WorldWideScience

Sample records for normal healthy skin

  1. Healthy Skin Matters

    Science.gov (United States)

    ... skin. If you’re helping out in the kitchen, make sure you use hot pads or wear ... in humans, plants, and animals, while others are essential for a healthy life. Propionibacterium acnes (P. acnes) ( ...

  2. Maintaining Healthy Skin -- Part 1

    Science.gov (United States)

    ... with no breaks in the surface. It is warm (not hot or red) and neither dry and flaky nor moist and wrinkled. Healthy skin is a mirror of a healthy body. How to take care of your skin NUTRITION: To keep your skin healthy, eat a well- ...

  3. Maintaining Healthy Skin -- Part 2

    Science.gov (United States)

    ... and SCI • Depression and SCI • Taking Care of Pressure Sores • Maintaining Healthy Skin (Part I) • Maintaining Healthy Skin ( ... For information on establishing skin tolerance, see our “Pressure Sores” pamphlet.) Pressure releases in a wheelchair can be ...

  4. Investigation of the predictive validity of laser-EPs in normal, UVB-inflamed and capsaicin-irritated skin with four analgesic compounds in healthy volunteers.

    Science.gov (United States)

    Schaffler, Klaus; Nicolas, Laurent B; Borta, Andreas; Brand, Tobias; Reitmeir, Peter; Roebling, Robert; Scholpp, Joachim

    2017-07-01

    The aim of the present study was to assess the predictivity of laser-(radiant-heat)-evoked potentials (LEPs) from the vertex electroencephalogram, using an algesimetric procedure, testing the anti-nociceptive/anti-hyperalgesic effects of single oral doses of four marketed analgesics (of different compound classes) vs. placebo, in healthy volunteers with three skin types. This was a randomized, placebo-controlled, single-blind, five-way-crossover trial. Twenty-five healthy male/female Caucasians were included (receiving celecoxib 200 mg, pregabalin 150 mg, duloxetine 60 mg, lacosamide 100 mg or placebo) in a Williams design, with CO 2 laser-induced painful stimuli to normal, ultraviolet (UV) B-inflamed and capsaicin-irritated skin. LEPs and visual analogue scale ratings were taken at baseline and hourly for 6 h postdose from all three skin types. In normal skin, the averaged postdose LEP peak-to-peak-(PtP)-amplitudes were reduced by pregabalin (-2.68 μV; 95% confidence interval (CI) -4.16, 1.19) and duloxetine (-1.73 μV; 95% CI -3.21, -0.26) but not by lacosamide and celecoxib vs. placebo. On UVB-irradiated skin, reflecting inflammatory pain, celecoxib induced a pronounced reduction in LEP PtP amplitudes vs. placebo (-6.2 μV; 95% CI -7.88, -4.51), with a smaller reduction by duloxetine (-4.54 μV; 95% CI -6.21, -2.87) and pregabalin (-3.72 μV; 95% CI -5.40, -2.04), whereas lacosamide was inactive. LEP PtP amplitudes on capsaicin-irritated skin, reflecting peripheral/spinal sensitization, as in neuropathic pain, were reduced by pregabalin (-3.78 μV; 95% CI -5.31, -2.25) and duloxetine (-2.32 μV; 95% CI -3.82, -0.82) but not by celecoxib or lacosamide vs. placebo, which was in agreement with known clinical profiles. Overall, PtP amplitude reductions were in agreement with subjective ratings. LEP algesimetry is sensitive to analgesics with different modes of action and may enable the effects of novel analgesics to be assessed during early clinical

  5. Study of skin and nail Candida species as a normal flora based on age groups in healthy persons in Tehran-Iran.

    Science.gov (United States)

    Rafat, Z; Hashemi, S J; Ahamdikia, K; Daie Ghazvini, R; Bazvandi, F

    2017-12-01

    The skin is the body's largest organ that hosts heterogeneous inhabitants. Until now, the diversity of the cutaneous microbiome was mainly investigated for bacteria and there is a little information about the skin fungal flora. Also, among skin fungal flora, Candida is found as a main member whose distribution is affected by sex, age, climate. In this study, differences in Candida community structure associated with 9 different skin sites of 238 healthy people during 10 months from July to March 2016, are described. These subjects were divided by age into 4 groups: infants, children, adults and geriatrics. The collected samples were examined by culture on Sabouraud Chloramphenicol Agar and CHROM-agar Candida. For precise identification of species ITS1-5. 8S-ITS2 rDNA regions were sequenced where needed. The frequency of Candida species was significantly different between age groups. The most Candida isolations were related to the elderly age group and the fewest in the infants. C. parapsilosis virtually, was the predominant isolated species in all age groups. This study showed no statistically significant effect of the subject's sex on Candida population resident on human skin surface. Copyright © 2017. Published by Elsevier Masson SAS.

  6. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Jungerstedt, J; Hellgren, Lars; Drachmann, Tue

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...

  7. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...

  8. Mast cell distribution in normal adult skin

    NARCIS (Netherlands)

    A.S. Janssens (Artiena Soe); R. Heide (Rogier); J.C. den Hollander (Jan); P.G.M. Mulder (P. G M); B. Tank (Bhupendra); A.P. Oranje (Arnold)

    2005-01-01

    markdownabstract__AIMS:__ To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. __METHODS:__ Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults.

  9. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  10. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease.......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...

  11. Skin hydration, microrelief and greasiness of normal skin in Antarctica.

    Science.gov (United States)

    Tsankov, N; Mateev, D; Darlenski, R

    2018-03-01

    The skin is the primary defence of the human body against external factors from physical, chemical, mechanical and biologic origin. Climatic factors together with low temperature and sun radiation affect the skin. The effect of climatic conditions in Antarctica on healthy skin has not been previously addressed. The aim of this study was to evaluate the changes in the skin hydration, greasiness and microrelief due to the extreme climatic environmental factors during the stay of the members of the Bulgarian Antarctic expedition. Fifty-nine Caucasian healthy subjects, 42 men and 17 women with mean age 50.9 years (27-68), were enrolled. The study was performed in five consecutive years from 2011 to 2016 at the Bulgarian Antarctic base camp at Livingston Island. The study protocol consisted of two parts: study A: duration of 15 days with measurement of skin physiology parameters on a daily basis, and study B: five measurements at baseline and at days 14, 30, 45 and 50 upon arrival in Antarctica. We measured three biophysical parameters related to skin physiology at cheek skin by an impedance measuring device. No statistically significant difference between parameters at the different measurement points. There is a variation in skin hydration reaching its lower point at day 11 and then returning to values similar to baseline. Initially, an increase in skin greasiness was witnessed with a sharp depression at day 11 and final values at day 15 resembling the ones at baseline. An increase, although not statistically significant, in skin roughness was observed in the first 15 days of the study. Study B showed no statistically significant variances between values of the three parameters. Our studies show the pioneer results of the effect of Antarctic climate on human skin physiology. © 2017 European Academy of Dermatology and Venereology.

  12. Mast cell distribution in normal adult skin.

    Science.gov (United States)

    Janssens, A S; Heide, R; den Hollander, J C; Mulder, P G M; Tank, B; Oranje, A P

    2005-03-01

    To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults. There was an uneven distribution of MCs in different body sites using the anti-tryptase monoclonal antibody technique. Numbers of MCs on the trunk, upper arm, and upper leg were similar, but were significantly different from those found on the lower leg and forearm. Two distinct groups were formed--proximal and distal. There were 77.0 MCs/mm2 at proximal body sites and 108.2 MCs/mm2 at distal sites. Adjusted for the adjacent diagnosis and age, this difference was consistent. The numbers of MCs in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders were not different from those in the control group. Differences in the numbers of MCs between the distal and the proximal body sites must be considered when MCs are counted for a reliable diagnosis of mastocytosis. A pilot study in patients with mastocytosis underlined the variation in the numbers of MCs in mastocytosis and normal skin, but showed a considerable overlap. The observed numbers of MCs in adults cannot be extrapolated to children. MC numbers varied significantly between proximal and distal body sites and these differences must be considered when MCs are counted for a reliable diagnosis of mastocytosis. There was a considerable overlap between the numbers of MCs in mastocytosis and normal skin.

  13. Neurotrophins in healthy and diseased skin.

    Science.gov (United States)

    Raap, U; Kapp, A

    2010-04-01

    Understanding the complex mechanism of allergic inflammatory skin diseases has been a main challenge of clinical and experimental research for years. It is well known that the inflammatory response is also controlled by tissue resident cells including neurons and structural cells. Thus, allergic inflammation triggers neuronal dysfunction and structural changes in diseased skin. Prime candidates for the interaction between immune, structural, and neuronal cells are presented by neurotrophins. Neurotrophins have initially been described for their neurotrophic capacity. However, recent evidence emerges that neurotrophins display bidirectional interaction pathways in activating structural cells, immune cells in addition to neurons. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) are upregulated in allergic inflammatory skin diseases. Further, structural cells, neurons and tissue resident cells have not only been shown to be a target but also a source of neurotrophin. In this regard, eosinophil granulocytes which are key target effector cells in chronic inflammatory skin have been identified as a target of neurotrophins but are also capable of neurotrophin production. Thus, neuroimmune interaction mechanisms in allergic inflammatory skin display a novel pathophysiological aspect in which neurotrophins serve as prime candidates for bidirectional interaction mechanisms. In this review, we provide an actual overview of neurotrophins in healthy and diseased skin with special emphasis on atopic dermatitis and therapeutic implications.

  14. Touch Receptors Undergo Rapid Remodeling in Healthy Skin

    Directory of Open Access Journals (Sweden)

    Kara L. Marshall

    2016-11-01

    Full Text Available Sensory tissues exposed to the environment, such as skin, olfactory epithelia, and taste buds, continuously renew; therefore, peripheral neurons must have mechanisms to maintain appropriate innervation patterns. Although somatosensory neurons regenerate after injury, little is known about how these neurons cope with normal target organ changes. To elucidate neuronal plasticity in healthy skin, we analyzed the structure of Merkel-cell afferents, which are gentle touch receptors, during skin remodeling that accompanies mouse hair-follicle regeneration. The number of Merkel cells is reduced by 90% and axonal arbors are simplified during active hair growth. These structures rebound within just days. Computational modeling predicts that Merkel-cell changes are probabilistic, but myelinated branch stability depends on Merkel-cell inputs. Electrophysiology and behavior demonstrate that tactile responsiveness is less reliable during active growth than in resting skin. These results reveal that somatosensory neurons display structural plasticity at the cost of impairment in the reliability of encoding gentle touch.

  15. Differentiation of involved and uninvolved psoriatic skin from healthy skin using noninvasive visual, colorimeter and evaporimeter methods.

    Science.gov (United States)

    Pershing, L K; Bakhtian, S; Wright, E D; Rallis, T M

    1995-08-01

    Uninvolved skin of psoriasis may not be entirely normal. The object was to characterize healthy, uninvolved psoriatic skin and lesional skin by biophysical methods. Involved and uninvolved psoriatic and age-gender matched healthy skin was measured objectively with a colorimeter and evaporimeter and subjectively with visual assessment in 14 subjects. Visual assessment of erythema (E), scaling (S) and induration (I) as well as the target lesion score at the involved psoriatic skin sites were significantly elevated (puninvolved psoriatic skin >healthy skin (pcolorimeter L* and a* scale values at uninvolved psoriatic skin sites were lower and higher (pcolorimeter description (L*× b*)/a* significantly differentiated healthy skin from both involved and uninvolved psoriatic skin. These collective data highlight that even visually appearing uninvolved psoriatic skin is compromised compared with healthy skin. These objective, noninvasive but differential capabilities of the colorimeter and evaporimeter will aid in the mechanistic quantification of new psoriatic drug therapies and in conjuction with biochemical studies, add to understanding of the multifactorial pathogenesis of psoriasis.

  16. Normal variants of skin in neonates

    Directory of Open Access Journals (Sweden)

    Kulkarni M

    1996-01-01

    Full Text Available 2221 consecutive live births taking place between March 1994 and February 1995 were evaluated for a minimum period of 5 days to note for the occurrence of various normal anatomical variants specially those of skin. Birth weight, gestational age, maternal age, socio-economic status and consanguinity were carefully recorded in all the cases. Mongolian spots (72%, Epstein pearls (43.8%, Milia (26.2% and Erythema toxicum (25.2%, were the common dermatological variants noted. Maturity of the babies and possibly genetic factors (consanguinity are important factors in their causation as ordered in our study.

  17. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    DEFF Research Database (Denmark)

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars

    2008-01-01

    colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults......Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...

  18. The skin microbiome in healthy and allergic dogs.

    Directory of Open Access Journals (Sweden)

    Aline Rodrigues Hoffmann

    Full Text Available BACKGROUND: Changes in the microbial populations on the skin of animals have traditionally been evaluated using conventional microbiology techniques. The sequencing of bacterial 16S rRNA genes has revealed that the human skin is inhabited by a highly diverse and variable microbiome that had previously not been demonstrated by culture-based methods. The goals of this study were to describe the microbiome inhabiting different areas of the canine skin, and to compare the skin microbiome of healthy and allergic dogs. METHODOLOGY/PRINCIPAL FINDINGS: DNA extracted from superficial skin swabs from healthy (n = 12 and allergic dogs (n = 6 from different regions of haired skin and mucosal surfaces were used for 454-pyrosequencing of the 16S rRNA gene. Principal coordinates analysis revealed clustering for the different skin sites across all dogs, with some mucosal sites and the perianal regions clustering separately from the haired skin sites. The rarefaction analysis revealed high individual variability between samples collected from healthy dogs and between the different skin sites. Higher species richness and microbial diversity were observed in the samples from haired skin when compared to mucosal surfaces or mucocutaneous junctions. In all examined regions, the most abundant phylum and family identified in the different regions of skin and mucosal surfaces were Proteobacteria and Oxalobacteriaceae. The skin of allergic dogs had lower species richness when compared to the healthy dogs. The allergic dogs had lower proportions of the Betaproteobacteria Ralstonia spp. when compared to the healthy dogs. CONCLUSIONS/SIGNIFICANCE: The study demonstrates that the skin of dogs is inhabited by much more rich and diverse microbial communities than previously thought using culture-based methods. Our sequence data reveal high individual variability between samples collected from different patients. Differences in species richness was also seen between

  19. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  20. Small Demodex populations colonize most parts of the skin of healthy dogs.

    Science.gov (United States)

    Ravera, Iván; Altet, Laura; Francino, Olga; Sánchez, Armand; Roldán, Wendy; Villanueva, Sergio; Bardagí, Mar; Ferrer, Lluís

    2013-02-01

    It is unproven that all dogs harbour Demodex mites in their skin. In fact, several microscopic studies have failed to demonstrate mites in healthy dogs. Demodex canis is a normal inhabitant of the skin of most, if not all, dogs. This hypothesis was tested using a sensitive real-time PCR to detect Demodex DNA in the skin of dogs. One hundred dogs living in a humane society shelter, 20 privately owned and healthy dogs and eight dogs receiving immunosuppressive or antineoplastic therapy. Hair samples (250-300 hairs with their hair bulbs) were taken from five or 20 skin locations. A real-time PCR that amplifies a 166 bp sequence of the D. canis chitin synthase gene was used. The percentage of positive dogs increased with the number of sampling points. When a large canine population was sampled at five cutaneous locations, 18% of dogs were positive for Demodex DNA. When 20 skin locations were sampled, all dogs tested positive for mite DNA. Our study indicates that Demodex colonization of the skin is present in all dogs, independent of age, sex, breed or coat. Nevertheless, the population of mites in a healthy dog appears to be small. Demodex DNA was amplified from all 20 cutaneous points investigated, without statistically significant differences. Using a real-time PCR technique, Demodex mites, albeit in very low numbers, were found to be normal inhabitants of haired areas of the skin of healthy dogs. © 2013 The Authors. Veterinary Dermatology © 2013 ESVD and ACVD.

  1. Clinical and histological effects of blue light on normal skin.

    NARCIS (Netherlands)

    Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.

    2010-01-01

    INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and

  2. The feline skin microbiota: The bacteria inhabiting the skin of healthy and allergic cats

    Science.gov (United States)

    Diesel, Alison; Patterson, Adam P.; Meason-Smith, Courtney; Johnson, Timothy J.; Mansell, Joanne; Suchodolski, Jan S.; Rodrigues Hoffmann, Aline

    2017-01-01

    Background The skin is inhabited by a multitude of microorganisms. An imbalance of these microorganisms is associated with disease, however, the causal relationship between skin microbiota and disease remains unknown. To describe the cutaneous bacterial microbiota of cats and determine whether bacterial dysbiosis occurs on the skin of allergic cats, the skin surfaces on various regions of 11 healthy cats and 10 allergic cats were sampled. Methodology/Principal findings Genomic DNA was extracted from skin swabs and sequenced using primers that target the V4 region of the bacterial 16S rRNA. The bacterial sequences from healthy cats revealed that there are differences in species diversity and richness between body sites and different epithelial surfaces. Bacterial communities preferred body site niches in the healthy cats, however, the bacterial communities on allergic cat skin tended to be more unique to the individual cat. Overall, the number of bacterial species was not significantly different between the two health status groups, however, the abundances of these bacterial species were different between healthy and allergic skin. Staphylococcus, in addition to other taxa, was more abundant on allergic skin. Conclusions/Significance This study reveals that there are more bacterial species inhabiting the skin of cats than previously thought and provide some evidence of an association between dysbiosis and skin disease. PMID:28575016

  3. Individual signatures and environmental factors shape skin microbiota in healthy dogs.

    Science.gov (United States)

    Cuscó, Anna; Belanger, Janelle M; Gershony, Liza; Islas-Trejo, Alma; Levy, Kerinne; Medrano, Juan F; Sánchez, Armand; Oberbauer, Anita M; Francino, Olga

    2017-10-13

    The individual, together with its environment, has been reported as the main force driving composition and structure of skin microbiota in healthy dogs. Therefore, one of the major concerns when analyzing canine skin microbiota is the likely influence of the environment. Despite the dense fur covering, certain skin diseases exhibit differential prevalence among skin sites, dog breeds, and individuals. We have characterized the normal variability of dog skin microbiota in a well-controlled cohort of a large number of Golden-Labrador Retriever crossed dogs (N = 35) with similar ages, related genetic background, and a shared environment. We found that the individual drives the skin microbiota composition and structure followed by the skin site. The main bacterial classes inhabiting dog skin in this cohort are Gammaproteobacteria and Bacilli. We also detected bacteria associated to the environment on different dog skin sites that could be reflecting the different degrees of exposure of each skin site and each dog. Network analyses elucidated bacterial interactions within and between skin sites, especially in the chin, abdomen, axilla, and perianal region, with the highly shared interactions probably representing an anatomical, behavioral, or environmental component. When analyzing each skin site independently to assess host-specific factors, we found that temporality (season of birth and time spent in the kennel) affected all the skin sites and specially the inner pinna. The most abundant taxon driving this difference was Sphingomonas. We also found taxonomic differences among male and female dogs on the abdomen, axilla, and back. We observed a large inter-individual variability and differences among skin sites. Host-specific variables, such as temporality or sex, were also shaping skin microbiota of healthy dogs, even in an environmental homogenous cohort.

  4. Reflectance spectrometry of normal and bruised human skins: experiments and modeling

    International Nuclear Information System (INIS)

    Kim, Oleg; Alber, Mark; McMurdy, John; Lines, Collin; Crawford, Gregory; Duffy, Susan

    2012-01-01

    A stochastic photon transport model in multilayer skin tissue combined with reflectance spectroscopy measurements is used to study normal and bruised skins. The model is shown to provide a very good approximation to both normal and bruised real skin tissues by comparing experimental and simulated reflectance spectra. The sensitivity analysis of the skin reflectance spectrum to variations of skin layer thicknesses, blood oxygenation parameter and concentrations of main chromophores is performed to optimize model parameters. The reflectance spectrum of a developed bruise in a healthy adult is simulated, and the concentrations of bilirubin, blood volume fraction and blood oxygenation parameter are determined for different times as the bruise progresses. It is shown that bilirubin and blood volume fraction reach their peak values at 80 and 55 h after contusion, respectively, and the oxygenation parameter is lower than its normal value during 80 h after contusion occurred. The obtained time correlations of chromophore concentrations in developing contusions are shown to be consistent with previous studies. The developed model uses a detailed seven-layer skin approximation for contusion and allows one to obtain more biologically relevant results than those obtained with previous models using one- to three-layer skin approximations. A combination of modeling with spectroscopy measurements provides a new tool for detailed biomedical studies of human skin tissue and for age determination of contusions. (paper)

  5. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... yielded the following results: (1) in atopic dermatitis lesional skin an increased number of mast cell profiles was found as compared with nonlesional skin, (2) comparing atopic dermatitis skin with normal skin, a significantly increased number of mast cell profiles per millimetre squared was found...

  6. Evaluation of trace elements contents in healthy and seborrhoeic skin samples by SRTXRF

    International Nuclear Information System (INIS)

    Soares, Julio C.A.C.; Anjos, Marcelino J.; Lopes, Ricardo T.

    2009-01-01

    The aim of this work is to evaluate the concentrations of trace elements content in seborrhoeic keratosis (SK) skin lesions as well in normal skin and compare them. These data was acquired by Synchrotron Radiation Total Reflection X-ray Fluorescence (SRTXRF). It focused elements with atomic number greater than 14. This stage of research was supported by LNLS - Brazilian Synchrotron Light Laboratory in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, from the same patient, has involved 5 males and females with ages varying from 34 to 80 years old. The results have shown the presence of P, S, Cl, K, Ca, Ti, Cr, Fe, Ni, Cu, and Zn in healthy skin. The comparison with lesion contents has revealed significant differences in contents of Fe, K, Cr, and Zn. (author)

  7. Evaluation of trace elements contents in healthy and seborrhoeic skin samples by SRTXRF

    Energy Technology Data Exchange (ETDEWEB)

    Soares, Julio C.A.C.; Anjos, Marcelino J.; Lopes, Ricardo T., E-mail: marcelin@lin.ufrj.b, E-mail: ricardo@lin.ufrj.b [Federal University of Rio de Janeiro (UFRJ/COPPE), Rio de Janeiro, RJ (Brazil). Nuclear Engineering Program. Nuclear Instrumentation Lab.

    2009-07-01

    The aim of this work is to evaluate the concentrations of trace elements content in seborrhoeic keratosis (SK) skin lesions as well in normal skin and compare them. These data was acquired by Synchrotron Radiation Total Reflection X-ray Fluorescence (SRTXRF). It focused elements with atomic number greater than 14. This stage of research was supported by LNLS - Brazilian Synchrotron Light Laboratory in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, from the same patient, has involved 5 males and females with ages varying from 34 to 80 years old. The results have shown the presence of P, S, Cl, K, Ca, Ti, Cr, Fe, Ni, Cu, and Zn in healthy skin. The comparison with lesion contents has revealed significant differences in contents of Fe, K, Cr, and Zn. (author)

  8. Normal distribution of standing balance for healthy Danish children

    DEFF Research Database (Denmark)

    Pedersen, Line Kjeldgaard; Ghasemi, Habib; Rahbek, Ole

    2013-01-01

    Title: Normal distribution of standing balance for healthy Danish children – Reproducibility of parameters of balance. Authors Line Kjeldgaard Pedersen Habib Ghasemi Ole Rahbek Bjarne Møller-Madsen 1800 characters incl. spaces Background Pedobarographic measurements are increasingly used in child......Title: Normal distribution of standing balance for healthy Danish children – Reproducibility of parameters of balance. Authors Line Kjeldgaard Pedersen Habib Ghasemi Ole Rahbek Bjarne Møller-Madsen 1800 characters incl. spaces Background Pedobarographic measurements are increasingly used...

  9. Metabolite characterization in serum samples from normal healthy ...

    African Journals Online (AJOL)

    Metabolite characterization in serum samples from normal healthy human subjects by 1H and 13C NMR spectroscopy. D Misra, U Bajpai. Abstract. One and two dimensional NMR spectroscopy has been employed to characterize the various metabolites of serum control healthy samples. Two dimensional heteronuclear ...

  10. Confocal laser-scanning microscopy of capillaries in normal and psoriatic skin

    Science.gov (United States)

    Archid, Rami; Patzelt, Alexa; Lange-Asschenfeldt, Bernhard; Ahmad, Sufian S.; Ulrich, Martina; Stockfleth, Eggert; Philipp, Sandra; Sterry, Wolfram; Lademann, Juergen

    2012-10-01

    An important and most likely active role in the pathogenesis of psoriasis has been attributed to changes in cutaneous blood vessels. The purpose of this study was to use confocal laser-scanning microscopy (CLSM) to investigate dermal capillaries in psoriatic and normal skin. The structures of the capillary loops in 5 healthy participants were compared with those in affected skin of 13 psoriasis patients. The diameters of the capillaries and papillae were measured for each group with CLSM. All investigated psoriasis patients showed elongated, widened, and tortuous microvessels in the papillary dermis, whereas all healthy controls showed a single capillary loop in each dermal papilla. The capillaries of the papillary loop and the dermal papilla were significantly enlarged in the psoriatic skin lesions (diameters 24.39±2.34 and 146.46±28.52 μm, respectively) in comparison to healthy skin (diameters 9.53±1.8 and 69.48±17.16 μm, respectively) (P<0.001). CLSM appears to represent a promising noninvasive technique for evaluating dermal capillaries in patients with psoriasis. The diameter of the vessels could be seen as a well-quantifiable indicator for the state of psoriatic skin. CLSM could be useful for therapeutic monitoring to delay possible recurrences.

  11. Incorporation of 14C-linoleic acid in lipids of normal and psoriatic human skin

    International Nuclear Information System (INIS)

    Ruestow, B.; Metz, D.; Kunze, D.; Meffert, H.

    1980-01-01

    The 14 C-linoleic acid incorporation in lipids of surviving epidermis and corium of normal and psoriatic human skin was investigated. Changes of lipid metabolism were found in both epidermis and corium. Particularly the turnover of phospholipids was increased in the uninvolved psoriatic epidermis in relation to the involved psoriatic epidermis or to healthy controls. Possible reasons of these phenomena and the significance of structural lipids in psoriasis are discussed. (author)

  12. Elemental concentration in normal skin and fibroepithelial polip lesions by synchrotron radiation total reflection X-ray fluorescence technique

    International Nuclear Information System (INIS)

    Soares, Julio C.A.C.R.; Canellas, Catarine G.L.; Lopes, Ricardo T.; Anjos, Marcelino J.

    2011-01-01

    In this work, the concentrations of trace elements were measured in acrochordon, a skin lesion also known as skin tag or fibroepithelial polyp, as well as in normal skin from the same patient. The samples were analysed by Synchrotron Radiation Total Reflection X- ray Fluorescence (SRTXRF) in the Synchrotron Light National Laboratory (LNLS) in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, has involved 17 patients. It was evaluated the presence of P, S, Cl, K, Ca, Cr, Mn, Fe, Cu, Zn, Br and Rb in the paired samples, which were compared, and significant differences were found in some of them. (author)

  13. High load of Merkel cell polyomavirus DNA detected in the normal skin of Japanese patients with Merkel cell carcinoma.

    Science.gov (United States)

    Hashida, Yumiko; Nakajima, Kimiko; Nakajima, Hideki; Shiga, Takeo; Tanaka, Moe; Murakami, Masanao; Matsuzaki, Shigenobu; Naganuma, Seiji; Kuroda, Naoki; Seki, Yasutaka; Katano, Harutaka; Sano, Shigetoshi; Daibata, Masanori

    2016-09-01

    Although Merkel cell polyomavirus (MCPyV) has the potential to cause Merkel cell carcinoma (MCC), it is also found in the normal skin of healthy individuals. However, the mechanism for transformation of MCPyV to an oncogenic form is unknown. To investigate the levels of MCPyV infection in the normal skin patients with MCC compared with those in a control cohort. We studied a total of six Japanese patients with cutaneous MCC. Sun-exposed and sun-unexposed skin swabs were obtained and analyzed for MCPyV loads using quantitative real-time polymerase chain reaction. At first, we found a patient with MCC carrying an extremely high load of MCPyV DNA in normal skin. This unique case prompted us to further explore the levels of MCPyV as skin microbiota in patients with MCC. We showed that MCPyV DNA levels were significantly higher in swabs obtained from normal skin samples of six patients with MCC compared with those from 30 age-matched healthy individuals and 19 patients with other cutaneous cancers. Whereas MCPyV strains obtained from the normal skin of patients with MCC had gene sequences without structural alterations, sequences of the tumor-derived strains showed truncating mutations or deletions. Although the number of patients with MCC studied was small, our findings suggest that MCC may occur with a background of high MCPyV load in the skin, and are expected to stimulate further studies on whether such skin virome levels could be one of predictive markers for the development of MCC. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Proteome Analysis of Human Sebaceous Follicle Infundibula Extracted from Healthy and Acne-Affected Skin

    Science.gov (United States)

    Bek-Thomsen, Malene; Lomholt, Hans B.; Scavenius, Carsten; Enghild, Jan J.; Brüggemann, Holger

    2014-01-01

    Acne vulgaris is a very common disease of the pilosebaceous unit of the human skin. The pathological processes of acne are not fully understood. To gain further insight sebaceous follicular casts were extracted from 18 healthy and 20 acne-affected individuals by cyanoacrylate-gel biopsies and further processed for mass spectrometry analysis, aiming at a proteomic analysis of the sebaceous follicular casts. Human as well as bacterial proteins were identified. Human proteins enriched in acne and normal samples were detected, respectively. Normal follicular casts are enriched in proteins such as prohibitins and peroxiredoxins which are involved in the protection from various stresses, including reactive oxygen species. By contrast, follicular casts extracted from acne-affected skin contained proteins involved in inflammation, wound healing and tissue remodeling. Among the most distinguishing proteins were myeloperoxidase, lactotransferrin, neutrophil elastase inhibitor and surprisingly, vimentin. The most significant biological process among all acne-enriched proteins was ‘response to a bacterium’. Identified bacterial proteins were exclusively from Propionibacterium acnes. The most abundant P. acnes proteins were surface-exposed dermatan sulphate adhesins, CAMP factors, and a so far uncharacterized lipase in follicular casts extracted from normal as well as acne-affected skin. This is a first proteomic study that identified human proteins together with proteins of the skin microbiota in sebaceous follicular casts. PMID:25238151

  15. Regional outbreak of staphylococcal scalded skin syndrome in healthy children

    Directory of Open Access Journals (Sweden)

    Hyun Jeong Do

    2010-01-01

    Full Text Available Purpose : Staphylococcal scalded skin syndrome (SSSS is a relatively uncommon superficial blistering skin disease that is due to Staphylococcus aureus. We had experienced a regional outbreak of SSSS over 3 years in healthy children. Methods : We retrospectively reviewed the medical records of those patients diagnosed as SSSS. Most of neonatal cases were nosocomial infections and excluded from the analysis. The clinical features, laboratory findings, the isolation and antibiotic resistance of S. aureus, the antibiotic management and other supportive treatments were analyzed. Results : Fifty-five patients with SSSS were admitted to our hospital from October 2001 to September 2004. The median age of patients was 3.0 years. Of the 55 patients, 9 were the generalized type, 13 were the intermediate type and 33 were the scarletiniform rash. All the patients were living in neighborhood of the Jinju area. S. aureus were isolated from 9 of the patients and all of the isolated S. aureus were methicillin resistant. All the patients except two were treated with intravenous flocloxacillin or nafcillin and/or cefotaxime. All the patients recovered during the follow-up period of 2 to 3 weeks. Conclusion : We experienced a regional outbreak of SSSS in previous healthy children. Further study for finding the carriers of S. aureus caused SSSS and preventing the spread of this disease is needed. Additionally, guidelines for treating SSSS due to methicillin resistant S. aureus should be established.

  16. Normal range values for thromboelastography in healthy adult volunteers

    Directory of Open Access Journals (Sweden)

    S. Scarpelini

    2009-12-01

    Full Text Available Thromboelastography (TEG® provides a functional evaluation of coagulation. It has characteristics of an ideal coagulation test for trauma, but is not frequently used, partially due to lack of both standardized techniques and normal values. We determined normal values for our population, compared them to those of the manufacturer and evaluated the effect of gender, age, blood type, and ethnicity. The technique was standardized using citrated blood, kaolin and was performed on a Haemoscope 5000 device. Volunteers were interviewed and excluded if pregnant, on anticoagulants or having a bleeding disorder. The TEG® parameters analyzed were R, K, α, MA, LY30, and coagulation index. All volunteers outside the manufacturer’s normal range underwent extensive coagulation investigations. Reference ranges for 95% for 118 healthy volunteers were R: 3.8-9.8 min, K: 0.7-3.4 min, α: 47.8-77.7 degrees, MA: 49.7-72.7 mm, LY30: -2.3-5.77%, coagulation index: -5.1-3.6. Most values were significantly different from those of the manufacturer, which would have diagnosed coagulopathy in 10 volunteers, for whom additional investigation revealed no disease (81% specificity. Healthy women were significantly more hypercoagulable than men. Aging was not associated with hypercoagulability and East Asian ethnicity was not with hypocoagulability. In our population, the manufacturer’s normal values for citrated blood-kaolin had a specificity of 81% and would incorrectly identify 8.5% of the healthy volunteers as coagulopathic. This study supports the manufacturer’s recommendation that each institution should determine its own normal values before adopting TEG®, a procedure which may be impractical. Consideration should be given to a multi-institutional study to establish wide standard values for TEG®.

  17. Using silicone technology to maintain healthy skin in stoma care.

    Science.gov (United States)

    White, Maddie

    The use of silicone in stoma care has grown in recent years and may be considered the next step in the revolutionary development of stoma-care products. Clinical nurse specialists aim to provide evidence-based care at all times, and the same is true for stoma-care nurses. Preventing harm by choosing products that have a sound research base provides the patients with up-to-date, quality care, which enables them to adapt to life with a stoma and return to 'normal' functioning. This article explores the issue of peristomal skin problems and the development of silicone products, and highlights scenarios where it could be an advantage to choose a silicone product.

  18. Skin flora: Differences between people affected by Albinism and those with normally pigmented skin in Northern Tanzania - cross sectional study.

    Science.gov (United States)

    Kiprono, Samson K; Masenga, John E; Chaula, Baraka M; Naafs, Bernard

    2012-07-30

    Skin flora varies from one site of the body to another. Individual's health, age and gender determine the type and the density of skin flora. A 1  cm² of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35 °C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and 31 individuals with normal skin pigmentation. Those with normal skin were either relatives or staying with the individuals affected by albinism who were recruited for the study. The mean age of the 97 recruited individuals was 30.6 (SD ± 14.9) years. The mean of the colony forming units was 1580.5 per cm2. Those affected by albinism had a significantly higher mean colony forming units (1680  CFU per cm²) as compared with 453.5  CFU per cm² in those with normally pigmented skin (p = 0.023). The skin type and the severity of sun- damaged skin was significantly associated with a higher number of colony forming units (p = 0.038). Individuals affected by albinism have a higher number of colony forming units which is associated with sun- damaged skin.

  19. Detection of human papillomavirus in nonmelanoma skin cancer lesions and healthy perilesional skin in kidney transplant recipients and immunocompetent patients.

    Science.gov (United States)

    Bernat-García, J; Morales Suárez-Varela, M; Vilata-Corell, J J; Marquina-Vila, A

    2014-04-01

    The influence of human papillomavirus (HPV) on the development of nonmelanoma skin cancer (NMSC) is a topic of debate. HPV types from the beta genus (HPV-β) have been most frequently associated with the development of skin cancer. To analyze the prevalence and range of HPV types in NMSC lesions and healthy perilesional skin in immunodepressed and immunocompetent patients and to evaluate the influence of various clinical factors on the prevalence of HPV in skin cancer. Nested polymerase chain reaction and sequencing were used to detect HPV in 120 NMSC samples obtained by biopsy from 30 kidney transplant recipients and 30 immunocompetent patients. In all cases, a sample was taken from the tumor site and the surrounding healthy skin. Potential confounders were assessed and the data analyzed by multivariate logistic regression. HPV DNA was detected in 44 (73.3%) of the 60 samples from immunodepressed patients and in 32 (53.3%) of the 60 samples from immunocompetent patients (adjusted odds ratio, 3.4; 95% CI, 1.2-9.6). In both groups of patients, HPV was more common in healthy perilesional skin than in lesional skin. HPV-β was the most common type isolated. We found a wide range of HPV types (mostly HPV-β) in the skin of kidney transplant recipients and immunocompetent patients with skin cancer. Copyright © 2013 Elsevier España, S.L. and AEDV. All rights reserved.

  20. Direct immunofluorescence of normal skin in rheumatoid arthritis.

    Science.gov (United States)

    Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S

    1985-11-01

    The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.

  1. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... at the site of each biopsy. After fixation and plastic embedding, the biopsies were cut into 2 microns serial sections. Ten sections, 30 microns apart, from each biopsy were examined and stained alternately with either toluidine blue or Giemsa stain and mast cell profile numbers were determined. The study...

  2. 'To preserve the skin in health': drainage, bodily control and the visual definition of healthy skin 1835-1900.

    Science.gov (United States)

    te Hennepe, Mieneke

    2014-07-01

    The concept of a healthy skin penetrated the lives of many people in late-nineteenth-century Britain. Popular writings on skin and soap advertisements are significant for pointing to the notions of the skin as a symbolic surface: a visual moral ideal. Popular health publications reveal how much contemporary understanding of skin defined and connected ideas of cleanliness and the visual ideals of the healthy body in Victorian Britain. Characterised as a 'sanitary commissioner' of the body, skin represented the organ of drainage for body and society. The importance of keeping the skin clean and purging it of waste materials such as sweat and dirt resonated in a Britain that embraced city sanitation developments, female beauty practices, racial identities and moral reform. By focusing on the popular work by British surgeon and dermatologist Erasmus Wilson (1809-84), this article offers a history of skin through the lens of the sanitary movement and developments in the struggle for control over healthy skin still in place today.

  3. Normal tissue tolerance to external beam radiation therapy: Skin

    International Nuclear Information System (INIS)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A.

    2010-01-01

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  4. Effect of friction on vibrotactile sensation of normal and dehydrated skin.

    Science.gov (United States)

    Chen, S; Ge, S; Tang, W; Zhang, J

    2016-02-01

    Vibrotactile sensation mediated is highly dependent on surface mechanical and frictional properties. Dehydration of skin could change these properties. To investigate the relationship between friction and vibrotactile sensation of normal and dehydrated skin. Vibrations were firstly measured during surface exploration using a biomimetic sensor. Piglet skin was used as human skin model to study frictional properties for both normal and dehydrated skin using an atomic force microscope on nanoscale and a pin-on-disk tribometer on macroscale. Effect of vibrational frequency on friction and vibrotactile perception was also observed on nano and macro scale for normal and dehydrated skin. The result indicated that dehydrated skin was less sensitive than normal skin. The coefficient of friction of dehydrated skin is smaller than that of normal skin on both nano and macro scale. The coefficient of friction increases as increasing scanning frequencies. There is a positive correlation between coefficient of friction and vibrotactile sensation on nanoscale and macroscale. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Efficacy of a shower cream and a lotion with skin-identical lipids in healthy subjects with atopic dry skin.

    Science.gov (United States)

    Berardesca, Enzo; Mortillo, Susan; Cameli, Norma; Ardigo, Marco; Mariano, Maria

    2018-05-10

    Atopic dermatitis is a chronic, pruritic inflammatory skin disease that adversely affects quality of life. The current study evaluates the efficacy of a shower cream and a lotion, each with skin-identical lipids and emollients, in the treatment of atopic dry skin of subjects with a history of atopic condition. In all, 40 healthy females with clinically dry skin on the lower legs were enrolled in the study and underwent 4 weeks of daily use of the shower cream and 2 additional weeks of both the shower cream and the body lotion. Subjects were evaluated at day 0, week 4, and week 6. Skin barrier function was assessed by Tewameter ® , skin hydration by Corneometer ® , smoothness and desquamation by Visioscan ® , and stratum corneum architecture by reflectance confocal microscopy (RCM). The investigator assessed the degree of dryness, roughness, redness, cracks, tingling and itch, and subjective self-assessment evaluated the perception of skin soothing, smoothness, and softness. Skin barrier function and skin moisture maintenance were significantly improved using the shower cream. The lotion with physiological lipids, together with the shower cream, also improved skin barrier function and moisture. Both the shower cream and the body lotion reduced clinical dryness, roughness, redness, cracks, tingling and itch, according to the dermatologist, and increased soothing, smoothness, and softness, according to the subjects of the study. The combination of a shower cream and a lotion with physiological lipids efficiently restores skin barrier function and increases skin hydration, becoming an effective skin-care option for patients with atopic dry skin. © 2018 Wiley Periodicals, Inc.

  6. Defining normal liver stiffness range in a normal healthy Chinese population without liver disease.

    Directory of Open Access Journals (Sweden)

    James Fung

    Full Text Available BACKGROUND: For patients with chronic liver disease, different optimal liver stiffness cut-off values correspond to different stages of fibrosis, which are specific for the underlying liver disease and population. AIMS: To establish the normal ranges of liver stiffness in the healthy Chinese population without underlying liver disease. METHODS: This is a prospective cross sectional study of 2,528 healthy volunteers recruited from the general population and the Red Cross Transfusion Center in Hong Kong. All participants underwent a comprehensive questionnaire survey, measurement of weight, height, and blood pressure. Fasting liver function tests, glucose and cholesterol was performed. Abdominal ultrasound and transient elastography were performed on all participants. RESULTS: Of the 2,528 subjects, 1,998 were excluded with either abnormal liver parenchyma on ultrasound, chronic medical condition, abnormal blood tests including liver enzymes, fasting glucose, fasting cholesterol, high body mass index, high blood pressure, or invalid liver stiffness scan. The reference range for the 530 subjects without known liver disease was 2.3 to 5.9 kPa (mean 4.1, SD 0.89. The median liver stiffness was higher in males compared with females (4.3 vs 4.0 kPa respectively, p55 years (p=0.001. CONCLUSIONS: The healthy reference range for liver stiffness in the Chinese population is 2.3 to 5.9 kPa. Female gender and older age group was associated with a lower median liver stiffness.

  7. Effect of atopic skin stressors on natural moisturizing factors and cytokines in healthy adult epidermis

    DEFF Research Database (Denmark)

    Engebretsen, K A; Kezic, S; Jakasa, I

    2018-01-01

    : To explore the effect of selected exogenous skin stressors on NMF and skin cytokines levels in healthy adult epidermis. MATERIAL AND METHODS: 40 healthy volunteers (18-49 years) were exposed to hard, soft, and chlorinated water, 0.5% SLS, house dust mite, cat allergen, staphylococcal enterotoxin B (SEB...... of various skin cytokines in healthy individuals. Our data highlight environmental factors that might play a role in AD pathophysiology, but needs confirmation in AD patients. This article is protected by copyright. All rights reserved....

  8. Supraclavicular skin temperature and BAT activity in lean healthy adults.

    Science.gov (United States)

    van der Lans, Anouk A J J; Vosselman, Maarten J; Hanssen, Mark J W; Brans, Boudewijn; van Marken Lichtenbelt, Wouter D

    2016-01-01

    The 'gold standard' for measuring brown adipose tissue (BAT) in humans is [(18)F]FDG-PET/CT-imaging. With this technique subjects are exposed to ionizing radiation and are therefore limited in the number of scans that can be performed. We investigated the relation between supraclavicular skin temperatures and BAT activity values using a strictly temperature-controlled air-cooling protocol. Data of 36 male subjects was analyzed. BAT activity was evaluated by [(18)F]FDG-PET/CT-imaging and skin temperature was measured by means of wireless temperature sensors. Supraclavicular skin temperature dropped less compared to skin temperatures at other sites (all P values BAT activity (R (2) 0.23), and the change in supraclavicular skin temperature and non-shivering thermogenesis (R (2) 0.18, both P values BAT activity and BAT thermogenesis.

  9. Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa

    DEFF Research Database (Denmark)

    Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus

    2017-01-01

    therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid – fluorescence in situ hybridization probes...... were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...... and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease....

  10. Global classification of human facial healthy skin using PLS discriminant analysis and clustering analysis.

    Science.gov (United States)

    Guinot, C; Latreille, J; Tenenhaus, M; Malvy, D J

    2001-04-01

    Today's classifications of healthy skin are predominantly based on a very limited number of skin characteristics, such as skin oiliness or susceptibility to sun exposure. The aim of the present analysis was to set up a global classification of healthy facial skin, using mathematical models. This classification is based on clinical, biophysical skin characteristics and self-reported information related to the skin, as well as the results of a theoretical skin classification assessed separately for the frontal and the malar zones of the face. In order to maximize the predictive power of the models with a minimum of variables, the Partial Least Square (PLS) discriminant analysis method was used. The resulting PLS components were subjected to clustering analyses to identify the plausible number of clusters and to group the individuals according to their proximities. Using this approach, four PLS components could be constructed and six clusters were found relevant. So, from the 36 hypothetical combinations of the theoretical skin types classification, we tended to a strengthened six classes proposal. Our data suggest that the association of the PLS discriminant analysis and the clustering methods leads to a valid and simple way to classify healthy human skin and represents a potentially useful tool for cosmetic and dermatological research.

  11. Early skin-to-skin contact for mothers and their healthy newborn infants.

    Science.gov (United States)

    Moore, E R; Anderson, G C; Bergman, N

    2007-07-18

    Mother-infant separation postbirth is common in Western culture. Early skin-to-skin contact (SSC) begins ideally at birth and involves placing the naked baby, covered across the back with a warm blanket, prone on the mother's bare chest. According to mammalian neuroscience, the intimate contact inherent in this place (habitat) evokes neurobehaviors ensuring fulfillment of basic biological needs. This time may represent a psychophysiologically 'sensitive period' for programming future behavior. To assess the effects of early SSC on breastfeeding, behavior, and physiological adaptation in healthy mother-newborn dyads. Cochrane Pregnancy and Childbirth Group's and Neonatal Group's Trials Registers (August 2006), Cochrane Central Register of Controlled Trials (The Cochrane Library 2006, Issue 2), MEDLINE (1976 to 2006). Randomized and quasi-randomized clinical trials comparing early SSC with usual hospital care. We independently assessed trial quality and extracted data. Study authors were contacted for additional information. Thirty studies involving 1925 participants (mother-infant dyads), were included. Data from more than two trials were available for only 8-of-64 outcome measures. We found statistically significant and positive effects of early SSC on breastfeeding at one to four months postbirth (10 trials; 552 participants) (odds ratio (OR) 1.82, 95% confidence interval (CI) 1.08 to 3.07), and breastfeeding duration (seven trials; 324 participants) (weighted mean difference (WMD) 42.55, 95% CI -1.69 to 86.79). Trends were found for improved summary scores for maternal affectionate love/touch during observed breastfeeding (four trials; 314 participants) (standardized mean difference (SMD) 0.52, 95% CI 0.07 to 0.98) and maternal attachment behavior (six trials; 396 participants) (SMD 0.52, 95% CI 0.31 to 0.72) with early SSC. SSC infants cried for a shorter length of time (one trial; 44 participants) (WMD -8.01, 95% CI -8.98 to -7.04). Late preterm infants had

  12. In vivo spectroscopy of healthy skin and pathology in terahertz frequency range

    International Nuclear Information System (INIS)

    Zaytsev, Kirill I; Gavdush, Arseniy A; Chernomyrdin, Nikita V; Karasik, Valeriy E; Yurchenko, Stanislav O; Kudrin, Konstantin G; Reshetov, Igor V

    2015-01-01

    Biomedical applications of terahertz (THz) technology and, in particular, THz pulsed spectroscopy have attracted considerable interest in the scientific community. A lot of papers have been dedicated to studying the ability for human disease diagnosis, including the diagnosis of human skin cancers. In this paper we have studied the THz material parameters and THz dielectric properties of human skin and pathology in vivo, and THz pulsed spectroscopy has been utilized for this purpose. We have found a contrast between material parameters of basal cell carcinoma and healthy skin, and we have also compared the THz material parameters of dysplastic and non-dysplastic pigmentary nevi in order to study the ability for early melanoma diagnosis. Significant differences between the THz material parameters of healthy skin and pathology have been detected, thus, THz pulsed spectroscopy promises to be become an effective tool for non-invasive diagnosis of skin neoplasms

  13. The role of innate lymphoid cells in healthy and inflamed skin

    DEFF Research Database (Denmark)

    Bonefeld, Charlotte M.; Geisler, Carsten

    2016-01-01

    system. During the last years, it has become clear that innate lymphoid cells play a role in homeostasis and inflammation of the skin in humans and mice. In this review, we will discuss the role of innate lymphoid cells in healthy and inflamed skin with special focus on their role in atopic dermatitis.......The skin constitutes the interface between the organism and the environment, and it protects the body from harmful substances in the environment via physical, chemical and immunological barriers. The immunological barrier of the skin comprises both cells from the innate and the adaptive immune...

  14. Keep Your Skin Healthy: Protecting Your Outer Self

    Science.gov (United States)

    ... other protective clothing, use sunscreen with a sun protection factor (SPF) of at least 30, and restrict your time in the sun during the late morning and early afternoon hours, when sunlight is strongest. Many skin researchers like Kong are studying the skin’s microbiome— ...

  15. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  16. Differences Between Psoriasis Patients and Skin-healthy Controls Concerning Appraisal of Touching, Shame and Disgust.

    Science.gov (United States)

    Lahousen, Theresa; Kupfer, Jörg; Gieler, Uwe; Hofer, Angelika; Linder, M Dennis; Schut, Christina

    2016-08-23

    Psoriasis is a chronic skin disease associated with high levels of psychological distress and considerable life impact. Feelings of shame and stigmatization can lead to avoidance of social activity and intimacy. In this study, the questionnaire TSD-Q was used to evaluate pleasure in touching oneself and in a partnership, parental touching during childhood and (skin-related) shame and disgust. Skin-related disgust and shame were significantly higher in psoriatic patients than in healthy controls. Moreover, psoriasis-patients scored significantly lower than skin-healthy controls concerning appraisal of self-touching and parental touching. In contrast, psoriasis-patients scored higher concerning appraisal of touching in a partnership. Due to the fact that low self-esteem might enhance the negative evaluation of touch and the feelings of shame and disgust, psychological interventions should be integrated in the treatment of psoriasis.

  17. The follicular skin microbiome in patients with hidradenitis suppurativa and healthy controls

    DEFF Research Database (Denmark)

    Ring, Hans Christian; Thorsen, Jonathan; Saunte, Ditte M.

    2017-01-01

    IMPORTANCE: Although the pathogenesis of hidradenitis suppurativa (HS) remains enigmatic, several factors point to potential involvement of the cutaneous microbiome. Insight into the cutaneous microbiome in HS using next-generation sequencing may provide novel data on the microbiological diversity...... of the skin.  OBJECTIVE: To investigate the follicular skin microbiome in patients with HS and in healthy controls.  DESIGN, SETTING, AND PARTICIPANTS: This case-control study obtained punch biopsy specimens from patients with HS (lesional and nonlesional) and healthy controls between October 1, 2014....... Biopsy specimens from healthy controls were obtained from the axilla only.  MAIN OUTCOMES AND MEASURES: The different microbiomes were investigated using next-generation sequencing targeting 16S and 18S ribosomal RNA.  RESULTS: The skin microbiome was characterized in 30 patients with HS (mean [SD] age...

  18. Spectral analysis of blood perfusion in the free latissimus dorsi myocutaneous flap and in normal skin

    International Nuclear Information System (INIS)

    Liu Xudong; Zeng Bingfang; Fan Cunyi; Jiang Peizhu; Hu Xiao

    2006-01-01

    To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable

  19. The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

    Science.gov (United States)

    Draelos, Zoe D

    2006-07-01

    Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

  20. Skin temperature in the extremities of healthy and neurologically impaired children.

    Science.gov (United States)

    Svedberg, Lena E; Stener-Victorin, Elisabet; Nordahl, Gunnar; Lundeberg, Thomas

    2005-01-01

    Little emphasis has been accorded to peripheral skin temperature impairments in children with neurological disorders but attention has been paid to the significance of cold extremities (autonomic failure) for well-being and quality of life in adults stroke patients. Therefore, it seems important to investigate skin temperature in children with neurological disorder, especially when their communication is impaired. In the present study, we wanted to objectively verify any skin temperature differences between pre-school children with and without neurological disorders and also ascertain if any correlation existed between skin temperature and physical activity. Skin temperatures in 25 healthy children and 15 children with cerebral or spinal cord damages were assessed using infrared radiation. The temperatures were recorded on the palm and the dorsal surface of the hands and on the sole and dorsal surface of the feet three times at 15-minute intervals over 30min. A significant lower mean skin temperature in all measurement points was seen in non-walking children with cerebral damages compared to healthy controls. Also, the mean skin temperature was significantly lower in all foot measuring points in the children with cerebral damages that were unable to walk compared to those walking. In conclusion, as cold extremities may result in impaired well-being and hypothetically may be associated with other symptoms born by the child, further investigations of thermal dysfunction and autonomic function are of importance and treatment may be warranted.

