin of diabetic individuals, where one foot is hotter than the other, may mean that the coldest foot is losing the capacity to communicate properly with the central nervous system and/or that vasoconstriction/vasodilatation is having problems in regulating the passing of blood through the vessels. Thus, the asymmetric thermograms of diabetic patients, and particularly those coldest regions of foot are of interest, because of the reduction of the local autonomic sensing and the lack of achieving properly the passing of the blood.
My Skin – a self-questionnaire for assessment of the emotional-cognitive representation of skin
Directory of Open Access Journals (Sweden)
Marlena M. Kossakowska
2016-02-01
Full Text Available Background The aims of this paper are: 1 to present the My Skin questionnaire, 2 to report the preliminary results of a study on the emotional-cognitive skin representation, and 3 to encourage dermatologists and other specialists to use the My Skin questionnaire in their research. The inspiration for a new tool measuring the emotional and cognitive representation of skin was the psychological conception of the ‘skin ego’. Participants and procedure My Skin, a self-questionnaire (MSQ, was used to measure the emotional and cognitive representation of an individual’s skin. It consists of two main scales: satisfaction with the skin condition (AB and awareness of the biopsychosocial functions of the skin (C. The Body Esteem Scale, Body Self Questionnaire and Self-Esteem Scale were used to validate the MSQ. The participants were: healthy individuals (n = 343 and dermatology patients (psoriasis, vitiligo, juvenile acne, n = 84. Results The psychometric parameters are presented in this article. The internal consistency reliabilities for subscales are in the range of .75 and .95. This article also presents preliminary basic statistics for the skin representation of dermatology patients and healthy people. Conclusions My Skin questionnaire is a valid tool for assessing cognitive and emotional representation of skin and may be used in psychodermatology and esthetic dermatology to assess satisfaction with and awareness of skin.
Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...
Imaging Blood Vessel Morphology in Skin
DEFF Research Database (Denmark)
Schuh, Sandra; Holmes, Jon; Ulrich, Martina
2017-01-01
Conventional optical coherence tomography (OCT) enables the visualization of morphological changes of skin cancer. The use of OCT in the diagnostic investigation and in the therapy decision of non-melanoma skin cancer and other skin changes is already established, and has found its way into routine...... practice. With the development of speckle-variance OCT, also named dynamic OCT (D-OCT), the vascular architecture and the blood flow of the skin can be displayed in vivo and in 3D. This novel angiographic variant of OCT offers the ability to visualize and measure vessel morphology providing a new insight...... into healthy, inflammatory and neoplastic skin lesions such as malignant melanoma. This review focuses on the possibilities of using D-OCT on healthy and diseased skin. We suggest and illustrate key diagnostic characteristics by analyzing the initial publications and preliminary unpublished data on vessel...
Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka
2006-02-01
Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.
Iron deposition in skin of patients with haemochromatosis
International Nuclear Information System (INIS)
Pinheiro, T.; Silva, J.N.; Alves, L.C.; Filipe, P.
2003-01-01
Haemochromatosis is the most common inherited liver disease in Caucasians and the most common autosomal recessive genetic disorder. It is characterized by inappropriately high iron absorption resulting in progressive iron overload in parenchymal organs such as liver, heart, pancreas, pituitary, joints, and skin. Upon early detection, haemochromatosis can be a manageable chronic disease but, if undetected, is potentially fatal. Skin biopsies were obtained from patients and from healthy donors. Images of the elemental distributions in skin were obtained using nuclear microscopy techniques (nuclear microprobe, NMP). Elemental profiles along skin, and intra-, and extra-cellular iron concentrations, were determined. Results for patients with haemochromatosis were cross-examined with morphologic features and with data obtained for healthy skin. Skin iron content is much increased in patients with haemochromatosis when compared with healthy subjects. Extensive iron deposits are observed at dermis, at the dermo-epidermal interface, at upper epidermis layers and at stratum corneum. Iron deposition was observed preferentially at cell boundaries or at the interstitial matrix
Larraona-Puy, M.; Ghita, A.; Zoladek, A.; Perkins, W.; Varma, S.; Leach, I. H.; Koloydenko, A. A.; Williams, H.; Notingher, I.
2011-05-01
Skin cancer is the most common human malignancy and basal cell carcinoma (BCC) represents approximately 80% of the non-melanoma cases. Current methods of treatment require histopathological evaluation of the tissues by qualified personnel. However, this method is subjective and in some cases BCC can be confused with other structures in healthy skin, including hair follicles. In this preliminary study, we investigated the potential of Raman micro-spectroscopy (RMS) to discriminate between hair follicles and BCC in skin tissue sections excised during Mohs micrographic surgery (MMS). Imaging and diagnosis of skin sections was automatically generated using ' a priori'-built spectral model based on LDA. This model had 90 ± 9% sensitivity and 85 ± 9% specificity for discrimination of BCC from dermis and epidermis. The model used selected Raman bands corresponding to the largest spectral differences between the Raman spectra of BCC and the normal skin regions, associated mainly with nucleic acids and collagen type I. Raman spectra corresponding to the epidermis regions of the hair follicles were found to be closer to those of healthy epidermis rather than BCC. Comparison between Raman spectral images and the gold standard haematoxylin and eosin (H&E) histopathology diagnosis showed good agreement. Some hair follicle regions were misclassified as BCC; regions corresponded mainly to the outermost layer of hair follicle (basal cells) which are expected to have higher nucleic acid concentration. This preliminary study shows the ability of RMS to distinguish between BCC and other tissue structures associated to healthy skin which can be confused with BCC due to their similar morphology.
Directory of Open Access Journals (Sweden)
Renan Cardoso Soares
Full Text Available Malassezia yeasts are part of the resident cutaneous microbiota, and are also associated with skin diseases such as seborrheic dermatitis (SD. The role these fungi play in skin diseases and why they are pathogenic for only some individuals remain unclear. This study aimed to characterize Malassezia microbiota from different body sites in healthy and SD subjects from Brazil. Scalp and forehead samples from healthy, mild SD and severe SD subjects were collected. Non-scalp lesions from severe SD patients were also sampled. 5.8S rDNA/ITS2 amplicons from Malassezia sp. were analyzed by RFLP and sequencing. Results indicate that Malassezia microbiota did not group according to health condition or body area. Phylogenetic analysis revealed that three groups of sequences did not cluster together with any formally described species, suggesting that they might belong to potential new species. One of them was found in high proportions in scalp samples. A large variety of Malassezia subtypes were detected, indicating intra-specific diversity. Higher M. globosa proportions were found in non-scalp lesions from severe SD subjects compared with other areas, suggesting closer association of this species with SD lesions from areas other than scalp. Our results show the first panorama of Malassezia microbiota in Brazilian subjects using molecular techniques and provide new perspectives for further studies to elucidate the association between Malassezia microbiota and skin diseases.
Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Lukasz R; Pomorski, Zbigniew J H
2011-04-01
The purpose of this study was to evaluate transepidermal water loss (TEWL), skin hydration and skin pH in normal cats. Twenty shorthaired European cats of both sexes were examined in the study. Measurements were taken from five different sites: the lumbar region, the axillary fossa, the inguinal region, the ventral abdominal region and the left thoracic region. In each of the regions, TEWL, skin hydration and skin pH were measured. The highest TEWL value was observed in the axillary fossa (18.22g/h/m(2)) and the lowest in the lumbar region (10.53g/h/m(2)). The highest skin hydration was found in the inguinal region (18.29CU) and the lowest in the lumbar region (4.62CU). The highest skin pH was observed in the inguinal region (6.64) and the lowest in the lumbar region (6.39). Statistically significant differences in TEWL were observed between the lumbar region and the left side of the thorax region (P=0.016), the axillary fossa (P=0.0004), the ventral region (P=0.005), and the inguinal region (P=0.009). There were significant differences in skin hydration between the lumbar region and the left thorax (P=0.000003), the axillary fossa (P=0.002), the ventral abdomen (P=0.03), and the inguinal region (P=0.0003) as well as between the thorax and the ventral abdomen (P=0.005). TEWL was higher in females (15g/h/m(2)) than in males (4.57g/h/m(2)). Skin hydration was higher in females (13.89CU) than in males (12.28CU). Significant differences were not found between males and females for TEWL and skin hydration. Skin pH was higher in males (6.94) than in females (6.54), which was significant (P=0.004). Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.
Jiang, L-Y; Shan, J-J; Tong, X-M; Zhu, H-Y; Yang, L-Y; Zheng, Q; Luo, Y; Shi, Q-X; Zhang, S-Y
2014-10-01
Cystic fibrosis transmembrane conductance regulator (CFTR) has been demonstrated to be expressed in mature spermatozoa and correlated with sperm quality. Sperm CFTR expression in fertile men is higher than that in infertile men suffering from teratospermia, asthenoteratospermia, asthenospermia and oligospermia, but it is unknown whether CFTR is correlated with sperm parameters when sperm parameters are normal. In this study, 282 healthy and fertile men with normal semen parameters were classified into three age groups, group (I): age group of 20-29 years (98 cases, 27.1 ± 6.2), group (II): age group of 30-39 years (142 cases, 33.7 ± 2.6) and group (III): age group of more than or equal to 40 years (42 cases, 44.1 ± 4.6). Sperm concentration, total count and progressive motility were analysed by computer-assisted sperm analysis. Sperm morphology was analysed by modified Papanicolaou staining. Sperm CFTR expression was conducted by indirect immunofluorescence staining. There was a significant positive correlation (P sperm progressive motility (r = 0.221) and normal morphology (r = 0.202), but there were no correlations between sperm CFTR expression and semen volume, sperm concentration, sperm total count as well as male age (P > 0.05). Our findings show that CFTR expression is associated with sperm progressive motility and normal morphology in healthy and fertile men with normal sperm parameters, but not associated with the number of spermatozoa and male age. © 2013 Blackwell Verlag GmbH.
Fullerton, A; Serup, J
1997-02-01
To study whether anatomical location and age and gender of subjects had any influence on the objective skin colour measurements. Baseline colour in prone position was measured with the Minolta ChromaMeter® in the upper, middle and lower level of the upper back and on the forearm of 168 volunteers. These two sites are commonly used in skin testing. Higher basal a* and lower basal L* levels were found on the upper scapular region compared to the lower scapular region and the subscapular region. The basal b* level showed no variation relative to site. The basal a* and the basal b* levels were lower on the forearm compared to the upper back while the basal L* level was higher. Females above 65 years showed a less coloured skin with lower values as compared to those of younger age. Females were found to have a generally lower basal a* level than males both on the upper back and forearm skin. These relatively major differences and sources of variation have to be considered when planning irritancy studies where colour differences between erythema and normal skin is used.
Early skin-to-skin contact for mothers and their healthy newborn infants.
Moore, E R; Anderson, G C; Bergman, N
2007-07-18
Mother-infant separation postbirth is common in Western culture. Early skin-to-skin contact (SSC) begins ideally at birth and involves placing the naked baby, covered across the back with a warm blanket, prone on the mother's bare chest. According to mammalian neuroscience, the intimate contact inherent in this place (habitat) evokes neurobehaviors ensuring fulfillment of basic biological needs. This time may represent a psychophysiologically 'sensitive period' for programming future behavior. To assess the effects of early SSC on breastfeeding, behavior, and physiological adaptation in healthy mother-newborn dyads. Cochrane Pregnancy and Childbirth Group's and Neonatal Group's Trials Registers (August 2006), Cochrane Central Register of Controlled Trials (The Cochrane Library 2006, Issue 2), MEDLINE (1976 to 2006). Randomized and quasi-randomized clinical trials comparing early SSC with usual hospital care. We independently assessed trial quality and extracted data. Study authors were contacted for additional information. Thirty studies involving 1925 participants (mother-infant dyads), were included. Data from more than two trials were available for only 8-of-64 outcome measures. We found statistically significant and positive effects of early SSC on breastfeeding at one to four months postbirth (10 trials; 552 participants) (odds ratio (OR) 1.82, 95% confidence interval (CI) 1.08 to 3.07), and breastfeeding duration (seven trials; 324 participants) (weighted mean difference (WMD) 42.55, 95% CI -1.69 to 86.79). Trends were found for improved summary scores for maternal affectionate love/touch during observed breastfeeding (four trials; 314 participants) (standardized mean difference (SMD) 0.52, 95% CI 0.07 to 0.98) and maternal attachment behavior (six trials; 396 participants) (SMD 0.52, 95% CI 0.31 to 0.72) with early SSC. SSC infants cried for a shorter length of time (one trial; 44 participants) (WMD -8.01, 95% CI -8.98 to -7.04). Late preterm infants had
Expression and activity of arginase isoenzymes during normal and diabetes-impaired skin repair.
Kämpfer, Heiko; Pfeilschifter, Josef; Frank, Stefan
2003-12-01
Within the past years, an important role for nitric oxide (NO) in skin repair has been well defined. As NO is synthesized from L-arginine by NO synthases (NOS), the availability of L-arginine might be one rate-limiting factor of NO production at the wound site. Upon injury, arginase-1 and -2 mRNA, protein, and activity were strongly induced reaching a maximum between day 3 and day 7 postwounding. Immunohistochemistry colocalized both arginases and the inducible NOS (iNOS) at epithelial sites at the margins of the wound. Notably, diabetes-impaired skin repair in leptin-deficient mice (diabetes/diabetes, db/db; and obese/obese, ob/ob) was characterized by an abnormally elevated arginase activity in wound tissue in the absence of an expression of iNOS. Expression analyses demonstrated that arginase-1 contributed to increased arginase activities in impaired repair. Interestingly, an improved healing of chronic wound situations in leptin-supplemented ob/ob mice was strongly associated with an adjustment of the dysregulated expression of L-arginine-converting enzymes: an attenuated iNOS expression was upregulated early in repair and an augmented arginase-1 expression and activity was downregulated in the presence of markedly elevated numbers of macrophages during late repair. These data suggest a coordinated consumption of L-arginine by the NOS and arginase enzymatic pathways at the wound site as a prerequisite for a balanced NO (via iNOS) and polyamine (via arginases) synthesis that drives a normal skin repair.
Skin temperature during sunbathing--relevance for skin cancer
DEFF Research Database (Denmark)
Petersen, Bibi; Philipsen, Peter Alshede; Wulf, Hans Christian
2014-01-01
It has been found that exposure to heat and infrared radiation (IR) can be carcinogenic, and that a combination of ultraviolet radiation (UVR) and IR possibly amplifies carcinogenesis. To investigate how the skin temperature is affected by sunbathing, we measured the skin temperature on 20 healthy...... volunteers over 6 days' sun holiday in Egypt. Temperatures were measured with an infrared thermometer gun at 8 skin sites on the volunteers while they were indoors in the morning and when sunbathing during the day. Skin temperatures were higher during sunbathing (33.5 °C ± 2.1 °C) (mean ± SD) than when...... indoors in the morning (32.6 °C ± 1.4 °C) (mean ± SD) (P skin temperature for men was higher than for women by 0.40 °C in the morning (P = 0.02) and by 0.44 °C during sunbathing (P skin temperature, which possibly...
Skin blood flow from gas transport: helium xenon and laser Doppler compared
Energy Technology Data Exchange (ETDEWEB)
Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.
1988-03-01
A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics.
Skin blood flow from gas transport: helium xenon and laser Doppler compared
International Nuclear Information System (INIS)
Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.
1988-01-01
A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics
Erosion or normal variant? 4-year MRI follow-up of the wrists in healthy children
Energy Technology Data Exchange (ETDEWEB)
Avenarius, Derk F.M. [University of Tromsoe, Faculty of Health Sciences, Tromsoe (Norway); University Hospital of North Norway, Department of Radiology, Tromsoe (Norway); Ording Mueller, Lil-Sofie [Oslo University Hospital, Department for Radiology and Intervention, Oslo (Norway); Rosendahl, Karen [Haukeland University Hospital, Department of Radiology, Bergen (Norway); University of Bergen, Department of Clinical Medicine K1, Bergen (Norway)
2016-03-15
A large proportion of healthy children have wrist changes on MRI, namely carpal depressions, findings that have been described as pathological in children with juvenile idiopathic arthritis. We performed follow-up imaging in a cohort of healthy children to evaluate carpal surface depressions over time, focusing on the presence of overlying cartilage as a potential discriminator between normal variants and true erosions. 74 of the initial cohort of 89 healthy children (83%) had a re-scan of their wrists using the same protocol, including coronal T1 and fat-saturated T2 sequences. A cartilage-selective sequence was added for this study. We registered number and location of bony depressions and presence of overlying cartilage. The total number of carpal depressions increased by age group and over time; their location was unchanged in 370 of 487 (76%) carpal sites and 91 of 117 (78%) metacarpal sites. In total, 426 of the 1,087 (39.2%) bony depressions were covered by cartilage, with a decreasing percentage by age (P = 0.001). Normal appearances during growth, such as bony depressions, should not be mistaken for pathology. There must be additional findings to support a diagnosis of disease. A cartilage sequence may add to the diagnostic image analysis. (orig.)
Costa, Natalia Moriya Xavierda; Albuquerque, Maly de; Lins, Janaína Bacelar Acioli; Alvares-Junior, João Teixeira; Stefani, Mariane Martins de Araújo
2011-10-01
Among HIV-1-infected patients, CD4+ T cell counts are well-established markers of cell-mediated immunity. Delayed-type hypersensitivity (DTH) skin tests can be used to evaluate in vivo cell-mediated immunity to common antigens. DTH responses to tuberculin purified protein derivative (PPD), sporotrichin, trichophytin, candidin and streptokinase/streptodornase antigens were assessed. Thirty-six HIV-1-infected children/adolescents and 56 age- and sex-matched HIV-1/HIV-2-seronegative participants were tested. All participants had a BCG scar. Fisher's exact test was used to evaluate significant differences between groups (pPPD positivity prevailed among healthy participants (40/56, 71.4%). PPD reactivity in the HIV-1-positive group was 8.3% (pPPD induration was 2.5mm (range: 2-5mm) in the HIV-1 group and 6.0 mm among healthy participants (range: 3-15 mm). There was no correlation between PPD positivity and age. No correlation between CD4+ T cell counts and DTH reactivity was observed among HIV-1-infected patients. DTH skin test responses, including PPD reactivity, were significantly lower among HIV-1-infected participants compared to healthy controls, which likely reflects advanced disease and T cell depletion.
Shivaprasad, C; Goel, Amit; Vilier, Alice; Calvet, Jean-Henri
2018-01-01
Electrochemical skin conductance (ESC) test is a widely accepted objective technique for quantitatively assessing sudomotor dysfunction, which is one of the earliest-detected neurophysiologic abnormalities in diabetic patients with distal symmetric polyneuropathy. This study aimed to provide normative data for ESC values among healthy Indian participants and assess the potential influence of age, sex, and body mass index (BMI) on ESC measurements. A sample of 217 healthy participants aged 18-75 years were recruited and assessed for parameters including age, gender, BMI, and ESC measurements of the hands and feet. The Shapiro-Wilk test was used to assess the normality of the data. Pearson's correlation was used to evaluate the association between age, gender, and BMI, and ESC measurements. The mean age of the participants was 43.3 ± 13.2 years, and mean BMI was 26.0 ± 4.3 kg/m 2 . Mean ESC for the hands and feet was 68.9 ± 13.1 and 71 ± 12.9 micro-Siemens, respectively, and there was a significant correlation between values from the right and left hands and feet ( r = 0.9, P < 0.0001). A significant correlation was also observed between ESC measurements of the hands and feet ( r = 0.94, P < 0.0001). ESC values of both hands and feet declined with age. A weak but significant inverse correlation between ESC and age was observed for the hands ( r = 0.02, P = 0.01) and for the feet ( r = 0.12, P < 0.0001). There was no significant difference in hand or feet ESC measurement between male and female participants. No significant correlation was observed between BMI and ESC of hands or feet. Only age was identified as a significant determinant of ESC on multivariate logistic regression analysis. Normative values for Indians are lower than that reported for Caucasians.
Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha
2015-06-25
Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.
Trait Positive Affect Buffers the Effects of Acute Stress on Skin Barrier Recovery
Robles, Theodore F.; Brooks, Kathryn P.; Pressman, Sarah D.
2010-01-01
Objective This study examines the role of self-reported trait positive affect (PA) on skin barrier recovery after skin disruption, and whether the role of trait PA in wound healing is consistent with the direct effects model or the stress-buffering model of PA and health. Design Sixty healthy participants (mean age 22.7 ± 3.9 years) completed a self-report measure of trait positive and negative affect, underwent a “tape-stripping” procedure that disrupts normal skin barrier function, and were randomly assigned to a Stress (Trier Social Stress Test) or No Stress (reading task) condition. Main Outcome Measures Skin barrier recovery was assessed by measuring transepidermal water loss up to 2 hr after skin disruption. Results Multilevel modeling indicated that greater trait PA was related to faster skin barrier recovery (p < .05). The effects of PA on skin barrier recovery were independent of levels of trait NA. Conclusion These findings suggest that trait PA may influence skin barrier recovery following a brief stressor. In addition, these results provide additional evidence that trait PA can positively impact objective health outcomes. PMID:19450044
Majdzadeh, Ali; Lee, Anthony M D; Wang, Hequn; Lui, Harvey; McLean, David I; Crawford, Richard I; Zloty, David; Zeng, Haishan
2015-05-01
Recent advances in biomedical optics have enabled dermal and epidermal components to be visualized at subcellular resolution and assessed noninvasively. Multiphoton microscopy (MPM) and reflectance confocal microscopy (RCM) are noninvasive imaging modalities that have demonstrated promising results in imaging skin micromorphology, and which provide complementary information regarding skin components. This study assesses whether combined MPM/RCM can visualize intracellular and extracellular melanin granules in the epidermis and dermis of normal human skin. We perform MPM and RCM imaging of in vivo and ex vivo skin in the infrared domain. The inherent three-dimensional optical sectioning capability of MPM/RCM is used to image high-contrast granular features across skin depths ranging from 50 to 90 μm. The optical images thus obtained were correlated with conventional histologic examination including melanin-specific staining of ex vivo specimens. MPM revealed highly fluorescent granular structures below the dermal-epidermal junction (DEJ) region. Histochemical staining also demonstrated melanin-containing granules that correlate well in size and location with the granular fluorescent structures observed in MPM. Furthermore, the MPM fluorescence excitation wavelength and RCM reflectance of cell culture-derived melanin were equivalent to those of the granules. This study suggests that MPM can noninvasively visualize and quantify subepidermal melanin in situ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Benefits of optical coherence tomography for imaging of skin diseases
Directory of Open Access Journals (Sweden)
Utz S.R.
2015-09-01
Full Text Available Aim: working out the methods of visualization of information obtained during optical coherent tomography in normal skin and in series of inflammatory disorders. Materials and Methods. OCS1300SS (made in Thorlabs, USA was used in which the source of emission of radiation was a super-luminiscent diode with mean wavelength of 1325 nm. 12 patients with different skin conditions and 5 virtually healthy volunteers were examined with ОСТ procedure in OPD and IPD settings. High resolution USG numerical system DUB (TPM GmbH, Germany was used for comparative USG assessment. Results. ОСТ demonstrated considerably more detailed picture of the objects scanned compared to USG investigation. Image obtained with the help of ОСТ contains vital information about sizes of macro-morphological elements, status of vascular elements and their density in different depths of the skin. Conclusion. Additional results obtained from ОСТ of the skin lesions in plane section improves attraction for ОСТ in practical dermatology.
Supraclavicular skin temperature and BAT activity in lean healthy adults.
van der Lans, Anouk A J J; Vosselman, Maarten J; Hanssen, Mark J W; Brans, Boudewijn; van Marken Lichtenbelt, Wouter D
2016-01-01
The 'gold standard' for measuring brown adipose tissue (BAT) in humans is [(18)F]FDG-PET/CT-imaging. With this technique subjects are exposed to ionizing radiation and are therefore limited in the number of scans that can be performed. We investigated the relation between supraclavicular skin temperatures and BAT activity values using a strictly temperature-controlled air-cooling protocol. Data of 36 male subjects was analyzed. BAT activity was evaluated by [(18)F]FDG-PET/CT-imaging and skin temperature was measured by means of wireless temperature sensors. Supraclavicular skin temperature dropped less compared to skin temperatures at other sites (all P values BAT activity (R (2) 0.23), and the change in supraclavicular skin temperature and non-shivering thermogenesis (R (2) 0.18, both P values BAT activity and BAT thermogenesis.
Electrical measurement of the hydration state of the skin surface in vivo.
Tagami, H
2014-09-01
Healthy skin surface is smooth and soft, because it is covered by the properly hydrated stratum corneum (SC), an extremely thin and soft barrier membrane produced by the underlying normal epidermis. By contrast, the skin surfaces covering pathological lesions exhibit dry and scaly changes and the SC shows poor barrier function. The SC barrier function has been assessed in vivo by instrumentally measuring transepidermal water loss (TEWL). However, there was a lack of any appropriate method for evaluating the hydration state of the skin surface in vivo until 1980 when we reported the feasibility of employing high-frequency conductance or capacitance to evaluate it quickly and accurately. With such measurements, we can assess easily the moisturizing efficacy of various topical agents in vivo as well as the distribution pattern of water in the SC by combining it with a serial tape-stripping procedure of the skin surface. © 2014 The Author BJD © 2014 British Association of Dermatologists.
DEFF Research Database (Denmark)
Søndergaard, Klaus; Deleuran, Mette; Heickendorff, Lene
1998-01-01
In order to investigate whether soluble intercellular adhesion molecule-1 (sICAM-1) and soluble interleukin-2 receptors (sIL-2R) were present in scleroderma skin, and to compare their levels to concentrations measured in plasma and clinical parameters, we examined suction blister fluid and plasma...... from 13 patients with systemic sclerosis and 11 healthy volunteers. Suction blisters and biopsies were from the transition zone between normal skin and scleroderma, and uninvolved abdominal skin. The levels of sICAM-1 and sIL-2R were significantly increased in both plasma and suction blister fluid from...
International Nuclear Information System (INIS)
Brock, W.A.; Wike, J.; Tucker, S.L.
1995-01-01
To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs
The outcomes of barrier protection in periwound skin and stoma care.
Stephen-Haynes, Jackie
This article considers the anatomy and physiology of the skin,wound healing, excoriation, maceration, peristomal skin and the importance of periwound protection. The results of a 54-patient study of the use of barrier film forming skin protection in periwound skin are presented and a 10-patient healthy volunteer experimental evaluation. The results confirm the effectiveness of barrier protection in healthy skin in an experimental evaluation and a 54-patient study requiring periwound protection.
Sympathetic skin response evoked by laser skin stimulation
Rossi, P.; Truini, A.; Serrao, M.; Iannetti, G. D.; Parisi, L.; Pozzessere, G.; Cruccu, G.
2002-01-01
The objective of this study was to evoke sympathetic skin responses (SSRs) in healthy subjects using laser stimulation and to compare these responses with those induced by conventional electrical stimuli. Twenty healthy subjects were investigated. SSRs were obtained using electrical and laser stimuli delivered to the wrist controlateral to the recording site. The sympathetic sudomotor conduction velocity (SSFCV) was measured in 8 subjects by simultaneously recording the SSR from the hand and ...
Neurogenic inflammation in human and rodent skin
DEFF Research Database (Denmark)
Schmelz, M; Petersen, Lars Jelstrup
2001-01-01
The combination of vasodilation and protein extravasation following activation of nociceptors has been termed "neurogenic inflammation." In contrast to rodents, no neurogenic protein extravasation can be elicited in healthy human skin. Dermal microdialysis has considerably increased our knowledge...... about neurogenic inflammation in human skin, including the involvement of mast cells.......The combination of vasodilation and protein extravasation following activation of nociceptors has been termed "neurogenic inflammation." In contrast to rodents, no neurogenic protein extravasation can be elicited in healthy human skin. Dermal microdialysis has considerably increased our knowledge...
Törmä, Hans; Lindberg, Magnus; Berne, Berit
2008-05-01
Detergents are skin irritants affecting keratinocytes. In this study, healthy volunteers were exposed to water (vehicle) and 1% sodium lauryl sulfate (SLS) under occlusive patch tests for 24 hours. The messenger RNA (mRNA) expression of keratinocyte differentiation markers and of enzymes involved in corneodesmosome degradation was examined in skin biopsies (n=8) during the repair phase (6 hours to 7 days postexposure) using real-time reverse-transcription PCR. It was found that the expression of involucrin was increased at 6 hours, but then rapidly normalized. The expression of transglutaminase 1 exhibited a twofold increase after 24 hours in the SLS-exposed skin. Profilaggrin was decreased after 6 hours. Later (4-7 days), the expression in SLS-exposed areas was >50% above than in control areas. An increased and altered immunofluorescence pattern of involucrin, transglutaminase 1, and filaggrin was also found (n=4). At 6 hours post-SLS exposure, the mRNA expression of kallikrein-7 (KLK-7) and kallikrein-5 (KLK-5) was decreased by 50 and 75%, respectively, as compared with control and water-exposed areas. Thereafter, the expression pattern of KLK-7 and KLK-5 was normalized. Changes in protein expression of KLK-5 were also found. In conclusion, SLS-induced skin barrier defects induce altered mRNA expression of keratinocyte differentiation markers and enzymes degrading corneodesmosomes.
Recommendations for skin decontamination
International Nuclear Information System (INIS)
1989-01-01
Further to the reecommendations for determining the surface contamination of the skin and estimating the radiation exposure of the skin after contamination (SAAS-Mitt--89-16), measures for skin decontamination are recommended. They are necessary if (1) after simple decontamination by means of water, soap and brush without damaging the skin the surface contamination limits are exceeded and the radiation exposure to be expected for the undamaged healthy skin is estimated as to high, and if (2) a wound is contaminated. To remove skin contaminations, in general universally applicable, non-aggressive decontamination means and methods are sufficient. In special cases, nuclide-specific decontamination is required taking into account the properties of the radioactive substance
The effect of skin thickness determined using breast CT on mammographic dosimetry
International Nuclear Information System (INIS)
Huang Shihying; Boone, John M.; Yang, Kai; Kwan, Alexander L. C.; Packard, Nathan J.
2008-01-01
The effect of breast skin thickness on dosimetry in mammography was investigated. Breast computed tomography (CT) acquisition techniques, combined with algorithms designed for determining specific breast metrics, were useful for estimating skin thickness. A radial-geometry edge detection scheme was implemented on coronal reconstructed breast CT (bCT) images to measure the breast skin thickness. Skin thickness of bilateral bCT volume data from 49 women and unilateral bCT volume data from 2 women (10 healthy women and 41 women with BIRADS 4 and 5 diagnoses) was robustly measured with the edge detection scheme. The mean breast skin thickness (±inter-breast standard deviation) was found to be 1.45±0.30 mm. Since most current published normalized glandular dose (D gN ) coefficients are based on the assumption of a 4-mm breast skin thickness, the D gN values computed with Monte Carlo techniques will increase up to 18% due to the thinner skin layers (e.g., 6-cm 50% glandular breast, 28 kVp Mo-Mo spectrum). The thinner skin dimensions found in this study suggest that the current D gN values used for mammographic dosimetry lead to a slight underestimate in glandular dose
International Nuclear Information System (INIS)
Selsky, C.A.
1978-01-01
The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)
International Nuclear Information System (INIS)
1989-01-01
The recommendations are applicable to the determination of surface contaminations of the skin and to the estimation of the expected radiation exposure of the skin of contaminated persons. According to the present recommendations, the radiation exposure can only be estimated for the intact and healthy skin
Evaluation of pH of bathing soaps and shampoos for skin and hair care
Directory of Open Access Journals (Sweden)
Jose Tarun
2014-01-01
Full Text Available Background: Normal healthy skin has potential of hydrogen (pH range of 5.4-5.9 and a normal bacterial flora. Use of soap with high pH causes an increase in skin pH, which in turn causes an increase in dehydrative effect, irritability and alteration in bacterial flora. The majority of soaps and shampoos available in the market do not disclose their pH. Aims and Objectives: The aim of this study was to assess the pH of different brands of bathing soaps and shampoos available in the market. Materials and Methods: The samples of soaps and shampoos were collected from shops in the locality. The samples of different brands are coded before the analysis of the pH. Solution of each sample was made and pH was measured using pH meter. Results: Majority of the soaps have a pH within the range of 9-10. Majority of the shampoos have a pH within the range of 6-7. Conclusions: The soaps and shampoos commonly used by the population at large have a pH outside the range of normal skin and hair pH values. Therefore, it is hoped that before recommending soap to patient especially those who have sensitive and acne prone skin, due consideration is given to the pH factor and also that manufacturers will give a thought to pH of soaps and shampoos manufactured by them, so that their products will be more skin and hair friendly.
... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...
Beccarelli, Lori M; Scherr, Rachel E; Dharmar, Madan; Ermakov, Igor V; Gellermann, Werner; Jahns, Lisa; Linnell, Jessica D; Keen, Carl L; Steinberg, Francene M; Young, Heather M; Zidenberg-Cherr, Sheri
2017-01-01
To determine whether fourth-grade students participating in the Shaping Healthy Choices Program (SHCP), a school-based nutrition intervention, would change vegetable and carotenoid intake measured by skin carotenoids and dietary intake. Single-group pretest-posttest with a self-selected, convenience sample of students (n = 30) participating in the SHCP, which lasted 1 academic year (9 months). Dietary intake of vegetables and carotenoids as measured by Block food frequency questionnaire and skin carotenoids as measured by Raman spectroscopy were collected at the school preintervention and postintervention. Reported carotenoid intake decreased by 1.5 mg (P = .05) and skin carotenoids decreased by 2,247.9 RRS intensity units (P = .04). Change in reported intake correlated with change in skin carotenoids (r = .43; P = .02). The reported decrease in vegetable and carotenoid intake was unanticipated; nevertheless, the RRS measurements confirmed this. RRS data can help evaluate changes in fruit and vegetable intake. Copyright © 2016 Society for Nutrition Education and Behavior. All rights reserved.
PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION
Directory of Open Access Journals (Sweden)
Anjanappa
2015-01-01
Full Text Available BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganisms on the skin surface and to reduce the resident flora to a low level. Povidone iodine (I odophors and chlorhexidine are most often used antiseptics for pre - operative skin preparation. OBJECTIVES : To evaluate the efficacy of povidone iodine alone and in combination with antiseptic agent containing alcoholic chlorhexidine in preoperative skin p reparation by taking swab culture. (2 To compare the rate of postoperative wound infection in both the groups. METHODS: One hundred patients (fifty in each group undergoing clean elective surgery with no focus of infection on the body were included in th e study. The pre - operative skin preparation in each group is done with the respective antiseptic regimen. In both the groups after application of antiseptics , sterile saline swab culture was taken immediately from site of incision. In cases which showed gr owth of organisms , the bacteria isolated were identified by their morphological and cultural characteristics. Grams staining , coagulase test and antibiotic sensitivity test were done wherever necessary and difference in colonization rates was determined as a measure of efficacy of antiseptic regimen. RESULTS: The results of the study showed that when compared to povidone iodine alone , using a combination of povidone iodine and alcoholic solution of chlorhexidine , the colonization rates of the site of incisi on were reduced significantly. As for the rate of post - operative wound infection , it is also proven that wound infections are also
UVB 311 nm tolerance of vitiligo skin increases with skin photo type
Caron-Schreinemachers, Anne-Lou D. B.; Kingswijk, Melanie M.; Bos, Jan D.; Westerhof, Wiete
2005-01-01
It is assumed that skin is protected against sunburn by melanin. In patients with vitiligo, there are white patches in the normal pigmented skin. We noticed that there is a difference in burning capacity of these white patches between people with different skin types. With UVB 311 nm lamps, we
About Skin-to-Skin Care (Kangaroo Care)
... Our Sponsors Ages & Stages Ages & Stages Ages and Stages Prenatal Baby (0-12 mos.) Toddler 1-3yrs. Preschool 3-5yrs Grade School 5-12yrs. Teen 12- ... the Word Shop AAP Find a Pediatrician Ages & Stages Prenatal Baby Bathing & Skin ... Teen Young Adult Healthy Children > Ages & Stages > ...
Plasma and skin vitamin E concentrations in canine atopic dermatitis.
Plevnik Kapun, Alja; Salobir, Janez; Levart, Alenka; Tavčar Kalcher, Gabrijela; Nemec Svete, Alenka; Kotnik, Tina
2013-01-01
Altered homeostasis of vitamin E has been demonstrated in human atopic dermatitis. Data on plasma and skin vitamin E concentrations in canine atopic dermatitis (CAD) are not available. To determine vitamin E concentrations in plasma and skin of atopic dogs. Vitamin E concentrations in plasma and full-thickness skin biopsies of 15 atopic dogs were related to CAD extent and severity index (CADESI-03) scores and compared to the equivalent concentrations in 17 healthy dogs. Statistically significant differences of measured parameters between the two groups were determined by the nonparametric Mann Whitney U test and correlations between CADESI-03 scores and vitamin E concentrations were evaluated by the Spearman rank test. A value of P vitamin E were significantly lower in atopic dogs than in healthy dogs, with median values of 29.8 and 52.9 μmol/L, respectively. Skin vitamin E values did not differ significantly between patients and healthy controls. The median concentration of skin vitamin E in atopic dogs was higher than that in healthy dogs. No significant correlations were found between CADESI-03 score and plasma vitamin E or skin vitamin E concentrations. Significantly lower plasma vitamin E concentrations in atopic dogs than in healthy controls indicate altered homeostasis of vitamin E in CAD. Further investigation into vitamin E supplementation in CAD is warranted.
O'Connor, Akira R.; Moulin, Christopher J. A.
2006-01-01
We report the case of a 25-year-old healthy, blind male, MT, who experiences normal patterns of deja vu. The optical pathway delay theory of deja vu formation assumes that neuronal input from the optical pathways is necessary for the formation of the experience. Surprisingly, although the sensation of deja vu is known to be experienced by blind…
Mokhtari, Suzanne; Grace, Benjamin; Pak, Youngju; Reina, Astrid; Durand, Quinn; Yee, Jennifer K
2017-01-01
The current literature on determinants of behavior change in weight management lacks sufficient studies on type of motivation among children/adolescents, on perceived competence, and in relation to healthy eating. This study aimed to investigate type of motivation and levels of perceived competence for healthy diet and exercise, as well as general self efficacy among adolescents. We hypothesized that overweight/obese adolescents would demonstrate lower autonomous motivation and perceived competence regarding diet and exercise, and lower self-efficacy in general, and that the scores would be influenced by socioeconomic factors. Normal weight ( n = 40, body mass index Competence Scale (PCS) for healthy eating and exercise, and the General Self-Efficacy Scale (GSES). Composite scores for the three scales were compared between the two groups using the using the two-sample t-test (for normal data) or the Mann-Whitney U test (for non-parametric data). Relationships between the composite scores and patient characteristics were determined using Pearson or Spearman's correlations. The average age of the total cohort was 15.9 ± 1.9 years. 54% were female, and 82% identified as Latino/Hispanic. In comparison to normal weight subjects, overweight/obese adolescents exhibited higher scores for controlled motivation (mean ± standard deviation 28.3 ± 9.3 vs 18.1 ± 8.1) and higher perceived competence [median and 25-75% interquartile range 22.5 (19.0-26.0) vs 20.0 (15.5-25.0)] in relation to eating a healthy diet. These differences persisted after adjustment for age, sex, paternal education, and family income. Overweight/obese adolescents did not lack autonomous motivation but demonstrated higher controlled motivation and perceived competence for healthy eating in comparison to normal weight adolescents, independent of socioeconomic factors. In the clinical practice of weight management, providers should carefully assess adolescents for type of
International Nuclear Information System (INIS)
Cebulska-Wasilewska, A.; Dyga, W.; Budzanowska, E.
1999-01-01
The aim of this study was to compare variation in the individual susceptibility of various donors to the induction of the DNA damage by genotoxic agents and their cellular capabilities to repair induced damage. DNA damages induced by UV or X-rays in lymphocytes and cellular repair capability of healthy donors and persons bearing various categories of skin cancer cells were investigated. Fresh blood was collected by venipuncture from 35 individuals (including nine prior to skin cancer treatment). All cancer patients were nonsmoking males, however 42.3 % of them were former smokers. All healthy donors were also males, an average age was 38.6 y and among them 68% were recent or former smokers. Immediately after collecting samples, lymphocytes were isolated and stored at -70 o C for further studies in vitro. Previously cryopreserved lymphocytes were defrosted and viability of the cells was investigated. The single cell gel electrophoresis assay (SCGE), known as a Comet assay, was performed in defrozen lymphocytes to evaluate individual DNA damage levels presented in lymphocytes at the time of sample's collection. To compare individual susceptibility to the induction of DNA damage by UV and ionizing radiation, lymphocytes were exposed to dose of 6 J/m 2 of UV or 2 Gy of X-rays and DNA damages were detected again with an application of the Comet assay. Additionally, to study variation in the individuals cellular capability to repair damages induced, prior to the DNA damage analysis an incubation of cells exposed was also done in presence or absence of phytohemagglutinin (cell divisions processes starting agent). Results showed in untreated lymphocytes of skin cancer patients significantly higher than in the reference group levels of the DNA damages. Significantly different responses to UV and significantly lower capabilities to repair UV induced damage in skin cancer patients were observed. On the average, no differences between reference group and skin cancer patients
International Nuclear Information System (INIS)
Moehrle, G.
1975-01-01
A general survey of skin decontamination is given. The success of every decontamination treatments depends mainly on the speed, but also on the care, with which the action is taken. The best way to remove the skin contaminants is thorough washing under lukewarm running water with mild soap and a soft brush. This washing is to be repeated several times for a period of several minutes. If results are not satisfactory, light duty detergents and wetting agents available commercially may also be used. Some solutions which have proved useful are mentioned. The decontamination solutions are best used in the order given. When one has no satisfactory decontamination effect, the next one is to be used. If necessary, these agents must be used several times in the stated order as long as this does not involve too much strain for the skin. All the decontamination measures mentioned refer, of course, to intact healthy skin. After decontamination has been completed, the skin should be treated with a protective cream
International Nuclear Information System (INIS)
Selsky, C.A.
1976-01-01
The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants
Influence of low-energy laser radiation on normal skin and certain tumor tissues
Energy Technology Data Exchange (ETDEWEB)
Pletnev, S.D.; Karpenko, O.M.
For some years, the authors' Institute has studied the influence of various types of low-energy laser radiation on normal tissue and the growth of tumors. Radiation at 3 and 30 J/cm/sup 2/ causes an increase in biological activity of various cell elements, manifested as an increase in mitotic activity of the cells in the basal layer of the epidermis, conglomeration of chromatin in the cell nuclei and an increase in degranulation of fat cells in the process of their migration to the reticular layer. Also noted was an increase in content of fibroblastic and lymphohistocytic elements in the dermis, as well as an increase in collagenization of connective tissue. It was found that irradiation of the skin by helium-neon, cadmium-helium and nitrogen lasers before and after grafting of the cells of various tumors modifies the course of the tumor process. This effect is apparently related to the fact that systematic irradiation results in changes creating a favorable background for survival and proliferation of tumor cells in the skin tissue medium. The changes facilitate an increase in survival and growth of both pigmented and nonpigmented tumors. Low power radiation stimulates the activity of the cells or cell structures; medium power stimulates their activity; high power suppresses activity.
Three-Dimensional In Vitro Skin and Skin Cancer Models Based on Human Fibroblast-Derived Matrix.
Berning, Manuel; Prätzel-Wunder, Silke; Bickenbach, Jackie R; Boukamp, Petra
2015-09-01
Three-dimensional in vitro skin and skin cancer models help to dissect epidermal-dermal and tumor-stroma interactions. In the model presented here, normal human dermal fibroblasts isolated from adult skin self-assembled into dermal equivalents with their specific fibroblast-derived matrix (fdmDE) over 4 weeks. The fdmDE represented a complex human extracellular matrix that was stabilized by its own heterogeneous collagen fiber meshwork, largely resembling a human dermal in vivo architecture. Complemented with normal human epidermal keratinocytes, the skin equivalent (fdmSE) thereof favored the establishment of a well-stratified and differentiated epidermis and importantly allowed epidermal regeneration in vitro for at least 24 weeks. Moreover, the fdmDE could be used to study the features of cutaneous skin cancer. Complementing fdmDE with HaCaT cells in different stages of malignancy or tumor-derived cutaneous squamous cell carcinoma cell lines, the resulting skin cancer equivalents (fdmSCEs) recapitulated the respective degree of tumorigenicity. In addition, the fdmSCE invasion phenotypes correlated with their individual degree of tissue organization, disturbance in basement membrane organization, and presence of matrix metalloproteinases. Together, fdmDE-based models are well suited for long-term regeneration of normal human epidermis and, as they recapitulate tumor-specific growth, differentiation, and invasion profiles of cutaneous skin cancer cells, also provide an excellent human in vitro skin cancer model.
A Simple Device For Measuring Skin Friction
Directory of Open Access Journals (Sweden)
Gupta A.B
1995-01-01
Full Text Available A simple device for measuring skin friction in vivo is described. The frictional coefficient of normal Indian skin and the effect of hydration and application of talc and glycerol on the frictional coefficient and also the friction of ichthyotic skin have been determined with its help. The average value of friction of friction of normal India skin at forearm is found to be 0.41 +- 0.08, the hydration raises the value to 0.71 +- 0.11 and the effect of glycerol is also to school it up to 0.70+- 0.05, almost equal to that of water. The effect of talc however is opposite and its application lowers the friction to 0.21+-0.07. The mean coeff of friction for ichthyotic skin is found to be 0.21+- 0.0.5, which closely agrees with talc-treated normal skin. A good positive correlation (p<0.01 between friction and sebum level at skin site, with r = 0.64, has been observed.
First genomic survey of human skin fungal diversity
Fungal infections of the skin affect 29 million people in the United States. In the first study of human fungal skin diversity, National Institutes of Health researchers sequenced the DNA of fungi that thrive at different skin sites of healthy adults to d
The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun's ultraviolet rays, which can burn the skin, and ...
Directory of Open Access Journals (Sweden)
Bijo Elsy
2017-10-01
Full Text Available Introduction: Long-standing hyperglycemia in addition to many of its associated complications also hampers normal wound healing which may be further aggravated in the presence of infection and oxidative stress. Therefore, antioxidant supplementation appears to be strategically relevant for wound healing. This study is designed to explore the therapeutic potential of d-δ-tocotrienol rich fraction (d-δ-TRF on skin wound healing in both healthy and diabetic rats. Materials and Methods: Diabetes was induced through single subcutaneous injection of alloxan at the dose of 100 mg/kg at hip region. 24 albino rats were divided into four groups; healthy control, diabetic control, healthy treated and diabetic treated. d-δ-TRF was administered to treated groups (200 mg/kg, orally, daily for 3 weeks. Full thickness excisional skin wounds were. Wound area was studied by assessing the morphological, histomorphological and histological features at weekly intervals and biochemical analyses were performed at the end of 3rd week. Results: The findings of present study revealed that d-δ-TRF accelerated the skin wound healing by means of early regeneration of both epidermal and dermal components; enhancement of serum protein synthesis, improvement of antioxidant status, maintenance of glycemic condition and controlling serum creatinine levels in diabetic rats. Conclusion: It is concluded that d-δ-TRF has significant therapeutic potency on the healing of skin wounds in both healthy and diabetics.
X-ray microanalysis of psoriatic skin
International Nuclear Information System (INIS)
Grundin, T.G.; Roomans, G.M.; Forslind, B.; Lindberg, M.; Werner, Y.
1985-01-01
Electron probe x-ray microanalysis was used to study elemental distribution in uninvolved and involved skin from patients with psoriasis, and in skin from healthy controls. Significant differences were found between the involved and uninvolved psoriatic skin. In the involved skin, the concentrations of Mg, P, and K were higher in the stratum germinativum, spinosum, and granulosum, compared to the corresponding strata in uninvolved skin. Neither involved nor uninvolved psoriatic stratum germinativum differed markedly from nonpsoriatic control stratum germinativum. In uninvolved psoriatic skin only a lower level of K was noted. In comparison to uninvolved psoriatic skin, the elemental composition of the various strata of involved psoriatic skin shows a pattern typical for highly proliferative, nonneoplastic cells
Directory of Open Access Journals (Sweden)
Eva Maria Augusta Boeckh Haebisch
Full Text Available In order to find an explanation for individual reactions to transdermal glyceryl trinitrate (GTN we studied the skin temperature and hemodynamic reactions in 63 healthy persons. The data were obtained before and after the application of GTN and Glycerin (GL placebo patches, during one hour. The skin temperature was measured on both forearms, the local (left sided and systemic (right sided reaction on GTN was related to the skin fold and the calculated body fat content. The bilateral rise of skin temperature and its duration was higher and longer in obese than in lean persons mainly in obese women. The UV induced thermo and the later photothermoreaction (Erythema was reduced on the left forearm after the application of GTN and GL patches. The observed hemodynamic GTN effect confirmed known postural reactions, such as decreased arterial pressure (ΔmAP = -2.9%, increased heart rate (ΔHR = +7,4% and QTc prolongation (ΔQTc = +4,9% in upright position. An adverse drug effect with increased mean blood pressure (ΔmAP = +12% and increased heart rate (ΔHR = + 10.4% mainly in supine position was observed in 11 % of the participants, but only in men. Such a reaction was already described by Murell, 1879. Individual GTN effects were analyzed and related to habits and family history. In male smokers and in persons with hypertensive and diabetic close relatives, the hypotensive GTN effect was accentuated in supine position. In the upright position the group with hypertensives in the family presented a moderate hypotensive reaction without secondary tachycardia and the smokers presented only a slightly increased heart rate. Our observations suggest that individual reactions to transdermal glyceryl trinitrate (GTN with its active component nitric oxide (NO depends on physiological conditions, related to endogenous vasoactive substances, mainly the interaction with EDRF (the endogenous NO and the activity of the Renin-Angiotensin System.
Bisphenol A, phthalate metabolites and glucose homeostasis in healthy normal-weight children
Directory of Open Access Journals (Sweden)
Amalie Carlsson
2018-01-01
Full Text Available Introduction: Bisphenol A and several of the most commonly used phthalates have been associated with adverse metabolic health effects such as obesity and diabetes. Therefore, we analyzed these man-made chemicals in first morning urine samples from 107 healthy normal-weight Danish children and adolescents. Method: This was a cross-sectional study. Participants were recruited as part of the Copenhagen Puberty Study. The subjects were evaluated by an oral glucose tolerance test (OGTT, a dual-energy X-ray absorptiometry (DXA scan, direct oxygen uptake measurement during cycle ergometry and fasting blood samples. First morning urine was collected and phthalate metabolites and BPA were measured by liquid chromatography-tandem mass spectrometry (LC–MS/MS with prior enzymatic deconjugation. Individual chemical concentrations were divided into tertiles and analyzed in relation to biological outcome. Results: Children in the lowest tertile of urinary BPA had significantly higher peak insulin levels during OGTT (P = 0.01, lower insulin sensitivity index (P < 0.01, higher leptin (P = 0.03, triglyceride (P < 0.01 and total cholesterol levels (P = 0.04, lower aerobic fitness (P = 0.02 and a tendency toward higher fat mass index (P = 0.1 compared with children in the highest tertile for uBPA. No significant differences in anthropometrics, body composition or glucose metabolism were associated with any of the phthalate metabolites measured. Conclusion: This pilot study on healthy normal-weight children suggests an inverse association between BPA and insulin resistance. Our findings contrast other cross-sectional studies showing a positive association for BPA, which may be due to confounding or reverse causation because diet is an important source of both BPA exposure and obesity.
Energy Technology Data Exchange (ETDEWEB)
Netchareonsirisuk, Ponsawan [Chulalongkorn University, Program in Biotechnology, Faculty of Science (Thailand); Puthong, Songchan [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand); Dubas, Stephan [Chulalongkorn University, Petroleum and Petrochemical College (Thailand); Palaga, Tanapat [Chulalongkorn University, Department of Microbiology, Faculty of Science (Thailand); Komolpis, Kittinan, E-mail: kittinan.k@chula.ac.th [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand)
2016-11-15
Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5–15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO{sub 3} alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC{sub 50}), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84–90 %) than necrosis (8–12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.
Majewski, Sebastian; Pietrzak, Anna; Tworek, Damian; Szewczyk, Karolina; Kumor-Kisielewska, Anna; Kurmanowska, Zofia; Górski, Paweł; Zalewska-Janowska, Anna; Piotrowski, Wojciech Jerzy
2017-01-01
The systemic (extrapulmonary) effects and comorbidities of chronic obstructive pulmonary disease (COPD) contribute substantially to its burden. The supposed link between COPD and its systemic effects on distal organs could be due to the low-grade systemic inflammation. The aim of this study was to investigate whether the systemic inflammation may influence the skin condition in COPD patients. Forty patients with confirmed diagnosis of COPD and a control group consisting of 30 healthy smokers and 20 healthy never-smokers were studied. Transepidermal water loss, stratum corneum hydration, skin sebum content, melanin index, erythema index, and skin temperature were measured with worldwide-acknowledged biophysical measuring methods at the volar forearm of all participants using a multifunctional skin physiology monitor. Biomarkers of systemic inflammation, including high-sensitivity C-reactive protein (hsCRP), interleukin-6 (IL-6), and tumor necrosis factor α (TNF-α), were measured in serum using commercially available enzyme-linked immunosorbent assays. There were significant differences between COPD patients and healthy never-smokers in skin temperature, melanin index, sebum content, and hydration level ( P skin measured. The mean levels of hsCRP and IL-6 in serum were significantly higher in COPD patients and healthy smokers in comparison with healthy never-smokers. There were significant correlations between skin temperature and serum hsCRP ( R =0.40; P =0.02) as well as skin temperature and serum IL-6 ( R =0.49; P =0.005) in smokers. Stratum corneum hydration correlated significantly with serum TNF-α ( R =0.37; P =0.01) in COPD patients. Differences noted in several skin biophysical properties and biomarkers of systemic inflammation between COPD patients, smokers, and healthy never-smokers may suggest a possible link between smoking-driven, low-grade systemic inflammation, and the overall skin condition.
International Nuclear Information System (INIS)
Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.
1987-01-01
The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation
Nickel deposited on the skin-visualization by DMG test.
Julander, Anneli; Skare, Lizbet; Vahter, Marie; Lidén, Carola
2011-03-01
Nickel is the most common cause of contact allergy and an important risk factor for hand eczema. Visualization techniques may be powerful in showing exposures. The dimethylglyoxime (DMG) test might be used to establish skin exposure to nickel. To develop and evaluate methods for visualization of nickel on the skin by the DMG test and hand imprints. Nickel solutions at different concentrations were applied in duplicate on the hands in healthy subjects (n = 5). The DMG test and acid wipe sampling for quantification were then performed. Hand imprints were taken after manipulation of nickel-releasing tools (n = 1), and in workers performing their normal tasks (n = 7). The imprints were developed by the DMG test. The DMG test on hands gave positive results in all subjects. The lowest concentration giving rise to a colour change was set to 0.13 µg/cm(2) for DMG testing on skin. DMG test-developed imprints worked well except when hands were heavily contaminated by other particles/dust. The DMG test may be used as a simple and powerful tool for visualization of nickel on skin. DMG test-developed hand imprints may, in the future, be used for semi-quantitative or quantitative exposure assessment. © 2011 John Wiley & Sons A/S.
Shiratsuchi, Eri; Nakaba, Misako; Yamada, Michio
2016-03-30
Recent studies have shown that certain peptides significantly improve skin conditions, such as skin elasticity and the moisture content of the skin of healthy woman. This study aimed to investigate the effects of elastin hydrolysate on human skin. Proliferation and elastin synthesis were evaluated in human skin fibroblasts exposed to elastin hydrolysate and proryl-glycine (Pro-Gly), which is present in human blood after elastin hydrolysate ingestion. We also performed an ingestion test with elastin hydrolysate in humans and evaluated skin condition. Elastin hydrolysate and Pro-Gly enhanced the proliferation of fibroblasts and elastin synthesis. Maximal proliferation response was observed at 25 ng mL(-1) Pro-Gly. Ingestion of elastin hydrolysate improved skin condition, such as elasticity, number of wrinkles, and blood flow. Elasticity improved by 4% in the elastin hydrolysate group compared with 2% in the placebo group. Therefore, elastin hydrolysate activates human skin fibroblasts and has beneficial effects on skin conditions. © 2015 Society of Chemical Industry.
Armour-Burton, Teri; Fields, Willa; Outlaw, Lanie; Deleon, Elvira
2013-06-01
Hospital-acquired pressure ulcers are serious clinical complications that can lead to increased length of stay, pain, infection, and, potentially, death. The surgical progressive care unit at Sharp Grossmont Hospital, San Diego, California, developed the multidisciplinary Healthy Skin Project to decrease the prevalence of hospital-acquired pressure ulcers. The previous treatment plan was reviewed and modified according to current evidence-based practice. The project consisted of 3 components: creation of a position for a unit-based wound liaison nurse, staff education, and involvement of the nursing assistants. The wound liaison nurse developed and conducted bimonthly skin audits, which revealed inconsistencies in clinical practice and documentation. Education for the staff was accomplished via a self-learning module, case presentations, and 1-on-1 training. In addition, a pressure ulcer algorithm tool was developed to demonstrate step-by-step wound management and documentation. From Spring 2003 through Summer 2006, the prevalence of hospital-acquired pressure ulcers ranged from 0.0% to 18.92%, with a mean of 4.85%. After implementation of the project, the prevalence decreased to 0.0% for 17 of 20 quarters, through 2011. Prevention and a multidisciplinary approach are effective in reducing the occurrence of hospital-acquired pressure ulcers.
Fujita, Keishi; Yamamoto, Tetsuya; Kamezaki, Takao; Matsumura, Akira
2010-01-01
Cold sensation and numbness have been reported as post-stroke sensory sequelae attributable to distal axonopathy, which is caused by chronic ischemia of diseased limbs resulting from dysfunction of vasomotor regulatory systems. Keishibukuryogan is a traditional herbal medicine used to treat symptoms of peripheral ischemia such as cold extremities. This study investigated clinical improvement and skin temperature in peripheral ischemia patients to determine the efficacy of keishibukuryogan in alleviating post-stroke cold sensation and numbness. Twenty-two stroke patients with cold sensation and/or numbness were enrolled in this study. Subjective cold sensation and numbness, evaluated using the visual analogue scale, were found in 21 and 31 limbs, respectively. The skin temperature of diseased and healthy limbs was recorded. We observed all patients for 4 weeks and 17 patients for 8 weeks after administration of keishibukuryogan. The skin temperature of diseased limbs was significantly higher than baseline at 4 weeks and 8 weeks, whereas that of healthy limbs did not change significantly. Cold sensation and numbness were significantly improved at 4 weeks and 8 weeks compared to baseline. Keishibukuryogan administration resulted in warming of diseased limbs and improved cold sensation and numbness, probably by increasing peripheral blood flow.
Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue
International Nuclear Information System (INIS)
Woodward, Ruth M; Cole, Bryan E; Wallace, Vincent P; Pye, Richard J; Arnone, Donald D; Linfield, Edmund H; Pepper, Michael
2002-01-01
We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo
Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.
2013-01-01
Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445
The Microbiome in Skin Health and Disease
Indian Academy of Sciences (India)
Souvik Mukherjee
Differential Skin Microbiome profile in Caesarean babies is associated with risk of immune/metabolic .... Indicator. Genus. Cheek Sebum. (μg/cm2) p-value. Forehead Hydration. [Age adjusted] (a.u.) p-value .... Key Inferences. The Healthy Skin ...
Chen, Defu; Ren, Jie; Wang, Ying; Gu, Ying
2014-11-01
Vascular-targeted photodynamic therapy (V-PDT) is known to be an effective therapeutic modality for the treatment of port wine stains (PWS). Monitoring the PWS microvascular response to the V-PDT is crucial for improving the effectiveness of PWS treatment. The objective of this study was to use laser Doppler technique to directly assess the skin perfusion in PWS before and during V-PDT. In this study, 30 patients with PWS were treated with V-PDT. A commercially laser Doppler line scanner (LDLS) was used to record the skin perfusion of PWS immediately before; and at 1, 3, 5, 7, 10, 15 and 20 minutes during V-PDT treatment. Our results showed that there was substantial inter- and intra-patient perfusion heterogeneity in PWS lesion. Before V-PDT, the comparison of skin perfusion in PWS and contralateral healthy control normal skin indicated that PWS skin perfusion could be larger than, or occasionally equivalent to, that of control normal skin. During V-PDT, the skin perfusion in PWS significantly increased after the initiation of V-PDT treatment, then reached a peak within 10 minutes, followed by a slowly decrease to a relatively lower level. Furthermore, the time for reaching peak and the subsequent magnitude of decrease in skin perfusion varied with different patients, as well as different PWS lesion locations. In conclusion, the LDLS system is capable of assessing skin perfusion changes in PWS during V-PDT, and has potential for elucidating the mechanisms of PWS microvascular response to V-PDT.
Menstrual cycle and skin reactivity
DEFF Research Database (Denmark)
Agner, T; Damm, P; Skouby, S O
1991-01-01
The hypothesis was tested that a cyclic variation exists in skin reactivity to irritant stimuli. Twenty-nine healthy women with regular menstrual cycles were challenged with sodium lauryl sulfate as an irritant patch test at day 1 and at days 9 through 11 of the menstrual cycle. The skin response...... to the applied irritant stimulus was evaluated by visual scoring and also quantified by measurements of transepidermal water loss, edema formation, and blood flow in the skin. The skin response to challenge with sodium lauryl sulfate was found to be significantly stronger at day 1 than at days 9 through 11...
Matching the skin barrier to the skin type.
Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia
Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.
In vivo skin penetration of macromolecules in irritant contact dermatitis.
Abdel-Mottaleb, Mona M A; Lamprecht, Alf
2016-12-30
Recently, a selective preferential accumulation of polymeric nanoparticles (in the size range around 100nm) has been observed in the follicular system of dermatitis skin. The present investigation aimed at clearly investigating the effect of irritant contact dermatitis on the barrier permeability for colloidal systems below this size range, namely quantum dots and hydrophilic macromolecules. Irritant dermatitis was induced in mice and the penetrability of quantum dots (5nm) and hydrophilic dextran molecules has been tracked in both healthy and inflamed skin using confocal laser scanning microscopy. The selective accumulation of the quantum dots was clearly observed in inflamed skin while hydrophilic dextran behaved similarly in both healthy and inflamed skin. The therapeutic potential for the transdermal delivery of peptide drugs through inflamed skin has been also tested in rats. Results revealed that the transdermal permeation of insulin and calcitonin was not significantly enhanced in dermatitis compared to healthy skin. On the other side, permeation through stripped skin was significantly higher. However, the effect was limited and shorter compared to the SC injection where t min was 0.5h and 2h with a 70% and 46% reduction in blood glucose levels for the stripped skin and the SC injection respectively. Similarly, t min was 4h and 8h with area under the curve of 161±65% and 350±97% for the stripped skin and the SC injection respectively. In conclusion, the changes in skin permeability accompanied with skin inflammation did not affect its permeability to peptide drugs. Our findings also underline that experiments with the tape stripped skin model as a surrogate for inflamed skin can risk misleading conclusions due to significant difference of skin permeability between the tape stripped skin and inflamed skin. Copyright © 2016 Elsevier B.V. All rights reserved.
Dietary water affects human skin hydration and biomechanics.
Palma, Lídia; Marques, Liliana Tavares; Bujan, Julia; Rodrigues, Luís Monteiro
2015-01-01
It is generally assumed that dietary water might be beneficial for the health, especially in dermatological (age preventing) terms. The present study was designed to quantify the impact of dietary water on major indicators of skin physiology. A total of 49 healthy females (mean 24.5±4.3 years) were selected and characterized in terms of their dietary daily habits, especially focused in water consumption, by a Food Frequency Questionnaire. This allowed two groups to be set - Group 1 consuming less than 3,200 mL/day (n=38), and Group 2 consuming more than 3,200 mL/day (n=11). Approximately 2 L of water were added to the daily diet of Group 2 individuals for 1 month to quantify the impact of this surplus in their skin physiology. Measurements involving epidermal superficial and deep hydration, transepidermal water loss, and several biomechanical descriptors were taken at day 0 (T0), 15 (T1), and 30 (T2) in several anatomical sites (face, upper limb, and leg). This stress test (2 L/day for 30 days) significantly modified superficial and deep skin hydration, especially in Group 1. The same impact was registered with the most relevant biomechanical descriptors. Thus, in this study, it is clear that higher water inputs in regular diet might positively impact normal skin physiology, in particular in those individuals with lower daily water consumptions.
Histopathology of normal skin and melanomas after nanosecond pulsed electric field treatment
Chen, Xinhua; Swanson, R. James; Kolb, Juergen F.; Nuccitelli, Richard; Schoenbach, Karl H.
2011-01-01
Nanosecond pulsed electric fields (nsPEFs) can affect the intracellular structures of cells in vitro. This study shows the direct effects of nsPEFs on tumor growth, tumor volume, and histological characteristics of normal skin and B16-F10 melanoma in SKH-1 mice. A melanoma model was set up by injecting B16-F10 into female SKH-1 mice. After a 100-pulse treatment with an nsPEF (40-kV/cm field strength; 300-ns duration; 30-ns rise time; 2-Hz repetition rate), tumor growth and histology were studied using transillumination, light microscopy with hematoxylin and eosin stain and transmission electron microscopy. Melanin and iron within the melanoma tumor were also detected with specific stains. After nsPEF treatment, tumor development was inhibited with decreased volumes post-nsPEF treatment compared with control tumors (Pelectric fields surrounding the needle electrodes. PMID:19730404
Nakatsuji, Teruaki; Chen, Tiffany H.; Narala, Saisindhu; Chun, Kimberly A.; Two, Aimee M.; Yun, Tong; Shafiq, Faiza; Kotol, Paul F.; Bouslimani, Amina; Melnik, Alexey V.; Latif, Haythem; Kim, Ji-Nu; Lockhart, Alexandre; Artis, Keli; David, Gloria; Taylor, Patricia; Streib, Joanne; Dorrestein, Pieter C.; Grier, Alex; Gill, Steven R.; Zengler, Karsten; Hata, Tissa R.; Leung, Donald Y. M.; Gallo, Richard L.
2017-01-01
The microbiome can promote or disrupt human health by influencing both adaptive and innate immune functions. We tested whether bacteria that normally reside on human skin participate in host defense by killing Staphylococcus aureus, a pathogen commonly found in patients with atopic dermatitis (AD) and an important factor that exacerbates this disease. High-throughput screening for antimicrobial activity against S.aureus was performed on isolates of coagulase-negative Staphylococcus (CoNS) collected from the skin of healthy and AD subjects. CoNS strains with antimicrobial activity were common on the normal population but rare on AD subjects. A low frequency of strains with antimicrobial activity correlated with colonization by S.aureus. The antimicrobial activity was identified as previously unknown antimicrobial peptides (AMPs) produced by CoNS species including Staphylococcus epidermidis and Staphylococcus hominis. These AMPs were strain-specific, highly potent, selectively killed S.aureus, and synergized with the human AMP LL-37. Application of these CoNS strains to mice confirmed their defense function in vivo relative to application of nonactive strains. Strikingly, reintroduction of antimicrobial CoNS strains to human subjects with AD decreased colonization by S.aureus. These findings show how commensal skin bacteria protect against pathogens and demonstrate how dysbiosis of the skin microbiome can lead to disease. PMID:28228596
Psychoneuroimmunology and the Skin.
Honeyman, Juan F
2016-08-23
The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.
Reproducibility of the heat/capsaicin skin sensitization model in healthy volunteers
Directory of Open Access Journals (Sweden)
Cavallone LF
2013-11-01
Full Text Available Laura F Cavallone,1 Karen Frey,1 Michael C Montana,1 Jeremy Joyal,1 Karen J Regina,1 Karin L Petersen,2 Robert W Gereau IV11Department of Anesthesiology, Washington University in St Louis, School of Medicine, St Louis, MO, USA; 2California Pacific Medical Center Research Institute, San Francisco, CA, USAIntroduction: Heat/capsaicin skin sensitization is a well-characterized human experimental model to induce hyperalgesia and allodynia. Using this model, gabapentin, among other drugs, was shown to significantly reduce cutaneous hyperalgesia compared to placebo. Since the larger thermal probes used in the original studies to produce heat sensitization are now commercially unavailable, we decided to assess whether previous findings could be replicated with a currently available smaller probe (heated area 9 cm2 versus 12.5–15.7 cm2.Study design and methods: After Institutional Review Board approval, 15 adult healthy volunteers participated in two study sessions, scheduled 1 week apart (Part A. In both sessions, subjects were exposed to the heat/capsaicin cutaneous sensitization model. Areas of hypersensitivity to brush stroke and von Frey (VF filament stimulation were measured at baseline and after rekindling of skin sensitization. Another group of 15 volunteers was exposed to an identical schedule and set of sensitization procedures, but, in each session, received either gabapentin or placebo (Part B.Results: Unlike previous reports, a similar reduction of areas of hyperalgesia was observed in all groups/sessions. Fading of areas of hyperalgesia over time was observed in Part A. In Part B, there was no difference in area reduction after gabapentin compared to placebo.Conclusion: When using smaller thermal probes than originally proposed, modifications of other parameters of sensitization and/or rekindling process may be needed to allow the heat/capsaicin sensitization protocol to be used as initially intended. Standardization and validation of
Roper, James A; Williamson, Rosalind C; Bally, Blandine; Cowell, Christopher A M; Brooks, Rebecca; Stephens, Phil; Harrison, Andrew J; Bass, Mark D
2015-11-01
Chronic skin-healing defects are one of the leading challenges to lifelong well-being, affecting 2-5% of populations. Chronic wound formation is linked to age and diabetes and frequently leads to major limb amputation. Here we identify a strategy to reverse fibroblast senescence and improve healing rates. In healthy skin, fibronectin activates Rac1 in fibroblasts, causing migration into the wound bed, and driving wound contraction. We discover that mechanical stimulation of the skin with ultrasound can overturn healing defects by activating a calcium/CamKinaseII/Tiam1/Rac1 pathway that substitutes for fibronectin-dependent signaling and promotes fibroblast migration. Treatment of diabetic and aged mice recruits fibroblasts to the wound bed and reduces healing times by 30%, restoring healing rates to those observed in young, healthy animals. Ultrasound treatment is equally effective in rescuing the healing defects of animals lacking fibronectin receptors, and can be blocked by pharmacological inhibition of the CamKinaseII pathway. Finally, we discover that the migration defects of fibroblasts from human venous leg ulcer patients can be reversed by ultrasound, demonstrating that the approach is applicable to human chronic samples. By demonstrating that this alternative Rac1 pathway can substitute for that normally operating in the skin, we identify future opportunities for management of chronic wounds.
Structure, function and diversity of the healthy human microbiome.
2012-06-13
Studies of the human microbiome have revealed that even healthy individuals differ remarkably in the microbes that occupy habitats such as the gut, skin and vagina. Much of this diversity remains unexplained, although diet, environment, host genetics and early microbial exposure have all been implicated. Accordingly, to characterize the ecology of human-associated microbial communities, the Human Microbiome Project has analysed the largest cohort and set of distinct, clinically relevant body habitats so far. We found the diversity and abundance of each habitat's signature microbes to vary widely even among healthy subjects, with strong niche specialization both within and among individuals. The project encountered an estimated 81-99% of the genera, enzyme families and community configurations occupied by the healthy Western microbiome. Metagenomic carriage of metabolic pathways was stable among individuals despite variation in community structure, and ethnic/racial background proved to be one of the strongest associations of both pathways and microbes with clinical metadata. These results thus delineate the range of structural and functional configurations normal in the microbial communities of a healthy population, enabling future characterization of the epidemiology, ecology and translational applications of the human microbiome.
Histological Study on the Skin of Japanese Flounder Paralichthys olivaceus
Institute of Scientific and Technical Information of China (English)
ZHU Jie; ZHANG Xiumei; GAO Tianxiang
2005-01-01
Histological development of Japanese flounder Paralichthys olivaceus larval skin and ultrastructural difference of skin between reared normal and malpigmented Japanese flounder were studied with light microscopy (LM) and transmission electron microscopy (TEM). The results show that the skin develops slowly before the metamorphosis, while at the onset of metamorphosis, the skin develops quickly and becomes complete in structure till about 50 d after being hatched. Ultrastructural observation on the normal and malpigmented skins shows that the iridophore and melanophore are adjacent to each other. Profile and structure of the two kinds of pigment cells are more complete in the skin of normal ocular side than in the skin of pigmented blind side. The ultrastructure of typical chloride cell was observed in the skin of Japanese flounder larvae for the first time.
Meason-Smith, Courtney; Diesel, Alison; Patterson, Adam P; Older, Caitlin E; Johnson, Timothy J; Mansell, Joanne M; Suchodolski, Jan S; Rodrigues Hoffmann, Aline
2017-02-01
Next generation sequencing (NGS) studies have demonstrated a diverse skin-associated microbiota and microbial dysbiosis associated with atopic dermatitis in people and in dogs. The skin of cats has yet to be investigated using NGS techniques. We hypothesized that the fungal microbiota of healthy feline skin would be similar to that of dogs, with a predominance of environmental fungi, and that fungal dysbiosis would be present on the skin of allergic cats. Eleven healthy cats and nine cats diagnosed with one or more cutaneous hypersensitivity disorders, including flea bite, food-induced and nonflea nonfood-induced hypersensitivity. Healthy cats were sampled at twelve body sites and allergic cats at six sites. DNA was isolated and Illumina sequencing was performed targeting the internal transcribed spacer region of fungi. Sequences were processed using the bioinformatics software QIIME. The most abundant fungal sequences from the skin of all cats were classified as Cladosporium and Alternaria. The mucosal sites, including nostril, conjunctiva and reproductive tracts, had the fewest number of fungi, whereas the pre-aural space had the most. Allergic feline skin had significantly greater amounts of Agaricomycetes and Sordariomycetes, and significantly less Epicoccum compared to healthy feline skin. The skin of healthy cats appears to have a more diverse fungal microbiota compared to previous studies, and a fungal dysbiosis is noted in the skin of allergic cats. Future studies assessing the temporal stability of the skin microbiota in cats will be useful in determining whether the microbiota sequenced using NGS are colonizers or transient microbes. © 2016 ESVD and ACVD.
Optical coherence tomography for imaging of skin and skin diseases
DEFF Research Database (Denmark)
Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini
2009-01-01
Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studi...... technical solutions are being pursued to further improve the quality of the images and the data provided, and OCT is being integrated in multimodal imaging devices that would potentially be able to provide a quantum leap to the imaging of skin in vivo....
Skin Blood Perfusion and Oxygenation Colour Affect Perceived Human Health
Stephen, Ian D.; Coetzee, Vinet; Law Smith, Miriam; Perrett, David I.
2009-01-01
Skin blood perfusion and oxygenation depends upon cardiovascular, hormonal and circulatory health in humans and provides socio-sexual signals of underlying physiology, dominance and reproductive status in some primates. We allowed participants to manipulate colour calibrated facial photographs along empirically-measured oxygenated and deoxygenated blood colour axes both separately and simultaneously, to optimise healthy appearance. Participants increased skin blood colour, particularly oxygenated, above basal levels to optimise healthy appearance. We show, therefore, that skin blood perfusion and oxygenation influence perceived health in a way that may be important to mate choice. PMID:19337378
Proteomic profiling reveals candidate markers for arsenic-induced skin keratosis.
Guo, Zhiling; Hu, Qin; Tian, Jijing; Yan, Li; Jing, Chuanyong; Xie, Heidi Qunhui; Bao, Wenjun; Rice, Robert H; Zhao, Bin; Jiang, Guibin
2016-11-01
Proteomics technology is an attractive biomarker candidate discovery tool that can be applied to study large sets of biological molecules. To identify novel biomarkers and molecular targets in arsenic-induced skin lesions, we have determined the protein profile of arsenic-affected human epidermal stratum corneum by shotgun proteomics. Samples of palm and foot sole from healthy subjects were analyzed, demonstrating similar protein patterns in palm and sole. Samples were collected from the palms of subjects with arsenic keratosis (lesional and adjacent non-lesional samples) and arsenic-exposed subjects without lesions (normal). Samples from non-exposed healthy individuals served as controls. We found that three proteins in arsenic-exposed lesional epidermis were consistently distinguishably expressed from the unaffected epidermis. One of these proteins, the cadherin-like transmembrane glycoprotein, desmoglein 1 (DSG1) was suppressed. Down-regulation of DSG1 may lead to reduced cell-cell adhesion, resulting in abnormal epidermal differentiation. The expression of keratin 6c (KRT6C) and fatty acid binding protein 5 (FABP5) were significantly increased. FABP5 is an intracellular lipid chaperone that plays an essential role in fatty acid metabolism in human skin. This raises a possibility that overexpression of FABP5 may affect the proliferation or differentiation of keratinocytes by altering lipid metabolism. KRT6C is a constituent of the cytoskeleton that maintains epidermal integrity and cohesion. Abnormal expression of KRT6C may affect its structural role in the epidermis. Our findings suggest an important approach for future studies of arsenic-mediated toxicity and skin cancer, where certain proteins may represent useful biomarkers of early diagnoses in high-risk populations and hopefully new treatment targets. Further studies are required to understand the biological role of these markers in skin pathogenesis from arsenic exposure. Copyright © 2016 Elsevier Ltd
Mochizuki, H; Tadaki, H; Takami, S; Muramatsu, R; Hagiwara, S; Mizuno, T; Arakawa, H
2009-05-01
Atopic dermatitis is a disease of skin barrier dysfunction and outside stimuli can cross the skin barrier. To examine a new method for evaluating the outside to inside skin transparency with a colorimeter and yellow dyes. In study 1, a total of 28 volunteer subjects (24 normal and four with atopic dermatitis) participated. After provocation with yellow dye, the skin colour of all the subjects was measured using a colorimeter. The skin transparency index was calculated by the changes of the skin colour to yellow. Other variables of skin function, including transepidermal water loss (TEWL) and stratum corneum hydration, were also measured. In study 2, the skin transparency index was evaluated for a cohort of 38 patients with atopic dermatitis, 27 subjects with dry skin and 29 healthy controls. In study 1, the measurement of skin colour (b*) using tartrazine showed good results. There was a significant relationship between the skin transparency index with tartrazine and the atopic dermatitis score (P = 0.014). No other measurements of skin function, including the TEWL, were correlated. In study 2, the skin transparency index score obtained with tartrazine in the patients with atopic dermatitis was significantly higher than that of the controls and those with dry skin (P colorimeter and food dye, is noninvasive, safe and reliable for the evaluation of out-in skin transparency and can demonstrate the characteristic dysfunction in the skin barrier in patients with atopic dermatitis.
High-normal levels of hs-CRP predict the development of non-alcoholic fatty liver in healthy men.
Directory of Open Access Journals (Sweden)
Jieun Lee
Full Text Available We performed a follow-up study to address whether high sensitivity C-reactive protein (hs-CRP levels within the normal range can predict the development of non-alcoholic fatty liver disease (NAFLD in healthy male subjects. Among15347 male workers between 30 and 59 years old who received annual health check-ups in 2002, a NAFLD-free cohort of 4,138 was followed through December 2009. Alcohol consumption was assessed with a questionnaire. At each visit, abdominal ultrasonography was performed to identify fatty liver disease. The COX proportional hazard model was used to evaluate the relationship between hs-CRP and incident NAFLD. During the follow-up period, 28.8% (1191 of 4138 of participants developed NAFLD. The hazard ratios of NAFLD were increased by hs-CRP categories within the normal range in the non-adjusted model and age-adjusted model. After adjusting for age, exercise, smoking, BMI, systolic BP, triglyceride, and fasting glucose, these incidences were only increased between the lowest and the highest hs-CRP categories. The risk for NAFLD increased as the hs-CRP level increased (p< 0.001. As the hs-CRP level increased within the healthy cohort, the risk of developing NAFLD increased. This trend remained true even if the hs-CRP level remained within the normal range. hs-CRP can be used as a predictor of NAFLD, as well as other obesity-associated diseases. Therefore, individuals with higher hs-CRP levels (even within the normal range may require appropriate follow-up and management to prevent NAFLD development.
Directory of Open Access Journals (Sweden)
Mir Misbahuddin
2013-03-01
Full Text Available Spirulina, a dietary supplement, improves the symptoms of arsenical palmer keratosis. To understand its mechanism of action, palm skin extracts of moderate palmer arsenical keratosis (n=10, arsenic exposed controls (n=10 and healthy volunteers (n=10 were collected before and after treatment with spirulina powder 10 g/day orally for 12 weeks. The mean (±SD amount of zinc in the palm skin of healthy volunteers was 13.1 ± 5.7 ng/cm2, which was not changed significantly in patients (11.3 ± 5.3 ng/cm2. The amount of vitamin E in healthy volunteers was 6.0 ± 0.3 ng/cm2 which was severely reduced in patients (3.5 ± 0.6 ng/cm2. The amount of linoleic acid was lowered in patient (26.7 ± 17.1 ng/cm2 which was statistically significant in comparison to healthy volunteers (p=0.029. After supplementation of spirulina, zinc level in the palm skin of arsenic exposed controls was increased but it was not statistically significant (p=0.068. The vitamin E and linoleic acid levels were not changed significantly in the skin of palm. In conclusion, arsenical keratosis showed significantly low levels of vitamin E and linoleic acid without any significant change in zinc level. After supplementation of spirulina, low levels of these three compounds were not returned towards the normal levels.
Chiang, Charles; Eichenfield, Lawrence F
2009-01-01
Standard recommendations for skin care for patients with atopic dermatitis stress the importance of skin hydration and the application of moisturizers. However, objective data to guide recommendations regarding the optimal practice methods of bathing and emollient application are scarce. This study quantified cutaneous hydration status after various combination bathing and moisturizing regimens. Four bathing/moisturizer regimens were evaluated in 10 subjects, five pediatric subjects with atopic dermatitis and five subjects with healthy skin. The regimens consisted of bathing alone without emollient application, bathing and immediate emollient application, bathing and delayed application, and emollient application alone. Each regimen was evaluated in all subjects, utilizing a crossover design. Skin hydration was assessed with standard capacitance measurements. In atopic dermatitis subjects, emollient alone yielded a significantly (p hydration over 90 minutes (206.2% baseline hydration) than bathing with immediate emollient (141.6%), bathing and delayed emollient (141%), and bathing alone (91.4%). The combination bathing and emollient application regimens demonstrated hydration values at 90 minutes not significantly greater than baseline. Atopic dermatitis subjects had a decreased mean hydration benefit compared with normal skin subjects. Bathing without moisturizer may compromise skin hydration. Bathing followed by moisturizer application provides modest hydration benefits, though less than that of simply applying moisturizer alone.
Biophysical effects of water and synthetic urine on skin.
Mayrovitz, H N; Sims, N
2001-01-01
Pressure ulcers often occur at sites subjected to pressure and wetness. Although skin wetness is a risk factor for pressure ulcers,the mechanisms and effects of wetness versus urine constituents on skin breakdown is unclear. The hypothesis that wetness reduces skin hardness and, thereby, increases vulnerability of underlying blood vessels to pressure-induced flow reductions was tested in this study. Pads saturated with water and with a water solution mixed with the main chemical constituents of urine (synthetic urine; s-urine) were applied to forearm skin of 10 healthy subjects for 5.5 hours. Skin hardness, blood flow change caused by 60 mm Hg of pressure, erythema, and temperature were compared among dry, water, and s-urine test sites. 10 healthy women. Research Center, Nova Southeastern University, Health Professions Division, Fort Lauderdale, FL. S-urine and water caused significant reductions in initial hardness and caused greater initial perfusion decreases during pressure load when compared with dry sites. Skin temperature and erythema were lower at wet sites when compared with dry sites. The findings of this study are consistent with the concept that sustained skin wetness increases vulnerability to pressure-induced blood flow reduction. The effect appears to be mainly dependent on wetness, but urine constituents may exacerbate the effect. In addition, wetness-related skin cooling may play a role. In the healthy subjects studied, the blood flow decrease was not sustained due to perfusion recovery under pressure. Skin wetness would likely have more sustained effects in patients with compromised recovery mechanisms. Measures to diminish skin exposure to wetness in these patients, whatever the wetness source, are an important consideration in a multifaceted strategy to reduce the risk of pressure ulcers.
Keep Your Skin Healthy: Protecting Your Outer Self
... other protective clothing, use sunscreen with a sun protection factor (SPF) of at least 30, and restrict your time in the sun during the late morning and early afternoon hours, when sunlight is strongest. Many skin researchers like Kong are studying the skin’s microbiome— ...
Shani, Michal; Vinker, Shlomo; Dinour, Dganit; Leiba, Merav; Twig, Gilad; Holtzman, Eliezer J; Leiba, Adi
2016-10-01
The risk associated with serum uric acid (SUA) levels within the normal range is unknown, especially among lean and apparently healthy adults. Evaluating whether high-normal SUA levels, 6.8 mg/dL and below, are associated with an increased diabetes risk, compared with low-normal SUA. This was a cohort study with 10 years of followup involving all clinics of the largest nationally distributed Health Maintenance Organization in Israel. Participants included 469,947 examinees, 40-70 years old at baseline, who had their SUA measured during 2002. We excluded examinees who had hyperuricemia (SUA > 6.8 mg/dL), impaired fasting glucose, overweight or obesity and chronic cardiovascular or renal disorders. The final cohort was composed of 30 302 participants. Participants were followed up to a new diagnosis of diabetes during the study period. Odds ratio of developing diabetes among participants with high-normal baseline SUA were compared with low-normal (2 ≤ uric acid lean women when compared with those with low-normal values.
Kikuchi, Kumiko; Masuda, Yuji; Yamashita, Toyonobu; Kawai, Eriko; Hirao, Tetsuji
2015-05-01
Heterogeneity with respect to skin color tone is one of the key factors in visual perception of facial attractiveness and age. However, there have been few studies on quantitative analyses of the color heterogeneity of facial skin. The purpose of this study was to develop image evaluation methods for skin color heterogeneity focusing on skin chromophores and then characterize ethnic differences and age-related changes. A facial imaging system equipped with an illumination unit and a high-resolution digital camera was used to develop image evaluation methods for skin color heterogeneity. First, melanin and/or hemoglobin images were obtained using pigment-specific image-processing techniques, which involved conversion from Commission Internationale de l'Eclairage XYZ color values to melanin and/or hemoglobin indexes as measures of their contents. Second, a spatial frequency analysis with threshold settings was applied to the individual images. Cheek skin images of 194 healthy Asian and Caucasian female subjects were acquired using the imaging system. Applying this methodology, the skin color heterogeneity of Asian and Caucasian faces was characterized. The proposed pigment-specific image-processing techniques allowed visual discrimination of skin redness from skin pigmentation. In the heterogeneity analyses of cheek skin color, age-related changes in melanin were clearly detected in Asian and Caucasian skin. Furthermore, it was found that the heterogeneity indexes of hemoglobin were significantly higher in Caucasian skin than in Asian skin. We have developed evaluation methods for skin color heterogeneity by image analyses based on the major chromophores, melanin and hemoglobin, with special reference to their size. This methodology focusing on skin color heterogeneity should be useful for better understanding of aging and ethnic differences. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Bisphenol A, phthalate metabolites and glucose homeostasis in healthy normal-weight children
DEFF Research Database (Denmark)
Carlsson, Amalie; Sørensen, Kaspar; Andersson, Anna-Maria
2018-01-01
. RESULTS: Children in the lowest tertile of urinary BPA had significantly higher peak insulin levels during OGTT (P = 0.01), lower insulin sensitivity index (P triglyceride (P ... toward higher fat mass index (P = 0.1) compared with children in the highest tertile for uBPA. No significant differences in anthropometrics, body composition or glucose metabolism were associated with any of the phthalate metabolites measured. CONCLUSION: This pilot study on healthy normal...... and adolescents. METHOD: This was a cross-sectional study. Participants were recruited as part of the Copenhagen Puberty Study. The subjects were evaluated by an oral glucose tolerance test (OGTT), a dual-energy X-ray absorptiometry (DXA) scan, direct oxygen uptake measurement during cycle ergometry and fasting...
Study of mast cell count in skin tags
Directory of Open Access Journals (Sweden)
Zaher Hesham
2007-01-01
Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.
Kocabay, Gonenc; Muraru, Denisa; Peluso, Diletta; Cucchini, Umberto; Mihaila, Sorina; Padayattil-Jose, Seena; Gentian, Denas; Iliceto, Sabino; Vinereanu, Dragos; Badano, Luigi P
2014-08-01
Two-dimensional speckle-tracking echocardiography is a novel tool to assess myocardial function. The purpose of this study was to evaluate left ventricular myocardial strain and rotation parameters by two-dimensional speckle-tracking echocardiography in a large group of healthy adults across a wide age range to establish their reference values and to assess the influence of age, sex, and hemodynamic factors. Transthoracic echocardiograms were acquired in 247 healthy volunteers (139 women, 44 years [standard deviation, 16 years old] (range, 18-80 years). We measured longitudinal, circumferential, and radial peak systolic strain values, and left ventricular rotation and twist. Average values of global longitudinal, radial, and circumferential strain were -21.5% (standard deviation, 2.0%), 40.1% (standard deviation, 11.8%) and -22.2% (standard deviation, 3.4%), respectively. Longitudinal strain was significantly more negative in women, whereas radial and circumferential strain and rotational parameters were similar in both sexes. Accordingly, lower limits of normality for the strain components were -16.9% in men and -18.5% in women for longitudinal strain, and -15.4% for circumferential and 24.6% for radial strain, irrespective of sex. Longitudinal strain values were more negative at the base than at apical segments. Mean rotational values were -6.9° (standard deviation, 3.5°) for the base, 13.0° (standard deviation, 6.5°) for apical rotation, and 20.0° (standard deviation, 7.3°) for net twist. We report the comprehensive assessment of normal myocardial deformation and rotational mechanics in a large cohort of healthy volunteers. We found that women have more negative longitudinal strain, accounting for their higher left ventricular ejection fraction. Availability of reference values for these parameters may foster their implementation in the clinical routine. Copyright © 2013 Sociedad Española de Cardiología. Published by Elsevier Espana. All rights reserved.
Skin Hydration Assessment through Modern Non-Invasive Bioengineering Technologies.
Constantin, Maria-Magdalena; Poenaru, Elena; Poenaru, Calin; Constantin, Traian
2014-03-01
Non-invasive bioengineering technologies continuously discovered and developed in recent decades provide a significant input to research development and remarkably contribute to the improvement of medical education and care to our patients. Assessing skin hydration by using the capacitance method for a group of patients with allergic contact dermatitis versus healthy subjects, before and after applying a moisturiser (assessing the immediate and long-term effectiveness of hydration). For both groups, but especially for the patients with dry skin, there was a clear improvement of hydration, statistically significant after applying the moisturiser. In the case of the patients with allergic contact dermatitis, hydration was at a maximum immediately after the first application, and then maintained an increased level after 7 and 28 days, respectively. In the healthy subjects, the increase in hydration was lower, but progressive. The moisturiser determined an increase in hydration for all age groups, but those who showed the most obvious effect were the young adults (18-29 years old) with an increase of 19.9%.The maintenance effect of hydration lasted for 28 days, while the improvement was important for allergic skin (17.1%) and significant for healthy skin (10.9%). The assessment of epidermal hydration performed by using the corneometer showed very good hydration of the stratum corneum for both groups studied, with immediate and long-term effect. This study also showed that the degree of skin hydration was inversely proportional with age. The corneometer is easy to use, efficient and widely utilised in international studies for measurements in healthy or pathological conditions, for quantitative assessment of the effectiveness of various preparations intended for application to the skin surface, under well-controlled and standardised conditions.