  1. Evaluation of skin test reactivity to environmental allergens in healthy cats and cats with atopic dermatitis.

    Science.gov (United States)

    Schleifer, Sebastian G; Willemse, Ton

    2003-06-01

    To evaluate skin test reactivity to environmental allergens in healthy cats and in cats with atopic dermatitis (AD). 10 healthy cats and 10 cats with AD. 10 allergens in serial dilutions were injected ID on the lateral aspect of the thorax of sedated cats. Histamine (0.01% solution) and buffer solutions were used as positive and negative controls, respectively. Immediately after the last injection, 10% fluorescein solution was administered IV. Skin test results were evaluated with ultraviolet light after 15 to 30 minutes and at 4 and 6 hours by 2 independent observers. In the control group, skin tests were repeated after 6 weeks. Skin test reactivity and the nature of the immunoglobulin involved were investigated by use of the Prausnitz-Küstner test with untreated and heat-treated cat sera. Intertest and interobserver agreement were high when measurement of the diameter of the fluorescent wheal was used to evaluate skin test responses, compared with assessment of its intensity. In both groups of cats, immediate skin test reactivity was observed as an IgE-mediated reaction, as an IgG-mediated reaction, and as a result of nonspecific mast cell degranulation. There was no correlation between allergen concentration and the type of reaction observed. Skin test reactivity in cats should be evaluated after IV administration of 10% fluorescein solution by means of a Prausnitz-Küstner test to differentiate among IgE-mediated, IgG-mediated, and nonspecific reactions.

  2. Skin perfusion measurement: the normal range, the effects of ambient temperature and its clinical application

    International Nuclear Information System (INIS)

    Henry, R.E.; Malone, J.M.; Daly, M.J.; Hughes, J.H.; Moore, W.S.

    1982-01-01

    Quantitation of skin perfusion provides objective criteria to determine the optimal amputation level in ischemic limb disease, to assess the maturation of pedicle flaps in reconstructive surgery, and to select appropriate treatment for chronic skin ulcers. A technique for measurement of skin perfusion using intradermal (ID) Xe-133 and a gamma camera/minicomputer system was previously reported. An update of this procedure is now reported, the normal range for the lower extremity in men, observations on the effects of ambient temperature, and an experience using the procedure to determine amputation level

  3. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?.

    Science.gov (United States)

    Filipović, Mila; Gledović, Ana; Lukić, Milica; Tasić-Kostov, Marija; Isailović, Tanja; Pantelić, Ivana; Vuleta, Gordana; Savić, Snežana

    2016-11-01

    Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. With the employment of noninvasive skin biophysical measurements, skin hydration (EC), transepi-dermal water loss (TEWL), erythema index (EI) and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study) on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  4. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?

    Directory of Open Access Journals (Sweden)

    Filipović Mila

    2016-01-01

    Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  5. Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis

    International Nuclear Information System (INIS)

    Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.

    1982-01-01

    The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)

  6. Efficacy of Phoenix dactylifera L. (Date Palm Creams on Healthy Skin

    Directory of Open Access Journals (Sweden)

    Sidra Meer

    2017-05-01

    Full Text Available The date palm fruit (Phoenix dactylifera L. Arecaceae is used in most of the countries of the world and is an essential part of the diet, especially in many Arabian countries. Phoenix dactylifera L. fruits are a rich source of sugars (glucose and fructose, vitamins (A, C, and B complex, fibers, minerals, and phenolic compounds having antioxidant and anti-inflammatory properties. This study is designed to explore the Phoenix dactylifera L. fruit for skin care. A single-blinded, placebo control trial was conducted, including 11 healthy female volunteers after their informed consent. The efficacy of the Phoenix dactylifera L. extract (4% was evaluated in cream form after one, two, three, four, six, and eight weeks of treatment compared with the baseline. Prior to the study, the composition of the extract was analyzed to understand the underlying mechanisms by which the extract affects skin. Treating facial skin with the Phoenix dactylifera L. extract significantly improved all parameters investigated, such as skin elasticity, pigmentation, redness, brightness, and hydration and led to the improvement of the facial skin. There were no adverse reactions noted during the course of the patch test, demonstrating that the extract could be safe to apply on the skin. The Phoenix dactylifera L. fruit extract serves as a skin care ingredient that significantly improves characteristics important for perception of skin ageing and health. The efficacy of the treatment is possibly due to a combination of numerous active substances found in the Phoenix dactylifera L. extract.

  7. Are normal narcissists psychologically healthy?: self-esteem matters.

    Science.gov (United States)

    Sedikides, Constantine; Rudich, Eric A; Gregg, Aiden P; Kumashiro, Madoka; Rusbult, Caryl

    2004-09-01

    Five studies established that normal narcissism is correlated with good psychological health. Specifically, narcissism is (a) inversely related to daily sadness and dispositional depression, (b) inversely related to daily and dispositional loneliness, (c) positively related to daily and dispositional subjective well-being as well as couple well-being, (d) inversely related to daily anxiety, and (e) inversely related to dispositional neuroticism. More important, self-esteem fully accounted for the relation between narcissism and psychological health. Thus, narcissism is beneficial for psychological health only insofar as it is associated with high self-esteem. Explanations of the main and mediational findings in terms of response or social desirability biases (e.g., defensiveness, repression, impression management) were ruled out. Supplementary analysis showed that the links among narcissism, self-esteem, and psychological health were preponderantly linear. ((c) 2004 APA, all rights reserved)

  8. Radiosensitiviness of blood lymphocytes from skin cancer patients and healthy volunteers as determined by micronucleus assay

    International Nuclear Information System (INIS)

    Lohmann, Tania Helena Ochi.

    1995-01-01

    Cancer, a major death cause in developed countries, has been related to somatic mutations that could be detected by cytogenetic analysis. Among the tools used in these tests, the micronucleus assay has been largely applied at population surveillance, biological dosimetry and early detection of groups with higher risks to developing cancers. In this study, we analysed the chromosome susceptibility of blood lymphocytes from basocellular skin cancer patients and healthy volunteers. The cytogenetic analysis was performed by a micronucleus assay, using progressive doses of ionizing radiation from a 60 Co source as mutagen. Briefly, the blood lymphocytes were irradiated in vitro, as processed by the cytokinesis-blocked method. The micronucleus frequency and distribution, cell cycle kinetics, nucleation index and dose-response relationship were determined in each patient. The results showed that the basocellular skin cancer patients lymphocytes presented higher spontaneous micronucleus frequency as compared with those from healthy young volunteers but lower than healthy now young volunteers . The radiation-induced micronucleus analysis showed that the basocellular skin cancer patients' lymphocytes presented similar proportion of damage lymphocytes as compared with those from healthy volunteers. Nevertheless, the magnitude of this damage was higher in this group with doses. Higher than 400 c Gy, which was not occurred in healthy volunteers. Cell cycle kinetics, as determined by the nucleation index, was lower in basocellular skin cancer patients as compared with healthy volunteers, indicating a more slow cell cycle. Our data showed that the lymphocytes from carcinoma basocellular patients were more radiosensitive as compared with those form healthy volunteers. (author). 159 refs., 21 figs., 16 tabs

  9. Functional analyses of the skin surface of the areola mammae: comparison between healthy adult male and female subjects and between healthy individuals and patients with atopic dermatitis.

    Science.gov (United States)

    Kikuchi, K; Tagami, H; Akaraphanth, R; Aiba, S

    2011-01-01

    Although the nipple and areola of the breast constitute a unique and prominent area on the chest, so far no study has been done on the functional properties of their skin surfaces. To study the stratum corneum (SC) covering the areola using noninvasive methods. Eighteen adult healthy subjects comprising nine men and nine women and 18 age- and sex-matched patients with atopic dermatitis (AD), none of whom had visible skin lesions, participated in the study. Transepidermal water loss (TEWL), skin surface hydration and skin surface lipid levels were measured on the areola and adjacent breast skin. The size of the skin surface corneocytes of these skin regions was assessed. All the healthy subjects showed significantly higher TEWL accompanied by smaller sized corneocytes on the areola than on the adjacent breast skin. Only female subjects revealed a significantly higher skin surface hydration state together with significantly increased skin surface lipid levels on the areola than on the adjacent breast skin. These sex differences were observed even in patients with AD. Comparison between healthy individuals and the patients with AD demonstrated higher TEWL, decreased skin surface hydration state and lower skin surface lipid levels associated with smaller sized corneocytes in the areola in the patients with AD, especially in male patients. In adults, the SC barrier function and SC water-binding capacity of the areola were functionally poorer than in the adjacent skin, being covered by smaller sized corneocytes and lower amounts of skin surface lipids, especially in men and in patients with AD. © 2011 The Authors. BJD © 2011 British Association of Dermatologists 2011.

  10. Ambient humidity and the skin: the impact of air humidity in healthy and diseased states.

    Science.gov (United States)

    Goad, N; Gawkrodger, D J

    2016-08-01

    studies are needed to better delineate the interactions that can occur in normal and diseased states. Therapeutic measures might be forthcoming especially for skin diseases such as eczema, which are regarded as being characterized by 'skin dryness'. Further research examining the interaction between different environmental exposures thought to impact the skin, and indeed the interplay between genetic, environmental and immunological influences, are required. © 2016 European Academy of Dermatology and Venereology.

  11. A study of several normal values of Korean healthy adults on chest roentgenograms

    Energy Technology Data Exchange (ETDEWEB)

    Rhee, Byung Chull [Choong Nam University College of Medicine, Taejeon (Korea, Republic of)

    1975-06-15

    Determination of several normal values were carried out healthy 1805 cases of Korean adults, 1436 cases of male and 369 cases of female, by the drawing and calculation on chest roentgenograms. In many instances, the change of normal values provides an important clinical values, and often is decisive to evaluate the diagnosis, treatment and prognosis of pulmonary, cardiac and mediastinal disease.

  12. Mast cells are dispensable for normal and activin-promoted wound healing and skin carcinogenesis.

    Science.gov (United States)

    Antsiferova, Maria; Martin, Caroline; Huber, Marcel; Feyerabend, Thorsten B; Förster, Anja; Hartmann, Karin; Rodewald, Hans-Reimer; Hohl, Daniel; Werner, Sabine

    2013-12-15

    The growth and differentiation factor activin A is a key regulator of tissue repair, inflammation, fibrosis, and tumorigenesis. However, the cellular targets, which mediate the different activin functions, are still largely unknown. In this study, we show that activin increases the number of mature mast cells in mouse skin in vivo. To determine the relevance of this finding for wound healing and skin carcinogenesis, we mated activin transgenic mice with CreMaster mice, which are characterized by Cre recombinase-mediated mast cell eradication. Using single- and double-mutant mice, we show that loss of mast cells neither affected the stimulatory effect of overexpressed activin on granulation tissue formation and reepithelialization of skin wounds nor its protumorigenic activity in a model of chemically induced skin carcinogenesis. Furthermore, mast cell deficiency did not alter wounding-induced inflammation and new tissue formation or chemically induced angiogenesis and tumorigenesis in mice with normal activin levels. These findings reveal that mast cells are not major targets of activin during wound healing and skin cancer development and also argue against nonredundant functions of mast cells in wound healing and skin carcinogenesis in general.

  13. Body mass index, chronological age and hormonal status are better predictors of biological skin age than arm skin autofluorescence in healthy women who have never smoked

    NARCIS (Netherlands)

    Randag, A. C.; Graaff, R.; Dreise, M. M.; Vierkoetter, A.; Werker, P. M. N.; Stenekes, M. W.

    Background As life expectancy is increasing and healthy ageing becomes more and more important, skin ageing is a growing topic of interest from both a medical and a commercial point of view. The urgency to unravel the causes of skin ageing is rising. However, there is a lack of objective, simple,

  14. Body mass index, chronological age and hormonal status are better predictors of biological skin age than arm skin autofluorescence in healthy women who have never smoked

    NARCIS (Netherlands)

    Randag, A. C.; Graaff, R.; Dreise, M. M.; Vierkoetter, A.; Werker, P. M. N.; Stenekes, M. W.

    2015-01-01

    Background As life expectancy is increasing and healthy ageing becomes more and more important, skin ageing is a growing topic of interest from both a medical and a commercial point of view. The urgency to unravel the causes of skin ageing is rising. However, there is a lack of objective, simple,

  15. Tolerance of natural baby skin-care products on healthy, full-term infants and toddlers

    OpenAIRE

    Coret, Catherine D; Suero, Michael B; Tierney, Neena K

    2014-01-01

    Catherine D Coret, Michael B Suero, Neena K Tierney Johnson & Johnson Consumer Companies, Inc, Skillman, NJ, USA Purpose: To evaluate the tolerance of baby skin-care products with at least 95% naturally derived ingredients on infants and toddlers. Materials and methods: Healthy, full-term infants and toddlers aged 1–36 months were enrolled. In study 1, a lightly fragranced natural baby hair and body wash (n=30), a lightly fragranced natural baby shampoo (n=30), or a lightly...

  16. New Mydriasis-Free Electroretinogram Recorded with Skin Electrodes in Healthy Subjects

    Directory of Open Access Journals (Sweden)

    Ken Asakawa

    2017-01-01

    Full Text Available Purpose. To evaluate the reproducibility and consistency of the new mydriasis-free electroretinogram (ERG with a skin electrode (RETeval device, to determine the normative values of parameters, and to clarify the usefulness of pupil records to colored-light stimulus. Methods. A total of 100 eyes of 50 healthy subjects (mean age, 21.4 years were enrolled. The diagnostic parameters obtained by the RETeval device were examined under the following conditions. The reproducibility was determined with the coefficient of variation (CV. The consistency was examined by intraclass correlation coefficients (ICCs. The mean value and the normal range were analyzed with a 95% confidence interval as the normative values of parameters. The correlation of parameters to pupil records (area ratio, constriction ratio and flicker ERG was also examined in the diabetic retinopathy assessment protocol. Results. From the CV for each of the two measurements, the amplitude has a low reproducibility compared with the implicit time. Generally good consistency was obtained with both ERG parameters (ICCs = 0.48–0.92. Moderate correlations were found for the white-, red-, and blue-light stimulus in the area ratio and the constriction ratio, respectively (r = 0.44–0.62; P = 0.010–<0.0001. No correlation was observed between pupil and flicker parameters (r = 0.06–0.34; P = 0.646–0.051. Conclusions. The RETeval device was suggested as a possible screening device to detect the visual afferent diseases by evaluating in combination with the ERG recording and the colored-light pupil response.

  17. High-definition optical coherence tomography enables visualization of individual cells in healthy skin

    DEFF Research Database (Denmark)

    Boone, Marc; Jemec, Gregor B E; Del Marmol, Véronique

    2012-01-01

    High-definition OCT (HD-OCT) is an innovative technique based on the principle of conventional OCT. Our objective was to test the resolution and image quality of HD-OCT in comparison with reflectance confocal microscopy (RCM) of healthy skin. Firstly, images have been made of a ultra-high-resolut......High-definition OCT (HD-OCT) is an innovative technique based on the principle of conventional OCT. Our objective was to test the resolution and image quality of HD-OCT in comparison with reflectance confocal microscopy (RCM) of healthy skin. Firstly, images have been made of a ultra......-high-resolution line-pair phantome with both systems. Secondly, we investigated 21 healthy volunteers of different phototypes with HD-OCT and RCM on volar forearm and compared the generated images. HD-OCT displays also differences depending on the skin phototype and anatomical site. The 3-μm lateral resolution...... of the HD-OCT could be confirmed by the phantom analysis. The identification of cells in the epidermis can be made by both techniques. RCM offers the best lateral resolution, and HD-OCT has the best penetration depth, providing images of individual cells deeper within the dermis. Eccrine ducts and hair...

  18. Protoporphyrin IX formation and photobleaching in different layers of normal human skin

    DEFF Research Database (Denmark)

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A

    2012-01-01

    human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...

  19. Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.

    Science.gov (United States)

    Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R

    1991-12-01

    The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.

  20. ‘To Preserve the Skin in Health’: Drainage, Bodily Control and the Visual Definition of Healthy Skin 1835–1900

    Science.gov (United States)

    te Hennepe, Mieneke

    2014-01-01

    The concept of a healthy skin penetrated the lives of many people in late-nineteenth-century Britain. Popular writings on skin and soap advertisements are significant for pointing to the notions of the skin as a symbolic surface: a visual moral ideal. Popular health publications reveal how much contemporary understanding of skin defined and connected ideas of cleanliness and the visual ideals of the healthy body in Victorian Britain. Characterised as a ‘sanitary commissioner’ of the body, skin represented the organ of drainage for body and society. The importance of keeping the skin clean and purging it of waste materials such as sweat and dirt resonated in a Britain that embraced city sanitation developments, female beauty practices, racial identities and moral reform. By focusing on the popular work by British surgeon and dermatologist Erasmus Wilson (1809–84), this article offers a history of skin through the lens of the sanitary movement and developments in the struggle for control over healthy skin still in place today. PMID:25045181

  1. An echocardiographic study of healthy Border Collies with normal reference ranges for the breed.

    Science.gov (United States)

    Jacobson, Jake H; Boon, June A; Bright, Janice M

    2013-06-01

    The objectives of this study were to obtain standard echocardiographic measurements from healthy Border Collies and to compare these measurements to those previously reported for a general population of dogs. Standard echocardiographic data were obtained from twenty apparently healthy Border Collie dogs. These data (n = 20) were compared to data obtained from a general population of healthy dogs (n = 69). Border Collies were deemed healthy based on normal history, physical examination, complete blood count, serum biochemical profile, electrocardiogram, and blood pressure, with no evidence of congenital or acquired heart disease on echocardiographic examination. Standard two dimensional, M-mode, and Doppler echocardiographic measurements were obtained and normal ranges determined. The data were compared to data previously obtained at our hospital from a general population of normal dogs. Two dimensional, M-mode, and Doppler reference ranges for healthy Border Collies are presented in tabular form. Comparison of the weight adjusted M-mode echocardiographic means from Border Collies to those from the general population of dogs showed Border Collies to have larger left ventricular systolic and diastolic dimensions, smaller interventricular septal thickness, and lower fractional shortening. There are differences in some echocardiographic parameters between healthy Border Collies and the general dog population, and the echocardiographic reference ranges provided in this study should be used as breed specific reference values for Border Collies. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  3. Does dietary fluid intake affect skin hydration in healthy humans? A systematic literature review.

    Science.gov (United States)

    Akdeniz, M; Tomova-Simitchieva, T; Dobos, G; Blume-Peytavi, U; Kottner, J

    2018-02-02

    Associations between daily amounts of drinking water and skin hydration and skin physiology receive increasingly attention in the daily life and in clinical practice. However, there is a lack of evidence of dermatological benefits from drinking increased amounts of water. Pubmed and Web of Science were searched without any restrictions of publication dates. References of included papers and related reviews were checked. Eligibility criteria were primary intervention and observational studies investigating the effects of fluid intake on skin properties in English, German, Spanish or Portuguese language, including subjects being healthy and 18+ years. Searches resulted in 216 records, 23 articles were read in full text, and six were included. The mean age of the samples ranged from 24 to 56 years. Overall the evidence is weak in terms of quantity and methodological quality. Disregarding the methodological limitations a slight increase in stratum corneum and "deep" skin hydration was observed after additional water intake, particularly in individuals with lower prior water consumption. Reductions of clinical signs of dryness and roughness were observed. The extensibility and elasticity of the skin increased slightly. Unclear associations were shown between water intake and transepidermal water loss, sebum content, and skin surface pH. Additional dietary water intake may increase stratum corneum hydration. The underlying biological mechanism for this possible relationship is unknown. Whether this association also exists in aged subjects is unclear. Research is needed to answer the question whether increased fluid intake decreases signs of dry skin. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Skin care for healthy babies at term: A systematic review of the evidence.

    Science.gov (United States)

    Cooke, Alison; Bedwell, Carol; Campbell, Malcolm; McGowan, Linda; Ersser, Steven J; Lavender, Tina

    2018-01-01

    to identify what skin practices are important for the protection of baby skin in healthy term babies (0-6 months) and generate evidence-based conclusions to inform health professionals and parents. eleven databases were searched for all empirical quantitative and qualitative research published between 2000-2015 which explored baby skin care for bathing and cleansing, nappy care, hair and scalp care, management of dry skin or baby massage, for healthy term babies up to 6 months old. Papers not published in English were excluded. A total of 3062 papers were identified. Pairs of reviewers assessed all citations and extracted data independently. There were 26 included papers: 16 RCTs, 3 non-randomised experimental studies, 1 mixed-methods study and 6 qualitative studies. Primary and secondary outcome measures were analysed using meta-analysis or narrative descriptive statistics. Synthesis of qualitative data was not possible due to disparity of the evidence. from the small numbers of studies with comparable data, there was no evidence of any significant differences between tested wash products and water or tested baby wipes and water. There was some evidence to suggest that daily use of full-body emollient therapy may help to reduce the risk of atopic eczema in high risk babies with a genetic predisposition to eczema; however, the use of olive oil or sunflower oil for baby dry skin may adversely affect skin barrier function. There was no evidence about hair/scalp care or baby massage. Qualitative research indicates that parents and health professionals believe that water alone is best. meta-analysis was restricted due to the lack of consistency of study outcome measures. Although there is considerable RCT evidence comparing the use of specific products against water alone, or another product, for bathing, cleansing and nappy care, the power of this evidence is reduced due to inconsistency of outcome measures in terms of outcome, treatment site or time-point. The

  5. Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells

    International Nuclear Information System (INIS)

    Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki

    2008-01-01

    The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)

  6. Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair

    Science.gov (United States)

    Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.; hide

    1994-01-01

    The skin repair studies started to be problematic for the following reasons: (1) It was very difficult to locate the wound and many lesions were not of the same dimensions. A considerable amount of time was devoted to the identification of the wound using polarized light. We understand that this experiment was added on to the overall project. Marking of the wound site and standard dimensions should be recommended for the next flight experiment. (2) The tissue was frozen, therefore thawing and fixation caused problems with some of the immunocytochemical staining for obtaining better special resolution with light microscopy image processing. Despite these problems, we were unable to detect any significant qualitative differences for the following wound markers: (1) Collagen Type 3, (2) Hematotoxylin and Eosin, and (3) Macrophage Factor 13. All protein markers were isolated from rat sources and antibodies prepared and tested for cross reactivity with other molecules at the University of Wisconsin Hybridoma Facility. However, rat skin from the non lesioned site 'normal' showed interesting biochemical results. Skin was prepared for the following measurements: (1) DNA content, (2) Collagen content by hydroxyproline, and (3) uronic acid content and estimation of ground substance. The results indicated there was a non-significant increase (10%) in the DNA concentration of skin from flight animals. However, the data expressed as a ratio DNA/Collagen estimates the cell or nuclear density that supports a given quantity of collagen showed a dramatic increase in the flight group (33%). This means flight conditions may have slowed down collagen secretion and/or increased cell proliferation in adult rat skin. Further biochemical tests are being done to determine the crosslinking of elastin which will enhance the insight to assessing changes in skin turnover.

  7. Increased expression of enhancer of Zeste Homolog 2 (EZH2) differentiates squamous cell carcinoma from normal skin and actinic keratosis.

    Science.gov (United States)

    Xie, Qiang; Wang, Hongbei; Heilman, Edward R; Walsh, Michael G; Haseeb, M A; Gupta, Raavi

    2014-01-01

    Enhancer of Zeste Homolog 2 (EZH2) is a polycomb group protein that has been shown to be involved in the progression of multiple human cancers including melanoma. The expression of EZH2 in normal skin and in pre-malignant and malignant cutaneous squamous cell carcinoma (SCC) has not been studied. We examined the expression of EZH2 in normal skin, actinic keratosis (AK), SCC in situ, well-differentiated (SCC-WD), moderately-differentiated (SCC-MD) and poorly-differentiated SCC (SCC-PD) to ascertain whether EZH2 expression differentiates these conditions. Immunohistochemical staining for EZH2 was performed on formalin-fixed paraffin-embedded biopsies and a tissue microarray containing normal skin, AK, SCC in situ, and SCC of different grades. In comparison to the normal skin, EZH2 expression in actinic keratosis was increased (p=0.03). Similarly, EZH2 expression in all of the neoplastic conditions studied (SCC in situ, SCC-WD, SCC-MD and SCC-PD) was greatly increased in comparison to both the normal skin and actinic keratosis (p≤0.001). EZH2 expression increases incrementally from normal skin to AK and further to SCC, suggesting a role for EZH2 in the progression and differentiation of SCC. EZH2 expression may be used as a diagnostic marker for differentiating SCC from AK or normal skin.

  8. Effects of turning on skin-bed interface pressures in healthy adults.

    Science.gov (United States)

    Peterson, Matthew J; Schwab, Wilhelm; van Oostrom, Johannes H; Gravenstein, Nikolaus; Caruso, Lawrence J

    2010-07-01

    This paper is a report of a study of the effects of lateral turning on skin-bed interface pressures in the sacral, trochanteric and buttock regions, and its effectiveness in unloading at-risk tissue. Minimizing skin-support surface interface pressure is important in pressure ulcer prevention, but the effect of standard patient repositioning on skin interface pressure has not been objectively established. Data were collected from 15 healthy adults from a university-affiliated hospital. Mapped 24-inch x 24-inch (2304 half-inch sensors) interface pressure profiles were obtained in the supine position, followed by lateral turning with pillow or wedge support and subsequent head-of-bed elevation to 30 degrees . Raising the head-of-bed to 30 degrees in the lateral position statistically significantly increased peak interface pressures and total area > or = 32 mmHg. Comparing areas > or = 32 mmHg from all positions, 93% of participants had skin areas with interface pressures > or = 32 mmHg throughout all positions (60 +/- 54 cm(2)), termed 'triple jeopardy areas'. The triple jeopardy area increased statistically significantly with wedges as compared to pillows (153 +/- 99 cm(2) vs. 48 +/- 47 cm(2), P turning by experienced intensive care unit nurses does not reliably unload all areas of high skin-bed interface pressures. These areas remain at risk for skin breakdown, and help to explain why pressure ulcers occur despite the implementation of standard preventive measures. Support materials for maintaining lateral turned positions can also influence tissue unloading and triple jeopardy areas.

  9. Normal Patterns of Deja Experience in a Healthy, Blind Male: Challenging Optical Pathway Delay Theory

    Science.gov (United States)

    O'Connor, Akira R.; Moulin, Christopher J. A.

    2006-01-01

    We report the case of a 25-year-old healthy, blind male, MT, who experiences normal patterns of deja vu. The optical pathway delay theory of deja vu formation assumes that neuronal input from the optical pathways is necessary for the formation of the experience. Surprisingly, although the sensation of deja vu is known to be experienced by blind…

  10. Efficacy and safety of topical depigmenting agent in healthy human fair skin female volunteers: A single-arm study.

    Science.gov (United States)

    Shah, Saurabh; Chew, Soon-Keong

    2017-11-28

    Skin hyperpigmentation is the darkening of skin due to the increased production of melanin in the body. To evaluate the efficacy and safety of a botanical-based Rosa E pigmentation serum in healthy fair skin female volunteers with wrinkles, skin tone, and pigmentation. This was a single-arm, open label study conducted in healthy Indian females; 18 subjects aged 30-55, having fair Caucasian-like skin with at least 2 dark skin pigments with facial wrinkles diagnosed by dermatologist were selected. Rosa E pigmentation serum was applied twice a day for 84 days. Effect was evaluated by (i) instrumental technique (spectrophotometer ® 2600D), (ii) clinically by dermatologist regarding product efficacy (skin tone, antiwrinkle, pigmentation), and (iii) volunteers self-evaluation. The L* value of spectrophotometer reading represents lightness in the skin pigment. Reduction in the pigment was reported from day 14, with significant reductions observed till day 84 compared with baseline. Significant (P < .0001) skin pigmentation lightening was seen on day 14 (1.11) vastly improving on day 84 (1.94) based on photographic assessments. The significant reduction in skin pigment was 76.85%, Felix von Luschan skin color score was 30.24% (P < .0001) with a 7.38-fold reduction in skin tone and 57% reduction in facial wrinkles at day 84 from baseline. Rosa E pigmentation serum was found safe and effective in significant reduction in skin pigments, improvement of skin tone, and antiwrinkle properties instrumentally, clinically, and self-evaluation by volunteers. In these evaluations, best results were seen the longer the Rosa E was used. © 2017 Wiley Periodicals, Inc.

  11. Polarimetry based partial least square classification of ex vivo healthy and basal cell carcinoma human skin tissues.

    Science.gov (United States)

    Ahmad, Iftikhar; Ahmad, Manzoor; Khan, Karim; Ikram, Masroor

    2016-06-01

    Optical polarimetry was employed for assessment of ex vivo healthy and basal cell carcinoma (BCC) tissue samples from human skin. Polarimetric analyses revealed that depolarization and retardance for healthy tissue group were significantly higher (ppolarimetry together with PLS statistics hold promise for automated pathology classification. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Tolerance of natural baby skin-care products on healthy, full-term infants and toddlers.

    Science.gov (United States)

    Coret, Catherine D; Suero, Michael B; Tierney, Neena K

    2014-01-01

    To evaluate the tolerance of baby skin-care products with at least 95% naturally derived ingredients on infants and toddlers. Healthy, full-term infants and toddlers aged 1-36 months were enrolled. In study 1, a lightly fragranced natural baby hair and body wash (n=30), a lightly fragranced natural baby shampoo (n=30), or a lightly fragranced natural baby lotion (n=32) were assessed over 2 weeks. In study 2, a lightly fragranced natural baby hair and body wash and a lightly fragranced natural baby lotion (n=33) were assessed as a regimen over 4 weeks. The wash and shampoo were used three or more times per week, but not more than once daily. Lotions were applied in the morning or after a bath. Clinicians assessed the arms, legs, torso, or scalp for erythema, dryness, peeling/flakiness (study 1 only), tactile roughness, edema (study 1 only), rash/irritation (study 2 only), and overall skin condition (study 2 only) at baseline, week 1, and weeks 2 or 4. Parents completed skin assessment questionnaires. In study 2, stratum corneum hydration was measured. Subjects were monitored for adverse events. No significant changes in clinical grading scores were observed, indicating that all products were well tolerated. By the end of each study, >90% of parents/caregivers believed each product was mild and gentle. In study 2, improvement in stratum corneum hydration was observed (+37% at week 1 and +48% at week 4, Pproduct-related adverse events. The natural baby skin-care products were well tolerated by infants and toddlers when used alone or as part of a skin-care regimen.

  13. Normalizing Electrocardiograms of Both Healthy Persons and Cardiovascular Disease Patients for Biometric Authentication

    Science.gov (United States)

    Zhao, Miaomiao; Li, Fan; Wang, Guoqing; Zhou, Fengfeng

    2013-01-01

    Although electrocardiogram (ECG) fluctuates over time and physical activity, some of its intrinsic measurements serve well as biometric features. Considering its constant availability and difficulty in being faked, the ECG signal is becoming a promising factor for biometric authentication. The majority of the currently available algorithms only work well on healthy participants. A novel normalization and interpolation algorithm is proposed to convert an ECG signal into multiple template cycles, which are comparable between any two ECGs, no matter the sampling rates or health status. The overall accuracies reach 100% and 90.11% for healthy participants and cardiovascular disease (CVD) patients, respectively. PMID:23977063

  14. CT Densitometry of the Lung in Healthy Nonsmokers with Normal Pulmonary Function

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Tack Sun; Chae, Eun Jin; Seo, Joon Beom; Jung, Young Ju; Oh, Yeon Mok; Lee, Sang Do [University of Ulsan College of Medicine, Asan Medical Center, Seoul (Korea, Republic of)

    2012-09-15

    To investigate the upper normal limit of low attenuation area in healthy nonsmokers. A total of 36 nonsmokers with normal pulmonary function test underwent a CT scan. Six thresholds (-980 --930 HU) on inspiration CT and two thresholds (-950 and -910 HU) on expiration CT were used for obtaining low attenuation area. The mean lung density was obtained on both inspiration CT and expiration CT. Descriptive statistics of low attenuation area and the mean lung density, evaluation of difference of low attenuation area and the mean lung density in both sex and age groups, analysis of the relationship between demographic information and CT parameters were performed. Upper normal limit for low attenuation area was 12.96% on inspiration CT (-950 HU) and 9.48% on expiration CT (-910 HU). Upper normal limit for the mean lung density was -837.58 HU on inspiration CT and 686.82 HU on expiration CT. Low attenuation area and the mean lung density showed no significant differences in both sex and age groups. Body mass index (BMI) was negatively correlated with low attenuation area on inspiration CT (-950 HU, r = -0.398, p = 0.016) and positively correlated with the mean lung density on inspiration CT (r 0.539, p = 0.001) and expiration CT (r = 0.432, p = 0.009). Age and body surface area were not correlated with low attenuation area or the mean lung density. Low attenuation area on CT densitometry of the lung could be found in healthy nonsmokers with normal pulmonary function, and showed negative association with BMI. Reference values, such as range and upper normal limit for low attenuation area in healthy subjects could be helpful in quantitative analysis and follow up of early emphysema, using CT densitometry of the lung.

  15. Survival of human diploid skin fibroblasts from normal individuals after X-irradiation

    International Nuclear Information System (INIS)

    Little, J.B.; Nove, J.; Strong, L.C.; Nichols, W.W.

    1988-01-01

    The cytotoxic effect of X-rays was measured by a colony formation assay in multiple experiments with fibroblast cell strains derived from 24 presumably normal individuals, received as 65 different coded and blinded samples. Each strain was received on two or more occasions at different times and bearing different codes. The means and standard deviations of the survival curve parameters for the 24 strains were: D 0 = 123 +- 23; D 10 = 273 +- 42 cGy. The D 0 ranged from 89 to 175 and the D 10 from 196 to 372 cGy. The degree of interexperimental variation, though generally minimal, differed considerably among cell strains. There was no systematic effect of passage level, cloning efficiency, serum lot, age or sex of the donor on X-ray survival. These results confirm that the intrinsic radiosensitivity varies significantly among skin fibroblasts isolated from clinically normal individuals, apparently owing to as yet unidentified genetic factors. (Author)

  16. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  17. Action spectra for inactivation of normal and xeroderma pigmentosum human skin fibroblasts by ultraviolet radiations

    International Nuclear Information System (INIS)

    Keyse, S.M.; Moss, S.H.; Davies, D.J.G.

    1983-01-01

    Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)

  18. Contrast-enhanced MRI findings of the knee in healthy children; establishing normal values

    Energy Technology Data Exchange (ETDEWEB)

    Hemke, Robert; Maas, Mario [University of Amsterdam, Department of Radiology and Nuclear Medicine, Academic Medical Center, Amsterdam (Netherlands); Berg, J.M. van den; Schonenberg-Meinema, Dieneke; Kuijpers, Taco W. [University of Amsterdam, Department of Pediatric Hematology, Immunology, Rheumatology and Infectious Diseases, Emma Children' s Hospital AMC, Amsterdam (Netherlands); Nusman, Charlotte M. [University of Amsterdam, Department of Pediatric Hematology, Immunology, Rheumatology and Infectious Diseases, Emma Children' s Hospital AMC, Amsterdam (Netherlands); Onze Lieve Vrouwe Gasthuis (OLVG), Department of Pediatrics, Amsterdam (Netherlands); Gulik, E.C. van; Barendregt, Anouk M. [University of Amsterdam, Department of Radiology and Nuclear Medicine, Academic Medical Center, Amsterdam (Netherlands); University of Amsterdam, Department of Pediatric Hematology, Immunology, Rheumatology and Infectious Diseases, Emma Children' s Hospital AMC, Amsterdam (Netherlands); Dolman, Koert M. [Onze Lieve Vrouwe Gasthuis (OLVG), Department of Pediatrics, Amsterdam (Netherlands); Reade, Department of Pediatric Rheumatology, Amsterdam (Netherlands)

    2018-03-15

    To define normative standards for the knee in healthy children using contrast-enhanced MRI, focusing on normal synovial membrane thickness. Secondly, presence of joint fluid and bone marrow oedema was evaluated. For this study, children without disorders potentially resulting in (accompanying) arthritis were included. Patients underwent clinical assessments, followed by contrast-enhanced MRI. MRI features were evaluated in consensus using the Juvenile Arthritis MRI Scoring (JAMRIS) system. Additionally, the presence of joint fluid was evaluated. No cartilage lesions or bone abnormalities were observed. We included 57 healthy children. The overall mean thickness of the normal synovial membrane was 0.4 mm (min-max; 0.0-1.8mm). The synovium was thickest around the cruciate ligaments and retropatellar and suprapatellar regions. The mean overall diameter of the largest pocket of joint fluid was 2.8 mm (min-max; 0.9-8.0mm). Bone marrow changes were observed in three children (all in the apex patellae). The normal synovial membrane was maximally 1.8 mm thick, indicating that the JAMRIS cut-off value of 2 mm can be considered a valid measure for evaluating synovial hypertrophy. Some joint fluid and bone marrow changes suggestive of bone marrow oedema in the apex patellae can be seen in healthy children. (orig.)

  19. Contrast-enhanced MRI findings of the knee in healthy children; establishing normal values

    International Nuclear Information System (INIS)

    Hemke, Robert; Maas, Mario; Berg, J.M. van den; Schonenberg-Meinema, Dieneke; Kuijpers, Taco W.; Nusman, Charlotte M.; Gulik, E.C. van; Barendregt, Anouk M.; Dolman, Koert M.

    2018-01-01

    To define normative standards for the knee in healthy children using contrast-enhanced MRI, focusing on normal synovial membrane thickness. Secondly, presence of joint fluid and bone marrow oedema was evaluated. For this study, children without disorders potentially resulting in (accompanying) arthritis were included. Patients underwent clinical assessments, followed by contrast-enhanced MRI. MRI features were evaluated in consensus using the Juvenile Arthritis MRI Scoring (JAMRIS) system. Additionally, the presence of joint fluid was evaluated. No cartilage lesions or bone abnormalities were observed. We included 57 healthy children. The overall mean thickness of the normal synovial membrane was 0.4 mm (min-max; 0.0-1.8mm). The synovium was thickest around the cruciate ligaments and retropatellar and suprapatellar regions. The mean overall diameter of the largest pocket of joint fluid was 2.8 mm (min-max; 0.9-8.0mm). Bone marrow changes were observed in three children (all in the apex patellae). The normal synovial membrane was maximally 1.8 mm thick, indicating that the JAMRIS cut-off value of 2 mm can be considered a valid measure for evaluating synovial hypertrophy. Some joint fluid and bone marrow changes suggestive of bone marrow oedema in the apex patellae can be seen in healthy children. (orig.)

  20. Transdermal glyceryl trinitrate (nitroglycerin in healthy persons: acute effects on skin temperature and hemodynamic orthostatic response

    Directory of Open Access Journals (Sweden)

    Eva Maria Augusta Boeckh Haebisch

    Full Text Available In order to find an explanation for individual reactions to transdermal glyceryl trinitrate (GTN we studied the skin temperature and hemodynamic reactions in 63 healthy persons. The data were obtained before and after the application of GTN and Glycerin (GL placebo patches, during one hour. The skin temperature was measured on both forearms, the local (left sided and systemic (right sided reaction on GTN was related to the skin fold and the calculated body fat content. The bilateral rise of skin temperature and its duration was higher and longer in obese than in lean persons mainly in obese women. The UV induced thermo and the later photothermoreaction (Erythema was reduced on the left forearm after the application of GTN and GL patches. The observed hemodynamic GTN effect confirmed known postural reactions, such as decreased arterial pressure (ΔmAP = -2.9%, increased heart rate (ΔHR = +7,4% and QTc prolongation (ΔQTc = +4,9% in upright position. An adverse drug effect with increased mean blood pressure (ΔmAP = +12% and increased heart rate (ΔHR = + 10.4% mainly in supine position was observed in 11 % of the participants, but only in men. Such a reaction was already described by Murell, 1879. Individual GTN effects were analyzed and related to habits and family history. In male smokers and in persons with hypertensive and diabetic close relatives, the hypotensive GTN effect was accentuated in supine position. In the upright position the group with hypertensives in the family presented a moderate hypotensive reaction without secondary tachycardia and the smokers presented only a slightly increased heart rate. Our observations suggest that individual reactions to transdermal glyceryl trinitrate (GTN with its active component nitric oxide (NO depends on physiological conditions, related to endogenous vasoactive substances, mainly the interaction with EDRF (the endogenous NO and the activity of the Renin-Angiotensin System.

  1. Are Prescription Stimulants "Smart Pills"? The Epidemiology and Cognitive Neuroscience of Prescription Stimulant Use by Normal Healthy Individuals

    Science.gov (United States)

    Smith, M. Elizabeth; Farah, Martha J.

    2011-01-01

    Use of prescription stimulants by normal healthy individuals to enhance cognition is said to be on the rise. Who is using these medications for cognitive enhancement, and how prevalent is this practice? Do prescription stimulants in fact enhance cognition for normal healthy people? We review the epidemiological and cognitive neuroscience…

  2. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, W.A.; Wike, J.; Tucker, S.L.

    1995-01-01

    To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

  3. Early skin-to-skin contact between healthy late preterm infants and their parents: an observational cohort study.

    Science.gov (United States)

    Nyqvist, Kerstin H; Rosenblad, Andreas; Volgsten, Helena; Funkquist, Eva-Lotta; Mattsson, Elisabet

    2017-01-01

    Skin-to-skin contact (SSC) is an important factor to consider in the care of late preterm infants (born between 34 0/7 and 36 6/7 completed weeks of gestation). The literature suggests that SSC between preterm infants and their mothers facilitates breastfeeding. However, more studies are needed to explore potential dose-response effects between SSC and breastfeeding as well as studies that explicitly investigate SSC by fathers among late preterm infants. The aim was to investigate the duration of healthy late preterm infants' SSC with the mother and father, respectively, during the first 48 h after birth and the associations with breastfeeding (exclusive/partial at discharged), clinical and demographic variables. This was an observational cohort study in which parents to healthy late preterm infants, born between 34 5/7 and 36 6/7 completed weeks of gestation, recorded duration of SSC provided by mother and father, respectively. Demographic and clinical variables were retrieved from the medical records and were used as predictors. Multiple linear regression analysis was used to assess the association between the predictors and the outcome, SSC (hours), separately for mothers and fathers. The mean (standard deviation [SD]) time per day spent with SSC with mothers ( n  = 64) and fathers ( n  = 64), was 14.7 (5.6) and 4.4 (3.3) hours during the first day (24 h) after birth and 9.2 (7.1) and 3.1 (3.3) hours during the second day (24 h), respectively. Regarding SSC with mothers, no variable was significantly associated with SSC during the first day, while the mean (95% confidence interval [CI]) time of SSC during the second day was 6.9 (1.4-12.4) hours shorter for each additional kg of birthweight ( p  = 0.014). Concerning SSC with fathers, the mean (95% CI) time of SSC during the first day was 2.1 (0.4-3.7) hours longer for infants born at night ( p  = 0.015), 1.7 (0.1-3.2) hours longer for boys ( p  = 0.033), 3.2 (1.2-5.2) hours longer for infants born by

  4. Early skin-to-skin contact between healthy late preterm infants and their parents: an observational cohort study

    Directory of Open Access Journals (Sweden)

    Kerstin H. Nyqvist

    2017-10-01

    Full Text Available Background Skin-to-skin contact (SSC is an important factor to consider in the care of late preterm infants (born between 34 0/7 and 36 6/7 completed weeks of gestation. The literature suggests that SSC between preterm infants and their mothers facilitates breastfeeding. However, more studies are needed to explore potential dose-response effects between SSC and breastfeeding as well as studies that explicitly investigate SSC by fathers among late preterm infants. The aim was to investigate the duration of healthy late preterm infants’ SSC with the mother and father, respectively, during the first 48 h after birth and the associations with breastfeeding (exclusive/partial at discharged, clinical and demographic variables. Methods This was an observational cohort study in which parents to healthy late preterm infants, born between 34 5/7 and 36 6/7 completed weeks of gestation, recorded duration of SSC provided by mother and father, respectively. Demographic and clinical variables were retrieved from the medical records and were used as predictors. Multiple linear regression analysis was used to assess the association between the predictors and the outcome, SSC (hours, separately for mothers and fathers. Results The mean (standard deviation [SD] time per day spent with SSC with mothers (n = 64 and fathers (n = 64, was 14.7 (5.6 and 4.4 (3.3 hours during the first day (24 h after birth and 9.2 (7.1 and 3.1 (3.3 hours during the second day (24 h, respectively. Regarding SSC with mothers, no variable was significantly associated with SSC during the first day, while the mean (95% confidence interval [CI] time of SSC during the second day was 6.9 (1.4–12.4 hours shorter for each additional kg of birthweight (p = 0.014. Concerning SSC with fathers, the mean (95% CI time of SSC during the first day was 2.1 (0.4–3.7 hours longer for infants born at night (p = 0.015, 1.7 (0.1–3.2 hours longer for boys (p = 0.033, 3.2 (1.2–5.2 hours

  5. Tolerance of natural baby skin-care products on healthy, full-term infants and toddlers

    Directory of Open Access Journals (Sweden)

    Coret CD

    2014-02-01

    Full Text Available Catherine D Coret, Michael B Suero, Neena K Tierney Johnson & Johnson Consumer Companies, Inc, Skillman, NJ, USA Purpose: To evaluate the tolerance of baby skin-care products with at least 95% naturally derived ingredients on infants and toddlers. Materials and methods: Healthy, full-term infants and toddlers aged 1–36 months were enrolled. In study 1, a lightly fragranced natural baby hair and body wash (n=30, a lightly fragranced natural baby shampoo (n=30, or a lightly fragranced natural baby lotion (n=32 were assessed over 2 weeks. In study 2, a lightly fragranced natural baby hair and body wash and a lightly fragranced natural baby lotion (n=33 were assessed as a regimen over 4 weeks. The wash and shampoo were used three or more times per week, but not more than once daily. Lotions were applied in the morning or after a bath. Clinicians assessed the arms, legs, torso, or scalp for erythema, dryness, peeling/flakiness (study 1 only, tactile roughness, edema (study 1 only, rash/irritation (study 2 only, and overall skin condition (study 2 only at baseline, week 1, and weeks 2 or 4. Parents completed skin assessment questionnaires. In study 2, stratum corneum hydration was measured. Subjects were monitored for adverse events. Results: No significant changes in clinical grading scores were observed, indicating that all products were well tolerated. By the end of each study, >90% of parents/caregivers believed each product was mild and gentle. In study 2, improvement in stratum corneum hydration was observed (+37% at week 1 and +48% at week 4, P<0.05 for both. In study 1, one baby experienced mild erythema on the neck and scalp after using the shampoo (possibly related to treatment. In study 2, there were no product-related adverse events. Conclusion: The natural baby skin-care products were well tolerated by infants and toddlers when used alone or as part of a skin-care regimen. Keywords: bath, cleanser, natural, infant, lotion, shampoo

  6. Erosion or normal variant? 4-year MRI follow-up of the wrists in healthy children

    Energy Technology Data Exchange (ETDEWEB)

    Avenarius, Derk F.M. [University of Tromsoe, Faculty of Health Sciences, Tromsoe (Norway); University Hospital of North Norway, Department of Radiology, Tromsoe (Norway); Ording Mueller, Lil-Sofie [Oslo University Hospital, Department for Radiology and Intervention, Oslo (Norway); Rosendahl, Karen [Haukeland University Hospital, Department of Radiology, Bergen (Norway); University of Bergen, Department of Clinical Medicine K1, Bergen (Norway)

    2016-03-15

    A large proportion of healthy children have wrist changes on MRI, namely carpal depressions, findings that have been described as pathological in children with juvenile idiopathic arthritis. We performed follow-up imaging in a cohort of healthy children to evaluate carpal surface depressions over time, focusing on the presence of overlying cartilage as a potential discriminator between normal variants and true erosions. 74 of the initial cohort of 89 healthy children (83%) had a re-scan of their wrists using the same protocol, including coronal T1 and fat-saturated T2 sequences. A cartilage-selective sequence was added for this study. We registered number and location of bony depressions and presence of overlying cartilage. The total number of carpal depressions increased by age group and over time; their location was unchanged in 370 of 487 (76%) carpal sites and 91 of 117 (78%) metacarpal sites. In total, 426 of the 1,087 (39.2%) bony depressions were covered by cartilage, with a decreasing percentage by age (P = 0.001). Normal appearances during growth, such as bony depressions, should not be mistaken for pathology. There must be additional findings to support a diagnosis of disease. A cartilage sequence may add to the diagnostic image analysis. (orig.)

  7. Expression and activity of arginase isoenzymes during normal and diabetes-impaired skin repair.

    Science.gov (United States)

    Kämpfer, Heiko; Pfeilschifter, Josef; Frank, Stefan

    2003-12-01

    Within the past years, an important role for nitric oxide (NO) in skin repair has been well defined. As NO is synthesized from L-arginine by NO synthases (NOS), the availability of L-arginine might be one rate-limiting factor of NO production at the wound site. Upon injury, arginase-1 and -2 mRNA, protein, and activity were strongly induced reaching a maximum between day 3 and day 7 postwounding. Immunohistochemistry colocalized both arginases and the inducible NOS (iNOS) at epithelial sites at the margins of the wound. Notably, diabetes-impaired skin repair in leptin-deficient mice (diabetes/diabetes, db/db; and obese/obese, ob/ob) was characterized by an abnormally elevated arginase activity in wound tissue in the absence of an expression of iNOS. Expression analyses demonstrated that arginase-1 contributed to increased arginase activities in impaired repair. Interestingly, an improved healing of chronic wound situations in leptin-supplemented ob/ob mice was strongly associated with an adjustment of the dysregulated expression of L-arginine-converting enzymes: an attenuated iNOS expression was upregulated early in repair and an augmented arginase-1 expression and activity was downregulated in the presence of markedly elevated numbers of macrophages during late repair. These data suggest a coordinated consumption of L-arginine by the NOS and arginase enzymatic pathways at the wound site as a prerequisite for a balanced NO (via iNOS) and polyamine (via arginases) synthesis that drives a normal skin repair.

  8. Influence of low-energy laser radiation on normal skin and certain tumor tissues

    Energy Technology Data Exchange (ETDEWEB)

    Pletnev, S.D.; Karpenko, O.M.

    For some years, the authors' Institute has studied the influence of various types of low-energy laser radiation on normal tissue and the growth of tumors. Radiation at 3 and 30 J/cm/sup 2/ causes an increase in biological activity of various cell elements, manifested as an increase in mitotic activity of the cells in the basal layer of the epidermis, conglomeration of chromatin in the cell nuclei and an increase in degranulation of fat cells in the process of their migration to the reticular layer. Also noted was an increase in content of fibroblastic and lymphohistocytic elements in the dermis, as well as an increase in collagenization of connective tissue. It was found that irradiation of the skin by helium-neon, cadmium-helium and nitrogen lasers before and after grafting of the cells of various tumors modifies the course of the tumor process. This effect is apparently related to the fact that systematic irradiation results in changes creating a favorable background for survival and proliferation of tumor cells in the skin tissue medium. The changes facilitate an increase in survival and growth of both pigmented and nonpigmented tumors. Low power radiation stimulates the activity of the cells or cell structures; medium power stimulates their activity; high power suppresses activity.

  9. Histopathology of normal skin and melanomas after nanosecond pulsed electric field treatment

    Science.gov (United States)

    Chen, Xinhua; Swanson, R. James; Kolb, Juergen F.; Nuccitelli, Richard; Schoenbach, Karl H.

    2011-01-01

    Nanosecond pulsed electric fields (nsPEFs) can affect the intracellular structures of cells in vitro. This study shows the direct effects of nsPEFs on tumor growth, tumor volume, and histological characteristics of normal skin and B16-F10 melanoma in SKH-1 mice. A melanoma model was set up by injecting B16-F10 into female SKH-1 mice. After a 100-pulse treatment with an nsPEF (40-kV/cm field strength; 300-ns duration; 30-ns rise time; 2-Hz repetition rate), tumor growth and histology were studied using transillumination, light microscopy with hematoxylin and eosin stain and transmission electron microscopy. Melanin and iron within the melanoma tumor were also detected with specific stains. After nsPEF treatment, tumor development was inhibited with decreased volumes post-nsPEF treatment compared with control tumors (Pelectric fields surrounding the needle electrodes. PMID:19730404

  10. The Healthy Skin Project: changing nursing practice to prevent and treat hospital-acquired pressure ulcers.

    Science.gov (United States)

    Armour-Burton, Teri; Fields, Willa; Outlaw, Lanie; Deleon, Elvira

    2013-06-01

    Hospital-acquired pressure ulcers are serious clinical complications that can lead to increased length of stay, pain, infection, and, potentially, death. The surgical progressive care unit at Sharp Grossmont Hospital, San Diego, California, developed the multidisciplinary Healthy Skin Project to decrease the prevalence of hospital-acquired pressure ulcers. The previous treatment plan was reviewed and modified according to current evidence-based practice. The project consisted of 3 components: creation of a position for a unit-based wound liaison nurse, staff education, and involvement of the nursing assistants. The wound liaison nurse developed and conducted bimonthly skin audits, which revealed inconsistencies in clinical practice and documentation. Education for the staff was accomplished via a self-learning module, case presentations, and 1-on-1 training. In addition, a pressure ulcer algorithm tool was developed to demonstrate step-by-step wound management and documentation. From Spring 2003 through Summer 2006, the prevalence of hospital-acquired pressure ulcers ranged from 0.0% to 18.92%, with a mean of 4.85%. After implementation of the project, the prevalence decreased to 0.0% for 17 of 20 quarters, through 2011. Prevention and a multidisciplinary approach are effective in reducing the occurrence of hospital-acquired pressure ulcers.