Directory of Open Access Journals (Sweden)
Xavier Deplanque
2016-10-01
Full Text Available Background: Low-density lipoprotein (LDL oxidation is a risk factor for atherosclerosis. Lycopene and tomato-based products have been described as potent inhibitors of LDL oxidation. Objectives: To evaluate the effect of a 2-week supplementation with a carotenoid-rich tomato extract (CRTE standardized for a 1:1 ratio of lycopene and phytosterols, on post-prandial LDL oxidation after a high-fat meal. Design: In a randomized, double-blind, parallel-groups, placebo-controlled study, 146 healthy normal weight individuals were randomly assigned to a daily dose of CRTE standardized for tomato phytonutrients or placebo during 2 weeks. Oxidized LDL (OxLDL, glucose, insulin, and triglyceride (TG responses were measured for 8 h after ingestion of a high-fat meal before and at the end of intervention. Results: Plasma lycopene, phytofluene, and phytoene were increased throughout the study period in the CRTE group compared to placebo. CRTE ingestion significantly improved changes in OxLDL response to high-fat meal compared to placebo after 2 weeks (p<0.0001. Changes observed in glucose, insulin, and TG responses were not statistically significant after 2 weeks of supplementation, although together they may suggest a trend of favorable effect on metabolic outcomes after a high-fat meal. Conclusions: Two-week supplementation with CRTE increased carotenoids levels in plasma and improved oxidized LDL response to a high-fat meal in healthy normal weight individuals.
Energy Technology Data Exchange (ETDEWEB)
Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)
2013-03-01
Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.
International Nuclear Information System (INIS)
Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi
2013-01-01
Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes
Nyqvist, Kerstin H; Rosenblad, Andreas; Volgsten, Helena; Funkquist, Eva-Lotta; Mattsson, Elisabet
2017-01-01
Skin-to-skin contact (SSC) is an important factor to consider in the care of late preterm infants (born between 34 0/7 and 36 6/7 completed weeks of gestation). The literature suggests that SSC between preterm infants and their mothers facilitates breastfeeding. However, more studies are needed to explore potential dose-response effects between SSC and breastfeeding as well as studies that explicitly investigate SSC by fathers among late preterm infants. The aim was to investigate the duration of healthy late preterm infants' SSC with the mother and father, respectively, during the first 48 h after birth and the associations with breastfeeding (exclusive/partial at discharged), clinical and demographic variables. This was an observational cohort study in which parents to healthy late preterm infants, born between 34 5/7 and 36 6/7 completed weeks of gestation, recorded duration of SSC provided by mother and father, respectively. Demographic and clinical variables were retrieved from the medical records and were used as predictors. Multiple linear regression analysis was used to assess the association between the predictors and the outcome, SSC (hours), separately for mothers and fathers. The mean (standard deviation [SD]) time per day spent with SSC with mothers ( n = 64) and fathers ( n = 64), was 14.7 (5.6) and 4.4 (3.3) hours during the first day (24 h) after birth and 9.2 (7.1) and 3.1 (3.3) hours during the second day (24 h), respectively. Regarding SSC with mothers, no variable was significantly associated with SSC during the first day, while the mean (95% confidence interval [CI]) time of SSC during the second day was 6.9 (1.4-12.4) hours shorter for each additional kg of birthweight ( p = 0.014). Concerning SSC with fathers, the mean (95% CI) time of SSC during the first day was 2.1 (0.4-3.7) hours longer for infants born at night ( p = 0.015), 1.7 (0.1-3.2) hours longer for boys ( p = 0.033), 3.2 (1.2-5.2) hours longer for infants born by
Stereological quantification of lymphocytes in skin biopsies from atopic dermatitis patients
DEFF Research Database (Denmark)
Ellingsen, A R; Sørensen, F B; Larsen, Jytte Overgaard
2001-01-01
with active eczema in 8 adults with AD and from clinically normal skin from 4 of the patients. Five persons without allergy or skin disease served as controls. The mean number of lymphocytes in 4-mm skin biopsies was 469,000 and 124,000 in active eczema and in clinically normal skin, respectively. Compared......Atopic dermatitis (AD) is histologically characterized by lymphocytic infiltration of the skin and quantitative assessment is required. This study introduces stereological techniques to quantify the number of lymphocytes in skin biopsies. Four-millimetre punch biopsies were taken from skin...... with controls, the number of lymphocytes in biopsies increased by a factor of 6.8 in active eczema and a factor of 1.8 in clinically normal skin. If 20% of skin is affected by eczema the total number of lymphocytes located in the affected skin can be estimated to 1.27 x 10(10). A patient with clinically...
Quantification of thermal damage in skin tissue
Institute of Scientific and Technical Information of China (English)
徐峰; 文婷; 卢天健; Seffen; Keith
2008-01-01
Skin thermal damage or skin burns are the most commonly encountered type of trauma in civilian and military communities. Besides, advances in laser, microwave and similar technologies have led to recent developments of thermal treatments for disease and damage involving skin tissue, where the objective is to induce thermal damage precisely within targeted tissue structures but without affecting the surrounding, healthy tissue. Further, extended pain sensation induced by thermal damage has also brought great...
Gimblet, Ciara; Meisel, Jacquelyn S; Loesche, Michael A; Cole, Stephen D; Horwinski, Joseph; Novais, Fernanda O; Misic, Ana M; Bradley, Charles W; Beiting, Daniel P; Rankin, Shelley C; Carvalho, Lucas P; Carvalho, Edgar M; Scott, Phillip; Grice, Elizabeth A
2017-07-12
Skin microbiota can impact allergic and autoimmune responses, wound healing, and anti-microbial defense. We investigated the role of skin microbiota in cutaneous leishmaniasis and found that human patients infected with Leishmania braziliensis develop dysbiotic skin microbiota, characterized by increases in the abundance of Staphylococcus and/or Streptococcus. Mice infected with L. major exhibit similar changes depending upon disease severity. Importantly, this dysbiosis is not limited to the lesion site, but is transmissible to normal skin distant from the infection site and to skin from co-housed naive mice. This observation allowed us to test whether a pre-existing dysbiotic skin microbiota influences disease, and we found that challenging dysbiotic naive mice with L. major or testing for contact hypersensitivity results in exacerbated skin inflammatory responses. These findings demonstrate that a dysbiotic skin microbiota is not only a consequence of tissue stress, but also enhances inflammation, which has implications for many inflammatory cutaneous diseases. Copyright © 2017 Elsevier Inc. All rights reserved.
Figueiredo, Maria Marta; Moura, Eliane Perlatto; Costa, Miriam Maria; Ribeiro, Vitor Marcio; Michalick, Marilene Suzan; Tafuri, Washington Luiz; Tafuri, Wagner Luiz
2010-07-01
Although 90% of clinical cases of American visceral leishmaniasis (AVL) occur in the northeastern region of Brazil, the incidence of cases in recent years has increased in southeastern states such as Minas Gerais (MG), where the disease has been reported in several cities, including Belo Horizonte, the state capital. Some studies have shown a strong correlation between the incidence of AVL and canine visceral leishmaniasis (CVL) in Belo Horizonte. A study of 108 dogs with parasite Leishmania chagasi detected by immuno-histochemistry in healthy ear skin was obtained from two distinct geographical areas: 55 from a metropolitan area of the municipality (Santa Luzia, MG) and 53 dogs from a central area of Belo Horizonte. In parallel, a group of 10 beagles were experimentally infected with L. chagasi. Considering the clinical aspects of all naturally infected dogs, symptomatic dogs were more frequent than asymptomatic ones, especially animals from the metropolitan area compared with the central area (79.6% and 20.3%, respectively). A chronic exudate was observed in the ear of 51 out of 55 dogs naturally infected from the metropolitan area (92.7%) and 45 out of 53 dogs naturally infected from the central area (84.9%). Importantly, asymptomatic dogs from the central area harbor more parasites in the skin than the asymptomatic ones from the metropolitan area. In addition, a profound difference was noted in the intensity of the inflammatory reaction and parasite load in the skin of experimental infected dogs.
DEFF Research Database (Denmark)
Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase
2011-01-01
An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...... blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high...... reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new...
Bacterial skin flora of diabetic patients in the Jos University Teaching ...
African Journals Online (AJOL)
Diabetics frequently are afflicted with bacterial skin infections because of the high circulating blood sugar. The frequent skin infections in these patients may be a result of change in normal skin flora. This study was carried out to find out the normal skin flora of these patients. Ninety four (50 study and 44 control) consecutive ...
Skin barrier homeostasis in atopic dermatitis: feedback regulation of kallikrein activity.
Directory of Open Access Journals (Sweden)
Reiko J Tanaka
Full Text Available Atopic dermatitis (AD is a widely spread cutaneous chronic disease characterised by sensitive reactions (eg. eczema to normally innocuous elements. Although relatively little is understood about its underlying mechanisms due to its complexity, skin barrier dysfunction has been recognised as a key factor in the development of AD. Skin barrier homeostasis requires tight control of the activity of proteases, called kallikreins (KLKs, whose activity is regulated by a complex network of protein interactions that remains poorly understood despite its pathological importance. Characteristic symptoms of AD include the outbreak of inflammation triggered by external (eg. mechanical and chemical stimulus and the persistence and aggravation of inflammation even if the initial stimulus disappears. These characteristic symptoms, together with some experimental data, suggest the presence of positive feedback regulation for KLK activity by inflammatory signals. We developed simple mathematical models for the KLK activation system to study the effects of feedback loops and carried out bifurcation analysis to investigate the model behaviours corresponding to inflammation caused by external stimulus. The model analysis confirmed that the hypothesised core model mechanisms capture the essence of inflammation outbreak by a defective skin barrier. Our models predicted the outbreaks of inflammation at weaker stimulus and its longer persistence in AD patients compared to healthy control. We also proposed a novel quantitative indicator for inflammation level by applying principal component analysis to microarray data. The model analysis reproduced qualitative AD characteristics revealed by this indicator. Our results strongly implicate the presence and importance of feedback mechanisms in KLK activity regulation. We further proposed future experiments that may provide informative data to enhance the system-level understanding on the regulatory mechanisms of skin barrier
Noxious heat and scratching decrease histamine-induced itch and skin blood flow.
Yosipovitch, Gil; Fast, Katharine; Bernhard, Jeffrey D
2005-12-01
The aim of this study was to assess the effect of thermal stimuli or distal scratching on skin blood flow and histamine-induced itch in healthy volunteers. Twenty-one healthy volunteers participated in the study. Baseline measurements of skin blood flow were obtained on the flexor aspect of the forearm. These measurements were compared with skin blood flow after various stimuli: heating the skin, cooling the skin, noxious cold 2 degrees C, noxious heat 49 degrees C, and scratching via a brush with controlled pressure. Afterwards histamine iontophoresis was performed and skin blood flow and itch intensity were measured immediately after the above-mentioned stimuli. Scratching reduced mean histamine-induced skin blood flow and itch intensity. Noxious heat pain increased basal skin blood flow but reduced histamine-induced maximal skin blood flow and itch intensity. Cold pain and cooling reduced itch intensity, but neither affected histamine-induced skin blood flow. Sub-noxious warming the skin did not affect the skin blood flow or itch intensity. These findings suggest that heat pain and scratching may inhibit itch through a neurogenic mechanism that also affects skin blood flow.
Quantification of thermal damage in skin tissue
Institute of Scientific and Technical Information of China (English)
Xu Feng; Wen Ting; Lu Tianjian; Seffen Keith
2008-01-01
Skin thermal damage or skin burns are the most commonly encountered type of trauma in civilian and military communities. Besides, advances in laser, microwave and similar technologies have led to recent developments of thermal treatments for disease and damage involving skin tissue, where the objective is to induce thermal damage precisely within targeted tissue structures but without affecting the surrounding, healthy tissue. Further, extended pain sensation induced by thermal damage has also brought great problem for burn patients. Thus, it is of great importance to quantify the thermal damage in skin tissue. In this paper, the available models and experimental methods for quantification of thermal damage in skin tissue are discussed.
Huang, Huey-Chun; Chang, Tsong-Min
2008-08-01
Stratum corneum intercellular lipids, such as ceramides, play an important role in the regulation of skin water barrier homeostasis and water-holding capacity. Aim To evaluate the potential water retention capacity of control emulsion and three oil-in-water (o/w) emulsions containing ceramide 1, ceramide 3, or both. Fifteen healthy Asian women (age, 20-30 years) with healthy skin, pretreated with sodium lauryl sulfate (SLS), applied the tested emulsions twice daily over a period of 28 days. Skin hydration and transepidermal water loss (TEWL) values were measured on the indicated days with a Corneometer(R)825 and a TEWAMETER TM210, respectively. The maximum increase in skin humidity was reached after 4 weeks, with values of 21.9 +/- 1.8% and 8.9 +/- 0.9% for emulsion C and control emulsion, respectively. The maximum decrease in TEWL was also reached after 4 weeks, with values of 36.7 +/- 4.7% and 5.1 +/- 0.8% for the same emulsions. It can be concluded that all the tested ceramide-containing emulsions improved skin barrier function when compared with untreated skin. There was some indication that ceramides 1 and 3 contained in emulsion C might exert a beneficial synergistic effect on skin biochemical properties, such as skin hydration and TEWL, and play a key role in the protection mechanism against SLS irritation.
Li, Z; Hu, L; Elias, PM; Man, M-Q
2018-01-01
Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...
International Nuclear Information System (INIS)
Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase; Thomassen, Anders
2011-01-01
An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new pressure device thus had acceptable validity and reproducibility for estimation of the skin perfusion pressure and can be used on bony and tendineous sites on the lower limb in regions where critical wound healing is frequent, e.g. ankle and forefoot
Raboni, R; Roberta, R; Patrizi, A; Cocchi, G; Faldella, G; Raone, B
2014-10-01
Physiologic post-partum skin adaptation to the relative dry extra-uterine environment is a dynamic process which begins immediately after birth. Considering the differences from adult skin, the neonatal skin is more prone to damage by environmental factors; therefore, skin care regimens should be age adapted to ensure a good epidermal maturation. The effects of two different skin care practices were evaluated by transepidermal water loss (TEWL) measurement in 94 newborns aged ≤ 10 days: group 1 (G1), newborns washed only with a cotton washcloth moistened with water; group 2 (G2), newborns washed with liquid baby cleansers and hydrated with moisturizers. These recordings were compared to TEWL baseline values of the same neonates and to adults' values. A prospective study was conducted in healthy full-term newborns, measuring TEWL with TEWAMETER® TM300. The areas tested were the volar forearm and the popliteal fossa. In G1 (52 subjects), TEWL mean values were 6.65 ± 2.81 SD (g/m2/h) at volar forearm and 7.49 ± 2.47 SD (g/m2/h) at popliteal fossa. In G2 (42 subjects), TEWL mean values were 8.83 ± 3.05 SD (g/m2/h) at volar forearm and 10.18 ± 3.64 SD (g/m2/h) at popliteal fossa. There were statistically significant differences of TEWL mean values between G1 and G2, newborns and adults, baseline and post-skin care procedures. Tested skin care regimens could influence the process of functional adaptation of skin, in the early postnatal period. We could hypothesize that daily washing with liquid baby cleansers and moisturizing may delay the natural maturation of skin barrier function.
Hyperpigmentation of the skin associated with minocycline therapy
International Nuclear Information System (INIS)
Gordon, G.; Sparano, B.M.; Iatropoulos, M.J.
1985-01-01
Skin biopsy specimens and discolored fingernails from minocycline-treated patients were examined by light and electron microscopy, histochemistry, and energy-dispersive x-ray analysis. Both hyperpigmented and adjacent normally pigmented skin samples contained pigment-laden macrophages in the dermis, although these cells were more numerous in the hyperpigmented skin samples. Elemental analysis showed that both pigment deposits and stratum corneum of hyperpigmented skin samples contained iron and calcium. Discolored areas of fingernails from a minocycline-treated patient also contained iron and calcium. Both skin and nail discoloration were possibly due to the presence of an iron chelate of minocycline and/or quinoid derivatives of minocycline. The presence of iron-containing pigment in normal as well as hyperpigmented skin may have predisposed to formation of minocycline-associated pigment in these patients
Ziziphus mauritiana leaf extract emulsion for skin rejuvenation ...
African Journals Online (AJOL)
During this period, stability parameters, including liquefaction, phase separation, color, electrical conductivity, centrifugation and pH were monitored at specified time intervals. Skin rejuvenation was evaluated using 13 healthy human volunteers over a period of 8 weeks. During this period, various skin parameters such as ...
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached.......Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached....
Lymphatic albumin clearance from psoriatic skin
International Nuclear Information System (INIS)
Staberg, B.; Klemp, P.; Aasted, M.; Worm, A.M.; Lund, P.
1983-01-01
In nine patients with untreated psoriasis vulgaris, human serum albumin labelled with 125 I or 131 I was injected intradermally in symmetrically located involved and uninvolved skin. The activity of the depots was followed by external detection, and the arrival of labelled albumin in plasma was monitored. In involved psoriatic skin the local mean half-time (T1/2) for tracer disappearance was 20.8 +/- 8.2 (S.D.) hr and in clinically normal skin, 29.1 +/- 9.6 (S.D.) hr. The difference was significant (p less than 0.002). Accordingly, the tracer from involved skin reached higher plasma levels than the tracer from uninvolved skin. However, under slight lymphatic stasis the appearance rate of radiolabelled albumin in plasma from both tissues was minimal during 1 to 2 hours after the injection, indicating that a local direct transvascular drainage of plasma albumin from the interstitium of diseased and normal skin was negligible. We conclude that the previously demonstrated increased extravasation of plasma proteins in involved psoriatic skin is compensated by an increased lymphatic drainage of plasma proteins, and not by an increased local transvascular return
p63 in skin development and ectodermal dysplasias
Koster, Maranke I.
2010-01-01
The transcription factor p63 is critically important for skin development and maintenance. Processes that require p63 include epidermal lineage commitment, epidermal differentiation, cell adhesion, and basement membrane formation. Not surprisingly, alterations in the p63 pathway underlie a subset of ectodermal dysplasias, developmental syndromes in which the skin and skin appendages do not develop normally. This review summarizes the current understanding of the role of p63 in normal development and ectodermal dysplasias. PMID:20445549
Chernomyrdin, Nikita V.; Zaytsev, Kirill I.; Lesnichaya, Anastasiya D.; Kudrin, Konstantin G.; Cherkasova, Olga P.; Kurlov, Vladimir N.; Shikunova, Irina A.; Perchik, Alexei V.; Yurchenko, Stanislav O.; Reshetov, Igor V.
2016-09-01
In present paper, an ability to differentiate basal cell carcinoma (BCC) and healthy skin by combining multi-spectral autofluorescence imaging, principle component analysis (PCA), and linear discriminant analysis (LDA) has been demonstrated. For this purpose, the experimental setup, which includes excitation and detection branches, has been assembled. The excitation branch utilizes a mercury arc lamp equipped with a 365-nm narrow-linewidth excitation filter, a beam homogenizer, and a mechanical chopper. The detection branch employs a set of bandpass filters with the central wavelength of spectral transparency of λ = 400, 450, 500, and 550 nm, and a digital camera. The setup has been used to study three samples of freshly excised BCC. PCA and LDA have been implemented to analyze the data of multi-spectral fluorescence imaging. Observed results of this pilot study highlight the advantages of proposed imaging technique for skin cancer diagnosis.
Ectodermal dysplasia-skin fragility syndrome
Directory of Open Access Journals (Sweden)
Vijay S Adhe
2011-01-01
Full Text Available Ectodermal dysplasia-skin fragility (EDSF syndrome is a rare and first described inherited disorder of desmosomes. It occurs due to loss-of-function mutations in PKP1 gene resulting in poorly formed desmosomes and loss of desmosomal and epidermal integrity. We report a case of a 2-year-old Indian male child who presented with palmoplantar hyperkeratosis with fissuring, short, sparse, and easily pluckable scalp hair, nail dystrophy, and multiple erosions over the skin. Skin biopsy showed epidermal hyperplasia with widening of intercellular spaces. His developmental milestones were delayed but intelligence was normal. Echocardiography, X-ray chest, and electrocardiogram were normal. Very few cases of this syndrome have been reported in the literature. We consider this as the first case report from India.
International Nuclear Information System (INIS)
Kutovyi, V.A.; Komir, A.I.
2013-01-01
The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz
OCT imaging of skin cancer and other dermatological diseases
DEFF Research Database (Denmark)
Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini
2009-01-01
Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a lar...... number of applications in the fields of non-melanoma skin cancer, malignant melanomas, psoriasis and dermatitis, infestations, bullous skin diseases, tattoos, nails, haemangiomas, and other skin diseases. (© 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim)......Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a large...
Age-associated decrease in GDNF and its cognate receptor GFRα-1 protein expression in human skin.
Adly, Mohamed A; Assaf, Hanan A; Hussein, Mahmoud Rezk Abdelwahed
2016-06-01
Glial cell line-derived neurotrophic factor (GDNF) and its cognate receptor (GFRα-1) are expressed in normal human skin. They are involved in murine hair follicle morphogenesis and cycling control. We hypothesize that 'GDNF and GFRα-1 protein expression in human skin undergoes age-associated alterations. To test our hypothesis, the expression of these proteins was examined in human skin specimens obtained from 30 healthy individuals representing three age groups: children (5-18 years), adults (19-60 years) and the elderly (61-81 years). Immunofluorescent and light microscopic immunohistologic analyses were performed using tyramide signal amplification and avidin-biotin complex staining methods respectively. GDNF mRNA expression was examined by RT-PCR analysis. GDNF mRNA and protein as well as GFRα-1 protein expressions were detected in normal human skin. We found significantly reduced epidermal expression of these proteins with ageing. In the epidermis, the expression was strong in the skin of children and declined gradually with ageing, being moderate in adults and weak in the elderly. In children and adults, the expression of both GDNF and GFRα-1 proteins was strongest in the stratum basale and decreased gradually towards the surface layers where it was completely absent in the stratum corneum. In the elderly, GDNF and GFRα-1 protein expression was confined to the stratum basale. In the dermis, both GDNF and GFRα-1 proteins had strong expressions in the fibroblasts, sweat glands, sebaceous glands, hair follicles and blood vessels regardless of the age. Thus there is a decrease in epidermal GDNF and GFRα-1 protein expression in normal human skin with ageing. Our findings suggest that the consequences of this is that GFRα-1-mediated signalling is altered during the ageing process. The clinical and therapeutic ramifications of these observations mandate further investigations. © 2016 The Authors. International Journal of Experimental Pathology © 2016
Internalization of subcellular-scale microfabricated chips by healthy and cancer cells
Wong, H.-S. Philip
2018-01-01
Continuous monitoring of physiological parameters inside a living cell will lead to major advances in our understanding of biology and complex diseases, such as cancer. It also enables the development of new medical diagnostics and therapeutics. Progress in nanofabrication and wireless communication has opened up the potential of making a wireless chip small enough that it can be wholly inserted into a living cell. To investigate how such chips could be internalized into various types of living single cells and how this process might affect cells’ physiology, we designed and fabricated a series of multilayered micron-scale tag structures with different sizes as potential RFID (Radio Frequency IDentification) cell trackers. While the present structures are test structures that do not resonate, the tags that do resonate have similar structure from device fabrication, material properties, and device size point of view. The structures are in four different sizes, the largest with the lateral dimension of 9 μm × 21 μm. The thickness for these structures is kept constant at 1.5 μm. We demonstrate successful delivery of our fabricated chips into various types of living cells, such as melanoma skin cancer, breast cancer, colon cancer and healthy/normal fibroblast skin cells. To our surprise, we observed a remarkable internalization rate difference between each cell type; the uptake rate was faster for more aggressive cancer cells than the normal/healthy cells. Cell viability before and after tag cellular internalization and persistence of the internalized tags have also been recorded over the course of five days of incubation. These results establish the foundations of the possibility of long term, wireless, intracellular physiological signal monitoring. PMID:29601607
Directory of Open Access Journals (Sweden)
Kerstin H. Nyqvist
2017-10-01
Full Text Available Background Skin-to-skin contact (SSC is an important factor to consider in the care of late preterm infants (born between 34 0/7 and 36 6/7 completed weeks of gestation. The literature suggests that SSC between preterm infants and their mothers facilitates breastfeeding. However, more studies are needed to explore potential dose-response effects between SSC and breastfeeding as well as studies that explicitly investigate SSC by fathers among late preterm infants. The aim was to investigate the duration of healthy late preterm infants’ SSC with the mother and father, respectively, during the first 48 h after birth and the associations with breastfeeding (exclusive/partial at discharged, clinical and demographic variables. Methods This was an observational cohort study in which parents to healthy late preterm infants, born between 34 5/7 and 36 6/7 completed weeks of gestation, recorded duration of SSC provided by mother and father, respectively. Demographic and clinical variables were retrieved from the medical records and were used as predictors. Multiple linear regression analysis was used to assess the association between the predictors and the outcome, SSC (hours, separately for mothers and fathers. Results The mean (standard deviation [SD] time per day spent with SSC with mothers (n = 64 and fathers (n = 64, was 14.7 (5.6 and 4.4 (3.3 hours during the first day (24 h after birth and 9.2 (7.1 and 3.1 (3.3 hours during the second day (24 h, respectively. Regarding SSC with mothers, no variable was significantly associated with SSC during the first day, while the mean (95% confidence interval [CI] time of SSC during the second day was 6.9 (1.4–12.4 hours shorter for each additional kg of birthweight (p = 0.014. Concerning SSC with fathers, the mean (95% CI time of SSC during the first day was 2.1 (0.4–3.7 hours longer for infants born at night (p = 0.015, 1.7 (0.1–3.2 hours longer for boys (p = 0.033, 3.2 (1.2–5.2 hours
Skin Protective Nutraceuticals: The Current Evidence in Brief
Directory of Open Access Journals (Sweden)
Oroma Nwanodi
2018-05-01
Full Text Available Nutraceuticals are important for healthy skin maintenance. Probiotics, phenolics, and vitamins are just a few of the nutraceuticals meant to potentially prevent and assist medical management of dermatologic conditions. Among these, probiotics, vitamin E, and green tea catechins may offer the broadest array of skin protective mechanisms with probiotics having the greatest clinical range. Probiotics’ amelioration of atopic dermatitis and opportunistic infections of skin burns has been targeted in recent research efforts. This includes the improvement of Scoring Atopic Dermatitis index scores, p = 0.02, with intact Lactobacillus rhamnosus Goldin and Gorbach (LGG in comparison to heat inactivated LGG or placebo. Lactobacillus reuteri used prior to or concurrently with Staphylococcus aureus infection can increase epidermal keratinocyte survival, p < 0.01. Phenolics may not have been extensively studied for atopic dermatitis or skin burns. However, phenolics do have a role in photoprotection. The phenolic rutin increases ultraviolet B radiation filter reactive oxygen species scavenging at 75%, p < 0.002, and peak wavelength absorption, p < 0.001. While oral and topical probiotics have untapped potential for atopic dermatitis amelioration and skin infection prevention, phenolics will be increasingly used for photoprotection. With optimized bioavailability, dosage, and formulation, nutraceuticals will become crucial for healthy skin maintenance.
Heterogeneous Stem Cells in Skin Homeostatis and Wound Repair
Directory of Open Access Journals (Sweden)
Anna Meilana
2015-08-01
Full Text Available BACKGROUND: The skin protects mammals from insults, infection and dehydration and enables thermoregulation and sensory perception. Various skin-resident cells carry out these diverse functions. Constant turnover of cells and healing upon injury necessitate multiple reservoirs of stem cells. The skin is a complex organ harboring several distinct populations of stem cells and a rich array of cell types. Advances in genetic and imaging tools have brought new findings about the lineage relationships between skin stem cells and their progeny. Such knowledge may offer novel avenues for therapeutics and regenerative medicine. CONTENT: In the past years, our view of the mechanisms that govern skin homeostasis and regeneration have markedly changed. New populations of stem cells have been identified that behave spatio-temporally differently in healthy tissues and in situations of damage, indicating that a great level of stem cell heterogeneity is present in the skin. There are believed to be distinct populations of stem cells in different locations. The lineages that they feed are normally constrained by signals from their local environment, but they can give rise to all epidermal lineages in response to appropriate stimuli. Given the richness of structures such as blood vessels, subcutaneous fat, innervation and the accumulation of fibroblasts under the upper parts of the rete ridges (in the case of human skin, it is reasonable to speculate that the microenvironment might be essential for interfollicular epidermal homeostasis. The bloodstream is probably the main source of long-range signals reaching the skin, and cues provided by the vascular niche might be essential for skin homeostasis. SUMMARY: A key function of the interfollicular epidermis is to act as a protective interface between the body and the external environment, and it contains several architectural elements that enable it to fulfill this function. All elements of the epidermis play
Molecular subsets in the gene expression signatures of scleroderma skin.
Directory of Open Access Journals (Sweden)
Ausra Milano
2008-07-01
Full Text Available Scleroderma is a clinically heterogeneous disease with a complex phenotype. The disease is characterized by vascular dysfunction, tissue fibrosis, internal organ dysfunction, and immune dysfunction resulting in autoantibody production.We analyzed the genome-wide patterns of gene expression with DNA microarrays in skin biopsies from distinct scleroderma subsets including 17 patients with systemic sclerosis (SSc with diffuse scleroderma (dSSc, 7 patients with SSc with limited scleroderma (lSSc, 3 patients with morphea, and 6 healthy controls. 61 skin biopsies were analyzed in a total of 75 microarray hybridizations. Analysis by hierarchical clustering demonstrates nearly identical patterns of gene expression in 17 out of 22 of the forearm and back skin pairs of SSc patients. Using this property of the gene expression, we selected a set of 'intrinsic' genes and analyzed the inherent data-driven groupings. Distinct patterns of gene expression separate patients with dSSc from those with lSSc and both are easily distinguished from normal controls. Our data show three distinct patient groups among the patients with dSSc and two groups among patients with lSSc. Each group can be distinguished by unique gene expression signatures indicative of proliferating cells, immune infiltrates and a fibrotic program. The intrinsic groups are statistically significant (p<0.001 and each has been mapped to clinical covariates of modified Rodnan skin score, interstitial lung disease, gastrointestinal involvement, digital ulcers, Raynaud's phenomenon and disease duration. We report a 177-gene signature that is associated with severity of skin disease in dSSc.Genome-wide gene expression profiling of skin biopsies demonstrates that the heterogeneity in scleroderma can be measured quantitatively with DNA microarrays. The diversity in gene expression demonstrates multiple distinct gene expression programs in the skin of patients with scleroderma.
Directory of Open Access Journals (Sweden)
Dong Soo Ryu
2018-01-01
Full Text Available Purpose: Urologic diseases affected by testosterone can be associated with smaller penis size compared to the normal population. We sought to compare penile length in children with unilateral cryptorchidism and normative data from a cohort of healthy Korean boys. Materials and Methods: This study was performed in 259 Korean boys (212, normal cohort; 47, cryptorchidism aged 6–24 months, each of whom had been brought to an outpatient clinic at one of five tertiary hospitals (Gyeongsangnam-do Province between April 2014 and June 2015. Penile length was measured via stretched penile length (SPL and testicular size was measured using orchidometry (mL. Results: SPL in children with cryptorchidism was significantly shorter compared to a cohort of healthy Korean boys aged 6–24 months (3.7±0.5 cm and 4.3±0.8 cm, p<0.001, although there were no differences with regard to height, body weight and contralateral testicular size between the two groups. According to the stratified ages (6–12, 12–18, and 18–24 months, SPL in children with cryptorchidism was persistently shorter at their ages than those without. Conclusions: It might be that the penile length aged 6–24 months of children with unilateral cryptorchidism is shorter than that of a cohort of healthy Korean boys.
Efficacy and dermal tolerance of a novel alcohol-based skin antiseptic in horses.
Tannahill, Victoria J; Cogan, Tristan; Allen, Kate; Acutt, Elizabeth; Busschers, Evita
2018-04-14
To determine the efficacy and dermal tolerance of a novel alcohol-based skin antiseptic (ABSA) in horses. Experimental study. Systemically healthy horses (n = 25) with no history or clinical signs of skin disease. Four clipped sites on the abdomen were randomly assigned to a skin preparation protocol: saline (negative control; NC), chlorhexidine gluconate followed by isopropyl alcohol (positive control; PC), saline followed by the ABSA (ABSA A), or a commercially available horse shampoo followed by the ABSA (ABSA B). Microbiological swabs were obtained from each site and cultured on MacConkey and mannitol salt agar plates. Colony-forming units were counted 18-24 hours later. All sites were scored for signs of skin reaction before, immediately after, 1 hour after, and 24 hours after skin preparation. The PC, ABSA A, and ABSA B methods reduced skin microbial burden compared with the NC method (P horses required veterinary treatment. The ABSA preparations tested in this study were as effective and well tolerated as a chlorhexidine gluconate-based method, but required less time in healthy horses. The ABSA tested here provides an efficacious, fast-acting, and well-tolerated alternative to achieve skin antisepsis in healthy horses. These results justify further investigation in clinical cases. © 2018 The American College of Veterinary Surgeons.
Time course of primary and secondary hyperalgesia after heat injury to the skin
DEFF Research Database (Denmark)
Møiniche, S; Dahl, J B; Kehlet, H
1993-01-01
the injury in any volunteer. These findings suggest post-injury development of secondary hyperalgesia to be a dynamic process, closely related in time to a peripheral nociceptive input, with reversal to normal when the peripheral lesion disappears. These observations may be relevant to the concept of "pre......We have examined the time course of, and relationship between, primary and secondary hyperalgesia after thermal injury to the skin in humans. Burn injuries (15 x 25 mm rectangular thermode, 49 degrees C, 5 min) were produced in eight healthy, unmedicated male volunteers, on the medial side...... of the right calf, on two occasions at least 8 days apart. Heat pain detection thresholds (HPDT), heat pain tolerance (HPT), mechanical pain detection threshold (MPDT) and the intensity of burn-injury induced erythema (skin erythema index, SEI) were assessed inside the burn injury. HPT was assessed only in one...
DEFF Research Database (Denmark)
Boone, M A L M; Suppa, M; Marneffe, A
2016-01-01
properties for discrimination of AK from SCC and from normal sun exposed skin and to subdifferentiate AKs. METHODS: The technique of semi-log plot has been implemented on HD-OCT signals. This permitted the in vivo measurement of OCT signals coming from the skin entrance up to the superficial reticular dermis...... involvement, non-Bowenoid AK with follicular involvement, Bowenoid AK, hypertrophic and lichenoid form of AK and squamous cell carcinoma. CONCLUSION: HD-OCT seems to enable the combination of in vivo morphological analysis of cellular and 3D microarchitectural structures with in vivo analysis of optical...... properties of tissue scatterers in AK/SCC lesions and normal sun-exposed skin. In vivoHD-OCT analysis of optical properties permits AK discrimination from SCC and AK subdifferentiation with higher accuracy than in vivoHD-OCT analysis of morphology alone....
Couppé, Christian; Dall, Christian Have; Svensson, Rene Brüggebusch; Olsen, Rasmus Huan; Karlsen, Anders; Praet, Stephan; Prescott, Eva; Magnusson, S Peter
2017-05-01
Life-long regular endurance exercise yields positive effects on cardiovascular and metabolic function, disease and mortality rate. Glycation may be a major mechanism behind age-related diseases. However, it remains unknown if skin autofluorescence (SAF), which reflects glycation, is related to arterial and metabolic function in life-long endurance runners and sedentary controls. Healthy elderly men: 15 life-long endurance runners (OT) (64±4years) and 12 old untrained (OU) (66±4years), and healthy young men; ten young athletes (YT) (26±4years) matched to OT for running distance, and 12 young untrained (YU) (24±3years) were recruited. Endothelial function (reactive hyperemia index, RHI) and arterial stiffness (augmentation index, AI@75 and AI) were measured by an operator-independent PAT 2000. SAF was non-invasively determined using an autofluorescence spectrometer. For AI@75 there was an effect of age (page correction (both r 2 =0.19, paging and pathology). Surprisingly, endurance running only had modest effects on cardiovascular function compared to lean healthy controls. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Pinar Cetinay Aydin
2014-08-01
Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428
An Ultrasound Surface Wave Technique for Assessing Skin and Lung Diseases.
Zhang, Xiaoming; Zhou, Boran; Kalra, Sanjay; Bartholmai, Brian; Greenleaf, James; Osborn, Thomas
2018-02-01
Systemic sclerosis (SSc) is a multi-organ connective tissue disease characterized by immune dysregulation and organ fibrosis. Severe organ involvement, especially of the skin and lung, is the cause of morbidity and mortality in SSc. Interstitial lung disease (ILD) includes multiple lung disorders in which the lung tissue is fibrotic and stiffened. The purpose of this study was to translate ultrasound surface wave elastography (USWE) for assessing patients with SSc and/or ILD via measuring surface wave speeds of both skin and superficial lung tissue. Forty-one patients with both SSc and ILD and 30 healthy patients were enrolled in this study. An external harmonic vibration was used to generate the wave propagation on the skin or lung. Three excitation frequencies of 100, 150 and 200 Hz were used. An ultrasound probe was used to measure the wave propagation in the tissue non-invasively. Surface wave speeds were measured on the forearm and upper arm of both left and right arm, as well as the upper and lower lungs, through six intercostal spaces of patients and healthy patients. Viscoelasticity of the skin was calculated by the wave speed dispersion with frequency using the Voigt model. The magnitudes of surface wave speed and viscoelasticity of patients' skin were significantly higher than those of healthy patients (p wave speeds of patients' lung were significantly higher than those of healthy patients (p ionizing technique for measuring both skin and lung surface wave speed and may be useful for quantitative assessment of SSc and/or ILD. Copyright © 2018 World Federation for Ultrasound in Medicine and Biology. Published by Elsevier Inc. All rights reserved.
Psoriasis and staphylococcus aureus skin colonization in Moroccan ...
African Journals Online (AJOL)
Psoriatic lesions are rarely complicated by recurrent infections. The aim of our study is to determine skin colonisation and nasal carriage of Staphylococcus aureus in patients with psoriasis and in healthy persons. Patients and methods: a comparative study that include 33 patients with psoriasis and 33 healthy persons.
Lee, Woan-Ruoh; Shen, Shing-Chuan; Sung, Calvin T; Liu, Pei-Ying; Fang, Jia-You
2018-04-26
Most of the investigations into laser-assisted skin permeation have used the intact skin as the permeation barrier. Whether the laser is effective in improving cutaneous delivery via barrier-defective skin is still unclear. In this study, ablative (Er:YAG) and non-ablative (Er:glass) lasers were examined for the penetration of peptide and siRNA upon topical application on in vitro skin with a healthy or disrupted barrier. An enhanced peptide flux (6.9 fold) was detected after tape stripping of the pig stratum corneum (SC). A further increase of flux to 11.7 fold was obtained after Er:YAG laser irradiation of the SC-stripped skin. However, the application of Er:glass modality did not further raise the flux via the SC-stripped skin. A similar trend was observed in the case of psoriasiform skin. Conversely, the flux was enhanced 3.7 and 2.6 fold after treatment with the Er:YAG and the Er:glass laser on the atopic dermatitis (AD)-like skin. The 3-D skin structure captured by confocal microscopy proved the distribution of peptide and siRNA through the microchannels and into the surrounding tissue. The fractional laser was valid for ameliorating macromolecule permeation into barrier-disrupted skin although the enhancement level was lower than that of normal skin.
Kuehni, Claudia E; Schindler, Matthias; Mazur, Agnieszka; Malzacher, Andreas; Hornung, René; Barben, Juerg
2017-07-01
Nanoduct™ is a simple and practical sweat analysis system measuring conductivity in situ. It requires only three microlitres of sweat, making it especially applicable to newborns. We measured conductivity in 260 healthy term infants at the age of four days, and again at four weeks to determine the proportion of successful tests, test duration, and normal values for sweat conductivity in newborns. Sufficient sweat was collected in 159/260 of four-day olds (61%), and in 225/239 of four-week olds (94%). Mean (sd) test duration was 27 (5) and 25 (5) min. Mean (sd, range) conductivity was 53mmol/l (16, 8-114) at age four days, and 36 (9, 12-64) at four weeks. Determination of sweat conductivity using Nanoduct™ cannot be recommended for four-day old newborns. However, at the age of four weeks the success rate is high (94%), and conductivity values at that age are comparable to older healthy children. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.
Stratum corneum hydration and skin surface pH in patients with atopic dermatitis.
Knor, Tanja; Meholjić-Fetahović, Ajša; Mehmedagić, Aida
2011-01-01
Atopic dermatitis (AD) is a chronically relapsing skin disease with genetic predisposition, which occurs most frequently in preschool children. It is considered that dryness and pruritus, which are always present in AD, are in correlation with degradation of the skin barrier function. Measurement of hydration and pH value of the stratum corneum is one of the noninvasive methods for evaluation of skin barrier function. The aim of the study was to assess skin barrier function by measuring stratum corneum hydration and skin surface pH of the skin with lesions, perilesional skin and uninvolved skin in AD patients, and skin in a healthy control group. Forty-two patients were included in the study: 21 young and adult AD patients and 21 age-matched healthy controls. Capacitance, which is correlated with hydration of stratum corneum and skin surface pH were measured on the forearm in the above areas by SM810/CM820/pH900 combined units (Courage AND Khazaka, Germany). The mean value of water capacitance measured in AD patients was 44.1 ± 11.6 AU (arbitrary units) on the lesions, 60.2 ± 12.4 AU on perilesional skin and 67.2 ± 8.8 AU on uninvolved skin. In healthy controls, the mean value was 74.1 ± 9.2 AU. The mean pH value measured in AD patients was 6.13 ± 0.52 on the lesions, 5.80 ± 0.41 on perilesional skin, and 5.54 ± 0.49 on uninvolved skin. In control group, the mean pH of the skin surface was 5.24 ± 0.40. The values of both parameters measured on lesional skin were significantly different (capacitance decreased and pH increased) from the values recorded on perilesional skin and uninvolved skin. The same held for the relation between perilesional and uninvolved skin. According to study results, the uninvolved skin of AD patients had significantly worse values of the measured parameters as compared with control group. The results of this study suggested the skin barrier function to be degraded in AD patients, which is specifically expressed in lesional skin.
Busquets, Joanna; Del Galdo, Francesco; Kissin, Eugene Y.
2010-01-01
Objectives. To obtain an objective, unbiased assessment of skin fibrosis in patients with SSc for use in clinical trials of SSc disease-modifying therapeutics. Methods. Skin biopsies from the dorsal forearm of six patients with diffuse SSc and six healthy controls, and skin biopsies from the forearm of one patient with diffuse SSc before and following 1 year treatment with mycophenolate mofetil were analysed by confocal laser scanning microscopy (CLSM) with specific antibodies against collagen types I and III or fibronectin. The integrated density of fluorescence (IDF) was calculated employing National Institutes of Health-ImageJ software in at least four different fields per biopsy spanning the full dermal thickness. Results. The intensities of collagen types I and III and fibronectin IDF were 174, 147 and 139% higher in SSc skin than in normal skin, respectively. All differences were statistically significant. The sum of the IDF values obtained for the three proteins yielded a comprehensive fibrosis score. The average fibrosis score for the six SSc samples was 28.3 × 106 compared with 18.6 × 106 for the six normal skin samples (P < 0.0001). Comparison of skin biopsies obtained from the same SSc patient before treatment and after 12 months of treatment with mycophenolate mofetil showed a reduction of 39% in total fibrosis score after treatment. Conclusions. CLSM followed by quantitative image analysis provides an objective and unbiased assessment of skin fibrosis in SSc and could be a useful end-point for clinical trials with disease-modifying agents to monitor the response or progression of the disease. PMID:20202926
International Nuclear Information System (INIS)
Rude, J.M.; Friedberg, E.C.
1977-01-01
Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity
Main approaches for delivering antioxidant vitamins through the skin to prevent skin ageing.
Gašperlin, Mirjana; Gosenca, Mirjam
2011-07-01
One of the major contributions to skin photoageing and diseases is oxidative stress, caused by UV radiation inducing reactive oxygen and nitrogen species. Successful prophylaxis and therapy would necessitate control of the oxidant/antioxidant balance at the affected site, which can be achieved through the external supply of endogenous antioxidants. This review discusses possible strategies for dermal delivery of the antioxidant vitamins E and C, as oral supplementation has proved insufficient. These antioxidants have low skin bioavailability, owing to their poor solubility, inefficient skin permeability, or instability during storage. These drawbacks can be overcome by various approaches, such as chemical modification of the vitamins and the use of new colloidal drug delivery systems. New knowledge is included about the importance of: enhancing the endogenous skin antioxidant defense through external supply; the balance between various skin antioxidants; factors that can improve the skin bioavailability of antioxidants; and new delivery systems, such as microemulsions, used to deliver vitamins C and E into the skin simultaneously. A promising strategy for enhancing skin protection from oxidative stress is to support the endogenous antioxidant system, with antioxidants containing products that are normally present in the skin.
Petersen, L J; Lyngholm, A M; Arendt-Nielsen, L
2010-09-01
Sodium lauryl sulfate (SLS) is a known irritant. It releases pro-inflammatory mediators considered pivotal in inflammatory pain. The sensory effects of SLS in the skin remain largely unexplored. In this study, SLS was evaluated for its effect on skin sensory functions. Eight healthy subjects were recruited for this study. Skin sites were randomized to topical SLS 0.25, 0.5, 1, 2% and vehicle for 24 h. Topical capsaicin 1% was applied for 30 min at 24 h after SLS application. Assessments included laser Doppler imaging of local vasodilation and flare reactions, rating of spontaneous pain, assessment of primary thermal and tactile hyperalgesia, and determination of secondary dynamic and static hyperalgesia. SLS induced significant and dose-dependent local inflammation and primary hyperalgesia to tactile and thermal stimulation at 24 h after application, with SLS 2% treatment eliciting results comparable to those observed following treatment with capsaicin 1%. SLS induced no spontaneous pain, small areas of flare, and minimal secondary hyperalgesia. The primary hyperalgesia vanished within 2-3 days, whereas the skin inflammation persisted and was only partly normalized by Day 6. SLS induces profound perturbations of skin sensory functions lasting 2-3 days. SLS-induced inflammation may be a useful model for studying the mechanisms of inflammatory pain.
Magnetic Resonance Imaging of the Ovaries of Healthy Women: Determination of Normal Values
International Nuclear Information System (INIS)
Hauth, E.A.M.; Jaeger, H.J.; Libera, H.; Lange, S.; Forsting, M.