  11. Forehead Skin Blood Flow in Normal Neonates during Active and Quiet Sleep, Measured with a Diode Laser Doppler Instrument

    NARCIS (Netherlands)

    Suichies, H.E.; Aarnoudse, J.G.; Okken, A.; Jentink, H.W.; de Mul, F.F.M.; Greve, Jan

    1988-01-01

    Changes in forehead skin blood flow during active and quiet sleep were determined in 16 healthy neonates using a recently developed semi-conductor laser Doppler flow meter without light conducting fibres. Measurements were carried out at a postnatal age varying from 5 hours to 7 days. The two sleep

  12. Spectrophotometer is useful for assessing vitiligo and chemical leukoderma severity by quantifying color difference with surrounding normally pigmented skin.

    Science.gov (United States)

    Hayashi, M; Okamura, K; Araki, Y; Suzuki, M; Tanaka, T; Abe, Y; Nakano, S; Yoshizawa, J; Hozumi, Y; Inoie, M; Suzuki, T

    2018-05-01

    Acquired skin hypopigmentation has many etiologies, including autoimmune melanocyte destruction, skin aging, inflammation, and chemical exposure. Distinguishing lesions from normally pigmented skin is clinically important to precisely assess disease severity. However, no gold standard assessment method has been reported. We aimed to investigate whether spectrophotometers are useful for assessing vitiligo and rhododendrol (4-(4-hydroxyphenol)-2-butanol) (Rhododenol ® )-induced leukoderma disease severity by quantifying skin color. Mexameter ® MX18 and CM-700d spectrophotometer were used for assessing vitiligo/leukoderma by measuring melanin index, L*a*b* color space, and ΔE*ab value, which represents the color difference between two subjects and is calculated by the values of L*a*b*. MX18 and CM-700d can quantitatively distinguish vitiligo/leukoderma from normally pigmented skin based on melanin index. CM-700d consistently quantified the color of vitiligo/leukoderma lesions and surrounding normally pigmented skin in L*a*b* color spaces and ΔE*ab. ΔE*ab is well correlated with melanin index and clinical appearance. ΔE*ab has been frequently used in aesthetic dentistry; however, current study is the first to use it in the measurement of skin color. ΔE*ab seems to be a useful parameter to evaluate the color contrast between vitiligo/leukoderma and surrounding normally pigmented skin and can be used to evaluate disease severity and patient's quality of life. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Characterization of skin friction coefficient, and relationship to stratum corneum hydration in a normal Chinese population.

    Science.gov (United States)

    Zhu, Y H; Song, S P; Luo, W; Elias, P M; Man, M Q

    2011-01-01

    Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. A total of 633 subjects (300 males and 333 females) aged 0.15-79 years were enrolled. A Frictiometer FR 770 and Corneometer CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p skin friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p skin friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. Copyright © 2010 S. Karger AG, Basel.

  14. Proprietary tomato extract improves metabolic response to high-fat meal in healthy normal weight subjects

    Directory of Open Access Journals (Sweden)

    Xavier Deplanque

    2016-10-01

    Full Text Available Background: Low-density lipoprotein (LDL oxidation is a risk factor for atherosclerosis. Lycopene and tomato-based products have been described as potent inhibitors of LDL oxidation. Objectives: To evaluate the effect of a 2-week supplementation with a carotenoid-rich tomato extract (CRTE standardized for a 1:1 ratio of lycopene and phytosterols, on post-prandial LDL oxidation after a high-fat meal. Design: In a randomized, double-blind, parallel-groups, placebo-controlled study, 146 healthy normal weight individuals were randomly assigned to a daily dose of CRTE standardized for tomato phytonutrients or placebo during 2 weeks. Oxidized LDL (OxLDL, glucose, insulin, and triglyceride (TG responses were measured for 8 h after ingestion of a high-fat meal before and at the end of intervention. Results: Plasma lycopene, phytofluene, and phytoene were increased throughout the study period in the CRTE group compared to placebo. CRTE ingestion significantly improved changes in OxLDL response to high-fat meal compared to placebo after 2 weeks (p<0.0001. Changes observed in glucose, insulin, and TG responses were not statistically significant after 2 weeks of supplementation, although together they may suggest a trend of favorable effect on metabolic outcomes after a high-fat meal. Conclusions: Two-week supplementation with CRTE increased carotenoids levels in plasma and improved oxidized LDL response to a high-fat meal in healthy normal weight individuals.

  15. Skin reactions to human papillomavirus (HPV) 16 specific antigens intradermally injected in healthy subjects and patients with cervical neoplasia

    NARCIS (Netherlands)

    van den Hende, Muriel; van Poelgeest, Mariëtte I. E.; van der Hulst, Jeanette M.; de Jong, Joan; Drijfhout, Jan W.; Fleuren, Gert Jan; Valentijn, A. Rob P. M.; Wafelman, Amon R.; Slappendel, Gijs M.; Melief, Cornelis J. M.; Offringa, Rienk; van der Burg, Sjoerd H.; Kenter, Gemma G.

    2008-01-01

    We have tested the safety and feasibility of a synthetic long peptide-based HPV16-specific skin test to detect cellular immune responses to HPV16 E2, E6 and E7 in vivo. Women with cervical neoplasia (n = 11) and healthy individuals (n = 19) were intradermally challenged with 8 different pools of

  16. Skin Autofluorescence Examination as a Diagnostic Tool for Mild Cognitive Impairment in Healthy People.

    Science.gov (United States)

    Igase, Michiya; Ohara, Maya; Igase, Keiji; Kato, Takeaki; Okada, Yoko; Ochi, Masayuki; Tabara, Yasuharu; Kohara, Katsuhiko; Ohyagi, Yasumasa

    2017-01-01

    Accumulation of advanced glycation endproducts (AGEs) is thought to be involved in the pathogenesis of dementia, especially Alzheimer's disease. Tissue AGE accumulation can be estimated using the relative simple noninvasive measurement of skin autofluorescence (SAF), a method based on the fluorescent properties of some AGEs. However, possible involvement of tissue AGE accumulation in mild cognitive impairment (MCI) has not been fully investigated. We investigated whether tissue AGE accumulation estimated by SAF is associated with mild cognitive impairment. We analyzed 226 community-dwelling subjects. In addition to several atherosclerosis-related clinical parameters, MCI screening test, assessment of brain atrophy, and SAF were performed on people aged > 40 years. MCI was assessed using the Japanese version of the MCI screening method. Atrophy of the brain was assessed by examining the temporal horn area (THA) by brain MRI. SAF was significantly higher in participants with MCI than in those with normal cognitive function (2.56±0.55 versus 2.10±0.41; p  2.27 was significantly related to the presence of MCI (odds, 6.402; 95% CI, 1.590-25.773, p = 0.009). We found an association between SAF and MCI, which was independent of brain atrophy, in healthy subjects.

  17. Genetic deletion of amphiregulin restores the normal skin phenotype in a mouse model of the human skin disease tylosis

    Directory of Open Access Journals (Sweden)

    Vishnu Hosur

    2017-08-01

    Full Text Available In humans, gain-of-function (GOF mutations in RHBDF2 cause the skin disease tylosis. We generated a mouse model of human tylosis and show that GOF mutations in RHBDF2 cause tylosis by enhancing the amount of amphiregulin (AREG secretion. Furthermore, we show that genetic disruption of AREG ameliorates skin pathology in mice carrying the human tylosis disease mutation. Collectively, our data suggest that RHBDF2 plays a critical role in regulating EGFR signaling and its downstream events, including development of tylosis, by facilitating enhanced secretion of AREG. Thus, targeting AREG could have therapeutic benefit in the treatment of tylosis.

  18. [Colorimetric investigation of normal tongue and lip colors from 516 healthy adults by visible reflection spectrum].

    Science.gov (United States)

    Zeng, Chang-chun; Yang, Li; Xu, Ying; Liu, Pei-pei; Guo, Shi-jun; Liu, Song-hao

    2011-09-01

    Using the data from normal tongue and lip colors of normal people which were collected by the visible reflection spectrum, we analyzed the colorimetric parameters of tongue and lip colors. In this study, 516 healthy students aging from 19 to 26 from the colleges and universities of Guangdong Province of China were taken as research subjects. After collecting the data of tongue and lip colors of the 516 subjects using visible reflectance spectroscopy, CIE XYZ tristimulus values as defined by the International Commission on Illumination in 1964 were calculated, and the colorimetric parameters of the normal tongue and lip colors were obtained, such as the CIE 1964 chromaticity coordinate, brightness, dominant wavelength and excitation purity. The results of CIE 1964 chromaticity diagram calculated on the visible reflection spectrum showed that the normal tongue color chromaticity coordinate x(10) was 0.341 3±0.008 5 and y(10) was 0.332 6±0.005 1, and the normal lip color chromaticity coordinate x(10) was 0.357 7±0.009 2 and y(10) was 0.338 3±0.005 7; the brightness Y values of the normal tongue color and lip colors were 17.96±3.78 and 19.78±3.72, the dominant wavelength values of the normal tongue color and lip color were (626.3±51.6) nm and (600.4±18.2) nm, and the excitation purity values of the normal tongue color and lip color were 0.083±0.031 and 0.144±0.036, respectively. Application of the visible reflection spectrum is a standard way to collect colorimetric data for inspection of the complexion. The investigation of chromaticity coordinates, brightness, dominant wavelength and excitation purity of the normal tongue and lip colors may offer the basic reference for diagnosing morbid complexion on the tongue and lip colors in traditional Chinese medicine.

  19. Normative Values for Electrochemical Skin Conductance Measurements for Quantitative Assessment of Sudomotor Function in Healthy Indian Adults.

    Science.gov (United States)

    Shivaprasad, C; Goel, Amit; Vilier, Alice; Calvet, Jean-Henri

    2018-01-01

    Electrochemical skin conductance (ESC) test is a widely accepted objective technique for quantitatively assessing sudomotor dysfunction, which is one of the earliest-detected neurophysiologic abnormalities in diabetic patients with distal symmetric polyneuropathy. This study aimed to provide normative data for ESC values among healthy Indian participants and assess the potential influence of age, sex, and body mass index (BMI) on ESC measurements. A sample of 217 healthy participants aged 18-75 years were recruited and assessed for parameters including age, gender, BMI, and ESC measurements of the hands and feet. The Shapiro-Wilk test was used to assess the normality of the data. Pearson's correlation was used to evaluate the association between age, gender, and BMI, and ESC measurements. The mean age of the participants was 43.3 ± 13.2 years, and mean BMI was 26.0 ± 4.3 kg/m 2 . Mean ESC for the hands and feet was 68.9 ± 13.1 and 71 ± 12.9 micro-Siemens, respectively, and there was a significant correlation between values from the right and left hands and feet ( r = 0.9, P < 0.0001). A significant correlation was also observed between ESC measurements of the hands and feet ( r = 0.94, P < 0.0001). ESC values of both hands and feet declined with age. A weak but significant inverse correlation between ESC and age was observed for the hands ( r = 0.02, P = 0.01) and for the feet ( r = 0.12, P < 0.0001). There was no significant difference in hand or feet ESC measurement between male and female participants. No significant correlation was observed between BMI and ESC of hands or feet. Only age was identified as a significant determinant of ESC on multivariate logistic regression analysis. Normative values for Indians are lower than that reported for Caucasians.

  20. Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

    Science.gov (United States)

    van Smeden, Jeroen; Bouwstra, Joke A

    2016-01-01

    Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

  1. Transforming growth factor-β (TGF-β) signaling in healthy human fetal skin: a descriptive study.

    Science.gov (United States)

    Walraven, M; Beelen, R H J; Ulrich, M M W

    2015-05-01

    TGF-β plays an important role in growth and development but is also involved in scarring and fibrosis. Differences for this growth factor are known between scarless fetal wound healing and adult wound healing. Nonetheless, most of the data in this area are from animal studies or in vitro studies and, thus, information about the human situation is incomplete and scarce. The aim of this study was to compare the canonical TGF-β signaling in unwounded human fetal and adult skin. Q-PCR, immunohistochemistry, Western Blot and Luminex assays were used to determine gene expression, protein levels and protein localization of components of this pathway in healthy skin. All components of the canonical TGF-β pathway were present in unwounded fetal skin. Compared to adult skin, fetal skin had differential concentrations of the TGF-β isoforms, had high levels of phosphorylated receptor-Smads, especially in the epidermis, and had low expression of several fibrosis-associated target genes. Further, the results indicated that the processes of receptor endocytosis might also differ between fetal and adult skin. This descriptive study showed that there are differences in gene expression, protein concentrations and protein localization for most components of the canonical TGF-β pathway between fetal and adult skin. The findings of this study can be a starting point for further research into the role of TGF-β signaling in scarless healing. Copyright © 2015 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  2. Distribution and ultrastructure of pigment cells in the skins of normal and albino adult turbot, Scophthalmus Maximus

    Institute of Scientific and Technical Information of China (English)

    GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui

    2007-01-01

    The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.

  3. The examination of biophysical parameters of skin (transepidermal water loss, skin hydration and pH value) in different body regions of normal cats of both sexes.

    Science.gov (United States)

    Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Lukasz R; Pomorski, Zbigniew J H

    2011-04-01

    The purpose of this study was to evaluate transepidermal water loss (TEWL), skin hydration and skin pH in normal cats. Twenty shorthaired European cats of both sexes were examined in the study. Measurements were taken from five different sites: the lumbar region, the axillary fossa, the inguinal region, the ventral abdominal region and the left thoracic region. In each of the regions, TEWL, skin hydration and skin pH were measured. The highest TEWL value was observed in the axillary fossa (18.22g/h/m(2)) and the lowest in the lumbar region (10.53g/h/m(2)). The highest skin hydration was found in the inguinal region (18.29CU) and the lowest in the lumbar region (4.62CU). The highest skin pH was observed in the inguinal region (6.64) and the lowest in the lumbar region (6.39). Statistically significant differences in TEWL were observed between the lumbar region and the left side of the thorax region (P=0.016), the axillary fossa (P=0.0004), the ventral region (P=0.005), and the inguinal region (P=0.009). There were significant differences in skin hydration between the lumbar region and the left thorax (P=0.000003), the axillary fossa (P=0.002), the ventral abdomen (P=0.03), and the inguinal region (P=0.0003) as well as between the thorax and the ventral abdomen (P=0.005). TEWL was higher in females (15g/h/m(2)) than in males (4.57g/h/m(2)). Skin hydration was higher in females (13.89CU) than in males (12.28CU). Significant differences were not found between males and females for TEWL and skin hydration. Skin pH was higher in males (6.94) than in females (6.54), which was significant (P=0.004). Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  4. Potentially lethal damage repair in cell lines of radioresistant human tumours and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Marchese, M.J.; Minarik, L.; Hall, E.J.; Zaider, M.

    1985-01-01

    Radiation cell survival data were obtained in vitro for three cell lines isolated from human tumours traditionally considered to be radioresistant-two melanomas and one osteosarcoma-as well as from a diploid skin fibroblast cell line. One melanoma cell line was much more radioresistant than the other, while the osteosarcoma and fibroblast cell lines were more radiosensitive than either. For cells growing exponentially, little potentially lethal damage repair (PLDR) could be demonstrated by comparing survival data for cells in which subculture was delayed by 6 h with those sub-cultured immediately after treatment. For the malignant cells in plateau phase, which in these cells might be better termed 'slowed growth phase', since an appreciable fraction of the cells are still cycling, a small amount of PLDR was observed, but not as much as reported by other investigators in the literature. The normal fibroblasts, which achieved a truer plateau phase in terms of noncycling cells, showed a significantly larger amount of PLDR than the tumour cells. (author)

  5. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  6. Bisphenol A, phthalate metabolites and glucose homeostasis in healthy normal-weight children

    DEFF Research Database (Denmark)

    Carlsson, Amalie; Sørensen, Kaspar; Andersson, Anna-Maria

    2018-01-01

    . RESULTS: Children in the lowest tertile of urinary BPA had significantly higher peak insulin levels during OGTT (P = 0.01), lower insulin sensitivity index (P triglyceride (P ... toward higher fat mass index (P = 0.1) compared with children in the highest tertile for uBPA. No significant differences in anthropometrics, body composition or glucose metabolism were associated with any of the phthalate metabolites measured. CONCLUSION: This pilot study on healthy normal...... and adolescents. METHOD: This was a cross-sectional study. Participants were recruited as part of the Copenhagen Puberty Study. The subjects were evaluated by an oral glucose tolerance test (OGTT), a dual-energy X-ray absorptiometry (DXA) scan, direct oxygen uptake measurement during cycle ergometry and fasting...

  7. An oral TRPV1 antagonist attenuates laser radiant-heat-evoked potentials and pain ratings from UV(B)-inflamed and normal skin.

    Science.gov (United States)

    Schaffler, Klaus; Reeh, Peter; Duan, W Rachel; Best, Andrea E; Othman, Ahmed A; Faltynek, Connie R; Locke, Charles; Nothaft, Wolfram

    2013-02-01

    Laser (radiant-heat) evoked potentials (LEPs) from vertex-EEG peak-to-peak (PtP) amplitude were used to determine acute antinociceptive/antihyperalgesic efficacy of ABT-102, a novel TRPV1 antagonist efficacious in preclinical pain models, compared with active controls and placebo in normal and UV(B)-inflamed skin. This was a randomized, placebo- and active-controlled, double-blind, intra-individual, crossover trial. Twenty-four healthy subjects received six sequences of single doses of ABT-102 (0.5, 2, 6 mg), etoricoxib 90 mg, tramadol 100 mg and placebo. Painful stimuli were induced by CO(2) -laser on normal and UV(B) -inflamed skin. LEPs and visual analogue scale (VAS-pain) ratings were taken at baseline and hourly up to 8 h post-dose from both skin types. Compared with placebo, significant mean decreases in the primary variable of LEP PtP-amplitude from UV(B)-inflamed skin were observed with ABT-102 6 mg (P < 0.001), ABT-102 2 mg (P = 0.002), tramadol 100 mg (P < 0.001), and etoricoxib 90 mg (P = 0.001) over the 8 h period; ABT-102 0.5 mg was similar to placebo. ABT-102 6 mg was superior to active controls over the 8 h period (P < 0.05) whereas ABT-102 2 mg was comparable. Improvements in VAS scores compared with placebo were observed with ABT-102 6 mg (P < 0.001) and ABT-102 2 mg (P = 0.002). ABT-102 average plasma concentrations were 1.3, 4.4 and 9.4 ng ml(-1) for the 0.5, 2 and 6 mg doses, respectively. There were no clinically significant safety findings. TRPV-1 antagonism appears promising in the management of clinical pain, but requires further investigation. © 2012 Abbott. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

  8. Bisphenol A, phthalate metabolites and glucose homeostasis in healthy normal-weight children

    Directory of Open Access Journals (Sweden)

    Amalie Carlsson

    2018-01-01

    Full Text Available Introduction: Bisphenol A and several of the most commonly used phthalates have been associated with adverse metabolic health effects such as obesity and diabetes. Therefore, we analyzed these man-made chemicals in first morning urine samples from 107 healthy normal-weight Danish children and adolescents. Method: This was a cross-sectional study. Participants were recruited as part of the Copenhagen Puberty Study. The subjects were evaluated by an oral glucose tolerance test (OGTT, a dual-energy X-ray absorptiometry (DXA scan, direct oxygen uptake measurement during cycle ergometry and fasting blood samples. First morning urine was collected and phthalate metabolites and BPA were measured by liquid chromatography-tandem mass spectrometry (LC–MS/MS with prior enzymatic deconjugation. Individual chemical concentrations were divided into tertiles and analyzed in relation to biological outcome. Results: Children in the lowest tertile of urinary BPA had significantly higher peak insulin levels during OGTT (P = 0.01, lower insulin sensitivity index (P < 0.01, higher leptin (P = 0.03, triglyceride (P < 0.01 and total cholesterol levels (P = 0.04, lower aerobic fitness (P = 0.02 and a tendency toward higher fat mass index (P = 0.1 compared with children in the highest tertile for uBPA. No significant differences in anthropometrics, body composition or glucose metabolism were associated with any of the phthalate metabolites measured. Conclusion: This pilot study on healthy normal-weight children suggests an inverse association between BPA and insulin resistance. Our findings contrast other cross-sectional studies showing a positive association for BPA, which may be due to confounding or reverse causation because diet is an important source of both BPA exposure and obesity.

  9. Can Functional Cardiac Age be Predicted from ECG in a Normal Healthy Population

    Science.gov (United States)

    Schlegel, Todd; Starc, Vito; Leban, Manja; Sinigoj, Petra; Vrhovec, Milos

    2011-01-01

    In a normal healthy population, we desired to determine the most age-dependent conventional and advanced ECG parameters. We hypothesized that changes in several ECG parameters might correlate with age and together reliably characterize the functional age of the heart. Methods: An initial study population of 313 apparently healthy subjects was ultimately reduced to 148 subjects (74 men, 84 women, in the range from 10 to 75 years of age) after exclusion criteria. In all subjects, ECG recordings (resting 5-minute 12-lead high frequency ECG) were evaluated via custom software programs to calculate up to 85 different conventional and advanced ECG parameters including beat-to-beat QT and RR variability, waveform complexity, and signal-averaged, high-frequency and spatial/spatiotemporal ECG parameters. The prediction of functional age was evaluated by multiple linear regression analysis using the best 5 univariate predictors. Results: Ignoring what were ultimately small differences between males and females, the functional age was found to be predicted (R2= 0.69, P ECGs, functional cardiac age can be estimated by multiple linear regression analysis of mostly advanced ECG results. Because some parameters in the regression formula, such as QTcorr, high frequency QRS amplitude and P-wave width also change with disease in the same direction as with increased age, increased functional age of the heart may reflect subtle age-related pathologies in cardiac electrical function that are usually hidden on conventional ECG.

  10. Cognitive Deficits in Healthy Elderly Population With "Normal" Scores on the Mini-Mental State Examination.

    Science.gov (United States)

    Votruba, Kristen L; Persad, Carol; Giordani, Bruno

    2016-05-01

    This study investigated whether healthy older adults with Mini-Mental State Examination (MMSE) scores above 23 exhibit cognitive impairment on neuropsychological tests. Participants completed the MMSE and a neuropsychological battery including tests of 10 domains. Results were compared to published normative data. On neuropsychological testing, participants performed well on measures of naming and recall but showed mild to moderate impairment in working memory and processing speed and marked impairment in inhibition, sustained attention, and executive functioning. Almost everyone (91%) scored at least 1 standard deviation (SD) below the mean in at least 1 domain. The median number of domains in which individuals scored below 1 SD was 3.0 of 10.0, whereas over 21% scored below 1 SD in 5 domains or more. With the strictest of definitions for impairment, 20% of this population scored below 2.0 SDs below the norm in at least 2 domains, a necessary condition for a diagnosis of dementia. The finding that cognitive impairment, particularly in attention and executive functioning, is found in healthy older persons who perform well on the MMSE has clinical and research implications in terms of emphasizing normal variability in performance and early identification of possible impairment. © The Author(s) 2016.

  11. Feasibility and normal values of an integrated conductivity (Nanoduct™) sweat test system in healthy newborns.

    Science.gov (United States)

    Kuehni, Claudia E; Schindler, Matthias; Mazur, Agnieszka; Malzacher, Andreas; Hornung, René; Barben, Juerg

    2017-07-01

    Nanoduct™ is a simple and practical sweat analysis system measuring conductivity in situ. It requires only three microlitres of sweat, making it especially applicable to newborns. We measured conductivity in 260 healthy term infants at the age of four days, and again at four weeks to determine the proportion of successful tests, test duration, and normal values for sweat conductivity in newborns. Sufficient sweat was collected in 159/260 of four-day olds (61%), and in 225/239 of four-week olds (94%). Mean (sd) test duration was 27 (5) and 25 (5) min. Mean (sd, range) conductivity was 53mmol/l (16, 8-114) at age four days, and 36 (9, 12-64) at four weeks. Determination of sweat conductivity using Nanoduct™ cannot be recommended for four-day old newborns. However, at the age of four weeks the success rate is high (94%), and conductivity values at that age are comparable to older healthy children. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

  12. Magnetic Resonance Imaging of the Ovaries of Healthy Women: Determination of Normal Values

    International Nuclear Information System (INIS)

    Hauth, E.A.M.; Jaeger, H.J.; Libera, H.; Lange, S.; Forsting, M.

    2006-01-01

    Purpose: To establish normal values for the volume and maximal diameter of ovaries and ovarian follicles and for the number of ovarian follicles in magnetic resonance imaging (MRI) based on menstrual cycle phase and age. Material and Methods: We performed MRI of the pelvis on 100 healthy women. Volume of the ovaries and largest ovarian follicles and the number of ovarian follicles were determined by menstrual cycle phase and age. Results: The mean volume of the ovaries significantly increased with age and reached its peak between 31 and 40 years, and subsequently decreased. The mean volume of the largest ovarian follicles also significantly increased with age to reach its peak at 41-50 years. The highest mean numbers of ovarian follicles were found at 20-40 years. When the volumes of ovaries and of the largest ovarian follicles, and the number of ovarian follicles were compared between the first and second phase of the menstrual cycle, no significant differences were found. Conclusion: The volume and maximal diameter of ovaries and ovarian follicles and the number of ovarian follicles differ significantly with age, but not between the two phases of the menstrual cycle. Knowledge of MRI-related normal values can be expected to aid the early identification of ovarian pathologies

  13. MR imaging of the uterus and cervix in healthy women: Determination of normal values

    International Nuclear Information System (INIS)

    Hauth, Elke A.M.; Libera, Hanna; Lange, Silke; Forsting, Michael; Jaeger, Horst J.

    2007-01-01

    The purpose of this study was to establish normal values for the volume of the uterus and cervix in MRI based on age and the menstrual cycle phase. We performed MRI of the pelvis in 100 healthy women. For the uterus, they were further divided into two groups: one with myomas and/or adenomyosis and one without either. The volume of the uterus and cervix and thickness of the uterine wall layers were analysed by age and the menstrual cycle phase. The mean volume of the uterus in both groups and the cervix significantly increased with age to reach its peak at 41-50 years, and then dropped. Likewise, the thickness of the endometrium and the junctional zone, but not the myometrium, significantly increased until 41-50 years, and then decreased. When we compared the volume of the uterus and cervix and the thickness of the uterine wall layers between the two phases of the menstrual cycle, we found no significant differences. The volume of the uterus and cervix and the thickness of the endometrium and junctional zone differ significantly with age, but not between the two phases of the menstrual cycle. Knowledge of MRI-related normal values can be expected to aid the early identification of uterine pathologies. (orig.)

  14. What Limits Cardiac Performance during Exercise in Normal Subjects and in Healthy Fontan Patients?

    Directory of Open Access Journals (Sweden)

    André La Gerche

    2010-01-01

    Full Text Available Exercise is an important determinant of health but is significantly reduced in the patient with a univentricular circulation. Normal exercise physiology mandates an increase in pulmonary artery pressures which places an increased work demand on the right ventricle (RV. In a biventricular circulation with pathological increases in pulmonary vascular resistance and/or reductions in RV function, exercise-induced augmentation of cardiac output is limited. Left ventricular preload reserve is dependent upon flow through the pulmonary circulation and this requires adequate RV performance. In the Fontan patient, the reasons for exercise intolerance are complex. In those patients with myocardial dysfunction or other pathologies of the circulatory components, it is likely that these abnormalities serve as a limitation to cardiac performance during exercise. However, in the healthy Fontan patient, it may be the absence of a sub-pulmonary pump which limits normal increases in pulmonary pressures, trans-pulmonary flow requirements and cardiac output. If so, performance will be exquisitely dependent on pulmonary vascular resistance. This provides a potential explanation as to why pulmonary vasodilators may improve exercise tolerance. As has recently been demonstrated, these agents may offer an important new treatment strategy which directly addresses the physiological limitations in the Fontan patient.

  15. Comparison of cellular location and expression of Plakophilin-2 in epidermal cells from nonlesional atopic skin and healthy skin in German shepherd dogs.

    Science.gov (United States)

    Ardesjö-Lundgren, Brita; Tengvall, Katarina; Bergvall, Kerstin; Farias, Fabiana H G; Wang, Liya; Hedhammar, Åke; Lindblad-Toh, Kerstin; Andersson, Göran

    2017-08-01

    Canine atopic dermatitis (CAD) is an inflammatory and pruritic allergic skin disease caused by interactions between genetic and environmental factors. Previously, a genome-wide significant risk locus on canine chromosome 27 for CAD was identified in German shepherd dogs (GSDs) and Plakophilin-2 (PKP2) was defined as the top candidate gene. PKP2 constitutes a crucial component of desmosomes and also is important in signalling, metabolic and transcriptional activities. The main objective was to evaluate the role of PKP2 in CAD by investigating PKP2 expression and desmosome structure in nonlesional skin from CAD-affected (carrying the top GWAS SNP risk allele) and healthy GSDs. We also aimed at defining the cell types in the skin that express PKP2 and its intracellular location. Skin biopsies were collected from nine CAD-affected and five control GSDs. The biopsies were frozen for immunofluorescence and fixed for electron microscopy immunolabelling and morphology. We observed the novel finding of PKP2 expression in dendritic cells and T cells in dog skin. Moreover, we detected that PKP2 was more evenly expressed within keratinocytes compared to its desmosomal binding-partner plakoglobin. PKP2 protein was located in the nucleus and on keratin filaments attached to desmosomes. No difference in PKP2 abundance between CAD cases and controls was observed. Plakophilin-2 protein in dog skin is expressed in both epithelial and immune cells; based on its subcellular location its functional role is implicated in both nuclear and structural processes. © 2017 The Authors. Veterinary Dermatology published by John Wiley & Sons Ltd on behalf of the ESVD and ACVD.

  16. Effectiveness of the Healthy Skin Clinic – a randomized clinical trial of nurse-led patient counselling in hand eczema

    DEFF Research Database (Denmark)

    Mollerup, Annette; Veien, Niels K; Johansen, Jeanne D

    2014-01-01

    BACKGROUND: Hand eczema is a common disease, and continuous preventive skin protection and skin care must be adopted to prevent a chronic course. Hand eczema is not a uniform disease, and counselling must therefore be individually tailored. OBJECTIVES: To evaluate the effectiveness of a nurse-led...... or burden of disease were found between the two groups. CONCLUSION: A tailored nurse-led programme of skin protection counselling may be recommended as an essential part of hand eczema treatment.......BACKGROUND: Hand eczema is a common disease, and continuous preventive skin protection and skin care must be adopted to prevent a chronic course. Hand eczema is not a uniform disease, and counselling must therefore be individually tailored. OBJECTIVES: To evaluate the effectiveness of a nurse......-led counselling programme, the Healthy Skin Clinic, emphasizing the patient's self-management, resources, and risks. PATIENTS AND METHODS: Patients (n = 306) referred for diagnostic work-up and treatment of hand eczema were randomized and allocated either to the programme or to usual care. The primary outcome...

  17. Reproducibility of the heat/capsaicin skin sensitization model in healthy volunteers

    Directory of Open Access Journals (Sweden)

    Cavallone LF

    2013-11-01

    Full Text Available Laura F Cavallone,1 Karen Frey,1 Michael C Montana,1 Jeremy Joyal,1 Karen J Regina,1 Karin L Petersen,2 Robert W Gereau IV11Department of Anesthesiology, Washington University in St Louis, School of Medicine, St Louis, MO, USA; 2California Pacific Medical Center Research Institute, San Francisco, CA, USAIntroduction: Heat/capsaicin skin sensitization is a well-characterized human experimental model to induce hyperalgesia and allodynia. Using this model, gabapentin, among other drugs, was shown to significantly reduce cutaneous hyperalgesia compared to placebo. Since the larger thermal probes used in the original studies to produce heat sensitization are now commercially unavailable, we decided to assess whether previous findings could be replicated with a currently available smaller probe (heated area 9 cm2 versus 12.5–15.7 cm2.Study design and methods: After Institutional Review Board approval, 15 adult healthy volunteers participated in two study sessions, scheduled 1 week apart (Part A. In both sessions, subjects were exposed to the heat/capsaicin cutaneous sensitization model. Areas of hypersensitivity to brush stroke and von Frey (VF filament stimulation were measured at baseline and after rekindling of skin sensitization. Another group of 15 volunteers was exposed to an identical schedule and set of sensitization procedures, but, in each session, received either gabapentin or placebo (Part B.Results: Unlike previous reports, a similar reduction of areas of hyperalgesia was observed in all groups/sessions. Fading of areas of hyperalgesia over time was observed in Part A. In Part B, there was no difference in area reduction after gabapentin compared to placebo.Conclusion: When using smaller thermal probes than originally proposed, modifications of other parameters of sensitization and/or rekindling process may be needed to allow the heat/capsaicin sensitization protocol to be used as initially intended. Standardization and validation of

  18. Human paraoxonase and HDL-cholesterol in pakistan patients with acute myocardial infarction and normal healthy adults

    International Nuclear Information System (INIS)

    Iqbal, I.P.; Khan, A.H.; Mehboobali, N.

    2007-01-01

    Human serum paraoxonase is a high density lipoprotein (HDL)-bound enzyme exhibiting antiatherogenic properties. The aim of this study was to investigate any relationship between serum paraoxonase activity and serum levels of HDL-cholesterol in Pakistani patients with acute myocardial infarction (AMI) compared to normal healthy subjects and to examine possible association between serum paraoxonase activity and AMI in Pakistani population. In a case-control study, serum paraoxonase activity and serum levels of HDL-cholesterol and LDL-cholesterol were monitored in 164 Pakistani patients with AMI and 106 normal healthy adults matched for gender, BMI and age within 10 years. Mean serum concentration of HDL-cholesterol and mean serum paraoxonase activity in AMI patients were not significantly different from the corresponding values in normal healthy subjects. Mean serum paraoxonase activity value was significantly lower in normal healthy subjects with low HDL-cholesterol (serum levels < 40mg/dl) compared to the value in those with normal levels of HDL-cholesterol (P=0.04). In AMI patients, paraoxonase activity was lower in subjects with low HDL-cholesterol compared to those with normal levels of HDL-cholesterol, however, the decrease was not statistically significant. Correlation analyses of the data revealed a moderate association of paraoxonase activity with HDL-cholesterol (Pearson's r= 0.225, P<0.01 for AMI patients and r=0.281, P<0.01 for normal healthy controls). Seventy three percent of normal healthy subjects and 65% of AMI patients in this study had low HDL-cholesterol. Low serum paraoxonase activity and high prevalence of low HDL-cholesterol in Pakistani population could be contributing to the high rates of coronary heart disease in this population. (author)

  19. A comparison study of lipid profile levels between skin tags affected people and normal population in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Abbas Rasi

    2014-01-01

    Full Text Available Background: For many years the association of skin tags and endocrynopathies has been postulated, although many reports are available but it has never been evaluated to mean normal population. Dyslipidemia is a frequent disorder among people and seemed to be necessary for screening within skin tag condition. This study is designed to find any possible association between skin tags and dyslipidemia. Materials and Methods: From April 2009 to June 2011, 168 patients enrolled the study. Among the remaining 152 patients, there were 89 females (58.5% and 63 males (%41.5. Based on the TLGS study 136 men and 220 women enrolled the control group of study. The mean age was 28.4 years. Patients trained to have normal free diet for at least 1 month then referred to the laboratory. Blood samples were taken over 12 hours fasting with 2 hours intervals. Hypertriglyceridemia was defined as plasma level ≥160 mg/dl for men and ≥130 mg/dl for women. Hypercholesterolemia pointed at its value >200 mg/dl. Normal HDL levels was defined as >39 mg/dl for men and >35 mg/dl to women. Results: Mean skin tag number was 12.6 per subject. The most frequent localizations of skin tags were neck and upper chest (mean number: 13.4, 48.9% followed by axilla (mean number: 11.6, 33% and breast (10.2, 10.1% in the patient group. The mean cholesterol level of case group was 192.2 ± 33.1 mg/dl, while it was 187.0 ± 42 mg/dl in the control group. The mean ± SD for triglyceride was 132.1 ± 69 mg/dl in comparison to 129 ± 74 in the control group. Conclusion: The study showed no significant differences between normal population and patients′ lipid profile.

  20. Developing a reference of normal lung sounds in healthy Peruvian children.

    Science.gov (United States)

    Ellington, Laura E; Emmanouilidou, Dimitra; Elhilali, Mounya; Gilman, Robert H; Tielsch, James M; Chavez, Miguel A; Marin-Concha, Julio; Figueroa, Dante; West, James; Checkley, William

    2014-10-01

    Lung auscultation has long been a standard of care for the diagnosis of respiratory diseases. Recent advances in electronic auscultation and signal processing have yet to find clinical acceptance; however, computerized lung sound analysis may be ideal for pediatric populations in settings, where skilled healthcare providers are commonly unavailable. We described features of normal lung sounds in young children using a novel signal processing approach to lay a foundation for identifying pathologic respiratory sounds. 186 healthy children with normal pulmonary exams and without respiratory complaints were enrolled at a tertiary care hospital in Lima, Peru. Lung sounds were recorded at eight thoracic sites using a digital stethoscope. 151 (81%) of the recordings were eligible for further analysis. Heavy-crying segments were automatically rejected and features extracted from spectral and temporal signal representations contributed to profiling of lung sounds. Mean age, height, and weight among study participants were 2.2 years (SD 1.4), 84.7 cm (SD 13.2), and 12.0 kg (SD 3.6), respectively; and, 47% were boys. We identified ten distinct spectral and spectro-temporal signal parameters and most demonstrated linear relationships with age, height, and weight, while no differences with genders were noted. Older children had a faster decaying spectrum than younger ones. Features like spectral peak width, lower-frequency Mel-frequency cepstral coefficients, and spectro-temporal modulations also showed variations with recording site. Lung sound extracted features varied significantly with child characteristics and lung site. A comparison with adult studies revealed differences in the extracted features for children. While sound-reduction techniques will improve analysis, we offer a novel, reproducible tool for sound analysis in real-world environments.

  1. Developing a Reference of Normal Lung Sounds in Healthy Peruvian Children

    Science.gov (United States)

    Ellington, Laura E.; Emmanouilidou, Dimitra; Elhilali, Mounya; Gilman, Robert H.; Tielsch, James M.; Chavez, Miguel A.; Marin-Concha, Julio; Figueroa, Dante; West, James

    2018-01-01

    Purpose Lung auscultation has long been a standard of care for the diagnosis of respiratory diseases. Recent advances in electronic auscultation and signal processing have yet to find clinical acceptance; however, computerized lung sound analysis may be ideal for pediatric populations in settings, where skilled healthcare providers are commonly unavailable. We described features of normal lung sounds in young children using a novel signal processing approach to lay a foundation for identifying pathologic respiratory sounds. Methods 186 healthy children with normal pulmonary exams and without respiratory complaints were enrolled at a tertiary care hospital in Lima, Peru. Lung sounds were recorded at eight thoracic sites using a digital stethoscope. 151 (81 %) of the recordings were eligible for further analysis. Heavy-crying segments were automatically rejected and features extracted from spectral and temporal signal representations contributed to profiling of lung sounds. Results Mean age, height, and weight among study participants were 2.2 years (SD 1.4), 84.7 cm (SD 13.2), and 12.0 kg (SD 3.6), respectively; and, 47 % were boys. We identified ten distinct spectral and spectro-temporal signal parameters and most demonstrated linear relationships with age, height, and weight, while no differences with genders were noted. Older children had a faster decaying spectrum than younger ones. Features like spectral peak width, lower-frequency Mel-frequency cepstral coefficients, and spectro-temporal modulations also showed variations with recording site. Conclusions Lung sound extracted features varied significantly with child characteristics and lung site. A comparison with adult studies revealed differences in the extracted features for children. While sound-reduction techniques will improve analysis, we offer a novel, reproducible tool for sound analysis in real-world environments. PMID:24943262

  2. Role of the vitamin D3 pathway in healthy and diseased skin--facts, contradictions and hypotheses.

    Science.gov (United States)

    Lehmann, Bodo

    2009-02-01

    Irradiation of human keratinocytes with UVB (280-320 nm) in vitro and in vivo activates the metabolism of 7-dehydrocholesterol to hormonally active calcitriol. The production of calcitriol in the skin strongly depends on the photosynthesis of vitamin D(3) which is biologically inactive in the first instance. Vitamin D(3) serves as the starting substrate for two subsequent enzymatic hydroxylation steps in epidermal keratinocytes. Both the amount of vitamin D(3) and the activity of anabolic and catabolic vitamin D hydroxylases determine the cutaneous level of calcitriol. The hormonally active metabolite of vitamin D(3) regulates a huge number of genes in keratinocytes, and thus acts in an autocrine and/or paracrine manner. This local pathway of vitamin D(3) is unique, but its relevance for healthy and diseased skin is widely unknown, yet. Experimental findings implicate several questions: (1) Is UVB-induced formation of calcitriol involved in regulation of growth and differentaition of epidermal cells as well as immunological and skin protective processes? (2) What endogenous and exogenous factors including drugs affect the cutaneous vitamin D(3) pathway? From a therapeutical point of view, it has been known for a long time that topical application of calcitriol and its analogs can improve hyperproliferative skin diseases like psoriasis. In spite of many encouraging studies in recent years, the fields of the routinely therapeutical application of calcitriol or vitamin D analogs in dermatology (e.g. treatment of immunological, inflammatory, malignancies and infectious skin diseases) have not been intensified. Why is that?

  3. Site, gender and age variation in normal skin colour on the back and the forearm: tristimulus colorimeter measurements.

    Science.gov (United States)

    Fullerton, A; Serup, J

    1997-02-01

    To study whether anatomical location and age and gender of subjects had any influence on the objective skin colour measurements. Baseline colour in prone position was measured with the Minolta ChromaMeter® in the upper, middle and lower level of the upper back and on the forearm of 168 volunteers. These two sites are commonly used in skin testing. Higher basal a* and lower basal L* levels were found on the upper scapular region compared to the lower scapular region and the subscapular region. The basal b* level showed no variation relative to site. The basal a* and the basal b* levels were lower on the forearm compared to the upper back while the basal L* level was higher. Females above 65 years showed a less coloured skin with lower values as compared to those of younger age. Females were found to have a generally lower basal a* level than males both on the upper back and forearm skin. These relatively major differences and sources of variation have to be considered when planning irritancy studies where colour differences between erythema and normal skin is used.

  4. Real-time visualization of melanin granules in normal human skin using combined multiphoton and reflectance confocal microscopy.

    Science.gov (United States)

    Majdzadeh, Ali; Lee, Anthony M D; Wang, Hequn; Lui, Harvey; McLean, David I; Crawford, Richard I; Zloty, David; Zeng, Haishan

    2015-05-01

    Recent advances in biomedical optics have enabled dermal and epidermal components to be visualized at subcellular resolution and assessed noninvasively. Multiphoton microscopy (MPM) and reflectance confocal microscopy (RCM) are noninvasive imaging modalities that have demonstrated promising results in imaging skin micromorphology, and which provide complementary information regarding skin components. This study assesses whether combined MPM/RCM can visualize intracellular and extracellular melanin granules in the epidermis and dermis of normal human skin. We perform MPM and RCM imaging of in vivo and ex vivo skin in the infrared domain. The inherent three-dimensional optical sectioning capability of MPM/RCM is used to image high-contrast granular features across skin depths ranging from 50 to 90 μm. The optical images thus obtained were correlated with conventional histologic examination including melanin-specific staining of ex vivo specimens. MPM revealed highly fluorescent granular structures below the dermal-epidermal junction (DEJ) region. Histochemical staining also demonstrated melanin-containing granules that correlate well in size and location with the granular fluorescent structures observed in MPM. Furthermore, the MPM fluorescence excitation wavelength and RCM reflectance of cell culture-derived melanin were equivalent to those of the granules. This study suggests that MPM can noninvasively visualize and quantify subepidermal melanin in situ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

    Science.gov (United States)

    Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

    2006-02-01

    Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

  6. EEG Oscillatory States: Universality, Uniqueness and Specificity across Healthy-Normal, Altered and Pathological Brain Conditions

    Science.gov (United States)

    Fingelkurts, Alexander A.; Fingelkurts, Andrew A.

    2014-01-01

    For the first time the dynamic repertoires and oscillatory types of local EEG states in 13 diverse conditions (examined over 9 studies) that covered healthy-normal, altered and pathological brain states were quantified within the same methodological and conceptual framework. EEG oscillatory states were assessed by the probability-classification analysis of short-term EEG spectral patterns. The results demonstrated that brain activity consists of a limited repertoire of local EEG states in any of the examined conditions. The size of the state repertoires was associated with changes in cognition and vigilance or neuropsychopathologic conditions. Additionally universal, optional and unique EEG states across 13 diverse conditions were observed. It was demonstrated also that EEG oscillations which constituted EEG states were characteristic for different groups of conditions in accordance to oscillations’ functional significance. The results suggested that (a) there is a limit in the number of local states available to the cortex and many ways in which these local states can rearrange themselves and still produce the same global state and (b) EEG individuality is determined by varying proportions of universal, optional and unique oscillatory states. The results enriched our understanding about dynamic microstructure of EEG-signal. PMID:24505292

  7. Normal Values for Heart Electrophysiology Parameters of Healthy Swine Determined on Electrophysiology Study.

    Science.gov (United States)

    Noszczyk-Nowak, Agnieszka; Cepiel, Alicja; Janiszewski, Adrian; Pasławski, Robert; Gajek, Jacek; Pasławska, Urszula; Nicpoń, Józef

    2016-01-01

    Swine are a well-recognized animal model for human cardiovascular diseases. Despite the widespread use of porcine model in experimental electrophysiology, still no reference values for intracardiac electrical activity and conduction parameters determined during an invasive electrophysiology study (EPS) have been developed in this species thus far. The aim of the study was to develop a set of normal values for intracardiac electrical activity and conduction parameters determined during an invasive EPS of swine. The study included 36 healthy domestic swine (24-40 kg body weight). EPS was performed under a general anesthesia with midazolam, propofol and isoflurane. The reference values for intracardiac electrical activity and conduction parameters were calculated as arithmetic means ± 2 standard deviations. The reference values were determined for AH, HV and PA intervals, interatrial conduction time at its own and imposed rhythm, sinus node recovery time (SNRT), corrected sinus node recovery time (CSNRT), anterograde and retrograde Wenckebach points, atrial, atrioventricular node and ventricular refractory periods. No significant correlations were found between body weight and heart rate of the examined pigs and their electrophysiological parameters. The hereby presented reference values can be helpful in comparing the results of various studies, as well as in more accurately estimating the values of electrophysiological parameters that can be expected in a given experiment.

  8. Contrast sensitivity measured by two different test methods in healthy, young adults with normal visual acuity.

    Science.gov (United States)

    Koefoed, Vilhelm F; Baste, Valborg; Roumes, Corinne; Høvding, Gunnar

    2015-03-01

    This study reports contrast sensitivity (CS) reference values obtained by two different test methods in a strictly selected population of healthy, young adults with normal uncorrected visual acuity. Based on these results, the index of contrast sensitivity (ICS) is calculated, aiming to establish ICS reference values for this population and to evaluate the possible usefulness of ICS as a tool to compare the degree of agreement between different CS test methods. Military recruits with best eye uncorrected visual acuity 0.00 LogMAR or better, normal colour vision and age 18-25 years were included in a study to record contrast sensitivity using Optec 6500 (FACT) at spatial frequencies of 1.5, 3, 6, 12 and 18 cpd in photopic and mesopic light and CSV-1000E at spatial frequencies of 3, 6, 12 and 18 cpd in photopic light. Index of contrast sensitivity was calculated based on data from the three tests, and the Bland-Altman technique was used to analyse the agreement between ICS obtained by the different test methods. A total of 180 recruits were included. Contrast sensitivity frequency data for all tests were highly skewed with a marked ceiling effect for the photopic tests. The median ICS for Optec 6500 at 85 cd/m2 was -0.15 (95% percentile 0.45), compared with -0.00 (95% percentile 1.62) for Optec at 3 cd/m2 and 0.30 (95% percentile 1.20) FOR CSV-1000E. The mean difference between ICSFACT 85 and ICSCSV was -0.43 (95% CI -0.56 to -0.30, p<0.00) with limits of agreement (LoA) within -2.10 and 1.22. The regression line on the difference of average was near to zero (R2=0.03). The results provide reference CS and ICS values in a young, adult population with normal visual acuity. The agreement between the photopic tests indicated that they may be used interchangeably. There was little agreement between the mesopic and photopic tests. The mesopic test seemed best suited to differentiate between candidates and may therefore possibly be useful for medical selection purposes.

  9. Cystic fibrosis transmembrane conductance regulator is correlated closely with sperm progressive motility and normal morphology in healthy and fertile men with normal sperm parameters.

    Science.gov (United States)

    Jiang, L-Y; Shan, J-J; Tong, X-M; Zhu, H-Y; Yang, L-Y; Zheng, Q; Luo, Y; Shi, Q-X; Zhang, S-Y

    2014-10-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) has been demonstrated to be expressed in mature spermatozoa and correlated with sperm quality. Sperm CFTR expression in fertile men is higher than that in infertile men suffering from teratospermia, asthenoteratospermia, asthenospermia and oligospermia, but it is unknown whether CFTR is correlated with sperm parameters when sperm parameters are normal. In this study, 282 healthy and fertile men with normal semen parameters were classified into three age groups, group (I): age group of 20-29 years (98 cases, 27.1 ± 6.2), group (II): age group of 30-39 years (142 cases, 33.7 ± 2.6) and group (III): age group of more than or equal to 40 years (42 cases, 44.1 ± 4.6). Sperm concentration, total count and progressive motility were analysed by computer-assisted sperm analysis. Sperm morphology was analysed by modified Papanicolaou staining. Sperm CFTR expression was conducted by indirect immunofluorescence staining. There was a significant positive correlation (P sperm progressive motility (r = 0.221) and normal morphology (r = 0.202), but there were no correlations between sperm CFTR expression and semen volume, sperm concentration, sperm total count as well as male age (P > 0.05). Our findings show that CFTR expression is associated with sperm progressive motility and normal morphology in healthy and fertile men with normal sperm parameters, but not associated with the number of spermatozoa and male age. © 2013 Blackwell Verlag GmbH.

  10. Distribution of erlotinib in rash and normal skin in cancer patients receiving erlotinib visualized by matrix assisted laser desorption/ionization mass spectrometry imaging.

    Science.gov (United States)

    Nishimura, Meiko; Hayashi, Mitsuhiro; Mizutani, Yu; Takenaka, Kei; Imamura, Yoshinori; Chayahara, Naoko; Toyoda, Masanori; Kiyota, Naomi; Mukohara, Toru; Aikawa, Hiroaki; Fujiwara, Yasuhiro; Hamada, Akinobu; Minami, Hironobu

    2018-04-06

    The development of skin rashes is the most common adverse event observed in cancer patients treated with epidermal growth factor receptor-tyrosine kinase inhibitors such as erlotinib. However, the pharmacological evidence has not been fully revealed. Erlotinib distribution in the rashes was more heterogeneous than that in the normal skin, and the rashes contained statistically higher concentrations of erlotinib than adjacent normal skin in the superficial skin layer (229 ± 192 vs. 120 ± 103 ions/mm 2 ; P = 0.009 in paired t -test). LC-MS/MS confirmed that the concentration of erlotinib in the skin rashes was higher than that in normal skin in the superficial skin layer (1946 ± 1258 vs. 1174 ± 662 ng/cm 3 ; P = 0.028 in paired t -test). The results of MALDI-MSI and LC-MS/MS were well correlated (coefficient of correlation 0.879, P distribution of erlotinib in the skin tissue was visualized using non-labeled MALDI-MSI. Erlotinib concentration in the superficial layer of the skin rashes was higher than that in the adjacent normal skin. We examined patients with advanced pancreatic cancer who developed skin rashes after treatment with erlotinib and gemcitabine. We biopsied both the rash and adjacent normal skin tissues, and visualized and compared the distribution of erlotinib within the skin using matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI). The tissue concentration of erlotinib was also measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) with laser microdissection.

  11. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  12. Distribution of Malassezia species on the skin of patients with atopic dermatitis, psoriasis, and healthy volunteers assessed by conventional and molecular identification methods.

    Science.gov (United States)

    Jagielski, Tomasz; Rup, Elżbieta; Ziółkowska, Aleksandra; Roeske, Katarzyna; Macura, Anna B; Bielecki, Jacek

    2014-03-07

    The Malassezia yeasts which belong to the physiological microflora of human skin have also been implicated in several dermatological disorders, including pityriasis versicolor (PV), atopic dermatitis (AD), and psoriasis (PS). The Malassezia genus has repeatedly been revised and it now accommodates 14 species, all but one being lipid-dependent species. The traditional, phenotype-based identification schemes of Malassezia species are fraught with interpretative ambiguities and inconsistencies, and are thus increasingly being supplemented or replaced by DNA typing methods. The aim of this study was to explore the species composition of Malassezia microflora on the skin of healthy volunteers and patients with AD and PS. Species characterization was performed by conventional, culture-based methods and subsequently molecular techniques: PCR-RFLP and sequencing of the internal transcribed spacer (ITS) 1/2 regions and the D1/D2 domains of the 26S rRNA gene. The Chi-square test and Fisher's exact test were used for statistical analysis. Malassezia sympodialis was the predominant species, having been cultured from 29 (82.9%) skin samples collected from 17 out of 18 subjects under the study. Whereas AD patients yielded exclusively M. sympodialis isolates, M. furfur isolates were observed only in PS patients. The isolation of M. sympodialis was statistically more frequent among AD patients and healthy volunteers than among PS patients (P < 0.03). Whether this mirrors any predilection of particular Malassezia species for certain clinical conditions needs to be further evaluated. The overall concordance between phenotypic and molecular methods was quite high (65%), with the discordant results being rather due to the presence of multiple species in a single culture (co-colonization) than true misidentification. All Malassezia isolates were susceptible to cyclopiroxolamine and azole drugs, with M. furfur isolates being somewhat more drug tolerant than other Malassezia species

  13. An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments

    Science.gov (United States)

    2014-03-27

    20 11 40 0. 56 0. 57 0. 58 0. 590 . 6 0. 61 0. 62 0. 63 W av el en gt h (n m ) Reflectance 0 m L 1. 07 m L 2. 14 m L 3. 21 m L 4. 28 m L 35 .7 1...thickness from water concentration profiles obtained with Raman spectroscopy”. Acta Dermato-Venereologica, 87(1):4–8, 2007. [10] Eismann, Michael T...confocal Raman spectroscopy”. Skin Research and Technology, 16(2):137–141, 2009. [35] Nunez, Abel S. “A physical model of human skin and its application

  14. Macro-environment of breast carcinoma: frequent genetic alterations in the normal appearing skins of patients with breast cancer.

    Science.gov (United States)

    Moinfar, Farid; Beham, Alfred; Friedrich, Gerhard; Deutsch, Alexander; Hrzenjak, Andelko; Luschin, Gero; Tavassoli, Fattaneh A

    2008-05-01

    Genetic abnormalities in microenvironmental tissues with subsequent alterations of reciprocal interactions between epithelial and mesenchymal cells play a key role in the breast carcinogenesis. Although a few reports have demonstrated abnormal fibroblastic functions in normal-appearing fibroblasts taken from the skins of breast cancer patients, the genetic basis of this phenomenon and its implication for carcinogenesis are unexplored. We analyzed 12 mastectomy specimens showing invasive ductal carcinomas. In each case, morphologically normal epidermis and dermis, carcinoma, normal stroma close to carcinoma, and stroma at a distant from carcinoma were microdissected. Metastatic-free lymphatic tissues from lymph nodes served as a control. Using PCR, DNA extracts were examined with 11 microsatellite markers known for a high frequency of allelic imbalances in breast cancer. Losses of heterozygosity and/or microsatellite instability were detected in 83% of the skin samples occurring either concurrently with or independently from the cancerous tissues. In 80% of these cases at least one microsatellite marker displayed loss of heterozygosity or microsatellite instability in the skin, which was absent in carcinoma. A total of 41% of samples showed alterations of certain loci observed exclusively in the carcinoma but not in the skin compartments. Our study suggests that breast cancer is not just a localized genetic disorder, but rather part of a larger field of genetic alterations/instabilities affecting multiple cell populations in the organ with various cellular elements, ultimately contributing to the manifestation of the more 'localized' carcinoma. These data indicate that more global assessment of tumor micro- and macro-environment is crucial for our understanding of breast carcinogenesis.

  15. Plasma progranulin and relaxin levels in PCOS women with normal BMI compared to control healthy subjects

    Directory of Open Access Journals (Sweden)

    Samad Akbarzadeh

    2013-09-01

    Full Text Available Background: Poly Cystic Ovary Syndrome (PCOS is the most commonly encountered endocrine gland disease affecting 5-10 present of women at their reproductive age. This syndrome is associated with type 2 diabetes, dyslipidemia, and obesity. Progranulin and relaxin are adipokins that are related with carbohydrate and lipid metabolism. Due to limited data about progranulin and relaxin plasma levels´ in women with PCOS and normal BMI, this study was conducted. Material and Methods: This study is a cross-sectional. During the study 39 women with PCOS and BMI< 25 on the basis of Rotterdam criteria were chosen as the patient group and 38 healthy women were selected as the control group. The concentration of progranulin and relaxin were measured by ELISA technique. Results: The difference in Plasma concentration of progranulin and relaxin, and also some of the biochemical parameters in the patient group versus to the control group was not significant, but there was significant difference in the concentrations of VLDL, triglyceride (p=0.046, insulin (p=0.016, HOMA-IR (p=0.015, testosterone (p=0.01, and DHEAS (p=0.034 in the patients group compared to the control group. Conclusion: In this study, the difference in Plasma concentration of progranulin and relaxin in the patient group compared to the control group was not significant. It could be inferred that lack of change in plasma level of progranulin and relaxin in women with PCOS is related to BMI<25 and FBS<110. Moreoverestosterones, insulin, DHEAS and HOMA-IR changes could be better predictors of PCOS and its associated diabetes.

  16. Normal spectrum of pulmonary parametric response map to differentiate lung collapsibility: distribution of densitometric classifications in healthy adult volunteers

    International Nuclear Information System (INIS)

    Silva, Mario; Nemec, Stefan F.; Dufresne, Valerie; Occhipinti, Mariaelena; Heidinger, Benedikt H.; Bankier, Alexander A.; Chamberlain, Ryan

    2016-01-01

    Pulmonary parametric response map (PRM) was proposed for quantitative densitometric phenotypization of chronic obstructive pulmonary disease. However, little is known about this technique in healthy subjects. The purpose of this study was to describe the normal spectrum of densitometric classification of pulmonary PRM in a group of healthy adults. 15 healthy volunteers underwent spirometrically monitored chest CT at total lung capacity (TLC) and functional residual capacity (FRC). The paired CT scans were analyzed by PRM for voxel-by-voxel characterization of lung parenchyma according to 4 densitometric classifications: normal lung (TLC ≥ -950 HU, FRC ≥ -856 HU); expiratory low attenuation area (LAA) (TLC ≥ -950 HU, FRC < -856 HU); dual LAA (TLC<-950 HU, FRC < -856 HU); uncharacterized (TLC < -950 HU, FRC ≥ -856 HU). PRM spectrum was 78 % ± 10 % normal lung, 20 % ± 8 % expiratory LAA, and 1 % ± 1 % dual LAA. PRM was similar between genders, there was moderate correlation between dual LAA and spirometrically assessed TLC (R = 0.531; p = 0.042), and between expiratory LAA and Vol Exp/Insp ratio (R = -0.572; p = 0.026). PRM reflects the predominance of normal lung parenchyma in a group of healthy volunteers. However, PRM also confirms the presence of physiological expiratory LAA seemingly related to air trapping and a minimal amount of dual LAA likely reflecting emphysema. (orig.)

  17. Body Site Is a More Determinant Factor than Human Population Diversity in the Healthy Skin Microbiome.

    Directory of Open Access Journals (Sweden)

    Guillermo I Perez Perez

    Full Text Available We studied skin microbiota present in three skin sites (forearm, axilla, scalp in men from six ethnic groups living in New York City.Samples were obtained at baseline and after four days following use of neutral soap and stopping regular hygiene products, including shampoos and deodorants. DNA was extracted using the MoBio Power Lyzer kit and 16S rRNA gene sequences determined on the IIlumina MiSeq platform, using QIIME for analysis.Our analysis confirmed skin swabbing as a useful method for sampling different areas of the skin because DNA concentrations and number of sequences obtained across subject libraries were similar. We confirmed that skin location was the main factor determining the composition of bacterial communities. Alpha diversity, expressed as number of species observed, was greater in arm than on scalp or axilla in all studied groups. We observed an unexpected increase in α-diversity on arm, with similar tendency on scalp, in the South Asian group after subjects stopped using their regular shampoos and deodorants. Significant differences at phylum and genus levels were observed between subjects of the different ethnic origins at all skin sites.We conclude that ethnicity and particular soap and shampoo practices are secondary factors compared to the ecological zone of the human body in determining cutaneous microbiota composition.

  18. T-cell receptor gamma delta bearing cells in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.

    1990-01-01

    T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+

  19. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    DEFF Research Database (Denmark)

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise

    2012-01-01

    Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...

  20. Evidence of the regulatory effect of Ginkgo biloba extract on skin blood flow and study of its effects on urinary metabolites in healthy humans

    NARCIS (Netherlands)

    Boelsma, E.; Lamers, R.-J.A.N.; Hendriks, H.F.J.; Nesselrooij, J.H.J. van; Roza, L.

    2004-01-01

    Ginkgo biloba extract has been advocated for the improvement of blood circulation in circulatory disorders. This study investigated the effect of the Gingko biloba extract EGb 761 on skin blood flow in healthy volunteers and accompanying changes in urinary metabolites. Twenty-seven healthy

  1. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  2. Research surface resistance of copper normal and abnormal skin-effects depending on the frequency of electromagnetic field

    International Nuclear Information System (INIS)

    Kutovyi, V.A.; Komir, A.I.

    2013-01-01

    The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz

  3. Direct evidence for insulin-induced capillary recruitment in skin of healthy subjects during physiological hyperinsulinemia

    NARCIS (Netherlands)

    Serne, EH; IJzerman, RG; Gans, ROB; Nijveldt, R; de Vries, G; Evertz, R; Donker, AJM; Stehouwer, CDA

    It has been proposed that insulin-mediated changes in muscle perfusion modulate insulin-mediated glucose uptake. However, the putative effects of insulin on the microcirculation that permit such modulation have not been studied in humans. We examined the effects of systemic hyperinsulinemia on skin

  4. Effects of the association of chemotherapy and radiotherapy on normal mouse skin

    International Nuclear Information System (INIS)

    Guigon, M.; Frindel, E.; Tubiana, M.; Hewitt, J.

    1978-01-01

    The effects of an association of chemotherapy and radiotherapy on the skin of mice were studied. The following drugs were tested; hydroxyurea, Methotrexate, and Bleomycin; they were injected at various times before irradiation. When hydroxyurea was injected 15 min before irradiation, the early and late cutaneous reactions were significantly lower than with irradiation alone. This protective effect corresponds to about 500 rad for an irradiation dose of 2500 rad. In the other protocols, we observed either no increase of the effect as a result of adjuvant chemotherapy (Methotrexate) or slightly increased reactions

  5. Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin

    National Research Council Canada - National Science Library

    Chang, Howard Y

    2008-01-01

    The results from year I of funding suggest that appropriate markers and technologies are in place for systematic investigation of the positional identity of fibroblasts both in normal and diseased tissues...

  6. Histopathological and parasitological investigations of ear healthy skin of dogs naturally and experimentally infected with Leishmania (Leishmania) chagasi.

    Science.gov (United States)

    Figueiredo, Maria Marta; Moura, Eliane Perlatto; Costa, Miriam Maria; Ribeiro, Vitor Marcio; Michalick, Marilene Suzan; Tafuri, Washington Luiz; Tafuri, Wagner Luiz

    2010-07-01

    Although 90% of clinical cases of American visceral leishmaniasis (AVL) occur in the northeastern region of Brazil, the incidence of cases in recent years has increased in southeastern states such as Minas Gerais (MG), where the disease has been reported in several cities, including Belo Horizonte, the state capital. Some studies have shown a strong correlation between the incidence of AVL and canine visceral leishmaniasis (CVL) in Belo Horizonte. A study of 108 dogs with parasite Leishmania chagasi detected by immuno-histochemistry in healthy ear skin was obtained from two distinct geographical areas: 55 from a metropolitan area of the municipality (Santa Luzia, MG) and 53 dogs from a central area of Belo Horizonte. In parallel, a group of 10 beagles were experimentally infected with L. chagasi. Considering the clinical aspects of all naturally infected dogs, symptomatic dogs were more frequent than asymptomatic ones, especially animals from the metropolitan area compared with the central area (79.6% and 20.3%, respectively). A chronic exudate was observed in the ear of 51 out of 55 dogs naturally infected from the metropolitan area (92.7%) and 45 out of 53 dogs naturally infected from the central area (84.9%). Importantly, asymptomatic dogs from the central area harbor more parasites in the skin than the asymptomatic ones from the metropolitan area. In addition, a profound difference was noted in the intensity of the inflammatory reaction and parasite load in the skin of experimental infected dogs.

  7. Impact of overweight on the normal physiology of human in vivo skin

    Directory of Open Access Journals (Sweden)

    Liliana Tavares

    2013-06-01

    Full Text Available Obesity is an increasing public health issue, particularly in Portugal, where more than 50% of the population is obese. The pathophysiological consequences of being overweight have a severe cutaneous impact. However, there is still a lack of studies to link these alterations to BMI categories. This present work intends to identify the hydration and biomechanical behaviour changes related to weight augmentation. This transversal study was performed on a convenience sample of 57 volunteers, all females, aged between 20 and 46 (30±8 years old. Volunteers were divided in two groups – group I, with a BMI between 19,9 and 24,9 Kg/m2 and group II, between 25 and 29,9 Kg/m2. One single determination of the superficial hydration, transepidermal water loss and biomechanical behaviour of the skin, was obtained with non-invasive methods. The data showed that weight increase positively influences hydration levels and transepidermal water loss, and negatively influences the skin's biomechanical behaviour. Despite the relevance of these results, there is still a need for complementary studies, with a wider number of individuals, in order to better understand its nature and meaning.

  8. Distribution and infection of Langerhans cells in the skin of HIV-infected healthy subjects and AIDS patients.

    Science.gov (United States)

    Müller, H; Weier, S; Kojouharoff, G; Grez, M; Berger, S; Kappus, R; Shah, P M; Stutte, H J; Schmidts, H L

    1993-01-01

    The in situ content of cells of the reticuloendothelial system and lymphatic cells was examined in the skin of eight symptom-free HIV-positive individuals, three AIDS patients and eleven healthy immunocompetent volunteers. The epidermis was obtained in vivo by the suction blister technique. The numbers of CD68+, CD3+, CD8+, CD25-(IL2R)+ and HLA-DR+ intraepidermal cells proved to be independent of the number of CD4+ peripheral blood lymphocytes. At the same time, the intraepidermal concentrations of these cells were generally low in symptom-free HIV-infected individuals. The strong inverse correlation between the number of epidermal Langerhans cells (LC) and the severity of immunodeficiency was quantitatively confirmed; an increase in LC in symptom-free HIV-infected individuals was found. Thus, the reduction in these cells which was observed in the epidermis of AIDS patients began at a significantly elevated level. In contrast to results from other studies, in AIDS patients, in the present study, the concentration of epidermal LC did not differ significantly from that of healthy immunocompetent volunteers. The immunohistochemical technique can be as effective as in situ hybridization for the detection of HIV in the skin. Our results suggest that the viral load of the skin is rather low in HIV-infected subjects. HIV was demonstrated in one cell of one AIDS case by in situ techniques and this result was confirmed by a polymerase chain reaction examination using the same amount of tissue as for the in situ techniques.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  10. Effect of capping agents on the cytotoxicity of silver nanoparticles in human normal and cancer skin cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Netchareonsirisuk, Ponsawan [Chulalongkorn University, Program in Biotechnology, Faculty of Science (Thailand); Puthong, Songchan [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand); Dubas, Stephan [Chulalongkorn University, Petroleum and Petrochemical College (Thailand); Palaga, Tanapat [Chulalongkorn University, Department of Microbiology, Faculty of Science (Thailand); Komolpis, Kittinan, E-mail: kittinan.k@chula.ac.th [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand)

    2016-11-15

    Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5–15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO{sub 3} alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC{sub 50}), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84–90 %) than necrosis (8–12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.

  11. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  12. Skin reactions to histamine of healthy subjects after hypnotically induced emotions of sadness, anger, and happiness.

    Science.gov (United States)

    Zachariae, R; Jørgensen, M M; Egekvist, H; Bjerring, P

    2001-08-01

    The severity of symptoms in asthma and other hypersensitivity-related disorders has been associated with changes in mood but little is known about the mechanisms possibly mediating such a relationship. The purpose of this study was to examine the influence of mood on skin reactivity to histamine by comparing the effects of hypnotically induced emotions on flare and wheal reactions to cutaneous histamine prick tests. Fifteen highly hypnotically susceptible volunteers had their cutaneous reactivity to histamine measured before hypnosis at 1, 2, 3, 4, 5, 10, and 15 min after the histamine prick. These measurements were repeated under three hypnotically induced emotions of sadness, anger, and happiness presented in a counterbalanced order. Skin reactions were measured as change in histamine flare and wheal area in mm2 per minute. The increase in flare reaction in the time interval from 1 to 3 min during happiness and anger was significantly smaller than flare reactions during sadness (P<0.05). No effect of emotion was found for wheal reactions. Hypnotic susceptibility scores were associated with increased flare reactions at baseline (r=0.56; P<0.05) and during the condition of happiness (r=0.56; P<0.05). Our results agree with previous studies showing mood to be a predictor of cutaneous immediate-type hypersensitivity and histamine skin reactions. The results are also in concordance with earlier findings of an association between hypnotic susceptibility and increased reactivity to an allergen.

  13. The apple skin: colourful healthiness : developmental and environmental regulation of flavonoids and chlorogenic acid in apples

    NARCIS (Netherlands)

    Awad, M.A.G.

    2001-01-01

    The ultimate objective of the production, handling and distribution of fresh fruits and vegetables is to satisfy consumers requirements. In general the attractiveness of fruits and vegetables to consumers is determined both by visible (e.g. colour) and invisible (e.g. healthiness) quality

  14. Abnormally dark or light skin

    Science.gov (United States)

    Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...

  15. Quantitative nailfold capillaroscopy findings in a population with connective tissue disease and in normal healthy controls.

    Science.gov (United States)

    Kabasakal, Y; Elvins, D M; Ring, E F; McHugh, N J

    1996-01-01

    OBJECTIVE: To describe and quantify the morphological characteristics of nailfold capillaries that distinguish different forms of connective tissue disease from healthy controls. METHODS: A CCD video microscope with fibreoptic illumination and PC based image processing was used to visualise nailfold capillaries and to quantify findings in 23 patients with systemic sclerosis (SSc), 22 patients with systemic lupus erythematosus (SLE), 21 patients with undifferentiated connective tissue disease (UCTD), and 38 healthy controls. RESULTS: Capillary density was reduced in SSc (5.2 (SD 1.3) capillaries/mm) compared with other patient groups and controls. The average number of enlarged capillaries/finger was high in all disease groups (5.5-6.6) compared with controls (2). However, giant capillaries were most frequent in SSc (43%) and were not present in controls. Mild and moderate avascular areas were present in all groups (35%-68%), but severe avascularity was most frequent in SSc (44%) compared with other patients (18%-19%) and controls (0%). The greatest frequency of extensive haemorrhage was in SSc (35%). CONCLUSIONS: There is a range of abnormal capillary findings in patients with connective tissue disease and healthy controls. However, certain abnormalities such as a reduced number of capillaries, severe avascularity, giant capillaries, and haemorrhage are most commonly associated with SSc. Videomicroscopy with image processing offers many technical advantages that can be exploited in further studies of nailfold capillaries. Images PMID:8774177

  16. High Normal Uric Acid Levels Are Associated with an Increased Risk of Diabetes in Lean, Normoglycemic Healthy Women.

    Science.gov (United States)

    Shani, Michal; Vinker, Shlomo; Dinour, Dganit; Leiba, Merav; Twig, Gilad; Holtzman, Eliezer J; Leiba, Adi

    2016-10-01

    The risk associated with serum uric acid (SUA) levels within the normal range is unknown, especially among lean and apparently healthy adults. Evaluating whether high-normal SUA levels, 6.8 mg/dL and below, are associated with an increased diabetes risk, compared with low-normal SUA. This was a cohort study with 10 years of followup involving all clinics of the largest nationally distributed Health Maintenance Organization in Israel. Participants included 469,947 examinees, 40-70 years old at baseline, who had their SUA measured during 2002. We excluded examinees who had hyperuricemia (SUA > 6.8 mg/dL), impaired fasting glucose, overweight or obesity and chronic cardiovascular or renal disorders. The final cohort was composed of 30 302 participants. Participants were followed up to a new diagnosis of diabetes during the study period. Odds ratio of developing diabetes among participants with high-normal baseline SUA were compared with low-normal (2 ≤ uric acid lean women when compared with those with low-normal values.

  17. Reaffirming normal: the high risk of pathologizing healthy adults when interpreting the MMPI-2-RF.

    Science.gov (United States)

    Odland, Anthony P; Lammy, Andrew B; Perle, Jonathan G; Martin, Phillip K; Grote, Christopher L

    2015-01-01

    Monte Carlo simulations were utilized to determine the proportion of the normal population expected to have scale elevations on the MMPI-2-RF when multiple scores are interpreted. Results showed that when all 40 MMPI-2-RF scales are simultaneously considered, approximately 70% of normal adults are likely to have at least one scale elevation at or above 65 T, and as many as 20% will have five or more elevated scales. When the Restructured Clinical (RC) Scales are under consideration, 34% of normal adults have at least one elevated score. Interpretation of the Specific Problem Scales and Personality Psychopathology Five Scales--Revised also yielded higher than expected rates of significant scores, with as many as one in four normal adults possibly being miscategorized as having features of a personality disorder by the latter scales. These findings are consistent with the growing literature on rates of apparently abnormal scores in the normal population due to multiple score interpretation. Findings are discussed in relation to clinical assessment, as well as in response to recent work suggesting that the MMPI-2-RF's multiscale composition does not contribute to high rates of elevated scores.

  18. Angiogenic effects of cryosurgery with liquid nitrogen on the normal skin of rats, through morphometric study.

    Science.gov (United States)

    Pimentel, Camila Bianco; Moraes, Aparecida Machado de; Cintra, Maria Letícia

    2014-01-01

    Cryosurgery is an efficient therapeutic technique used to treat benign and malignant cutaneous diseases. The primary active mechanism of cryosurgery is related to vascular effects on treated tissue. After a cryosurgical procedure, exuberant granulation tissue is formed at the injection site, probably as a result of angiogenic stimulation of the cryogen and inflammatory response, particularly in endothelial cells. To evaluate the angiogenic effects of freezing, as part of the phenomenon of healing rat skin subjected to previous injury. Two incisions were made in each of the twenty rats, which were divided randomly into two groups of ten. After 3 days, cryosurgery with liquid nitrogen was performed in one of incisions. The rats' samples were then collected, cut and stained to conduct histopathological examination, to assess the local angiogenesis in differing moments and situations. It was possible to demonstrate that cryosurgery, in spite of promoting cell death and accentuated local inflammation soon after its application, induces quicker cell proliferation in the affected tissue and maintenance of this rate in a second phase, than in tissue healing without this procedure. These findings, together with the knowledge that there is a direct relationship between mononuclear cells and neovascularization (the development of a rich system of new vessels in injury caused by cold), suggest that cryosurgery possesses angiogenic stimulus, even though complete healing takes longer to occur. The significance level for statistical tests was 5% (p<0,05).

  19. Motivation and perceived competence for healthy eating and exercise among overweight/obese adolescents in comparison to normal weight adolescents.

    Science.gov (United States)

    Mokhtari, Suzanne; Grace, Benjamin; Pak, Youngju; Reina, Astrid; Durand, Quinn; Yee, Jennifer K

    2017-01-01

    The current literature on determinants of behavior change in weight management lacks sufficient studies on type of motivation among children/adolescents, on perceived competence, and in relation to healthy eating. This study aimed to investigate type of motivation and levels of perceived competence for healthy diet and exercise, as well as general self efficacy among adolescents. We hypothesized that overweight/obese adolescents would demonstrate lower autonomous motivation and perceived competence regarding diet and exercise, and lower self-efficacy in general, and that the scores would be influenced by socioeconomic factors. Normal weight ( n  = 40, body mass index Competence Scale (PCS) for healthy eating and exercise, and the General Self-Efficacy Scale (GSES). Composite scores for the three scales were compared between the two groups using the using the two-sample t-test (for normal data) or the Mann-Whitney U test (for non-parametric data). Relationships between the composite scores and patient characteristics were determined using Pearson or Spearman's correlations. The average age of the total cohort was 15.9 ± 1.9 years. 54% were female, and 82% identified as Latino/Hispanic. In comparison to normal weight subjects, overweight/obese adolescents exhibited higher scores for controlled motivation (mean ± standard deviation 28.3 ± 9.3 vs 18.1 ± 8.1) and higher perceived competence [median and 25-75% interquartile range 22.5 (19.0-26.0) vs 20.0 (15.5-25.0)] in relation to eating a healthy diet. These differences persisted after adjustment for age, sex, paternal education, and family income. Overweight/obese adolescents did not lack autonomous motivation but demonstrated higher controlled motivation and perceived competence for healthy eating in comparison to normal weight adolescents, independent of socioeconomic factors. In the clinical practice of weight management, providers should carefully assess adolescents for type of

  20. Comparison of penile length at 6–24 months between children with unilateral cryptorchidism and a healthy normal cohort

    Directory of Open Access Journals (Sweden)

    Dong Soo Ryu

    2018-01-01

    Full Text Available Purpose: Urologic diseases affected by testosterone can be associated with smaller penis size compared to the normal population. We sought to compare penile length in children with unilateral cryptorchidism and normative data from a cohort of healthy Korean boys. Materials and Methods: This study was performed in 259 Korean boys (212, normal cohort; 47, cryptorchidism aged 6–24 months, each of whom had been brought to an outpatient clinic at one of five tertiary hospitals (Gyeongsangnam-do Province between April 2014 and June 2015. Penile length was measured via stretched penile length (SPL and testicular size was measured using orchidometry (mL. Results: SPL in children with cryptorchidism was significantly shorter compared to a cohort of healthy Korean boys aged 6–24 months (3.7±0.5 cm and 4.3±0.8 cm, p<0.001, although there were no differences with regard to height, body weight and contralateral testicular size between the two groups. According to the stratified ages (6–12, 12–18, and 18–24 months, SPL in children with cryptorchidism was persistently shorter at their ages than those without. Conclusions: It might be that the penile length aged 6–24 months of children with unilateral cryptorchidism is shorter than that of a cohort of healthy Korean boys.

  1. Diagnosis of malignant melanoma and basal cell carcinoma by in vivo NIR-FT Raman spectroscopy is independent of skin pigmentation

    DEFF Research Database (Denmark)

    Philipsen, P A; Knudsen, L; Gniadecka, M

    2013-01-01

    and skin tumour diagnostics in vivo. We obtained Raman spectra in vivo from the normal skin of 55 healthy persons with different skin pigmentation (Fitzpatrick skin type I-VI) and in vivo from 25 basal cell carcinomas, 41 pigmented nevi and 15 malignant melanomas. Increased skin pigmentation resulted...

  2. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Rude, J.M.; Friedberg, E.C.

    1977-01-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

  3. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Rude' e, J.M.; Friedberg, E.C.

    1977-03-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.

  4. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  5. Skin barrier response to occlusion of healthy and irritated skin: differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached.......Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached....

  6. Studying the effect of different elements in gastric emptying that produce normal variations in `healthy` individuals

    Energy Technology Data Exchange (ETDEWEB)

    Hauser, L. [Sydney University, Sydney, NSW (Australia)

    1999-06-01

    Maintaining the rate of emptying solids and liquids at normal levels, is an essential component for the correct functioning of the entire gastro-intestinal tract. There is no single-test available which provides a `baseline` for all gastric emptying studies. This problem arises due to many elements which normally effect the rate of gastric emptying, such as those dealing with patient factors, the composition of the liquid/solid meal used and also which radiopharmaceutical is chosen. It is therefore recommended that each Nuclear Medicine practice needs to set-up guidelines which are able to be consistently reproduced. One such guideline may be in the form of a `liquid glucose meal` which provides consistent and accurate results for gastric emptying studies 18 refs., 2 figs.

  7. Characterization of oily mature skin by biophysical and skin imaging techniques.

    Science.gov (United States)

    de Melo, M O; Maia Campos, P M B G

    2018-02-13

    The skin is a complex biological system and may suffer change according to the environmental factors, as higher temperatures can increase sebum excretion, presenting oiliness and acne. These alterations can persist during the aging and provoke more changes in aged skin. In this study we evaluated the mature oily skin characteristics using biophysical and skin imaging techniques. Sixty healthy female subjects, aged between 39 and 55 years old were recruited and separated into 2 groups according to their skin type: normal/dry and oily skin. The skin was evaluated in terms of stratum corneum water content, transepidermal water loss (TEWL) sebum content, dermis thickness and echogenicity, skin microrelief, and pores content. The mature oily skin presented no significant differences when compared to the normal/dry skin on the stratum corneum water content and TEWL parameters. The sebum content was significantly higher on the oily skin group. The microrelief analysis showed an increase of skin roughness values in the oily skin and increase of scaliness in the normal/dry skin. The oily skin showed lower dermis echogenicity mainly in the frontal region and higher dermis thickness when compared to normal/dry skin. The mature oily skin showed different characteristics from normal/dry skin in terms of sebum content, microrelief parameters, and dermis thickness. This way, the characterization of mature oily skin in an objective way is very important to development of dermocosmetic products for more effective treatments focused specially on this type of skin. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. High-normal levels of hs-CRP predict the development of non-alcoholic fatty liver in healthy men.

    Directory of Open Access Journals (Sweden)

    Jieun Lee

    Full Text Available We performed a follow-up study to address whether high sensitivity C-reactive protein (hs-CRP levels within the normal range can predict the development of non-alcoholic fatty liver disease (NAFLD in healthy male subjects. Among15347 male workers between 30 and 59 years old who received annual health check-ups in 2002, a NAFLD-free cohort of 4,138 was followed through December 2009. Alcohol consumption was assessed with a questionnaire. At each visit, abdominal ultrasonography was performed to identify fatty liver disease. The COX proportional hazard model was used to evaluate the relationship between hs-CRP and incident NAFLD. During the follow-up period, 28.8% (1191 of 4138 of participants developed NAFLD. The hazard ratios of NAFLD were increased by hs-CRP categories within the normal range in the non-adjusted model and age-adjusted model. After adjusting for age, exercise, smoking, BMI, systolic BP, triglyceride, and fasting glucose, these incidences were only increased between the lowest and the highest hs-CRP categories. The risk for NAFLD increased as the hs-CRP level increased (p< 0.001. As the hs-CRP level increased within the healthy cohort, the risk of developing NAFLD increased. This trend remained true even if the hs-CRP level remained within the normal range. hs-CRP can be used as a predictor of NAFLD, as well as other obesity-associated diseases. Therefore, individuals with higher hs-CRP levels (even within the normal range may require appropriate follow-up and management to prevent NAFLD development.

  9. Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

    Science.gov (United States)

    Xiong, S. Y.; Yang, J. G.; Zhuang, J.

    2011-10-01

    In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

  10. Crowdsourced Data Indicate Widespread Multidrug Resistance in Skin Flora of Healthy Young Adults

    Directory of Open Access Journals (Sweden)

    Scott Freeman

    2015-10-01

    Full Text Available In a laboratory exercise for undergraduate biology majors, students plated bacteria from swabs of their facial skin under conditions that selected for coagulase-negative Staphylococcus; added disks containing the antibiotics penicillin, oxacillin, tetracycline, and erythromycin; and measured zones of inhibition. Students also recorded demographic and lifestyle variables and merged this information with similar data collected from 9,000 other students who had contributed to the database from 2003 to 2011. Minimum inhibitory concentration (MIC testing performed at the Harborview Medical Center Microbiology Laboratory (Seattle, WA indicated a high degree of accuracy for student-generated data; species identification with a matrix-assisted laser desorption ionization (MALDI Biotyper revealed that over 88% of the cells analyzed by students were S. epidermidis or S. capitus. The overall frequency of resistant cells was high, ranging from 13.2% of sampled bacteria resistant to oxacillin to 61.7% resistant to penicillin. Stepwise logistic regressions suggested that recent antibiotic use was strongly associated with resistance to three of the four antibiotics tested (p = 0.0003 for penicillin, p << 0.0001 for erythromycin and tetracycline, and that age, gender, use of acne medication, use of antibacterial soaps, or makeup use were associated with resistance to at least one of the four antibiotics. Furthermore, drug resistance to one antibiotic was closely linked to resistance to the other three antibiotics in every case (all p values << 0.0001, suggesting the involvement of multidrug–resistant strains. The data reported here suggest that citizen science could not only provide an important educational experience for undergraduates, but potentially play a role in efforts to expand antibiotic resistance (ABR surveillance.

  11. Sleep extension normalizes ERP of waking auditory sensory gating in healthy habitually short sleeping individuals.

    Science.gov (United States)

    Gumenyuk, Valentina; Korzyukov, Oleg; Roth, Thomas; Bowyer, Susan M; Drake, Christopher L

    2013-01-01

    Chronic sleep loss has been associated with increased daytime sleepiness, as well as impairments in memory and attentional processes. In the present study, we evaluated the neuronal changes of a pre-attentive process of wake auditory sensory gating, measured by brain event-related potential (ERP)--P50 in eight normal sleepers (NS) (habitual total sleep time (TST) 7 h 32 m) vs. eight chronic short sleeping individuals (SS) (habitual TST ≤6 h). To evaluate the effect of sleep extension on sensory gating, the extended sleep condition was performed in chronic short sleeping individuals. Thus, one week of time in bed (6 h 11 m) corresponding to habitual short sleep (hSS), and one week of extended time (∼ 8 h 25 m) in bed corresponding to extended sleep (eSS), were counterbalanced in the SS group. The gating ERP assessment was performed on the last day after each sleep condition week (normal sleep and habitual short and extended sleep), and was separated by one week with habitual total sleep time and monitored by a sleep diary. We found that amplitude of gating was lower in SS group compared to that in NS group (0.3 µV vs. 1.2 µV, at Cz electrode respectively). The results of the group × laterality interaction showed that the reduction of gating amplitude in the SS group was due to lower amplitude over the left hemisphere and central-midline sites relative to that in the NS group. After sleep extension the amplitude of gating increased in chronic short sleeping individuals relative to their habitual short sleep condition. The sleep condition × frontality interaction analysis confirmed that sleep extension significantly increased the amplitude of gating over frontal and central brain areas compared to parietal brain areas.

  12. Sleep extension normalizes ERP of waking auditory sensory gating in healthy habitually short sleeping individuals.

    Directory of Open Access Journals (Sweden)

    Valentina Gumenyuk

    Full Text Available Chronic sleep loss has been associated with increased daytime sleepiness, as well as impairments in memory and attentional processes. In the present study, we evaluated the neuronal changes of a pre-attentive process of wake auditory sensory gating, measured by brain event-related potential (ERP--P50 in eight normal sleepers (NS (habitual total sleep time (TST 7 h 32 m vs. eight chronic short sleeping individuals (SS (habitual TST ≤6 h. To evaluate the effect of sleep extension on sensory gating, the extended sleep condition was performed in chronic short sleeping individuals. Thus, one week of time in bed (6 h 11 m corresponding to habitual short sleep (hSS, and one week of extended time (∼ 8 h 25 m in bed corresponding to extended sleep (eSS, were counterbalanced in the SS group. The gating ERP assessment was performed on the last day after each sleep condition week (normal sleep and habitual short and extended sleep, and was separated by one week with habitual total sleep time and monitored by a sleep diary. We found that amplitude of gating was lower in SS group compared to that in NS group (0.3 µV vs. 1.2 µV, at Cz electrode respectively. The results of the group × laterality interaction showed that the reduction of gating amplitude in the SS group was due to lower amplitude over the left hemisphere and central-midline sites relative to that in the NS group. After sleep extension the amplitude of gating increased in chronic short sleeping individuals relative to their habitual short sleep condition. The sleep condition × frontality interaction analysis confirmed that sleep extension significantly increased the amplitude of gating over frontal and central brain areas compared to parietal brain areas.

  13. Normal left ventricular mechanics by two-dimensional speckle-tracking echocardiography. Reference values in healthy adults.

    Science.gov (United States)

    Kocabay, Gonenc; Muraru, Denisa; Peluso, Diletta; Cucchini, Umberto; Mihaila, Sorina; Padayattil-Jose, Seena; Gentian, Denas; Iliceto, Sabino; Vinereanu, Dragos; Badano, Luigi P

    2014-08-01

    Two-dimensional speckle-tracking echocardiography is a novel tool to assess myocardial function. The purpose of this study was to evaluate left ventricular myocardial strain and rotation parameters by two-dimensional speckle-tracking echocardiography in a large group of healthy adults across a wide age range to establish their reference values and to assess the influence of age, sex, and hemodynamic factors. Transthoracic echocardiograms were acquired in 247 healthy volunteers (139 women, 44 years [standard deviation, 16 years old] (range, 18-80 years). We measured longitudinal, circumferential, and radial peak systolic strain values, and left ventricular rotation and twist. Average values of global longitudinal, radial, and circumferential strain were -21.5% (standard deviation, 2.0%), 40.1% (standard deviation, 11.8%) and -22.2% (standard deviation, 3.4%), respectively. Longitudinal strain was significantly more negative in women, whereas radial and circumferential strain and rotational parameters were similar in both sexes. Accordingly, lower limits of normality for the strain components were -16.9% in men and -18.5% in women for longitudinal strain, and -15.4% for circumferential and 24.6% for radial strain, irrespective of sex. Longitudinal strain values were more negative at the base than at apical segments. Mean rotational values were -6.9° (standard deviation, 3.5°) for the base, 13.0° (standard deviation, 6.5°) for apical rotation, and 20.0° (standard deviation, 7.3°) for net twist. We report the comprehensive assessment of normal myocardial deformation and rotational mechanics in a large cohort of healthy volunteers. We found that women have more negative longitudinal strain, accounting for their higher left ventricular ejection fraction. Availability of reference values for these parameters may foster their implementation in the clinical routine. Copyright © 2013 Sociedad Española de Cardiología. Published by Elsevier Espana. All rights reserved.

  14. Circulating thrombopoietin levels in normal healthy blood donors and in aplastic anemia patients in relation to disease severity

    Directory of Open Access Journals (Sweden)

    Abhay Singh

    2015-01-01

    Full Text Available Background: Thrombopoietin (TPO is the key hematopoietic growth factor regulating the production of platelets from bone marrow megakaryocytes and maintaining platelet hemostasis. This study was done to find any relationship between the levels of thrombopoietin and the severity of disease in patients with aplastic anemia. Materials and Methods: Serum samples were collected from 52 patients with a confirmed diagnosis of aplastic anemia and 45 normal healthy blood donors of both sexes over a period of 2 years, and TPO was estimated by using commercially available TPO-specific-enzyme-linked immunosorbent assay. Results: The median TPO level of 1190 pg/ml (range 625-7651 pg/ml in aplastic anemia patients was significantly higher than the median TPO level of 121.1 pg/ml (81.25-237.7 pg/ml in normal healthy blood donors (P = 0.000. No significant difference was observed in TPO levels of male and female patients (P = 0.453. The median TPO concentrations observed in very severe aplastic anemia, severe aplastic anemia, and nonsevere aplastic anemia were 2765 pg/ml (range 625-6451 pg/ml, 1190 pg/ml (range 672.1-7651 pg/ml, and 1111.5 pg/ml (range 761.1-2289.2 pg/ml, respectively. TPO in patients of very severe aplastic anemia was significantly higher than patients of nonsevere aplastic anemia (P = 0.043, with no significant relation among rest of the groups. Discussion: TPO levels in aplastic anemia patients were significantly higher than in healthy blood donors; however, in aplastic anemia patients TPO levels were significantly higher only in patients with very severe disease.

  15. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  16. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  17. Restoration of a healthy intestinal microbiota normalizes portal hypertension in a rat model of nonalcoholic steatohepatitis.

    Science.gov (United States)

    García-Lezana, Teresa; Raurell, Imma; Bravo, Miren; Torres-Arauz, Manuel; Salcedo, María Teresa; Santiago, Alba; Schoenenberger, Andreu; Manichanh, Chaysavanh; Genescà, Joan; Martell, María; Augustin, Salvador

    2018-04-01

    Portal hypertension (PH) drives most of the clinical complications in chronic liver diseases. However, its progression in nonalcoholic steatohepatitis (NASH) and its association with the intestinal microbiota (IM) have been scarcely studied. Our aim was to investigate the role of the IM in the mechanisms leading to PH in early NASH. The experimental design was divided in two stages. In stage 1, Sprague-Dawley rats were fed for 8 weeks a high-fat, high-glucose/fructose diet (HFGFD) or a control diet/water (CD). Representative rats were selected as IM donors for stage 2. In stage 2, additional HFGFD and CD rats underwent intestinal decontamination, followed by IM transplantation with feces from opposite-diet donors (heterologous transplant) or autologous fecal transplant (as controls), generating four groups: CD-autotransplanted, CD-transplanted, HFGFD-autotransplanted, HFGFD-transplanted. After IM transplantation, the original diet was maintained for 12-14 days until death. HFGFD rats developed obesity, insulin resistance, NASH without fibrosis but with PH, intrahepatic endothelial dysfunction, and IM dysbiosis. In HFGFD rats, transplantation with feces from CD donors caused a significant reduction of PH to levels comparable to CD without significant changes in NASH histology. The reduction in PH was due to a 31% decrease of intrahepatic vascular resistance compared to the HFGFD-autotransplanted group (P protein kinase B-dependent endothelial nitric oxide synthase signaling pathway. The IM exerts a direct influence in the development of PH in rats with diet-induced NASH and dysbiosis; PH, insulin resistance, and endothelial dysfunction revert when a healthy IM is restored. (Hepatology 2018;67:1485-1498). © 2017 by the American Association for the Study of Liver Diseases.

  18. Regional relation between skin blood flow and sweating to passive heating and local administration of acetylcholine in young, healthy humans.

    Science.gov (United States)

    Smith, Caroline J; Kenney, W Larry; Alexander, Lacy M

    2013-04-01

    Regional variation in sweating over the human body is widely recognized yet variation in vasomotor responses and mechanisms causing this variation remain unclear. This study aimed to explore the relation between regional sweating rates (RSR) and skin blood flow (SkBF) responses to thermal and pharmacological stimuli in young, healthy subjects. In nine subjects (23 ± 3 yr), intradermal microdialysis (MD) probes were inserted into the ventral forearm, abdomen, thigh, and lower back and perfused with lactated Ringer solution. RSR over each MD membrane were measured using ventilated capsules with a laser Doppler probe housed in each capsule for measurement of red cell flux (laser Doppler flux, LDF) as an index of SkBF. Subjects completed a whole body heating protocol to 1°C rise in oral temperature and an acetylcholine dose response (ACh 1 × 10(-7)-0.1 M; mean skin temperature 34°C). Maximal LDF were obtained at the end of both protocols (50 mM sodium nitroprusside).During heating RSR varied among sites (P back versus other sites (P back: r = 0.86 ± 0.04) but not latter stages of heating. No differences in RSR (P = 0.160) or SkBF (LDF, P = 0.841) were observed between sites during ACh perfusion. Taken together, these data suggest that increases in SkBF are necessary to initiate and increase sweating, but further rises in RSR are not fully dependent on SkBF in a dose-response manner. Furthermore, RSR cannot be explained by cholinergic sensitivity or variation in SkBF.

  19. [Statistical (Poisson) motor unit number estimation. Methodological aspects and normal results in the extensor digitorum brevis muscle of healthy subjects].

    Science.gov (United States)

    Murga Oporto, L; Menéndez-de León, C; Bauzano Poley, E; Núñez-Castaín, M J

    Among the differents techniques for motor unit number estimation (MUNE) there is the statistical one (Poisson), in which the activation of motor units is carried out by electrical stimulation and the estimation performed by means of a statistical analysis based on the Poisson s distribution. The study was undertaken in order to realize an approximation to the MUNE Poisson technique showing a coprehensible view of its methodology and also to obtain normal results in the extensor digitorum brevis muscle (EDB) from a healthy population. One hundred fourteen normal volunteers with age ranging from 10 to 88 years were studied using the MUNE software contained in a Viking IV system. The normal subjects were divided into two age groups (10 59 and 60 88 years). The EDB MUNE from all them was 184 49. Both, the MUNE and the amplitude of the compound muscle action potential (CMAP) were significantly lower in the older age group (page than CMAP amplitude ( 0.5002 and 0.4142, respectively pphisiology of the motor unit. The value of MUNE correlates better with the neuromuscular aging process than CMAP amplitude does.

  20. Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...

  1. Expression and Localization of Peroxisome Proliferator-Activated Receptors and Nuclear Factor κB in Normal and Lesional Psoriatic Skin

    DEFF Research Database (Denmark)

    Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus

    2003-01-01

    Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...... activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology...

  2. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture.

    Science.gov (United States)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S

    2016-04-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Effects of an outdoor bicycle-based intervention in healthy rural Indian men with normal and low birth weight

    DEFF Research Database (Denmark)

    Madsen, C; Mogensen, P; Thomas, N

    2015-01-01

    Physical inactivity and low birth weight (LBW) may lead to an increased risk for developing type 2 diabetes. The extent to which LBW individuals may benefit from physical exercise training when compared with those with normal birth weight (NBW) controls is uncertain. We assessed the impact...... of an outdoor exercise intervention on body composition, insulin secretion and action in young men born with LBW and NBW in rural India. A total of 61 LBW and 56 NBW healthy young men were recruited into the study. The individuals were instructed to perform outdoor bicycle exercise training for 45 min every day...... with LBW in rural India benefit metabolically from exercise training to an extent comparable with NBW controls....

  4. Red and green laser Doppler compared with capillary microscopy to assess skin microcirculation in the feet of healthy subjects

    NARCIS (Netherlands)

    Tulevski, I. I.; Ubbink, D. T.; Jacobs, M. J.

    1999-01-01

    Skin microvasculature consists of nutritive capillaries and subpapillary arteriolar and venular plexus connected by arteriolovenular anastomoses. Capillary perfusion is of paramount importance for skin viability. Recently a new combined laser Doppler instrument has become available, featuring a

  5. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Science.gov (United States)

    Ruiz, Lorena; Espinosa-Martos, Irene; García-Carral, Cristina; Manzano, Susana; McGuire, Michelle K.; Meehan, Courtney L.; McGuire, Mark A.; Williams, Janet E.; Foster, James; Sellen, Daniel W.; Kamau-Mbuthia, Elizabeth W.; Kamundia, Egidioh W.; Mbugua, Samwel; Moore, Sophie E.; Kvist, Linda J.; Otoo, Gloria E.; Lackey, Kimberly A.; Flores, Katherine; Pareja, Rossina G.; Bode, Lars; Rodríguez, Juan M.

    2017-01-01

    Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα), acquired immunity factors (IL2, IL4, IL10, IL13, IL17), chemokines (IL8, Groα, MCP1, MIP1β), growth factors [IL5, IL7, epidermal growth factor (EGF), granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM), in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not) common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid. Clinical Trial Registration: www.ClinicalTrials.gov, identifier NCT02670278. PMID:28713365

  6. What’s normal? Oligosaccharide concentrations and profiles in milk produced by healthy women vary geographically12

    Science.gov (United States)

    Meehan, Courtney L; McGuire, Mark A; Foster, James; Sellen, Daniel W; Kamau-Mbuthia, Elizabeth W; Kamundia, Egidioh W; Mbugua, Samwel; Moore, Sophie E; Prentice, Andrew M; Kvist, Linda J; Otoo, Gloria E; Brooker, Sarah L; Price, William J; Shafii, Bahman; Placek, Caitlyn; Lackey, Kimberly A; Robertson, Bianca; Ruíz, Lorena; Pareja, Rossina G; Bode, Lars

    2017-01-01

    Background: Human milk is a complex fluid comprised of myriad substances, with one of the most abundant substances being a group of complex carbohydrates referred to as human milk oligosaccharides (HMOs). There has been some evidence that HMO profiles differ in populations, but few studies have rigorously explored this variability. Objectives: We tested the hypothesis that HMO profiles differ in diverse populations of healthy women. Next, we examined relations between HMO and maternal anthropometric and reproductive indexes and indirectly examined whether differences were likely related to genetic or environmental variations. Design: In this cross-sectional, observational study, milk was collected from a total of 410 healthy, breastfeeding women in 11 international cohorts and analyzed for HMOs by using high-performance liquid chromatography. Results: There was an effect of the cohort (P 4 times higher in milk collected in Sweden than in milk collected in rural Gambia (mean ± SEM: 473 ± 55 compared with 103 ± 16 nmol/mL, respectively; P < 0.05), and disialyllacto-N-tetraose (DSLNT) concentrations ranged from 216 ± 14 nmol/mL (in Sweden) to 870 ± 68 nmol/mL (in rural Gambia) (P < 0.05). Maternal age, time postpartum, weight, and body mass index were all correlated with several HMOs, and multiple differences in HMOs [e.g., lacto-N-neotetrose and DSLNT] were shown between ethnically similar (and likely genetically similar) populations who were living in different locations, which suggests that the environment may play a role in regulating the synthesis of HMOs. Conclusions: The results of this study support our hypothesis that normal HMO concentrations and profiles vary geographically, even in healthy women. Targeted genomic analyses are required to determine whether these differences are due at least in part to genetic variation. A careful examination of sociocultural, behavioral, and environmental factors is needed to determine their roles in this regard. This

  7. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Directory of Open Access Journals (Sweden)

    Lorena Ruiz

    2017-06-01

    Full Text Available Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα, acquired immunity factors (IL2, IL4, IL10, IL13, IL17, chemokines (IL8, Groα, MCP1, MIP1β, growth factors [IL5, IL7, epidermal growth factor (EGF, granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM, in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid.Clinical Trial Registration:www.ClinicalTrials.gov, identifier NCT02670278.

  8. The buccal cytome and micronucleus frequency is substantially altered in Down's syndrome and normal ageing compared to young healthy controls

    International Nuclear Information System (INIS)

    Thomas, Philip; Harvey, Sarah; Gruner, Tini; Fenech, Michael

    2008-01-01

    The buccal micronucleus cytome assay was used to investigate biomarkers for DNA damage, cell death and basal cell frequency in buccal cells of healthy young, healthy old and young Down's syndrome cohorts. With normal ageing a significant increase in cells with micronuclei (P < 0.05, average increase +366%), karyorrhectic cells (P < 0.001, average increase +439%), condensed chromatin cells (P < 0.01, average increase +45.8%) and basal cells (P < 0.001, average increase +233%) is reported relative to young controls. In Down's syndrome we report a significant increase in cells with micronuclei (P < 0.001, average increase +733%) and binucleated cells (P < 0.001, average increase +84.5%) and a significant decrease in condensed chromatin cells (P < 0.01, average decrease -52%), karyolytic cells (P < 0.001, average decrease -51.8%) and pyknotic cells (P < 0.001, average decrease -75.0%) relative to young controls. These changes show distinct differences between the cytome profile of normal ageing relative to that for a premature ageing syndrome, and highlight the diagnostic value of the cytome approach for measuring the profile of cells with DNA damage, cell death and proportion of cells with proliferative potential (i.e., basal cells). Significant correlations amongst cell death biomarkers observed in this study were used to propose a new model of the inter-relationship of cell types scored within the buccal micronucleus cytome assay. This study validates the use of a cytome approach to investigate DNA damage, cell death and cell proliferation in buccal cells with ageing

  9. Analysis of the diffusion tensor imaging parameters of a normal cervical spinal cord in a healthy population.

    Science.gov (United States)

    Wei, Liang-Feng; Wang, Shou-Sen; Zheng, Zhao-Cong; Tian, Jun; Xue, Liang

    2017-05-01

    Diffusion tensor imaging (DTI) shows great advantage in the diagnosis of brain diseases, including cervical spinal cord (CSC) disease. This study aims to obtain the normal values of the DTI parameters for a healthy population and to establish a baseline for CSC disease diagnosis using DTI. A total of 36 healthy adults were subjected to magnetic resonance imaging (MRI) for the entire CSC using the Siemens 3.0 T MR System. Sagittal DTI acquisition was carried out with a single-shot spin-echo echo-planar imaging (EPI) sequence along 12 non-collinear directions. Fractional anisotropy (FA) and apparent diffusion coefficient (ADC) values were determined at different cervical levels using a region of interest (ROI) method, following which they were correlated with parameters, like age and sex. Further, diffusion tensor tracking (DTT) was carried out to reconstruct the white matter fiber bundles of the CSC. The full and complete fiber bundle structure of a normal CSC was confirmed in both the T2-weighted and DTI images. The FA and ADC values were significantly negatively correlated with each other and showed strongly negative and positive correlations with age, respectively, but not with sex. Additionally, there was no significant difference between the FA and the ADC values at different cervical levels. The DTI technique can act as an important supplement to the conventional MRI technique for CSC observation. Moreover, the FA and ADC values can be used as sensitive parameters in the DTI study on the CSC by taking the effects of age into consideration.