2006-01-01
Purpose: To establish normal values for the volume and maximal diameter of ovaries and ovarian follicles and for the number of ovarian follicles in magnetic resonance imaging (MRI) based on menstrual cycle phase and age. Material and Methods: We performed MRI of the pelvis on 100 healthy women. Volume of the ovaries and largest ovarian follicles and the number of ovarian follicles were determined by menstrual cycle phase and age. Results: The mean volume of the ovaries significantly increased with age and reached its peak between 31 and 40 years, and subsequently decreased. The mean volume of the largest ovarian follicles also significantly increased with age to reach its peak at 41-50 years. The highest mean numbers of ovarian follicles were found at 20-40 years. When the volumes of ovaries and of the largest ovarian follicles, and the number of ovarian follicles were compared between the first and second phase of the menstrual cycle, no significant differences were found. Conclusion: The volume and maximal diameter of ovaries and ovarian follicles and the number of ovarian follicles differ significantly with age, but not between the two phases of the menstrual cycle. Knowledge of MRI-related normal values can be expected to aid the early identification of ovarian pathologies
ICRP-26 and skin contamination
International Nuclear Information System (INIS)
Finnigan, T.; Huda, W.; Newbery, G.R.
1979-01-01
The experience of dealing with skin contamination incidents at The Radiochemical Centre over a 3-year period is presented. Data are given for the primary isotopes involved, the duration of skin contamination, and the skin doses that arise from these incidents. The methods employed in performing dosimetry for skin contamination are discussed and examples involving the isotopes carbon-14 and indium-111 are described. For skin contamination incidents, the mode of penetration of the activity into skin is normally not known and this can be of major significance for the final skin dose estimate. The operational health physics difficulties encountered in complying with both ICRP-26 and UK legislation for skin contamination are considered. In the event of multiple exposure (i.e. skin doses calculated from whole body film badges, extremity TLD dose meters and skin contamination) there is ambiguity in the precise meaning of the skin dose. The usefulness of Derived Working Levels is also discussed. Experience at The Radiochemical Centre has shown that good plant design, proper training and prompt action in dealing with contamination incidents ensures that overexposures to skin from accidental contamination are rare occurrences. (author)
An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments
2014-03-27
20 11 40 0. 56 0. 57 0. 58 0. 590 . 6 0. 61 0. 62 0. 63 W av el en gt h (n m ) Reflectance 0 m L 1. 07 m L 2. 14 m L 3. 21 m L 4. 28 m L 35 .7 1...thickness from water concentration profiles obtained with Raman spectroscopy”. Acta Dermato-Venereologica, 87(1):4–8, 2007. [10] Eismann, Michael T...confocal Raman spectroscopy”. Skin Research and Technology, 16(2):137–141, 2009. [35] Nunez, Abel S. “A physical model of human skin and its application
Zhu, Y H; Song, S P; Luo, W; Elias, P M; Man, M Q
2011-01-01
Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. A total of 633 subjects (300 males and 333 females) aged 0.15-79 years were enrolled. A Frictiometer FR 770 and Corneometer CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p skin friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p skin friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. Copyright © 2010 S. Karger AG, Basel.
Dietary water affects human skin hydration and biomechanics
Directory of Open Access Journals (Sweden)
Palma L
2015-08-01
Full Text Available Lídia Palma,1 Liliana Tavares Marques,1 Julia Bujan,2,3 Luís Monteiro Rodrigues1,4 1CBIOS – Research Center for Health Science and Technologies, Universidade Lusófona, Campo Grande, Lisboa, Portugal; 2Department of Medicine and Medical Specialities, Universidad de Alcalá de Henares, Madrid, Spain; 3CIBER-BBN, Madrid, España, Spain; 4Department of Pharmacological Sciences, School of Pharmacy, Universidade de Lisboa, Lisboa, Portugal Abstract: It is generally assumed that dietary water might be beneficial for the health, especially in dermatological (age preventing terms. The present study was designed to quantify the impact of dietary water on major indicators of skin physiology. A total of 49 healthy females (mean 24.5±4.3 years were selected and characterized in terms of their dietary daily habits, especially focused in water consumption, by a Food Frequency Questionnaire. This allowed two groups to be set – Group 1 consuming less than 3,200 mL/day (n=38, and Group 2 consuming more than 3,200 mL/day (n=11. Approximately 2 L of water were added to the daily diet of Group 2 individuals for 1 month to quantify the impact of this surplus in their skin physiology. Measurements involving epidermal superficial and deep hydration, transepidermal water loss, and several biomechanical descriptors were taken at day 0 (T0, 15 (T1, and 30 (T2 in several anatomical sites (face, upper limb, and leg. This stress test (2 L/day for 30 days significantly modified superficial and deep skin hydration, especially in Group 1. The same impact was registered with the most relevant biomechanical descriptors. Thus, in this study, it is clear that higher water inputs in regular diet might positively impact normal skin physiology, in particular in those individuals with lower daily water consumptions. Keywords: dietary water, water consume, skin hydration, TEWL, skin biomechanics
Human Wharton's jelly mesenchymal stem cells promote skin wound healing through paracrine signaling.
Arno, Anna I; Amini-Nik, Saeid; Blit, Patrick H; Al-Shehab, Mohammed; Belo, Cassandra; Herer, Elaine; Tien, Col Homer; Jeschke, Marc G
2014-02-24
The prevalence of nonhealing wounds is predicted to increase due to the growing aging population. Despite the use of novel skin substitutes and wound dressings, poorly vascularized wound niches impair wound repair. Mesenchymal stem cells (MSCs) have been reported to provide paracrine signals to promote wound healing, but the effect of human Wharton's jelly-derived MSCs (WJ-MSCs) has not yet been described in human normal skin. Human WJ-MSCs and normal skin fibroblasts were isolated from donated umbilical cords and normal adult human skin. Fibroblasts were treated with WJ-MSC-conditioned medium (WJ-MSC-CM) or nonconditioned medium. Expression of genes involved in re-epithelialization (transforming growth factor-β2), neovascularization (hypoxia-inducible factor-1α) and fibroproliferation (plasminogen activator inhibitor-1) was upregulated in WJ-MSC-CM-treated fibroblasts (P≤0.05). WJ-MSC-CM enhanced normal skin fibroblast proliferation (P≤0.001) and migration (P≤0.05), and promoted wound healing in an excisional full-thickness skin murine model. Under our experimental conditions, WJ-MSCs enhanced skin wound healing in an in vivo mouse model.
Developing a reference of normal lung sounds in healthy Peruvian children.
Ellington, Laura E; Emmanouilidou, Dimitra; Elhilali, Mounya; Gilman, Robert H; Tielsch, James M; Chavez, Miguel A; Marin-Concha, Julio; Figueroa, Dante; West, James; Checkley, William
2014-10-01
Lung auscultation has long been a standard of care for the diagnosis of respiratory diseases. Recent advances in electronic auscultation and signal processing have yet to find clinical acceptance; however, computerized lung sound analysis may be ideal for pediatric populations in settings, where skilled healthcare providers are commonly unavailable. We described features of normal lung sounds in young children using a novel signal processing approach to lay a foundation for identifying pathologic respiratory sounds. 186 healthy children with normal pulmonary exams and without respiratory complaints were enrolled at a tertiary care hospital in Lima, Peru. Lung sounds were recorded at eight thoracic sites using a digital stethoscope. 151 (81%) of the recordings were eligible for further analysis. Heavy-crying segments were automatically rejected and features extracted from spectral and temporal signal representations contributed to profiling of lung sounds. Mean age, height, and weight among study participants were 2.2 years (SD 1.4), 84.7 cm (SD 13.2), and 12.0 kg (SD 3.6), respectively; and, 47% were boys. We identified ten distinct spectral and spectro-temporal signal parameters and most demonstrated linear relationships with age, height, and weight, while no differences with genders were noted. Older children had a faster decaying spectrum than younger ones. Features like spectral peak width, lower-frequency Mel-frequency cepstral coefficients, and spectro-temporal modulations also showed variations with recording site. Lung sound extracted features varied significantly with child characteristics and lung site. A comparison with adult studies revealed differences in the extracted features for children. While sound-reduction techniques will improve analysis, we offer a novel, reproducible tool for sound analysis in real-world environments.
DEFF Research Database (Denmark)
Lillebaek, Troels; Bergstedt, Winnie; Tingskov, Pernille N
2009-01-01
1 open clinical trial was to assess the sensitization risk and safety of repeated administration of rdESAT-6 reagent in 31 healthy adult volunteers. Three groups of volunteers received two fixed doses of 0.1 microg rdESAT-6 28, 56 or 112 days apart, respectively. After the second injection...... of 31 (3%) volunteers showed a positive skin reaction (sensitization) upon a second injection of rdESAT-6 after 28days and an increased IFN-gamma response to ESAT-6. For 7 (23%) of the volunteers, local adverse reactions related to the product were registered, but all reactions were mild and predictable...
International Nuclear Information System (INIS)
Huiskamp, R.; Philipp, K.H.I.; Gavin, P.R.; Wheeler, F.J.; Siefert, A.
1993-01-01
Epithermal neutron beams are being developed for the application of boron neutron capture therapy (BNCT) of deep seated tumors, like glioblastoma and astrocytomas, through the intact skin. Epithermal neutrons will be moderated by the tissue mass between skin and tumour to produce the thermal neutrons necessary for the 10 B(n,α) 7 Li reaction in the target tissue. Although the neutron capture cross-sections of elements in normal tissue are several orders of magnitude lower that for boron, the high abundance of hydrogen and nitrogen will cause a significant contribution to the total absorbed radiation dose through the 1 H(n,γ) 2 H and the 14 N(n,p) 14 C reaction, respectively. Due to inevitable incomplete filtration, an epithermal beam will also contain a fast neutron component, i.e. neutrons with energies ≥ 10 keV, and a γ-photon component originating from the reactor and produced in structural and filter materials. Therefore, the resultant radiation consists of a complex of low and high LET radiation of which the constitutents vary rapidly with depth in tissue. Based on the ongoing canine healthy tissue tolerance study at the Brookhaven Medical Research Reactor (BMRR) using the epithermal beam without BSH, the relative biological effectiveness (RBE) of the fast neutron beam component has been determined for skin reactions. In addition, a open-quotes compound factorclose quotes, i.e geometry x RBE, for the 10 B(n,α) 7 Li reaction was derived for dogs irradiated at the BMRR with the epithermal beam and BSH (Gavin et al.). Currently, a healthy tissue tolerance study with BSH is being carried out at the HB11 epithermal beam of the High Flux Reactor at Petten. The present paper describes preliminary dose effect comparisons between High Flux Reactor (HFR) and BMRR irradiated dogs with respect to healthy tissue tolerance in order to refine the BSH compound factors and the fast neutron RBE for skin and brain
DEFF Research Database (Denmark)
Kastrup, J; Nørgaard, T; Parving, H H
1987-01-01
The distensibility of the resistance vessels of the skin at the dorsum of the foot was determined in 11 long-term type 1 (insulin-dependent) diabetic patients with nephropathy and retinopathy, nine short-term type 1 diabetic patients without clinical microangiopathy and in nine healthy non-diabetic...... during head-up tilt was only 24% in diabetic subjects with and 48% in diabetic patients without clinical microangiopathy, compared with 79% in normal non-diabetic subjects (P less than 0.0005 and P less than 0.05, respectively). An inverse correlation between microvascular distensibility and degree...
Gretener, S B; Läuchli, S; Leu, A J; Koppensteiner, R; Franzeck, U K
2000-01-01
The aim of the present study was to assess the influence of venous and lymphatic congestion on lymph capillary pressure (LCP) in the skin of the foot dorsum of healthy volunteers and of patients with lymph edema. LCP was measured at the foot dorsum of 12 patients with lymph edema and 18 healthy volunteers using the servo-nulling technique. Glass micropipettes (7-9 microm) were inserted under microscopic control into lymphatic microvessels visualized by fluorescence microlymphography before and during venous congestion. Venous and lymphatic congestion was attained by cuff compression (50 mm Hg) at the thigh level. Simultaneously, the capillary filtration rate was measured using strain gauge plethysmography. The mean LCP in patients with lymph edema increased significantly (p < 0.05) during congestion (15.7 +/- 8.8 mm Hg) compared to the control value (12.2 +/- 8.9 mm Hg). The corresponding values of LCP in healthy volunteers were 4.3 +/- 2.6 mm Hg during congestion and 2.6 +/- 2.8 mm Hg during control conditions (p < 0.01). The mean increase in LCP in patients with lymph edema was 3.4 +/- 4.1 mm Hg, and 1.7 +/- 2.0 mm Hg in healthy volunteers (NS). The maximum spread of the lymph capillary network in patients increased from 13.9 +/- 6.8 mm before congestion to 18.8 +/- 8.2 mm during thigh compression (p < 0.05). No increase could be observed in healthy subjects. In summary, venous and lymphatic congestion by cuff compression at the thigh level results in a significant increase in LCP in healthy volunteers as well as in patients with lymph edema. The increased spread of the contrast medium in the superficial microlymphatics in lymph edema patients indicates a compensatory mechanism for lymphatic drainage during congestion of the veins and lymph collectors of the leg. Copyright 2000 S. Karger AG, Basel
House dust mites on skin, clothes, and bedding of atopic dermatitis patients.
Teplitsky, Valery; Mumcuoglu, Kosta Y; Babai, Ilan; Dalal, Ilan; Cohen, Rifka; Tanay, Amir
2008-08-01
Atopic dermatitis is a common allergic condition in children, often associated with a positive skin reaction to house dust mite allergens. To determine the presence of house dust mites on the skin, clothes, and bedding of patients with atopic dermatitis. Nineteen patients with atopic dermatitis were examined during a 2-year period. Samples from affected and healthy skin surfaces were obtained with adhesive tape, and dust samples from bedding and clothes were collected with a vacuum cleaner at the start of the study and 3-6 weeks later, and examined for the presence of house dust mites. The findings were compared with those of 21 healthy controls. The most common mite species on skin were Dermatophagoides pteronyssinus and Dermatophagoides farinae, which were found in nine patients and three controls. The patient group showed a significantly larger percentage of samples with mites than did the control group (34.9% and 7.9%, respectively) (P bedding of patients, or between patients and controls with regard to the number of mites on the clothes and bedding. Patients with atopic dermatitis showed a higher prevalence of mites on their skin than did healthy individuals, which could be involved in allergic sensitization and disease exacerbation.
International Nuclear Information System (INIS)
Giudici, T.A.; Chen, R.G.; Oizumi, J.; Shaw, K.N.; Ng, W.G.; Donnell, G.N.
1986-01-01
Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with [1- 14 C]propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines
Zeng, Chang-chun; Yang, Li; Xu, Ying; Liu, Pei-pei; Guo, Shi-jun; Liu, Song-hao
2011-09-01
Using the data from normal tongue and lip colors of normal people which were collected by the visible reflection spectrum, we analyzed the colorimetric parameters of tongue and lip colors. In this study, 516 healthy students aging from 19 to 26 from the colleges and universities of Guangdong Province of China were taken as research subjects. After collecting the data of tongue and lip colors of the 516 subjects using visible reflectance spectroscopy, CIE XYZ tristimulus values as defined by the International Commission on Illumination in 1964 were calculated, and the colorimetric parameters of the normal tongue and lip colors were obtained, such as the CIE 1964 chromaticity coordinate, brightness, dominant wavelength and excitation purity. The results of CIE 1964 chromaticity diagram calculated on the visible reflection spectrum showed that the normal tongue color chromaticity coordinate x(10) was 0.341 3±0.008 5 and y(10) was 0.332 6±0.005 1, and the normal lip color chromaticity coordinate x(10) was 0.357 7±0.009 2 and y(10) was 0.338 3±0.005 7; the brightness Y values of the normal tongue color and lip colors were 17.96±3.78 and 19.78±3.72, the dominant wavelength values of the normal tongue color and lip color were (626.3±51.6) nm and (600.4±18.2) nm, and the excitation purity values of the normal tongue color and lip color were 0.083±0.031 and 0.144±0.036, respectively. Application of the visible reflection spectrum is a standard way to collect colorimetric data for inspection of the complexion. The investigation of chromaticity coordinates, brightness, dominant wavelength and excitation purity of the normal tongue and lip colors may offer the basic reference for diagnosing morbid complexion on the tongue and lip colors in traditional Chinese medicine.
Systemic antioxidants and skin health.
Nguyen, Gloria; Torres, Abel
2012-09-01
Most dermatologists agree that antioxidants help fight free radical damage and can help maintain healthy skin. They do so by affecting intracellular signaling pathways involved in skin damage and protecting against photodamage, as well as preventing wrinkles and inflammation. In today's modern world of the rising nutraceutical industry, many people, in addition to applying topical skin care products, turn to supplementation of the nutrients missing in their diets by taking multivitamins or isolated, man-made nutraceuticals, in what is known as the Inside-Out approach to skin care. However, ingestion of large quantities of isolated, fragmented nutrients can be harmful and is a poor representation of the kind of nutrition that can be obtained from whole food sources. In this comprehensive review, it was found that few studies on oral antioxidants benefiting the skin have been done using whole foods, and that the vast majority of current research is focused on the study of compounds in isolation. However, the public stands to benefit greatly if more research were to be devoted toward the impact that physiologic doses of antioxidants (obtained from fruits, vegetables, and whole grains) can have on skin health, and on health in general.
Directory of Open Access Journals (Sweden)
Abhay Singh
2015-01-01
Full Text Available Background: Thrombopoietin (TPO is the key hematopoietic growth factor regulating the production of platelets from bone marrow megakaryocytes and maintaining platelet hemostasis. This study was done to find any relationship between the levels of thrombopoietin and the severity of disease in patients with aplastic anemia. Materials and Methods: Serum samples were collected from 52 patients with a confirmed diagnosis of aplastic anemia and 45 normal healthy blood donors of both sexes over a period of 2 years, and TPO was estimated by using commercially available TPO-specific-enzyme-linked immunosorbent assay. Results: The median TPO level of 1190 pg/ml (range 625-7651 pg/ml in aplastic anemia patients was significantly higher than the median TPO level of 121.1 pg/ml (81.25-237.7 pg/ml in normal healthy blood donors (P = 0.000. No significant difference was observed in TPO levels of male and female patients (P = 0.453. The median TPO concentrations observed in very severe aplastic anemia, severe aplastic anemia, and nonsevere aplastic anemia were 2765 pg/ml (range 625-6451 pg/ml, 1190 pg/ml (range 672.1-7651 pg/ml, and 1111.5 pg/ml (range 761.1-2289.2 pg/ml, respectively. TPO in patients of very severe aplastic anemia was significantly higher than patients of nonsevere aplastic anemia (P = 0.043, with no significant relation among rest of the groups. Discussion: TPO levels in aplastic anemia patients were significantly higher than in healthy blood donors; however, in aplastic anemia patients TPO levels were significantly higher only in patients with very severe disease.
Directory of Open Access Journals (Sweden)
Bharat Bhushan
2012-11-01
Full Text Available Skin can be damaged by the environment easily. Skin cream is an effective and rapid way to moisten the skin by changing the skin surface properties. Rat skin and pig skin are common animal models for studies and were used as skin samples in this study. The nano- and macroscale friction and durability of damaged skin were measured and compared with those of virgin (intact/undamaged skin. The effect of skin cream on friction and durability of damaged and virgin skin samples is discussed. The effects of velocity, normal load, relative humidity and number of cycles were studied. The nanoscale studies were performed by using atomic force microscope (AFM, and macroscale studies were performed by using a pin-on-disk (POD reciprocating tribometer. It was found that damaged skin has different mechanical properties, surface roughness, contact angle, friction and durability compared to that of virgin skin. But similar changes occur after skin cream treatment. Rat and pig skin show similar trends in friction and durability.
Bartelink, M L; Wollersheim, H; Theeuwes, A; van Duren, D; Thien, T
1990-05-01
1. It is known that females have a lower skin perfusion than males. In women there are also differences in blood flow at different reproductive stages of their lives. As an initial investigation of the possible contribution of sex hormones to these differences, we studied skin and forearm blood flow during the natural changes in hormone levels which occur during the menstrual cycle. 2. Thirty-one healthy female volunteers were studied. The effect of a standardized finger cooling test (immersion of a gloved hand in a 16 degrees C water bath) on finger skin temperature and on laser Doppler flux in the finger, and forearm blood flow (strain gauge venous occlusion plethysmography) was assessed at four different times during one cycle: during menstruation, 1 day before ovulation, 2 days after ovulation and at the mid-luteal phase. Test days were determined by daily measurements of basal body temperature and were confirmed afterwards by determinations of serum luteinizing hormone, follicle-stimulating hormone, 17 beta-oestradiol and progesterone. 3. Peripheral skin circulation varied significantly within one menstrual cycle. The extremes were a mean finger skin temperature of 25.9 +/- 3.0 degrees C in the luteal phase compared with 28.4 +/- 3.7 degrees C in the pre-ovulatory phase (P = 0.002). The respective values for the mean laser Doppler flux were 18.4 +/- 10.9 compared with 29.2 +/- 16.4 arbitrary units (P = 0.003). 4. Baseline forearm muscle blood flow also varied significantly (P = 0.04) within one menstrual cycle, with low values in the menstrual phase compared with the other phases.(ABSTRACT TRUNCATED AT 250 WORDS)
Polarization singularities of the object field of skin surface
International Nuclear Information System (INIS)
Angelsky, O V; Ushenko, A G; Ushenko, Yu A; Ushenko, Ye G
2006-01-01
The paper deals with the investigation of formation mechanisms of laser radiation polarization structure scattered by an optically thin surface layer of human skin in two registration zones: a boundary field and a far zone of Fraunhofer diffraction. The conditions of forming polarization singularities by such an object in the scattered radiation field have been defined. Statistical and fractal polarization structure of object fields of physiologically normal and pathologically changed skin has been studied. It has been shown that polarization singularities of radiation scattered by physiologically normal skin samples have a fractal coordinate structure. It is characteristic for fields of pathologically changed skin to have a statistical coordinate structure of polarization singularities in all diffraction zones
Analgesia with breastfeeding in addition to skin-to-skin contact during heel prick.
Marín Gabriel, Miguel Ángel; del Rey Hurtado de Mendoza, Beatriz; Jiménez Figueroa, Lourdes; Medina, Virginia; Iglesias Fernández, Beatriz; Vázquez Rodríguez, María; Escudero Huedo, Virginia; Medina Malagón, Lorena
2013-11-01
To investigate the analgesic effect (measured with Neonatal Infant Pain Scale (NIPS)) of breastfeeding (BF) in addition to skin-to-skin contact (SSC) versus other methods of non-pharmacological analgesia during blood sampling through heel lance in healthy term neonates. Randomised controlled trial. Tertiary level maternity ward. One hundred thirty-six healthy term newborns. healthy term neonates, wish to breastfeed and absence of feeding during the previous 60 min. Neonates were randomly assigned to four groups: Group breastfed with SSC (BF+SSC Group) (n=35); Group sucrose with SSC (Sucrose+SSC Group) (n=35); SSC Group (n=33); or Sucrose Group (n=33). Babies were recorded with a video camera. Three observers watched the videos and measured NIPS score at three time points (t0: 2 min before heel prick; t1: During heel prick; and t2: 2 min after the heel prick). The influences of non-pharmacological methods on crying time, percentage of crying while sampling, heart rate, number of attempts and duration of sampling were also studied. BF+SSC Group achieved a significant lower median NIPS score (value=1) compared with other groups (value=2, 4 and 4, respectively). The percentage of neonates with moderate-to-severe pain was also lower in the BF+SSC Group. Both groups BF+SSC and Sucrose+SSC achieved a significant lower percentage of crying compared with SSC Group. This study suggests that BF in addition to SSC provides superior analgesia to other kinds of non-pharmacological analgesia in healthy term neonates during heel prick.
Shadgan, Babak; Stothers, Lynn; Molavi, Behnam; Mutabazi, Sharif; Mukisa, Ronald; Macnab, Andrew
2015-02-01
Background: Prior research indicates the epidermal pigment layer of human skin (Melanin) has a significant absorption coefficient in the near infra-red (NIR) region; hence attenuation of light in vivo is a potential confounder for NIR spectroscopy (NIRS). A NIRS method developed for transcutaneous evaluation of bladder function is being investigated as a means of improving the burden of bladder disease in sub-Saharan Africa. This required development of a simple wireless NIRS device suitable for use as a screening tool in patients with pigmented skin where the NIR light emitted would penetrate through the epidermal pigment layer and return in sufficient quantity to provide effective monitoring. Methods: Two healthy subjects, one with pigmented skin and one with fair skin, were monitored as they voided spontaneously using the prototype transcutaneous NIRS device positioned over the bladder. The device was a self-contained wireless unit with light emitting diodes (wavelengths 760 and 850 nanometres) and interoptode distance of 4cm. The raw optical data were transmitted to a laptop where graphs of chromophore change were generated with proprietary software and compared between the subjects and with prior data from asymptomatic subjects. Results: Serial monitoring was successful in both subjects. Voiding volumes varied between 350 and 380 cc. In each subject the patterns of chromophore change, trend and magnitude of change were similar and matched the physiologic increase in total and oxygenated hemoglobin recognized to occur in normal bladder contraction during voiding. Conclusions: Skin pigmentation does not compromise the ability of transcutaneous NIRS to interrogate physiologic change in the bladder during bladder contraction in healthy subjects.
Histamine response and local cooling in the human skin: involvement of H1- and H2-receptors.
Grossmann, M; Jamieson, M J; Kirch, W
1999-08-01
Histamine may contribute locally to cutaneous blood flow control under normal and pathologic conditions. The objective of this study was to observe the influence of skin temperature on histamine vasodilation, and the roles of H1-and H2-receptors using novel noninvasive methods. Eleven healthy subjects received, double-blind, single doses of the H1-receptor antagonist cetirizine (10 mg), cetirizine (10 mg) plus the H2-receptor antagonist cimetidine (400 mg), or placebo on separate occasions. Histamine was dosed cumulatively by iontophoresis to the forearm skin at 34 degrees C and 14 degrees C. Laser-Doppler flux (LDF) was measured at the same sites using customised probeholder/iontophoretic chambers with Peltier cooling elements. Finger mean arterial pressure (MAP) was measured and cutaneous vascular conductance calculated as LDF/MAP. Histamine vasodilation was reduced in cold skin. Cetirizine shifted the histamine dose-response at both temperatures: statistically significantly at 14 degrees C only. Combined H1- and H2-receptor antagonism shifted the response significantly at both temperatures. H1- and H2-receptors mediate histamine-induced skin vasodilation. The sensitivity of these receptors, particularly the H1- receptor, is attenuated at low skin temperature. Whether the reduced effect in cold skin represents specific receptor or postreceptor desensitization, or nonspecific attenuation of cutaneous vasodilation remains to be elucidated.
Institute of Scientific and Technical Information of China (English)
TANG Jin; GUO Wei-chun; YU Ling; ZHAO Sheng-hao
2010-01-01
Objective: To observe the clinical efficacy of artificial skin combined with vacuum sealing drainage (VSD) in treating large-area skin defects.Methods: Totally 18 patients with skin defects, treated with artificial skin combined with VSD from September 2008to May 2009 in our hospital, were retrospectively analyzed in this study. There were 15 males and 3 females, aged 7-66years, 34.3 years on average. Among them, 10 cases had skin laceration caused by traffic accidents (7 with open fractures), 1 mangled injury, 1 blast injury, 1 stump infection combined with skin defects after amputation and 5 heel ulcers.Results: All skin grafts in 16 cases survived after being controlled by VSD for one time. For the rest 2 patients,one with skin avulsion on the left foot was given median thickness skin grafts after three times of VSD, the other with open fractures in the left tibia and fibula caused by a traffic accident was given free flap transplantation. Skin grafts of both patients survived, with normal color and rich blood supply.Conclusion: Skin grafting in conjunction with artificial skin and VSD is much more effective than traditional dressing treatment and worth wide application in clinic.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Can Functional Cardiac Age be Predicted from ECG in a Normal Healthy Population
Schlegel, Todd; Starc, Vito; Leban, Manja; Sinigoj, Petra; Vrhovec, Milos
2011-01-01
In a normal healthy population, we desired to determine the most age-dependent conventional and advanced ECG parameters. We hypothesized that changes in several ECG parameters might correlate with age and together reliably characterize the functional age of the heart. Methods: An initial study population of 313 apparently healthy subjects was ultimately reduced to 148 subjects (74 men, 84 women, in the range from 10 to 75 years of age) after exclusion criteria. In all subjects, ECG recordings (resting 5-minute 12-lead high frequency ECG) were evaluated via custom software programs to calculate up to 85 different conventional and advanced ECG parameters including beat-to-beat QT and RR variability, waveform complexity, and signal-averaged, high-frequency and spatial/spatiotemporal ECG parameters. The prediction of functional age was evaluated by multiple linear regression analysis using the best 5 univariate predictors. Results: Ignoring what were ultimately small differences between males and females, the functional age was found to be predicted (R2= 0.69, P ECGs, functional cardiac age can be estimated by multiple linear regression analysis of mostly advanced ECG results. Because some parameters in the regression formula, such as QTcorr, high frequency QRS amplitude and P-wave width also change with disease in the same direction as with increased age, increased functional age of the heart may reflect subtle age-related pathologies in cardiac electrical function that are usually hidden on conventional ECG.
Elevation of telomerase activity in chronic radiation ulcer of human skin
International Nuclear Information System (INIS)
Li Xiaoying; Zhao Po; Wang Dewen; Yang Zhixiang
1997-01-01
Objective: To investigate the levels of telomerase activity in chronic radiation ulcers of human skin and the possible relationship between the enzyme and cancer transformation. Method: Using nonisotopic telomere repeat amplification protocol (TRAP), detections were performed in 20 cases of chronic radiation ulcers of human skin, 5 cases of normal skin tissues and 5 cases of carcinoma. Results: The positive rates for telomerase activity were 30.0%(6/20), 0(0/5) and 100%(5/5) in chronic radiation ulcers of human skin, normal skin and carcinoma, respectively. The telomerase activity in radiation ulcer was weaker than in carcinoma. Conclusion: The telomerase activity assay might be used as a marker for predicting the prognosis and the effect of treatment in chronic radiation ulcer of human skin
The Pinking Shears: A Novel Tool for Improving Skin Graft Cosmesis
Directory of Open Access Journals (Sweden)
Cormac W. Joyce, MB BCh
2014-12-01
Full Text Available Summary: A significant aesthetic disadvantage to split skin grafts is the obvious transition between the graft and the normal skin. We report on a novel method to interrupt this transition point by using pinking shears, which are dressmaking scissors with saw-toothed blades that create a chevron pattern instead of a straight edge. We describe a case where the pinking shears were utilized on a split skin graft and Integra for reconstruction of the skin on a volar forearm. This technique allows for breaking-up of the transition point between the skin graft and normal skin and gives rise to an improved aesthetic outcome as the boundary is significantly less well-defined. This novel method shows promise and further study is certainly warranted.
Fujimura, Tsutomu; Makino, Mayumi; Takagi, Miyuki; Maki, Kumiko; Murakami, Emiko; Tasaka, Yoshiko; Sato, Noriko; Akiba, Shunichi; Hotta, Mitsuyuki; Kitahara, Takashi; Ando, Kikue
2016-05-01
The mechanisms of skin breakdown induced by incontinence have been proposed from a variety of experimental studies. However, studies on the influence of skin properties caused by incontinence of bedridden subjects are very limited. This work was conducted to reveal how incontinence influences skin properties by comparing bedridden incontinent elderly subjects with age-matched healthy continent elderly and middle-aged subjects. Bedridden incontinent elderly subjects (n = 35, 83.5 ± 9.7 years, mean age ± SD), healthy continent elderly (n = 41, 75.9 ± 5.6 years), and middle-aged (n = 20, 41.3 ± 2.8 years) were recruited for this study. Skin surface pH, capacitance/hydration, transepidermal water loss, and bacteria on forearm and buttock skin were measured. Hydration and transepidermal water loss values between healthy elderly subjects and incontinent elderly subjects were significantly different on buttock skin. Significant differences between those two groups were also observed regarding pH and total bacteria levels on buttock skin. The forearm skin showed no significant difference in these parameters. No significant influence was observed between with and without urination at the measurement time except for the pH of buttock skin. No significant correlation was observed except between pH and bacteria levels on buttock skin of incontinent elderly subjects. In this study, we clarified the characteristic features of skin induced by incontinence. Our results indicate that these parameters are adequate not only to evaluate the characteristic skin features of bedridden incontinent subjects but also to develop new diapers to avoid the diaper dermatitis caused by incontinence. © 2015 The International Society of Dermatology.
Göllner, Imke; Voss, Werner; von Hehn, Ulrike; Kammerer, Susanne
2017-10-01
Intake of oral supplements with the aim of a cutaneous antiaging effect are increasingly common. Hyaluronic acid (HA) is a promising candidate, as it is the key factor for preserving tissue hydration. In our practice study, we evaluated the effect of an oral HA preparation diluted in a cascade-fermented organic whole food concentrate supplemented with biotin, vitamin C, copper, and zinc (Regulatpro Hyaluron) on skin moisture content, elasticity, skin roughness, and wrinkle depths. Twenty female subjects with healthy skin in the age group of 45 to 60 years took the product once daily for 40 days. Different skin parameters were objectively assessed before the first intake, after 20 and after 40 days. Intake of the HA solution led to a significant increase in skin elasticity, skin hydration, and to a significant decrease in skin roughness and wrinkle depths. The supplement was well tolerated; no side effects were noted throughout the study.
Wu, Y; Niu, Y; Zhong, S; Liu, H; Zhen, Y; Saint-Leger, D; Verschoore, M
2013-10-01
This preliminary study investigated both the impact of oily skin on quality of life (QoL) and the agreement between subjective oily skin self-assessment and objective skin surface sebum measurement in young to middle-aged Chinese women in Beijing. A 18-item Chinese version of the Oily Skin Self-Image Questionnaire (OSSIQ) was used to assess the impact of oily skin on QoL in 300 healthy female subjects (age groups: 20-25; 26-30; 31-35,). The subjects were divided equally into the oily skin group and the non-oily skin group based on their self-perception of skin oiliness. The level of skin surface lipids (SSL) was measured on the middle of the forehead, and both cheeks using the Sebumeter(®). In order to assess the agreement between self-perceived skin oiliness and measured SSL, we tentatively used the SSL median value as a dividing point to regroup all subjects. The results indicate that the Chinese version of the OSSIQ distinguished the oily skin group from the non-oily skin group. Subjects in the oily skin group had significant higher emotional status score and behavior score when compared with subjects in the non-oily skin group. Subjects in the oily skin group had higher SSL when compared with subjects in the non-oily skin group, especially in younger age groups. The agreement between self-perceived skin oiliness and measured SSL was moderately strong in younger age groups, and declined with age. These results strongly suggest that having oily skin can cause a significant negative impact on QoL among Chinese women. The Chinese version of the OSSIQ is a reliable and valid tool for assessing the impact of oily skin on QoL. The accuracy of oily skin self-assessment declines with age. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Energy Technology Data Exchange (ETDEWEB)
Rude' e, J.M.; Friedberg, E.C.
1977-03-01
Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.
Increased numbers of CD4+ and CD8+ T cells in lesional skin of cats with allergic dermatitis.
Roosje, P J; van Kooten, P J; Thepen, T; Bihari, I C; Rutten, V P; Koeman, J P; Willemse, T
1998-07-01
The aim of this study was to characterize T cells in the skin of cats with an allergic dermatitis histologically compatible with atopic dermatitis, since T cells play an important role in the pathogenesis of atopic dermatitis in humans. We observed a significantly greater number of T cells in lesional skin of domestic short-haired cats with allergic dermatitis (n = 10; median age 5.8 years) than in the skin of healthy control animals (n = 10; median age 5.0 years). In the skin of the healthy control animals, one or two CD4+ cells and no CD8+ cells were found. A predominant increase of CD4+ T cells and a CD4+/CD8+ ratio (mean +/- SD: 3.9 +/- 2.0) was found in the lesional skin of 10 cats with allergic dermatitis. The CD4+/CD8+ cell ratio in the skin of healthy control animals could not be determined because of the absence of CD8+ cells. The CD4+/CD8+ cell ratio in the peripheral blood of 10 cats with allergic dermatitis (mean +/- SD: 1.9 +/- 0.4) did not differ significantly from that in 10 healthy control animals (2.2 +/- 0.4). The CD4+/CD8+ cell ratio and predominance of CD4+ T cells in the lesional skin of cats with allergic dermatitis is comparable to that found in atopic dermatitis in humans. In addition, the observed increase of CD4+ T cells in the nonlesional skin of cats with allergic dermatitis compared to the skin of healthy cats is similar to what is seen in humans. Cytokines produced by T cells and antigen-specific T cells are important mediators in the inflammatory cascade resulting in atopic dermatitis in humans. This study is a first step to investigate their role in feline allergic dermatitis.
Nanocarriers for skin delivery of cosmetic antioxidants
Directory of Open Access Journals (Sweden)
Lucia Montenegro
2014-08-01
Full Text Available The demand of natural skin care products is steadily growing since consumers perceive them as safe. Currently, cosmetic manufacturers are focusing their efforts on developing innovative natural products to address skin-aging signs, thus meeting consumers’ needs of healthy appearance and well-being. To prevent or treat skin aging, topical supplementation with antioxidant is regarded as one of the most promising strategies. However, most antioxidants presently used in skin care formulations show unfavorable physicochemical properties such as excessive lipophilicity or hydrophilicity, chemical instability and poor skin penetration that actively limit their effectiveness after topical application. Therefore, nanocarriers such as liposomes, niosomes, microemulsions and nanoparticles have been widely investigated as delivery systems for antioxidants to improve their beneficial effects in the treatment of skin aging. In this article, the antioxidants most commonly used in anti-aging cosmetic products will be reviewed along with the nanocarriers designed to improve their safety and effectiveness.
Developing a Reference of Normal Lung Sounds in Healthy Peruvian Children
Ellington, Laura E.; Emmanouilidou, Dimitra; Elhilali, Mounya; Gilman, Robert H.; Tielsch, James M.; Chavez, Miguel A.; Marin-Concha, Julio; Figueroa, Dante; West, James
2018-01-01
Purpose Lung auscultation has long been a standard of care for the diagnosis of respiratory diseases. Recent advances in electronic auscultation and signal processing have yet to find clinical acceptance; however, computerized lung sound analysis may be ideal for pediatric populations in settings, where skilled healthcare providers are commonly unavailable. We described features of normal lung sounds in young children using a novel signal processing approach to lay a foundation for identifying pathologic respiratory sounds. Methods 186 healthy children with normal pulmonary exams and without respiratory complaints were enrolled at a tertiary care hospital in Lima, Peru. Lung sounds were recorded at eight thoracic sites using a digital stethoscope. 151 (81 %) of the recordings were eligible for further analysis. Heavy-crying segments were automatically rejected and features extracted from spectral and temporal signal representations contributed to profiling of lung sounds. Results Mean age, height, and weight among study participants were 2.2 years (SD 1.4), 84.7 cm (SD 13.2), and 12.0 kg (SD 3.6), respectively; and, 47 % were boys. We identified ten distinct spectral and spectro-temporal signal parameters and most demonstrated linear relationships with age, height, and weight, while no differences with genders were noted. Older children had a faster decaying spectrum than younger ones. Features like spectral peak width, lower-frequency Mel-frequency cepstral coefficients, and spectro-temporal modulations also showed variations with recording site. Conclusions Lung sound extracted features varied significantly with child characteristics and lung site. A comparison with adult studies revealed differences in the extracted features for children. While sound-reduction techniques will improve analysis, we offer a novel, reproducible tool for sound analysis in real-world environments. PMID:24943262
The relationship of psychological trauma with trichotillomania and skin picking.
Özten, Eylem; Sayar, Gökben Hızlı; Eryılmaz, Gül; Kağan, Gaye; Işık, Sibel; Karamustafalıoğlu, Oğuz
2015-01-01
Interactions between psychological, biological and environmental factors are important in development of trichotillomania and skin picking. The aim of this study is to determine the relationship of traumatic life events, symptoms of post-traumatic stress disorder and dissociation in patients with diagnoses of trichotillomania and skin picking disorder. The study included patients who was diagnosed with trichotillomania (n=23) or skin picking disorder (n=44), and healthy controls (n=37). Beck Depression Inventory, Traumatic Stress Symptoms Scale and Dissociative Experiences Scale were administered. All groups checked a list of traumatic life events to determine the exposed traumatic events. There was no statistical significance between three groups in terms of Dissociative Experiences Scale scores (P=0.07). But Beck Depression Inventory and Traumatic Stress Symptoms Scale scores of trichotillomania and skin picking groups were significantly higher than the control group. Subjects with a diagnosis of trichotillomania and skin picking reported statistically significantly higher numbers of traumatic and negative events in childhood compared to healthy subjects. We can conclude that trauma may play a role in development of both trichotillomania and skin picking. Increased duration of trichotillomania or skin picking was correlated with decreased presence of post-traumatic stress symptoms. The reason for the negatively correlation of severity of post-traumatic stress symptoms and self-harming behavior may be speculated as developing trichotillomania or skin picking symptoms helps the patient to cope with intrusive thoughts related to trauma. Future longitudinal research must focus on whether trauma and post-traumatic stress or trichotillomania and skin picking precede the development of mental disorder.
Han, J Y; Nam, G W; Lee, H K; Kim, M J; Kim, E J
2015-11-01
This study was conducted to develop methods for measuring skin fine-structure via optical image and apparatus for photographing to analyze efficacy of anti-aging. We developed an apparatus named 3D Skin CycloScan(™) to evaluate the efficacy of cosmetics by imagification of skin fine-structure such as wrinkles, pores, and skin texture. The semi-sphere shaped device has 12 different sequential flashing light sources captures optical image simultaneously in one second to exclude the influence of the subject's movement. The normal map that is extracted through shape from shading method is composed of face contour and skin fine-structure parts. When the low-frequency component which is the result of the Gaussian Filter application is eliminated, we can get only skin fine-structure. In this normal map, it is possible to extract two-dimensional vector map called direction map and we can regulate the intensity of the image of wrinkles, pores, and skin texture after filtering the direction map. We performed a clinical study to apply this new apparatus and methods to evaluate an anti-aging efficacy of cosmetics visually and validate with other conventional methods. After using anti-aging cream including 2% adenosine for 8 weeks, the total amount of fine wrinkle around eye area detected via 3D Skin CycloScan(™) was reduced by 12.1%. Also, wrinkles on crow's feet measured by PRIMOS COMPACT(®) (GFMesstechnik GmbH, Germany) reduced 11.7%. According to an aspect of the present study, by changing the direction of the lights toward to subject's skin, we can obtain the information about the fine structures present on the skin such as wrinkles, pores, or skin texture and represent it as an image. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
The Microbiota of the Human Skin.
Egert, Markus; Simmering, Rainer
2016-01-01
The aim of this chapter is to sum up important progress in the field of human skin microbiota research that was achieved over the last years.The human skin is one of the largest and most versatile organs of the human body. Owing to its function as a protective interface between the largely sterile interior of the human body and the highly microbially contaminated outer environment, it is densely colonized with a diverse and active microbiota. This skin microbiota is of high importance for human health and well-being. It is implicated in several severe skin diseases and plays a major role in wound infections. Many less severe, but negatively perceived cosmetic skin phenomena are linked with skin microbes, too. In addition, skin microorganisms, in particular on the human hands, are crucial for the field of hygiene research. Notably, apart from being only a potential source of disease and contamination, the skin microbiota also contributes to the protective functions of the human skin in many ways. Finally, the analysis of structure and function of the human skin microbiota is interesting from a basic, evolutionary perspective on human microbe interactions.Key questions in the field of skin microbiota research deal with (a) a deeper understanding of the structure (species inventory) and function (physiology) of the healthy human skin microbiota in space and time, (b) the distinction of resident and transient skin microbiota members, (c) the distinction of beneficial skin microorganisms from microorganisms or communities with an adverse or sickening effect on their hosts, (d) factors shaping the skin microbiota and its functional role in health and disease, (e) strategies to manipulate the skin microbiota for therapeutic reasons.
Guo, X; Ruiz, A; Rando, R R; Bok, D; Gudas, L J
2000-11-01
When exogenous [(3)H]retinol (vitamin A) was added to culture medium, normal human epithelial cells from the oral cavity, skin, lung and breast took up and esterified essentially all of the [(3)H]retinol within a few hours. As shown by [(3)H]retinol pulse-chase experiments, normal epithelial cells then slowly hydrolyzed the [(3)H]retinyl esters to [(3)H]retinol, some of which was then oxidized to [(3)H]retinoic acid (RA) over a period of several days. In contrast, cultured normal human fibroblasts and human umbilical vein endothelial cells (HUVEC) did not esterify significant amounts of [(3)H]retinol; this lack of [(3)H]retinol esterification was correlated with a lack of expression of lecithin:retinol acyltransferase (LRAT) transcripts in normal fibroblast and HUVEC strains. These results indicate that normal, differentiated cell types differ in their ability to esterify retinol. Human carcinoma cells (neoplastically transformed epithelial cells) of the oral cavity, skin and breast did not esterify much [(3)H]retinol and showed greatly reduced LRAT expression. Transcripts of the neutral, bile salt-independent retinyl ester hydrolase and the bile salt-dependent retinyl ester hydrolase were undetectable in all of the normal cell types, including the epithelial cells. These experiments suggest that retinoid-deficiency in the tumor cells could develop because of the lack of retinyl esters, a storage form of retinol.
Hydrocortisone Diffusion Through Synthetic Membrane, Mouse Skin, and Epiderm™ Cultured Skin.