  10. 'Aussie normals': an a priori study to develop clinical chemistry reference intervals in a healthy Australian population.

    Science.gov (United States)

    Koerbin, G; Cavanaugh, J A; Potter, J M; Abhayaratna, W P; West, N P; Glasgow, N; Hawkins, C; Armbruster, D; Oakman, C; Hickman, P E

    2015-02-01

    Development of reference intervals is difficult, time consuming, expensive and beyond the scope of most laboratories. The Aussie Normals study is a direct a priori study to determine reference intervals in healthy Australian adults. All volunteers completed a health and lifestyle questionnaire and exclusion was based on conditions such as pregnancy, diabetes, renal or cardiovascular disease. Up to 91 biochemical analyses were undertaken on a variety of analytical platforms using serum samples collected from 1856 volunteers. We report on our findings for 40 of these analytes and two calculated parameters performed on the Abbott ARCHITECTci8200/ci16200 analysers. Not all samples were analysed for all assays due to volume requirements or assay/instrument availability. Results with elevated interference indices and those deemed unsuitable after clinical evaluation were removed from the database. Reference intervals were partitioned based on the method of Harris and Boyd into three scenarios, combined gender, males and females and age and gender. We have performed a detailed reference interval study on a healthy Australian population considering the effects of sex, age and body mass. These reference intervals may be adapted to other manufacturer's analytical methods using method transference.

  11. Impact of the Make Healthy Normal mass media campaign (Phase 1) on knowledge, attitudes and behaviours: a cohort study.

    Science.gov (United States)

    Kite, James; Gale, Joanne; Grunseit, Anne; Bellew, William; Li, Vincy; Lloyd, Beverley; Maxwell, Michelle; Vineburg, John; Bauman, Adrian

    2018-06-01

    To determine the impact of the first phase of the Make Healthy Normal mass media campaign on NSW adults' active living and healthy eating knowledge, attitudes, intentions and behaviour. Cohort design with NSW adults, followed up three times over 12 months, with n=939 participants completing all three waves. We used generalised linear mixed models to examine campaign awareness, knowledge, attitudes, intentions and behaviours over time. Campaign recognition built to a reasonable level (45% at Wave 3), although unprompted recall was low (9% at Wave 3). There were significant increases in knowledge of physical activity recommendations (46% to 50%), the health effects of obesity (52% to 64%), and weight loss benefits (53% to 65%), with stronger effects in campaign recognisers. Conversely, we found declines in self-efficacy and intention to increase physical activity (39% to 31%) and decrease soft drink consumption (31% to 24%). Overall, there are some positives for the campaign but intentions need to be a focus of future campaign phases. Continued investment over the medium- to long-term is needed. Mass media campaigns can play a role in obesity prevention but robust evaluations are needed to identify the characteristics of effective campaigns. © 2018 The Authors.

  12. Comparison of two different neonatal skin care practices and their influence on transepidermal water loss in healthy newborns within first 10 days of life.

    Science.gov (United States)

    Raboni, R; Roberta, R; Patrizi, A; Cocchi, G; Faldella, G; Raone, B

    2014-10-01

    Physiologic post-partum skin adaptation to the relative dry extra-uterine environment is a dynamic process which begins immediately after birth. Considering the differences from adult skin, the neonatal skin is more prone to damage by environmental factors; therefore, skin care regimens should be age adapted to ensure a good epidermal maturation. The effects of two different skin care practices were evaluated by transepidermal water loss (TEWL) measurement in 94 newborns aged ≤ 10 days: group 1 (G1), newborns washed only with a cotton washcloth moistened with water; group 2 (G2), newborns washed with liquid baby cleansers and hydrated with moisturizers. These recordings were compared to TEWL baseline values of the same neonates and to adults' values. A prospective study was conducted in healthy full-term newborns, measuring TEWL with TEWAMETER® TM300. The areas tested were the volar forearm and the popliteal fossa. In G1 (52 subjects), TEWL mean values were 6.65 ± 2.81 SD (g/m2/h) at volar forearm and 7.49 ± 2.47 SD (g/m2/h) at popliteal fossa. In G2 (42 subjects), TEWL mean values were 8.83 ± 3.05 SD (g/m2/h) at volar forearm and 10.18 ± 3.64 SD (g/m2/h) at popliteal fossa. There were statistically significant differences of TEWL mean values between G1 and G2, newborns and adults, baseline and post-skin care procedures. Tested skin care regimens could influence the process of functional adaptation of skin, in the early postnatal period. We could hypothesize that daily washing with liquid baby cleansers and moisturizing may delay the natural maturation of skin barrier function.

  13. Biochemical composition of fetal fluids in at term, normal developed, healthy, viable dogs and preliminary data from pathologic littermates.

    Science.gov (United States)

    Veronesi, M C; Bolis, B; Faustini, M; Rota, A; Mollo, A

    2018-03-01

    A proper canine neonatal assistance, required to reduce the high perinatal loss rate, imply a full knowledge about the fetal-to-neonatal physiology. Because fetal fluids play an important role throughout mammals pregnancy, influencing fetal growth and development, fetal well being, and contributing to guarantee the most suitable environment for the fetus, the knowledge about fetal fluids biochemical composition is of major importance. At first, the biochemical composition of fetal fluids collected by normal developed, healthy and viable newborns, is necessary to depict the normal features, and represent the first step for the further detection of abnormalities associated to fetal/neonatal distress and useful for the early identification of newborns needing special attention, immediately after birth. The present study was aimed to define the biochemical composition of amniotic and allantoic fluids collected from fetus delivered by caesarean section at term of pregnancy. To reduce the possible confounding effect of maternal labor or troubles at parturition, fetal fluids were collected only from puppies born by elective caesaeran section, at term of normal pregnancies. Fetal fluids from 76 puppies, 70 normal and six pathologic newborns, born by elective caesarean section were collected and analyzed for alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin, lactate dehydrogenase (LDH), creatine-kinase (CK), alkaline phosphatase (ALP), creatinine, urea, amylase, lipase, gamma-glutamyl transferase (γ-GT), triglycerides, cholesterol, total proteins, albumin, globulins, glucose, magnesium, potassium, chloride, sodium, calcium, phosphorus and osmolarity. No significant differences were found between biochemical composition of amniotic or allantoic fluid in normal and pathologic newborns, maybe due to the small number of the pathologic puppies. Although some correlations between the two fluids were found (albumin, phosphorus, glucose and

  14. Multivariate relationships between international normalized ratio and vitamin K-dependent coagulation-derived parameters in normal healthy donors and oral anticoagulant therapy patients

    Directory of Open Access Journals (Sweden)

    Golanski Jacek

    2003-11-01

    Full Text Available Abstract Background and objectives International Normalized Ratio (INR is a world-wide routinely used factor in the monitoring of oral anticoagulation treatment (OAT. However, it was reported that other factors, e. g. factor II, may even better reflect therapeutic efficacy of OAT and, therefore, may be potentialy useful for OAT monitoring. The primary purpose of this study was to characterize the associations of INR with other vitamin K-dependent plasma proteins in a heterogenous group of individuals, including healthy donors, patients on OAT and patients not receiving OAT. The study aimed also at establishing the influence of co-morbid conditions (incl. accompanying diseases and co-medications (incl. different intensity of OAT on INR. Design and Methods Two hundred and three subjects were involved in the study. Of these, 35 were normal healthy donors (group I, 73 were patients on medication different than OAT (group II and 95 were patients on stable oral anticoagulant (acenocoumarol therapy lasting for at least half a year prior to the study. The values of INR and activated partial thromboplastin time (APTT ratio, as well as activities of FII, FVII, FX, protein C, and concentration of prothrombin F1+2 fragments and fibrinogen were obtained for all subjects. In statistical evaluation, the uni- and multivariate analyses were employed and the regression equations describing the obtained associations were estimated. Results Of the studied parameters, three (factors II, VII and X appeared as very strong modulators of INR, protein C and prothrombin fragments F1+2 had moderate influence, whereas both APTT ratio and fibrinogen had no significant impact on INR variability. Due to collinearity and low tolerance of independent variables included in the multiple regression models, we routinely employed a ridge multiple regression model which compromises the minimal number of independent variables with the maximal overall determination coefficient. The best

  15. Myocardial infarction during anaphylaxis in a young healthy male with normal coronary arteries- is epinephrine the culprit?

    Science.gov (United States)

    Jayamali, W D; Herath, H M M T B; Kulathunga, Aruna

    2017-09-04

    Anaphylaxis is an acute, potentially fatal medical emergency. Myocardial injury or infarction in the setting of an anaphylaxis can be due the anaphylaxis itself, when it is known as Kounis syndrome or it can also be due to the effect of epinephrine treatment. Epinephrine is considered as the cornerstone in management of anaphylaxis. Myocardial infarction secondary to therapeutic doses of adrenaline is a rare occurrence and only a few cases have been reported in literature. The mechanism of myocardial injury was considered to be due to coronary vasospasm secondary to epinephrine as the coronary angiograms were normal on these occasions. A 21-year- old previously healthy male got admitted to the local hospital with an urticarial rash and difficulty in breathing, one hour after ingestion of prawns for which he was known to be allergic. He was treated with 0.5 ml of intramuscular adrenaline (1:1000) which was administered to the lateral side of the thigh, following which he developed palpitations and tightening type central chest pain. Electrocardiogram showed ST segment depressions in leads III, aVF and V1 to V5 and he was transferred to a tertiary care hospital. The second electrocardiogram, done 2 h later, showed resolution of ST segment depressions but new T inversions in leads I and aVL. Troponin I was elevated with a titer of 2.15 ng/ml. He was treated with sublingual GTN in the emergency treatment unit and the symptoms resolved. Transthoracic 2D echocardiogram and stress testing with treadmill was normal and CT coronary angiogram revealed normal coronary arteries. Here we present a case of a young healthy adult with no significant risk factors for coronary artery disease who developed myocardial infarction following intramuscular administration of therapeutic dose of adrenalin for an anaphylactic reaction. The postulated mechanism is most likely an alpha receptor mediated coronary vascular spasm. However the use of adrenaline in the setting of life

  16. Factors associated with metabolically healthy status in obesity, overweight, and normal weight at baseline of ELSA-Brasil

    Science.gov (United States)

    Diniz, Maria de Fátima Haueisen Sander; Beleigoli, Alline Maria Rezende; Ribeiro, Antônio Luiz P.; Vidigal, Pedro Guatimosim; Bensenor, Isabela M.; Lotufo, Paulo A.; Duncan, Bruce B.; Schmidt, Maria Inês; Barreto, Sandhi Maria

    2016-01-01

    Abstract The primary aim of this study was to evaluate metabolically healthy status (MHS) among participants in obesity, overweight, and normal weight groups and characteristics associated with this phenotype using baseline data of Brazilian Longitudinal Study of Adult Health (ELSA-Brasil). The secondary aim was to investigate agreement among 4 different MHS criteria. This cross-sectional study included 14,545 participants aged 35 to 74 years with a small majority (54.1%) being women. Of all participants, 22.7% (n = 3298) were obese, 40.8% (n = 5934) were overweight, and 37.5% (n = 5313) were of normal weight. Socio-demographic, behavioral, and anthropometric factors related to MHS were ascertained. Logistic regression models estimated the odds of associations. We used 4 different criteria separately and in combination to define MHS: the National Health and Nutrition Examination Survey (NHANES), the National Cholesterol Education Program (NCEP-ATPIII), the International Diabetes Federation (IDF) and comorbidities, and the agreement between them were evaluated by Cohen-kappa coefficient. MHS was present among 12.0% (n = 396) of obese, 25.5% (n = 1514) of overweight, and 48.6% (n = 2582) of normal weight participants according to the combination of the 4 criteria. The agreement between all the 4 MHS criteria was strong (kappa 0.73 P < 0.001). In final logistic models, MHS was associated with lower age, female sex, lower body mass index (BMI), and weight change from age 20 within all BMI categories. This study showed that, despite differences in prevalence among the 4 criteria, MHS was associated with common characteristics at every BMI category. PMID:27399079

  17. Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

    DEFF Research Database (Denmark)

    Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke

    2009-01-01

    BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess the diagn......BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...

  18. Normal tissue tolerance to external beam radiation therapy: Skin; Dose de tolerance des tissus sains: la peau et les phaneres

    Energy Technology Data Exchange (ETDEWEB)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)

    2010-07-15

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  19. Topical microemulsion containing Punica granatum extract: its control over skin erythema and melanin in healthy Asian subjects.

    Science.gov (United States)

    Parveen, Rashida; Akhtar, Naveed; Mahmood, Tariq

    2014-12-01

    Punica granatum is apotent source of polyphenolic compounds with strong free radicals scavenging activity. The skin lightening effects of Punica granatum are assumed due to ellagic acid which acts by chelating copper at the active site of tyrosinase. To explore a topical microemulsion (O/W) of pomegranate (Punica granatum) extract for its control on skin erythema and melanin. Microemulsions were formulated using a polysorbate surfactant (Tween 80(®)) along with cosurfactant (propylene glycol) and were characterized regarding their stability. The placebo microemulsion (without extract) and the active microemulsion (containing Punica extract) were applied in a split face fashion by the volunteers (n = 11) for a period of 12 weeks. Skin erythema and melanin were measured at baseline and after every 15 days to determine any effect produced by these formulations. Active formulation showed a significant impact on skin erythema and melanin (p Punica granatum extract for conditions where elevated skin melanin and erythema have significantly prone skin physiology.

  20. Tenskinmetric Evaluation of Surface Energy Changes in Adult Skin: Evidence from 834 Normal Subjects Monitored in Controlled Conditions

    Directory of Open Access Journals (Sweden)

    Camilla Dal Bosco

    2014-03-01

    Full Text Available To evaluate the influence of the skin aging critical level on the adult skin epidermal functional state, an improved analytical method based on the skin surface energetic measurement (TVS modeling was developed. Tenskinmetric measurements were carried out non-invasively in controlled conditions by contact angle method using only a water-drop as reference standard liquid. Adult skin was monitored by TVS Observatory according to a specific and controlled thermal protocol (Camianta protocol in use at the interconnected “Mamma Margherita Terme spa” of Terme Euganee. From June to November 2013, the surface free energy and the epidermal hydration level of adult skin were evaluated on arrival of 265 male and 569 female adult volunteers (51–90 years of age and when they departed 2 weeks later. Sensitive measurements were carried out at 0.1 mN/m. High test compliance was obtained (93.2% of all guests. Very interesting results are obtained. The high sensitivity and discrimination power of tenskinmetry combined with a thermal Camianta protocol demonstrate the possibility to evaluate at baseline level the surface energetic changes and the skin reactivity which occurs on adult skin.

  1. Host-cell reactivation of UV-irradiated and chemically-treated herpes simplex virus-1 by xeroderma pigmentosum, xp heterozygotes and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1978-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)

  2. Radiosensitivity of fibroblasts obtained from a cafe-au-lait spot and normal-appearing skin of a patient with neurofibromatosis (NF-6)

    International Nuclear Information System (INIS)

    Hannan, M.A.; Smith, B.P.; Sigut, D.; Sackey, K.

    1990-01-01

    Fibroblast cells derived from a cafe-au-lait spot and normal-appearing skin of a neurofibromatosis (NF-6) patient were studied for radiosensitivity in comparison with two normal cell lines used as controls. No difference in radiosensitivity was observed between the patient's cell lines and the controls using acute gamma-irradiation. However, a markedly increased radiosensitivity of the fibroblasts obtained from the patient's skin of normal appearance was demonstrated after chronic gamma-irradiation. The cells from the cafe-au-lait spot showed intermediate sensitivity to chronic irradiation as compared with the control cell lines and the fibroblasts derived from the normal skin of the patient. These results showed the usefulness of chronic irradiation in detecting increased cellular radiosensitivity which may result from a unique DNA repair defect in an NF patient. We suggest that enhanced genetic changes in radiosensitive NF patients may lead to formation of cafe-au-lait lesions and certain tumors. Such a transformation may be associated with production of radiotolerant cells

  3. Skin Graft

    OpenAIRE

    Shimizu, Ruka; Kishi, Kazuo

    2012-01-01

    Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

  4. Efficacy of keishibukuryogan, a traditional Japanese herbal medicine, in treating cold sensation and numbness after stroke: clinical improvement and skin temperature normalization in 22 stroke patients.

    Science.gov (United States)

    Fujita, Keishi; Yamamoto, Tetsuya; Kamezaki, Takao; Matsumura, Akira

    2010-01-01

    Cold sensation and numbness have been reported as post-stroke sensory sequelae attributable to distal axonopathy, which is caused by chronic ischemia of diseased limbs resulting from dysfunction of vasomotor regulatory systems. Keishibukuryogan is a traditional herbal medicine used to treat symptoms of peripheral ischemia such as cold extremities. This study investigated clinical improvement and skin temperature in peripheral ischemia patients to determine the efficacy of keishibukuryogan in alleviating post-stroke cold sensation and numbness. Twenty-two stroke patients with cold sensation and/or numbness were enrolled in this study. Subjective cold sensation and numbness, evaluated using the visual analogue scale, were found in 21 and 31 limbs, respectively. The skin temperature of diseased and healthy limbs was recorded. We observed all patients for 4 weeks and 17 patients for 8 weeks after administration of keishibukuryogan. The skin temperature of diseased limbs was significantly higher than baseline at 4 weeks and 8 weeks, whereas that of healthy limbs did not change significantly. Cold sensation and numbness were significantly improved at 4 weeks and 8 weeks compared to baseline. Keishibukuryogan administration resulted in warming of diseased limbs and improved cold sensation and numbness, probably by increasing peripheral blood flow.

  5. A comparison of whole body vibration and moist heat on lower extremity skin temperature and skin blood flow in healthy older individuals.

    Science.gov (United States)

    Lohman, Everett B; Sackiriyas, Kanikkai Steni Balan; Bains, Gurinder S; Calandra, Giovanni; Lobo, Crystal; Nakhro, Daniel; Malthankar, Gauri; Paul, Sherwine

    2012-07-01

    Tissue healing is an intricate process that is regulated by circulation. Heat modalities have been shown to improve skin circulation. Recent research supports that passive vibration increases circulation without risk of burns. Study purpose is to compare and determine effects of short duration vibration, moist heat, and a combination of the two on skin blood flow (SBF) and skin temperature (ST) in elderly, non-diabetic individuals following short-term exposure. Ten subjects, 3 female and 7 male (55-73 years of age), received two interventions over three days: 1--Active vibration, 2--passive vibration, 3--moist heat, 4--moist heat combined with passive vibration (MHPV), 5--a commercial massaging heating pad, and 6--no intervention. SBF and ST were measured using a MOOR Laser Doppler before and after the intervention and the third measurement were taken 10 minutes following. Mean SBF following a ten-minute intervention were significantly different in the combination of moist heat and passive vibration from the control, active vibration, and the commercial massaging heating pad. Compared to baseline measurements, this resulted in mean SBF elevation to 450% (at conclusion of 10 minutes of intervention) and 379% (10 minutes post). MHPV (p=0.02) showed significant changes in ST from the commercial massaging heating pad, passive vibration, and active vibration interventions. SBF in the lower legs showed greatest increase with MHPV. Interventions should be selected that are low risk while increasing lower extremity skin blood flow.

  6. Host-cell reactivation of uv-irradiated and chemically treated Herpes simplex virus type 1 strain MP in normal and xeroderma pigmentosum skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1976-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants

  7. The thermoregulation of healthy individuals, overweight-obese, and diabetic from the plantar skin thermogram: a clue to predict the diabetic foot.

    Science.gov (United States)

    Renero-C, Francisco-J

    2017-01-01

    Background : Thermoregulation is a complex autonomic process to keep or to dissipate heat in the human body. Methods : In this work, by means of the thermogram of the plantar skin, the thermoregulation of healthy individuals, overweight-obese, and diabetic is discussed. Results : The thermograms of the plantar skin, for the healthy individuals, are: (1) symmetrical, the temperature distribution of the right foot being a mirror image of that of the left foot ; (2) the thermograms of women, on average, are 3°C colder than those of the men; and (3) the temperature distributions decrease distally from the medial longitudinal arch. The plantar skin thermograms of overweight-obese individuals show: (1) increased average temperature of both feet and for both genders; (2) no symmetry between the left and right feet thermograms; and (3) the temperature distribution is still decreasing from the medial longitudinal arch to the periphery of the foot. However, the standard deviation, for each averaged temperature of the angiosomes, shows greater uncertainty. Most thermograms of diabetic individuals show temperature increase on the plantar skin, and are mostly symmetric between left and right feet. Conclusions: An asymmetric thermogram of the plantar skin of diabetic individuals, where one foot is hotter than the other, may mean that the coldest foot is losing the capacity to communicate properly with the central nervous system and/or that vasoconstriction/vasodilatation is having problems in regulating the passing of blood through the vessels. Thus, the asymmetric thermograms of diabetic patients, and particularly those coldest regions of foot are of interest, because of the reduction of the local autonomic sensing and the lack of achieving properly the passing of the blood.

  8. Additive insulinogenic action of Opuntia ficus-indica cladode and fruit skin extract and leucine after exercise in healthy males

    Science.gov (United States)

    2013-01-01

    Background Oral intake of a specific extract of Opuntia ficus-indica cladode and fruit skin (OpunDia™) (OFI) has been shown to increase serum insulin concentration while reducing blood glucose level for a given amount of glucose ingestion after an endurance exercise bout in healthy young volunteers. However, it is unknown whether OFI-induced insulin stimulation after exercise is of the same magnitude than the stimulation by other insulinogenic agents like leucine as well as whether OFI can interact with those agents. Therefore, the aims of the present study were: 1) to compare the degree of insulin stimulation by OFI with the effect of leucine administration; 2) to determine whether OFI and leucine have an additive action on insulin stimulation post-exercise. Methods Eleven subjects participated in a randomized double-blind cross-over study involving four experimental sessions. In each session the subjects successively underwent a 2-h oral glucose tolerance test (OGTT) after a 30-min cycling bout at ~70% VO2max. At t0 and t60 during the OGTT, subjects ingested 75 g glucose and capsules containing either 1) a placebo; 2) 1000 mg OFI; 3) 3 g leucine; 4) 1000 mg OFI + 3 g leucine. Blood samples were collected before and at 30-min intervals during the OGTT for determination of blood glucose and serum insulin. Results Whereas no effect of leucine was measured, OFI reduced blood glucose at t90 by ~7% and the area under the glucose curve by ~15% and increased serum insulin concentration at t90 by ~35% compared to placebo (P<0.05). From t60 to the end of the OGTT, serum insulin concentration was higher in OFI+leucine than in placebo which resulted in a higher area under the insulin curve (+40%, P<0.05). Conclusion Carbohydrate-induced insulin stimulation post-exercise can be further increased by the combination of OFI with leucine. OFI and leucine could be interesting ingredients to include together in recovery drinks to resynthesize muscle glycogen faster post

  9. Malassezia intra-specific diversity and potentially new species in the skin microbiota from Brazilian healthy subjects and seborrheic dermatitis patients.

    Directory of Open Access Journals (Sweden)

    Renan Cardoso Soares

    Full Text Available Malassezia yeasts are part of the resident cutaneous microbiota, and are also associated with skin diseases such as seborrheic dermatitis (SD. The role these fungi play in skin diseases and why they are pathogenic for only some individuals remain unclear. This study aimed to characterize Malassezia microbiota from different body sites in healthy and SD subjects from Brazil. Scalp and forehead samples from healthy, mild SD and severe SD subjects were collected. Non-scalp lesions from severe SD patients were also sampled. 5.8S rDNA/ITS2 amplicons from Malassezia sp. were analyzed by RFLP and sequencing. Results indicate that Malassezia microbiota did not group according to health condition or body area. Phylogenetic analysis revealed that three groups of sequences did not cluster together with any formally described species, suggesting that they might belong to potential new species. One of them was found in high proportions in scalp samples. A large variety of Malassezia subtypes were detected, indicating intra-specific diversity. Higher M. globosa proportions were found in non-scalp lesions from severe SD subjects compared with other areas, suggesting closer association of this species with SD lesions from areas other than scalp. Our results show the first panorama of Malassezia microbiota in Brazilian subjects using molecular techniques and provide new perspectives for further studies to elucidate the association between Malassezia microbiota and skin diseases.

  10. Effects of the Healthy Start randomized intervention on dietary intake among obesity-prone normal-weight children.

    Science.gov (United States)

    Rohde, Jeanett F; Larsen, Sofus C; Ängquist, Lars; Olsen, Nanna J; Stougaard, Maria; Mortensen, Erik L; Heitmann, Berit L

    2017-11-01

    The study aimed to evaluate the impact of a 15-month intervention on dietary intake conducted among obesity-prone normal-weight pre-school children. Information on dietary intake was obtained using a 4 d diet record. A diet quality index was adapted to assess how well children's diet complied with the Danish national guidelines. Linear regression per protocol and intention-to-treat analyses of differences in intakes of energy, macronutrients, fruit, vegetables, fish, sugar-sweetened beverages and diet quality index between the two groups were conducted. The Healthy Start study was conducted during 2009-2011, focusing on changing diet, physical activity, sleep and stress management to prevent excessive weight gain among Danish children. From a population of 635 Danish pre-school children, who had a high birth weight (≥4000 g), high maternal pre-pregnancy BMI (≥28·0 kg/m2) or low maternal educational level (dietary intake. Children in the intervention group had a lower energy intake after the 15-month intervention (group means: 5·29 v. 5·59 MJ, P=0·02) compared with the control group. We observed lower intakes of carbohydrates and added sugar in the intervention group compared with the control group after the intervention (P=0·002, P=0·01). The intervention resulted in a lower energy intake, particularly from carbohydrates and added sugar after 15 months of intervention, suggesting that dietary intake can be changed in a healthier direction in children predisposed to obesity.

  11. DNA damages induced in human lymphocytes by UV or X-rays and repair capacities of healthy donors and skin cancer patients

    International Nuclear Information System (INIS)

    Cebulska-Wasilewska, A.; Dyga, W.; Budzanowska, E.

    1999-01-01

    The aim of this study was to compare variation in the individual susceptibility of various donors to the induction of the DNA damage by genotoxic agents and their cellular capabilities to repair induced damage. DNA damages induced by UV or X-rays in lymphocytes and cellular repair capability of healthy donors and persons bearing various categories of skin cancer cells were investigated. Fresh blood was collected by venipuncture from 35 individuals (including nine prior to skin cancer treatment). All cancer patients were nonsmoking males, however 42.3 % of them were former smokers. All healthy donors were also males, an average age was 38.6 y and among them 68% were recent or former smokers. Immediately after collecting samples, lymphocytes were isolated and stored at -70 o C for further studies in vitro. Previously cryopreserved lymphocytes were defrosted and viability of the cells was investigated. The single cell gel electrophoresis assay (SCGE), known as a Comet assay, was performed in defrozen lymphocytes to evaluate individual DNA damage levels presented in lymphocytes at the time of sample's collection. To compare individual susceptibility to the induction of DNA damage by UV and ionizing radiation, lymphocytes were exposed to dose of 6 J/m 2 of UV or 2 Gy of X-rays and DNA damages were detected again with an application of the Comet assay. Additionally, to study variation in the individuals cellular capability to repair damages induced, prior to the DNA damage analysis an incubation of cells exposed was also done in presence or absence of phytohemagglutinin (cell divisions processes starting agent). Results showed in untreated lymphocytes of skin cancer patients significantly higher than in the reference group levels of the DNA damages. Significantly different responses to UV and significantly lower capabilities to repair UV induced damage in skin cancer patients were observed. On the average, no differences between reference group and skin cancer patients

  12. A frequência do HPV na mucosa oral normal de indivíduos sadios por meio da PCR The frequency of human papillomavirus findings in normal oral mucosa of healthy people by PCR

    Directory of Open Access Journals (Sweden)

    David Esquenazi

    2010-02-01

    Full Text Available Os papilomavírus humanos (HPV são DNA vírus pertencentes à família papilomaviridae com grupos de baixo e alto risco que infectam a pele e a mucosa podendo induzir a formação de tumores epiteliais benignos e malignos. Na mucosa oral, estes vírus têm sido associados a papilomas orais, hiperplasias epiteliais focais, leucoplasias e neoplasias orais. OBJETIVO: Estudar a frequência do HPV em mucosa oral de indivíduos normais. MATERIAL E MÉTODO: Trabalho prospectivo em coorte transversal. Participaram desse estudo 100 indivíduos voluntários, faixa etária de 20 a 31 anos, estudantes universitários, sem história, queixas ou lesões visíveis ao exame físico de cavidade oral e orofaringe. Foram submetidos a questionário com perguntas referentes à epidemiologia da infecção pelo HPV. Foi colhido material de mucosa oral por raspado com escova e analisado pelo PCR. RESULTADOS: Os resultados mostraram ausência de HPV em todas as amostras. CONCLUSÃO: Parece ter havido participação do alto nível socioeconômico com alimentação rica em carotenoides e vitamina C, baixo consumo tabágico e etílico e comportamento heterossexual predominantemente monogâmico com uso regular de preservativos.The human papillomavirus (HPV is a DNA virus, which belongs to papillomaviridae family, being of low and high risk, which infect the skin and mucous membranes and can induce benign and malign tumor formation. In the oral mucosa they have been associated with oral papilloma, focal epithelial hyperplasia, leucoplakia and oral neoplasia. AIM: to study the frequency of HPV finding in oral mucosa of normal people. MATERIALS AND METHODS: Prospective study, cross-sectional cohort. One hundred volunteers, young adults, healthy, aged between 20 and 31 years, university students with no history, no complains, without oral or oropharyngeal lesions. They were submitted to a questionnaire with questions regarding HPV infection epidemiology. The samples were

  13. Using Skin Carotenoids to Assess Dietary Changes in Students After 1 Academic Year of Participating in the Shaping Healthy Choices Program.

    Science.gov (United States)

    Beccarelli, Lori M; Scherr, Rachel E; Dharmar, Madan; Ermakov, Igor V; Gellermann, Werner; Jahns, Lisa; Linnell, Jessica D; Keen, Carl L; Steinberg, Francene M; Young, Heather M; Zidenberg-Cherr, Sheri

    2017-01-01

    To determine whether fourth-grade students participating in the Shaping Healthy Choices Program (SHCP), a school-based nutrition intervention, would change vegetable and carotenoid intake measured by skin carotenoids and dietary intake. Single-group pretest-posttest with a self-selected, convenience sample of students (n = 30) participating in the SHCP, which lasted 1 academic year (9 months). Dietary intake of vegetables and carotenoids as measured by Block food frequency questionnaire and skin carotenoids as measured by Raman spectroscopy were collected at the school preintervention and postintervention. Reported carotenoid intake decreased by 1.5 mg (P = .05) and skin carotenoids decreased by 2,247.9 RRS intensity units (P = .04). Change in reported intake correlated with change in skin carotenoids (r = .43; P = .02). The reported decrease in vegetable and carotenoid intake was unanticipated; nevertheless, the RRS measurements confirmed this. RRS data can help evaluate changes in fruit and vegetable intake. Copyright © 2016 Society for Nutrition Education and Behavior. All rights reserved.

  14. Delayed-type hypersensitivity skin test responses to PPD and other antigens among BCG-vaccinated HIV-1-infected and healthy children and adolescents.

    Science.gov (United States)

    Costa, Natalia Moriya Xavierda; Albuquerque, Maly de; Lins, Janaína Bacelar Acioli; Alvares-Junior, João Teixeira; Stefani, Mariane Martins de Araújo

    2011-10-01

    Among HIV-1-infected patients, CD4+ T cell counts are well-established markers of cell-mediated immunity. Delayed-type hypersensitivity (DTH) skin tests can be used to evaluate in vivo cell-mediated immunity to common antigens. DTH responses to tuberculin purified protein derivative (PPD), sporotrichin, trichophytin, candidin and streptokinase/streptodornase antigens were assessed. Thirty-six HIV-1-infected children/adolescents and 56 age- and sex-matched HIV-1/HIV-2-seronegative participants were tested. All participants had a BCG scar. Fisher's exact test was used to evaluate significant differences between groups (pPPD positivity prevailed among healthy participants (40/56, 71.4%). PPD reactivity in the HIV-1-positive group was 8.3% (pPPD induration was 2.5mm (range: 2-5mm) in the HIV-1 group and 6.0 mm among healthy participants (range: 3-15 mm). There was no correlation between PPD positivity and age. No correlation between CD4+ T cell counts and DTH reactivity was observed among HIV-1-infected patients. DTH skin test responses, including PPD reactivity, were significantly lower among HIV-1-infected participants compared to healthy controls, which likely reflects advanced disease and T cell depletion.

  15. Principle component analysis and linear discriminant analysis of multi-spectral autofluorescence imaging data for differentiating basal cell carcinoma and healthy skin

    Science.gov (United States)

    Chernomyrdin, Nikita V.; Zaytsev, Kirill I.; Lesnichaya, Anastasiya D.; Kudrin, Konstantin G.; Cherkasova, Olga P.; Kurlov, Vladimir N.; Shikunova, Irina A.; Perchik, Alexei V.; Yurchenko, Stanislav O.; Reshetov, Igor V.

    2016-09-01

    In present paper, an ability to differentiate basal cell carcinoma (BCC) and healthy skin by combining multi-spectral autofluorescence imaging, principle component analysis (PCA), and linear discriminant analysis (LDA) has been demonstrated. For this purpose, the experimental setup, which includes excitation and detection branches, has been assembled. The excitation branch utilizes a mercury arc lamp equipped with a 365-nm narrow-linewidth excitation filter, a beam homogenizer, and a mechanical chopper. The detection branch employs a set of bandpass filters with the central wavelength of spectral transparency of λ = 400, 450, 500, and 550 nm, and a digital camera. The setup has been used to study three samples of freshly excised BCC. PCA and LDA have been implemented to analyze the data of multi-spectral fluorescence imaging. Observed results of this pilot study highlight the advantages of proposed imaging technique for skin cancer diagnosis.

  16. Risk of sensitization in healthy adults following repeated administration of rdESAT-6 skin test reagent by the Mantoux injection technique

    DEFF Research Database (Denmark)

    Lillebaek, Troels; Bergstedt, Winnie; Tingskov, Pernille N

    2009-01-01

    1 open clinical trial was to assess the sensitization risk and safety of repeated administration of rdESAT-6 reagent in 31 healthy adult volunteers. Three groups of volunteers received two fixed doses of 0.1 microg rdESAT-6 28, 56 or 112 days apart, respectively. After the second injection...... of 31 (3%) volunteers showed a positive skin reaction (sensitization) upon a second injection of rdESAT-6 after 28days and an increased IFN-gamma response to ESAT-6. For 7 (23%) of the volunteers, local adverse reactions related to the product were registered, but all reactions were mild and predictable...

  17. Changes in skin blood flow during the menstrual cycle: the influence of the menstrual cycle on the peripheral circulation in healthy female volunteers.

    Science.gov (United States)

    Bartelink, M L; Wollersheim, H; Theeuwes, A; van Duren, D; Thien, T

    1990-05-01

    1. It is known that females have a lower skin perfusion than males. In women there are also differences in blood flow at different reproductive stages of their lives. As an initial investigation of the possible contribution of sex hormones to these differences, we studied skin and forearm blood flow during the natural changes in hormone levels which occur during the menstrual cycle. 2. Thirty-one healthy female volunteers were studied. The effect of a standardized finger cooling test (immersion of a gloved hand in a 16 degrees C water bath) on finger skin temperature and on laser Doppler flux in the finger, and forearm blood flow (strain gauge venous occlusion plethysmography) was assessed at four different times during one cycle: during menstruation, 1 day before ovulation, 2 days after ovulation and at the mid-luteal phase. Test days were determined by daily measurements of basal body temperature and were confirmed afterwards by determinations of serum luteinizing hormone, follicle-stimulating hormone, 17 beta-oestradiol and progesterone. 3. Peripheral skin circulation varied significantly within one menstrual cycle. The extremes were a mean finger skin temperature of 25.9 +/- 3.0 degrees C in the luteal phase compared with 28.4 +/- 3.7 degrees C in the pre-ovulatory phase (P = 0.002). The respective values for the mean laser Doppler flux were 18.4 +/- 10.9 compared with 29.2 +/- 16.4 arbitrary units (P = 0.003). 4. Baseline forearm muscle blood flow also varied significantly (P = 0.04) within one menstrual cycle, with low values in the menstrual phase compared with the other phases.(ABSTRACT TRUNCATED AT 250 WORDS)

  18. Effects of topical corticosteroid and tacrolimus on ceramides and irritancy to sodium lauryl sulphate in healthy skin

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellegren, Lars I

    2011-01-01

    twice daily for one week with betamethasone, tacrolimus, emollient, or left untreated, respectively. After one week each area was challenged with a 24 h sodium lauryl sulphate patch test. The lipids were collected using the cyanoacrylate method and evaluated by high performance thin layer chromatography......The skin barrier, located in the stratum corneum, is influenced mainly by the lipid and protein composition of this layer. In eczematous diseases impairment of the skin barrier is thought to be of prime importance. Topical anti-inflammatory drugs and emollients are the most widely used eczema...

  19. Motivation and perceived competence for healthy eating and exercise among overweight/obese adolescents in comparison to normal weight adolescents

    OpenAIRE

    Mokhtari, Suzanne; Grace, Benjamin; Pak, Youngju; Reina, Astrid; Durand, Quinn; Yee, Jennifer K.

    2017-01-01

    Background The current literature on determinants of behavior change in weight management lacks sufficient studies on type of motivation among children/adolescents, on perceived competence, and in relation to healthy eating. This study aimed to investigate type of motivation and levels of perceived competence for healthy diet and exercise, as well as general self efficacy among adolescents. We hypothesized that overweight/obese adolescents would demonstrate lower autonomous motivation and per...

  20. Helicobacter Pylori Associated Antral Gastritis in Peptic Ulcer Disease Patients and Normal Healthy Population of Kashmir, India

    OpenAIRE

    Gh. Jeelani Romshoo; G. M. Malik; M. Youssuf Bhat; Ab. Rashid rather; Javaid Ahmad Basu; Khursheed Ahmad Qureshi

    1998-01-01

    Aim: To study the association of Helicobacter pylori infection with chronic antral gastritis in peptic ulcer disease patients and healthy population of Kashmir. Methods: 50 peptic ulcer patients (duodenal ulcer = 46, gastric ulcer = 2 and combined duodenal and gastric ulcer = 2) and 30 asymptomatic healthy volunteers were included in this study. Peptic ulcer was diagnosed on endoscopic examination. 4–6 punch biopsies were taken from gastric antrum in all the individuals and in case of gastric...

  1. Using skin carotenoids to assess potential dietary changes after one academic year in the Shaping Healthy Choices Program

    Science.gov (United States)

    Reported dietary intake is often used in community interventions to assess intake of fruits and vegetables (F/V); however, dietary assessment methods are inaccurate, and time and labor intensive. Skin carotenoids are a potential biomarker to assess F/V intake given that carotenoids are predominately...

  2. Effect of venous and lymphatic congestion on lymph capillary pressure of the skin in healthy volunteers and patients with lymph edema.

    Science.gov (United States)

    Gretener, S B; Läuchli, S; Leu, A J; Koppensteiner, R; Franzeck, U K

    2000-01-01

    The aim of the present study was to assess the influence of venous and lymphatic congestion on lymph capillary pressure (LCP) in the skin of the foot dorsum of healthy volunteers and of patients with lymph edema. LCP was measured at the foot dorsum of 12 patients with lymph edema and 18 healthy volunteers using the servo-nulling technique. Glass micropipettes (7-9 microm) were inserted under microscopic control into lymphatic microvessels visualized by fluorescence microlymphography before and during venous congestion. Venous and lymphatic congestion was attained by cuff compression (50 mm Hg) at the thigh level. Simultaneously, the capillary filtration rate was measured using strain gauge plethysmography. The mean LCP in patients with lymph edema increased significantly (p < 0.05) during congestion (15.7 +/- 8.8 mm Hg) compared to the control value (12.2 +/- 8.9 mm Hg). The corresponding values of LCP in healthy volunteers were 4.3 +/- 2.6 mm Hg during congestion and 2.6 +/- 2.8 mm Hg during control conditions (p < 0.01). The mean increase in LCP in patients with lymph edema was 3.4 +/- 4.1 mm Hg, and 1.7 +/- 2.0 mm Hg in healthy volunteers (NS). The maximum spread of the lymph capillary network in patients increased from 13.9 +/- 6.8 mm before congestion to 18.8 +/- 8.2 mm during thigh compression (p < 0.05). No increase could be observed in healthy subjects. In summary, venous and lymphatic congestion by cuff compression at the thigh level results in a significant increase in LCP in healthy volunteers as well as in patients with lymph edema. The increased spread of the contrast medium in the superficial microlymphatics in lymph edema patients indicates a compensatory mechanism for lymphatic drainage during congestion of the veins and lymph collectors of the leg. Copyright 2000 S. Karger AG, Basel

  3. DFT:B3LYP/3-21G theoretical insights on the confocal Raman experimental observations in skin dermis of healthy young, healthy elderly, and diabetic elderly women

    Science.gov (United States)

    Téllez Soto, Claudio Alberto; Pereira, Liliane; dos Santos, Laurita; Rajasekaran, Ramu; Fávero, Priscila; Martin, Airton Abrahão

    2016-12-01

    In the confocal Raman spectra of skin dermis, the band area in the spectral region of proline and hydroxyproline varies according to the age and health condition of the volunteers, classified as healthy young women, healthy elderly women, and diabetic elderly women. Another observation refers to the intensity variation and negative Raman shift of the amide I band. To understand these effects, we adopted a model system using the DFT/B3LYP:3-21G procedure, considering the amino acid chain formed by glycine, hydroxyproline, proline, and alanine, which interacts with two and six water molecules. Through these systems, polarizability variations were analyzed to correlate its values with the observed Raman intensities of the three groups of volunteers and to assign the vibrational spectra of the skin dermis. As a way to correlate other experimental trends, we propose a model of chemical reaction of water interchange between the bonding amino acids, in which water molecules are attached with glucose by hydrogen bonds. The theoretical results are in accordance with the observed experimental trends.

  4. Increase in circulating holotranscobalamin after oral administration of cyanocobalamin or hydroxocobalamin in healthy adults with low and normal cobalamin status

    DEFF Research Database (Denmark)

    Greibe, Eva; Mahalle, Namita; Bhide, Vijayshri

    2017-01-01

    PURPOSE: To investigate the absorption of synthetic cyanocobalamin and natural occurring hydroxocobalamin in populations with low and normal cobalamin (vitamin B12) status. METHODS: We included adults with low (n = 59) and normal (n = 42) cobalamin status and measured the change in serum holotran...

  5. Irregular meal pattern-effects on energy expenditure, metabolism and appetite regulation: a randomized controlled trial in healthy normal-weight women

    OpenAIRE

    Alhussain, Maha H; Macdonald, Ian A.; Taylor, Moira A.

    2016-01-01

    Background: Obesity is increasing in parallel with greater all-day food availability. The latter may promote meal irregularity, dysregulation of the energy balance, and poor metabolic health.\\ud Objective: We investigated the effect of meal irregularity on the thermic effect of food (TEF), lipid concentrations, carbohydrate metabolism, subjective appetite, and gut hormones in healthy women.\\ud Design: Eleven normal-weight women (18–40 y of age) were recruited in a randomized crossover trial w...

  6. Prevalence of Demodex canis-positive healthy dogs at trichoscopic examination.

    Science.gov (United States)

    Fondati, Alessandra; De Lucia, Michela; Furiani, Nicla; Monaco, Moira; Ordeix, Laura; Scarampella, Fabia

    2010-04-01

    Demodex canis is thought to be present in small numbers in the skin of most healthy dogs; however, available data on the prevalence of normal dogs harbouring D. canis are scarce. The purpose of this study was to investigate, using microscopic examination of plucked hairs, the prevalence of healthy dogs harbouring D. canis. Seventy-eight clinically healthy dogs with no history of dermatological problems and clinically normal skin and hair coat were included in the study. Five areas (perioral skin 2-3mm from both labial commissures, periungual skin of the third digit of both anterior paws and chin) were examined in each dog. Fifty to sixty hairs were plucked from each skin site and microscopically examined. No D. canis mites were observed and only one adult form of Demodex injai was found in the labial commissure of one dog. Based on these results, the estimated prevalence of healthy dogs harbouring D. canis in clinically normal skin should not exceed the threshold of 5.4%, with 95% confidence level. Considering our and previous findings, we propose that, although small numbers of D. canis might inhabit the skin of normal dogs, the probability of finding these mites in normal dogs is low. Consequently, in most cases, the presence of a D. canis mite in the skin should not be considered as indicative of normality.

  7. Data-driven identification of intensity normalization region based on longitudinal coherency of 18F-FDG metabolism in the healthy brain.

    Science.gov (United States)

    Zhang, Huiwei; Wu, Ping; Ziegler, Sibylle I; Guan, Yihui; Wang, Yuetao; Ge, Jingjie; Schwaiger, Markus; Huang, Sung-Cheng; Zuo, Chuantao; Förster, Stefan; Shi, Kuangyu

    2017-02-01

    In brain 18 F-FDG PET data intensity normalization is usually applied to control for unwanted factors confounding brain metabolism. However, it can be difficult to determine a proper intensity normalization region as a reference for the identification of abnormal metabolism in diseased brains. In neurodegenerative disorders, differentiating disease-related changes in brain metabolism from age-associated natural changes remains challenging. This study proposes a new data-driven method to identify proper intensity normalization regions in order to improve separation of age-associated natural changes from disease related changes in brain metabolism. 127 female and 128 male healthy subjects (age: 20 to 79) with brain 18 F-FDG PET/CT in the course of a whole body cancer screening were included. Brain PET images were processed using SPM8 and were parcellated into 116 anatomical regions according to the AAL template. It is assumed that normal brain 18 F-FDG metabolism has longitudinal coherency and this coherency leads to better model fitting. The coefficient of determination R 2 was proposed as the coherence coefficient, and the total coherence coefficient (overall fitting quality) was employed as an index to assess proper intensity normalization strategies on single subjects and age-cohort averaged data. Age-associated longitudinal changes of normal subjects were derived using the identified intensity normalization method correspondingly. In addition, 15 subjects with clinically diagnosed Parkinson's disease were assessed to evaluate the clinical potential of the proposed new method. Intensity normalizations by paracentral lobule and cerebellar tonsil, both regions derived from the new data-driven coherency method, showed significantly better coherence coefficients than other intensity normalization regions, and especially better than the most widely used global mean normalization. Intensity normalization by paracentral lobule was the most consistent method within both

  8. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  9. Comparison of the effects of dopamine, dobutamine, and dopexamine upon renal blood flow: a study in normal healthy volunteers.

    OpenAIRE

    Mousdale, S; Clyburn, P A; Mackie, A M; Groves, N D; Rosen, M

    1988-01-01

    1. We compared the effects of dopexamine, dopamine and dobutamine on the heart rate, blood pressure and renal blood flow of six healthy volunteers in an open triple crossover trial. 2. The results suggest that at the dose ranges investigated dopamine was the most effective agent for increasing renal blood flow.

  10. Helicobacter Pylori Associated Antral Gastritis in Peptic Ulcer Disease Patients and Normal Healthy Population of Kashmir, India

    Science.gov (United States)

    Malik, G. M.; Bhat, M. Youssuf; rather, Ab. Rashid; Basu, Javaid Ahmad; Qureshi, Khursheed Ahmad

    1998-01-01

    Aim: To study the association of Helicobacter pylori infection with chronic antral gastritis in peptic ulcer disease patients and healthy population of Kashmir. Methods: 50 peptic ulcer patients (duodenal ulcer = 46, gastric ulcer = 2 and combined duodenal and gastric ulcer = 2) and 30 asymptomatic healthy volunteers were included in this study. Peptic ulcer was diagnosed on endoscopic examination. 4–6 punch biopsies were taken from gastric antrum in all the individuals and in case of gastric ulcer an additional biopsy was taken from the edge of the ulcer to exclude its malignant nature. Helicobacter pylori (H. pylori) organism was diagnosed using three different test methods, viz. Histology (using Giemsa Stain), Microbiology (Gram Stain) and Biochemistry (using one minute Endoscopy Room Test). Histological diagnosis of H. pylori was taken as the “gold standard” for the presence of H. pylori organism. Histological diagnosis of gastritis was made using Hematoxylin and Eosin Stain and the gastritis was classified as active chronic gastritis and superficial chronic gastritis. Results: Out of 30 peptic ulcer disease patients with associated antral gastritis, 27 (90%) were positive for H. pylori on histological examination (13 superficial chronic gastritis and 14 active chronic gastritis) whereas out of 8 healthy volunteers with histological evidence of chronic antral gastritis, H. pylori was observed in 7 individuals (87.50%) (4 active chronic gastritis and 3 superficial chronic gastritis). Conclusion: A highly significant association between H. pylori infection with chronic antral gastritis both in peptic ulcer disease patients and healthy volunteers of Kashmir was found in this study. Association between H. pylori infection and chronic gastritis was 90% in peptic ulcer group and 87.50% in healthy population (P<0.005). PMID:18493464

  11. Skin autofluorescence is associated with arterial stiffness and insulin level in endurance runners and healthy controls - Effects of aging and endurance exercise.

    Science.gov (United States)

    Couppé, Christian; Dall, Christian Have; Svensson, Rene Brüggebusch; Olsen, Rasmus Huan; Karlsen, Anders; Praet, Stephan; Prescott, Eva; Magnusson, S Peter

    2017-05-01

    Life-long regular endurance exercise yields positive effects on cardiovascular and metabolic function, disease and mortality rate. Glycation may be a major mechanism behind age-related diseases. However, it remains unknown if skin autofluorescence (SAF), which reflects glycation, is related to arterial and metabolic function in life-long endurance runners and sedentary controls. Healthy elderly men: 15 life-long endurance runners (OT) (64±4years) and 12 old untrained (OU) (66±4years), and healthy young men; ten young athletes (YT) (26±4years) matched to OT for running distance, and 12 young untrained (YU) (24±3years) were recruited. Endothelial function (reactive hyperemia index, RHI) and arterial stiffness (augmentation index, AI@75 and AI) were measured by an operator-independent PAT 2000. SAF was non-invasively determined using an autofluorescence spectrometer. For AI@75 there was an effect of age (page correction (both r 2 =0.19, paging and pathology). Surprisingly, endurance running only had modest effects on cardiovascular function compared to lean healthy controls. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Methylmalonic and propionic acidemias: lipid profiles of normal and affected human skin fibroblasts incubated with [1-14C]propionate

    International Nuclear Information System (INIS)

    Giudici, T.A.; Chen, R.G.; Oizumi, J.; Shaw, K.N.; Ng, W.G.; Donnell, G.N.

    1986-01-01

    Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with [1- 14 C]propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines

  13. Foxp3+ Treg expanded from patients with established diabetes reduce Helios expression while retaining normal function compared to healthy individuals.

    Directory of Open Access Journals (Sweden)

    Weiting Du

    Full Text Available Foxp3(+ regulatory T cells (Treg play a crucial role in regulating immune tolerance. The use of Treg to restore immune tolerance is considered an attractive novel approach to inhibit autoimmune disease, including type 1 diabetes (T1D, and to prevent rejection of organ transplants. In view of the goal of developing autologous Treg-based cell therapy for patients with long-term (>15 years T1D, it will be necessary to expand a sufficient amount of functional Treg in vitro in order to study and compare Treg from T1D patients and healthy subjects. Our results have demonstrated that there is a comparable frequency of Treg in the peripheral blood lymphocytes (PBLs of patients with long-term T1D relative to those in healthy subjects; however, Th1 cells, but not Th17 cells, were increased in the T1D patients. Further, more Treg in PBLs from T1D patients than from healthy subjects expressed the CD45RO(+ memory cell phenotype, suggesting they were antigen-experienced cells. After isolation, Treg from both T1D patients and healthy subjects were successfully expanded with high purity. Although there was no difference in Helios expression on Treg in PBLs, in vitro expansion led to fewer Helios-expressing Treg from T1D patients than healthy subjects. While more Th1-like Treg expressing IFN-γ or TNF-α were found in the PBLs of T1D patients than healthy controls, there was no such difference in the expanded Treg. Importantly, expanded Treg from both subject groups were able to suppress autologous or allogeneic CD8(+ effector T cells equally well. Our findings demonstrate that a large number of ex vivo expanded functional Treg can be obtained from long-term T1D patients, although fewer expanded Treg expressed a high level of Helios. Thus, based on the positive outcomes, these potent expanded Treg from diabetic human patients may be useful in treating T1D or preventing islet graft rejection.

  14. Protein, RNA, and DNA synthesis in cultures of skin fibroblasts from healthy subjects and patients with rheumatic diseases

    International Nuclear Information System (INIS)

    Abakumova, O.Y.; Kutsenko, N.G.; Panasyuk, A.F.

    1985-01-01

    To study the mechanism of the lasting disturbance of fibroblast function, protein, RNA and DNA synthesis was investigated in skin fibroblasts from patients with rheumatoid arthritis (RA) and systemic scleroderma (SS). The labeled precursors used to analyze synthesis of protein, RNA, and DNA were 14 C-protein hydrolysate, ( 14 C)uridine, and ( 14 C) thymidine. Stimulation was determined by measuring incorporation of ( 14 C)proline into fibroblast proteins. During analysis of stability of fast-labeled RNA tests were carried out to discover whether all measurable radioactivity belonged to RNA molecules

  15. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    OpenAIRE

    Sobanska, Anna W.; Pyzowski, Jaroslaw

    2012-01-01

    Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present ...

  16. Formation of DNA single-strand breaks by near-ultraviolet and gamma-rays in normal and Bloom's syndrome skin fibroblasts

    International Nuclear Information System (INIS)

    Hirschi, M.; Netrawali, M.S.; Remsen, J.F.; Cerutti, P.A.

    1981-01-01

    The formation of single-strand breaks by near-ultraviolet light at 313 nm and by aerobic gamma-rays was compared for skin fibroblast monolayer cultures from 4 normal donors (NF) and 8 patients with Bloom's syndrome (BS) by the alkaline elution method. In 6 of 8 BS strains, the number of breaks induced by near-ultraviolet light, 2.25 kJ/sq m, at 0 degrees was comparable to NF, while elevated breakage was observed in BS strains HG 369 and HG 916. Breakage frequencies were increased substantially in 6 of 8 BS strains relative to NF when the near-ultraviolet light exposure was at 37 degrees. BS strain GM 2520 represents an exception since normal breakage frequencies were induced both at 0 degrees and 37 degrees. Aerobic gamma-rays (75 R) induced comparable numbers of single-strand breaks in BS and NF strains at 0 degrees. The breakage frequencies were reduced an average of 17% in NF when the same dose was given at 30 degrees followed by 6 min incubation. Under the same conditions, the breakage frequencies were on the average reduced by 42% relative to 0 degrees in the BS strains, indicating that they possess normal or possibly slightly increased capacities for the rejoining of gamma-ray-induced breaks

  17. Relationship between elevated triglyceride levels with the increase of HOMA-IR and HOMA-β in healthy children and adolescents with normal weight.

    Science.gov (United States)

    Simental-Mendía, Luis E; Castañeda-Chacón, Argelia; Rodriguez-Morán, Martha; Aradillas-García, Celia; Guerrero-Romero, Fernando

    2015-05-01

    To test the hypothesis that mildly elevated triglyceride levels are associated with the increase of homeostasis model assessment of insulin resistance (HOMA-IR) and β-cell function (HOMA-β) indices in healthy children and adolescents with normal weight, we conducted a cross-sectional population study. Based on fasting triglyceride levels, participants were allocated into groups with and without triglyceride levels ≥1.2 mmol/L. Normal weight was defined by body mass index between the 15th and 85th percentiles, for age and gender. Insulin resistance and insulin secretion were estimated using HOMA-IR and HOMA-β indices. A total of 1660 children and adolescents were enrolled, of them 327 (19.7%) with mildly elevated triglycerides. The multivariate linear regression analysis showed that mildly elevated triglyceride levels in children were associated with HOMA-IR (β = 0.214, p HOMA-β (β = 0.139, p = 0.001), systolic (β = 0.094, p = 0.01), and diastolic blood pressure (β = 0.102, p = 0.007), whereas in adolescents, HOMA-IR (β = 0.267, p HOMA-β (β = 0.154, p HOMA-IR and HOMA-β indices in healthy children and adolescents with normal weight.

  18. The intramuscular glucagon stimulation test does not provide good discrimination between normal and inadequate ACTH reserve when used in the investigation of short healthy children.

    Science.gov (United States)

    Tenenbaum, Ariel; Phillip, Moshe; de Vries, Liat

    2014-01-01

    Few studies have addressed the role of the glucagon stimulation test (GST) in evaluating the hypothalamic-pituitary-adrenal axis in children. We investigated the diagnostic value of the GST in evaluating the adrenocortical response in short healthy children. The GST was performed in 190 children investigated for short stature. A peak cortisol >500 nmol/l was considered a normal response. In the 45 (23.7%) with subnormal response, a 250-μg ACTH test was done. The rate of subnormal adrenal response to GST was higher among boys (33.9 vs. 8.9%, p 500 nmol/l in all the patients undergoing an ACTH stimulation test. Since adrenal response to GST is age- and gender-related and the false-positive rate is high, its routine performance in healthy children warrants reconsideration. © 2014 S. Karger AG, Basel.

  19. Effect of treatment in fractionated schedules with the combination of x-irradiation and six cytotoxic drugs on the RIF-1 tumor and normal mouse skin

    International Nuclear Information System (INIS)

    Lelieveld, P.; Scoles, M.A.; Brown, J.M.; Phil, D.; Kallman, R.F.

    1985-01-01

    RIF-1 tumors, implanted syngeneically in the gastrocnemius muscles of the right hind legs of C3H/Km mice, were treated either with X ray alone, drug alone, or drug and X ray combined. The drugs tested were bleomycin, BCNU, cis-diamminedichloro platinum, adriamycin, cyclophosphamide, and actinomycin-D. All drugs were administered either in the maximum tolerated dose or a dose that causes minimal tumor growth delay. Both drugs and X rays were administered either as a single dose or in five daily fractions. In addition to the single modality controls, seven different schedules of combined modalities were tested. Tumors were measured periodically after treatment in order that the day at which each tumor reached 4 times its initial cross-sectional area, i.e., its size at the time of treatment, could be determined. The effect of treatment on tumors was based upon excess growth delay (GD), i.e., T400% (treated)-T400% (untreated control). Treatment effects for the same combined modality schedules were also determined for normal skin, using the early skin reaction as an endpoint. Dose effect factors (DEF) were computed for all combined modality schedules and were based upon calculated radiation dose equivalents. We also calculated supra-additivity ratios, SR/sub I/ and SR/sub II/, therapeutic gain factors and adjusted therapeutic gain factors. The only drugs to produce significant supra-additivity with X rays were cis-Pt and cyclo

  20. A randomized control trial of the effect of yoga on Gunas (personality) and Self esteem in normal healthy volunteers

    OpenAIRE

    Deshpande, Sudheer; Nagendra, H R; Nagarathna, Raghuram

    2009-01-01

    Background/Aims: To study the efficacy of yoga on Gunas (personality) and self esteem in normal adults through a randomized comparative study. Materials and Methods: Of the 1228 persons who attended motivational lectures, 226 subjects aged 18–71 years, of both sexes, who satisfied the inclusion and exclusion criteria, and who consented to participate in the study were randomly allocated into two groups. The Yoga (Y) group practised an integrated yoga module that included asanas, pranayama, me...

  1. A randomized control trial of the effect of yoga on Gunas (personality) and Health in normal healthy volunteers

    OpenAIRE

    Deshpande, Sudheer; Nagendra, H R; Raghuram, Nagarathna

    2008-01-01

    Objective: To study the efficacy of yoga on Guna (yogic personality measure) and general health in normal adults. Methods: Of the 1228 persons who attended introductory lectures, 226 subjects aged 18–71 years, of both sexes, who satisfied the inclusion and exclusion criteria and who consented to participate in the study were randomly allocated into two groups. The Yoga(Y) group practised an integrated yoga module that included asanas, pranayama, meditation, notional correction and devotional ...

  2. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    Directory of Open Access Journals (Sweden)

    Anna W. Sobanska

    2012-01-01

    Full Text Available Ethylhexyl triazone (ET was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A cyclohexane-diethyl ether 1 : 1 (v/v and (B cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials, with R > 0.998. For both mobile phases limits of detection (LOD were 0.03 and limits of quantification (LOQ 0.1 μg spot−1. Both methods were validated.

  3. Quantification of sunscreen ethylhexyl triazone in topical skin-care products by normal-phase TLC/densitometry.

    Science.gov (United States)

    Sobanska, Anna W; Pyzowski, Jaroslaw

    2012-01-01

    Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials), with R > 0.998. For both mobile phases limits of detection (LOD) were 0.03 and limits of quantification (LOQ) 0.1 μg spot(-1). Both methods were validated.

  4. Molecular characterization of Staphylococcus aureus isolates from skin and soft tissue infections samples and healthy carriers in the Central Slovenia region.

    Science.gov (United States)

    Svent-Kucina, Natasa; Pirs, Mateja; Kofol, Romina; Blagus, Rok; Smrke, Dragica Maja; Bilban, Marjan; Seme, Katja

    2016-04-01

    Staphylococcus aureus is among the most important human pathogens. It is associated with different infections and is a major cause of skin and soft tissue infections (SSTIs). The aim of our study was to compare S. aureus isolates associated with SSTIs with isolates obtained from healthy carriers in the Central Slovenia region in terms of antimicrobial susceptibility, genetic diversity by clonal complex (CC)/sequence type, spa type, and by toxin gene profiling. In total, 274 S. aureus isolates were collected prospectively by culturing wound samples from 461 SSTI patients and nasal samples from 451 healthy carriers. We have demonstrated high heterogeneity in terms of CCs and spa type in both groups of isolates. The main clone among SSTI strains was Panton-Valentine leukocidin gene (pvl) positive CC121, whereas the main clone among carrier strains was CC45 carrying a large range of toxin genes. The main spa type in both groups was t091. Pvl was more frequently present in SSTI strains (31.2% SSTI vs 3.6% carrier strains) and staphylococcal enterotoxin C was more frequently present in carrier strains (1.6% SSTI vs 17.0% carrier strains). We have also demonstrated that methicillin-resistant S. aureus was a rare cause (2.8%) of SSTIs in our region. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  5. Ghrelin gene: identification of missense variants and a frameshift mutation in extremely obese children and adolescents and healthy normal weight students.

    Science.gov (United States)

    Hinney, Anke; Hoch, Anne; Geller, Frank; Schäfer, Helmut; Siegfried, Wolfgang; Goldschmidt, Hanspeter; Remschmidt, Helmut; Hebebrand, Johannes

    2002-06-01

    Ghrelin induces obesity via central and peripheral mechanisms. Administration of ghrelin leads to increased food intake and decreased fat utilisation in rodents. Ghrelin levels are decreased in obese individuals. Recently, a polymorphism (Arg-51-Gln) within the ghrelin gene (GHRL) was described to be associated with obesity. We screened the GHRL coding region in 215 extremely obese German Children and adolescents (study group 1) and 93 normal weight students (study group 2) by single strand conformation polymorphism analysis (SSCP). We found the two previously described single nucleotide polymorphisms (SNP: Arg-51-Gln and Leu-72-Met) in similar frequencies in study groups 1 and 2 (allele frequencies were: 0.019 and 0.016 for the 51-Gln allele and 0.091 and 0.086 for the 72-Met allele, respectively). Hence, we could not confirm the previous finding. Additionally, two novel variants were identified within the coding region: (1) We detected one healthy normal weight individual with a frameshift mutation (2bp deletion at codon 34). This frameshift mutation affects the coding region of the mature ghrelin. Hence, it is highly likely that the normal weight student is haplo-insufficient for ghrelin. (2) An A to T transversion leads to an amino acid exchange from Gln to Leu at amino acid position 90. The frequency of the 90-Leu allele was significantly higher in the extremely obese children and adolescents (0.063) than in the normal weight students (0.016; nominal p = 0.011). Additionally, we genotyped 134 underweight students and 44 normal weight adults for this SNP. Genotype frequencies were similar in extremely obese children and adolescents, underweight students and normal weight adults (p > 0.8). In conclusion, we identified four sequence variants in the coding region of the ghrelin gene in individuals belonging to different weight extremes. A frameshift mutation was detected in a normal weight individual. None of the variants seem to influence weight regulation.

  6. Effects of Indoor Horseback Riding and Virtual Reality Exercises on the Dynamic Balance Ability of Normal Healthy Adults

    Science.gov (United States)

    Lee, Daehee; Lee, Sangyong; Park, Jungseo

    2014-01-01

    [Purpose] The objective of this study was to determine the effect of indoor horseback riding and virtual reality exercises on the dynamic balance ability of normal adults. [Subjects] This study enrolled 24 normal adults and divided them into two groups: an indoor horseback riding exercise group (IHREG, n = 12) and a virtual reality exercise group (VREG, n = 12). [Methods] IHREG exercised on indoor horseback riding equipment and VREG exercised using the Nintendo Wii Fit three times a week for six weeks. The Biodex Balance System was used to analyze dynamic balance as measured by the overall stability index (OSI), anteroposterior stability index (APSI), and mediolateral stability index (MLSI). [Results] In the within-group comparison, IHREG and VERG both showed significant decreases in the dynamic balance indexes of OSI, APSI, and MLSI after the intervention, but no significant difference was found between the groups. [Conclusion] Both indoor horseback riding and virtual reality exercises were effective at improving the subjects’ dynamic balance ability as measured by OSI, APSI, and MLSI, and can be used as additional exercises for patients with conditions affecting postural control. PMID:25540494

  7. Clinical characteristics in normal healthy adults with microbleeds on echo-planar gradient-echo T2*-weighted MRI

    International Nuclear Information System (INIS)

    Takahashi, Wakoh; Ide, Michiru; Ohnuki, Tomohide; Takagi, Shigeharu; Shinohara, Yukito

    2004-01-01

    The gradient-echo T 2 * -weighted sequence in magnetic resonance imaging is known to be useful for detecting microbleeds (MBs) in patients with intracranial hemorrhage or lacunar stroke. We investigated the characteristics of apparently healthy adults with MBs but without stroke, employing echo-planar gradient-echo T 2 * -weighted MRI. The subjects were recruited from among 3,537 participants who underwent brain check-ups at the HIMEDIC Imaging Center. Of the 3,537 participants, 3,296 (mean age, 55±11 years) without any history of cerebrovascular disease or apparent focal neurological manifestations were selected for the present study. MBs on echo-planar gradient-echo T 2 * -weighted MRI were observed in 74 (2.2%) of the 3,296 subjects. Of a total of 133 lesions found in these 74 persons, 31 were located in the basal ganglia or cortico-subcortical regions. Thirty were in the deep white matter, 19 in the thalamus, 16 in the cerebellum, and 6 in the brain stem. The subjects with MBs were significantly older than the subjects without MBs, and the mean values for their systolic and diastolic blood pressures were higher than those in the subjects without MBs. Asymptomatic cerebral infarction, periventricular hyperintensity, and deep and subcortical white matter hyperintensity on T 1 - and T 2 -weighted MRI were more frequent in the subjects with MBs, as compared with those without MBs. Asymptomatic cerebral infarction, periventricular hyperintensity, and deep and subcortical white matter hyperintensity on T 1 - and T 2 -weighted MRI were more frequent in the subjects with MBs of the basal ganglia or thalamus than in those with MBs in other regions. MBs on echo-planar gradient-echo T 2 * -weighted MRI were thus relatively rare in apparently healthy adults. However, MBs in the basal ganglia or thalamus are suggested to be closely related to intracerebral microangiopathy. Persons with MBs in such regions should therefore be carefully checked for cerebrovascular risk

  8. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    DEFF Research Database (Denmark)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...... blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high...... reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new...

  9. Malassezia versus Candida in Healthy Dogs

    Directory of Open Access Journals (Sweden)

    Sihelská Z.

    2017-03-01

    Full Text Available The genera Malassezia and Candida include yeasts which are members of the normal mycobiota of the skin and mucosal sites of humans and other warm-blooded animals. These yeasts are associated with a variety of dermatological disorders and also systemic diseases in humans and other animals. This study confirms the occurrence of Malassezia and Candida species in healthy dogs. Samples were collected from different body sites: external ear canal, interdigital area, skin of the axilla and of the neck, and the oral and rectal mucosae. The isolates were identified using phenotypic methods (biochemical-physiological and morphological characteristics. The presence of yeasts were investigated in the specimens from 70 healthy dogs. Malassezia species were isolated in 44 dogs from which 84 Malassezia isolates were obtained. Only one Candida isolate was obtained from the dogs examined. It was found that Candida does not occur in dogs normally and Malassezia was the main colonizing yeast in healthy dogs.

  10. The normalization of data in the Constant-Murley score for the shoulder. A study conducted on 563 healthy subjects.

    Science.gov (United States)

    Grassi, F A; Tajana, M S

    2003-01-01

    The study was conducted in order to evaluate the theoretical design of the Constant-Murley system and to reveal any difficulties in obtaining data when it is used in 563 subjects not affected with shoulder pathology. The total mean score for the subjects examined was 85.2 points (minimum 75, maximum 100 points). Values revealed a decreasing trend beginning at 50 years of age for men and 30 for women. Only 4 subjects achieved a maximum score of 100. The measurements taken allowed us to elaborate a reference table based on sex and age, which was required to calculate the correct score. These values differ from those reported by the inventors of the system and they reveal the need to compile personal tables for the normalization of scores.

  11. Effects of the Healthy Start randomized intervention on dietary intake among obesity-prone normal-weight children

    DEFF Research Database (Denmark)

    Rohde, Jeanett F.; Larsen, Sofus C.; Ängquist, Lars

    2017-01-01

    Start study was conducted during 2009–2011, focusing on changing diet, physical activity, sleep and stress management to prevent excessive weight gain among Danish children. Subjects: From a population of 635 Danish pre-school children, who had a high birth weight (≥4000 g), high maternal pre......Objective: The study aimed to evaluate the impact of a 15-month intervention on dietary intake conducted among obesity-prone normal-weight pre-school children. Design: Information on dietary intake was obtained using a 4 d diet record. A diet quality index was adapted to assess how well children......-pregnancy BMI (≥28·0 kg/m2) or low maternal educational level (schooling), 285 children completed the intervention and had complete information on dietary intake. Results: Children in the intervention group had a lower energy intake after the 15-month intervention (group means: 5·29 v. 5·59 MJ, P...

  12. Normal ranges for fetal electrocardiogram values for the healthy fetus of 18-24 weeks of gestation: a prospective cohort study.

    Science.gov (United States)

    Verdurmen, Kim M J; Lempersz, Carlijn; Vullings, Rik; Schroer, Christian; Delhaas, Tammo; van Laar, Judith O E H; Oei, S Guid

    2016-08-17

    The fetal anomaly ultrasound only detects 65 to 81 % of the patients with congenital heart disease, making it the most common structural fetal anomaly of which a significant part is missed during prenatal life. Therefore, we need a reliable non-invasive diagnostic method which improves the predictive value for congenital heart diseases early in pregnancy. Fetal electrocardiography could be this desired diagnostic method. There are multiple technical challenges to overcome in the conduction of the fetal electrocardiogram. In addition, interpretation is difficult due to the organisation of the fetal circulation in utero. We want to establish the normal ranges and values of the fetal electrocardiogram parameters in healthy fetuses of 18 to 24 weeks of gestation. Women with an uneventful singleton pregnancy between 18 and 24 weeks of gestation are asked to participate in this prospective cohort study. A certified and experienced sonographist performs the fetal anomaly scan. Subsequently, a fetal electrocardiogram recording is performed using dedicated signal processing methods. Measurements are performed at two institutes. We will include 300 participants to determine the normal values and 95 % confidence intervals of the fetal electrocardiogram parameters in a healthy fetus. We will evaluate the fetal heart rate, segment intervals, normalised amplitude and the fetal heart axis. Three months postpartum, we will evaluate if a newborn is healthy through a questionnaire. Fetal electrocardiography could be a promising tool in the screening program for congenital heart diseases. The electrocardiogram is a depiction of the intimate relationship between the cardiac nerve conduction pathways and the structural morphology of the fetal heart, and therefore particularly suitable for the detection of secondary effects due to a congenital heart disease (hypotrophy, hypertrophy and conduction interruption).

  13. Reduced circulating stem cells associate with excess fasting and post-load NEFA exposure in healthy adults with normal glucose tolerance.

    Science.gov (United States)

    Fadini, Gian Paolo; Tura, Andrea; Pacini, Giovanni; Avogaro, Angelo; Vigili de Kreutzenberg, Saula

    2017-06-01

    Reduced levels of circulating stem cells (CSCs) predict cardiovascular events and death, but the factors underlying variability of CSCs in healthy adults are mostly unknown. Previous studies detected associations of CSCs with glucose tolerance or insulin resistance, while the role of fatty acids has been overlooked. We herein aimed to describe in better detail the metabolic abnormalities associated with a reduced CSC level. This was a cross-sectional study on 94 healthy male and female individuals with normal glucose tolerance, aged 18-65 years. All participants underwent an oral glucose tolerance test (OGTT) with blood samples collected at 0, 10, 20, 30, 60, 90 and 120 min. Mathematical models were applied to plasma glucose, insulin, C-peptide and non-esterified fatty acids (NEFA) concentrations. CSCs were defined as CD34 + or CD133 + . Participants (mean ± SEM age 43.8 ± 0.7; 41% males) were divided according to CSC levels below (low) or above (high) the median value and metabolic parameters were compared. There was no significant baseline difference between groups except for higher concentrations of fasting NEFA in subjects with low CSCs. Upon OGTT, individuals with low CSCs had higher area under curve (AUC) of NEFA (p glucose, insulin and C-peptide. Several insulin sensitivity and beta cell function indexes were not significantly different, except for a decrease in the disposition index (DI) in subjects with low CSCs. CSCs were associated with excess NEFA levels independently from age and DI. We show for the first time that, in healthy adults with normal glucose tolerance, low CSCs are strongly associated with excess NEFA exposure. The pathophysiological consequence of this association needs to be interpreted in view of the prognostic role of CSCs. Future studies should explore whether excess NEFA and low CSCs and are causally interconnected. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Skin graft - slideshow

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...

  15. Effects of the Healthy Start randomized intervention trial on physical activity among normal weight preschool children predisposed to overweight and obesity.

    Directory of Open Access Journals (Sweden)

    Mina Nicole Händel

    Full Text Available There is limited evidence to support the effectiveness of primary interventions aiming to prevent excess weight gain among young children. Evaluating behavioral changes, such as physical activity (PA, may add to future development of efficient interventions. The objective was to evaluate the effect on PA outcomes of the 15 month Healthy Start intervention that focused on changing diet, PA, sleep and stress management among normal weight but obesity-prone preschool children. Children were defined as obesity-prone if they had a birth weight > 4,000 g, mothers with a pre-pregnancy body mass index of > 28 kg/m2, or mothers with ≤ 10 years of schooling.From a baseline study population of 635 normal weight 2-6 year old preschool children from the greater Copenhagen area, parents of 307 children had given information on PA at both the baseline and follow-up examinations. PA was obtained from a 7 days recording in the Children's Physical Activity Questionnaire. Time used for sport activities were combined with outdoor playing time to achieve a proxy of total PA level of moderate to vigorous intensity.Linear regression analyses revealed that at follow-up the intervention group spent more time on sports and outdoor activities combined per week than the control group (ITT analyses: intervention: 400 min/week; 95% confidence interval (CI: 341, 459 versus control: 321 min/week; 95% CI: 277, 366; p = 0.02, although no significant intervention effects were seen for each of the subcategories, e.g. sports participation, outdoor activities, screen time, or commuting frequency.Our results suggest that the overall time spent on sports and outdoor activities combined was increased at follow-up among normal weight obesity-prone children, as a result of the Healthy Start intervention.ClinicalTrials.gov NCT01583335.

  16. Effects of the Healthy Start randomized intervention trial on physical activity among normal weight preschool children predisposed to overweight and obesity.

    Science.gov (United States)

    Händel, Mina Nicole; Larsen, Sofus Christian; Rohde, Jeanett Friis; Stougaard, Maria; Olsen, Nanna Julie; Heitmann, Berit Lilienthal

    2017-01-01

    There is limited evidence to support the effectiveness of primary interventions aiming to prevent excess weight gain among young children. Evaluating behavioral changes, such as physical activity (PA), may add to future development of efficient interventions. The objective was to evaluate the effect on PA outcomes of the 15 month Healthy Start intervention that focused on changing diet, PA, sleep and stress management among normal weight but obesity-prone preschool children. Children were defined as obesity-prone if they had a birth weight > 4,000 g, mothers with a pre-pregnancy body mass index of > 28 kg/m2, or mothers with ≤ 10 years of schooling. From a baseline study population of 635 normal weight 2-6 year old preschool children from the greater Copenhagen area, parents of 307 children had given information on PA at both the baseline and follow-up examinations. PA was obtained from a 7 days recording in the Children's Physical Activity Questionnaire. Time used for sport activities were combined with outdoor playing time to achieve a proxy of total PA level of moderate to vigorous intensity. Linear regression analyses revealed that at follow-up the intervention group spent more time on sports and outdoor activities combined per week than the control group (ITT analyses: intervention: 400 min/week; 95% confidence interval (CI): 341, 459 versus control: 321 min/week; 95% CI: 277, 366; p = 0.02), although no significant intervention effects were seen for each of the subcategories, e.g. sports participation, outdoor activities, screen time, or commuting frequency. Our results suggest that the overall time spent on sports and outdoor activities combined was increased at follow-up among normal weight obesity-prone children, as a result of the Healthy Start intervention. ClinicalTrials.gov NCT01583335.

  17. A randomized control trial of the effect of yoga on Gunas (personality) and Self esteem in normal healthy volunteers.

    Science.gov (United States)

    Deshpande, Sudheer; Nagendra, H R; Nagarathna, Raghuram

    2009-01-01

    To study the efficacy of yoga on Gunas (personality) and self esteem in normal adults through a randomized comparative study. Of the 1228 persons who attended motivational lectures, 226 subjects aged 18-71 years, of both sexes, who satisfied the inclusion and exclusion criteria, and who consented to participate in the study were randomly allocated into two groups. The Yoga (Y) group practised an integrated yoga module that included asanas, pranayama, meditation, notional correction, and devotional sessions. The comparison group practised mild to moderate physical exercises (PE). Both groups had supervised practices for one hour daily, six days a week, for eight weeks. Guna (personality) was assessed before and after eight weeks using the self-administered "The 'Gita" Inventory of Personality" (GIN) to assess Sattva, Rajas, and Tamas. Self esteem in terms of competency (COM), global self esteem (GSE), moral and self esteem (MSE), social esteem (SET), family self esteem (FSE), body and physical appearance (BPA), and the lie scale (LIS) were assessed using the self esteem questionnaire (SEQ). The baseline scores for all domains for both the groups did not differ significantly (P > 0.05 independent samples t-test). There were significant pre-post improvements in all domains in both groups (P self esteem in the Y group is greater than for the PE group in three out of seven domains. This randomized controlled study has shown the influence of Yoga on Gunas and self esteem in comparison to physical exercise.

  18. A randomized control trial of the effect of yoga on Gunas (personality and Self esteem in normal healthy volunteers

    Directory of Open Access Journals (Sweden)

    Deshpande Sudheer

    2009-01-01

    Full Text Available Background/Aims: To study the efficacy of yoga on Gunas (personality and self esteem in normal adults through a randomized comparative study. Materials and Methods: Of the 1228 persons who attended motivational lectures, 226 subjects aged 18-71 years, of both sexes, who satisfied the inclusion and exclusion criteria, and who consented to participate in the study were randomly allocated into two groups. The Yoga (Y group practised an integrated yoga module that included asanas, pranayama, meditation, notional correction, and devotional sessions. The comparison group practised mild to moderate physical exercises (PE. Both groups had supervised practices for one hour daily, six days a week, for eight weeks. Guna (personality was assessed before and after eight weeks using the self-administered "The ′Gita" Inventory of Personality" (GIN to assess Sattva, Rajas, and Tamas . Self esteem in terms of competency (COM, global self esteem (GSE, moral and self esteem (MSE, social esteem (SET, family self esteem (FSE, body and physical appearance (BPA, and the lie scale (LIS were assessed using the self esteem questionnaire (SEQ. Results: The baseline scores for all domains for both the groups did not differ significantly ( P > 0.05 independent samples t-test. There were significant pre-post improvements in all domains in both groups ( P < 0.001 paired t-test. The number of persons who showed improvement in Sattva and decrease in Tamas was significant in the Y but not in the PE group (McNemar test. The effect size for self esteem in the Y group is greater than for the PE group in three out of seven domains. Conclusions: This randomized controlled study has shown the influence of Yoga on Gunas and self esteem in comparison to physical exercise.

  19. A randomized control trial of the effect of yoga on Gunas (personality) and Health in normal healthy volunteers.

    Science.gov (United States)

    Deshpande, Sudheer; Nagendra, H R; Raghuram, Nagarathna

    2008-01-01

    To study the efficacy of yoga on Guna (yogic personality measure) and general health in normal adults. Of the 1228 persons who attended introductory lectures, 226 subjects aged 18-71 years, of both sexes, who satisfied the inclusion and exclusion criteria and who consented to participate in the study were randomly allocated into two groups. The Yoga(Y) group practised an integrated yoga module that included asanas, pranayama, meditation, notional correction and devotional sessions. The control group practised mild to moderate physical exercises (PE). Both groups had supervised practice sessions (by trained experts) for one hour daily, six days a week for eight weeks. Guna (yogic personality) was assessed before and after eight weeks using the self-administered Vedic Personality Inventory (VPI) which assesses Sattva (gentle and controlled), Rajas (violent and uncontrolled) and Tamas (dull and uncontrolled). The general health status (total health), which includes four domains namely somatic symptoms (SS), anxiety and insomnia (AI), social dysfunction (SF) and severe depression (SP), was assessed using a General Health Questionnaire (GHQ). Baseline scores for all the domains for both the groups did not differ significantly (P > 0.05, independent samples t test). Sattva showed a significant difference within the groups and the effect size was more in the Y than in the PE group. Rajas showed a significant decrease within and between the groups with a higher effect size in the PE group. Tamas showed significant reduction within the PE group only. The GHQ revealed that there was significant decrease in SS, AI, SF and SP in both Y and PE groups (Wilcoxcon Singed Rank t test). SS showed a significant difference between the groups (Mann Whitney U Test). There was an improvement in Sattva in both the Yoga and control groups with a trend of higher effect size in Yoga; Rajas reduced in both but significantly better in PE than in Yoga and Tamas reduced in PE. The general health

  20. Changes in Transepidermal Water Loss and Skin Hydration according to Expression of Aquaporin-3 in Psoriasis

    Science.gov (United States)

    Lee, Young; Je, Young-Jin; Lee, Sang-Sin; Li, Zheng Jun; Choi, Dae-Kyoung; Kwon, Yoo-Bin; Sohn, Kyung-Cheol; Im, Myung; Seo, Young Joon

    2012-01-01

    Background Aquaporins (AQPs) are a family of water transporting proteins present in many mammalian epithelial and endothelial cell types. Among the AQPs, AQP3 is known to be a water/glycerol transporter expressed in human skin. Objective The relationship between the expression level of AQP3 and transpidermal water loss (TEWL) in the lesional and peri-lesional skin of psoriasis-affected patients, and skin hydration in the lesional and peri-lesional skin of psoriasis patients, was investigated. Methods The expression of AQP3 in psoriasis-affected and healthy control skin was determined using immunohistochemical and immunofluroscence staining. TEWL and skin hydration were measured using a Tewameter® TM210 (Courage & Khazaka, Cologne, Germany) and a Corneometer® CM 820 (Courage & Khazaka), respectively. Results AQP3 was mainly expressed in the plasma membrane of stratum corneum and the stratum spinosum in normal epidermis. Unlike the normal epidermis, AQP3 showed decreased expression in the lesional and peri-lesional epidermis of psoriasis. TEWL was increased, and skin hydration was decreased, in the lesional and peri-lesional skin of psoriasis patients, compared with the healthy control sample. Conclusion Although various factors contribute to reduced skin hydration in the lesional and peri-lesional skin of psoriasis, AQP3 appears to be a key factor in the skin dehydration of psoriasis-affected skin. PMID:22577267

  1. Registration of FA and T1-weighted MRI data of healthy human brain based on template matching and normalized cross-correlation.

    Science.gov (United States)

    Malinsky, Milos; Peter, Roman; Hodneland, Erlend; Lundervold, Astri J; Lundervold, Arvid; Jan, Jiri

    2013-08-01

    In this work, we propose a new approach for three-dimensional registration of MR fractional anisotropy images with T1-weighted anatomy images of human brain. From the clinical point of view, this accurate coregistration allows precise detection of nerve fibers that is essential in neuroscience. A template matching algorithm combined with normalized cross-correlation was used for this registration task. To show the suitability of the proposed method, it was compared with the normalized mutual information-based B-spline registration provided by the Elastix software library, considered a reference method. We also propose a general framework for the evaluation of robustness and reliability of both registration methods. Both registration methods were tested by four evaluation criteria on a dataset consisting of 74 healthy subjects. The template matching algorithm has shown more reliable results than the reference method in registration of the MR fractional anisotropy and T1 anatomy image data. Significant differences were observed in the regions splenium of corpus callosum and genu of corpus callosum, considered very important areas of brain connectivity. We demonstrate that, in this registration task, the currently used mutual information-based parametric registration can be replaced by more accurate local template matching utilizing the normalized cross-correlation similarity measure.

  2. A randomized control trial of the effect of yoga on Gunas (personality and Health in normal healthy volunteers

    Directory of Open Access Journals (Sweden)

    Deshpande Sudheer

    2008-01-01

    Full Text Available Objective : To study the efficacy of yoga on Guna (yogic personality measure and general health in normal adults. Methods : Of the 1228 persons who attended introductory lectures, 226 subjects aged 18-71 years, of both sexes, who satisfied the inclusion and exclusion criteria and who consented to participate in the study were randomly allocated into two groups. The Yoga(Y group practised an integrated yoga module that included asanas , pranayama , meditation, notional correction and devotional sessions. The control group practised mild to moderate physical exercises (PE. Both groups had supervised practice sessions (by trained experts for one hour daily, six days a week for eight weeks. Guna (yogic personality was assessed before and after eight weeks using the self-administered Vedic Personality Inventory (VPI which assesses Sattva (gentle and controlled, Rajas (violent and uncontrolled and Tamas (dull and uncontrolled. The general health status (total health, which includes four domains namely somatic symptoms (SS, anxiety and insomnia (AI, social dysfunction (SF and severe depression (SP, was assessed using a General Health Questionnaire (GHQ. Results : Baseline scores for all the domains for both the groups did not differ significantly ( P > 0.05, independent samples t test. Sattva showed a significant difference within the groups and the effect size was more in the Y than in the PE group. Rajas showed a significant decrease within and between the groups with a higher effect size in the PE group. Tamas showed significant reduction within the PE group only. The GHQ revealed that there was significant decrease in SS, AI, SF and SP in both Y and PE groups (Wilcoxcon Singed Rank t test. SS showed a significant difference between the groups (Mann Whitney U Test. Conclusions : There was an improvement in Sattva in both the Yoga and control groups with a trend of higher effect size in Yoga; Rajas reduced in both but significantly better in PE than

  3. A randomized control trial of the effect of yoga on Gunas (personality and Health in normal healthy volunteers

    Directory of Open Access Journals (Sweden)

    Deshpande Sudheer

    2008-01-01

    Full Text Available Objective: To study the efficacy of yoga on Guna (yogic personality measure and general health in normal adults. Methods: Of the 1228 persons who attended introductory lectures, 226 subjects aged 18-71 years, of both sexes, who satisfied the inclusion and exclusion criteria and who consented to participate in the study were randomly allocated into two groups. The Yoga(Y group practised an integrated yoga module that included asanas , pranayama , meditation, notional correction and devotional sessions. The control group practised mild to moderate physical exercises (PE. Both groups had supervised practice sessions (by trained experts for one hour daily, six days a week for eight weeks. Guna (yogic personality was assessed before and after eight weeks using the self-administered Vedic Personality Inventory (VPI which assesses Sattva (gentle and controlled, Rajas (violent and uncontrolled and Tamas (dull and uncontrolled. The general health status (total health, which includes four domains namely somatic symptoms (SS, anxiety and insomnia (AI, social dysfunction (SF and severe depression (SP, was assessed using a General Health Questionnaire (GHQ. Results: Baseline scores for all the domains for both the groups did not differ significantly ( P > 0.05, independent samples t test. Sattva showed a significant difference within the groups and the effect size was more in the Y than in the PE group. Rajas showed a significant decrease within and between the groups with a higher effect size in the PE group. Tamas showed significant reduction within the PE group only. The GHQ revealed that there was significant decrease in SS, AI, SF and SP in both Y and PE groups (Wilcoxcon Singed Rank t test. SS showed a significant difference between the groups (Mann Whitney U Test. Conclusions: There was an improvement in Sattva in both the Yoga and control groups with a trend of higher effect size in Yoga; Rajas reduced in both but significantly better in PE than in

  4. Sleep Deprivation in Young and Healthy Subjects Is More Sensitively Identified by Higher Frequencies of Electrodermal Activity than by Skin Conductance Level Evaluated in the Time Domain

    Directory of Open Access Journals (Sweden)

    Hugo F. Posada-Quintero

    2017-06-01

    Full Text Available We analyzed multiple measures of the autonomic nervous system (ANS based on electrodermal activity (EDA and heart rate variability (HRV for young healthy subjects undergoing 24-h sleep deprivation. In this study, we have utilized the error awareness test (EAT every 2 h (13 runs total, to evaluate the deterioration of performance. EAT consists of trials where the subject is presented words representing colors. Subjects are instructed to press a button (“Go” trials or withhold the response if the word presented and the color of the word mismatch (“Stroop No-Go” trial, or the screen is repeated (“Repeat No-Go” trials. We measured subjects' (N = 10 reaction time to the “Go” trials, and accuracy to the “Stroop No-Go” and “Repeat No-Go” trials. Simultaneously, changes in EDA and HRV indices were evaluated. Furthermore, the relationship between reactiveness and vigilance measures and indices of sympathetic control based on HRV were analyzed. We found the performance improved to a stable level from 6 through 16 h of deprivation, with a subsequently sustained impairment after 18 h. Indices of higher frequencies of EDA related more to vigilance measures, whereas lower frequencies index (skin conductance leve, SCL measured the reactiveness of the subject. We conclude that indices of EDA, including those of the higher frequencies, termed TVSymp, EDASymp, and NSSCRs, provide information to better understand the effect of sleep deprivation on subjects' autonomic response and performance.

  5. A new algorithm for the discrimination of actinic keratosis from normal skin and squamous cell carcinoma based on in vivo analysis of optical properties by high-definition optical coherence tomography

    DEFF Research Database (Denmark)

    Boone, M A L M; Suppa, M; Marneffe, A

    2016-01-01

    properties for discrimination of AK from SCC and from normal sun exposed skin and to subdifferentiate AKs. METHODS: The technique of semi-log plot has been implemented on HD-OCT signals. This permitted the in vivo measurement of OCT signals coming from the skin entrance up to the superficial reticular dermis...... involvement, non-Bowenoid AK with follicular involvement, Bowenoid AK, hypertrophic and lichenoid form of AK and squamous cell carcinoma. CONCLUSION: HD-OCT seems to enable the combination of in vivo morphological analysis of cellular and 3D microarchitectural structures with in vivo analysis of optical...... properties of tissue scatterers in AK/SCC lesions and normal sun-exposed skin. In vivoHD-OCT analysis of optical properties permits AK discrimination from SCC and AK subdifferentiation with higher accuracy than in vivoHD-OCT analysis of morphology alone....

  6. Effects of sulfate deprivation on the production of chondroitin/dermatan sulfate by cultures of skin fibroblasts from normal and diabetic individuals

    International Nuclear Information System (INIS)

    Silbert, C.K.; Humphries, D.E.; Palmer, M.E.; Silbert, J.E.

    1991-01-01

    Human skin fibroblast monolayer cultures from two normal men, three Type I diabetic men, and one Type I diabetic woman were incubated with [3H]glucosamine in the presence of diminished concentrations of sulfate. Although total synthesis of [3H]chondroitin/dermatan glycosaminoglycans varied somewhat between cell lines, glycosaminoglycan production was not affected within any line when sulfate levels were decreased from 0.3 mM to 0.06 mM to 0.01 mM to 0 added sulfate. Lowering of sulfate concentrations resulted in diminished sulfation of chondroitin/dermatan in a progressive manner, so that overall sulfation dropped to as low as 19% for one of the lines. Sulfation of chondroitin to form chondroitin 4-sulfate and chondroitin 6-sulfate was progressively and equally affected by decreasing the sulfate concentration in the culture medium. However, sulfation to form dermatan sulfate was preserved to a greater degree, so that the relative proportion of dermatan sulfate to chondroitin sulfate increased. Essentially all the nonsulfated residues were susceptible to chondroitin AC lyase, indicating that little epimerization of glucuronic acid residues to iduronic acid had occurred in the absence of sulfation. These results confirm the previously described dependency of glucuronic/iduronic epimerization on sulfation, and indicate that sulfation of the iduronic acid-containing disaccharide residues of dermatan can take place with sulfate concentrations lower than those needed for 6-sulfation and 4-sulfation of the glucuronic acid-containing disaccharide residues of chondroitin. There were considerable differences among the six fibroblast lines in susceptibility to low sulfate medium and in the proportion of chondroitin 6-sulfate, chondroitin 4-sulfate, and dermatan sulfate. However, there was no pattern of differences between normals and diabetics

  7. Proteomics reveals novel oxidative and glycolytic mechanisms in type 1 diabetic patients' skin which are normalized by kidney-pancreas transplantation.

    Directory of Open Access Journals (Sweden)

    Franco Folli

    2010-03-01

    Full Text Available In type 1 diabetes (T1D vascular complications such as accelerated atherosclerosis and diffused macro-/microangiopathy are linked to chronic hyperglycemia with a mechanism that is not yet well understood. End-stage renal disease (ESRD worsens most diabetic complications, particularly, the risk of morbidity and mortality from cardiovascular disease is increased several fold.We evaluated protein regulation and expression in skin biopsies obtained from T1D patients with and without ESRD, to identify pathways of persistent cellular changes linked to diabetic vascular disease. We therefore examined pathways that may be normalized by restoration of normoglycemia with kidney-pancreas (KP transplantation. Using proteomic and ultrastructural approaches, multiple alterations in the expression of proteins involved in oxidative stress (catalase, superoxide dismutase 1, Hsp27, Hsp60, ATP synthase delta chain, and flavin reductase, aerobic and anaerobic glycolysis (ACBP, pyruvate kinase muscle isozyme, and phosphoglycerate kinase 1, and intracellular signaling (stratifin-14-3-3, S100-calcyclin, cathepsin, and PPI rotamase as well as endothelial vascular abnormalities were identified in T1D and T1D+ESRD patients. These abnormalities were reversed after KP transplant. Increased plasma levels of malondialdehyde were observed in T1D and T1D+ESRD patients, confirming increased oxidative stress which was normalized after KP transplant.Our data suggests persistent cellular changes of anti-oxidative machinery and of aerobic/anaerobic glycolysis are present in T1D and T1D+ESRD patients, and these abnormalities may play a key role in the pathogenesis of hyperglycemia-related vascular complications. Restoration of normoglycemia and removal of uremia with KP transplant can correct these abnormalities. Some of these identified pathways may become potential therapeutic targets for a new generation of drugs.

  8. Effects of the Healthy Start randomized intervention trial on physical activity among normal weight preschool children predisposed to overweight and obesity

    DEFF Research Database (Denmark)

    Händel, Mina Nicole; Larsen, Sofus Christian; Rohde, Jeanett Friis

    2017-01-01

    was to evaluate the effect on PA outcomes of the 15 month Healthy Start intervention that focused on changing diet, PA, sleep and stress management among normal weight but obesity-prone preschool children. Children were defined as obesity-prone if they had a birth weight > 4,000 g, mothers with a pre...... was obtained from a 7 days recording in the Children’s Physical Activity Questionnaire. Time used for sport activities were combined with outdoor playing time to achieve a proxy of total PA level of moderate to vigorous intensity. Results: Linear regression analyses revealed that at follow-up the intervention...... group spent more time on sports and outdoor activities combined per week than the control group (ITT analyses: intervention: 400 min/week; 95% confidence interval (CI): 341, 459 versus control: 321 min/week; 95% CI: 277, 366; p = 0.02), although no significant intervention effects were seen for each...

  9. Both near ultraviolet radiation and the oxidizing agent hydrogen peroxide induce a 32-kDa stress protein in normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Keyse, S.M.; Tyrrell, R.M.

    1987-01-01

    We have analyzed the pattern of protein synthesis in solar near ultraviolet (334 nm, 365 nm) and near visible (405 nm) irradiated normal human skin fibroblasts. Two hours after irradiation we find that one major stress protein of approximately 32 kDa is induced in irradiated cells. This protein is not induced by ultraviolet radiation at wavelengths shorter than 334 nm and is not inducible by heat shock treatment of these cells. Although sodium arsenite, diamide, and menadione all induced a 32-kDa protein, they also induced the major heat shock proteins. In contrast, the oxidizing agent, hydrogen peroxide, induced the low molecular weight stress protein without causing induction of the major heat shock proteins. A comparison of the 32-kDa proteins induced by sodium arsenite, H 2 O 2 , and solar near ultraviolet radiation using chemical peptide mapping shows that they are closely related. These results imply that the pathways for induction of the heat shock response and the 32-kDa protein are not identical and suggest that, at least in the case of radiation and treatment with H 2 O 2 , the 32-kDa protein might be induced in response to cellular oxidative stress. This conclusion is supported by the observation that depletion of endogenous cellular glutathione prior to solar near ultraviolet irradiation lowers the fluence threshold for induction of the 32-kDa stress protein

  10. Cardiac MRI. Estimation of changes in normalized myocardial gadolinium accumulation over time after contrast injection in patients with acute myocarditis and healthy volunteers

    International Nuclear Information System (INIS)

    Breuckmann, F.; Buhr, C.; Maderwald, S.; Bruder, O.; Schlosser, T.; Nassenstein, K.; Erbel, R.; Barkhausen, J.

    2011-01-01

    An increased normalized gadolinium accumulation (NGA) in the myocardium during early washout has been used for the diagnosis of acute myocarditis (AM). Due to the fact that the pharmacokinetics of contrast agents are complex, time-related changes in NGA after contrast injection are likely. Because knowledge about time-related changes of NGA may improve the diagnostic accuracy of MR, our study aimed to estimate the time course of NGA after contrast injection in patients as well as in healthy volunteers. An ECG-triggered inversion recovery SSFP sequence with incrementally increasing inversion times was repetitively acquired over the 15 minutes after injection of 0.2 Gd-DTPA per kg body weight in a 4-chamber view in 15 patients with AM and 20 volunteers. The T 1relaxation times and the longitudinal relaxation rates (R1) of the myocardium and skeletal musculature were calculated for each point in time after contrast injection. The time course of NGA was estimated based on the linear relationship between R 1 and tissue Gd concentration. NGA decreased over time in the form of a negative power function in patients with AM and in healthy controls. NGA in AM tended to be higher than in controls (p > 0.05). NGA rapidly changes after contrast injection, which must be considered when measuring NGA. Although we observed a trend towards higher NGA values in patients with AM with a maximum difference one minute after contrast injection, NGA did not allow us to differentiate patients with AM from healthy volunteers, because the observed differences did not reach a level of significance. (orig.)

  11. Age-Specific Normal Reference Range for Serum Anti-Müllerian Hormone in Healthy Chinese Han Women: A nationwide Population-Based Study.

    Science.gov (United States)

    Du, Xiaofang; Ding, Ting; Zhang, Hanwang; Zhang, Cuilian; Ma, Wenmin; Zhong, Ying; Qu, Wenyu; Zheng, Jie; Liu, Yi; Li, Zhiying; Huang, Kecheng; Deng, Song; Ma, Lanfang; Yang, Jun; Jiang, Jingjing; Yang, Shuhong; Huang, Jia; Wu, Meng; Fang, Li; Lu, Yunping; Luo, Aiyue; Wang, Shixuan

    2016-08-01

    The increasing use of anti-Müllerian hormone (AMH) in clinic has raised concerns regarding the reliable reference range for this test. However, the reference range for AMH in normal Chinese female population has not been established. Furthermore, relationship between AMH and other clinical markers such as body mass index (BMI) and antral follicle counts (AFCs) and other sex-related hormones have not been examined in normal population-based women. We aimed to determine the age-specific reference range for serum AMH in healthy Chinese women throughout reproductive age to menopause and to estimate relationship between AMH and other clinical markers in healthy women. In this multicenter and nationwide study, advertisements were used to recruit 2055 women, aged 20 to 55 years, from 6 different regions in China; 1590 (77.37%) women met the inclusion criteria for the reference range population. We measured the baseline serum AMH levels using new Beckman Coulter Gen II assay. Serum concentration of follicle-stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2), testosterone (T), prolactin (PRL), progesterone (PRG), and AFCs were also determined in the follicular phase. The AMH-Age nomogram and AMH levels of different age-groups and the relationship between AMH and other clinical markers. Serum AMH concentrations declined progressively with age. A quadratic model defined as log (AMH) = (-1.970 + 0.296 × Age - 0.006 × Age(2)) fitted best the decline of AMH with age. The median AMH levels were 6.23, 5.65, 4.55, 3.74, 2.78, and 1.09 ng/mL for the 20 ≤ age women. © The Author(s) 2016.

  12. The buccal cytome and micronucleus frequency is substantially altered in Down's syndrome and normal ageing compared to young healthy controls

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, Philip [CSIRO Human Nutrition, PO Box 10041, Adelaide BC, Adelaide, SA 5000 (Australia); Discipline of Physiology, School of Molecular and Biomedical Sciences, The University of Adelaide, Adelaide, SA 5005 (Australia)], E-mail: philip.thomas@csiro.au; Harvey, Sarah; Gruner, Tini [Southern Cross University, PO Box 157, Lismore, NSW 2480 (Australia); Fenech, Michael [CSIRO Human Nutrition, PO Box 10041, Adelaide BC, Adelaide, SA 5000 (Australia)], E-mail: michael.fenech@csiro.au

    2008-02-01

    The buccal micronucleus cytome assay was used to investigate biomarkers for DNA damage, cell death and basal cell frequency in buccal cells of healthy young, healthy old and young Down's syndrome cohorts. With normal ageing a significant increase in cells with micronuclei (P < 0.05, average increase +366%), karyorrhectic cells (P < 0.001, average increase +439%), condensed chromatin cells (P < 0.01, average increase +45.8%) and basal cells (P < 0.001, average increase +233%) is reported relative to young controls. In Down's syndrome we report a significant increase in cells with micronuclei (P < 0.001, average increase +733%) and binucleated cells (P < 0.001, average increase +84.5%) and a significant decrease in condensed chromatin cells (P < 0.01, average decrease -52%), karyolytic cells (P < 0.001, average decrease -51.8%) and pyknotic cells (P < 0.001, average decrease -75.0%) relative to young controls. These changes show distinct differences between the cytome profile of normal ageing relative to that for a premature ageing syndrome, and highlight the diagnostic value of the cytome approach for measuring the profile of cells with DNA damage, cell death and proportion of cells with proliferative potential (i.e., basal cells). Significant correlations amongst cell death biomarkers observed in this study were used to propose a new model of the inter-relationship of cell types scored within the buccal micronucleus cytome assay. This study validates the use of a cytome approach to investigate DNA damage, cell death and cell proliferation in buccal cells with ageing.

  13. In vivo study of human skin using pulsed terahertz radiation

    International Nuclear Information System (INIS)

    Pickwell, E; Cole, B E; Fitzgerald, A J; Pepper, M; Wallace, V P

    2004-01-01

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation

  14. In vivo study of human skin using pulsed terahertz radiation

    Energy Technology Data Exchange (ETDEWEB)

    Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)

    2004-05-07

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.

  15. 3 Tesla (1) H MR spectroscopy of hip bone marrow in a healthy population, assessment of normal fat content values and influence of age and sex.

    Science.gov (United States)

    Pansini, Vittorio; Monnet, Aurélien; Salleron, Julia; Hardouin, Pierre; Cortet, Bernard; Cotten, Anne

    2014-02-01

    To evaluate in a healthy population normal spectroscopic fat content (FC) values of the hip bone marrow and to assess the influence of age and sex on bone marrow conversion. Eighty volunteers (40 men; 40 women; ages: 20-60 years; divided into four consecutive groups) underwent acetabulum, femoral head, femoral neck, greater trochanter, and diaphysis localized (1) H MR spectroscopy. FC values of each anatomical site were obtained according to the following formula: Fat content = CH2 /(CH2  + Water)*100. To assess bone marrow conversion, a spectroscopic conversion index (SCI) was calculated as FC neck/FC greater trochanter. FC values showed a gradient as follows: greater trochanter > femoral head > femoral neck > diaphysis > acetabulum in every age group both in men and in women. SCI increased with age both in men and women, showing lower values in women for every age group. We obtained normal spectroscopic FC values from different areas of the hip, according to age and sex. These values may be used as reference values to evaluate, by the means of (1) H MR spectroscopy, pathological conditions affecting hip bone marrow. Copyright © 2013 Wiley Periodicals, Inc.

  16. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    International Nuclear Information System (INIS)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase; Thomassen, Anders

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new pressure device thus had acceptable validity and reproducibility for estimation of the skin perfusion pressure and can be used on bony and tendineous sites on the lower limb in regions where critical wound healing is frequent, e.g. ankle and forefoot

  17. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  18. Psychoneuroimmunology and the Skin.