Christensen, John Mark; Chuong, Monica Chang; Le, Hang; Pham, Loan; Bendas, Ehab
2011-03-01
OBJECTIVES: The penetration of hydrocortisone (HC) from six topical over-the-counter products along with one prescription cream through cultured normal human-derived epidermal keratinocytes (Epiderm™), mouse skin and synthetic nylon membrane was performed as well as the effect hydrating the skin by pre-washing was explored using the Upright Franz Cell. METHOD AND RESULTS: Permeation of HC through EpiDerm™, mouse skin and synthetic membrane was highest with the topical HC gel formulation with prewash treatment of the membranes among seven products evaluated, 198 ± 32 µg/cm(2), 746.32 ± 12.43 µg/cm(2), and 1882 ± 395.18 µg/cm(2), respectively. Pre-washing to hydrate the skin enhanced HC penetration through EpiDerm™ and mouse skin. The 24-hour HC released from topical gel with prewash treatment was 198.495 ± 32 µg/cm(2) and 746.32 ± 12.43 µg/cm(2) while without prewash, the 24-h HC released from topical gel was 67.2 ± 7.41 µg/cm(2) and 653.43 ± 85.62 µg/cm(2) though EpiDerm™ and mouse skin, respectively. HC penetration through synthetic membrane was ten times greater than through mouse skin and EpiDerm™. Generally, the shape, pattern, and rank order of HC diffusion from each commercial product was similar through each membrane.
Hyperelastic Material Properties of Mouse Skin under Compression.
Directory of Open Access Journals (Sweden)
Yuxiang Wang
Full Text Available The skin is a dynamic organ whose complex material properties are capable of withstanding continuous mechanical stress while accommodating insults and organism growth. Moreover, synchronized hair cycles, comprising waves of hair growth, regression and rest, are accompanied by dramatic fluctuations in skin thickness in mice. Whether such structural changes alter skin mechanics is unknown. Mouse models are extensively used to study skin biology and pathophysiology, including aging, UV-induced skin damage and somatosensory signaling. As the skin serves a pivotal role in the transfer function from sensory stimuli to neuronal signaling, we sought to define the mechanical properties of mouse skin over a range of normal physiological states. Skin thickness, stiffness and modulus were quantitatively surveyed in adult, female mice (Mus musculus. These measures were analyzed under uniaxial compression, which is relevant for touch reception and compression injuries, rather than tension, which is typically used to analyze skin mechanics. Compression tests were performed with 105 full-thickness, freshly isolated specimens from the hairy skin of the hind limb. Physiological variables included body weight, hair-cycle stage, maturity level, skin site and individual animal differences. Skin thickness and stiffness were dominated by hair-cycle stage at young (6-10 weeks and intermediate (13-19 weeks adult ages but by body weight in mature mice (26-34 weeks. Interestingly, stiffness varied inversely with thickness so that hyperelastic modulus was consistent across hair-cycle stages and body weights. By contrast, the mechanics of hairy skin differs markedly with anatomical location. In particular, skin containing fascial structures such as nerves and blood vessels showed significantly greater modulus than adjacent sites. Collectively, this systematic survey indicates that, although its structure changes dramatically throughout adult life, mouse skin at a given
Effects of temperature on bleeding time and clotting time in normal male and female volunteers.
Valeri, C R; MacGregor, H; Cassidy, G; Tinney, R; Pompei, F
1995-04-01
This study was done to assess the effects of temperature on bleeding time and clotting time in normal male and female volunteers. Open study utilizing normal volunteers. University research laboratory. Fifty-four healthy male and female volunteers, ranging in age from 19 to 35 yrs, who were not receiving medications. The study was done and the samples of venous blood and shed blood collected at the template bleeding time site were obtained at a convenient time for each volunteer. Skin temperature was changed from +20 degrees to +38 degrees C and blood samples were obtained from the antecubital vein of each volunteer. The effect of local skin temperature ranging from +20 degrees to +38 degrees C on bleeding time was evaluated in 38 normal volunteers (19 male and 19 female). Skin temperature was maintained at +20 degrees to +38 degrees C by cooling or warming the forearm. At each temperature, measurements were made of complete blood count, bleeding time, and thromboxane B2 concentrations in shed blood collected at the template bleeding time site and in serum and plasma isolated from blood collected from the antecubital vein. Clotting time studies were measured in 16 normal volunteers (eight male and eight female) at temperatures ranging from +22 degrees to +37 degrees C. At +32 degrees C, the bleeding time was longer and hematocrit was lower in female than in male volunteers. However, at local skin temperatures of < +32 degrees C, both the males and females exhibited significantly increased bleeding times, which were associated with a reduction in shed blood thromboxane B2. Each 1 degree C decrease in temperature was associated with a 15% decrease in the shed blood thromboxane B2 concentration. Clotting times were three times longer at +22 degrees C than at +37 degrees C. Each 1 degree C reduction in the temperature of the clotted blood was associated with a 15% reduction in the serum thromboxane B2 concentration. Our data indicate that during surgical procedures, it
Rössing, K; Novak, N; Mommert, S; Pfab, F; Gehring, M; Wedi, B; Kapp, A; Raap, U
2011-10-01
Chronic spontaneous urticaria is triggered by many direct and indirect aggravating factors including autoreactive/autoimmune mechanisms, infections, non-allergic and pseudoallergic intolerance reactions. However, the role of neuroimmune mechanisms in chronic spontaneous urticaria so far is unclear. Thus, we wanted to address the regulation of the neurotrophin brain-derived neurotrophic factor (BDNF) in serum and inflammatory skin of patients with chronic spontaneous urticaria in comparison to subjects with healthy skin. Fifty adult patients with chronic spontaneous urticaria and 23 skin-healthy subjects were studied. Chronic spontaneous urticaria was defined as recurrent weals for more than 6 weeks. Autologous serum skin test was performed in all patients with chronic spontaneous urticaria and BDNF serum levels were analysed by enzyme immunoassay in all subjects. Furthermore, skin biopsies were taken from weals of eight patients with chronic spontaneous urticaria as well as from healthy skin of eight controls to evaluate the expression of BDNF and its receptors including tyrosine kinase (trk) B and pan-neurotrophin receptor p75(NTR) by immunohistochemistry. BDNF serum levels were detectable in all subjects studied. However, BDNF levels were significantly higher in patients with chronic spontaneous urticaria compared to non-atopic skin-healthy controls (Pchronic spontaneous urticaria compared with controls (Pchronic spontaneous urticaria and controls and no difference in BDNF serum levels between autologous serum skin test-positive (n=23) and -negative (n=27) patients with chronic spontaneous urticaria. This study shows that BDNF is increased in serum and diseased skin of patients with chronic spontaneous urticaria, suggesting a role for neurotrophins in the pathophysiology of this chronic inflammatory skin disease. Further studies are needed to address the functional role of BDNF on key target effector cells in chronic spontaneous urticaria to establish new
Directory of Open Access Journals (Sweden)
VijayKumar Patra
2018-05-01
Full Text Available The human skin is known to be inhabited by diverse microbes, including bacteria, fungi, viruses, archaea, and mites. This microbiome exerts a protective role against infections by promoting immune development and inhibiting pathogenic microbes to colonize skin. One of the factors having an intense effect on the skin and its resident microbes is ultraviolet-radiation (UV-R. UV-R can promote or inhibit the growth of microbes on the skin and modulate the immune system which can be either favorable or harmful. Among potential UV-R targets, skin resident memory T cells (TRM stand as well positioned immune cells at the forefront within the skin. Both CD4+ or CD8+ αβ TRM cells residing permanently in peripheral tissues have been shown to play prominent roles in providing accelerated and long-lived specific immunity, tissue homeostasis, wound repair. Nevertheless, their response upon UV-R exposure or signals from microbiome are poorly understood compared to resident TCRγδ cells. Skin TRM survive for long periods of time and are exposed to innumerable antigens during lifetime. The interplay of TRM with skin residing microbes may be crucial in pathophysiology of various diseases including psoriasis, atopic dermatitis and polymorphic light eruption. In this article, we share our perspective about how UV-R may directly shape the persistence, phenotype, specificity, and function of skin TRM; and moreover, whether UV-R alters barrier function, leading to microbial-specific skin TRM, disrupting the healthy balance between skin microbiome and skin immune cells, and resulting in chronic inflammation and diseased skin.
DEFF Research Database (Denmark)
Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...
MR imaging of the uterus and cervix in healthy women: Determination of normal values
International Nuclear Information System (INIS)
Hauth, Elke A.M.; Libera, Hanna; Lange, Silke; Forsting, Michael; Jaeger, Horst J.
2007-01-01
The purpose of this study was to establish normal values for the volume of the uterus and cervix in MRI based on age and the menstrual cycle phase. We performed MRI of the pelvis in 100 healthy women. For the uterus, they were further divided into two groups: one with myomas and/or adenomyosis and one without either. The volume of the uterus and cervix and thickness of the uterine wall layers were analysed by age and the menstrual cycle phase. The mean volume of the uterus in both groups and the cervix significantly increased with age to reach its peak at 41-50 years, and then dropped. Likewise, the thickness of the endometrium and the junctional zone, but not the myometrium, significantly increased until 41-50 years, and then decreased. When we compared the volume of the uterus and cervix and the thickness of the uterine wall layers between the two phases of the menstrual cycle, we found no significant differences. The volume of the uterus and cervix and the thickness of the endometrium and junctional zone differ significantly with age, but not between the two phases of the menstrual cycle. Knowledge of MRI-related normal values can be expected to aid the early identification of uterine pathologies. (orig.)
What Limits Cardiac Performance during Exercise in Normal Subjects and in Healthy Fontan Patients?
Directory of Open Access Journals (Sweden)
André La Gerche
2010-01-01
Full Text Available Exercise is an important determinant of health but is significantly reduced in the patient with a univentricular circulation. Normal exercise physiology mandates an increase in pulmonary artery pressures which places an increased work demand on the right ventricle (RV. In a biventricular circulation with pathological increases in pulmonary vascular resistance and/or reductions in RV function, exercise-induced augmentation of cardiac output is limited. Left ventricular preload reserve is dependent upon flow through the pulmonary circulation and this requires adequate RV performance. In the Fontan patient, the reasons for exercise intolerance are complex. In those patients with myocardial dysfunction or other pathologies of the circulatory components, it is likely that these abnormalities serve as a limitation to cardiac performance during exercise. However, in the healthy Fontan patient, it may be the absence of a sub-pulmonary pump which limits normal increases in pulmonary pressures, trans-pulmonary flow requirements and cardiac output. If so, performance will be exquisitely dependent on pulmonary vascular resistance. This provides a potential explanation as to why pulmonary vasodilators may improve exercise tolerance. As has recently been demonstrated, these agents may offer an important new treatment strategy which directly addresses the physiological limitations in the Fontan patient.
Laser-induced fluorescence for the detection of esophageal and skin cancer
Vo-Dinh, Tuan; Panjehpour, Masoud; Overholt, Bergein F.; Julius, Clark E.; Overholt, Suzanne; Phan, Mary N.
2003-07-01
Laser-induced fluorescence (LIF) is used for in-vivo cancer diagnosis of the esophagus and skin cancer. For esophageal measurements a fiberoptic probe inserted through an endoscope was used. Autofluorescence of normal and malignant tissues were measured directly on patient skin without requiring an endoscope. Measurement of the fluorescence signal from the tissue was performed using laser excitation at 410 nm. The methodology was applied to differentiate normal and malignant tumors of the esophagus and malignant skin lesions. The results of this LIF approach were compared with histopathology results of the biopsy samples and indicated excellent agreement in the classification of normal and malignant tumors for the samples investigated.
[Skin hydration and hydrating products].
Duplan, H; Nocera, T
2018-05-01
One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.
Tanaka, Akane; Matsuda, Akira; Jung, Kyungsook; Jang, Hyosun; Ahn, Ginnae; Ishizaka, Saori; Amagai, Yosuke; Oida, Kumiko; Arkwright, Peter D; Matsuda, Hiroshi
2015-09-01
Mineral ions in tap water react with fatty acids in soap, leading to the formation of insoluble precipitate (metallic soap) on skin during washing. We hypothesised that metallic soap might negatively alter skin conditions. Application of metallic soap onto the skin of NC/Tnd mice with allergic dermatitis further induced inflammation with elevation of plasma immunoglobulin E and proinflammatory cytokine expression. Pruritus and dryness were ameliorated when the back of mice was washed with soap in Ca2+- and Mg2+-free ultra-pure soft water (UPSW). Washing in UPSW, but not tap water, also protected the skin of healthy volunteers from the soap deposition. Furthermore, 4 weeks of showering with UPSW reduced dryness and pruritus of human subjects with dry skin. Washing with UPSW may be therapeutically beneficial in patients with skin troubles.
The involvement of galectin-3 in skin injury in systemic lupus erythematosus patients.
Shi, Z; Meng, Z; Han, Y; Cao, C; Tan, G; Wang, L
2018-04-01
Objective Our previous research suggested that anti-galectin-3 antibody was highly associated with the development of lupus skin lesions in systemic lupus erythematosus (SLE). In this study we aimed to investigate the involvement of galectin-3 in SLE skin damage. Methods The study consisted of 49 patients with SLE, 16 with dermatomyositis and 11 with systemic scleroderma and 20 healthy controls. Galectin-3 was examined by ELISA and immunohistochemical staining in serum and skin, respectively. Results Serum galectin-3 was significantly higher in patients with SLE than in those with dermatomyositis ( P 0.05). As for subtypes of skin lesions in SLE, galectin-3 expression was lower in chronic cutaneous lupus erythematosus than in acute cutaneous lupus erythematosus ( P = 0.0439). Conclusion Serum galectin-3 is unlikely to play a role in the pathogenesis of lupus skin damage, but can be a potential biomarker for the measurement of SLE disease activity. Galectin-3 is greatly reduced in patients with lupus lesions compared with healthy controls, which may contribute to the recruitment of inflammatory cells in the skin.
Radiation exposure to skin following radioactive contamination
International Nuclear Information System (INIS)
Baumann, H.; Beyermann, M.; Kraus, W.
1989-01-01
In the case of skin contamination intensive decontamination measures should not be carried out until the potential radiation exposure to the basal cell layer of the epidermis was assessed. Dose equivalent rates from alpha-, beta- or photon-emitting contaminants were calculated with reference to the surface activity for different skin regions as a function of radiation energy on the condition that the skin was healthy and uninjured and the penetration of contaminants through the epidermis negligible. The results have been presented in the form of figures and tables. In the assessment of potential skin doses, both radioactive decay and practical experience as to the decrease in the level of surface contamination by natural desquamation of the stratum corneum were taken into account. 9 figs., 5 tabs., 46 refs. (author)
International Nuclear Information System (INIS)
Marchese, M.J.; Minarik, L.; Hall, E.J.; Zaider, M.
1985-01-01
Radiation cell survival data were obtained in vitro for three cell lines isolated from human tumours traditionally considered to be radioresistant-two melanomas and one osteosarcoma-as well as from a diploid skin fibroblast cell line. One melanoma cell line was much more radioresistant than the other, while the osteosarcoma and fibroblast cell lines were more radiosensitive than either. For cells growing exponentially, little potentially lethal damage repair (PLDR) could be demonstrated by comparing survival data for cells in which subculture was delayed by 6 h with those sub-cultured immediately after treatment. For the malignant cells in plateau phase, which in these cells might be better termed 'slowed growth phase', since an appreciable fraction of the cells are still cycling, a small amount of PLDR was observed, but not as much as reported by other investigators in the literature. The normal fibroblasts, which achieved a truer plateau phase in terms of noncycling cells, showed a significantly larger amount of PLDR than the tumour cells. (author)
Expression of p63 and Cyclooxygenase-2 and Their Correlation in Skin Tumors
Institute of Scientific and Technical Information of China (English)
WU Yan; LIU Houjun; LI Jiawen
2007-01-01
To study the expression of p63 and cyclooxygenase-2 (cox-2) in skin tumors and evaluate the correlation between p63 and cox-2, the expressions of cox-2 and p63 were measured by streptavidin-peroxidase complex immunohistochemical technique in 17 cases of skin squamous cell carcinoma (SCC), 19 cases of Bowen's disease(Bowen), 11 cases of actinic keratosis(AK), 12 cases of seborreic keratosis(SK) and 13 specimens of normal skin. Our results showed that the expression of p63 in skin squamous cell carcinoma, Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while the expression of p63 in seborreic keratosis was significantly higher than that in normal skin. The expression of cox-2 in skin squamous cell carcinoma,Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while no statistical difference was noted in the expression of cox-2 between seborreic keratosis and normal skin. Cox-2 expression was positively correlated with the high p63 expression in malignant skin tumors. The increased expression of cox-2 and p63 may play an important role in the development of skin tumors and work synergetically in malignant skin tumors.
Directory of Open Access Journals (Sweden)
Juturu V
2016-10-01
Full Text Available Vijaya Juturu,1 James P Bowman,2 Jayant Deshpande1 1Department of Scientific and Clinical Affairs, OmniActive Health Technologies Inc., Morristown, NJ, 2James P Bowman & Associates LLC, Loveland, OH, USA Purpose: Carotenoids, especially lutein and zeaxanthin isomers (L/Zi, filter blue light and protect skin from environmental factors including high-energy sources. These carotenoids may be able to block the formation of melanin pathways, decrease cytokines, and increase antioxidants.Subjects and methods: This is a randomized, double-blind, placebo-controlled clinical trial over a 12-week supplementation period. Fifty healthy people (50 healthy subjects were recruited and 46 subjects completed the study (males and females, age: 18–45 years with mild-to-moderate dry skin were included in this study. Skin type of the subjects was classified as Fitzpatrick skin type II–IV scale. Subjects were administered with either an oral dietary supplement containing 10 mg lutein (L and 2 mg zeaxanthin isomers (Zi (L/Zi: RR-zeaxanthin and RS (meso-zeaxanthin or a placebo daily for 12 weeks. The minimal erythemal dose and skin lightening (L* were measured via the Chromameter®. The individual typological angle was calculated. Subjective assessments were also recorded.Results: Overall skin tone was significantly improved in the L/Zi group compared to placebo (P<0.0237, and luminance (L* values were significantly increased in the L/Zi group. Mean minimal erythemal dose was increased with L/Zi supplementation after 12 weeks of supplementation. L/Zi supplementation significantly increased the individual typological angle.Conclusion: L/Zi supplementation lightens and improves skin conditions. Keywords: lutein, zeaxanthin isomers, skin lightening, minimal erythemal dose, individual typological angle, overall skin tone
Zwedberg, Sofia; Blomquist, Josefin; Sigerstad, Emelie
2015-01-01
to explore midwives' experiences and perceptions of skin-to-skin contact between mothers and their healthy full-term infants immediately and during the first day after caesarean section. qualitative interviews with semi-structured questions. eight midwives at three different hospitals in Stockholm participated in the study. All participants provided care for mothers and their newborn infants after caesarean birth. transcribed material was analysed and interpreted using qualitative content analysis. The analysis yielded the theme 'fighting an uphill battle'. skin-to-skin contact was considered to be important, and something that midwives strove to implement as a natural element of postnatal care. However, in daily practice, midwives experienced many obstacles to such care, such as lack of knowledge among parents and other professionals about the benefits of skin-to-skin contact, the mother's condition after the caesarean section, and other organisational difficulties (e.g. collaboration with other professionals, lack of time). Introducing more skin-to-skin care was a challenge for the midwives, who sometimes felt both dismissed and disappointed when they tried to communicate the benefits of this type of care. skin-to-skin contact is not prioritised because many health care practitioners are unaware of its positive effects, and their care reflects this lack of knowledge. There is a need for education among all health care practitioners involved in caesarean procedures. Another difficulty is that many parents are unaware of the benefits of skin-to-skin contact. Maternity outpatient clinics need to inform parents about the benefits of such care, so mothers will understand the importance of skin-to-skin contact. Copyright © 2014 Elsevier Ltd. All rights reserved.
Langerhans cell precursors acquire RANK/CD265 in prenatal human skin.
Schöppl, Alice; Botta, Albert; Prior, Marion; Akgün, Johnnie; Schuster, Christopher; Elbe-Bürger, Adelheid
2015-01-01
The skin is the first barrier against foreign pathogens and the prenatal formation of a strong network of various innate and adaptive cells is required to protect the newborn from perinatal infections. While many studies about the immune system in healthy and diseased adult human skin exist, our knowledge about the cutaneous prenatal/developing immune system and especially about the phenotype and function of antigen-presenting cells such as epidermal Langerhans cells (LCs) in human skin is still scarce. It has been shown previously that LCs in healthy adult human skin express receptor activator of NF-κB (RANK), an important molecule prolonging their survival. In this study, we investigated at which developmental stage LCs acquire this important molecule. Immunofluorescence double-labeling of cryostat sections revealed that LC precursors in prenatal human skin either do not yet [10-11 weeks of estimated gestational age (EGA)] or only faintly (13-15 weeks EGA) express RANK. LCs express RANK at levels comparable to adult LCs by the end of the second trimester. Comparable with adult skin, dermal antigen-presenting cells at no gestational age express this marker. These findings indicate that epidermal leukocytes gradually acquire RANK during gestation - a phenomenon previously observed also for other markers on LCs in prenatal human skin. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.
Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie
2017-12-01
Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.
Albèr, C; Buraczewska-Norin, I; Kocherbitov, V; Saleem, S; Lodén, M; Engblom, J
2014-10-01
The mammalian skin is a barrier that effectively separates the water-rich interior of the body from the normally dryer exterior. Changes in the external conditions, for example ambient humidity, have been shown to affect the skin barrier properties. The prime objective of this study was to evaluate the effect of water activity of a topical formulation on skin hydration and permeability. A second objective was to gain more understanding on how two commonly used humectants, urea and glycerol, affect skin barrier function in vivo. Simple aqueous formulations were applied under occlusion to the volar forearm of healthy volunteers. Following 4-h exposure, skin water loss (by transepidermal water loss measurements), skin hydration (by Corneometry) and skin permeability (by time to vasodilation due to benzyl nicotinate exposure) were monitored. The results demonstrate that a relatively small change in the water activity of a topical formulation is sufficient to induce considerable effects on stratum corneum hydration and permeability to exogenous substances. Exposing the skin to high water activity leads to increased skin hydration and also increased permeability. Furthermore, urea and glycerol promote skin hydration and permeability even at reduced water activity of the applied formulation. These results highlight the importance of considering the water activity in topically applied formulations and the potential benefit of using humectants. The results may impact formulation optimization in how to facilitate skin hydration and to modify skin permeability by temporarily open and close the skin barrier. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
DEFF Research Database (Denmark)
Christiansen, Jens Juel; Andersen, Niels Holmark; Sørensen, Keld E
2007-01-01
because of skin side effects and anxiety, respectively. All patients had low circulating androgens baseline and normal range androgens during DHEA treatment. We examined patients with noninvasive endothelial cell function, magnetic resonance imaging (MRI)-based cardiac output, echocardiography, ambulatory...... 24-h blood pressure and maximal oxygen consumption. RESULTS: DHEA treatment normalized androgen status to levels seen in healthy women. DHEA and placebo treatment had no effect on echocardiographic parameters of myocardial dimensions or systolic and diastolic function, noninvasive endothelial cell...... in vascular endothelium has been described and in vitro studies have shown involvement of DHEA in NO dependent pathways. AIM: To evaluate effects of DHEA substitution on cardiovascular parameters. DESIGN: Six months randomized, double-blind, placebo-controlled crossover study. Treatment consisted of DHEA 50...
Imaging-guided two-photon excitation-emission-matrix measurements of human skin tissues
Yu, Yingqiu; Lee, Anthony M. D.; Wang, Hequn; Tang, Shuo; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan
2012-07-01
There are increased interests on using multiphoton imaging and spectroscopy for skin tissue characterization and diagnosis. However, most studies have been done with just a few excitation wavelengths. Our objective is to perform a systematic study of the two-photon fluorescence (TPF) properties of skin fluorophores, normal skin, and diseased skin tissues. A nonlinear excitation-emission-matrix (EEM) spectroscopy system with multiphoton imaging guidance was constructed. A tunable femtosecond laser was used to vary excitation wavelengths from 730 to 920 nm for EEM data acquisition. EEM measurements were performed on excised fresh normal skin tissues, seborrheic keratosis tissue samples, and skin fluorophores including: NADH, FAD, keratin, melanin, collagen, and elastin. We found that in the stratum corneum and upper epidermis of normal skin, the cells have large sizes and the TPF originates from keratin. In the lower epidermis, cells are smaller and TPF is dominated by NADH contributions. In the dermis, TPF is dominated by elastin components. The depth resolved EEM measurements also demonstrated that keratin structure has intruded into the middle sublayers of the epidermal part of the seborrheic keratosis lesion. These results suggest that the imaging guided TPF EEM spectroscopy provides useful information for the development of multiphoton clinical devices for skin disease diagnosis.
Votruba, Kristen L; Persad, Carol; Giordani, Bruno
2016-05-01
This study investigated whether healthy older adults with Mini-Mental State Examination (MMSE) scores above 23 exhibit cognitive impairment on neuropsychological tests. Participants completed the MMSE and a neuropsychological battery including tests of 10 domains. Results were compared to published normative data. On neuropsychological testing, participants performed well on measures of naming and recall but showed mild to moderate impairment in working memory and processing speed and marked impairment in inhibition, sustained attention, and executive functioning. Almost everyone (91%) scored at least 1 standard deviation (SD) below the mean in at least 1 domain. The median number of domains in which individuals scored below 1 SD was 3.0 of 10.0, whereas over 21% scored below 1 SD in 5 domains or more. With the strictest of definitions for impairment, 20% of this population scored below 2.0 SDs below the norm in at least 2 domains, a necessary condition for a diagnosis of dementia. The finding that cognitive impairment, particularly in attention and executive functioning, is found in healthy older persons who perform well on the MMSE has clinical and research implications in terms of emphasizing normal variability in performance and early identification of possible impairment. © The Author(s) 2016.
Energy Technology Data Exchange (ETDEWEB)
Lopez Pacheco, Maria del Carmen Lopez [Laboratorio de CitopatologIa Ambiental, Departamento de MorfologIa, ENCB-IPN, UP Lazaro Cardenas, Casco de Santo Tomas, 11340 (Mexico); Martins-Costa, Manuel Filipe Pereira da Cunha [Departamento de Fisica, Universidad do Minho, Escola de Ciencias Campus de Gualtar-PT-4710-057 Braga (Portugal); Zapata, Aura Judith Perez [Laboratorio de CitopatologIa Ambiental, Departamento de MorfologIa, ENCB-IPN, UP Lazaro Cardenas, Casco de Santo Tomas, 11340 (Mexico); Cherit, Judith DomInguez [Departamento de DermatologIa, Hospital General Dr Manuel Gea Gonzalez, Calzada de Tlalpan No 4800, 14000 (Mexico); Gallegos, Eva Ramon [Laboratorio de CitopatologIa Ambiental, Departamento de MorfologIa, ENCB-IPN, UP Lazaro Cardenas, Casco de Santo Tomas, 11340 (Mexico)
2005-12-07
The objective of this study was to be able to distinguish between healthy skin tissue and malignant ones, furthermore determining a unique pattern of roughness for each skin lesion by microtopographic analysis of the skin surface of Mexican patients during the period from April to October 2002. The standard technique used in this study for the diagnosis of skin cancer and the comparison of the results was the haematoxylin-eosin histopathological technique. Latex impressions were taken from skin lesions as well as from the healthy skin of each patient to serve as control samples. These impressions were analysed by the MICROTOP.03.MFC microtopographic system inspection. It was observed that when the tumour becomes rougher, more malign will be the lesion. On average, the melanoma present an increase of roughness of 67% compared to healthy skin, obtaining a roughness relation of 1:2.54. The percentage decreases to 49% (49%, 1:60) in the case of basal cell carcinoma and to 40% in pre-malignant lesions such as melanocytic nevus (40%, 1:150). In benign lesions such as the seborrhoea keratosis only a small increase in roughness was noted (4%, 1:0.72). Microtopographic inspection of the skin surface can be considered as a complementary diagnostic technique for skin cancer.
International Nuclear Information System (INIS)
Lopez Pacheco, Maria del Carmen Lopez; Martins-Costa, Manuel Filipe Pereira da Cunha; Zapata, Aura Judith Perez; Cherit, Judith DomInguez; Gallegos, Eva Ramon
2005-01-01
The objective of this study was to be able to distinguish between healthy skin tissue and malignant ones, furthermore determining a unique pattern of roughness for each skin lesion by microtopographic analysis of the skin surface of Mexican patients during the period from April to October 2002. The standard technique used in this study for the diagnosis of skin cancer and the comparison of the results was the haematoxylin-eosin histopathological technique. Latex impressions were taken from skin lesions as well as from the healthy skin of each patient to serve as control samples. These impressions were analysed by the MICROTOP.03.MFC microtopographic system inspection. It was observed that when the tumour becomes rougher, more malign will be the lesion. On average, the melanoma present an increase of roughness of 67% compared to healthy skin, obtaining a roughness relation of 1:2.54. The percentage decreases to 49% (49%, 1:60) in the case of basal cell carcinoma and to 40% in pre-malignant lesions such as melanocytic nevus (40%, 1:150). In benign lesions such as the seborrhoea keratosis only a small increase in roughness was noted (4%, 1:0.72). Microtopographic inspection of the skin surface can be considered as a complementary diagnostic technique for skin cancer
Simental-Mendía, Luis E; Castañeda-Chacón, Argelia; Rodriguez-Morán, Martha; Aradillas-García, Celia; Guerrero-Romero, Fernando
2015-05-01
To test the hypothesis that mildly elevated triglyceride levels are associated with the increase of homeostasis model assessment of insulin resistance (HOMA-IR) and β-cell function (HOMA-β) indices in healthy children and adolescents with normal weight, we conducted a cross-sectional population study. Based on fasting triglyceride levels, participants were allocated into groups with and without triglyceride levels ≥1.2 mmol/L. Normal weight was defined by body mass index between the 15th and 85th percentiles, for age and gender. Insulin resistance and insulin secretion were estimated using HOMA-IR and HOMA-β indices. A total of 1660 children and adolescents were enrolled, of them 327 (19.7%) with mildly elevated triglycerides. The multivariate linear regression analysis showed that mildly elevated triglyceride levels in children were associated with HOMA-IR (β = 0.214, p HOMA-β (β = 0.139, p = 0.001), systolic (β = 0.094, p = 0.01), and diastolic blood pressure (β = 0.102, p = 0.007), whereas in adolescents, HOMA-IR (β = 0.267, p HOMA-β (β = 0.154, p HOMA-IR and HOMA-β indices in healthy children and adolescents with normal weight.
Use of autologous tissue engineered skin to treat porcine full-thickness skin defects
Institute of Scientific and Technical Information of China (English)
CAI Xia; CAO Yi-lin; CUI Lei; LIU Wei; GUAN Wen-xiang
2005-01-01
Objective: To explore a feasible method to repair full-thickness skin defects utilizing tissue engineered techniques. Methods: The Changfeng hybrid swines were used and the skin specimens were cut from the posterior limb girdle region, from which the keratinocytes and fibroblasts were isolated and harvested by trypsin, EDTA, and type II collagenase. The cells were seeded in Petri dishes for primary culture. When the cells were in logarithmic growth phase, they were treated with trypsin to separate them from the floor of the tissue culture dishes. A biodegradable material, Pluronic F-127, was prefabricated and mixed with these cells, and then the cell-Pluronic compounds were seeded evenly into a polyglycolic acid (PGA). Then the constructs were replanted to the autologous animals to repair the full-thickness skin defects. Histology and immunohistochemistry of the neotissue were observed in 1, 2, 4, and 8 postoperative weeks. Results: The cell-Pluronic F-127-PGA compounds repaired autologous full-thickness skin defects 1 week after implantation. Histologically, the tissue engineered skin was similar to the normal skin with stratified epidermis overlying a moderately thick collageneous dermis. Three of the structural proteins in the epidermal basement membrane zone, type IV collagen, laminin, and type VII collagen were detected using immunohistochemical methods. Conclusions: By studying the histology and immunohistochemistry of the neotissue, the bioengineered skin graft holds great promise for improving healing of the skin defects.
Laggner, Ute; Di Meglio, Paola; Perera, Gayathri K; Hundhausen, Christian; Lacy, Katie E; Ali, Niwa; Smith, Catherine H; Hayday, Adrian C; Nickoloff, Brian J; Nestle, Frank O
2011-09-01
γδ T cells mediate rapid tissue responses in murine skin and participate in cutaneous immune regulation including protection against cancer. The role of human γδ cells in cutaneous homeostasis and pathology is characterized poorly. In this study, we show in vivo evidence that human blood contains a distinct subset of proinflammatory cutaneous lymphocyte Ag and CCR6-positive Vγ9Vδ2 T cells, which is rapidly recruited into perturbed human skin. Vγ9Vδ2 T cells produced an array of proinflammatory mediators including IL-17A and activated keratinocytes in a TNF-α- and IFN-γ-dependent manner. Examination of the common inflammatory skin disease psoriasis revealed a striking reduction of circulating Vγ9Vδ2 T cells in psoriasis patients compared with healthy controls and atopic dermatitis patients. Decreased numbers of circulating Vγ9Vδ2 T cells normalized after successful treatment with psoriasis-targeted therapy. Taken together with the increased presence of Vγ9Vδ2 T cells in psoriatic skin, these data indicate redistribution of Vγ9Vδ2 T cells from the blood to the skin compartment in psoriasis. In summary, we report a novel human proinflammatory γδ T cell involved in skin immune surveillance with immediate response characteristics and with potential clinical relevance in inflammatory skin disease.
Wei, Liang-Feng; Wang, Shou-Sen; Zheng, Zhao-Cong; Tian, Jun; Xue, Liang
2017-05-01
Diffusion tensor imaging (DTI) shows great advantage in the diagnosis of brain diseases, including cervical spinal cord (CSC) disease. This study aims to obtain the normal values of the DTI parameters for a healthy population and to establish a baseline for CSC disease diagnosis using DTI. A total of 36 healthy adults were subjected to magnetic resonance imaging (MRI) for the entire CSC using the Siemens 3.0 T MR System. Sagittal DTI acquisition was carried out with a single-shot spin-echo echo-planar imaging (EPI) sequence along 12 non-collinear directions. Fractional anisotropy (FA) and apparent diffusion coefficient (ADC) values were determined at different cervical levels using a region of interest (ROI) method, following which they were correlated with parameters, like age and sex. Further, diffusion tensor tracking (DTT) was carried out to reconstruct the white matter fiber bundles of the CSC. The full and complete fiber bundle structure of a normal CSC was confirmed in both the T2-weighted and DTI images. The FA and ADC values were significantly negatively correlated with each other and showed strongly negative and positive correlations with age, respectively, but not with sex. Additionally, there was no significant difference between the FA and the ADC values at different cervical levels. The DTI technique can act as an important supplement to the conventional MRI technique for CSC observation. Moreover, the FA and ADC values can be used as sensitive parameters in the DTI study on the CSC by taking the effects of age into consideration.
Skin deposits in hereditary cystatin C amyloidosis
DEFF Research Database (Denmark)
Benedikz, Eirikur; Blöndal, H; Gudmundsson, G
1990-01-01
Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker...
Modeling of skin cancer dermatoscopy images
Iralieva, Malica B.; Myakinin, Oleg O.; Bratchenko, Ivan A.; Zakharov, Valery P.
2018-04-01
An early identified cancer is more likely to effective respond to treatment and has a less expensive treatment as well. Dermatoscopy is one of general diagnostic techniques for skin cancer early detection that allows us in vivo evaluation of colors and microstructures on skin lesions. Digital phantoms with known properties are required during new instrument developing to compare sample's features with data from the instrument. An algorithm for image modeling of skin cancer is proposed in the paper. Steps of the algorithm include setting shape, texture generation, adding texture and normal skin background setting. The Gaussian represents the shape, and then the texture generation based on a fractal noise algorithm is responsible for spatial chromophores distributions, while the colormap applied to the values corresponds to spectral properties. Finally, a normal skin image simulated by mixed Monte Carlo method using a special online tool is added as a background. Varying of Asymmetry, Borders, Colors and Diameter settings is shown to be fully matched to the ABCD clinical recognition algorithm. The asymmetry is specified by setting different standard deviation values of Gaussian in different parts of image. The noise amplitude is increased to set the irregular borders score. Standard deviation is changed to determine size of the lesion. Colors are set by colormap changing. The algorithm for simulating different structural elements is required to match with others recognition algorithms.
An Adhesive Patch-Based Skin Biopsy Device for Molecular Diagnostics and Skin Microbiome Studies.
Yao, Zuxu; Moy, Ronald; Allen, Talisha; Jansen, Burkhard
2017-10-01
A number of diagnoses in clinical dermatology are currently histopathologically confirmed and this image recognition-based confirmation generally requires surgical biopsies. The increasing ability of molecular pathology to corroborate or correct a clinical diagnosis based on objective gene expression, mutation analysis, or molecular microbiome data is on the horizon and would be further supported by a tool or procedure to collect samples non-invasively. This study characterizes such a tool in form of a 'bladeless' adhesive patch-based skin biopsy device. The performance of this device was evaluated through a variety of complementary technologies including assessment of sample biomass, electron microscopy demonstrating the harvesting of layers of epidermal tissue, and isolation of RNA and DNA from epidermal skin samples. Samples were obtained by application of adhesive patches to the anatomical area of interest. Biomass assessment demonstrated collection of approximately 0.3mg of skin tissue per adhesive patch and electron microscopy confirmed the nature of the harvested epidermal skin tissue. The obtained tissue samples are stored in a stable fashion on adhesive patches over a wide range of temperatures (-80oC to +60oC) and for extended periods of time (7 days or more). Total human RNA, human genomic DNA and microbiome DNA yields were 23.35 + 15.75ng, 27.72 + 20.71ng and 576.2 + 376.8pg, respectively, in skin samples obtained from combining 4 full patches collected non-invasively from the forehead of healthy volunteers. The adhesive patch skin sampling procedure is well tolerated and provides robust means to obtain skin tissue, RNA, DNA, and microbiome samples without involving surgical biopsies. The non-invasively obtained skin samples can be shipped cost effectively at ambient temperature by mail or standard courier service, and are suitable for a variety of molecular analyses of the skin microbiome as well as of keratinocytes, T cells, dendritic cells
International Nuclear Information System (INIS)
Hirschi, M.; Netrawali, M.S.; Remsen, J.F.; Cerutti, P.A.
1981-01-01
The formation of single-strand breaks by near-ultraviolet light at 313 nm and by aerobic gamma-rays was compared for skin fibroblast monolayer cultures from 4 normal donors (NF) and 8 patients with Bloom's syndrome (BS) by the alkaline elution method. In 6 of 8 BS strains, the number of breaks induced by near-ultraviolet light, 2.25 kJ/sq m, at 0 degrees was comparable to NF, while elevated breakage was observed in BS strains HG 369 and HG 916. Breakage frequencies were increased substantially in 6 of 8 BS strains relative to NF when the near-ultraviolet light exposure was at 37 degrees. BS strain GM 2520 represents an exception since normal breakage frequencies were induced both at 0 degrees and 37 degrees. Aerobic gamma-rays (75 R) induced comparable numbers of single-strand breaks in BS and NF strains at 0 degrees. The breakage frequencies were reduced an average of 17% in NF when the same dose was given at 30 degrees followed by 6 min incubation. Under the same conditions, the breakage frequencies were on the average reduced by 42% relative to 0 degrees in the BS strains, indicating that they possess normal or possibly slightly increased capacities for the rejoining of gamma-ray-induced breaks
Rossi, M T; Arisi, M; Lonardi, S; Lorenzi, L; Ungari, M; Serana, F; Fusano, M; Moggio, E; Calzavara-Pinton, P G; Venturini, M
2018-02-11
Polymorphic light eruption (PLE) is the most common autoimmune photodermatosis. Plasmacytoid dendritic cells (PDCs) are important mediators of innate antimicrobial immunity involved in the pathogenesis of many inflammatory skin diseases. In addition to PDCs, regulatory T cells (Tregs) are involved in controlling inflammation and adaptive immunity in skin by their immunosuppressive capacity. The aim of this study was to investigate the presence of PDCs and Tregs in photoexposed skin from PLE compared to healthy skin. Patients with PLE diagnosis and healthy controls were recruited and underwent a photoprovocative test. A 4-mm punch biopsy was taken from the site of positive photoprovocation test reaction, and immunohistochemistry for BDCA2 as marker for PDCs, CD4 and FOXP3 as markers for Tregs was performed. Double immunostain for FOXP3 and CD4 was performed as well. Absolute counts for CD4, BDCA2 and FOXP3 were performed in at least 5 High Power Fields (HPF). Percentage of CD4-, BDCA2- and CD4FOXP3-positive cells over the total inflammatory infiltrate was assessed for each case. We enrolled 23 patients and controls. BDCA2+ cells were present in 91.3% of PLE skin samples and 100% of healthy volunteer. Both in PLE patients and healthy controls, PDCs distribution was mainly dermic (P PLE patients (P PLE patients and healthy controls, Tregs distribution was mainly dermic (P PLE patients compared to controls (P PLE, and dermal distribution of PDCs in PLE skin biopsies seems to confirm a possible overlap with cutaneous lupus erythematosus (CLE). © 2018 European Academy of Dermatology and Venereology.
Directory of Open Access Journals (Sweden)
Vishnu Hosur
2017-08-01
Full Text Available In humans, gain-of-function (GOF mutations in RHBDF2 cause the skin disease tylosis. We generated a mouse model of human tylosis and show that GOF mutations in RHBDF2 cause tylosis by enhancing the amount of amphiregulin (AREG secretion. Furthermore, we show that genetic disruption of AREG ameliorates skin pathology in mice carrying the human tylosis disease mutation. Collectively, our data suggest that RHBDF2 plays a critical role in regulating EGFR signaling and its downstream events, including development of tylosis, by facilitating enhanced secretion of AREG. Thus, targeting AREG could have therapeutic benefit in the treatment of tylosis.
Sitek, Aneta; Rosset, Iwona; Żądzińska, Elżbieta; Kasielska-Trojan, Anna; Neskoromna-Jędrzejczak, Aneta; Antoszewski, Bogusław
2016-04-01
Light skin pigmentation is a known risk factor for skin cancer. Skin color parameters and Fitzpatrick phototypes were evaluated in terms of their usefulness in predicting the risk of skin cancer. A case-control study involved 133 individuals with skin cancer (100 with basal cell carcinoma, 21 with squamous cell carcinoma, 12 with melanoma) and 156 healthy individuals. All of them had skin phototype determined and spectrophotometric skin color measurements were done on the inner surfaces of their arms and on the buttock. Using those data, prediction models were built and subjected to 17-fold stratified cross-validation. A model, based on skin phototypes, was characterized by area under the receiver operating characteristic curve = 0.576 and exhibited a lower predictive power than the models, which were mostly based on spectrophotometric variables describing pigmentation levels. The best predictors of skin cancer were R coordinate of RGB color space (area under the receiver operating characteristic curve 0.687) and melanin index (area under the receiver operating characteristic curve 0.683) for skin on the buttock. A small number of patients were studied. Models were not externally validated. Skin color parameters are more accurate predictors of skin cancer occurrence than skin phototypes. Spectrophotometry is a quick, easy, and affordable method offering relatively good predictive power. Copyright © 2015 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.
Neck Circumference as a Predictor of Adiposity among Healthy and Obese Children
Directory of Open Access Journals (Sweden)
Nayera E. Hassan
2015-11-01
Full Text Available BACKGROUND: Obesity, particularly in the upper part of body, is a major health problem. Because body mass index (BMI does not adequately describe regional adiposity, other indices of body fatness are being explored. OBJECTIVES: To determine if neck circumference is a valid measure of adiposity (fat distribution among group of Egyptian children. SUBJECTS AND METHODS: This is a cross sectional study, included 50 obese subjects, aged 7 - 12 years recruited from Endocrine, obesity and Metabolism Pediatric Unit at Children Hospital, Cairo University and 50 healthy children, age and sex matched. All children were subjected to blood pressure assessment (systolic SBP and diastolic DBP, and anthropometric assessment (body weight, height, neck circumference (NC, waist (WC and hip (HC circumferences, and skin fold thicknesses at three sites: biceps, triceps and sub scapular. BMI [weight (kg/height (m2] was calculated. RESULTS: In healthy females, significant associations were detected between NC and SBP, DBP and all anthropometric measurements. However, in healthy males NC was not significantly associated with BMI, SBP and DBP. In the obese group; both sexes; insignificant association was found between NC and SBP, DBP, BMI and skinfold thickness. CONCLUSION: NC is related to fat distribution among normal healthy female children. However, this relation disappears with increasing adiposity. The results do not support the use of NC as a useful screening tool for childhood obesity.
Permeability of commercial solvents through living human skin
DEFF Research Database (Denmark)
Ursin, C; Hansen, C M; Van Dyk, J W
1995-01-01
A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... of DMSO and octyl acetate were measured. No octyl acetate was detected and the permeability of DMSO was proportional to its mole fraction in the mixture. The effect of two hours of solvent exposure on the viability of skin (based on DNA synthesis) was measured and found to be very dependent on the solvent....
Skin Aging Remedies in Traditional Persian Medicine
Directory of Open Access Journals (Sweden)
Shirbeigi
2015-03-01
Full Text Available Context Traditional persian medicine (TPM is an ancient temperamental medicine with a rich literature about aging mechanism. Temperament has an important function in maintaining the ideal healthy status of human body. Aging process and skin aging could be postponed by applying herbal medicine and some specific traditional rules. Evidence Acquisition The aim of this review study was gathering and discussing the mechanism of whole body aging and skin aging from perspective of TPM and introducing remedies to prevent it. Skin aging is caused by external and internal factors. According to TPM, loss of fat and water content in different skin layers is the main cause of skin aging and it could be avoided by considering simple essential commands. Results Skin aging begins with whole body aging process and entire body gets cold and dry in elderly. Wrinkle formation is highly associated with loss of “skin natural moisture”. In the management, specific food supplements, simple massage therapy as well as herbal drugs were suggested. The current investigation was performed to show the knowledge of ancient Iranian scientists on aging process and related interventions. Conclusions Reported herbal drugs might be beneficial for further studies for the management of skin aging and aging process.
Identification of 5α-reductase isoenzymes in canine skin.