    Science.gov (United States)

    Honeyman, Juan F

    2016-08-23

    The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.

  19. Presence of non-fibrillar amyloid beta protein in skin biopsies of Alzheimer's disease (AD), Down's syndrome and non-AD normal persons

    DEFF Research Database (Denmark)

    Wen, G Y; Wisniewski, H M; Blondal, H

    1994-01-01

    A total of 66 skin biopsies from persons with Alzheimer's disease (AD) or Down's syndrome (DS) and from persons without AD were used in this study. The age range was from 7 to 89 years. Positive immunoreactivity of skin biopsies to monoclonal antibody 4G8, which is reactive to amino acid residue 17...

  20. Arterial and venous oxygen partial pressure and utilization factor η, resp., and 133Xe muscle clearance after UV irradiation of skin or blood of healthy persons and patients with occlusive arterial disease and psoriasis, resp

    International Nuclear Information System (INIS)

    Scherf, H.P.; Strangfeld, D.; Meffert, H.; Glatzel, E.; Siewert, H.; Soennichsen, N.; Correns, H.J.

    1988-01-01

    In three teams of test persons series of UV irradiations of the skin (λ max 365 nm) and of the blood (λ max 254 nm) were performed, and moreover pseudoirradiations of the blood as placebo and infrared irradiations of the skin were carried out. UV irradiations of the blood increased the factor η (O 2 utilization) in all test persons. In healthy persons and patients with psoriasis UV irradiations of the skin involved a homogeneous, but less distinct effect, this was, however, not the case in patients with vascular diseases. According to the results of the 133 Xe muscle clearance the improved utilization of oxygen does not result from increased peripheral blood supply. (author)

  1. Healthy lifestyle and normal waist circumference are associated with a lower 5-year risk of type 2 diabetes in middle-aged and elderly individuals: Results from the healthy aging longitudinal study in Taiwan (HALST).

    Science.gov (United States)

    Chen, Chu-Chih; Liu, Kiang; Hsu, Chih-Chen; Chang, Hsing-Yi; Chung, Hsiao-Chun; Liu, Jih-Shin; Liu, Yo-Hann; Tsai, Tsung-Lung; Liaw, Wen-Jin; Lin, I-Ching; Wu, Hsi-Wen; Juan, Chung-Chou; Chiu, Hou-Chang; Lee, Marion M; Hsiung, Chao A

    2017-02-01

    Type 2 diabetes mellitus (DM) is known to be closely associated with lifestyle and obesity and has a prevalence that increases with age. This study aimed to assess the short-term composite effect of diet, physical activity, psychosocial health, and waist circumference (WC) on the incidence of DM in the elderly and to provide a lifestyle-based predictive index.We used baseline measurements (2009-2013) of 5349 community-dwelling participants (aged 55 years and older, 52% female) of the Healthy Aging Longitudinal Study in Taiwan (HALST) for fasting plasma glucose, HbA1C, serum cholesterol, triglycerides, blood pressures, WC, and outcomes of home-visit questionnaire. Principal component analysis (PCA) was used to identify participants with a healthy lifestyle (HLF: higher diet, physical activity, and psychosocial scores) and a lower WC, with cutoffs determined by the receiver-operating characteristics. A Cox regression model was applied to 3424 participants without DM at baseline by linking to their National Health Insurance records (median follow-up of 3.1 years).In total, 247 new DM cases (7.2%) were identified. The HLF and lower WC group had a relative risk (RR) of DM of 0.54 (95% CI 0.35-0.82) compared to the non-HLF and higher WC group. When stratified by the presence of impaired glucose tolerance (IGT) or metabolic syndrome (MS), only participants with IGT/MS showed significant risks (RR 0.55; 95% CI 0.33-0.92). However, except for WC, the individual lifestyle factors were nonsignificant in the overall model without PCA.A composite protective effect of HLF and normal WC on DM within 5 years was observed, especially in those with IGT or MS. Psychosocial health constituted an important lifestyle factor in the elderly. The cutoffs identified could be used as a lifestyle-based risk index for DM. Maintaining an HLF to prevent DM is especially important for the elderly.

  2. Mycobacterium tuberculosis epitope-specific interferon-g production in healthy Brazilians reactive and non-reactive to tuberculin skin test

    Directory of Open Access Journals (Sweden)

    Bosco Christiano Maciel da Silva

    2014-12-01

    Full Text Available The interferon (IFN-γ response to peptides can be a useful diagnostic marker of Mycobacterium tuberculosis (MTB latent infection. We identified promiscuous and potentially protective CD4+ T-cell epitopes from the most conserved regions of MTB antigenic proteins by scanning the MTB antigenic proteins GroEL2, phosphate-binding protein 1 precursor and 19 kDa antigen with the TEPITOPE algorithm. Seven peptide sequences predicted to bind to multiple human leukocyte antigen (HLA-DR molecules were synthesised and tested with IFN-γ enzyme-linked immunospot (ELISPOT assays using peripheral blood mononuclear cells (PBMCs from 16 Mantoux tuberculin skin test (TST-positive and 16 TST-negative healthy donors. Eighty-eight percent of TST-positive donors responded to at least one of the peptides, compared to 25% of TST-negative donors. Each individual peptide induced IFN-γ production by PBMCs from at least 31% of the TST-positive donors. The magnitude of the response against all peptides was 182 ± 230 x 106 IFN-γ spot forming cells (SFC among TST-positive donors and 36 ± 62 x 106 SFC among TST-negative donors (p = 0.007. The response to GroEL2 (463-477 was only observed in the TST-positive group. This combination of novel MTB CD4 T-cell epitopes should be tested in a larger cohort of individuals with latent tuberculosis (TB to evaluate its potential to diagnose latent TB and it may be included in ELISPOT-based IFN-γ assays to identify individuals with this condition.

  3. Characterization of novel human papillomavirus types 157, 158 and 205 from healthy skin and recombination analysis in genus γ-Papillomavirus.

    Science.gov (United States)

    Bolatti, Elisa M; Chouhy, Diego; Casal, Pablo E; Pérez, Germán R; Stella, Emma J; Sanchez, Adriana; Gorosito, Mario; Bussy, Ramón Fernandez; Giri, Adriana A

    2016-08-01

    Gammapapillomavirus (γ-PV) is a diverse and rapidly expanding genus, currently consisting of 79 fully characterized human PV (HPV) types. In this study, three novel types, HPV157, HPV158 and HPV205, obtained from healthy sun-exposed skin of two immunocompetent individuals, were amplified by the "Hanging droplet" long PCR technique, cloned, sequenced and characterized. HPV157, HPV158 and HPV205 genomes comprise 7154-bp, 7192-bp and 7298-bp, respectively, and contain four early (E1, E2, E6 and E7) and two late genes (L1 and L2). Phylogenetic analysis of the L1 ORF placed all novel types within the γ-PV genus: HPV157 was classified as a new member of species γ-12 while HPV158 and HPV205 belong to species γ-1. We then explored potential recombination events in genus γ-PV with the RDP4 program in a dataset of 74 viruses (71 HPV types with available full-length genomes and the 3 novel types). Two events, both located in the E1 ORF, met the inclusion criterion (p-values methods) and persisted in different ORF combinations: an inter-species recombination in species γ-8 (major and minor parents: species γ-24 and γ-11, respectively), and an intra-species recombination in species γ-7 (recombinant strain: HPV170; major and minor parents: HPV-109 and HPV-149, respectively). These findings were confirmed by phylogenetic tree incongruence analysis. An additional incongruence was found in members of species γ-9 but it was not detected by the RDP4. This report expands our knowledge of the family Papillomaviridae and provides for the first time in silico evidence of recombination in genus γ-PV. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Skin decontamination

    International Nuclear Information System (INIS)

    Moehrle, G.

    1975-01-01

    A general survey of skin decontamination is given. The success of every decontamination treatments depends mainly on the speed, but also on the care, with which the action is taken. The best way to remove the skin contaminants is thorough washing under lukewarm running water with mild soap and a soft brush. This washing is to be repeated several times for a period of several minutes. If results are not satisfactory, light duty detergents and wetting agents available commercially may also be used. Some solutions which have proved useful are mentioned. The decontamination solutions are best used in the order given. When one has no satisfactory decontamination effect, the next one is to be used. If necessary, these agents must be used several times in the stated order as long as this does not involve too much strain for the skin. All the decontamination measures mentioned refer, of course, to intact healthy skin. After decontamination has been completed, the skin should be treated with a protective cream

  5. Age- and Sex-Associated Changes in Cerebral Glucose Metabolism in Normal Healthy Subjects: Statistical Parametric Mapping Analysis of F-18 Fluorodeoxyglucose Brain Positron Emission Tomography

    International Nuclear Information System (INIS)

    Kim, In-Ju; Kim, Seong-Jang; Kim, Yong-Ki

    2009-01-01

    Background: The age- and sex-associated changes of brain development are unclear and controversial. Several previous studies showed conflicting results of a specific pattern of cerebral glucose metabolism or no differences of cerebral glucose metabolism in association with normal aging process and sex. Purpose: To investigate the effects of age and sex on changes in cerebral glucose metabolism in healthy subjects using fluorine-18 fluorodeoxyglucose (F-18 FDG) brain positron emission tomography (PET) and statistical parametric mapping (SPM) analysis. Material and Methods: Seventy-eight healthy subjects (32 males, mean age 46.6±18.2 years; 46 females, mean age 40.6±19.8 years) underwent F-18 FDG brain PET. Using SPM, age- and sex-associated changes in cerebral glucose metabolism were investigated. Results: In males, a negative correlation existed in several gray matter areas, including the right temporopolar (Brodmann area [BA] 38), right orbitofrontal (BA 47), left orbitofrontal gyrus (BA 10), left dorsolateral frontal gyrus (BA 8), and left insula (BA 13) areas. A positive relationship existed in the left claustrum and left thalamus. In females, negative changes existed in the left caudate body, left temporopolar area (BA 38), right orbitofrontal gyri (BA 47 and BA 10), and right dorsolateral prefrontal cortex (BA 46). A positive association was demonstrated in the left subthalamic nucleus and the left superior frontal gyrus. In white matter, an age-associated decrease in FDG uptake in males was shown in the left insula, and increased FDG uptake was found in the left corpus callosum. The female group had an age-associated negative correlation of FDG uptake only in the right corpus callosum. Conclusion: Using SPM, we found not only similar areas of brain, but also sex-specific cerebral areas of age-associated changes of FDG uptake

  6. Age- and Sex-Associated Changes in Cerebral Glucose Metabolism in Normal Healthy Subjects: Statistical Parametric Mapping Analysis of F-18 Fluorodeoxyglucose Brain Positron Emission Tomography

    Energy Technology Data Exchange (ETDEWEB)

    Kim, In-Ju; Kim, Seong-Jang; Kim, Yong-Ki (Dept. of Nuclear Medicine, Pusan National Univ. Hospital, Busan (Korea); Medical Research Institute, Pusan National Univ., Busan (Korea)). e-mail: growthkim@daum.net/growthkim@pusan.ac.kr)

    2009-12-15

    Background: The age- and sex-associated changes of brain development are unclear and controversial. Several previous studies showed conflicting results of a specific pattern of cerebral glucose metabolism or no differences of cerebral glucose metabolism in association with normal aging process and sex. Purpose: To investigate the effects of age and sex on changes in cerebral glucose metabolism in healthy subjects using fluorine-18 fluorodeoxyglucose (F-18 FDG) brain positron emission tomography (PET) and statistical parametric mapping (SPM) analysis. Material and Methods: Seventy-eight healthy subjects (32 males, mean age 46.6+-18.2 years; 46 females, mean age 40.6+-19.8 years) underwent F-18 FDG brain PET. Using SPM, age- and sex-associated changes in cerebral glucose metabolism were investigated. Results: In males, a negative correlation existed in several gray matter areas, including the right temporopolar (Brodmann area [BA] 38), right orbitofrontal (BA 47), left orbitofrontal gyrus (BA 10), left dorsolateral frontal gyrus (BA 8), and left insula (BA 13) areas. A positive relationship existed in the left claustrum and left thalamus. In females, negative changes existed in the left caudate body, left temporopolar area (BA 38), right orbitofrontal gyri (BA 47 and BA 10), and right dorsolateral prefrontal cortex (BA 46). A positive association was demonstrated in the left subthalamic nucleus and the left superior frontal gyrus. In white matter, an age-associated decrease in FDG uptake in males was shown in the left insula, and increased FDG uptake was found in the left corpus callosum. The female group had an age-associated negative correlation of FDG uptake only in the right corpus callosum. Conclusion: Using SPM, we found not only similar areas of brain, but also sex-specific cerebral areas of age-associated changes of FDG uptake

  7. Age-Dependent Changes in Resting Energy Expenditure (REE): Insights from Detailed Body Composition Analysis in Normal and Overweight Healthy Caucasians.

    Science.gov (United States)

    Geisler, Corinna; Braun, Wiebke; Pourhassan, Maryam; Schweitzer, Lisa; Glüer, Claus-Christian; Bosy-Westphal, Anja; Müller, Manfred J

    2016-06-01

    Age-related changes in organ and tissue masses may add to changes in the relationship between resting energy expenditure (REE) and fat free mass (FFM) in normal and overweight healthy Caucasians. Secondary analysis using cross-sectional data of 714 healthy normal and overweight Caucasian subjects (age 18-83 years) with comprehensive information on FFM, organ and tissue masses (as assessed by magnetic resonance imaging (MRI)), body density (as assessed by Air Displacement Plethysmography (ADP)) and hydration (as assessed by deuterium dilution (D₂O)) and REE (as assessed by indirect calorimetry). High metabolic rate organs (HMR) summarized brain, heart, liver and kidney masses. Ratios of HMR organs and muscle mass (MM) in relation to FFM were considered. REE was calculated (REEc) using organ and tissue masses times their specific metabolic rates. REE, FFM, specific metabolic rates, the REE-FFM relationship, HOMA, CRP, and thyroid hormone levels change with age. The age-related decrease in FFM explained 59.7% of decreases in REE. Mean residuals of the REE-FFM association were positive in young adults but became negative in older subjects. When compared to young adults, proportions of MM to FFM decreased with age, whereas contributions of liver and heart did not differ between age groups. HOMA, TSH and inflammation (plasma CRP-levels) explained 4.2%, 2.0% and 1.4% of the variance in the REE-FFM residuals, but age and plasma T3-levels had no effects. HMR to FFM and MM to FFM ratios together added 11.8% on to the variance of REE-FFM residuals. Differences between REE and REEc increased with age, suggesting age-related changes in specific metabolic rates of organs and tissues. This bias was partly explained by plasmaT3-levels. Age-related changes in REE are explained by (i) decreases in fat free mass; (ii) a decrease in the contributions of organ and muscle masses to FFM; and (iii) decreases in specific organ and tissue metabolic rates. Age-dependent changes in the REE

  8. Gender differences in brain regional homogeneity of healthy subjects after normal sleep and after sleep deprivation: a resting-state fMRI study.

    Science.gov (United States)

    Dai, Xi-Jian; Gong, Hong-Han; Wang, Yi-Xiang; Zhou, Fu-Qing; Min, You-Jiang; Zhao, Feng; Wang, Si-Yong; Liu, Bi-Xia; Xiao, Xiang-Zuo

    2012-06-01

    To explore the gender differences of brain regional homogeneity (ReHo) in healthy subjects during the resting-state, after normal sleep, and after sleep deprivation (SD) using functional magnetic resonance imaging (fMRI) and the ReHo method. Sixteen healthy subjects (eight males and eight females) each underwent the resting-state fMRI exams twice, i.e., once after normal sleep and again after 24h's SD. According to the gender and sleep, 16 subjects were all measured twice and divided into four groups: the male control group (MC), female control group (FC), male SD group (MSD), and female SD group (FSD). The ReHo method was used to calculate and analyze the data, SPM5 software was used to perform a two-sample T-test and a two-pair T-test with a P value right paracentral lobule (BA3/6), but in no obviously lower regions. Compared with the FC, the FSD showed significantly higher ReHo in bilateral parietal lobes (BA2/3), bilateral vision-related regions of occipital lobes (BA17/18/19), right frontal lobe (BA4/6), and lower ReHo in the right frontal lobe. Compared with the FC, the MC showed significantly higher ReHo in the left occipital lobe (BA18/19), and left temporal lobe (BA21), left frontal lobe, and lower ReHo in the right insula and in the left parietal lobe. Compared with the FSD, the MSD showed significantly higher ReHo in the left cerebellum posterior lobe (uvula/declive of vermis), left parietal lobe, and bilateral frontal lobes, and lower ReHo in the right occipital lobe (BA17) and right frontal lobe (BA4). The differences of brain activity in the resting state can be widely found not only between the control and SD group in a same gender group, but also between the male group and female group. Thus, we should take the gender differences into consideration in future fMRI studies, especially the treatment of brain-related diseases (e.g., depression). Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Effects of a synthetic retinoid on skin structure, matrix metalloproteinases, and procollagen in healthy and high-risk subjects with diabetes.

    Science.gov (United States)

    Zeng, Wei; Tahrani, Abd; Shakher, Jayadave; Varani, James; Hughes, Sharon; Dubb, Kiran; Stevens, Martin J

    2011-01-01

    In diabetes, foot ulceration may result from increased skin fragility. Retinoids can reverse some diabetes-induced deficits of skin structure and function, but their clinical utility is limited by skin irritation. The effects of diabetes and MDI 301, a nonirritating synthetic retinoid, and retinoic acid have been evaluated on matrix metalloproteinases (MMPs), procollagen expression, and skin structure in skin biopsies from nondiabetic volunteers and diabetic subjects at risk of foot ulceration using organ culture techniques. Zymography and enzyme-linked immunosorbent assay were utilized for analysis of MMP-1, -2, and -9 and tissue inhibitor of metalloproteinase-1 (TIMP-1) and immunohistochemistry for type I procollagen protein abundance. Collagen structure parameters were assessed in formalin-fixed, paraffin-embedded tissue sections. The % of active MMP-1 and -9 was higher and TIMP-1 abundance was lower in subjects with diabetes. Type 1 procollagen abundance was reduced and skin structural deficits were increased in diabetes. Three μM MDI 301 reduced active MMP-1 and -9 abundance by 29% (P structural deficit scores. Two μM retinoic acid reduced MMP-1 but did not significantly affect skin structure. These data indicate that diabetic patients at risk of foot ulceration have deficits of skin structure and function. MDI 301 offers potential for repairing this skin damage complicating diabetes. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Esterification of all-trans-retinol in normal human epithelial cell strains and carcinoma lines from oral cavity, skin and breast: reduced expression of lecithin:retinol acyltransferase in carcinoma lines.

    Science.gov (United States)

    Guo, X; Ruiz, A; Rando, R R; Bok, D; Gudas, L J

    2000-11-01

    When exogenous [(3)H]retinol (vitamin A) was added to culture medium, normal human epithelial cells from the oral cavity, skin, lung and breast took up and esterified essentially all of the [(3)H]retinol within a few hours. As shown by [(3)H]retinol pulse-chase experiments, normal epithelial cells then slowly hydrolyzed the [(3)H]retinyl esters to [(3)H]retinol, some of which was then oxidized to [(3)H]retinoic acid (RA) over a period of several days. In contrast, cultured normal human fibroblasts and human umbilical vein endothelial cells (HUVEC) did not esterify significant amounts of [(3)H]retinol; this lack of [(3)H]retinol esterification was correlated with a lack of expression of lecithin:retinol acyltransferase (LRAT) transcripts in normal fibroblast and HUVEC strains. These results indicate that normal, differentiated cell types differ in their ability to esterify retinol. Human carcinoma cells (neoplastically transformed epithelial cells) of the oral cavity, skin and breast did not esterify much [(3)H]retinol and showed greatly reduced LRAT expression. Transcripts of the neutral, bile salt-independent retinyl ester hydrolase and the bile salt-dependent retinyl ester hydrolase were undetectable in all of the normal cell types, including the epithelial cells. These experiments suggest that retinoid-deficiency in the tumor cells could develop because of the lack of retinyl esters, a storage form of retinol.

  11. Effect of enforced physical inactivity induced by 60-day of bed rest on hepatic markers of NAFLD in healthy normal-weight women.

    Science.gov (United States)

    Rudwill, Floriane; Bergouignan, Audrey; Gastebois, Caroline; Gauquelin-Koch, Guillemette; Lefai, Etienne; Blanc, Stéphane; Simon, Chantal

    2015-06-01

    Physical inactivity leads to a cluster of metabolic disorders that have been associated with non-alcoholic fatty liver diseases. We tested whether physical inactivity increases hepatic biomarkers of NAFLDs. Sixteen normal-weight healthy women (body mass index = 21.2 ± 0.5 kg/m(2) ) were studied under controlled energy balance conditions during a previous 60-day bed rest with (n = 8) or without (n = 8) a combined aerobic/resistive exercise protocol. Stored samples were retrospectively used to measure plasma hepatic markers, i.e. steatosis-related alanine and aspartate transaminases, cytokeratin 18 and angiopoietin-like 3, at baseline, after 30 and 60 days of bed rest. Fasting insulin and triglycerides were measured at baseline and after 30 days of bed rest. Two indexes were calculated, one combining alanine and aspartate transaminase and cytokeratin 18 and another cytokeratin 18, homeostasis model assessment of insulin resistance and aspartate aminotransferase. Sixty days of bed rest increased all hepatic markers (P inactive conditions. Physical inactivity increases, independent of fat mass, hepatic markers of steatosis and steatohepatitis. Regular exercise can limit these physical inactivity-induced metabolic alterations. Future studies need to elucidate the underlying mechanisms. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Assessment of extent of skin involvement in scleroderma using shear wave elastography

    Directory of Open Access Journals (Sweden)

    Anupam Wakhlu

    2017-01-01

    Full Text Available Introduction: Scleroderma (systemic sclerosis [SSc] is a rare autoimmune disease which manifests as fibrosis in the skin and other internal organs. Conventionally, the modified Rodnan skin score (MRSS has been used to quantify the extent of skin fibrosis (resulting in skin tightness in SSc. This technique, although widely validated, is limited by the requirement of a trained, experienced assessor. Recent literature suggests that utilization of the objective ultrasound-based assessment of skin fibrosis utilizing shear wave elastography (SWE may be a more robust technique to detect early skin tightness in SSc. Methods: We evaluated the use of SWE (assessed by an experienced radiologist in 24 patients with SSc compared with 16 healthy controls. Results: Our patients were predominantly females, with median disease duration of 1.5 years and median MRSS of 17. There was minimal intraobserver variation in the assessment of SWE. Patients with SSc had higher SWE values (mean elasticity [Emean] compared to healthy controls at most assessed sites for the MRSS. The Emeancorrelated significantly at all sites with the MRSS scores. At the sites where MRSS was scored as 0 (normal, the Emeanin patients with SSc was higher when compared with similarly clinical normal skin in patients with SSc, suggesting potential early involvement of these areas of the skin with fibrosis. Conclusion: SWE is a promising tool to objectively assess skin fibrosis in SSc and may be useful in detecting early, subclinical skin involvement in this disease.

  13. Evaluation of out-in skin transparency using a colorimeter and food dye in patients with atopic dermatitis.

    Science.gov (United States)

    Mochizuki, H; Tadaki, H; Takami, S; Muramatsu, R; Hagiwara, S; Mizuno, T; Arakawa, H

    2009-05-01

    Atopic dermatitis is a disease of skin barrier dysfunction and outside stimuli can cross the skin barrier. To examine a new method for evaluating the outside to inside skin transparency with a colorimeter and yellow dyes. In study 1, a total of 28 volunteer subjects (24 normal and four with atopic dermatitis) participated. After provocation with yellow dye, the skin colour of all the subjects was measured using a colorimeter. The skin transparency index was calculated by the changes of the skin colour to yellow. Other variables of skin function, including transepidermal water loss (TEWL) and stratum corneum hydration, were also measured. In study 2, the skin transparency index was evaluated for a cohort of 38 patients with atopic dermatitis, 27 subjects with dry skin and 29 healthy controls. In study 1, the measurement of skin colour (b*) using tartrazine showed good results. There was a significant relationship between the skin transparency index with tartrazine and the atopic dermatitis score (P = 0.014). No other measurements of skin function, including the TEWL, were correlated. In study 2, the skin transparency index score obtained with tartrazine in the patients with atopic dermatitis was significantly higher than that of the controls and those with dry skin (P colorimeter and food dye, is noninvasive, safe and reliable for the evaluation of out-in skin transparency and can demonstrate the characteristic dysfunction in the skin barrier in patients with atopic dermatitis.

  14. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  15. The normal limits, subclinical significance, related metabolic derangements and distinct biological effects of body site-specific adiposity in relatively healthy population.

    Directory of Open Access Journals (Sweden)

    Chun-Ho Yun

    Full Text Available BACKGROUND: The accumulation of visceral adipose tissue that occurs with normal aging is associated with increased cardiovascular risks. However, the clinical significance, biological effects, and related cardiometabolic derangements of body-site specific adiposity in a relatively healthy population have not been well characterized. MATERIALS AND METHODS: In this cross-sectional study, we consecutively enrolled 608 asymptomatic subjects (mean age: 47.3 years, 27% female from 2050 subjects undergoing an annual health survey in Taiwan. We measured pericardial (PCF and thoracic peri-aortic (TAT adipose tissue volumes by 16-slice multi-detector computed tomography (MDCT (Aquarius 3D Workstation, TeraRecon, San Mateo, CA, USA and related these to clinical characteristics, body fat composition (Tanita 305 Corporation, Tokyo, Japan, coronary calcium score (CCS, serum insulin, high-sensitivity C-reactive protein (Hs-CRP level and circulating leukocytes count. Metabolic risk was scored by Adult Treatment Panel III guidelines. RESULTS: TAT, PCF, and total body fat composition all increased with aging and higher metabolic scores (all p<0.05. Only TAT, however, was associated with higher circulating leukocyte counts (ß-coef.:0.24, p<0.05, serum insulin (ß-coef.:0.17, p<0.05 and high sensitivity C-reactive protein (ß-coef.:0.24, p<0.05. These relationships persisted after adjustment in multivariable models (all p<0.05. A TAT volume of 8.29 ml yielded the largest area under the receiver operating characteristic curve (AUROC: 0.79, 95%CI: 0.74-0.83 to identify metabolic syndrome. TAT but not PCF correlated with higher coronary calcium score after adjustment for clinical variables (all p<0.05. CONCLUSION: In our study, we observe that age-related body-site specific accumulation of adipose tissue may have distinct biological effects. Compared to other adiposity measures, peri-aortic adiposity is more tightly associated with cardiometabolic risk profiles and

  16. Age influences the skin reaction pattern to mechanical stress and its repair level through skin care products.

    Science.gov (United States)

    Zouboulis, Christos C; Elewa, Rana; Ottaviani, Monica; Fluhr, Joachim; Picardo, Mauro; Bernois, Armand; Heusèle, Catherine; Camera, Emanuela

    2018-03-01

    Skin aging is associated with alterations of surface texture, sebum composition and immune response. Mechanical stress induces repair mechanisms, which may be dependent on the age and quality of the skin. The response to mechanical stress in young and aged individuals, their subjective opinion and the objective effectiveness of skin care products were evaluated by biophysical skin quality parameters (stratum corneum hydration, transepidermal water loss, skin pH, pigmentation and erythema) at baseline, 1, 6, 24h and 7days at the forearms of 2 groups of healthy volunteers, younger than 35 years (n=11) and older than 60 years (n=13). In addition, casual surface lipid composition was studied under the same conditions at the baseline and day 7 after mechanical stress induction. Evaluations were also performed in stressed skin areas treated daily with skin care products and the subjective opinion of the volunteers was additionally documented. The tested groups exhibited age-associated baseline skin functions as well as casual surface lipid composition and different reaction patterns to mechanical stress. Skin care was more effective in normalizing skin reaction to stress in the young than in the aged group. The subjective volunteer opinion correlated with the objective measurements. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. The effect of speaking rate on serial-order sound-level errors in normal healthy controls and persons with aphasia.

    Science.gov (United States)

    Fossett, Tepanta R D; McNeil, Malcolm R; Pratt, Sheila R; Tompkins, Connie A; Shuster, Linda I

    Although many speech errors can be generated at either a linguistic or motoric level of production, phonetically well-formed sound-level serial-order errors are generally assumed to result from disruption of phonologic encoding (PE) processes. An influential model of PE (Dell, 1986; Dell, Burger & Svec, 1997) predicts that speaking rate should affect the relative proportion of these serial-order sound errors (anticipations, perseverations, exchanges). These predictions have been extended to, and have special relevance for persons with aphasia (PWA) because of the increased frequency with which speech errors occur and because their localization within the functional linguistic architecture may help in diagnosis and treatment. Supporting evidence regarding the effect of speaking rate on phonological encoding has been provided by studies using young normal language (NL) speakers and computer simulations. Limited data exist for older NL users and no group data exist for PWA. This study tested the phonologic encoding properties of Dell's model of speech production (Dell, 1986; Dell,et al., 1997), which predicts that increasing speaking rate affects the relative proportion of serial-order sound errors (i.e., anticipations, perseverations, and exchanges). The effects of speech rate on the error ratios of anticipation/exchange (AE), anticipation/perseveration (AP) and vocal reaction time (VRT) were examined in 16 normal healthy controls (NHC) and 16 PWA without concomitant motor speech disorders. The participants were recorded performing a phonologically challenging (tongue twister) speech production task at their typical and two faster speaking rates. A significant effect of increased rate was obtained for the AP but not the AE ratio. Significant effects of group and rate were obtained for VRT. Although the significant effect of rate for the AP ratio provided evidence that changes in speaking rate did affect PE, the results failed to support the model derived predictions

  18. Assessment of axillary temperature for the evaluation of normal body temperature of healthy young adults at rest in a thermoneutral environment.

    Science.gov (United States)

    Marui, Shuri; Misawa, Ayaka; Tanaka, Yuki; Nagashima, Kei

    2017-02-22

    The aims of this study were to (1) evaluate whether recently introduced methods of measuring axillary temperature are reliable, (2) examine if individuals know their baseline body temperature based on an actual measurement, and (3) assess the factors affecting axillary temperature and reevaluate the meaning of the axillary temperature. Subjects were healthy young men and women (n = 76 and n = 65, respectively). Three measurements were obtained: (1) axillary temperature using a digital thermometer in a predictive mode requiring 10 s (T ax-10 s ), (2) axillary temperature using a digital thermometer in a standard mode requiring 10 min (T ax-10 min ), and (3) tympanic membrane temperature continuously measured by infrared thermometry (T ty ). The subjects answered questions about eating and exercise habits, sleep and menstrual cycles, and thermoregulation and reported what they believed their regular body temperature to be (T reg ). T reg , T ax-10 s , T ax-10 min , and T ty were 36.2 ± 0.4, 36.4 ± 0.5, 36.5 ± 0.4, and 36.8 ± 0.3 °C (mean ± SD), respectively. There were correlations between T ty and T ax-10 min , T ty and T ax-10 s , and T ax-10 min and T ax-10 s (r = .62, r = .46, and r = .59, respectively, P body mass indices and irregular menstrual cycles. Modern devices for measuring axillary temperature may have changed the range of body temperature that is recognized as normal. Core body temperature variations estimated by tympanic measurements were smaller than those estimated by axillary measurements. This variation of axillary temperature may be due to changes in the measurement methods introduced by modern devices and techniques. However, axillary temperature values correlated well with those of tympanic measurements, suggesting that the technique may reliably report an individual's state of health. It is important for individuals to know their baseline axillary temperature to evaluate subsequent

  19. Correlation between treatment time, photobleaching, inflammation and pain after photodynamic therapy with methyl aminolevulinate on tape-stripped skin in healthy volunteers

    DEFF Research Database (Denmark)

    Lerche, Catharina M; Fabricius, Susanne; Philipsen, Peter A

    2015-01-01

    Photodynamic therapy (PDT) is an attractive treatment option for skin diseases such as actinic keratosis, since large skin areas can be treated with high response rates and good cosmetic outcomes. Nevertheless inflammation and pain are still major side effects. The aim of this study was to invest......Photodynamic therapy (PDT) is an attractive treatment option for skin diseases such as actinic keratosis, since large skin areas can be treated with high response rates and good cosmetic outcomes. Nevertheless inflammation and pain are still major side effects. The aim of this study...... of PpIX and to avoid unspecific distribution. We propose a shorter PDT regimen, "Pulse PDT", comprising, for example 30 min incubation with MAL and illumination after 180 min, and we have planned a study of actinic keratosis and "Pulse PDT"....

  20. Blood flow in skin, subcutaneous adipose tissue and skeletal muscle in the forearm of normal man during an oral glucose load

    DEFF Research Database (Denmark)

    Bülow, J; Astrup, A; Christensen, N J

    1987-01-01

    Blood flow to the forearm, and the subcutaneous tissue and skin in the forearm were measured by strain gauge plethysmography, 133Xe-elimination and Laser Doppler flowmetry during an oral glucose load (I g glucose kg-1 lean body mass) and during control conditions. The forearm blood flow remained...... constant during both experiments. Glucose induced a two-fold vasodilatation in subcutaneous tissue. In skin, glucose induced a relative vasodilatation and later a relative vasoconstriction compared with control experiments. When estimated from forearm blood flow and subcutaneous and skin blood flows......, muscle blood flow decreased about 20-30% during both experiments. Proximal nervous blockade did not abolish the glucose-induced vasodilatation in subcutaneous tissue. In the glucose experiment, arterial glucose concentration increased to 7.8 +/- 1.17 mmol l-1 30 min after the load was given...

  1. Measurement of blood flow in the superior sagittal sinus in healthy volunteers, and in patients with normal pressure hydrocephalus and idiopathic intracranial hypertension with phase-contrast cine MR imaging

    DEFF Research Database (Denmark)

    Gideon, P; Thomsen, C; Gjerris, F

    1996-01-01

    PURPOSE: To measure blood flow and velocity in the superior sagittal ++sinus. MATERIAL AND METHODS: MR velocity mapping was used to examine 14 healthy volunteers, 15 patients with normal pressure hydrocephalus (NPH), 3 patients with high pressure hydrocephalus (HPH), and 11 patients with idiopathic...

  2. Skin blood flow from gas transport: helium xenon and laser Doppler compared

    International Nuclear Information System (INIS)

    Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.

    1988-01-01

    A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics

  3. Skin blood flow from gas transport: helium xenon and laser Doppler compared

    Energy Technology Data Exchange (ETDEWEB)

    Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.

    1988-03-01

    A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics.

  4. Patients cured from craniopharyngioma or nonfunctioning pituitary macroadenoma (NFMA) suffer similarly from increased daytime somnolence despite normal sleep patterns compared to healthy controls

    NARCIS (Netherlands)

    van der Klaauw, Agatha A.; Biermasz, Nienke R.; Pereira, Alberto M.; van Kralingen, Klaas W.; Dekkers, Olaf M.; Rabe, Klaus F.; Smit, Johannes W. A.; Romijn, Johannes A.

    2008-01-01

    Adults patients previously treated for craniopharyngioma have increased general and physical fatigue compared to healthy controls. This could be related to disturbed sleep patterns. The aim of this study was to compare sleepiness and sleep patterns in those patients to healthy controls and to

  5. Sun’s effect on skin

    Science.gov (United States)

    The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun's ultraviolet rays, which can burn the skin, and ...

  6. PERBEDAAN SKIN CAPACITANCE DAN TRANSEPIDERMAL WATER LOSS PADA KULIT NON-LESI PASIEN PITIRIASIS VERSIKOLOR DENGAN NON-PITIRIASIS VERSIKOLOR

    Directory of Open Access Journals (Sweden)

    Satya Wydya Yenny

    2008-09-01

    Full Text Available AbstrakPada pitiriasis versikolor sering timbul kekambuhan, diduga salah satu penyebabnya adalah kelembaban kulit yang tinggi. Kelembaban kulit dipengaruhi oleh skin capacitance dan transepidermal water loss.Mengetahui skin capacitance dan transepidermal water loss kulit pasien pitiriasis versikolor dan perbedaannya dengan non-pitiriasis versikolor.Penelitian ini merupakan studi potong lintang perbandingan antar kelompok, yang dilakukan pada bulan September sampai dengan Nopember 2004 di Rumah Sakit Dr. Cipto Mangunkusumo. Subyek penelitian pasien pitiriasis versikolor dan kontrol non-pitiriasis versikolor yang dipasangkan dalam hal umur dan jenis kelamin dan dilakukan pemeriksaan skin capacitance dan transepidermal water loss pada kulit yang tampak normal di punggung menggunakan alat Tewameter/Corneometer 350.Dalam kurun waktu tersebut telah diperiksa sebanyak 32 pasien pitiriasis versikolor dan 32 kontrol non-pitiriasis versikolor. Skin capacitance pasien pitiriasis versikolor secara statistik tidak berbeda dengan kontrol non-pitiriasis versikolor (p = 0,730. Transepidermal water loss pasien pitiriasis versikolor secara bermakna lebih rendah dari pada kelompok kontrol non-pitiriasis versikolor (p = 0,000.Tidak ada perbedaan skin capacitance kulit pasien pitiriasis versikolor dengan non-pitiriasis versikolor. Transepidermal water loss kulit pasien pitiriasis versikolor lebih rendah daripada non-pitiriasis versikolor.Kata kunci: pitiriasis versikolor, skin capacitance, transepidermal water lossAbstractThe recurrence of pityriasis versicolor is high, it could be caused by high skin hydration. Skin hydration was influenced by skin capacitance and transepidermal water loss.ARTIKEL PENELITIAN168The purpose of this study was to compare the differences of the skin capacitance and transepidermal water loss between the pityriasis versicolor skin and healthy non-pityriasis versicolor skin.The design of this study was comparative cross-sectional study

  7. Effect of Exercise-induced Sweating on facial sebum, stratum corneum hydration, and skin surface pH in normal population.

    Science.gov (United States)

    Wang, Siyu; Zhang, Guirong; Meng, Huimin; Li, Li

    2013-02-01

    Evidence demonstrated that sweat was an important factor affecting skin physiological properties. We intended to assess the effects of exercise-induced sweating on the sebum, stratum corneum (SC) hydration and skin surface pH of facial skin. 102 subjects (aged 5-60, divided into five groups) were enrolled to be measured by a combination device called 'Derma Unit SSC3' in their frontal and zygomatic regions when they were in a resting state (RS), at the beginning of sweating (BS), during excessive sweating (ES) and an hour after sweating (AS), respectively. Compared to the RS, SC hydration in both regions increased at the BS or during ES, and sebum increased at the BS but lower during ES. Compared to during ES, Sebum increased in AS but lower than RS. Compared to the RS, pH decreased in both regions at the BS in the majority of groups, and increased in frontal region during ES and in zygomatic region in the AS. There was an increase in pH in both regions during ES in the majority of groups compared to the BS, but a decrease in the AS compared to during ES. The study implies that even in summer, after we sweat excessively, lipid products should be applied locally in order to maintain stability of the barrier function of the SC. The study suggests that after a short term(1 h or less) of self adjustment, excessive sweat from moderate exercise will not impair the primary acidic surface pH of the facial skin. Exercise-induced sweating significantly affected the skin physiological properties of facial region. © 2012 John Wiley & Sons A/S.

  8. Fit, Healthy, and Ready To Learn: A School Health Policy Guide. Part II: Policies To Promote Sun Safety and Prevent Skin Cancer.

    Science.gov (United States)

    Fraser, Katherine

    This publication is a supplementary chapter to "Fit, Healthy, and Ready to Learn: A School Health Policy Guide; Part I: General School Health Policies, Physical Activity, Healthy Eating, and Tobacco-Use Prevention." It discusses various aspects of a complete school policy and plan to promote sun safety. The first section "Purpose…

  9. Measurement of spontaneous DNA damage and DNA repair capacity in healthy adult individuals from high and normal level natural radiation areas of Kerala, India

    International Nuclear Information System (INIS)

    Vivek Kumar, P.R.; Jaikrishan, G.; Das, Birajalaxmi

    2014-01-01

    Inhabitants of the south west coastal areas of Kerala receive high level natural radiation due to the presence of monazite ( 232 Th) in the beach sand. This provides a unique opportunity to investigate the biological effects of high level natural radiation on humans. This study evaluate basal DNA damage in 149 healthy adult male subjects (104 from high level natural radiation areas (HLNRA, > 1mSv year -1 ) and 45 from normal level natural radiation area (NLNRA, d''1mSv year -1 ) by the alkaline comet assay. Oxidative DNA damage (ENDO III, FPG and hOGG1-sensitive sites) was measured by the enzyme modified comet assay. Induction and rejoining of DNA strand breaks was measured after irradiating peripheral blood lymphocytes with 2 Gy or 4 Gy gamma radiation. Basal damage due to age and residential area of the donors showed significant interaction (P=0.001), when all subjects were analyzed using a general linear model (GLM). In subgroup analysis, basal damage increased with age in subjects from the NLNRA (P=0.007), while a significant negative correlation (P=0.01) was observed in subjects from HLNRA. Oxidative DNA damage was not influenced by age, smoking habit or residential area in the entire sample. Subjects of high dose group from HLNRA (>5.75 mSv/y, N=34) showed a significant reduction in the induction of DNA damage after 2 Gy (P=0.03) and 4 Gy (P=0.05) compared to subjects form NLNRA. The study showed increased rejoining of DNA strand breaks in subjects from HLNRA when measured at 7 minutes after irradiation (P=0.04). In this pilot study, a low basal damage in elderly subjects from HLNRA and a reduced induction of DNA damage after 2 Gy and 4 Gy irradiation in high dose group subjects from HLNRA might suggest a possible role of chronic low dose natural radiation on the induction of an in vivo radio adaptive response. However, our findings need more validation in a larger study population. (author)

  10. Irregular meal-pattern effects on energy expenditure, metabolism, and appetite regulation: a randomized controlled trial in healthy normal-weight women.

    Science.gov (United States)

    Alhussain, Maha H; Macdonald, Ian A; Taylor, Moira A

    2016-07-01

    Obesity is increasing in parallel with greater all-day food availability. The latter may promote meal irregularity, dysregulation of the energy balance, and poor metabolic health. We investigated the effect of meal irregularity on the thermic effect of food (TEF), lipid concentrations, carbohydrate metabolism, subjective appetite, and gut hormones in healthy women. Eleven normal-weight women (18-40 y of age) were recruited in a randomized crossover trial with two 14-d isoenergetic diet periods (identical foods provided and free living) that were separated by a 14-d habitual diet washout period. In period 1, participants followed a regular meal pattern (6 meals/d) or an irregular meal pattern (3-9 meals/d), and in period 2, the alternative meal pattern was followed. Before and after each period, when participants were fasting and for 3 h after intake of a test drink, measurements were taken of energy expenditure, circulating glucose, lipids (fasting only), insulin, glucagon-like peptide 1 (GLP-1), peptide YY (PYY), and ghrelin. An ad libitum test meal was offered. Subjective appetite ratings were assessed while fasting, after the test drink, after the ad libitum meal, and during the intervention. Continuous interstitial glucose monitoring was undertaken for 3 consecutive days during each intervention, and the ambulatory activity pattern was recorded (ambulatory energy expenditure estimation). Regularity was associated with a greater TEF (P breakfast; day 9: after lunch and dinner). There was no difference between treatments for the test-drink gut hormone response. A time effect was noted for fasting GLP-1, fasting PYY, PYY responses, and hunger-rating responses to the test drink (P < 0.05). Lower hunger and higher fullness ratings were seen premeal and postmeal during the regular period while subjects were free living. Meal regularity appears to be associated with greater TEF and lower glucose responses, which may favor weight management and metabolic health. This

  11. Connectivity pattern differences bilaterally in the cerebellum posterior lobe in healthy subjects after normal sleep and sleep deprivation: a resting-state functional MRI study

    Directory of Open Access Journals (Sweden)

    Liu XM

    2015-05-01

    Full Text Available Xuming Liu,1 Zhihan Yan,2 Tingyu Wang,1 Xiaokai Yang,1 Feng Feng,3 Luping Fan,1 Jian Jiang4 1Department of Radiology, The Third Clinical Institute Affiliated to Wenzhou Medical University, Wenzhou, 2Department of Radiology, The 2nd Affiliated Hospital of Wenzhou Medical University, Wenzhou, 3Peking Union Hospital, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing, 4Department of Radiology, The First Affiliated Hospital of Nanchang University, Nanchang, People’s Republic of China Objective: The aim of this study was to use functional magnetic resonance imaging (fMRI technique to explore the resting-state functional connectivity (rsFC differences of the bilaterial cerebellum posterior lobe (CPL after normal sleep (NS and after sleep deprivation (SD. Methods: A total of 16 healthy subjects (eight males, eight females underwent an fMRI scan twice at random: once following NS and the other following 24 hours’ SD, with an interval of 1 month between the two scans. The fMRI scanning included resting state and acupuncture stimulation. The special activated regions located during the acupuncture stimulation were selected as regions of interest for rsFC analysis. Results: Bilateral CPLs were positively activated by acupuncture stimulation. In the NS group, the left CPL showed rsFC with the bilateral CPL, bilateral frontal lobe (BFL, left precuneus and right inferior parietal lobule, while the right CPL showed rsFC with the bilateral temporal lobe, right cerebellum anterior lobe, right CPL, left frontal lobe, left anterior cingulate, right posterior cingulate, and bilateral inferior parietal lobule. In the SD group, the left CPL showed rsFC with the left posterior cingulate gyrus bilateral CPL, left precuneus, left precentral gyrus, BFL, and the left parietal lobe, while the right CPL showed rsFC with bilateral cerebellum anterior lobe, bilateral CPL, left frontal lobe and left temporal lobe. Compared with the NS group, the

  12. Your Skin

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Your Skin KidsHealth / For Kids / Your Skin What's in this ... body) are really dead skin cells. Bye-Bye Skin Cells These old cells are tough and strong, ...

  13. Transcriptome Analysis Reveals Markers of Aberrantly Activated Innate Immunity in Vitiligo Lesional and Non-Lesional Skin

    Science.gov (United States)

    Huang, Yuanshen; Wang, Yang; Yu, Jie; Gao, Min; Levings, Megan; Wei, Shencai; Zhang, Shengquan; Xu, Aie; Su, Mingwan; Dutz, Jan; Zhang, Xuejun; Zhou, Youwen

    2012-01-01

    Background Vitiligo is characterized by the death of melanocytes in the skin. This is associated with the presence of T cell infiltrates in the lesional borders. However, at present, there is no detailed and systematic characterization on whether additional cellular or molecular changes are present inside vitiligo lesions. Further, it is unknown if the normal appearing non-lesional skin of vitiligo patients is in fact normal. The purpose of this study is to systematically characterize the molecular and cellular characteristics of the lesional and non-lesional skin of vitiligo patients. Methods and Materials Paired lesional and non-lesional skin biopsies from twenty-three vitiligo patients and normal skin biopsies from sixteen healthy volunteers were obtained with informed consent. The following aspects were analyzed: (1) transcriptome changes present in vitiligo skin using DNA microarrays and qRT-PCR; (2) abnormal cellular infiltrates in vitiligo skin explant cultures using flow cytometry; and (3) distribution of the abnormal cellular infiltrates in vitiligo skin using immunofluorescence microscopy. Results Compared with normal skin, vitiligo lesional skin contained 17 genes (mostly melanocyte-specific genes) whose expression was decreased or absent. In contrast, the relative expression of 13 genes was up-regulated. The up-regulated genes point to aberrant activity of the innate immune system, especially natural killer cells in vitiligo. Strikingly, the markers of heightened innate immune responses were also found to be up-regulated in the non-lesional skin of vitiligo patients. Conclusions and Clinical Implications As the first systematic transcriptome characterization of the skin in vitiligo patients, this study revealed previously unknown molecular markers that strongly suggest aberrant innate immune activation in the microenvironment of vitiligo skin. Since these changes involve both lesional and non-lesional skin, our results suggest that therapies targeting

  14. Recommendations for skin decontamination

    International Nuclear Information System (INIS)

    1989-01-01

    Further to the reecommendations for determining the surface contamination of the skin and estimating the radiation exposure of the skin after contamination (SAAS-Mitt--89-16), measures for skin decontamination are recommended. They are necessary if (1) after simple decontamination by means of water, soap and brush without damaging the skin the surface contamination limits are exceeded and the radiation exposure to be expected for the undamaged healthy skin is estimated as to high, and if (2) a wound is contaminated. To remove skin contaminations, in general universally applicable, non-aggressive decontamination means and methods are sufficient. In special cases, nuclide-specific decontamination is required taking into account the properties of the radioactive substance

  15. Simulated Prism Therapy in Virtual Reality produces larger after-effects than standard prism exposure in normal healthy subject - Implications for Neglect Therapy

    DEFF Research Database (Denmark)

    Wilms, Inge Linda

    2018-01-01

    BACKGROUND: Virtual reality is an important area of exploration within computer-based cognitive rehabilitation of visual neglect. Virtual reality will allow for closer monitoring of patient behaviour during prism adaptation therapy and perhaps change the way we induce prismatic after......-effects. OBJECTIVE: This study compares the effect of two different prism simulation conditions in virtual reality to a standard exposure to prism goggles after one session of Prism Adaptation Therapy in healthy subjects. METHOD: 20 healthy subjects were subjected to one session of prism adaptation therapy under...... training for rehabilitation of hemi spatial attentional deficits such as visual neglect....

  16. Comparative potency of formulations of mometasone furoate in terms of inhibition of ′PIRHR′ in the forearm skin of normal human subjects measured with laser doppler velocimetry

    Directory of Open Access Journals (Sweden)

    Kulhalli Prabhakar

    2005-01-01

    Full Text Available BACKGROUND AND AIMS: Topical glucocorticoid formulations are widely used for effective treatment and control of a variety of dermatoses. Mometasone furoate is a newer corticoid that has high potency but low systemic toxicity. Pharmaceutical factors are known to significantly influence potency and systemic absorption of topically applied glucocorticoids. We studied the potency of "Elocon", a topical formulation of mometasone furoate, compared with two other branded formulations of the same corticoid. METHODS: Corticoid potency was measured by employing a pharmacodynamic parameter of an inhibitory effect of the corticoid on post-ischemic-reactive-hyperemic-response (PIRHR in human forearm skin under occlusive dressing. The PIRHR was expressed in terms of % increase in the skin blood flow (SBF as measured with laser doppler velocimetry (LDV. RESULTS : All three active branded formulations of mometasone furoate produced significant inhibition of PIRHR. The AUC(0-2min of PIRHR was ( Mean ± SEM , Control = 213.52 ± 11.80, Placebo = 209.77 ± 19.31, Formulation A = 119.83 ± 13.71, Formulation C = 53.67 ± 4.85 and Formulation D = 111.46 ± 22.87. Formulation "C" exhibited significantly higher topical anti-inflammatory potency than formulations "A" or "D". CONCLUSIONS: Thus, branded formulations of the same glucocorticoid, mometasone furoate significantly differed in their topical anti-inflammatory potency. "Elocon" was significantly more potent than the two other branded formulations studied.

  17. Friction coefficient of skin in real-time.

    Science.gov (United States)

    Sivamani, Raja K; Goodman, Jack; Gitis, Norm V; Maibach, Howard I

    2003-08-01

    Friction studies are useful in quantitatively investigating the skin surface. Previous studies utilized different apparatuses and materials for these investigations but there was no real-time test parameter control or monitoring. Our studies incorporated the commercially available UMT Series Micro-Tribometer, a tribology instrument that permits real-time monitoring and calculation of the important parameters in friction studies, increasing the accuracy over previous tribology and friction measurement devices used on skin. Our friction tests were performed on four healthy volunteers and on abdominal skin samples. A stainless steel ball was pressed on to the skin with at a pre-set load and then moved across the skin at a constant velocity of 5 mm/min. The UMT continuously monitored the friction force of the skin and the normal force of the ball to calculate the friction coefficient in real-time. Tests investigated the applicability of Amonton's law, the impact of increased and decreased hydration, and the effect of the application of moisturizers. The friction coefficient depends on the normal load applied, and Amonton's law does not provide an accurate description for the skin surface. Application of water to the skin increased the friction coefficient and application of isopropyl alcohol decreased it. Fast acting moisturizers immediately increased the friction coefficient, but did not have the prolonged effect of the slow, long lasting moisturizers. The UMT is capable of making real-time measurements on the skin and can be used as an effective tool to study friction properties. Results from the UMT measurements agree closely with theory regarding the skin surface.

  18. Skin absorption through atopic dermatitis skin

    DEFF Research Database (Denmark)

    Halling-Overgaard, A-S; Kezic, S; Jakasa, I

    2017-01-01

    Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...

  19. Using skin carotenoids to assess dietary changes in students after one academic year of participating in the shaping healthy choices program

    Science.gov (United States)

    Objective: To determine whether 4th-grade students participating in the Shaping Healthy Choices Program (SHCP), a school-based nutrition intervention, change vegetable intake Design: quasi-experimental single group pre-test, post-test with a self-selected, convenience sample of students recruited at...