Bernardi de Souza, Lucilene; Paradis, Manon; Zamberlam, Gustavo; Benoit-Biancamano, Marie-Odile; Price, Christopher
2015-10-01
Alopecia X in dogs is a noninflammatory alopecia that may be caused by a hormonal dysfunction. It may be similar to androgenic alopecia in men that is caused by the effect of dihydrotestosterone (DHT). The 5α-reductase isoenzymes, 5αR1 and 5αR2, and a recently described 5αR3, are responsible for the conversion of testosterone into DHT. However, which 5α-reductases are present in canine skin has not yet been described. The main objective of this study was to determine the pattern of expression of 5α-reductase genes in canine skin. Skin biopsies were obtained from healthy, intact young-mature beagles (three males, four females) at three anatomical sites normally affected by alopecia X (dorsal neck, back of thighs and base of tail) and two sites generally unaffected (dorsal head and ventral thorax). Prostate samples (n = 3) were collected as positive controls for 5α-reductase mRNA abundance measurement by real-time PCR. We detected mRNA encoding 5αR1 and 5αR3 but not 5αR2. There were no significant differences in 5αR1 and 5αR3 mRNA levels between the different anatomical sites, irrespective of gender (P > 0.05). Moreover, the mean mRNA abundance in each anatomical site did not differ between males and females (P > 0.05). To the best of the authors' knowledge, this is the first study demonstrating the expression of 5α-reductases in canine skin and the expression of 5αR3 in this tissue. These results may help to elucidate the pathogenesis of alopecia X and to determine more appropriate treatments for this disorder. © 2015 ESVD and ACVD.
Skin reactions after photodynamic therapy are unaffected by 839 nm photobiomodulation therapy
DEFF Research Database (Denmark)
Bay, Christiane; Vissing, Anne-Cathrine; Thaysen-Petersen, Daniel
2017-01-01
BACKGROUND AND OBJECTIVE: Photodynamic therapy (PDT) is associated with erythema and edema. Photobiomodulation (PBM) therapy may stimulate the skin recovery process. We investigated the potential of PBM to reduce PDT-induced skin reactions. STUDY DESIGN AND METHODS: Healthy volunteers (n = 20) were...
LAGGNER, Ute; DI MEGLIO, Paola; PERERA, Gayathri K.; HUNDHAUSEN, Christian; LACY, Katie E.; ALI, Niwa; SMITH, Catherine H.; HAYDAY, Adrian C.; NICKOLOFF, Brian J.; NESTLE, Frank O.
2011-01-01
γδ T cells mediate rapid tissue responses in murine skin and participate in cutaneous immune regulation including protection against cancer. The role of human γδ cells in cutaneous homeostasis and pathology is poorly characterized. In this study we show in vivo evidence that human blood contains a distinct subset of pro-inflammatory cutaneous lymphocyte antigen (CLA) and C-C chemokine receptor (CCR) 6 positive Vγ9Vδ2 T cells, which is rapidly recruited into perturbed human skin. Vγ9Vδ2 T cells produced an array of pro-inflammatory mediators including IL-17A and activated keratinocytes in a TNF-α and IFN-γ dependent manner. Examination of the common inflammatory skin disease psoriasis revealed a striking reduction of circulating Vγ9Vδ2 T cells in psoriasis patients compared to healthy controls and atopic dermatitis patients. Decreased numbers of circulating Vγ9Vδ2 T cells normalized after successful treatment with psoriasis-targeted therapy. Together with the increased presence of Vγ9Vδ2 T cells in psoriatic skin, this data indicates redistribution of Vγ9Vδ2 T cells from the blood to the skin compartment in psoriasis. In summary, we report a novel human pro-inflammatory γδ T cell involved in skin immune surveillance with immediate response characteristics and with potential clinical relevance in inflammatory skin disease. PMID:21813772
DEFF Research Database (Denmark)
Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke
2009-01-01
BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess the diagn......BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...
Microporous dermal-like electrospun scaffolds promote accelerated skin regeneration.
Bonvallet, Paul P; Culpepper, Bonnie K; Bain, Jennifer L; Schultz, Matthew J; Thomas, Steven J; Bellis, Susan L
2014-09-01
The goal of this study was to synthesize skin substitutes that blend native extracellular matrix (ECM) molecules with synthetic polymers which have favorable mechanical properties. To this end, scaffolds were electrospun from collagen I (col) and poly(ɛ-caprolactone) (PCL), and then pores were introduced mechanically to promote fibroblast infiltration, and subsequent filling of the pores with ECM. A 70:30 col/PCL ratio was determined to provide optimal support for dermal fibroblast growth, and a pore diameter, 160 μm, was identified that enabled fibroblasts to infiltrate and fill pores with native matrix molecules, including fibronectin and collagen I. Mechanical testing of 70:30 col/PCL scaffolds with 160 μm pores revealed a tensile strength of 1.4 MPa, and the scaffolds also exhibited a low rate of contraction (pores. Keratinocytes formed a stratified layer on the surface of fibroblast-remodeled scaffolds, and staining for cytokeratin 10 revealed terminally differentiated keratinocytes at the apical surface. When implanted, 70:30 col/PCL scaffolds degraded within 3-4 weeks, an optimal time frame for degradation in vivo. Finally, 70:30 col/PCL scaffolds with or without 160 μm pores were implanted into full-thickness critical-sized skin defects. Relative to nonporous scaffolds or sham wounds, scaffolds with 160 μm pores induced accelerated wound closure, and stimulated regeneration of healthy dermal tissue, evidenced by a more normal-appearing matrix architecture, blood vessel in-growth, and hair follicle development. Collectively, these results suggest that microporous electrospun scaffolds are effective substrates for skin regeneration.
In vitro culture of skin-homing T lymphocytes from inflammatory skin diseases
DEFF Research Database (Denmark)
Bang, Karen; Lund, Marianne; Mogensen, Søren C
2005-01-01
We, in this study, describe how T lymphocytes in a skin biopsy can proliferate in vitro for up to 3 months by using T-cell growth factors - interleukin-2 (IL-2) and IL-4 yielding approximately 100-160 million T lymphocytes within 1 month. We established cell lines from three tuberculin skin tests......, four positive patch tests, 15 of 16 biopsies from atopic dermatitis (AD), 15 of 19 biopsies from mycosis fungoides (MF), 12 of 24 biopsies from psoriasis vulgaris, which was significantly less than AD (P lymphocytes (P ... to immediate halt of proliferation. Blood mononuclear cells from patients and biopsies from healthy persons never gave cell lines. All cells were T lymphocytes expressing CD45RO+, HLA-DR+ and CD150. The CD7 expression was significantly increased in cell lines from AD (P
Directory of Open Access Journals (Sweden)
Shun Kitaba
2011-01-01
Full Text Available We report four adult cases of atopic dermatitis (AD complicated by Sjogren's syndrome (SS. The patients fulfilled diagnostic criteria for AD and SS. All cases showed persistent itchy dry skin and eczematous lesions complicated by sicca symptoms including dry eyes and dry mouth with moderate joint pain. One case manifested annular erythema and another manifested widespread discoid erythema. To investigate the underlying cause of dry skin in these cases, sweating function was evaluated using a quantitative sudomotor axon reflex test (QSART in which the axon reflex is stimulated by acetylcholine iontophoresis. The sweating latency time was significantly prolonged in eczematous skin of AD and AD/SS compared to normal controls. Axon reflex (AXR sweat volume was also significantly reduced in AD (normal and eczematous skin and AD/SS (normal and eczema compared to normal control. In contrast, the direct sweat volume of lesional or non-lesional AD skin induced by direct stimulation with acetylcholine was only slightly reduced compared to that in normal controls, but not in SS and lesional skin of AD/SS patients. These results suggest that the impaired sweat response in AD is attributable to an abnormal sudomotor axon reflex, which is accelerated and modulated when complicated by SS resulting in dry skin in the present cases.
Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang
2018-02-01
Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Scherf, H.P.; Strangfeld, D.; Meffert, H.; Glatzel, E.; Siewert, H.; Soennichsen, N.; Correns, H.J.
1988-01-01
In three teams of test persons series of UV irradiations of the skin (λ max 365 nm) and of the blood (λ max 254 nm) were performed, and moreover pseudoirradiations of the blood as placebo and infrared irradiations of the skin were carried out. UV irradiations of the blood increased the factor η (O 2 utilization) in all test persons. In healthy persons and patients with psoriasis UV irradiations of the skin involved a homogeneous, but less distinct effect, this was, however, not the case in patients with vascular diseases. According to the results of the 133 Xe muscle clearance the improved utilization of oxygen does not result from increased peripheral blood supply. (author)
Abnormal phenotype of cultured fibroblasts in human skin with chronic radiotherapy damage
International Nuclear Information System (INIS)
Delanian, S.; Martin, M.; Lefaix, J.-L.; Bravard, A.; Luccioni, C.
1998-01-01
Purpose: The pathophysiological aspects of radiation-induced fibrosis (RIF) have not been well characterized. We therefore cultured human fibroblasts from samples of skin with RIF to investigate the long-term effects of therapeutic irradiation. Materials and methods: Biopsies of normal and RIF skin were obtained from patients previously irradiated for cancer, without recurrence. Cells were extracted from dermis samples by the outgrowth technique, seeded as monolayers and cultured at confluence. Enzyme activities and proteins were assayed, RNA was isolated and Northern blot analysis was performed on surviving cells between passages 2 and 5. Results: RIF cell cultures displayed heterogeneous fibroblasts populations. The initial outgrowth consisted of one-third small cells that floated rapidly, one-third spindle-shaped cells migrating far from the explant to form islets and one-third large pleiomorphic cells. In subsequent subcultures, surviving cells exhibited either myofibroblastic characteristics with a normal proliferative capacity or senescent morphology with a reduced proliferative capacity. These RIF cells had a brief finite lifespan, with dramatically reduced growth rate during their initial outgrowth and the following passages. Study of the antioxidant metabolism showed that Mn superoxide dismutase and catalase activities were significantly weaker in surviving RIF cells than healthy fibroblasts. These exhausted RIF cells exhibited no overexpression of transforming growth factor β or tissue inhibitor of metalloproteinase. Conclusion: Irradiation may lead to apparently contradictory effects such as fibrosis and necrosis in clinical practice. In cell culture, we observed two main cellular phenotypes which may be related to both processes, i.e. myofibroblast-like cells and fibrocyte-like cells. These two phenotypes may represent two steps in the differentiation induced as a long-term effect of therapeutic irradiation of the skin. Cell culture probably
The irritant potential of n-propanol (nonanoic acid vehicle) in cumulative skin irritation
DEFF Research Database (Denmark)
Clemmensen, A; Andersen, F; Petersen, Thomas Kongsted
2008-01-01
have diverse mechanisms of action on the skin. We used sodium lauryl sulfate (SLS) and nonanoic acid (NON) in three different concentrations plus their vehicles, water and n-propanol, respectively, to validate our test models and to optimize test concentrations. METHODS: Healthy volunteer forearm skin...
Discovery of skin lymphocytes was a game changer in experimental dermatology
Matos, Tiago R.; de Rie, Menno A.
2017-01-01
A substantial part of ongoing research in experimental dermatology focuses on skin T cellsfor that reason, we find important to highlight the pioneering work of Jan D. Bos et al. from 1987 (The skin immune system (SIS): Distribution and immunophenotype of lymphocyte subpopulations in normal skin)
Effects of irradiation of skin flaps
International Nuclear Information System (INIS)
Sumi, Y.; Ueda, M.; Oka, T.; Torii, S.
1984-01-01
The reaction of skin flaps to irradiation and the optimum postoperative time for irradiation was studied in the rat. Flaps showed different reactions depending on the time of irradiation. There was a correlation between the radiosensitivity and the vascularity of the flap. Those flaps in the marginal hypovascular stage of revascularization showed reactions similar to normal skin. However, severe adverse reactions were observed in the marginal hypervascular stage
Systemic sclerosis with normal or nonspecific nailfold capillaroscopy.
Fichel, Fanny; Baudot, Nathalie; Gaitz, Jean-Pierre; Trad, Salim; Barbe, Coralie; Francès, Camille; Senet, Patricia
2014-01-01
In systemic sclerosis (SSc), a specific nailfold videocapillaroscopy (NVC) pattern is observed in 90% of cases and seems to be associated with severity and progression of the disease. To describe the characteristics of SSc patients with normal or nonspecific (normal/nonspecific) NVC. In a retrospective cohort study, clinical features and visceral involvements of 25 SSc cases with normal/nonspecific NVC were compared to 63 SSc controls with the SSc-specific NVC pattern. Normal/nonspecific NVC versus SSc-specific NVC pattern was significantly associated with absence of skin sclerosis (32 vs. 6.3%, p = 0.004), absence of telangiectasia (47.8 vs. 17.3%, p = 0.006) and absence of sclerodactyly (60 vs. 25.4%, p = 0.002), and less frequent severe pulmonary involvement (26.3 vs. 58.2%, p = 0.017). Normal/nonspecific NVC in SSc patients appears to be associated with less severe skin involvement and less frequent severe pulmonary involvement. © 2014 S. Karger AG, Basel.
Collagen synthesis in human musculoskeletal tissues and skin
DEFF Research Database (Denmark)
Babraj, J A; Cuthbertson, D J R; Smith, K
2005-01-01
We have developed a direct method for the measurement of human musculoskeletal collagen synthesis on the basis of the incorporation of stable isotope-labeled proline or leucine into protein and have used it to measure the rate of synthesis of collagen in tendon, ligament, muscle, and skin....... In postabsorptive, healthy young men (28 +/- 6 yr) synthetic rates for tendon, ligament, muscle, and skin collagen were 0.046 +/- 0.005, 0.040 +/- 0.006, 0.016 +/- 0.002, and 0.037 +/- 0.003%/h, respectively (means +/- SD). In postabsorptive, healthy elderly men (70 +/- 6 yr) the rate of skeletal muscle collagen...... synthesis is greater than in the young (0.023 +/- 0.002%/h, P collagen are similar to those of mixed skeletal muscle protein in the postabsorptive state, whereas the rate for muscle collagen synthesis is much lower in both young and elderly men...
Scar evaluation of split thickness skin graft donor site
Directory of Open Access Journals (Sweden)
Jani Muha
2014-12-01
Full Text Available BACKGROUND. Split thickness skin graft harvesting causes a certain degree of scaring on the donor site. Donor site scar can cause aesthetic and functional sequelae on the patient's body. Our goal was to study the process of donor site selection, and then evaluate donor site scars and their impact on patients. PATIENTS AND METHODS. This retrospective study included 45 patients aged 5 to 61 years (in average 36, who have been treated with STSG in the 2004–2010 period. 57.8% of them were men. On a follow-up visit, we photographed healed skin defects and donor sites. We then determined and compared the surface areas of skin defect and the donor site using the Adobe® Illustrator® CS5 computer program. Donor site scars were assessed according to the Vancouver scar scale (VSS. We examined scar’s light touch sensitivity with monofilaments and skin colouring compared to adjacent healthy skin using colorimeter. Patients were also interviewed about their treatment course in a form of a standardized questionnaire. RESULTS. Our research has revealed that 20.0% of patients participated in the decision making process of choosing the donor site, while in 80.0% the donor site was chosen by the surgeon himself. 6.7% of patients were not satisfied with their donor site. Most of the patients (37/45 had donor sites on their thighs. In average, the donor site surface area was 94% bigger than the skin defect area. We found statistically significant differences in VSS values, light touch sensitivity and skin colouring between donor site scaring and adjacent healthy skin. CONCLUSIONS. Donor site scar can represent a lasting aesthetic and functional disability for patients. Our research has shown that most of the patients do not participate in the donor site selection process, but are satisfied with their donor site. In most cases, STGSs are harvested from the thigh, other anatomical regions, where scarring would be aesthetically less obtrusive, are underused
Alhussain, Maha H; Macdonald, Ian A.; Taylor, Moira A.
2016-01-01
Background: Obesity is increasing in parallel with greater all-day food availability. The latter may promote meal irregularity, dysregulation of the energy balance, and poor metabolic health.\\ud Objective: We investigated the effect of meal irregularity on the thermic effect of food (TEF), lipid concentrations, carbohydrate metabolism, subjective appetite, and gut hormones in healthy women.\\ud Design: Eleven normal-weight women (18–40 y of age) were recruited in a randomized crossover trial w...
Raman spectroscopy reveals biophysical markers in skin cancer surgical margins
Feng, Xu; Moy, Austin J.; Nguyen, Hieu T. M.; Zhang, Yao; Fox, Matthew C.; Sebastian, Katherine R.; Reichenberg, Jason S.; Markey, Mia K.; Tunnell, James W.
2018-02-01
The recurrence rate of nonmelanoma skin cancer is highly related to the residual tumor after surgery. Although tissueconserving surgery, such as Mohs surgery, is a standard method for the treatment of nonmelanoma skin cancer, they are limited by lengthy and costly frozen-section histopathology. Raman spectroscopy (RS) is proving to be an objective, sensitive, and non-destructive tool for detecting skin cancer. Previous studies demonstrated the high sensitivity of RS in detecting tumor margins of basal cell carcinoma (BCC). However, those studies rely on statistical classification models and do not elucidate the skin biophysical composition. As a result, we aim to discover the biophysical differences between BCC and primary normal skin structures (including epidermis, dermis, hair follicle, sebaceous gland and fat). We obtained freshly resected ex vivo skin samples from fresh resection specimens from 14 patients undergoing Mohs surgery. Raman images were acquired from regions containing one or more structures using a custom built 830nm confocal Raman microscope. The spectra were grouped using K-means clustering analysis and annotated as either BCC or each of the five normal structures by comparing with the histopathology image of the serial section. The spectral data were then fit by a previously established biophysical model with eight primary skin constituents. Our results show that BCC has significant differences in the fit coefficients of nucleus, collagen, triolein, keratin and elastin compared with normal structures. Our study reveals RS has the potential to detect biophysical changes in resection margins, and supports the development of diagnostic algorithms for future intraoperative implementation of RS during Mohs surgery.
van den Broek, Lenie J; Bergers, Lambert I J C; Reijnders, Christianne M A; Gibbs, Susan
2017-06-01
Understanding the healthy and diseased state of skin is important in many areas of basic and applied research. Although the field of skin tissue engineering has advanced greatly over the last years, current in vitro skin models still do not mimic the complexity of the human skin. Skin-on-chip and induced pluripotent stem cells (iPSC) might be key technologies to improve in vitro skin models. This review summarizes the state of the art of in vitro skin models with regard to cell sources (primary, cell line, iPSC) and microfluidic devices. It can be concluded that iPSC have the potential to be differentiated into many kinds of immunologically matched cells and skin-on-chip technology might lead to more physiologically relevant skin models due to the controlled environment, possible exchange of immune cells, and an increased barrier function. Therefore the combination of iPSC and skin-on-chip is expected to lead to superior healthy and diseased in vitro skin models.
LEE, BO MI; AN, SUNGKWAN; KIM, SOO-YEON; HAN, HYUN JOO; JEONG, YU-JIN; LEE, KYOUNG-ROK; ROH, NAM KYUNG; AHN, KYU JOONG; AN, IN-SOOK; CHA, HWA JUN
2015-01-01
The effects of skin pores on skin topographic features can be reduced by decreasing excessive production and accumulation of sebum and elimination of comedones. Therefore, a cosmetic cleanser that regulates sebum homeostasis is required. In the present study, the effects of a cosmetic cleanser that contained Diospyros kaki folium, Polygonum cuspidatum and Castanea crenata var. dulcis (DPC) was examined on the removal of sebum and on skin pore size. Healthy volunteers (n=23) aged 20–50 years w...
Coagulation profiles of healthy Andalusian donkeys are different than those of healthy horses.
Mendoza, F J; Perez-Ecija, R A; Monreal, L; Estepa, J C
2011-01-01
Coagulation disorders are frequently diagnosed, especially in hospitalized equidae, and result in increased morbidity and mortality. However, hemostatic reference intervals have not been established for donkeys yet. To determine whether the most common coagulation parameters used in equine practice are different between healthy donkeys and horses. Thirty-eight healthy donkeys and 29 healthy horses. Blood samples were collected to assess both coagulation and fibrinolytic systems by determination of platelet count, fibrinogen concentration, clotting times (prothrombin time [PT] and activated partial thromboplastin time [aPTT]), fibrin degradation products (FDP) and D-Dimer concentrations. PT and aPTT in donkeys were significantly (P donkeys than in horses. The coagulation parameters most commonly determined in equine practice are different in donkeys compared with horses. Thus, the use of normal reference ranges reported previously for healthy horses in donkeys might lead to a misdiagnosis of coagulopathy in healthy donkeys, and unnecessary treatments in sick donkeys. This is the first report of normal coagulation profile results in donkeys, and further studies are warranted to elucidate the physiological mechanisms of the differences observed between donkeys and horses. Copyright © 2011 by the American College of Veterinary Internal Medicine.
DEFF Research Database (Denmark)
Heinz, Andrea; Huertas, Angela C Mora; Schräder, Christoph U
2016-01-01
Williams-Beuren syndrome (WBS) is a congenital disorder, which involves the heterozygous deletion of the elastin gene and other genes on chromosome 7. Clinical symptoms that are associated with hemizygosity of the essential extracellular matrix protein elastin include premature aging of the skin...... and supravalvular aortic stenosis. However, only little is known about the molecular basis of structural abnormalities in the connective tissue of WBS patients. Therefore, for the first time this study aimed to systematically characterize and compare the structure and amount of elastin present in skin and aortic...... tissue from WBS patients and healthy individuals. Elastin fibers were isolated from tissue biopsies, and it was found that skin of WBS patients contains significantly less elastin compared to skin of healthy individuals. Scanning electron microscopy and mass spectrometric measurements combined...
International Nuclear Information System (INIS)
Wahner, H.W.; Robertson, J.S.
1983-01-01
With respect to skin pedicles (tubular pedicle or direct flap), an estimation of the blood supply is of great importance in making a decision as to when to perform the separation from the original blood supply. This decision is based on empiric observation of the normal time of healing and varies greatly with the site and the concepts of the individual surgery. A number of methods have been proposed for testing the circulation of pedicle skin flaps or tubes, and these methods all seem more complicated and less accurate than the isotope method that is described in this chapter
Tribology of human skin and mechanical skin equivalents in contact with textiles
Derler, S.; Schrade, G.U.; Gerhardt, L.C.
2007-01-01
The friction of untreated human skin (finger) against a reference textile was investigated with 12 subjects using a force plate. In touch experiments, in which the subjects assessed the surface roughness of the textile at normal loads of 1.5 ± 0.7 N, the average friction coefficients ranged from
Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I
2000-08-01
The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.
Zöller, Nadja; Valesky, Eva; Butting, Manuel; Hofmann, Matthias; Kippenberger, Stefan; Bereiter-Hahn, Jürgen; Bernd, August; Kaufmann, Roland
2014-01-01
The treatment regime of non-healing or slowly healing wounds is constantly improving. One aspect is surgical defect coverage whereby mesh grafts and keratinocyte suspension are applied. Tissue-cultured skin autografts may be an alternative for the treatment of full-thickness wounds and wounds that cover large areas of the body surface. Autologous epidermal and dermal cells were isolated, expanded in vitro and seeded on collagen-elastin scaffolds. The developed autograft was immunohistochemically characterized and subsequently transplanted onto a facial chronic ulceration of a 71-year-old patient with vulnerable atrophic skin. Characterization of the skin equivalent revealed comparability to healthy human skin due to the epidermal strata, differentiation and proliferation markers. Within 138 days, the skin structure at the transplantation site closely correlated with the adjacent undisturbed skin. The present study demonstrates the comparability of the developed organotypic skin equivalent to healthy human skin and the versatility for clinical applications.
Necrotizing fasciitis after scrotum skin injury in an infant: A case report.
Ren, Z X; Liu, C L; Zhang, Q; Xu, F; Zheng, Y N; Li, X J; Yang, J
2018-03-01
Necrotizing fasciitis (NF) is a life-threatening situation that is rare in children, especially infants, and early diagnosis is challenging. Timely identification and broad-spectrum antibiotic and supportive treatment before surgical debridement are very important for survival and may reduce scar formation. A previously healthy 4-month-old infant was admitted to our pediatric intensive care unit (PICU) with a history of fever and cough for 5 days and extreme swelling of the scrotum for one day. Necrotic-like tissue without margins appeared on his scrotum and perineum in 24 hours. NF was suspected, and the patient soon developed shock. The patient underwent surgical debridement after his condition stabilized. Pathological analysis confirmed the diagnosis of NF. Broad-spectrum antibiotic, immediate fluid resuscitation, assistant ventilation, and vasoactive drugs were administered. Surgical debridement and autologous split-thickness skin grafting were performed. The wound recovered well after 2 months. Ultrasound revealed normal testicles, and no anorectal injury was found. Close clinical monitoring and timely treatment of skin injuries in sick children are very important. Sufficient antibiotic administration and supportive treatment before surgical debridement are crucial for survival from NF.
T-cell receptor gamma delta bearing cells in normal human skin
Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.
1990-01-01
T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+
Skin acceptability of a cosmetic moisturizer formulation in female subjects with sensitive skin
Directory of Open Access Journals (Sweden)
Nisbet SJ
2018-04-01
Full Text Available Stephanie J Nisbet Skin Health Medical Affairs, GSK Consumer Healthcare, Weybridge, Surrey, UK Purpose: This 3-week, open-label, noncomparative clinical study evaluated the skin acceptability of a cosmetic moisturizer in subjects with sensitive skin, by monitoring adverse events (AEs and cutaneous discomfort related to normal usage.Materials and methods: Female subjects aged between 18–60 years, with Fitzpatrick phototype classification I–IV and sensitive skin, verified by a positive reaction on the stinging test at screening, were included. Subjects applied the moisturizer to their face and body twice daily for 21±2 days at home and recorded study product usage and feelings of cutaneous discomfort (eg, dryness, prickling, stinging, and itching in a diary; any AEs were reported to the clinic. At study end, skin acceptability of the moisturizer was investigator-assessed based on the nature of AEs and subjects’ self-reported feelings of discomfort, and by clinical evaluation of skin reactions in the area of moisturizer application (appearance of erythema, formation of edema, and skin desquamation; scored according to an adapted Draize and Kligman scale. Only subjects with a treatment compliance of ≥80% were included in the final analysis.Results: In total, 35 subjects initiated and completed the study; all were compliant to the minimum study product usage. Per investigator clinical dermatological assessment at study end, none of the 35 subjects had skin reactions in the area of moisturizer application and there were no reported AEs. One subject reported sensations of mild prickling and itching immediately after applying the moisturizer (not classified as AEs, which spontaneously remitted after complete absorption of the product and were noted only in exposed areas. These events were considered by the investigator as being possibly/probably related to the use of study product; however, no clinical signs of skin reaction were observed in
Resveratrol anti-ultraviolet-induced guinea pig skin injury
International Nuclear Information System (INIS)
Li Wenxing; Zhao Ying
2014-01-01
Objective: To Estimate on the protection effect of Stilbene on skin damage induced by ultraviolet radiation. Methods: After the normal skin in guinea pig under the intervene of Resveratrol was irradiated with over- dose of ultraviolet rays (UVB and UVA), the samples in every group were matched and compared. Results: The skin tissue in the Resveratrol intervene group irradiated by ultraviolet rays didn't change obviously as compared with that in the self-control group. But, the damage skin tissue in the control group irradiated by ultraviolet did change significantly as compared with that in the Stilbene intervene group. Conclusion: Resveratrol is a good material to protect the skin from damage effect by ultraviolet radiation. (authors)
Yousuf, A K M; Misbahuddin, Mir; Rahman, Md Sayedur
2011-06-01
Melanosis and leucomelanosis with or without keratosis are the earliest symptoms of arsenicosis. Uneven distribution of arsenical melanosis and leucomelanosis in skin led us to investigate the possibility of preferential secretion of arsenic and three constituents of sweat; cholesterol, vitamin E, and zinc. Twenty-four-hour skin secretion was collected from skin lesions and unaffected sites of 20 patients. Skin secretions were collected from 20 people exposed to arsenic-contaminated drinking water and 20 healthy, unexposed individuals. The secretion of arsenic from the skin of healthy controls (mean ± SE; unit: μg/in.(2) of skin/24 h; chest: 0.6 ± 0.2; back: 0.3 ± 0.1; abdomen: 0.5 ± 0.2) was increased several folds in arsenic-exposed controls (chest: 8.4 ± 1.8; back: 8.3 ± 1.9; abdomen: 6.7 ± 1.8) and patients (chest: 9.2 ± 1.3; back: 7.8 ± 1.3; abdomen: 5.2 ± 1.0). There was no difference in the skin lesions and unaffected sites in patients. However, the secretion of cholesterol was significantly lower in the chest of patients (190 ± 36) and healthy controls (686 ± 100) (p vitamin E were low in healthy controls (chest: 8.5 ± 3.1; back: 5.2 ± 1.7; and abdomen: 8.7 ± 2.4), higher in arsenic-exposed controls (chest: 30.2 ± 8.1; back: 16.3 ± 8.9; and abdomen: 24.8 ± 9.3), and highest in patients [chest: 91.4 ± 14.9 (p skin lesions showed no alteration in secretion of arsenic, although the secretion of cholesterol, vitamin E, and zinc was changed. Potential implications are discussed.
Personnel decontamination and preventive skin care
International Nuclear Information System (INIS)
Henning, Klaus; Gojowczyk, Peter
2010-01-01
Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)
Effects of tretinoin on wound healing in aged skin.
de Campos Peseto, Danielle; Carmona, Erica Vilaça; Silva, Kellyn Cristina da; Guedes, Flavia Roberta Valente; Hummel Filho, Fernando; Martinez, Natalia Peres; Pereira, José Aires; Rocha, Thalita; Priolli, Denise Gonçalves
2016-03-01
Aged and adult populations have differences in the structural, biological, and healing properties of skin. Comparative studies of healing under the influence of retinoids in both these populations are very important and, to the best of our knowledge, have not been performed to date. The purpose of this study was to compare the activities of topical tretinoin in aged and adult animal models of wound healing by secondary intention. Male aged rats (24 months old, n = 7) and adult rats (6 months old, n = 8) were used. The rats were assigned to the following groups according to the dates on which wound samples were excised (day 14 or 21 after model creation): treated group, control group, and naive group. Topical application of tretinoin cream was used only on the proximal wound and was applied daily for 7 days. Wound healing areas were measured using metal calipers, and morphological analysis was performed. Slides were stained with Hematoxylin and Eosin, Masson's trichrome, and periodic acid-Schiff stains. Statistical analysis adopted a 5% coefficient for rejection of the null hypothesis. Although aged animals showed skin repair, complete reepithelialization was found on day 21 in some animals of both groups (treated and control). In aged rats, the wound area was significantly smaller in treated wounds than in untreated wounds, resulting in a larger scar area compared with the adult group. When treated wounds were compared, no differences were found between the wound areas in adult and aged rats. As expected, the collagen concentration was higher in normal skin from adult rats than in normal skin from aged animals, but there was no difference when aged skin was treated with tretinoin. These results indicate that tretinoin increases collagen synthesis in aged skin and returns the healing process to a normal state of skin healing. © 2016 by the Wound Healing Society.
Resistance of germfree athymic nude mice to two-stage skin carcinogenesis
Energy Technology Data Exchange (ETDEWEB)
Holland, J.M.; Perkins, E.H.
1979-01-01
Germfree athymic and normal littermate mice were compared with respect to their relative sensitivity to single skin application of dimethylbenzanthacine followed either by croton oil or TPA applied as a co-carcinogen. In separate experiments the acute response of both phenotypes to TPA was assessed by histologic examination of skin as well as the incorporttion of tritiated thymidine into acid insoluble material obtained from the isolated epidermis. Nude mice were observed to be less, equal, or more sensitive than normal littermate to topical skin carcinogenesis depending upon experimental variables. The tendency of solvent to spread rapidly on the skin of nude mice appeared to have the greatest influence on susceptibility to papilloma induction. Other factors of potential, although unproven importance, include differences in skin structure, possibly associated with accelerated activity of hair follicles as well as resistance to both the inflammatory and hyperplasiogenic effects of TPA.
Directory of Open Access Journals (Sweden)
NKA Maya Damayanti
2013-12-01
Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 So far, a lot of people who want their face skin always looks young though age continued to grow. It cannot be denied that aging will occur in everyone although some faster or later occur. Various ways were developed by scientists to fix this issue. Laser Skin Resurfacing (LSR technique to tighten facial skin is a procedure that is popular among the public and the practice of medicine. CO2 LSR technique is still a gold standard was used. Pain during surgery can be reduced when this technique was combined with air cooling. In addition, the adverse effects of post-operative might be tolerated. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}
Elevated c-Src and c-Yes expression in malignant skin cancers
Directory of Open Access Journals (Sweden)
Lee Jang
2010-08-01
Full Text Available Abstracts Background Src family kinases (SFKs play an important role in cancer proliferation, survival, motility, invasiveness, metastasis, and angiogenesis. Among the SFKs, c-Src and c-Yes are particularly over-expressed or hyper-activated in many human epithelial cancers. However, only a few studies have attempted to define the expression and role of c-Src and c-Yes in cutaneous carcinomas. Objectives To investigate the expression of c-Src and c-Yes in cutaneous carcinomas to include malignant melanoma (MM, squamous cell carcinoma (SCC and basal cell carcinoma (BCC. Methods We examined 6 normal skin tissues and 18 malignant skin tumor tissues using western blotting for the expression of c-Src and c-Yes. In another set, 16 specimens of MM, 16 SCCs and 16 BCCs were analyzed for the expression of c-Src and c-Yes using immunohistochemical staining. Results Western blotting showed that c-Src was expressed in all malignant skin tumors, but not in normal skin, while c-Yes was expressed in MM and SCC, but not in BCC and normal skin. Immunohistochemical staining results of c-Src and c-Yes in MM, SCC, and BCC mirrored those of the western blot analysis. Conclusions c-Src, rather than c-Yes, plays a key role in the proliferation and progression of malignant skin cancers.
Volumetric Visualization of Human Skin
Kawai, Toshiyuki; Kurioka, Yoshihiro
We propose a modeling and rendering technique of human skin, which can provide realistic color, gloss and translucency for various applications in computer graphics. Our method is based on volumetric representation of the structure inside of the skin. Our model consists of the stratum corneum and three layers of pigments. The stratum corneum has also layered structure in which the incident light is reflected, refracted and diffused. Each layer of pigment has carotene, melanin or hemoglobin. The density distributions of pigments which define the color of each layer can be supplied as one of the voxel values. Surface normals of upper-side voxels are fluctuated to produce bumps and lines on the skin. We apply ray tracing approach to this model to obtain the rendered image. Multiple scattering in the stratum corneum, reflective and absorptive spectrum of pigments are considered. We also consider Fresnel term to calculate the specular component for glossy surface of skin. Some examples of rendered images are shown, which can successfully visualize a human skin.
Human normal tissue reactions in radiotherapy
International Nuclear Information System (INIS)
Taniike, Keiko
1990-01-01
Acute and late normal tissue reactions in radiotherapy have not been considered to be major problems with conventional fractionation. But they may cause certain problems when newer schedules such as hyperfractionation or accelerated fractionation are used. In opposing parallel radiotherapy, the dose fractionation of skin or subcutaneous connective tissue are different between in one portal and two portals daily. So we examined acute skin erythema and late connective tissue fibrosis in the two groups (one and two portals) of the patients with uterus cancer. Acute skin erythema and late connective tissue fibrosis were slightly stronger in case of one portal daily. In relation to the anatomical site of skin, acute skin erythema was stronger at the buttocks than the lower abdomen, but late fibrosis was reverse to that. So the degree of acute skin erythema did not predict the degree of late connective tissue fibrosis. The number of Time Dose Fractionation Factor could roughly estimate the degree of erythema and fibrosis. Late fibrosis in 36 fractions increased with an increase of abdominal thickness, but acute erythema did not. (author)
Koerbin, G; Cavanaugh, J A; Potter, J M; Abhayaratna, W P; West, N P; Glasgow, N; Hawkins, C; Armbruster, D; Oakman, C; Hickman, P E
2015-02-01
Development of reference intervals is difficult, time consuming, expensive and beyond the scope of most laboratories. The Aussie Normals study is a direct a priori study to determine reference intervals in healthy Australian adults. All volunteers completed a health and lifestyle questionnaire and exclusion was based on conditions such as pregnancy, diabetes, renal or cardiovascular disease. Up to 91 biochemical analyses were undertaken on a variety of analytical platforms using serum samples collected from 1856 volunteers. We report on our findings for 40 of these analytes and two calculated parameters performed on the Abbott ARCHITECTci8200/ci16200 analysers. Not all samples were analysed for all assays due to volume requirements or assay/instrument availability. Results with elevated interference indices and those deemed unsuitable after clinical evaluation were removed from the database. Reference intervals were partitioned based on the method of Harris and Boyd into three scenarios, combined gender, males and females and age and gender. We have performed a detailed reference interval study on a healthy Australian population considering the effects of sex, age and body mass. These reference intervals may be adapted to other manufacturer's analytical methods using method transference.
Spectral Detection of Human Skin in VIS-SWIR Hyperspectral Imagery without Radiometric Calibration
2012-03-01
6 Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less melanin appears brighter because it has higher reflectance...6 illustrates the spectral reflectance of human skin with different melanin levels. One paper proposes a Normalized Difference Skin Index (NDSI), a...1.4% Melanin 12.6% Melanin 23.2% Melanin 34.3% Melanin 45% Melanin Figure 6. Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less
Jayamali, W D; Herath, H M M T B; Kulathunga, Aruna
2017-09-04
Anaphylaxis is an acute, potentially fatal medical emergency. Myocardial injury or infarction in the setting of an anaphylaxis can be due the anaphylaxis itself, when it is known as Kounis syndrome or it can also be due to the effect of epinephrine treatment. Epinephrine is considered as the cornerstone in management of anaphylaxis. Myocardial infarction secondary to therapeutic doses of adrenaline is a rare occurrence and only a few cases have been reported in literature. The mechanism of myocardial injury was considered to be due to coronary vasospasm secondary to epinephrine as the coronary angiograms were normal on these occasions. A 21-year- old previously healthy male got admitted to the local hospital with an urticarial rash and difficulty in breathing, one hour after ingestion of prawns for which he was known to be allergic. He was treated with 0.5 ml of intramuscular adrenaline (1:1000) which was administered to the lateral side of the thigh, following which he developed palpitations and tightening type central chest pain. Electrocardiogram showed ST segment depressions in leads III, aVF and V1 to V5 and he was transferred to a tertiary care hospital. The second electrocardiogram, done 2 h later, showed resolution of ST segment depressions but new T inversions in leads I and aVL. Troponin I was elevated with a titer of 2.15 ng/ml. He was treated with sublingual GTN in the emergency treatment unit and the symptoms resolved. Transthoracic 2D echocardiogram and stress testing with treadmill was normal and CT coronary angiogram revealed normal coronary arteries. Here we present a case of a young healthy adult with no significant risk factors for coronary artery disease who developed myocardial infarction following intramuscular administration of therapeutic dose of adrenalin for an anaphylactic reaction. The postulated mechanism is most likely an alpha receptor mediated coronary vascular spasm. However the use of adrenaline in the setting of life
Energy Technology Data Exchange (ETDEWEB)
Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)
2013-02-15
Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.
International Nuclear Information System (INIS)
Xia, Xiaojun; Park, Eunmi; Fischer, Susan M.; Hu, Yinling
2013-01-01
Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside
Posterior superior temporal sulcus responses predict perceived pleasantness of skin stroking
Directory of Open Access Journals (Sweden)
Monika Davidovic
2016-09-01
Full Text Available Love and affection is expressed through a range of physically intimate gestures, including caresses. Recent studies suggest that posterior temporal lobe areas typically associated with visual processing of social cues also respond to interpersonal touch. Here, we asked whether these areas are selective to caress-like skin stroking. We collected functional magnetic resonance imaging (fMRI data from 23 healthy participants and compared brain responses to skin stroking and vibration. We did not find any significant differences between stroking and vibration in the posterior temporal lobe; however, right posterior superior temporal sulcus (pSTS responses predicted healthy participant's perceived pleasantness of skin stroking, but not vibration. These findings link right pSTS responses to individual variability in perceived pleasantness of caress-like tactile stimuli. We speculate that the right pSTS may play a role in the translation of tactile stimuli into positively valenced, socially relevant interpersonal touch and that this system may be affected in disorders associated with impaired attachment.
Variation in skin biology to climate in Shanghai, China.
Liu, Xiaoping; Gao, Yanrui; Zhang, Yiyi; Wang, Xuemin
2017-09-01
To explore the relationship between climate and skin condition, and to investigate the variation of skin biology to climatic change. In total, 2005 healthy Chinese volunteers living in Shanghai (aged 13-69 years) were recruited. Transepidermal water loss (TEWL) and SCH were tested on six sites (forehead, cheek, nasolabial, inner forearm, dorsal hand, and palm) by noninvasive devices between January 2005 and December 2012. The corresponding climate data were recorded by local Weather Bureau. TEWL was increased with atmospheric pressure and decreased with temperature, steam pressure, and relative humidity (p climate parameters together, we introduced these correlated factors into the multivariate linear regression model which demonstrated that temperature and steam pressure were main factors related to skin biological parameters. At different sites, the effect of climatic factors on skin biology was diverse. Skin biological parameters are associated with climatic factors. Different sites have different sensitivity to climate factors.
Fritz, Jason R; Phillips, Brett T; Conkling, Nicole; Fourman, Mitchell; Melendez, Mark M; Bhatnagar, Divya; Simon, Marcia; Rafailovich, Miriam; Dagum, Alexander B
2012-10-01
Dermal substitutes are currently used in plastic surgery to cover various soft tissue defects caused by trauma, burns, or ablative cancer surgery. Little information is available on the biomechanical properties of these dermal substitutes after adequate incorporation as compared to normal skin. Determining parameters such as tensile strength in these skin substitutes will help us further understand their wound healing properties and potential in developing artificial tissue constructs. We hypothesize that a dermal substitute has a lower stress-strain curve and altered stress-induced deformation quantified with tensiometry and digital image speckle correlation (DISC) analysis. Two separate 5×10-cm full-thickness wounds were created on the dorsum of 3 female swine. Fibrin glue was applied before either a full-thickness skin graft (FTSG) or application of artificial dermal matrix. On day 42, cultured autologous keratinocytes were applied as a cell sheet to the wound covered with Integra. On day 56, the wounds were fully excised and fresh tissue specimens, including normal skin, were stored in a physiological solution and prepared for analysis. Rectangular samples were excised from the center of each specimen measuring 4×4×30 mm. Using a tensiometer and DISC analysis, we evaluated the tensile strength of 3 different groups of skin, namely, normal, FTSG, and Integra. There is a significant difference between the Integra specimen when compared to normal skin and FTSG. We found a minimal difference in the stress-strain curves of the latter two. Integra alone shows plastic deformation with continued stretching before ultimate midline fracture. There is significant change between the Young's moduli of the normal skin and the Integra, whereas there is little difference between the FTSG and the normal skin; DISC confirms this analysis. The normal skin and FTSG show a convergence of vectors to a linear plane, whereas Integra shows very little organization. Using 2 different
Kremer, M; Lang, E; Berger, A C
2000-09-01
origin. These experimental results demonstrate the establishment of an effective cell cultivation process which may be suitable for scale-up production of the epidermal component as large-scale composite-skin grafts. When seeded into Integratrade mark and grafted onto the nude mouse a replacement skin with normal functioning dermal-epidermal components was developed. These results encourage the design of a clinical trial to assess the function of this composite graft in man.
Westerhof, W.; Estevez-Uscanga, O.; Meens, J.; Kammeyer, A.; Durocq, M.; Cario, I.
1990-01-01
In 54 healthy volunteers we assessed predictors of sensitivity to ultraviolet (UV) light, including Fitzpatrick's sun reactive skin types and constitutional skin color, and compared these with one another and with responses of the skin to UV irradiation, as determined experimentally by a minimal
Wang, Liyun; Yan, Feng; Yang, Yujia; Xiang, Xi; Qiu, Li
2017-07-01
The purpose of this study was to evaluate the usefulness of ultrasound shear-wave elastography (US-SWE) in characterization of localized scleroderma (LS), as well as in the disease staging. A total of 21 patients with 37 LS lesions were enrolled in this study. The pathologic stage (edema, sclerosis or atrophy) of the lesions was characterized by pathologic examination. The skin elastic modulus (E-values including E mean , E min , E max and E sd ) and thickness (h) was evaluated both in LS lesions and site-matched unaffected skin (normal controls) using US-SWE. The relative difference of E-values (E RD ) was calculated between each pair of lesions and its normal control for comparison among different pathologic stages. Of the 37 LS lesions, 2 were in edema, 22 were in sclerosis and 13 were in atrophy. US-SWE results showed a significant increase of skin elastic modulus and thickness in all lesions (p < 0.001 in sclerosis and p < 0.05 in atrophy) compared with the normal controls. The measured skin elastic modulus and thickness were greater in sclerosis than in atrophy. However, once normalized by skin thickness, the atrophic lesions, which were on average thinner, appeared significantly stiffer than those of the sclerosis (normalized E RD : an increase of 316.3% in atrophy vs. 50.6% in sclerosis compared with the controls, p = 0.007). These findings suggest that US-SWE allows for quantitative evaluation of the skin stiffness of LS lesions in different stages; however, the E-values directly provided by the US-SWE system alone do not distinguish between the stages, and the normalization by skin thickness is necessary. This non-invasive, real-time imaging technique is an ideal tool for assessing and monitoring LS disease severity and progression. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.
Nguyen, Dai Q A; Potokar, Tom S; Price, Patricia
2010-02-01
The field of wound healing and tissue repair has advanced rapidly in the last decade, with this there is an increasing emphasis on the importance of the functional and cosmetic outcomes following injury. Integra artificial skin is the most widely used synthetic skin substitute and is reported to have better outcomes in relation to the appearance and elasticity when compared to split thickness skin grafting (SSG). A review of the literature reveals very few trials that are based on an objective evaluation of Integra treated scars as compared to SSGs. This research aimed to provide objective data on the long-term outcome of Integra. All adult patients from the Welsh Burns Centre who had been successfully treated with Integra+/-SSG were invited to attend a clinic for a follow up provided they had been healed for greater than one year. The hypothesis that Integra scars are more pliable than skin grafts was tested objectively using the Cutometer, a suction device which measures skin elasticity. Of the 13 patients eligible, six were available for assessment. The results of this study suggest that Integra treated sites correlate well with normal skin as measured by the Cutometer. This was statistically significant for the parameters Ur/Ue (elastic function) and Ur/Uf (gross elasticity). On the other hand there was no correlation seen between the patients SSG sites and the patient's normal skin. With advances in medicine we are increasingly able to modulate wound healing and the resultant scars. In order to assess new and often costly treatments the need for objective scar measurement tools have become apparent. Integra has been advocated to improve scarring from injury. However, there have been few studies to evaluate the long-term outcome of Integra as compared to traditional methods such as SSG. In the past scar evaluation has been based on subjective scores by patients and clinicians. Now the mechanical properties of the skin can be evaluated using simple
Elemental composition of skin tissue by PIXE and INAA analyses
International Nuclear Information System (INIS)
Hollands, R.; Spyrou, N.M.
1997-01-01
Hypertrophic scars are a particular type of scar that can form after any type of dermal injury. They are unsightly, red, elevated above normal skin level, itchy and painful. At present no-one knows why these scars form. Due to the differences between scar tissue and normal skin it was decided to analyse skin tissue which at a later date would be compared to scar tissue. Spit skin graft (epidermis) samples as well as full thickness skin (epidermis to dermis) tissue were analysed using PIXE and RBS with a 2 MeV proton beam. The epidermis was compared to the dermis to see if there were any variations between the two. In all the samples P, S, Cl, K, Ca, Fe, and Cd were detected and in a majority of the samples Zn and Ba were found, using PIXE. It was found that, between the epidermis and dermis, there was an significant increase in P in the epidermis in both full thickness and split skin graft samples. Complementary elemental analysis was also performed using neutron activation, and Br, Na and Zn were detected. (author)
The measurement of skin impedance for the diagnosis of skin cancer
International Nuclear Information System (INIS)
Menzies, S.; Crook, B.; McCarthy, W.
1996-01-01
Full text: In vivo skin impedance measurements have been reported to be diagnostic in differentiating benign from malignant skin tumours (Kiss G et al. Borgyogy Vener Szle 45: 164,1969; Melczer N. In: Cancer of the Skin. Saunders Co. Philadelphia, 1976, pp293-313). However, in contrast to non-melanoma skin cancer, only, a small sample of malignant melanomas were reported in these previous studies. We performed skin impedance measurements on a larger sample of melanomas in order to assess the potential use of such instrumentation for clinical diagnosis. The diagnostic method described by Kiss and Horvath was reproduced with only minor modifications. Low voltage impedance measurements at 1600 Hz were taken over each lesion and on nearby surrounding normal skin. Filter paper (4mm diameter) soaked in 0.1 M KCl was used at the skin-probe interface. A minimum of 2 skin and 1 lesion measurements were taken. All lesions were taken from relatively hairless sites and were non abraded or ulcerated. With the exception of 6 seborrhoeic keratoses all lesions were excised for histological diagnosis. The lesions tested were 27 invasive melanomas, 3 in situ melanomas, 27 basal cell carcinomas (BCC), 70 benign melanocytic lesions, 19 seborrhoeic keratoses, 5 Bowens disease (in situ SCC), 1 squamous cell carcinoma (SCC) and 25 other benign lesions. Results were interpreted as previously (Melczer) by the quotient of skin impedance / lesion impedance > 1.5 indicating malignancy. Analysis of total melanocytic lesions gave a sensitivity of 44% and specificity of 83% for the diagnosis of invasive melanoma (p < 0.05). Fifty two percent of BCCs were positively diagnosed. Analysis of all benign versus all invasive malignancy gave a sensitivity of 47% and specificity of 77% for the diagnosis of invasive malignancy (p < 0.01). While impedance measurements at 1600 Hz provide a statistically significant differentiation of melanoma versus non-melanoma and invasive malignancy versus benign lesions
Skin hydration and cooling effect produced by the Voltaren® vehicle gel.
Hug, Agnes M; Schmidts, Thomas; Kuhlmann, Jens; Segger, Dörte; Fotopoulos, Grigorios; Heinzerling, Johanna
2012-05-01
Voltaren vehicle gel is the carrier substance of the topical Voltaren products. This vehicle gel is especially formulated to be easily applied on the skin, while providing some sensory benefits. The present study aims to substantiate the widely perceived hydrating and cooling effect of Voltaren vehicle gel. Volar forearm skin hydration and transepidermal water loss (TEWL) were measured and user satisfaction was evaluated by questionnaires, after application in 31 healthy, female volunteers. The cooling effect was investigated for 40 min with thermal imaging on 12 forearm sites of six healthy subjects. Voltaren vehicle gel application increased skin hydration by 13.1% (P = 0.0002) when compared with the untreated site, 8 h after the final treatment after 2 weeks. TEWL decreased on both treated (0.37 g/m(2) /h) and untreated (0.74 g/m(2) /h) forearm sites after 2 weeks (8 h after last treatment), demonstrating a relative increase of 6.5% in water loss. Voltaren vehicle gel application resulted in a rapid reduction of skin surface temperature by 5.1°C after only 3 min with an average maximum reduction of 5.8°C after 10 min. The cooling effect was experienced by 94% subjects, while 74% felt that their skin became softer. No adverse events, including skin irritation, were reported during the study and by the 37 participants. This study showed a statistically significant increase in skin hydration as well as a rapid cooling effect lasting approximately 30 min, after application of Voltaren vehicle gel. The small relative increase in water loss may be attributed to an additional skin surface water loss secondary to the increased water content brought into the skin by the Voltaren vehicle gel. The use did not induce any skin irritation and was found acceptable to use by the majority of participants. © 2011 John Wiley & Sons A/S.
Heydari, Saman; Ghanbarzadeh, Saeed; Anoush, Behzad; Ranjkesh, Mohammadreza; Javadzadeh, Yousef; Kouhsoltani, Maryam; Hamishehkar, Hamed
2017-07-01
Free radical scavengers and antioxidants, with the main focus on enhanced targeting to the skin layers, can provide protection against skin ageing. The aim of the present study was to prepare nanoethosomal formulation of gammaoryzanol (GO), a water insoluble antioxidant, for its dermal delivery to prevent skin aging. Nanoethosomal formulation was prepared by a modified ethanol injection method and characterized by using laser light scattering, scanning electronic microscope (SEM) and X-ray diffraction (XRD) techniques. The effects of formulation parameters on nanoparticle size, encapsulation efficiency percent (EE%) and loading capacity percent (LC%) were investigated. Antioxidant activity of GO-loaded formulation was investigated in vitro using normal African green monkey kidney fibroblast cells (Vero). The effect of control and GO-loaded nanoethosomal formulation on superoxide dismutase (SOD) and malondialdehyde (MDA) content of rat skin was also probed. Furthermore, the effect of GO-loaded nanoethosomes on skin wrinkle improvement was studied by dermoscopic and histological examination on healthy humans and UV-irradiated rats, respectively. The optimized nanoethosomal formulation showed promising characteristics including narrow size distribution 0.17 ± 0.02, mean diameter of 98.9 ± 0.05 nm, EE% of 97.12 ± 3.62%, LC% of 13.87 ± 1.36% and zeta potential value of -15.1 ± 0.9 mV. The XRD results confirmed uniform drug dispersion in the nanoethosomes structure. In vitro and in vivo antioxidant studies confirmed the superior antioxidant effect of GO-loaded nanoethosomal formulation compared with control groups (blank nanoethosomes and GO suspension). Nanoethosomes was a promising carrier for dermal delivery of GO and consequently had superior anti-aging effect.
May, Elizabeth R; Kinyon, Joann M; Noxon, James O
2012-12-07
In veterinary medicine, Staphylococcus schleiferi was previously assumed to be an inhabitant of carnivore skin, however, more recently, it has been repeatedly documented in the literature as both an inhabitant and as a pathogen. In order to determine the frequency of nasal carriage, and the methicillin susceptibility pattern of S. schleiferi from healthy dogs as well as dogs with otitis and/or pyoderma, a prospective study including 24 dogs with healthy ears and skin, 27 dogs with healthy ears and pyoderma, 15 dogs with otitis without pyoderma and 20 dogs with both otitis and pyoderma was performed. Specimens were obtained and cultured and isolates were identified as S. schleiferi based on growth and biochemical characteristics. S. schleiferi was isolated from the nares of 1 healthy dog, 3 dogs with recurrent pyoderma, 2 dogs with recurrent otitis, and 1 dog with both recurrent otitis and pyoderma. One of the S. schleiferi isolates was methicillin resistant. Nasal carriage of S. schleiferi does occur in healthy dogs as well as dogs with otitis and pyoderma. Methicillin resistant and sensitive S. schleiferi can be found in the nares of dogs with diseased ears and skin. Copyright © 2012 Elsevier B.V. All rights reserved.
Effects of radiation on the skin blood volume pulse in humans
Energy Technology Data Exchange (ETDEWEB)
Zanelli, G D [Mount Vernon Hospital, Northwood (UK)
1977-01-01
Measurements have been made of the changes in skin blood volume pulse (BVP) in the irradiated skin of three patients (two female, one male) during and up to 250 days after radiotherapy for malignant disease. The instrumentation comprised a modified commercial finger photo-plethysmograph probe with associated electronics, and a survey of the literature revealed that the consensus of opinion seems to be that the recorded pulsations arise from small 'muscular' arteries and arterioles in the 40 to 300 ..mu..m size range. The results show that, as expected, normal, untreated skin shows sizeable variations in BVP. The BVP of irradiated skin became significantly greater than that of normal skin when a dose of 1000 to 1500 rad has been accumulated. The maximum amplitude of the BVP of the irradiated skin seemed to correlate well with the overall severity of the erythema, but increases in BVP preceded erythema flare-ups. In two patients, elevated BVP were recorded for irradiated areas even when most visual signs of erythema had disappeared. Mild cooling of irradiated and non-irradiated skin had differing effects in the BVP. The measurement of the BVP of irradiated skin is a simple, reliable and completely atraumatic method for investigating vascular damage to superficial tissues in humans.
Erythema exsudativum multiforme after a Leishmania skin test
Wind, Bas S.; Guimarães, Luiz H.; Machado, Paulo R. L.
2014-01-01
A 45-year-old otherwise healthy male from an endemic region for Leishmania braziliensis infection in Bahia, Brazil, presented with three erosive hemorrhagic infiltrated plaques on the left shin accompanied with lymphadenopathy in the groin since one month. A Leishmania skin test performed on the
Observation of radiation effects on skin clinical roentgenologists
International Nuclear Information System (INIS)
Chen Weizhong; Liu Yunling
1987-01-01
The clinical observation of the effects of chronic irradiation on skin in 158 cases of clinical roentgenologists was reported. The results revealed that the incidence of morphological changes of microcirculaton in finger nail fold was as high as 47.6% for roentgenologists in contract to 5.2% for healthy adults. Other positive signs for skin injury were found in about 10.8-46.2% of roentgenologists. Two cases with typical chronic dermatitis were reported in this paper as well. These resuls attracted our attention to the radiation protection for clinical roentgenologists
Permeability of commercial solvents through living human skin
DEFF Research Database (Denmark)
Ursin, C; Hansen, C M; Van Dyk, J W
1995-01-01
A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... was characterized by calculation of the "percent error of the slope." The following permeability rates (g/m2h) of single solvents were measured: dimethyl sulfoxide (DMSO), 176; N-methyl-2-pyrrolidone, 171; dimethyl acetamide, 107; methyl ethyl ketone, 53; methylene chloride, 24; [3H]water, 14.8; ethanol, 11...
Parveen, Rashida; Akhtar, Naveed; Mahmood, Tariq
2014-12-01
Punica granatum is apotent source of polyphenolic compounds with strong free radicals scavenging activity. The skin lightening effects of Punica granatum are assumed due to ellagic acid which acts by chelating copper at the active site of tyrosinase. To explore a topical microemulsion (O/W) of pomegranate (Punica granatum) extract for its control on skin erythema and melanin. Microemulsions were formulated using a polysorbate surfactant (Tween 80(®)) along with cosurfactant (propylene glycol) and were characterized regarding their stability. The placebo microemulsion (without extract) and the active microemulsion (containing Punica extract) were applied in a split face fashion by the volunteers (n = 11) for a period of 12 weeks. Skin erythema and melanin were measured at baseline and after every 15 days to determine any effect produced by these formulations. Active formulation showed a significant impact on skin erythema and melanin (p Punica granatum extract for conditions where elevated skin melanin and erythema have significantly prone skin physiology.
Increased number and frequency of group 3 innate lymphoid cells in nonlesional psoriatic skin
DEFF Research Database (Denmark)
Dyring-Andersen, B; Geisler, Carsten; Agerbeck, C
2014-01-01
BACKGROUND: Psoriasis is a common immune-mediated inflammatory disease that affects the skin and joints. The interleukin (IL)-23/IL-17A axis and IL-22 play key roles in the pathogenesis of psoriasis. IL-23-responsive innate lymphoid cells (ILCs) with a high capacity to produce IL-17 and/or IL-22....... METHODS: Skin biopsies were taken from healthy skin, nonlesional and lesional psoriatic skin, and nickel- and petrolatum-exposed skin from patients with contact allergy to nickel, and lymphocytes were isolated. The cells were stained and characterized by flow cytometry. Cytokine and ligand mRNA expression...
The skin microbiome: Associations between altered microbial communities and disease.
Weyrich, Laura S; Dixit, Shreya; Farrer, Andrew G; Cooper, Alan J; Cooper, Alan J
2015-11-01
A single square centimetre of the human skin can contain up to one billion microorganisms. These diverse communities of bacteria, fungi, mites and viruses can provide protection against disease, but can also exacerbate skin lesions, promote disease and delay wound healing. This review addresses the current knowledge surrounding the healthy skin microbiome and examines how different alterations to the skin microbial communities can contribute to disease. Current methodologies are considered, changes in microbial diversity and colonisation by specific microorganisms are discussed in the context of atopic dermatitis, psoriasis, acne vulgaris and chronic wounds. The recent impact of modern Westernised lifestyles on the human skin microbiome is also examined, as well as the potential benefits and pitfalls of novel therapeutic strategies. Further analysis of the human skin microbiome, and its interactions with the host immune system and other commensal microorganisms, will undoubtedly elucidate molecular mechanisms for disease and reveal gateways for novel therapeutic treatment strategies. © 2015 The Australasian College of Dermatologists.
Skin Diseases: Skin Health and Skin Diseases
Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...
Claudins 1, 2, 3, 4, 5 and 7 in solar keratosis and squamocellular carcinoma of the skin
Hintsala, Hanna-Riikka; Siponen, Maria; Haapasaari, Kirsi-Maria; Karihtala, Peeter; Soini, Ylermi
2013-01-01
Claudins are tight junction proteins regulating the paracellular permeability of cell layers. We investigated the expression of claudins 1, 2, 3, 4, 5 and 7 in a sample set consisting of a total of 93 cases representing normal skin, actinic keratoses and squamous cell carcinomas of the skin. There were several changes found in claudin expression. Claudin 1 appeared to be progressively decreased in solar keratosis and skin squamous cell carcinomas compared to normal skin while expression of claudin 2 was increased. With claudins 3 and 5 occasional immunoreactivity was found in squamous cell carcinomas. Claudins 4 and 7 were variably expressed in skin neoplasia compared to normal skin. According to the results expression of claudins 1 and 2 change in parallel with the severity of the epidermal preneoplastic and neoplastic lesions thus probably influencing the disturbed epithelial polarity characteristic of these lesions. Claudin 1 under- and claudin 2 overexpression also lead to a leakier epithelial barrier function of the skin with a resulting damage to skin epithelial resistance. Other claudins investigated in this study did not show progressive changes even though occasional overexpression of them was found in skin squamous cell carcinoma. PMID:24294371
The effect of vitamin E on acute skin reaction caused by radiotherapy.
Dirier, A; Akmansu, M; Bora, H; Gurer, M
2007-09-01
Ionizing radiation affects healthy organs and tissues as well as diseased tissues during radiation therapy. Skin reactions varying from acute erythema to necrosis can be seen. It has been found that vitamin E can prevent mutagenic and/or carcinogenic effects of ionizing radiation in both animals and cell cultures. This study investigated the preventative effect of antioxidant vitamin E on irradiation-induced acute skin reactions. No protective effect of vitamin E was demonstrated. It is possible that the vehicle induced free radical exposure in the irradiated skin.
Clinical Evaluation Of A New Emollient Cream In Cry Skin Conditions
Directory of Open Access Journals (Sweden)
Shukla V A
1998-01-01
Full Text Available Dry skin is a common problem both in healthy individuates and in patients with skin diseases. In all cases, emollients play important role in rehydrating the stratum corneum. To evaluate the efficacy of a new emollient, thirty-six patients with symptomatic dry skin disorders were enrolled. They were given the test emollient cream for topical application twice daily for 3 weeks and followed up weekly. Subjective complaints included pruritus and discomfort while objective parameters included scaling, erythema, roughness of skin, fissuring and hypopigmentation. Treatment with the test emollient cream reduced the severity in a majority of patients. Moreover, being free of perfume, co lour, urea and lanolin, the test cream was well tolerated by all participants.
Nanotribological characterization of human hair and skin using atomic force microscopy
International Nuclear Information System (INIS)
LaTorre, Carmen; Bhushan, Bharat
2005-01-01
Healthy hair and skin is highly desired. Characterization of their morphological, frictional, and adhesive properties (tribological properties) is essential to enhance understanding of hair and skin and to advance the science. Literature on the tribological characterization of hair and skin is scarce to date. The paper presents nanotribological data and analysis on hair (Caucasian, Asian, and African hair at virgin, chemo-mechanically damaged, and treated conditions) and synthetic hair and skin, as well as roughness data of human skin replica. Roughness statistics are presented to characterize the vertical and spatial surface parameters. Average coefficient of friction values were determined for each ethnicity and hair type, and are discussed. The directionality dependence of friction is also discussed. Magnitude and spatial distribution of adhesive force are used to estimate thickness and distribution of the conditioner film
Applications of positron annihilation to dermatology and skin cancer
International Nuclear Information System (INIS)
Liu, Guang; Chen, Hongmin; Chakka, Lakshmi; Gadzia, Joseph E.; Jean, Y.C.
2007-01-01
Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Applications of positron annihilation to dermatology and skin cancer
Energy Technology Data Exchange (ETDEWEB)
Liu, Guang; Chen, Hongmin; Chakka, Lakshmi [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); Gadzia, Joseph E. [Dermatology, Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS 66103 and Kansas Medical Clinic, Topeka, KS 66614 (United States); Jean, Y.C. [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); R and D Center for Membrane Technology, Chung Yuan Christian University, Chung-Li (China)
2007-07-01
Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Directory of Open Access Journals (Sweden)
Guillermo I Perez Perez
Full Text Available We studied skin microbiota present in three skin sites (forearm, axilla, scalp in men from six ethnic groups living in New York City.Samples were obtained at baseline and after four days following use of neutral soap and stopping regular hygiene products, including shampoos and deodorants. DNA was extracted using the MoBio Power Lyzer kit and 16S rRNA gene sequences determined on the IIlumina MiSeq platform, using QIIME for analysis.Our analysis confirmed skin swabbing as a useful method for sampling different areas of the skin because DNA concentrations and number of sequences obtained across subject libraries were similar. We confirmed that skin location was the main factor determining the composition of bacterial communities. Alpha diversity, expressed as number of species observed, was greater in arm than on scalp or axilla in all studied groups. We observed an unexpected increase in α-diversity on arm, with similar tendency on scalp, in the South Asian group after subjects stopped using their regular shampoos and deodorants. Significant differences at phylum and genus levels were observed between subjects of the different ethnic origins at all skin sites.We conclude that ethnicity and particular soap and shampoo practices are secondary factors compared to the ecological zone of the human body in determining cutaneous microbiota composition.
Relationship between infectious agents for vulvovaginitis and skin color.
Nomelini, Rosekeila Simoes; Carrijo, Ana Paula Borges; Adad, Sheila Jorge; Nunes, Altacílio Aparecido; Murta, Eddie Fernando Candido
2010-12-01
Many factors influence occurrences of vulvovaginitis. The aims here were to assess skin color and age-related differences in the vaginal flora and occurrences of vulvovaginitis. Cross-sectional study; tertiary referral hospital (Universidade Federal do Triângulo Mineiro, Uberaba). Healthy women who underwent routine outpatient gynecological assessments were assessed for vulvovaginitis and vaginal flora and then divided into whites (n = 13,881) and nonwhites (n = 5,295). Statistical analysis was performed using the X² test, logistic regression and odds ratios. The vaginal microflora was skin-color dependent, with greater occurrence of clue cells, Trichomonas vaginalis and coccobacilli in nonwhite women (p vulvovaginitis occurrence relating to skin color, which may be associated with variations in vaginal flora.
Changes in bacterial flora associated with skin damage on hands of health care personnel.
Larson, E L; Hughes, C A; Pyrek, J D; Sparks, S M; Cagatay, E U; Bartkus, J M
1998-10-01
In a prospective observational study of 40 nurses (20 with diagnosed hand irritation and 20 without), nurses with damaged hands did not have higher microbial counts (P = .63), but did have a greater number of colonizing species (means: 3.35 and 2.63, P = .03). Although numbers were small, nurses with damaged hands were significantly more likely to be colonized with Staphylococcus hominis (P = .03). Fifty-nine percent of S hominis isolates from nurses with damaged hands were resistant to methicillin compared with 27% of isolates from those with healthy skin (P = .14). Twenty percent of nurses with damaged hands were colonized with Staphylococcus aureus compared with none of the nurses with normal hands (P = .11). Nurses with damaged hands were also twice as likely to have gram-negative bacteria (P = .20), entercocci (P = .13), and Candida (P = .30) present on the hands. Antimicrobial resistance of the coagulase-negative staphylococcal flora (with the exception of S hominis) did not differ between the 2 groups, nor did a trend toward increasing resistance exist when compared with other studies during the past decade. Skin moisturizers and protectant products were used almost universally by nurses at work, primarily products brought from home. Efforts to improve hand condition are warranted because skin damage can change microbial flora. Such efforts should include assessment or monitoring of hand care practices, formal institutional policy adoption and control of use of skin protectant products or lotions, and prudent use of latex gloves or more widespread use of powder-free and nonlatex products.
Stratum corneum integrity as a predictor for peristomal skin problems in ostomates
DEFF Research Database (Denmark)
Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T
2010-01-01
BACKGROUND: Peristomal skin problems are common, most often the result is disruption of the skin barrier and this may account for more than one in three visits to ostomy nurses. Therefore a specific assessment of individual risk factors relating to the skin barrier function would be of great...... interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...
Experimental skin carcinoma by UVB application
Directory of Open Access Journals (Sweden)
Andrada Iftode
2016-12-01
Full Text Available OBJECTIVES AND BACKGROUND The aim of this research study was to evaluate the harmful effects at skin level induced by concomitant and repeated exposure to three toxic agents: UVB radiation, DMBA and TPA. MATERIALS AND METHODS Experimental mice were divided in thw following groups (n=5 mice/group: group 1 – healthy mice, group 2 – mice exposed to UVB – radiation and topical administration of acetone and group 3 – mice exposed to UVB – radiation and topical application of DMBA and TPA solutions (phase I - double tumor initiation and phase II - tumor promotion. RESULTS Application of these compounds led to the development of skin papilloma and to significant changes in skin parameters. CONCLUSIONS The barrier function of the skin was degraded in UVB exposed mice. DMBA and TPA depended on carcinogens schedule and corelated with skin carcinoma. Graphical abstract: Schematic protocol of experimental skin carcinoma REFERENCES 1. Lee Ja, Ko Jh, Jung Bg, Kim Th, Hong Ji, Park Ys, Lee Bj. Fermented Prunus mume with Probiotics Inhibits 7,12- Dimethylbenz[a]anthracene and 12-OTetradecanoyl phorbol-13-acetate Induced Skin Carcinogenesis through Alleviation of Oxidative Stress. Asian Pac J Cancer Prev. 2013;14:2973-2978. 2. Firooz A, Sadr B, Babakoohi S, Sarraf-Yazdy M, Fanian F, Kazerouni-Timsar A, NassiriKashani M, Naghizadeh MM, Dowlati Y. Variation of Biophysical Parameters of the Skin with Age, Gender, and Body Region. Scientific World Journal. 2012; doi.org/10.1100/2012/386936 3. Gheorgheosu (Coricovac D, Borcan F, Balasz NI, Soica C, Simu G, Kemeny L, Dehelean CA. Evaluation of skin parameters in C57BL/6J mice exposed to chemical and environmental factors using non-invasive methods. J Agroalim Proc Technol. 2014;20:14-20.
Ultrasonography of Skin Changes in Legs with Chronic Venous Disease.
Caggiati, A
2016-10-01
In daily practice, ultrasonography (US) is used only to designate the location and pattern of venous lesions. Skin US is not performed between routine venous investigations. Skin morphology is evaluated by the same probes used for routine Duplex evaluation of superficial veins. US findings from evident skin lesions are comparatively evaluated with those from the surrounding apparently normal skin and from the contralateral leg. Inflammation and dermal edema can be found in the apparently normal skin of C2 legs. Swollen legs show thickening of the subcutaneous layer as a result of diffuse soaking or anechoic cavities, with or without dermal edema. Chronic hypodermitis is characterized by inflammatory edema in initial phases, and by liposclerosis in advanced cases. Recrudescence of inflammation provokes focal rarefactions of the subcutaneous layer, possibly related to ulcer opening. In legs with venous disorders, sonography refines clinical evaluation of the skin and may reveal changes not highlighted by inspection. Some of these changes could require further investigation because they have not yet been explained or described. Skin sonography should improve knowledge of the natural history of skin changes, as well as contribute to a better grading of venous diseases severity In particular, US evidence of cutaneous and subcutaneous changes in C2 legs should be considered to stratify the treatment in C2 legs, by identifying those in which varicose veins are not simply a cosmetic problem. Copyright © 2016 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.
Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W
2013-11-01
The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Reconstructing in-vivo reflectance spectrum of pigmented skin lesion by Monte Carlo simulation
Wang, Shuang; He, Qingli; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan
2012-03-01
In dermatology applications, diffuse reflectance spectroscopy has been extensively investigated as a promising tool for the noninvasive method to distinguish melanoma from benign pigmented skin lesion (nevus), which is concentrated with the skin chromophores like melanin and hemoglobin. We carried out a theoretical study to examine melanin distribution in human skin tissue and establish a practical optical model for further pigmented skin investigation. The theoretical simulation was using junctional nevus as an example. A multiple layer skin optical model was developed on established anatomy structures of skin, the published optical parameters of different skin layers, blood and melanin. Monte Carlo simulation was used to model the interaction between excitation light and skin tissue and rebuild the diffuse reflectance process from skin tissue. A testified methodology was adopted to determine melanin contents in human skin based on in vivo diffuse reflectance spectra. The rebuild diffuse reflectance spectra were investigated by adding melanin into different layers of the theoretical model. One of in vivo reflectance spectra from Junctional nevi and their surrounding normal skin was studied by compare the ratio between nevus and normal skin tissue in both the experimental and simulated diffuse reflectance spectra. The simulation result showed a good agreement with our clinical measurements, which indicated that our research method, including the spectral ratio method, skin optical model and modifying the melanin content in the model, could be applied in further theoretical simulation of pigmented skin lesions.
The relationship of psychological trauma with trichotillomania and skin picking
Directory of Open Access Journals (Sweden)
Özten E
2015-05-01
Full Text Available Eylem Özten,1 Gökben Hızlı Sayar,1 Gül Eryilmaz,1 Gaye Kağan,2 Sibel Işik,3 Oğuz Karamustafalioğlu4 1Neuropsychiatry Health, Practice, and Research Center, Üsküdar University, 2Istanbul Neuropsychiatry Hospital, Üsküdar University, 3Turkish Red Crescent Altintepe Medical Center, 4Department of Psychology, Faculty of Human and Social Sciences, Üsküdar University, Istanbul, Turkey Objective: Interactions between psychological, biological and environmental factors are important in development of trichotillomania and skin picking. The aim of this study is to determine the relationship of traumatic life events, symptoms of post-traumatic stress disorder and dissociation in patients with diagnoses of trichotillomania and skin picking disorder.Methods: The study included patients who was diagnosed with trichotillomania (n=23 or skin picking disorder (n=44, and healthy controls (n=37. Beck Depression Inventory, Traumatic Stress Symptoms Scale and Dissociative Experiences Scale were administered. All groups checked a list of traumatic life events to determine the exposed traumatic events.Results: There was no statistical significance between three groups in terms of Dissociative Experiences Scale scores (P=0.07. But Beck Depression Inventory and Traumatic Stress Symptoms Scale scores of trichotillomania and skin picking groups were significantly higher than the control group. Subjects with a diagnosis of trichotillomania and skin picking reported statistically significantly higher numbers of traumatic and negative events in childhood compared to healthy subjects.Conclusion: We can conclude that trauma may play a role in development of both trichotillomania and skin picking. Increased duration of trichotillomania or skin picking was correlated with decreased presence of post-traumatic stress symptoms. The reason for the negatively correlation of severity of post-traumatic stress symptoms and self-harming behavior may be speculated as
Study of the skin effect in superconducting materials
Energy Technology Data Exchange (ETDEWEB)
Szeftel, Jacob, E-mail: jszeftel@lpqm.ens-cachan.fr [ENS Cachan, LPQM, 61 avenue du Président Wilson, 94230 Cachan (France); Sandeau, Nicolas [Aix Marseille Univ, CNRS, Centrale Marseille, Institut Fresnel, F-13013 Marseille (France); Khater, Antoine [Université du Maine, UMR 6087 Laboratoire PEC, F-72000 Le Mans (France)
2017-05-03
Highlights: • Comprehensive theoretical study of the skin effect in superconductors. • Based on Newton and Maxwell's equations. • Usual and anomalous skin effects dealt with in the same framework. - Abstract: The skin effect is analyzed to provide the numerous measurements of the penetration depth of the electromagnetic field in superconducting materials with a theoretical basis. Both the normal and anomalous skin effects are accounted for within a single framework, focusing on frequencies less than the superconducting gap. The emphasis is laid on the conditions required for the penetration depth to be equal to London's length, which enables us to validate an assumption widely used in the interpretation of all current experimental results.
Skin Tattoos Alter Sweat Rate and Na+ Concentration.
Luetkemeier, Maurie Joe; Hanisko, Joseph Michael; Aho, Kyle Mathiew
2017-07-01
The popularity of tattoos has increased tremendously in the last 10 yr particularly among athletes and military personnel. The tattooing process involves permanently depositing ink under the skin at a similar depth as eccrine sweat glands (3-5 mm). The purpose of this study was to compare the sweat rate and sweat Na concentration of tattooed versus nontattooed skin. The participants were 10 healthy men (age = 21 ± 1 yr), all with a unilateral tattoo covering a circular area at least 5.2 cm. Sweat was stimulated by iontophoresis using agar gel disks impregnated with 0.5% pilocarpine nitrate. The nontattooed skin was located contralateral to the position of the tattooed skin. The disks used to collect sweat were composed of Tygon® tubing wound into a spiral so that the sweat was pulled into the tubing by capillary action. The sweat rate was determined by weighing the disk before and after sweat collection. The sweat Na concentration was determined by flame photometry. The mean sweat rate from tattooed skin was significantly less than nontattooed skin (0.18 ± 0.15 vs 0.35 ± 0.25 mg·cm·min; P = 0.001). All 10 participants generated less sweat from tattooed skin than nontattooed skin and the effect size was -0.79. The mean sweat Na concentration from tattooed skin was significantly higher than nontattooed skin (69.1 ± 28.9 vs 42.6 ± 15.2 mmol·L; P = 0.02). Nine of 10 participants had higher sweat Na concentration from tattooed skin than nontattooed skin, and the effect size was 1.01. Tattooed skin generated less sweat and a higher Na concentration than nontattooed skin when stimulated by pilocarpine iontophoresis.
Optimal operation of a south double-skin facade
Energy Technology Data Exchange (ETDEWEB)
Gratia, E.; De Herde, A. [Universite Catholique de Louvain (Belgium). Architecture et Climat
2004-01-01
There is an increasing demand for higher quality office buildings. Occupants and developers of office buildings ask for a healthy and stimulating working environment. Double-skin facades are appropriate when buildings are subject to great external noise and wind loads. A further area of application is in rehabilitation work, when existing facades cannot be renewed, or where this is not desirable. Double-skin facades have a special esthetic of their own, and this can be exploited architecturally to great advantage. However there are still relatively few buildings in which double-skin facades have actually been realized, and there is still too little experience of their behaviour in operation. In this matter, we choose to study a multi-storey double-skin facades behaviour. Simulations were realized with TAS software on the building proposed in the frame of the subtask A of the Task 27 (performance of solar facade components) of the International Energy Agency. Simulations were performed on the chosen building with and without double-skin facades. We decide to study eight types of days; and we analyze the double-skin facade behaviour for various operations. The thermal behaviours of the building with and without double-skin are compared. The study of these eight cases showed the importance of the dynamic use of the double-skin. The operation of this one must be obligatorily related to the climatic conditions as well external as interior and a bad operation of the double-skin could lead to catastrophic results. (author)
Estimation of Thermal Sensation Based on Wrist Skin Temperatures
Sim, Soo Young; Koh, Myung Jun; Joo, Kwang Min; Noh, Seungwoo; Park, Sangyun; Kim, Youn Ho; Park, Kwang Suk
2016-01-01
Thermal comfort is an essential environmental factor related to quality of life and work effectiveness. We assessed the feasibility of wrist skin temperature monitoring for estimating subjective thermal sensation. We invented a wrist band that simultaneously monitors skin temperatures from the wrist (i.e., the radial artery and ulnar artery regions, and upper wrist) and the fingertip. Skin temperatures from eight healthy subjects were acquired while thermal sensation varied. To develop a thermal sensation estimation model, the mean skin temperature, temperature gradient, time differential of the temperatures, and average power of frequency band were calculated. A thermal sensation estimation model using temperatures of the fingertip and wrist showed the highest accuracy (mean root mean square error [RMSE]: 1.26 ± 0.31). An estimation model based on the three wrist skin temperatures showed a slightly better result to the model that used a single fingertip skin temperature (mean RMSE: 1.39 ± 0.18). When a personalized thermal sensation estimation model based on three wrist skin temperatures was used, the mean RMSE was 1.06 ± 0.29, and the correlation coefficient was 0.89. Thermal sensation estimation technology based on wrist skin temperatures, and combined with wearable devices may facilitate intelligent control of one’s thermal environment. PMID:27023538
The Use of Matriderm and Autologous Skin Graft in the Treatment of Full Thickness Skin Defects
Directory of Open Access Journals (Sweden)
Jang Hwan Min
2014-07-01
Full Text Available Background For patients with full thickness skin defects, autologous Split-thickness skin grafts (STSG are generally regarded as the mainstay of treatment. However, skin grafts have some limitations, including undesirable outcomes resulting from scars, poor elasticity, and limitations in joint movement due to contractures. In this study, we present outcomes of Matriderm grafts used for various skin tissue defects whether it improves on these drawbacks. Methods From January 2010 to March 2012, a retrospective review of patients who had undergone autologous STSG with Matriderm was performed. We assessed graft survival to evaluate the effectiveness of Matriderm. We also evaluated skin quality using a Cutometer, Corneometer, Tewameter, or Mexameter, approximately 12 months after surgery. Results A total of 31 patients underwent STSG with Matriderm during the study period. The success rate of skin grafting was 96.7%. The elasticity value of the portion on which Matriderm was applied was 0.765 (range, 0.635-0.800, the value of the trans-epidermal water loss (TEWL was 10.0 (range, 8.15-11.00 g/hr/m2, and the humidification value was 24.0 (range, 15.5-30.0. The levels of erythema and melanin were 352.0 arbitrary unit (AU (range, 299.25-402.75 AU and 211.0 AU (range, 158.25-297.00 AU, respectively. When comparing the values of elasticity and TEWL of the skin treated with Matriderm to the values of the surrounding skin, there was no statistically significant difference between the groups. Conclusions The results of this study demonstrate that a dermal substitute (Matriderm with STSG was adopted stably and with minimal complications. Furthermore, comparing Matriderm grafted skin to normal skin using Cutometer, Matriderm proved valuable in restoring skin elasticity and the skin barrier.
Verdurmen, Kim M J; Lempersz, Carlijn; Vullings, Rik; Schroer, Christian; Delhaas, Tammo; van Laar, Judith O E H; Oei, S Guid
2016-08-17
The fetal anomaly ultrasound only detects 65 to 81 % of the patients with congenital heart disease, making it the most common structural fetal anomaly of which a significant part is missed during prenatal life. Therefore, we need a reliable non-invasive diagnostic method which improves the predictive value for congenital heart diseases early in pregnancy. Fetal electrocardiography could be this desired diagnostic method. There are multiple technical challenges to overcome in the conduction of the fetal electrocardiogram. In addition, interpretation is difficult due to the organisation of the fetal circulation in utero. We want to establish the normal ranges and values of the fetal electrocardiogram parameters in healthy fetuses of 18 to 24 weeks of gestation. Women with an uneventful singleton pregnancy between 18 and 24 weeks of gestation are asked to participate in this prospective cohort study. A certified and experienced sonographist performs the fetal anomaly scan. Subsequently, a fetal electrocardiogram recording is performed using dedicated signal processing methods. Measurements are performed at two institutes. We will include 300 participants to determine the normal values and 95 % confidence intervals of the fetal electrocardiogram parameters in a healthy fetus. We will evaluate the fetal heart rate, segment intervals, normalised amplitude and the fetal heart axis. Three months postpartum, we will evaluate if a newborn is healthy through a questionnaire. Fetal electrocardiography could be a promising tool in the screening program for congenital heart diseases. The electrocardiogram is a depiction of the intimate relationship between the cardiac nerve conduction pathways and the structural morphology of the fetal heart, and therefore particularly suitable for the detection of secondary effects due to a congenital heart disease (hypotrophy, hypertrophy and conduction interruption).
Assessing human skin with diffuse reflectance spectroscopy and colorimetry
Seo, InSeok; Liu, Yang; Bargo, Paulo R.; Kollias, Nikiforos
2012-02-01
Colorimetry has been used as an objective measure of perceived skin color by human eye to document and score physiological responses of the skin from external insults. CIE color space values (L*, a* and b*) are the most commonly used parameters to correlate visually perceived color attributes such as L* for pigment, a* for erythema, and b* for sallowness of the skin. In this study, we investigated the relation of Lab color scale to the amount of major skin chromophores (oxy-, deoxyhemoglobin and melanin) calculated from diffuse reflectance spectroscopy. Thirty two healthy human subjects with ages from 20 to 70 years old, skin types I-VI, were recruited for the study. DRS and colorimetry measurements were taken from the left and right cheeks, and on the right upper inner arm. The melanin content calculated from 630-700 nm range of DRS measurements was shown to correlate with the lightness of skin (L*) for most skin types. For subjects with medium-to-light complexion, melanin measured at the blue part spectrum and hemoglobin interfered on the relation of lightness of the skin color to the melanin content. The sallowness of the skin that is quantified by the melanin contribution at the blue part spectrum of DRS was found to be related to b* scale. This study demonstrates the importance of documenting skin color by assessing individual skin chromophores with diffuse reflectance spectroscopy, in comparison to colorimetry assessment.
Directory of Open Access Journals (Sweden)
Camilla Dal Bosco
2014-03-01
Full Text Available To evaluate the influence of the skin aging critical level on the adult skin epidermal functional state, an improved analytical method based on the skin surface energetic measurement (TVS modeling was developed. Tenskinmetric measurements were carried out non-invasively in controlled conditions by contact angle method using only a water-drop as reference standard liquid. Adult skin was monitored by TVS Observatory according to a specific and controlled thermal protocol (Camianta protocol in use at the interconnected “Mamma Margherita Terme spa” of Terme Euganee. From June to November 2013, the surface free energy and the epidermal hydration level of adult skin were evaluated on arrival of 265 male and 569 female adult volunteers (51–90 years of age and when they departed 2 weeks later. Sensitive measurements were carried out at 0.1 mN/m. High test compliance was obtained (93.2% of all guests. Very interesting results are obtained. The high sensitivity and discrimination power of tenskinmetry combined with a thermal Camianta protocol demonstrate the possibility to evaluate at baseline level the surface energetic changes and the skin reactivity which occurs on adult skin.
Ubbink, D. T.; van der Oord, B. M.; Sobotka, M. R.; Jacobs, M. J.
2000-01-01
We investigated the short-term effect of vacuum compression (VC) treatment on skin microcirculatory perfusion in the foot of patients with lower limb ischaemia and healthy controls. Ten patients with intermittent claudication or rest pain and 5 healthy controls underwent vacuum-compression treatment
Ezerskaia, A.; Pereira, S. F.; Urbach, H. P.; Varghese, B.
2016-03-01
Skin health is characterized by heterogeneous system of water and lipids in upper layers providing protection from external environment and preventing loss of vital components of the body. Skin hydration (moisture) and sebum (skin surface lipids) are considered to be important factors in skin health; a right balance between these components is an indication of healthy skin and plays a central role in protecting and preserving skin integrity. In this manuscript we present inter- and intra-individual variation in skin hydration and surface lipids measured with a home-built experimental prototype based on infrared spectroscopy. Results show good agreement with measurements performed by commercially available instruments Corneometer and Sebumeter used for skin hydration and sebum measurements respectively.
Universal in vivo Textural Model for Human Skin based on Optical Coherence Tomograms.
Adabi, Saba; Hosseinzadeh, Matin; Noei, Shahryar; Conforto, Silvia; Daveluy, Steven; Clayton, Anne; Mehregan, Darius; Nasiriavanaki, Mohammadreza
2017-12-20
Currently, diagnosis of skin diseases is based primarily on the visual pattern recognition skills and expertise of the physician observing the lesion. Even though dermatologists are trained to recognize patterns of morphology, it is still a subjective visual assessment. Tools for automated pattern recognition can provide objective information to support clinical decision-making. Noninvasive skin imaging techniques provide complementary information to the clinician. In recent years, optical coherence tomography (OCT) has become a powerful skin imaging technique. According to specific functional needs, skin architecture varies across different parts of the body, as do the textural characteristics in OCT images. There is, therefore, a critical need to systematically analyze OCT images from different body sites, to identify their significant qualitative and quantitative differences. Sixty-three optical and textural features extracted from OCT images of healthy and diseased skin are analyzed and, in conjunction with decision-theoretic approaches, used to create computational models of the diseases. We demonstrate that these models provide objective information to the clinician to assist in the diagnosis of abnormalities of cutaneous microstructure, and hence, aid in the determination of treatment. Specifically, we demonstrate the performance of this methodology on differentiating basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) from healthy tissue.
Heart rate variability in healthy population
International Nuclear Information System (INIS)
Alamgir, M.; Hussain, M.M.
2010-01-01
Background: Heart rate variability has been considered as an indicator of autonomic status. Little work has been done on heart rate variability in normal healthy volunteers. We aimed at evolving the reference values of heart rate variability in our healthy population. Methods: Twenty-four hour holter monitoring of 37 healthy individuals was done using Holter ECG recorder 'Life card CF' from 'Reynolds Medical'. Heart rate variability in both time and frequency domains was analysed with 'Reynolds Medical Pathfinder Digital/700'. Results: The heart rate variability in normal healthy volunteers of our population was found in time domain using standard deviation of R-R intervals (SDNN), standard deviation of average NN intervals (SDANN), and Square root of the mean squared differences of successive NN intervals (RMSSD). Variation in heart rate variability indices was observed between local and foreign volunteers and RMSSD was found significantly increased (p<0.05) in local population. Conclusions: The values of heart rate variability (RMSSD) in healthy Pakistani volunteers were found increased compared to the foreign data reflecting parasympathetic dominance in our population. (author)
Movement Discordance between Healthy and Non-Healthy US Adults.
Directory of Open Access Journals (Sweden)
Ann M Swartz
Full Text Available Physical activity is known to significantly impact cardiometabolic health. Accelerometer data, as a measure of physical activity, can be used to objectively identify a disparity in movement (movement discordance between healthy and unhealthy adults. The purpose of this study was to examine the Movement Discordance between healthy and unhealthy adults in a large US population sample.Demographic, health and accelerometer data from the National Health and Nutrition Examination Study (NHANES 2003-2004 and 2005-2006 cohorts were used for this study. Participants were classified as either having a "normal" or "abnormal" value for each cardiometabolic health parameter examined, based on published criteria. Linear regression analyses were performed to determine significance of each abnormal health parameter (risk factor in its unique effect on the accelerometer counts, controlling for age and gender. Average accelerometer counts per minute (cpm by gender and age categories were estimated separately for the groups of normal and abnormal cardiometabolic risk.Average cpm for those with healthy levels of each individual cardiometabolic health parameter range from 296 cpm (for C reactive protein to 337 cpm (for waist circumference, while average cpm for those with abnormal levels of each individual cardiometabolic health parameter range from 216 cpm (for insulin to 291 cpm (for LDL-cholesterol. After controlling for age and gender, waist circumference, HbA1c, Insulin, Homocysteine, and HDL-Cholesterol were the cardiometabolic health parameters that showed significant, unique and independent effects on cpm. Overall, individuals who have abnormal values for all significant cardiometabolic health parameters ("unhealthy" averaged 267 cpm (SE = 15 cpm, while the healthy sample of this study averaged 428 cpm (SE = 10 cpm. The difference in cpm between the unhealthy and healthy groups is similar between males and females. Further, for both males and females, the
Directory of Open Access Journals (Sweden)
Isaac-Márquez Angélica Patricia
2003-01-01
Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.
Comparison of differences in knowledge about skin care bettwen young women and man
Directory of Open Access Journals (Sweden)
Katarzyna Bojarczuk
2017-08-01
Full Text Available Introduction: The skin of modern people is exposed daily to a number of irritants like stress, consequences of inadequate diet, exposure to chemicals and plastics. Those factors can pose a challenge not only for delicate skin of a child, or a woman, but also for more resistant skin of men. Every type of complexion requires individual care, adjusted to different conditions and life circumstances. The choice of proper skin care products should be based on basic skin type and also one's gender. Objectives: Evaluation of differences in students' knowledge about skin care in relation to their gender. Material and methods: Evaluation of students' knowledge concerning proper skin care guidelines was conducted among 210 students (150 women and 60 men using anonymous survey. Results: Majority of male respondents determined their skin type as a normal one (56.6%, majority of female respondents as a combination type (51.3%. Men in contrast to women are more often unable to evaluate the type of their own skin (16.7% vs 4.0%. Acne was the most common skin condition students of both sexes complained about. Daily skin care activities are performed by 96.6% interviewed women and 63.3% men. The regular use of face skin care products was reported by 87.3% of women and 31.6% of men. Conclusions: 1. Majority of women evaluate their basic skin type as combination one, most men regarded their skin type as normal . 2. Women more often than men take care of their skin and use adequate skin care products. 3. Facial moisturizing lotion is the most frequently chosen skin care product by both women and men.
Hodges, Gary J.; Kellogg, Dean L.; Johnson, John M.
2015-01-01
The vascular response to local skin cooling is dependent in part on a cold-induced translocation of α2C-receptors and an increased α-adrenoreceptor function. To discover whether β-adrenergic function might contribute, we examined whether β-receptor sensitivity to the β-agonist isoproterenol was affected by local skin temperature. In seven healthy volunteers, skin blood flow was measured from the forearm by laser-Doppler flowmetry and blood pressure was measured by finger photoplethysmography....
Huang, Hao; Yang, Xi-Fei; Deng, Qun-Yi; Li, Bing; Liu, Guo-Hui; Zhang, Jie-Yun; Yang, Da-Fei
2012-06-01
To explore the potential application of IFN-gamma enzyme-linked immunospot (ELISPOT) assay in the diagnosis of tuberculous epididymitis (TE) by comparing ELISPOT assay with the traditional purified protein derivative (PPD) tuberculin skin test. We examined 13 TE patients using an in-house ELISPOT kit, another 11 TE patients by PPD skin testing, and 57 healthy male volunteers by parallel test with both the methods. Twelve (92.3%) of the 13 TE cases were positive on ELISPOT assay, and 10 (90.9%) of the 11 TE cases positive on PPD skin test, with no statistically significant differences between the two groups (P > 0.05). Among the 57 healthy male volunteers, 8 (14.0%) were positive on ELISPOT, and 28 (49.1%) positive on PPD test, the latter significantly higher than the former (P PPD test in the examination of tuberculous epididymitis. As for specificity, ELISPOT assay seems better than PPD test in differentiating tuberculous epididymitis patients from healthy males.
Lohman, Everett B; Sackiriyas, Kanikkai Steni Balan; Bains, Gurinder S; Calandra, Giovanni; Lobo, Crystal; Nakhro, Daniel; Malthankar, Gauri; Paul, Sherwine
2012-07-01
Tissue healing is an intricate process that is regulated by circulation. Heat modalities have been shown to improve skin circulation. Recent research supports that passive vibration increases circulation without risk of burns. Study purpose is to compare and determine effects of short duration vibration, moist heat, and a combination of the two on skin blood flow (SBF) and skin temperature (ST) in elderly, non-diabetic individuals following short-term exposure. Ten subjects, 3 female and 7 male (55-73 years of age), received two interventions over three days: 1--Active vibration, 2--passive vibration, 3--moist heat, 4--moist heat combined with passive vibration (MHPV), 5--a commercial massaging heating pad, and 6--no intervention. SBF and ST were measured using a MOOR Laser Doppler before and after the intervention and the third measurement were taken 10 minutes following. Mean SBF following a ten-minute intervention were significantly different in the combination of moist heat and passive vibration from the control, active vibration, and the commercial massaging heating pad. Compared to baseline measurements, this resulted in mean SBF elevation to 450% (at conclusion of 10 minutes of intervention) and 379% (10 minutes post). MHPV (p=0.02) showed significant changes in ST from the commercial massaging heating pad, passive vibration, and active vibration interventions. SBF in the lower legs showed greatest increase with MHPV. Interventions should be selected that are low risk while increasing lower extremity skin blood flow.
Zhang, Huiwei; Wu, Ping; Ziegler, Sibylle I; Guan, Yihui; Wang, Yuetao; Ge, Jingjie; Schwaiger, Markus; Huang, Sung-Cheng; Zuo, Chuantao; Förster, Stefan; Shi, Kuangyu
2017-02-01
In brain 18 F-FDG PET data intensity normalization is usually applied to control for unwanted factors confounding brain metabolism. However, it can be difficult to determine a proper intensity normalization region as a reference for the identification of abnormal metabolism in diseased brains. In neurodegenerative disorders, differentiating disease-related changes in brain metabolism from age-associated natural changes remains challenging. This study proposes a new data-driven method to identify proper intensity normalization regions in order to improve separation of age-associated natural changes from disease related changes in brain metabolism. 127 female and 128 male healthy subjects (age: 20 to 79) with brain 18 F-FDG PET/CT in the course of a whole body cancer screening were included. Brain PET images were processed using SPM8 and were parcellated into 116 anatomical regions according to the AAL template. It is assumed that normal brain 18 F-FDG metabolism has longitudinal coherency and this coherency leads to better model fitting. The coefficient of determination R 2 was proposed as the coherence coefficient, and the total coherence coefficient (overall fitting quality) was employed as an index to assess proper intensity normalization strategies on single subjects and age-cohort averaged data. Age-associated longitudinal changes of normal subjects were derived using the identified intensity normalization method correspondingly. In addition, 15 subjects with clinically diagnosed Parkinson's disease were assessed to evaluate the clinical potential of the proposed new method. Intensity normalizations by paracentral lobule and cerebellar tonsil, both regions derived from the new data-driven coherency method, showed significantly better coherence coefficients than other intensity normalization regions, and especially better than the most widely used global mean normalization. Intensity normalization by paracentral lobule was the most consistent method within both
Fadini, Gian Paolo; Tura, Andrea; Pacini, Giovanni; Avogaro, Angelo; Vigili de Kreutzenberg, Saula
2017-06-01
Reduced levels of circulating stem cells (CSCs) predict cardiovascular events and death, but the factors underlying variability of CSCs in healthy adults are mostly unknown. Previous studies detected associations of CSCs with glucose tolerance or insulin resistance, while the role of fatty acids has been overlooked. We herein aimed to describe in better detail the metabolic abnormalities associated with a reduced CSC level. This was a cross-sectional study on 94 healthy male and female individuals with normal glucose tolerance, aged 18-65 years. All participants underwent an oral glucose tolerance test (OGTT) with blood samples collected at 0, 10, 20, 30, 60, 90 and 120 min. Mathematical models were applied to plasma glucose, insulin, C-peptide and non-esterified fatty acids (NEFA) concentrations. CSCs were defined as CD34 + or CD133 + . Participants (mean ± SEM age 43.8 ± 0.7; 41% males) were divided according to CSC levels below (low) or above (high) the median value and metabolic parameters were compared. There was no significant baseline difference between groups except for higher concentrations of fasting NEFA in subjects with low CSCs. Upon OGTT, individuals with low CSCs had higher area under curve (AUC) of NEFA (p glucose, insulin and C-peptide. Several insulin sensitivity and beta cell function indexes were not significantly different, except for a decrease in the disposition index (DI) in subjects with low CSCs. CSCs were associated with excess NEFA levels independently from age and DI. We show for the first time that, in healthy adults with normal glucose tolerance, low CSCs are strongly associated with excess NEFA exposure. The pathophysiological consequence of this association needs to be interpreted in view of the prognostic role of CSCs. Future studies should explore whether excess NEFA and low CSCs and are causally interconnected. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Madsen, C; Mogensen, P; Thomas, N
2015-01-01
Physical inactivity and low birth weight (LBW) may lead to an increased risk for developing type 2 diabetes. The extent to which LBW individuals may benefit from physical exercise training when compared with those with normal birth weight (NBW) controls is uncertain. We assessed the impact...... of an outdoor exercise intervention on body composition, insulin secretion and action in young men born with LBW and NBW in rural India. A total of 61 LBW and 56 NBW healthy young men were recruited into the study. The individuals were instructed to perform outdoor bicycle exercise training for 45 min every day...... with LBW in rural India benefit metabolically from exercise training to an extent comparable with NBW controls....
Diana, Alessia; Guglielmini, Carlo; Fracassi, Federico; Pietra, Marco; Balletti, Erika; Cipone, Mario
2008-09-01
To assess the usefulness of high-frequency diagnostic ultrasonography for evaluation of changes of skin thickness in relation to hydration status and fluid distribution at various cutaneous sites in dogs. 10 clinically normal adult dogs (6 males and 4 females) of various breeds. Ultrasonographic examination of the skin was performed before and after hydration via IV administration of an isotonic crystalloid solution (30 mL/kg/h for 30 minutes). A 13-MHz linear-array transducer was used to obtain series of ultrasonographic images at 4 different cutaneous sites (the frontal, sacral, flank, and metatarsal regions). Weight and various clinicopathologic variables (PCV; serum osmolality; and serum total protein, albumin, and sodium concentrations) were determined before and after the infusion. These variables and ultrasonographic measurements of skin thickness before and after hydration were compared. Among the 10 dogs, mean preinfusion skin thickness ranged from 2,211 microm (metatarsal region) to 3,249 microm (sacral region). Compared with preinfusion values, weight was significantly increased, whereas PCV; serum osmolality; and serum total protein, albumin, and sodium concentrations were significantly decreased after infusion. After infusion, dermal echogenicity decreased and skin thickness increased significantly by 21%, 14%, 15%, and 13% in the frontal, sacral, flank, and metatarsal regions, respectively. Cutaneous site and hydration were correlated with cutaneous characteristics and skin thickness determined by use of high-frequency ultrasonography in dogs. Thus, diagnostic ultrasonography may be a useful tool for the noninvasive evaluation of skin hydration in healthy dogs and in dogs with skin edema.
Infrared imaging of skin lesions
McIntosh, Laura M.; Mansfield, James R.; Jackson, Michael; Crowson, A. Neil; Mantsch, Henry H.
2002-02-01
IR spectroscopy produces spectra in which detailed information concerning chemical structure is inherent. Numerous studies have demonstrated that the most useful IR methods for analysis of biological tissues are microscopic image-based techniques in which fine-scaled spatial and high-quality spectral information is integrated. Unlike traditional visible microscopic methods, the contrast in IR imaging is gained by differences in spectra and the spatial heterogeneity of biochemical components, not by the addition of stains. In order for IR imaging to be more broadly accepted, non-subjective data processing methods are being developed to extract the most out of the large spectral images that are acquired. This paper demonstrates data processing techniques that have been extremely useful in the analysis of normal and abnormal skin. Analysis of skin specimens is of particular clinical importance due to the difficulty in rendering a differential diagnosis. Unstained frozen skin sections were mapped using an IR microscope. Functional group mapping, clustering routines and linear discriminant analysis were used to process the data. Functional group mapping and clustering routines were useful in the initial interpretation of images and to research for trends in uncharacterized spectral images. LDA was useful for differentiating normal from abnormal tissue once a well- defined training spectral set was established. Representative spectroscopic images are shown that demonstrate the power of IR imaging.
Skin manifestations of growth hormone-induced diseases.
Kanaka-Gantenbein, Christina; Kogia, Christina; Abdel-Naser, Mohamed Badawy; Chrousos, George P
2016-09-01
The human skin is a well-organized organ bearing different types of cells in a well-structured interference to each other including epidermal and follicular keratinocytes, sebocytes, melanocytes, dermal papilla cells and fibroblasts, endothelial cells, sweat gland cells as well as nerves. Several hormones act on different cell types of the skin, while it is also considered an endocrine organ secreting hormones that act at several sites of the organism. GH receptors are found in almost all cell types forming the skin, while IGF-1 receptors' expression is restricted to the epidermal keratinocytes. Both Growth Hormone (GH) excess, as in the case of Acromegaly in adults, or Gigantism in growing children, and GH deficiency states lead to skin manifestations. In case of GH excess the main dermatological findings are skin thickening, coarsening of facial features, acrochordons, puffy hands and feet, oily skin and hyperhidrosis, while GH deficiency, on the contrary, is characterized by thin, dry skin and disorder of normal sweating. Moreover, special disorders associated with GH excess may have specific characteristics, as is the case of café-au-lait spots in Neurofibromatosis, or big café-au-lait skin hyperpigmented regions with irregular margins, as is the case in McCune-Albright syndrome. Meticulous examination of the skin may therefore contribute to the final diagnosis in cases of GH-induced disorders.
[ROLE OF microRNA IN SKIN DEVELOPMENT AND WOUND HEALING].
Song, Zhifang; Liu, Dewu
2014-07-01
To review the role of microRNA (miRNA) in skin development and wound healing. The recent literature about miRNA in skin development and wound healing was reviewed and analyzed. miRNA extensively involved in the development of the skin, including epidermal cell proliferation, differentiation, aging and hair follicle development; miR-203 known as the "skin-specific miRNA" can directly inhibit the expression of p63 and promote the differentiation of the epidermis. Meanwhile, miRNA also involved in various stages of skin regeneration and wound healing. Abnormal expression of miRNA is closely related with abnormal wound healing. miRNA play an important role in maintaining normal skin physiology and skin regeneration. To explore their roles in the healing of skin wounds and their regulatory mechanism can provide a new target for the treatment, which has a potential value and broad prospects.
Svent-Kucina, Natasa; Pirs, Mateja; Kofol, Romina; Blagus, Rok; Smrke, Dragica Maja; Bilban, Marjan; Seme, Katja
2016-04-01
Staphylococcus aureus is among the most important human pathogens. It is associated with different infections and is a major cause of skin and soft tissue infections (SSTIs). The aim of our study was to compare S. aureus isolates associated with SSTIs with isolates obtained from healthy carriers in the Central Slovenia region in terms of antimicrobial susceptibility, genetic diversity by clonal complex (CC)/sequence type, spa type, and by toxin gene profiling. In total, 274 S. aureus isolates were collected prospectively by culturing wound samples from 461 SSTI patients and nasal samples from 451 healthy carriers. We have demonstrated high heterogeneity in terms of CCs and spa type in both groups of isolates. The main clone among SSTI strains was Panton-Valentine leukocidin gene (pvl) positive CC121, whereas the main clone among carrier strains was CC45 carrying a large range of toxin genes. The main spa type in both groups was t091. Pvl was more frequently present in SSTI strains (31.2% SSTI vs 3.6% carrier strains) and staphylococcal enterotoxin C was more frequently present in carrier strains (1.6% SSTI vs 17.0% carrier strains). We have also demonstrated that methicillin-resistant S. aureus was a rare cause (2.8%) of SSTIs in our region. © 2016 APMIS. Published by John Wiley & Sons Ltd.
Noszczyk-Nowak, Agnieszka; Cepiel, Alicja; Janiszewski, Adrian; Pasławski, Robert; Gajek, Jacek; Pasławska, Urszula; Nicpoń, Józef
2016-01-01
Swine are a well-recognized animal model for human cardiovascular diseases. Despite the widespread use of porcine model in experimental electrophysiology, still no reference values for intracardiac electrical activity and conduction parameters determined during an invasive electrophysiology study (EPS) have been developed in this species thus far. The aim of the study was to develop a set of normal values for intracardiac electrical activity and conduction parameters determined during an invasive EPS of swine. The study included 36 healthy domestic swine (24-40 kg body weight). EPS was performed under a general anesthesia with midazolam, propofol and isoflurane. The reference values for intracardiac electrical activity and conduction parameters were calculated as arithmetic means ± 2 standard deviations. The reference values were determined for AH, HV and PA intervals, interatrial conduction time at its own and imposed rhythm, sinus node recovery time (SNRT), corrected sinus node recovery time (CSNRT), anterograde and retrograde Wenckebach points, atrial, atrioventricular node and ventricular refractory periods. No significant correlations were found between body weight and heart rate of the examined pigs and their electrophysiological parameters. The hereby presented reference values can be helpful in comparing the results of various studies, as well as in more accurately estimating the values of electrophysiological parameters that can be expected in a given experiment.
Directory of Open Access Journals (Sweden)
Mina Nicole Händel
Full Text Available There is limited evidence to support the effectiveness of primary interventions aiming to prevent excess weight gain among young children. Evaluating behavioral changes, such as physical activity (PA, may add to future development of efficient interventions. The objective was to evaluate the effect on PA outcomes of the 15 month Healthy Start intervention that focused on changing diet, PA, sleep and stress management among normal weight but obesity-prone preschool children. Children were defined as obesity-prone if they had a birth weight > 4,000 g, mothers with a pre-pregnancy body mass index of > 28 kg/m2, or mothers with ≤ 10 years of schooling.From a baseline study population of 635 normal weight 2-6 year old preschool children from the greater Copenhagen area, parents of 307 children had given information on PA at both the baseline and follow-up examinations. PA was obtained from a 7 days recording in the Children's Physical Activity Questionnaire. Time used for sport activities were combined with outdoor playing time to achieve a proxy of total PA level of moderate to vigorous intensity.Linear regression analyses revealed that at follow-up the intervention group spent more time on sports and outdoor activities combined per week than the control group (ITT analyses: intervention: 400 min/week; 95% confidence interval (CI: 341, 459 versus control: 321 min/week; 95% CI: 277, 366; p = 0.02, although no significant intervention effects were seen for each of the subcategories, e.g. sports participation, outdoor activities, screen time, or commuting frequency.Our results suggest that the overall time spent on sports and outdoor activities combined was increased at follow-up among normal weight obesity-prone children, as a result of the Healthy Start intervention.ClinicalTrials.gov NCT01583335.
Händel, Mina Nicole; Larsen, Sofus Christian; Rohde, Jeanett Friis; Stougaard, Maria; Olsen, Nanna Julie; Heitmann, Berit Lilienthal
2017-01-01
There is limited evidence to support the effectiveness of primary interventions aiming to prevent excess weight gain among young children. Evaluating behavioral changes, such as physical activity (PA), may add to future development of efficient interventions. The objective was to evaluate the effect on PA outcomes of the 15 month Healthy Start intervention that focused on changing diet, PA, sleep and stress management among normal weight but obesity-prone preschool children. Children were defined as obesity-prone if they had a birth weight > 4,000 g, mothers with a pre-pregnancy body mass index of > 28 kg/m2, or mothers with ≤ 10 years of schooling. From a baseline study population of 635 normal weight 2-6 year old preschool children from the greater Copenhagen area, parents of 307 children had given information on PA at both the baseline and follow-up examinations. PA was obtained from a 7 days recording in the Children's Physical Activity Questionnaire. Time used for sport activities were combined with outdoor playing time to achieve a proxy of total PA level of moderate to vigorous intensity. Linear regression analyses revealed that at follow-up the intervention group spent more time on sports and outdoor activities combined per week than the control group (ITT analyses: intervention: 400 min/week; 95% confidence interval (CI): 341, 459 versus control: 321 min/week; 95% CI: 277, 366; p = 0.02), although no significant intervention effects were seen for each of the subcategories, e.g. sports participation, outdoor activities, screen time, or commuting frequency. Our results suggest that the overall time spent on sports and outdoor activities combined was increased at follow-up among normal weight obesity-prone children, as a result of the Healthy Start intervention. ClinicalTrials.gov NCT01583335.
Murga Oporto, L; Menéndez-de León, C; Bauzano Poley, E; Núñez-Castaín, M J
Among the differents techniques for motor unit number estimation (MUNE) there is the statistical one (Poisson), in which the activation of motor units is carried out by electrical stimulation and the estimation performed by means of a statistical analysis based on the Poisson s distribution. The study was undertaken in order to realize an approximation to the MUNE Poisson technique showing a coprehensible view of its methodology and also to obtain normal results in the extensor digitorum brevis muscle (EDB) from a healthy population. One hundred fourteen normal volunteers with age ranging from 10 to 88 years were studied using the MUNE software contained in a Viking IV system. The normal subjects were divided into two age groups (10 59 and 60 88 years). The EDB MUNE from all them was 184 49. Both, the MUNE and the amplitude of the compound muscle action potential (CMAP) were significantly lower in the older age group (page than CMAP amplitude ( 0.5002 and 0.4142, respectively pphisiology of the motor unit. The value of MUNE correlates better with the neuromuscular aging process than CMAP amplitude does.
Clinical scoring and instrumental analysis to evaluate skin types.
Mercurio, D G; Segura, J H; Demets, M B A; Maia Campos, P M B G
2013-04-01
The biology of the skin is very complex, and there are a number of methods used to classify the different skin types. It is possible to measure or quantify the characteristics of the specific skin types, using a variety of techniques that can objectively evaluate the properties of the skin in a noninvasive manner. To clinically characterize different skin types by dermatological evaluation and biophysical and skin imaging techniques, and to evaluate the relationship between the different characteristics. The study recruited 26 volunteers. Clinical scoring was performed by a dermatologist who classified the volunteers' skin as normal or dry (group 1) and combination or oily (group 2). Objective measurements included skin microrelief, pH, oiliness, water content of the stratum corneum and transepidermal water loss (TEWL). Positive correlations were found between the level of skin oiliness and skin texture obtained from both instrumental analysis and clinical scoring. The combination and oily skin types had higher clinical scores for shine intensity, oiliness and tendency to pigmentation, and also had higher objective scores for sebum secretion, TEWL and roughness. Biophysical and skin imaging techniques are effective tools to help characterize skin type and assist in clinical dermatology. We found that different skin types had different characteristics related to skin microrelief, oiliness and TEWL, and therefore require specific dermatological treatments. © The Author(s) CED © 2013 British Association of Dermatologists.
Smith, Caroline J; Kenney, W Larry; Alexander, Lacy M
2013-04-01
Regional variation in sweating over the human body is widely recognized yet variation in vasomotor responses and mechanisms causing this variation remain unclear. This study aimed to explore the relation between regional sweating rates (RSR) and skin blood flow (SkBF) responses to thermal and pharmacological stimuli in young, healthy subjects. In nine subjects (23 ± 3 yr), intradermal microdialysis (MD) probes were inserted into the ventral forearm, abdomen, thigh, and lower back and perfused with lactated Ringer solution. RSR over each MD membrane were measured using ventilated capsules with a laser Doppler probe housed in each capsule for measurement of red cell flux (laser Doppler flux, LDF) as an index of SkBF. Subjects completed a whole body heating protocol to 1°C rise in oral temperature and an acetylcholine dose response (ACh 1 × 10(-7)-0.1 M; mean skin temperature 34°C). Maximal LDF were obtained at the end of both protocols (50 mM sodium nitroprusside).During heating RSR varied among sites (P back versus other sites (P back: r = 0.86 ± 0.04) but not latter stages of heating. No differences in RSR (P = 0.160) or SkBF (LDF, P = 0.841) were observed between sites during ACh perfusion. Taken together, these data suggest that increases in SkBF are necessary to initiate and increase sweating, but further rises in RSR are not fully dependent on SkBF in a dose-response manner. Furthermore, RSR cannot be explained by cholinergic sensitivity or variation in SkBF.
Evaluating skin care problems in people with stomas.
Williams, Julia; Gwillam, Brandon; Sutherland, Norma; Matten, Jane; Hemmingway, Julie; Ilsey, Helen; Somerville, Mary; Vujnovich, Angela; Day, Stephanie; Redmond, Caroline; Cowin, Caroline; Fox, Kathy; Parker, Theresa
This study aimed to identify actual and potential peristomal skin problems in relation to the use of different types of stoma appliances and accessories. It also compared ostomists' perceptions of their peristomal skin condition with those of stoma care nurse specialists. Maintaining skin integrity is a basic skill that ensures good stoma management. It is widely accepted that from time to time a patient with a stoma will seek clinical advice about a peristomal skin problem. Little is known about how often patients present with these problems, the clinical course of peristomal skin problems, and how patients manage them. A multi-centred descriptive study was conducted among 80 ostomists. Fieldwork took place over 13 months. The sample was drawn from a UK home care delivery database. Using structured questionnaires, ostomists were interviewed by a stoma care nurse specialist. A digital photograph was taken of their peristomal skin and their answers compared with nurse assessment using the Stoma Care Ostomy Research index scoring system. Of the interviewees 32% had healthy peristomal skin both via questionnaire and at observation. At observation, 68% were observed to have peristomal skin problems, of whom 44% had irritated skin, 12% had ulcerated skin, 9% had an apparent allergy and 3% had macerated/eroded skin. In addition, 21% had an ill-fitting appliance at observation. Half (50%) were observed to have a parastomal hernia, although only 24% reported having one. These findings demonstrate significant differences between the perception of skin problems among ostomists and actual skin problems observed by stoma care nurse specialists. Peristomal skin problems are common among ostomists. The difference between ostomists' and nurses' perceptions of peristomal skin condition led to the identification of educational needs for the new ostomist. Education and regular follow-up by the stoma care nurse specialist is imperative.
Effect of skin hydration on the dynamics of fingertip gripping contact.
André, T; Lévesque, V; Hayward, V; Lefèvre, P; Thonnard, J-L
2011-11-07
The dynamics of fingertip contact manifest themselves in the complex skin movements observed during the transition from a stuck state to a fully developed slip. While investigating this transition, we found that it depended on skin hydration. To quantify this dependency, we asked subjects to slide their index fingertip on a glass surface while keeping the normal component of the interaction force constant with the help of visual feedback. Skin deformation inside the contact region was imaged with an optical apparatus that allowed us to quantify the relative sizes of the slipping and sticking regions. The ratio of the stuck skin area to the total contact area decreased linearly from 1 to 0 when the tangential force component increased from 0 to a maximum. The slope of this relationship was inversely correlated to the normal force component. The skin hydration level dramatically affected the dynamics of the contact encapsulated in the course of evolution from sticking to slipping. The specific effect was to reduce the tendency of a contact to slip, regardless of the variations of the coefficient of friction. Since grips were more unstable under dry skin conditions, our results suggest that the nervous system responds to dry skin by exaggerated grip forces that cannot be simply explained by a change in the coefficient of friction.
Smartphone-based fluorescence spectroscopy device aiding in preliminary skin screening
Sahoo, Aparajita; Wahi, Akshat; Das, Anshuman
2018-02-01
Preliminary diagnosis of closely resembling skin conditions can be highly subjective for dermatologists. In ambiguous cases, it often leads to performing invasive procedures like biopsies. Different skin conditions, however, have varying concentrations of fluorophores (like collagen, NADH) and chromophores (like melanin, hemoglobin) which can alter their fluorescence spectra. We demonstrate a handheld, portable, smartphone-based spectrometer that leverages these alterations in skin autofluorescence spectra for rapid screening of skin conditions. This methodology involves excitation of affected skin areas with ultraviolet (UV-A) 385 nm light, capturing the generated fluorescence spectra and sending the data wirelessly to a companion mobile application for data storage, analysis and visualization. By collecting the fluorescence spectral signals from healthy and unhealthy skin conditions, we establish that the signals collected using this portable device can be used to develop a classification method to help in differentially diagnosing these conditions. It shows promise as a useful skin screening tool for both dermatologists and primary health care workers. This device can enable quick, non-invasive and a more objective preliminary examination. We envision the device to be especially useful in primary healthcare centers of developing countries where availability of dermatologists is limited.
Ultrastructure of elastosis in facial rhytidectomy skin
International Nuclear Information System (INIS)
Rudolph, R.; Woodward, M.
1981-01-01
Skin from 19 facial rhytidectomies performed in patients with chronic solar damage was compared with postauricular skin from patients of similar age. Light microscopy demonstrated large areas of amorphous material that stained PAS positive in all 19 face-lift specimens, while none of the controls had such material. Electron microscopy of the ''elastotic'' material revealed large amorphous masses of granular material, with loss of the microfilament component of normal elastin. Current theories suggest that the elastotic material in solar-damaged skin is a product of radiation-damaged fibroblasts, rather than being either collagen or degenerated elastin. Such knowledge may help the plastic surgeons encourage rhytidectomy patients to protect themselves from solar radiation
Reliability of skin testing as a measure of nutritional state
International Nuclear Information System (INIS)
Forse, R.A.; Christou, N.; Meakins, J.L.; MacLean, L.D.; Shizgal, H.M.
1981-01-01
The reliability of skin testing to assess the nutritional state was evaluated in 257 patients who received total parenteral nutrition (TPN). The nutritional state was assessed by determining body composition, by multiple-isotope dilution. Immunocompetence was simultaneously evaluated by skin testing with five recall antigens. These measurements were carried out before and at two-week intervals during TPN. A statistically significant relationship existed between the response to skin testing and the nutritional state. A body composition consistent with malnutrition was present in the anergic patients, while body composition was normal in the patients who reacted normally to skin testing. However, a considerable overlap existed as 43% of the reactive patients were malnourished, and 21% of the anergic patients were normally nourished. Thirty-seven (43%) of the 86 anergic patients converted and became reactive during TPN, and their body composition improved significantly. The remaining 49 anergic patients (57%) did not convert, and their body composition did not change despite similar nutritional support. The principal difference between the two groups of anergic patients was the nature of the therapy administered. In the anergic patients who converted, therapy was aggressive and appropriate, and clinical improvement occurred in 23 (62.2%) of the patients, with a mortality of 5.4%. In the 49 patients who remained anergic, therapy was often inappropriate or unsuccessful, with clinical improvement in only three (6.1%) of the patients and a mortality of 42.8%. The data demonstrated a significant relationship between the response to skin testing and the nutritional state. However, because of the wide overlap, skin testing does not accurately assess a person's nutritional state. The persistence of the anergic state is indicative of a lack of response to therapy
Energy Technology Data Exchange (ETDEWEB)
Lheureux, E. (Universite des Sciences et Techniques, Lille (France). Lab. de Morphogenese Animale)
1983-08-01
An X-irradiated newt limb is able to regenerate if non-irradiated skin as well as non-irradiated muscle is transplanted to the stump. In order to know whether limb regeneration required healthy epidermis or not, a triploid skin cuff was set at the most proximal level of an irradiated limb and muscle was transplanted to the level of the midforearm. The forearm was then amputated through the muscle graft. The result was a complete replacement of diploid irradiated epidermis by triploid epidermis, during the six weeks necessary for regeneration. Another investigation consisted of detecting a possible migration of non-irradiated triploid epidermis along an irradiated limb which had not been amputated. Healthy epidermis was found to migrate distally and replace irradiated epidermis in three weeks. Transplantation of a non-irradiated skin cuff or muscle to an irradiated limb stump was carried out on animals entirely irradiated to prevent any extra healthy epidermis cells from contaminating the regenerating limb epidermis. A regenerate developed from the skin graft but not from muscle graft. It is concluded that healthy epidermis must be present on the limb stump to permit the blastema to develop.
International Nuclear Information System (INIS)
Lheureux, E.
1983-01-01
An X-irradiated newt limb is able to regenerate if non-irradiated skin as well as non-irradiated muscle is transplanted to the stump. In order to know whether limb regeneration required healthy epidermis or not, a triploid skin cuff was set at the most proximal level of an irradiated limb and muscle was transplanted to the level of the midforearm. The forearm was then amputated through the muscle graft. The result was a complete replacement of diploid irradiated epidermis by triploid epidermis, during the six weeks necessary for regeneration. Another investigation consisted of detecting a possible migration of non-irradiated triploid epidermis along an irradiated limb which had not been amputated. Healthy epidermis was found to migrate distally and replace irradiated epidermis in three weeks. Transplantation of a non-irradiated skin cuff or muscle to an irradiated limb stump was carried out on animals entirely irradiated to prevent any extra healthy epidermis cells from contaminating the regenerating limb epidermis. A regenerate developed from the skin graft but not from muscle graft. It is concluded that healthy epidermis must be present on the limb stump to permit the blastema to develop. (author)
Diniz, Maria de Fátima Haueisen Sander; Beleigoli, Alline Maria Rezende; Ribeiro, Antônio Luiz P.; Vidigal, Pedro Guatimosim; Bensenor, Isabela M.; Lotufo, Paulo A.; Duncan, Bruce B.; Schmidt, Maria Inês; Barreto, Sandhi Maria
2016-01-01
Abstract The primary aim of this study was to evaluate metabolically healthy status (MHS) among participants in obesity, overweight, and normal weight groups and characteristics associated with this phenotype using baseline data of Brazilian Longitudinal Study of Adult Health (ELSA-Brasil). The secondary aim was to investigate agreement among 4 different MHS criteria. This cross-sectional study included 14,545 participants aged 35 to 74 years with a small majority (54.1%) being women. Of all participants, 22.7% (n = 3298) were obese, 40.8% (n = 5934) were overweight, and 37.5% (n = 5313) were of normal weight. Socio-demographic, behavioral, and anthropometric factors related to MHS were ascertained. Logistic regression models estimated the odds of associations. We used 4 different criteria separately and in combination to define MHS: the National Health and Nutrition Examination Survey (NHANES), the National Cholesterol Education Program (NCEP-ATPIII), the International Diabetes Federation (IDF) and comorbidities, and the agreement between them were evaluated by Cohen-kappa coefficient. MHS was present among 12.0% (n = 396) of obese, 25.5% (n = 1514) of overweight, and 48.6% (n = 2582) of normal weight participants according to the combination of the 4 criteria. The agreement between all the 4 MHS criteria was strong (kappa 0.73 P < 0.001). In final logistic models, MHS was associated with lower age, female sex, lower body mass index (BMI), and weight change from age 20 within all BMI categories. This study showed that, despite differences in prevalence among the 4 criteria, MHS was associated with common characteristics at every BMI category. PMID:27399079
International Nuclear Information System (INIS)
Snyder, D.S.; May, M.
1975-01-01
Application of 5% para-aminobenzoic acid (PABA) to hairless mice one hour prior to ultraviolet light (UVL) irradiation will almost totally protect these animals from developing tumors induced by chronic exposure to UVL in the 290 to 320 nm range in conjunction with a chemical carcinogen. Mice exposed to UVL and not protected by PABA developed primarily squamous cell carcinomas. Two months after cessation of chronic UVL exposure, the non-PABA-treated irradiated mouse skin appeared thickened, yellow, and wrinkled while showing elevated DNA synthesis, hyperplasia, hypergranulosis, and increased amounts of elastotic material. The PABA-treated skin was grossly normal
Meehan, Courtney L; McGuire, Mark A; Foster, James; Sellen, Daniel W; Kamau-Mbuthia, Elizabeth W; Kamundia, Egidioh W; Mbugua, Samwel; Moore, Sophie E; Prentice, Andrew M; Kvist, Linda J; Otoo, Gloria E; Brooker, Sarah L; Price, William J; Shafii, Bahman; Placek, Caitlyn; Lackey, Kimberly A; Robertson, Bianca; Ruíz, Lorena; Pareja, Rossina G; Bode, Lars
2017-01-01
Background: Human milk is a complex fluid comprised of myriad substances, with one of the most abundant substances being a group of complex carbohydrates referred to as human milk oligosaccharides (HMOs). There has been some evidence that HMO profiles differ in populations, but few studies have rigorously explored this variability. Objectives: We tested the hypothesis that HMO profiles differ in diverse populations of healthy women. Next, we examined relations between HMO and maternal anthropometric and reproductive indexes and indirectly examined whether differences were likely related to genetic or environmental variations. Design: In this cross-sectional, observational study, milk was collected from a total of 410 healthy, breastfeeding women in 11 international cohorts and analyzed for HMOs by using high-performance liquid chromatography. Results: There was an effect of the cohort (P 4 times higher in milk collected in Sweden than in milk collected in rural Gambia (mean ± SEM: 473 ± 55 compared with 103 ± 16 nmol/mL, respectively; P < 0.05), and disialyllacto-N-tetraose (DSLNT) concentrations ranged from 216 ± 14 nmol/mL (in Sweden) to 870 ± 68 nmol/mL (in rural Gambia) (P < 0.05). Maternal age, time postpartum, weight, and body mass index were all correlated with several HMOs, and multiple differences in HMOs [e.g., lacto-N-neotetrose and DSLNT] were shown between ethnically similar (and likely genetically similar) populations who were living in different locations, which suggests that the environment may play a role in regulating the synthesis of HMOs. Conclusions: The results of this study support our hypothesis that normal HMO concentrations and profiles vary geographically, even in healthy women. Targeted genomic analyses are required to determine whether these differences are due at least in part to genetic variation. A careful examination of sociocultural, behavioral, and environmental factors is needed to determine their roles in this regard. This
Munise Daye; İnci Mevlitoğlu; Tahir Kemal Şahin
2015-01-01
Background and Design: For having a healthy skin; there are cleaning and cosmetic products that are specially prepared (nourishing,moisturizing,sunscreen, etc.) should be used and/or referred to as "skin care". In our study we aimed to determine knowledge and behaviors about skin care and moisturizers of dermatology patients. Materials and Methods: Between March-May 2013, we filled dermatology patients a questionary about their skin care products and moisturizers, behaviours abuot using th...
Pathological skin picking: case presentation and review of the literature
Directory of Open Access Journals (Sweden)
Maria Isabela Sarbu
2015-04-01
Full Text Available Pathological skin picking is a condition in which patients induce skin lesions through repetitive, compulsive excoriations of normal skin or skin with minor surface irregularities and they admit their role in the production of the lesions, but are unable to stop their behavior. Psychiatric comorbidities most often associated with skin picking include obsessive-compulsive disorder (OCD, anxiety disorders, mood disorders, body dysmorphic disorders, trichotillomania and compulsive-buying disorder. We report the case of a 17 year old female patient who addressed the dermatology department of our hospital with an eruption consisting of erythematous papules and plaques. The local examination revealed several clues of paramount importance in drawing the final conclusion and the psychiatric examination helped establish the diagnosis of pathological skin picking in a patient with obsessive-compulsive disorder.
Diversity of bacterial communities on the facial skin of different age-group Thai males
Directory of Open Access Journals (Sweden)
Alisa Wilantho
2017-11-01
Full Text Available Background Skin microbiome varies from person to person due to a combination of various factors, including age, biogeography, sex, cosmetics and genetics. Many skin disorders appear to be related to the resident microflora, yet databases of facial skin microbiome of many biogeographies, including Thai, are limited. Methods Metagenomics derived B-RISA and 16S rRNA gene sequencing was utilized to identify the culture-independent bacterial diversity on Thai male faces (cheek and forehead areas. Skin samples were categorized (grouped into (i normal (teenage.hea and (ii acne-prone (teenage.acn young adults, and normal (iii middle-aged (middle.hea and (iv elderly (elderly.hea adults. Results The 16S rRNA gene sequencing was successful as the sequencing depth had an estimated >98% genus coverage of the true community. The major diversity was found between the young and elderly adults in both cheek and forehead areas, followed by that between normal and acne young adults. Detection of representative characteristics indicated that bacteria from the order Rhizobiales, genera Sphingomonas and Pseudoalteromonas, distinguished the elderly.hea microbiota, along the clinical features of wrinkles and pores. Prediction of the metabolic potential revealed reduced metabolic pathways involved in replication and repair, nucleotide metabolism and genetic translation in the elderly.hea compared with that in the teenage.hea. For young adults, some unique compositions such as abundance of Propionibacterium acnes and Staphylococcus epidermidis, with a minor diversity between normal and acne skins, were detected. The metabolic potentials of the acne vs. normal young adults showed that teenage.acn was low in many cellular processes (e.g., cell motility and environmental adaptation, but high in carbohydrate metabolism, which could support acne growth. Moreover, comparison with the age-matched males from the US (Boulder, Colorado to gain insight into the diversity across
Diversity of bacterial communities on the facial skin of different age-group Thai males.
Wilantho, Alisa; Deekaew, Pamornya; Srisuttiyakorn, Chutika; Tongsima, Sissades; Somboonna, Naraporn
2017-01-01
Skin microbiome varies from person to person due to a combination of various factors, including age, biogeography, sex, cosmetics and genetics. Many skin disorders appear to be related to the resident microflora, yet databases of facial skin microbiome of many biogeographies, including Thai, are limited. Metagenomics derived B-RISA and 16S rRNA gene sequencing was utilized to identify the culture-independent bacterial diversity on Thai male faces (cheek and forehead areas). Skin samples were categorized (grouped) into (i) normal ( teenage.hea ) and (ii) acne-prone ( teenage.acn ) young adults, and normal (iii) middle-aged ( middle.hea ) and (iv) elderly ( elderly.hea ) adults. The 16S rRNA gene sequencing was successful as the sequencing depth had an estimated >98% genus coverage of the true community. The major diversity was found between the young and elderly adults in both cheek and forehead areas, followed by that between normal and acne young adults. Detection of representative characteristics indicated that bacteria from the order Rhizobiales, genera Sphingomonas and Pseudoalteromonas , distinguished the elderly.hea microbiota, along the clinical features of wrinkles and pores. Prediction of the metabolic potential revealed reduced metabolic pathways involved in replication and repair, nucleotide metabolism and genetic translation in the elderly.hea compared with that in the teenage.hea . For young adults, some unique compositions such as abundance of Propionibacterium acnes and Staphylococcus epidermidis , with a minor diversity between normal and acne skins, were detected. The metabolic potentials of the acne vs. normal young adults showed that teenage.acn was low in many cellular processes (e.g., cell motility and environmental adaptation), but high in carbohydrate metabolism, which could support acne growth. Moreover, comparison with the age-matched males from the US (Boulder, Colorado) to gain insight into the diversity across national biogeography
Egli-Gany, Dianne; Brill, Florian H H; Hintzpeter, Matthias; Andrée, Simone; Pavel, Viktoria
2012-09-01
The primary objective of this study was to compare the antimicrobial efficacy of polihexanide 0.02% and 0.04% with chlorhexidine 0.05% after 30 minutes of topical treatment on healthy intact skin. This study was performed as a double-blind, randomized, comparator-controlled, 3-arm, crossover study. : A phase I dermatological study unit. Twenty healthy volunteers with intact skin. : Test areas of 5 cm on the subjects' arms were treated with the investigational products using a polyurethane swab. Skin swabs were taken before and after treatment for quantitative microbial evaluation. The main outcome measure was the log reduction factor of colony-forming units on the skin after 30 minutes of treatment. No statistically significant difference was seen between both of the polihexanide test products (mean lgRF polihexanide 0.02%, 1.2251 [SD, 0.9399]; mean lgRF polihexanide 0.04%, 1.8991 [SD, 0.88]) and the comparator, chlorhexidine 0.05% (P > .1). The results of this study indicate that polihexanide is a suitable alternative to chlorhexidine for skin and wound antisepsis.
International Nuclear Information System (INIS)
Thomas, Philip; Harvey, Sarah; Gruner, Tini; Fenech, Michael
2008-01-01
The buccal micronucleus cytome assay was used to investigate biomarkers for DNA damage, cell death and basal cell frequency in buccal cells of healthy young, healthy old and young Down's syndrome cohorts. With normal ageing a significant increase in cells with micronuclei (P < 0.05, average increase +366%), karyorrhectic cells (P < 0.001, average increase +439%), condensed chromatin cells (P < 0.01, average increase +45.8%) and basal cells (P < 0.001, average increase +233%) is reported relative to young controls. In Down's syndrome we report a significant increase in cells with micronuclei (P < 0.001, average increase +733%) and binucleated cells (P < 0.001, average increase +84.5%) and a significant decrease in condensed chromatin cells (P < 0.01, average decrease -52%), karyolytic cells (P < 0.001, average decrease -51.8%) and pyknotic cells (P < 0.001, average decrease -75.0%) relative to young controls. These changes show distinct differences between the cytome profile of normal ageing relative to that for a premature ageing syndrome, and highlight the diagnostic value of the cytome approach for measuring the profile of cells with DNA damage, cell death and proportion of cells with proliferative potential (i.e., basal cells). Significant correlations amongst cell death biomarkers observed in this study were used to propose a new model of the inter-relationship of cell types scored within the buccal micronucleus cytome assay. This study validates the use of a cytome approach to investigate DNA damage, cell death and cell proliferation in buccal cells with ageing
Cyclic peptides as potential therapeutic agents for skin disorders.
Namjoshi, Sarika; Benson, Heather A E
2010-01-01
There is an increasing understanding of the role of peptides in normal skin function and skin disease. With this knowledge, there is significant interest in the application of peptides as therapeutics in skin disease or as cosmeceuticals to enhance skin appearance. In particular, antimicrobial peptides and those involved in inflammatory processes provide options for the development of new therapeutic directions in chronic skin conditions such as psoriasis and dermatitis. To exploit their potential, it is essential that these peptides are delivered to their site of action in active form and in sufficient quantity to provide the desired effect. Many polymers permeate the skin poorly and are vulnerable to enzymatic degradation. Synthesis of cyclic peptide derivatives can substantially alter the physicochemical characteristics of the peptide with the potential to improve its skin permeation. In addition, cyclization can stabilize the peptide structure and thereby increase its stability. This review describes the role of cyclic peptides in the skin, examples of current cyclic peptide therapeutic products, and the potential for cyclic peptides as dermatological therapeutics and cosmeceuticals.
International Nuclear Information System (INIS)
Chi, C.; Hayashi, Daisuke; Nemoto, Masato; Nyui, Minako; Anzai, Kazunori; Urano, Shiro
2011-01-01
We previously showed that free radicals and oxidative stress are involved in radiation-induced skin reactions. Since vitamin E (VE) is a particularly important lipophilic antioxidant, VE-deficient mice were used to examine its effects on radiation-induced skin damage. The VE content of the skin was reduced to one fourth of levels of normal mice. Neither the time of onset nor the extent of the reactions quantified with a scoring system differed between normal and VE-deficient mice after local X-irradiation (50 Gy). Similarly, there was no difference in the levels of the ascorbyl radical between the groups, although they were higher in irradiated skin than non-irradiated skin. X-irradiation increased the amount of Bax protein in the skin of normal mice both in the latent and acute inflammatory stages, time- and dose-dependently. The increase was associated with an increase in cytochrome c in the cytosolic fraction, indicating that apoptosis was also promoted by the irradiation. The increase in Bax protein correlated well with the thickness of the skin. Although a deficiency in VE should lower resistance to free radicals in the mitochondrial membrane and thus enhance radiation-induced Bax expression and apoptosis, it actually attenuated the increase in Bax protein caused by irradiation. (author)
DEFF Research Database (Denmark)
1991-01-01
The purpose of the study was to compare skin bloood flow by laser Doppler flowmetry (LDF) and the 133-Xenon washout technique in UVB-inflamed human skin. Six healthy subjects participated in the study. Forearm skin blood flow was measured prior to irradiation and then 8, 24, 48 and 72 h...