  20. The effect of dexmedetomidine on cerebral perfusion and oxygenation in healthy piglets with normal and lowered blood pressure anaesthetized with propofol-remifentanil total intravenous anaesthesia

    DEFF Research Database (Denmark)

    Mikkelsen, Mai Louise Grandsgaard; Ambrus, Rikard; Rasmussen, Rune

    2017-01-01

    Background During anaesthesia and surgery, in particular neurosurgery, preservation of cerebral perfusion and oxygenation (CPO) is essential for normal postoperative brain function. The isolated effects on CPO of either individual anaesthetic drugs or entire anaesthetic protocols are of importance...

  1. Characterization of innate lymphoid cells in human skin and blood demonstrates increase of NKp44+ ILC3 in psoriasis.

    Science.gov (United States)

    Villanova, Federica; Flutter, Barry; Tosi, Isabella; Grys, Katarzyna; Sreeneebus, Hemawtee; Perera, Gayathri K; Chapman, Anna; Smith, Catherine H; Di Meglio, Paola; Nestle, Frank O

    2014-04-01

    Innate lymphoid cells (ILCs) are increasingly appreciated as key regulators of tissue immunity. However, their role in human tissue homeostasis and disease remains to be fully elucidated. Here we characterize the ILCs in human skin from healthy individuals and from the inflammatory skin disease psoriasis. We show that a substantial proportion of IL-17A and IL-22 producing cells in the skin and blood of normal individuals and psoriasis patients are CD3-negative innate lymphocytes. Deep immunophenotyping of human ILC subsets showed a statistically significant increase in the frequency of circulating NKp44+ ILC3 in the blood of psoriasis patients compared with healthy individuals or atopic dermatitis patients. More than 50% of circulating NKp44+ ILC3 expressed cutaneous lymphocyte-associated antigen, indicating their potential for skin homing. Analysis of skin tissue revealed a significantly increased frequency of total ILCs in the skin compared with blood. Moreover, the frequency of NKp44+ ILC3 was significantly increased in non-lesional psoriatic skin compared with normal skin. A detailed time course of a psoriasis patient treated with anti-tumor necrosis factor showed a close association between therapeutic response, decrease in inflammatory skin lesions, and decrease of circulating NKp44+ ILC3. Overall, data from this initial observational study suggest a potential role for NKp44+ ILC3 in psoriasis pathogenesis.

  2. Characterization of innate lymphoid cells (ILC) in human skin and blood demonstrates increase of NKp44+ ILC3 in psoriasis

    Science.gov (United States)

    Tosi, Isabella; Grys, Katarzyna; Sreeneebus, Hemawtee; Perera, Gayathri K; Chapman, Anna; Smith, Catherine H; Di Meglio, Paola; Nestle, Frank O

    2013-01-01

    Innate lymphoid cells (ILC) are increasingly appreciated as key regulators of tissue immunity. However, their role in human tissue homeostasis and disease remains to be fully elucidated. Here we characterise the ILC in human skin from healthy individuals and from the inflammatory skin disease psoriasis. We show that a substantial proportion of IL-17A and IL-22 producing cells in skin and blood of normal individuals and psoriasis patients are CD3 negative innate lymphocytes. Deep immunophenotyping of human ILC subsets showed a statistically significant increase in the frequency of circulating NKp44+ ILC3 in blood of psoriasis patients compared to healthy individuals or atopic dermatitis patients. More than 50% of circulating NKp44+ ILC3 expressed cutaneous lymphocyte-associated antigen indicating their potential for skin homing. Analysis of skin tissue revealed a significantly increased frequency of total ILC in skin compared to blood. Moreover the frequency of NKp44+ ILC3 was significantly increased in non-lesional psoriatic skin compared to normal skin. A detailed time course of a psoriasis patient treated with anti-TNF showed a close association between therapeutic response, decrease in inflammatory skin lesions, and decrease of circulating NKp44+ ILC3. Overall, data from this initial observational study suggest a potential role for NKp44+ ILC3 in psoriasis pathogenesis. PMID:24352038

  3. Immunohistochemical analysis of regulatory T cell markers FOXP3 and GITR on CD4(+) CD25(+) T cells in normal skin and inflammatory dermatoses

    NARCIS (Netherlands)

    de Boer, Onno J.; van der Loos, Chris M.; Teeling, Peter; van der Wal, Allard C.; Teunissen, Marcel B. M.

    2007-01-01

    Regulatory T cells (Treg) are a subset of T lymphocytes that play a central role in immunologic tolerance and in the termination of immune responses. The identification of these cells in normal and inflammatory conditions may contribute to a better understanding of underlying pathology. We

  4. Diffuse Reflectance Spectroscopy of Human Skin Using a Commercial Fiber Optic Spectrometer

    International Nuclear Information System (INIS)

    Atencio, J. A. Delgado; Rodriguez, M. Cunill; Montiel, S. Vazquez y; Castro, Jorge; Rodriguez, A. Cornejo; Gutierrez, J. L.; Martinez, F.; Gutierrez, B.; Orozco, E.

    2008-01-01

    Diffuse reflectance spectroscopy is a reliable and easy to implement technique in human tissue characterization. In this work we evaluate the performance of the commercial USB4000 miniature fiber optic spectrometer in the in-vivo measurement of the diffuse reflectance spectra of different healthy skin sites and lesions in a population of 54 volunteers. Results show, that this spectrometer reproduces well the typical signatures of skin spectra over the 400-1000 nm region. Remarkable spectral differences exist between lesions and normal surrounding skin. A diffusion-based model was used to simulate reflectance spectra collected by the optical probe of the system

  5. Effect of psychological intervention in the form of relaxation and guided imagery on cellular immune function in normal healthy subjects. An overview

    DEFF Research Database (Denmark)

    Zachariae, R; Kristensen, J S; Hokland, P

    1991-01-01

    The present study measured the effects of relaxation and guided imagery on cellular immune function. During a period of 10 days 10 healthy subjects were given one 1-hour relaxation procedure and one combined relaxation and guided imagery procedure, instructing the subjects to imagine their immune...... on the immune defense and could form the basis of further studies on psychological intervention and immunological status. Udgivelsesdato: 1990-null...

  6. Lower corticosteroid skin blanching response is associated with severe COPD.

    Directory of Open Access Journals (Sweden)

    Susan J M Hoonhorst

    Full Text Available Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test.COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography.Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears.In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.

  7. DFD-01 Reduces Transepidermal Water Loss and Improves Skin Hydration and Flexibility.

    Science.gov (United States)

    Jackson, J Mark; Grove, Gary L; Allenby, Kent; Houser, Tim

    2017-12-01

    In plaque psoriasis, the benefit of topical steroids is well established. The vehicle formulation of topical steroids may also provide benefit in addition to the effects of the steroid itself. DFD-01 (betamethasone dipropionate spray, 0.05%) is a formulation composed of a topical steroid in an emollient-like vehicle that enhances penetration to the target site of inflammation in the skin. The aim of this study was to assess the effect of DFD-01 and its vehicle on skin hydration and barrier function in compromised skin and to evaluate its effect on flexibility in healthy skin. Eighteen healthy white volunteers were enrolled in each of two studies. In Study 1, dry shaving of volar forearms created a compromised skin barrier, through which transepidermal water loss (TEWL) was measured using an evaporimeter. Capacitance, a measure of epidermal hydration, was also measured at baseline and at 1, 2 and 4 h after application of DFD-01 or its vehicle formulation. In Study 2, intact skin flexibility was tested with a cutometer before and at 1, 2 and 4 h after application of DFD-01 or vehicle. In Study 1, both DFD-01 and its vehicle were effective at reducing TEWL through the compromised stratum corneum. Capacitance measurements confirmed this finding; razor-chafed skin treated with either DFD-01 or vehicle exhibited levels of skin hydration similar to unshaved control skin. Study 2 found softening and greater flexibility of normal skin treated with either DFD-01 or vehicle compared with nontreated control skin samples. These tests suggest that the DFD-01 formulation and its vehicle are each effective at retaining moisture within a damaged skin barrier and for softening and increasing the flexibility of intact skin. Dr. Reddy's Laboratories.

  8. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  9. Potentiation by caffeine of x-ray damage to cultured human skin fibroblasts from normal subjects and ataxia-telangiectasia patients

    International Nuclear Information System (INIS)

    Furcinitti, P.S.

    1983-01-01

    Caffeine was found to potentiate x-ray-induced killing of human diploid fibroblasts from a normal subject and an ataxia-telangiectasia (AT) patient when it was present at 2 mM concentration for 30 to 66 h postirradiation. The dose-modifying factor for caffeine-treated normal cells had an average value of 1.26 +- 0.13 which did not vary significantly with treatment time or x-ray dose. The dose-modifying factor for caffeine-treated AT cells was 1.12 +- 0.12 at 30 h, rose to 1.66 +- 0.17 at 41 h, and decreased to 1.31 +- 0.13 at 66 h. Thus no clear difference was observed between these two cell strains' susceptibility to postirradiation caffeine treatment

  10. Number of Langerhans cells is decreased in premalignant keratosis and skin cancers.

    Science.gov (United States)

    Shevchuk, Z; Filip, A; Shevchuk, V; Kashuba, E

    2014-03-01

    It was shown earlier that a number of CD207 positive Langerhans cells was lower in basal cell carcinomas than in the normal epidermis. Moreover, benign skin lesions presented a higher number of Langerhans cells when they were compared to malignant tumors. To count Langerhans cells, assessing expression levels of CD1A and CD207 markers in actinic keratosis, basal and squamous cell carcinomas, compared with the normal skin. Comparison of Langerhans cells might give a valuable prognostic marker for skin cancer. Immunohistochemistry and methods of statistics were used. Expression of CD1A and CD207 markers was assessed in tumor samples of actinic keratosis, cutaneous basal and squamous cell carcinomas, in comparison with the normal skin. In each cohort there were 40 patients (and 11 healthy individuals). We have shown that the number of Langerhans cells is considerably lower in cutaneous basal and squamous cell carcinomas, compared with their number in the normal skin (p keratosis, basal and squamous cell carcinoma. This may suggest an alteration of Langerhans cells phenotype in skin neoplastic diseases, making the number of Langerhans cells a valuable prognostic factor for skin tumors.

  11. COMPARISON BETWEEN PHYSIOLOGICAL COST INDEX IN HEALTHY NORMAL CHILDREN AS AGAINST AMBULATORY SPASTIC DIPLEGIC CEREBRAL PALSY (WITH AND WITHOUT ORTHOSIS IN THE AGE GROUP 6 TO 18 YEARS

    Directory of Open Access Journals (Sweden)

    Swatia Bhise

    2016-08-01

    Full Text Available Background: Efficacy of rehabilitation program for subjects with orthosis with objective measurement. The study aiming to objectively compare the PCI and walking speed of normal children with ambulatory spastic diaplegic. Also we aimed to analyze whether BMIhad impact on energy cost. Methods: 41 normal children and 41 community walking spastic diaplegic aged between 6 to 18 yrs. were assessed to compare the PCI. Speed of walking and heart rate were checked constantlyboth barefoot and in shoes in normal children and with and without conventional AFO in children with spastic diaplegic at their chosen velocities over four consecutive lengths of a 12.5m walkway i.e. total 50m.,Pre and Post readings are taken. Heart rate is affected by speed; PCI with speed of walking and heart rate was calculated for each child. Results: The mean PCI in shoes and barefoot was same in normal children i.e. 0.05 ±0.039beats/meter. The PCI for children with pathological gait i.e. spastic diaplegic without orthosis and with orthosis is 0.199 ±0.176 and 0.104± 0.093beats/meter appreciably greater than that for normal children(p less than 0.05. Conclusion: This study showed that walking with orthosis in spastic diplegic CP children showed higher costs of energy and slower walking speed compared normal children with age matched. The PCI of walking, with orthosis in children with spastic Diplegic cerebral palsy is less as compared to without orthosis i.e. gait is more energy efficient with orthosis. BMI doesn’t show any correlation with PCI further study may require.

  12. Skin abscess

    Science.gov (United States)

    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  13. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to astaxanthin and protection of the skin from UV-induced damage (ID 1687, 1979), defence against Helicobacter pylori (ID 1686), contribution to normal spermatogenesis

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to astaxanthin and protection of the skin from UV-induced damage, defence against Helicobacter pylori, contribution to normal spermatogenesis, contribution to normal muscle function, and “immune system”. The scientific substantiation is based on the information provided by the Member...

  14. Assessment of Blood Glucose Regulation and Safety of Resistant Starch Formula-Based Diet in Healthy Normal and Subjects With Type 2 Diabetes.

    Science.gov (United States)

    Lin, Chia-Hung; Chang, Daw-Ming; Wu, Da-Jen; Peng, Hui-Yu; Chuang, Lee-Ming

    2015-08-01

    To evaluate the effects of the new resistant starch (RS) formula, PPB-R-203, on glucose homeostasis in healthy subjects and subjects with type 2 diabetes.A cohort consisting of 40 healthy participants received test and control diets and was checked for up to 3 hours post-meal. A randomized, 2-regimen, cross-over, comparative study was conducted in 44 subjects with type 2 diabetes and glycemic control was assessed with a continuous glucose monitoring system.In healthy participants, serum glucose values and incremental areas under the glucose curves (AUC) were significantly lower in the PPB-R-203 than the control group (P blood glucose concentrations for subjects on the control regimen were higher than those for subjects on the PPB-R-203-based regimen (7.9 ± 1.7, 95% confidence interval [CI] 7.4-8.4 vs 7.4 ± 1.6, 95% CI 6.9-7.9 mmol/L, respectively; P = 0.023). AUCs for total blood glucose and hyperglycemia (glucose >10 mmol/L) were also reduced for subjects on the PPB-R-203-based regimen as compared with those on control regimen (total blood glucose: 16.2 ± 4.0, 95% CI 14.9-17.4 vs 18.7 ± 4.0, 95% CI 17.6-20.1, P AUC measurements for hypoglycemia (glucose glucose excursion.

  15. The contribution of 3D quantitative meniscal and cartilage measures to variation in normal radiographic joint space width—Data from the Osteoarthritis Initiative healthy reference cohort

    International Nuclear Information System (INIS)

    Roth, Melanie; Wirth, Wolfgang; Emmanuel, Katja; Culvenor, Adam G.; Eckstein, Felix

    2017-01-01

    Objective: To explore to what extent three-dimensional measures of the meniscus and femorotibial cartilage explain the variation in medial and lateral femorotibial radiographic joint space width (JSW), in healthy men and women. Methods: The right knees of 87 Osteoarthritis Initiative healthy reference participants (no symptoms, radiographic signs or risk factors of osteoarthritis; 37 men, 50 women; age 55.0 ± 7.6; BMI 24.4 ± 3.1) were assessed. Quantitative measures of subregional femorotibial cartilage thickness and meniscal position and morphology were computed from segmented magnetic resonance images. Minimal and medial/lateral fixed-location JSW were determined from fixed-flexion radiographs. Correlation and regression analyses were used to explore the contribution of demographic, cartilage and meniscal parameters to JSW in healthy subjects. Results: The correlation with (medial) minimal JSW was somewhat stronger for cartilage thickness (0.54 ≤ r ≤ 0.67) than for meniscal (−0.31 ≤ r ≤ 0.50) or demographic measures (−0.15 ≤ r ≤ 0.48), in particular in men. In women, in contrast, the strength of the correlations of cartilage thickness and meniscal measures with minimal JSW were in the same range. Fixed-location JSW measures showed stronger correlations with cartilage thickness (r ≥ 0.68 medially; r ≥ 0.59 laterally) than with meniscal measures (r ≤ |0.32| medially; r ≤ |0.32| laterally). Stepwise regression models revealed that meniscal measures added significant independent information to the total variance explained in minimal JSW (adjusted multiple r 2 = 58%) but not in medial or lateral fixed-location JSW (r 2 = 60/51%, respectively). Conclusions: In healthy subjects, minimal JSW was observed to reflect a combination of cartilage and meniscal measures, particularly in women. Fixed-location JSW, in contrast, was found to be dominated by variance in cartilage thickness in both men and women, with somewhat higher correlations between

  16. The contribution of 3D quantitative meniscal and cartilage measures to variation in normal radiographic joint space width—Data from the Osteoarthritis Initiative healthy reference cohort

    Energy Technology Data Exchange (ETDEWEB)

    Roth, Melanie, E-mail: melanie.roth@pmu.ac.at [Institute of Anatomy, Paracelsus Medical University Salzburg & Nuremberg, Strubergasse 21, 5020, Salzburg (Austria); Wirth, Wolfgang, E-mail: wolfgang.wirth@pmu.ac.at [Institute of Anatomy, Paracelsus Medical University Salzburg & Nuremberg, Strubergasse 21, 5020, Salzburg (Austria); Chondrometrics GmbH, Ulrichshöglerstrasse 23, 83404, Ainring (Germany); Emmanuel, Katja, E-mail: katja.emmanuel@icloud.com [Institute of Anatomy, Paracelsus Medical University Salzburg & Nuremberg, Strubergasse 21, 5020, Salzburg (Austria); Department of Orthopedics and Traumatology, Paracelsus Medical University, Müllner Hauptstraße 48, 5020, Salzburg (Austria); Culvenor, Adam G., E-mail: adam.culvenor@pmu.ac.at [Institute of Anatomy, Paracelsus Medical University Salzburg & Nuremberg, Strubergasse 21, 5020, Salzburg (Austria); School of Allied Health, La Trobe University, Plenty Road, Bundoora, 3086, Victoria (Australia); Eckstein, Felix, E-mail: felix.eckstein@pmu.ac.at [Institute of Anatomy, Paracelsus Medical University Salzburg & Nuremberg, Strubergasse 21, 5020, Salzburg (Austria); Chondrometrics GmbH, Ulrichshöglerstrasse 23, 83404, Ainring (Germany)

    2017-02-15

    Objective: To explore to what extent three-dimensional measures of the meniscus and femorotibial cartilage explain the variation in medial and lateral femorotibial radiographic joint space width (JSW), in healthy men and women. Methods: The right knees of 87 Osteoarthritis Initiative healthy reference participants (no symptoms, radiographic signs or risk factors of osteoarthritis; 37 men, 50 women; age 55.0 ± 7.6; BMI 24.4 ± 3.1) were assessed. Quantitative measures of subregional femorotibial cartilage thickness and meniscal position and morphology were computed from segmented magnetic resonance images. Minimal and medial/lateral fixed-location JSW were determined from fixed-flexion radiographs. Correlation and regression analyses were used to explore the contribution of demographic, cartilage and meniscal parameters to JSW in healthy subjects. Results: The correlation with (medial) minimal JSW was somewhat stronger for cartilage thickness (0.54 ≤ r ≤ 0.67) than for meniscal (−0.31 ≤ r ≤ 0.50) or demographic measures (−0.15 ≤ r ≤ 0.48), in particular in men. In women, in contrast, the strength of the correlations of cartilage thickness and meniscal measures with minimal JSW were in the same range. Fixed-location JSW measures showed stronger correlations with cartilage thickness (r ≥ 0.68 medially; r ≥ 0.59 laterally) than with meniscal measures (r ≤ |0.32| medially; r ≤ |0.32| laterally). Stepwise regression models revealed that meniscal measures added significant independent information to the total variance explained in minimal JSW (adjusted multiple r{sup 2} = 58%) but not in medial or lateral fixed-location JSW (r{sup 2} = 60/51%, respectively). Conclusions: In healthy subjects, minimal JSW was observed to reflect a combination of cartilage and meniscal measures, particularly in women. Fixed-location JSW, in contrast, was found to be dominated by variance in cartilage thickness in both men and women, with somewhat higher correlations

  17. Photometric assessment of skin colour and lightness using a tristimulus colorimeter: reliability of inter and intra-investigator observations in healthy adult volunteers.

    Science.gov (United States)

    Trujillo, O; Vanezis, P; Cermignani, M

    1996-07-31

    The ageing of injuries is an important aspect of forensic medicine, and one which can have significant medico-legal consequences. The sequence and timing of color changes associated with the appearance and disappearance of bruises, as well as the factors which govern this process, have long been a source of controversy. Whilst visual assessment currently remains the easiest and most practical method available to date bruises, it appears unlikely that it can be relied upon to provide an accurate and consistent measure of the age of a bruise. In an ongoing pilot study designed to assess the applicability of colorimetry to the dating of bruises, the Dr. Lange MICRO COLOR tristimulus colorimeter will be used to assess how the color and colour density (lightness) of bruises change over time. The results of a preliminary study are presented, in which the variability of skin colour measurements obtained by different investigators was assessed. Measurements were taken of the same area on the volar surface of the forearm of five volunteers, after having them remain with their arm motionless for a predetermined period of time (2, 5, and 10 min). Four sets of measurements were taken by each investigator over a total period of 3 h. No significant statistical difference was found after the resting time interval of 5 min between the values obtained by the two investigators (P > 0.05). While studies on a much larger population remain to be completed, our initial findings would seem to suggest that the colorimeter is able to provide an objective, quantitative, and relatively consistent measure of skin colour when used by different individuals.

  18. Effect of Equal Daily Doses Achieved by Different Power Densities of Low-Level Laser Therapy at 635 nm on Open Skin Wound Healing in Normal and Diabetic Rats

    Directory of Open Access Journals (Sweden)

    Róbert Kilík

    2014-01-01

    Full Text Available Background and Objective. Despite the fact that the molecular mechanism of low-level laser therapy (LLLT is not yet known, the exploitation of phototherapy in clinical medicine and surgery is of great interest. The present study investigates the effects of LLLT on open skin wound healing in normal and diabetic rats. Materials and Methods. Four round full-thickness skin wounds on dorsum were performed in male adult nondiabetic (n=24 and diabetic (n=24 Sprague–Dawley rats. AlGaInP (635 nm, wavelength; 5 J/cm2, daily dose was used to deliver power densities of 1, 5, and 15 mW/cm2 three times daily until euthanasia. Results. PMNL infiltration was lower in the irradiated groups (15 mW/cm2. The synthesis and organisation of collagen fibres were consecutively enhanced in the 5 mW/cm2 and 15 mW/cm2 groups compared to the others in nondiabetic rats. In the diabetic group the only significant difference was recorded in the ratio PMNL/Ma at 15 mW/cm2. A significant difference in the number of newly formed capillaries in the irradiated group (5, 15 mW/cm2 was recorded on day six after injury compared to the control group. Conclusion. LLLT confers a protective effect against excessive inflammatory tissue response; it stimulates neovascularization and the early formation of collagen fibres.

  19. High diversity of Staphylococcus aureus and Staphylococcus pseudintermedius lineages and toxigenic traits in healthy pet-owning household members. Underestimating normal household contact?

    Science.gov (United States)

    Gómez-Sanz, Elena; Torres, Carmen; Lozano, Carmen; Zarazaga, Myriam

    2013-01-01

    Forty-three unrelated pet-owning households were screened in Spain to study the Staphylococcus aureus and Staphylococcus pseudintermedius nasal carriage, their genetic lineages and virulence traits. Sixty-seven healthy owners and 66 healthy pets were investigated. Isolates characterization was performed and potential interspecies transmission was assessed. S. aureus was present in 51.2% of households studied while S. pseudintermedius in 30.2%. Twenty-eight owners (41.8%) carried S. aureus: one methicillin-resistant S. aureus (MRSA) [t5173-ST8-SCCmecIVa] and 27 methicillin-susceptible S. aureus (MSSA). Three owners (4.5%) were colonized by methicillin-susceptible S. pseudintermedius (MSSP). Fifteen pets (22.7%) carried S. pseudintermedius: two methicillin-resistant S. pseudintermedius (MRSP) [ST71-SCCmecII/III; ST92-SCCmecV] and 13 MSSP; in addition, 8 pets (12.1%) presented MSSA. High diversity of spa and sequence types (STs) was detected. Typical livestock-associated S. aureus lineages (CC398, CC9) were observed in humans and/or companion animals and hospital and/or community-acquired S. aureus lineages (CC45, CC121, CC5, CC8) were detected among pets. Almost 40% of S. pseudintermedius were multidrug-resistant. S. aureus isolates harboured a remarkable high number of virulence genes. The expA gene was detected in 3 S. pseudintermedius isolates. Identical strains from both owners and their pets were identified in 5 households (11.6%): (a) four MSSA (t073-ST45/CC45, t159-ST121/CC121, t209-ST109/CC9, t021-ST1654([new])/singleton) and (b) one multidrug-resistant MSSP (ST142([new])). Highly clonally diverse and toxigenic S. aureus and S. pseudintermedius are common colonizers of healthy humans and pets. The presence of these bacterial species, virulence genes, and interspecies transmission detected, points out to consider pet ownership as a risk factor to acquire, maintain and spread, potential pathogenic bacteria. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION

    Directory of Open Access Journals (Sweden)

    Anjanappa

    2015-01-01

    Full Text Available BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganisms on the skin surface and to reduce the resident flora to a low level. Povidone iodine (I odophors and chlorhexidine are most often used antiseptics for pre - operative skin preparation. OBJECTIVES : To evaluate the efficacy of povidone iodine alone and in combination with antiseptic agent containing alcoholic chlorhexidine in preoperative skin p reparation by taking swab culture. (2 To compare the rate of postoperative wound infection in both the groups. METHODS: One hundred patients (fifty in each group undergoing clean elective surgery with no focus of infection on the body were included in th e study. The pre - operative skin preparation in each group is done with the respective antiseptic regimen. In both the groups after application of antiseptics , sterile saline swab culture was taken immediately from site of incision. In cases which showed gr owth of organisms , the bacteria isolated were identified by their morphological and cultural characteristics. Grams staining , coagulase test and antibiotic sensitivity test were done wherever necessary and difference in colonization rates was determined as a measure of efficacy of antiseptic regimen. RESULTS: The results of the study showed that when compared to povidone iodine alone , using a combination of povidone iodine and alcoholic solution of chlorhexidine , the colonization rates of the site of incisi on were reduced significantly. As for the rate of post - operative wound infection , it is also proven that wound infections are also

  1. Barrier function and natural moisturizing factor levels after cumulative exposure to a fruit-derived organic acid and a detergent: different outcomes in atopic and healthy skin and relevance for occupational contact dermatitis in the food industry.

    Science.gov (United States)

    Angelova-Fischer, Irena; Hoek, Anne-Karin; Dapic, Irena; Jakasa, Ivone; Kezic, Sanja; Fischer, Tobias W; Zillikens, Detlef

    2015-12-01

    Fruit-derived organic compounds and detergents are relevant exposure factors for occupational contact dermatitis in the food industry. Although individuals with atopic dermatitis (AD) are at risk for development of occupational contact dermatitis, there have been no controlled studies on the effects of repeated exposure to multiple irritants, relevant for the food industry, in atopic skin. The aim of the study was to investigate the outcomes of repeated exposure to a fruit-derived organic acid and a detergent in AD compared to healthy volunteers. The volunteers were exposed to 2.0% acetic acid (AcA) and/or 0.5% sodium lauryl sulfate (SLS) in controlled tandem repeated irritation test. The outcomes were assessed by measurements of erythema, transepidermal water loss (TEWL) and natural moisturizing factor (NMF) levels. In the AD volunteers, repeated AcA exposure led to barrier disruption and significant TEWL increase; no significant differences after the same exposure in the healthy controls were found. Repeated exposure to SLS and the irritant tandems enhanced the reactions and resulted in a significantly higher increase in TEWL in the AD compared to the control group. Cumulative irritant exposure reduced the NMF levels in both groups. Differences in the severity of irritant-induced barrier impairment in atopic individuals contribute to the risk for occupational contact dermatitis in result of multiple exposures to food-derived irritants and detergents. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. A first‐in‐human pharmacodynamic and pharmacokinetic study of a fully human anti‐glucagon receptor monoclonal antibody in normal healthy volunteers

    Science.gov (United States)

    Kostic, Ana; King, Thomas Alexander; Yang, Feng; Chan, Kuo‐Chen; Yancopoulos, George D.; Gromada, Jesper

    2017-01-01

    Aims Glucagon receptor (GCGR) blockers are being investigated as potential therapeutics for type 1 and type 2 diabetes. Here we report the safety, tolerability, pharmacokinetics (PK) and pharmacodynamics (PD) of REGN1193, a fully human glucagon receptor blocking monoclonal antibody from a first‐in‐human healthy volunteer randomized double‐blinded trial. Methods Healthy men and women received single ascending doses of REGN1193 ranging from 0.05 to 0.6 mg/kg (n = 42) or placebo (n = 14) intravenously. Safety, tolerability and PK were assessed over 106 days. The glucose‐lowering effect of REGN1193 was assessed after induction of hyperglycaemia by serial glucagon challenges. Results REGN1193 was generally well tolerated. There were small (50 mg/dL, and did not require treatment or medical assistance. Concentration‐time profiles suggest a 2‐compartment disposition and marked nonlinearity, consistent with target‐mediated clearance. REGN1193 inhibited the glucagon‐stimulated glucose increase in a dose‐dependent manner. The 0.6 mg/kg dose inhibited the glucagon‐induced glucose area under the curve for 0 to 90 minutes (AUC0‐90 minutes) by 80% to 90% on days 3 and 15, while blunting the increase in C‐peptide. REGN1193 dose‐dependently increased total GLP‐1, GLP‐2 and glucagon, with plasma levels returning to baseline by day 29 in all dose groups. Conclusion REGN1193, a GCGR‐blocking monoclonal antibody, produced a safety, tolerability and PK/PD profile suitable for further clinical development. The occurrence of transient elevations in serum hepatic aminotransferases observed here and reported with several small molecule glucagon receptor antagonists suggests an on‐target effect of glucagon receptor blockade. The underlying mechanism is unknown. PMID:28755409

  3. Skin Cancer.

    Science.gov (United States)

    Linares, Miguel A; Zakaria, Alan; Nizran, Parminder

    2015-12-01

    Skin cancer accounts for most malignancies across the globe. They are primarily divided into melanoma and nonmelanoma skin malignancies. Nonmelanoma skin cancer includes basal cell carcinoma and squamous cell carcinoma. Fair skin and chronic ultraviolet B exposure are the most important risk factors. Primary prevention is achieved by avoiding sun exposure and tanning beds. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Skin tightening.

    Science.gov (United States)

    Woolery-Lloyd, Heather; Kammer, Jenna N

    2011-01-01

    Skin tightening describes the treatment of skin laxity via radiofrequency (RF), ultrasound, or light-based devices. Skin laxity on the face is manifested by progressive loss of skin elasticity, loosening of the connective tissue framework, and deepening of skin folds. This results in prominence of submandibular and submental tissues. Genetic factors (chronological aging) and extrinsic factors (ultraviolet radiation) both contribute to skin laxity. There are many RF, ultrasound, and light-based devices directed at treating skin laxity. All of these devices target and heat the dermis to induce collagen contraction. Heating of the dermis causes collagen denaturation and immediate collagen contraction in addition to long-term collagen remodeling. Via RF, light, or ultrasound, these skin tightening devices deliver heat to the dermis to create new collagen and induce skin tightening. This chapter will provide an overview of the various skin tightening devices. Copyright © 2011 S. Karger AG, Basel.

  5. Parkinson disease and progressive supranuclear palsy: protein expression in skin.

    Science.gov (United States)

    Rodríguez-Leyva, Ildefonso; Chi-Ahumada, Erika G; Carrizales, Juan; Rodríguez-Violante, Mayela; Velázquez-Osuna, Salvador; Medina-Mier, Verónica; Martel-Gallegos, María G; Zarazúa, Sergio; Enríquez-Macías, Lourdes; Castro, Adriana; Calderón-Garcidueñas, Ana Laura; Jiménez-Capdeville, María E

    2016-03-01

    This study characterizes the expression of tau (p-tau) and α-synuclein (α-syn) by immunohistochemistry in the skin of three different populations: healthy control (HC), Parkinson disease (PD), and progressive supranuclear paralysis (PSP) subjects, with the purpose of finding a biomarker that could differentiate between subjects with PD and PSP. We evaluated the presence of p-tau and α-syn in a pilot study in the skin of three distinct groups of patients: 17 healthy subjects, 17 patients with PD, and 10 patients with PSP. Four millimeters punch biopsies were obtained from the occipital area and analyzed by immunohistochemistry using antibodies against α-syn and phosphorylated species of tau. PHF (paired helical filaments) antibody identifies p-tau in both normal and pathological conditions and AT8 recognizes p-tau characteristic of pathological conditions. Differences between the three groups were assessed by quantification of immunopositive areas in the epidermis. The immunopositivity pattern of p-tau and α-syn was significantly different among the three groups. Healthy subjects showed minimal staining using AT8 and α-syn. The PD group showed significantly higher α-syn and AT8 immunopositivity, while the PSP group only expressed higher AT8 immunopositivity than HCs. These data suggest that the skin reflects brain pathology. Therefore, immunohistochemical analysis of p-tau and α-syn in the skin can be useful for further characterization of PD and PSP.

  6. Y-type congenital urethral duplication with normal dorsal urethra and small ventral fistula to perineal skin – 28th reported case

    Directory of Open Access Journals (Sweden)

    Donald E. Meier

    2016-05-01

    Full Text Available There are numerous types of urethral duplication previously described in the literature including a Type IIA2Y where a large ventral channel branches from the hypoplastic, dorsal, orthotopic urethra. There have been 27 previously reported cases of a similar defect, called “congenital posterior urethrocutaneous fistula” (CUPF with the only difference being that the ventral urethra is hypoplastic and the dorsal, orthotopic one normal. The difference in treatment for these 2 entities is markedly different, and preoperative identification of the appropriate abnormality is essential. Treatment of CUPF requires only safe excision of the ventral segment, but treatment for a Type IIA2Y duplication requires resection of the hypoplastic, orthotopic urethra and transposition of the larger ventral segment into the dorsal orthotopic position. The outcome for treatment of CUPF is much better than for treatment of Type IIA2Y entities. We herein present the 28th case of CUPF in the English literature with discussion of the anatomy, appropriate diagnostic criteria, and safe method of treatment for these entities.

  7. HEALTHY AND PATHOLOGICAL CHANGES OF MYOMETRIUM: PREGNANT MYOMETRIUM, UTERINE FIBROIDS AND LEIOMYOSARCOMA. Cambios normales y patológicos del miometrio: miometrio del embarazo, fibrosis uterina y leiomiosarcoma

    Directory of Open Access Journals (Sweden)

    Pasquapina Ciarmela

    2016-03-01

    Full Text Available El miometrio, la pared muscular del útero, puede modificar su misma masa y las propiedades celulares en el embarazo y también en los tumores como el leiomioma y el leiomiosarcoma. El leiomioma, dicho también fibroma, es un tumor benigno del útero y se considera como  una de las causas más frecuentes de infertilità en el período reproductivo femenino. El leiomiosarcoma, en cambio, es un tumor maligno y agresivo de la musculatura lisa uterina. La presente revisión discute las características generales del leiomioma y el leiomiosarcoma y los relativos tratamientos clínicos actualmente usados y además describe las características del miometrio normal en el embarazo.  The myometrium, the muscular wall of the uterus, can modify its mass and cellular properties in pregnancy as well as in tumor conditions such as leiomyoma and leiomyosarcoma. Leiomyomas, also known as fibroids, are benign tumors of the uterus, considered to be one of the most frequent causes of infertility in reproductive years of women. Leiomyosarcomas in turn, are rare aggressive malignant uterine smooth-muscle tumors. The present review is discussing the general features of leiomyoma and leiomyosarcoma with their current treatments and also discussing the characteristics of normal pregnant myometrium and compare with leiomyoma.

  8. Heterogeneous Stem Cells in Skin Homeostatis and Wound Repair

    Directory of Open Access Journals (Sweden)

    Anna Meilana

    2015-08-01

    Full Text Available BACKGROUND: The skin protects mammals from insults, infection and dehydration and enables thermoregulation and sensory perception. Various skin-resident cells carry out these diverse functions. Constant turnover of cells and healing upon injury necessitate multiple reservoirs of stem cells. The skin is a complex organ harboring several distinct populations of stem cells and a rich array of cell types. Advances in genetic and imaging tools have brought new findings about the lineage relationships between skin stem cells and their progeny. Such knowledge may offer novel avenues for therapeutics and regenerative medicine. CONTENT: In the past years, our view of the mechanisms that govern skin homeostasis and regeneration have markedly changed. New populations of stem cells have been identified that behave spatio-temporally differently in healthy tissues and in situations of damage, indicating that a great level of stem cell heterogeneity is present in the skin. There are believed to be distinct populations of stem cells in different locations. The lineages that they feed are normally constrained by signals from their local environment, but they can give rise to all epidermal lineages in response to appropriate stimuli. Given the richness of structures such as blood vessels, subcutaneous fat, innervation and the accumulation of fibroblasts under the upper parts of the rete ridges (in the case of human skin, it is reasonable to speculate that the microenvironment might be essential for interfollicular epidermal homeostasis. The bloodstream is probably the main source of long-range signals reaching the skin, and cues provided by the vascular niche might be essential for skin homeostasis. SUMMARY: A key function of the interfollicular epidermis is to act as a protective interface between the body and the external environment, and it contains several architectural elements that enable it to fulfill this function. All elements of the epidermis play

  9. Clinical relevance of specific cognitive complaints in determining Mild Cognitive Impairment from Cognitively Normal States in a study of Healthy Elderly Controls

    Directory of Open Access Journals (Sweden)

    Marina Avila Villanueva

    2016-10-01

    Full Text Available Introduction: Subjective memory complaints in the elderly have been suggested as an early sign of dementia. This study aims at investigating whether specific cognitive complaints are more useful than others to discriminate Mild Cognitive Impairment (MCI by examining the dimensional structure of the Everyday Memory Questionnaire (EMQ.Material and Methods: A sample of community-dwelling elderly individuals was recruited (766 controls and 78 MCI. The Everyday Memory Questionnaire (EMQ was administered to measure self-perception of cognitive complaints. All participants also underwent a comprehensive clinical and neuropsychological battery. Combined exploratory factor analysis and item response theory were performed to identify the underlying structure of the EMQ. Furthermore, logistic regression analyses were conducted to study whether single cognitive complaints were able to predict MCI.Results: A suitable five-factor solution was found. Each factor focused on a different cognitive domain. Interestingly, just three of them, namely forgetfulness of immediate information, executive functions and prospective memory proved to be effective in distinguishing between cognitively healthy individuals and MCI. Based on these results we propose a shortened EMQ version comprising 10 items (EMQ-10.Discussion: Not all cognitive complaints have the same clinical relevance. Only subjective complaints on specific cognitive domains are able to discriminate MCI. We encourage clinicians to the EMQ-10 as a useful tool to quantify and monitor the progression of individuals who report cognitive complaints.

  10. Hydrogen water intake via tube-feeding for patients with pressure ulcer and its reconstructive effects on normal human skin cells in vitro

    Science.gov (United States)

    2013-01-01

    Background Pressure ulcer (PU) is common in immobile elderly patients, and there are some research works to investigate a preventive and curative method, but not to find sufficient effectiveness. The aim of this study is to clarify the clinical effectiveness on wound healing in patients with PU by hydrogen-dissolved water (HW) intake via tube-feeding (TF). Furthermore, normal human dermal fibroblasts OUMS-36 and normal human epidermis-derived cell line HaCaT keratinocytes were examined in vitro to explore the mechanisms relating to whether hydrogen plays a role in wound-healing at the cellular level. Methods Twenty-two severely hospitalized elderly Japanese patients with PU were recruited in the present study, and their ages ranged from 71.0 to 101.0 (86.7 ± 8.2) years old, 12 male and 10 female patients, all suffering from eating disorder and bedridden syndrome as the secondary results of various underlying diseases. All patients received routine care treatments for PU in combination with HW intake via TF for 600 mL per day, in place of partial moisture replenishment. On the other hand, HW was prepared with a hydrogen-bubbling apparatus which produces HW with 0.8-1.3 ppm of dissolved hydrogen concentration (DH) and −602 mV to −583 mV of oxidation-reduction potential (ORP), in contrast to reversed osmotic ultra-pure water (RW), as the reference, with DH of < 0.018 ppm and ORP of +184 mV for use in the in vitro experimental research. In in vitro experiments, OUMS-36 fibroblasts and HaCaT keratinocytes were respectively cultured in medium prepared with HW and/or RW. Immunostain was used for detecting type-I collagen reconstruction in OUMS-36 cells. And intracellular reactive oxygen species (ROS) were quantified by NBT assay, and cell viability of HaCaT cells was examined by WST-1 assay, respectively. Results Twenty-two patients were retrospectively divided into an effective group (EG, n = 12) and a less effective group (LG, n = 10) according to

  11. A Wearable Magneto-Inertial System for Gait Analysis (H-Gait: Validation on Normal Weight and Overweight/Obese Young Healthy Adults

    Directory of Open Access Journals (Sweden)

    Valentina Agostini

    2017-10-01

    Full Text Available Background: Wearable magneto-inertial sensors are being increasingly used to obtain human motion measurements out of the lab, although their performance in applications requiring high accuracy, such as gait analysis, are still a subject of debate. The aim of this work was to validate a gait analysis system (H-Gait based on magneto-inertial sensors, both in normal weight (NW and overweight/obese (OW subjects. The validation is performed against a reference multichannel recording system (STEP32, providing direct measurements of gait timings (through foot-switches and joint angles in the sagittal plane (through electrogoniometers. Methods: Twenty-two young male subjects were recruited for the study (12 NW, 10 OW. After positioning body-fixed sensors of both systems, each subject was asked to walk, at a self-selected speed, over a 14-m straight path for 12 trials. Gait signals were recorded, at the same time, with the two systems. Spatio-temporal parameters, ankle, knee, and hip joint kinematics were extracted analyzing an average of 89 ± 13 gait cycles from each lower limb. Intraclass correlation coefficient and Bland-Altmann plots were used to compare H-Gait and STEP32 measurements. Changes in gait parameters and joint kinematics of OW with respect NW were also evaluated. Results: The two systems were highly consistent for cadence, while a lower agreement was found for the other spatio-temporal parameters. Ankle and knee joint kinematics is overall comparable. Joint ROMs values were slightly lower for H-Gait with respect to STEP32 for the ankle (by 1.9° for NW, and 1.6° for OW and for the knee (by 4.1° for NW, and 1.8° for OW. More evident differences were found for hip joint, with ROMs values higher for H-Gait (by 6.8° for NW, and 9.5° for OW. NW and OW showed significant differences considering STEP32 (p = 0.0004, but not H-Gait (p = 0.06. In particular, overweight/obese subjects showed a higher cadence (55.0 vs. 52.3 strides/min and a

  12. A randomised double-blind placebo-controlled pilot trial of a combined extract of sage, rosemary and melissa, traditional herbal medicines, on the enhancement of memory in normal healthy subjects, including influence of age.

    Science.gov (United States)

    Perry, N S L; Menzies, R; Hodgson, F; Wedgewood, P; Howes, M-J R; Brooker, H J; Wesnes, K A; Perry, E K

    2018-01-15

    To evaluate for the first time the effects of a combination of sage, rosemary and melissa (Salvia officinalis L., Rosmarinus officinalis L. and Melissa officinalis L.; SRM), traditional European medicines, on verbal recall in normal healthy subjects. To devise a suitable study design for assessing the clinical efficacy of traditional herbal medicines for memory and brain function. Forty-four normal healthy subjects (mean age 61 ± 9.26y SD; m/f 6/38) participated in this study. A double-blind, randomised, placebo-controlled pilot study was performed with subjects randomised into an active and placebo group. The study consisted of a single 2-week term ethanol extract of SRM that was chemically-characterised using high resolution LC-UV-MS/MS analysis. Immediate and delayed word recall were used to assess memory after taking SRM or placebo (ethanol extract of Myrrhis odorata (L.) Scop.). In addition analysis was performed with subjects divided into younger and older subgroups (≤ 62 years mean age n = 26: SRM n = 10, Placebo n = 16; ≥ 63 years n = 19: SRM n = 13, Placebo n = 6). Overall there were no significant differences between treatment and placebo change from baseline for immediate or delayed word recall. However subgroup analysis showed significant improvements to delayed word recall in the under 63 year age group (p memory in healthy subjects under 63 years of age. Short- and long- term supplementation with SRM extract merits more robust investigation as an adjunctive treatment for patients with Alzheimer's disease and in the general ageing population. The study design proved a simple cost effective trial protocol to test the efficacy of herbal medicines on verbal episodic memory, with future studies including broader cognitive assessment. Copyright © 2017 Elsevier GmbH. All rights reserved.

  13. The Risk of Heart Failure and Cardiometabolic Complications in Obesity May Be Masked by an Apparent Healthy Status of Normal Blood Glucose

    Directory of Open Access Journals (Sweden)

    Shuchita Tiwari

    2013-01-01

    Full Text Available Although many obese individuals are normoglycemic and asymptomatic of cardiometabolic complications, this apparent healthy state may be a misnomer. Since heart failure is a major cause of mortality in obesity, we investigated the effects of heme-oxygenase (HO on heart failure and cardiometabolic complications in obese normoglycemic Zucker-fatty rats (ZFs. Treatment with the HO-inducer, hemin, reduced markers of heart failure, such as osteopontin and osteoprotegerin, abated left-ventricular (LV hypertrophy/fibrosis, extracellular matrix/profibrotic proteins including collagen IV, fibronectin, TGF-β1, and reduced cardiac lesions. Furthermore, hemin suppressed inflammation by abating macrophage chemoattractant protein-1, macrophage-inflammatory protein-1 alpha, TNF-α, IL-6, and IL-1β but enhanced adiponectin, atrial-natriuretic peptide (ANP, HO activity, insulin sensitivity, and glucose metabolism. Correspondingly, hemin improved several hemodynamic/echocardiographic parameters including LV-diastolic wall thickness, LV-systolic wall thickness, mean-arterial pressure, arterial-systolic pressure, arterial-diastolic pressure, LV-developed pressure, +dP/dt, and cardiac output. Contrarily, the HO-inhibitor, stannous mesoporphyrin nullified the hemin effect, exacerbating inflammatory/oxidative insults and aggravated insulin resistance (HOMA-index. We conclude that perturbations in insulin signaling and cardiac function may be forerunners to overt hyperglycemia and heart failure in obesity. Importantly, hemin improves cardiac function by suppressing markers of heart failure, LV hypertrophy, cardiac lesions, extracellular matrix/profibrotic proteins, and inflammatory/oxidative mediators, while concomitantly enhancing the HO-adiponectin-ANP axis.

  14. Objective measurement of minimal fat in normal skeletal muscles of healthy children using T2 relaxation time mapping (T2 maps) and MR spectroscopy.

    Science.gov (United States)

    Kim, Hee Kyung; Serai, Suraj; Merrow, Arnold C; Wang, Lily; Horn, Paul S; Laor, Tal

    2014-02-01

    Various skeletal muscle diseases result in fatty infiltration, making it important to develop noninvasive biomarkers to objectively measure muscular fat. We compared T2 relaxation time mapping (T2 maps) and magnetic resonance spectroscopy (MRS) with physical characteristics previously correlated with intramuscular fat to validate T2 maps and MRS as objective measures of skeletal muscle fat. We evaluated gluteus maximus muscles in 30 healthy boys (ages 5-19 years) at 3 T with T1-weighted images, T2-W images with fat saturation, T2 maps with and without fat saturation, and MR spectroscopy. We calculated body surface area (BSA), body mass index (BMI) and BMI percentile (BMI %). We performed fat and inflammation grading on T1-W imaging and fat-saturated T2-W imaging, respectively. Mean T2 values from T2 maps with fat saturation were subtracted from T2 maps without fat saturation to determine T2 fat values. We obtained lipid-to-water ratios by MR spectroscopy. Pearson correlation was used to assess relationships between BSA, BMI, BMI %, T2 fat values, and lipid-to-water ratios for each boy. Twenty-four boys completed all exams; 21 showed minimal and 3 showed no fatty infiltration. None showed muscle inflammation. There was correlation between BSA, BMI, and BMI %, and T2 fat values (P values and lipid-to-water ratios (P skeletal muscles, even in microscopic amounts, and validate each other. Both techniques might enable detection of minimal pathological fatty infiltration in children with skeletal muscle disorders.

  15. Menstrual cycle and skin reactivity

    DEFF Research Database (Denmark)

    Agner, T; Damm, P; Skouby, S O

    1991-01-01

    The hypothesis was tested that a cyclic variation exists in skin reactivity to irritant stimuli. Twenty-nine healthy women with regular menstrual cycles were challenged with sodium lauryl sulfate as an irritant patch test at day 1 and at days 9 through 11 of the menstrual cycle. The skin response...... to the applied irritant stimulus was evaluated by visual scoring and also quantified by measurements of transepidermal water loss, edema formation, and blood flow in the skin. The skin response to challenge with sodium lauryl sulfate was found to be significantly stronger at day 1 than at days 9 through 11...

  16. Skin Complications

    Science.gov (United States)

    ... Text Size: A A A Listen En Español Skin Complications Diabetes can affect every part of the ... lipoidica diabeticorum, diabetic blisters, and eruptive xanthomatosis. General Skin Conditions Bacterial Infections Several kinds of bacterial infections ...

  17. Cryotherapy - skin

    Science.gov (United States)

    Cryosurgery - skin; Warts - freezing; Warts - cryotherapy; Actinic keratosis - cryotherapy; Solar keratosis - cryotherapy ... may be used to: Remove warts Destroy precancerous skin lesions (actinic keratoses or solar keratoses) In rare ...

  18. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  19. Sagging Skin

    Science.gov (United States)

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  20. Skin Biopsy

    Science.gov (United States)

    ... Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & ... like these: skin rashes or conditions, such as eczema or psoriasis skin infections, such as staph diseases, ...

  1. Healthy Places for Healthy People

    Science.gov (United States)

    Describes the Healthy Places for Healthy People technical assistance program that helps communities create walkable, healthy, economically vibrant places by engaging with local health care facility partners

  2. SU-E-J-273: Skin Temperature Recovery Rate as a Potential Predictor for Radiation-Induced Skin Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Biswal, N C; Wu, Z; Chu, J [Rush University Medical Center, Chicago, IL (United States); Sun, J [Argonne National Laboratory, Lemont, IL (United States)

    2015-06-15

    Purpose: To assess the potential of dynamic infrared imaging to evaluate early skin reactions during radiation therapy in cancer patients. Methods: Thermal images were captured by our home-built system consisting of two flash lamps and an infrared (IR) camera. The surface temperature of the skin was first raised by ∼ 6 °C from ∼1 ms short flashes; the camera then captured a series of IR images for 10 seconds. For each image series, a basal temperature was recorded for 0.5 seconds before flash was triggered. The temperature gradients (ε) were calculated between a reference point (immediately after the flash) and at a time point of 2sec, 4sec and 9sec after that. A 1.0 cm region of interest (ROI) on the skin was drawn; the mean and standard deviations of the ROIs were calculated. The standard ε values for normal human skins were evaluated by imaging 3 healthy subjects with different skin colors. All of them were imaged on 3 separate days for consistency checks. Results: The temperature gradient, which is the temperature recovery rate, depends on the thermal properties of underlying tissue, i.e. thermal conductivity. The average ε for three volunteers averaged over 3 measurements were 0.64±0.1, 0.72±0.2 and 0.80±0.3 at 2sec, 4sec and 9sec respectively. The standard deviations were within 1.5%–3.2%. One of the volunteers had a prior small skin burn on the left wrist and the ε values for the burned site were around 9% (at 4sec) and 13% (at 9sec) lower than that from the nearby normal skin. Conclusion: The temperature gradients from the healthy subjects were reproducible within 1.5%–3.2 % and that from a burned skin showed a significant difference (9%–13%) from the normal skin. We have an IRB approved protocol to image head and neck patients scheduled for radiation therapy.

  3. SU-E-J-273: Skin Temperature Recovery Rate as a Potential Predictor for Radiation-Induced Skin Reactions

    International Nuclear Information System (INIS)

    Biswal, N C; Wu, Z; Chu, J; Sun, J

    2015-01-01

    Purpose: To assess the potential of dynamic infrared imaging to evaluate early skin reactions during radiation therapy in cancer patients. Methods: Thermal images were captured by our home-built system consisting of two flash lamps and an infrared (IR) camera. The surface temperature of the skin was first raised by ∼ 6 °C from ∼1 ms short flashes; the camera then captured a series of IR images for 10 seconds. For each image series, a basal temperature was recorded for 0.5 seconds before flash was triggered. The temperature gradients (ε) were calculated between a reference point (immediately after the flash) and at a time point of 2sec, 4sec and 9sec after that. A 1.0 cm region of interest (ROI) on the skin was drawn; the mean and standard deviations of the ROIs were calculated. The standard ε values for normal human skins were evaluated by imaging 3 healthy subjects with different skin colors. All of them were imaged on 3 separate days for consistency checks. Results: The temperature gradient, which is the temperature recovery rate, depends on the thermal properties of underlying tissue, i.e. thermal conductivity. The average ε for three volunteers averaged over 3 measurements were 0.64±0.1, 0.72±0.2 and 0.80±0.3 at 2sec, 4sec and 9sec respectively. The standard deviations were within 1.5%–3.2%. One of the volunteers had a prior small skin burn on the left wrist and the ε values for the burned site were around 9% (at 4sec) and 13% (at 9sec) lower than that from the nearby normal skin. Conclusion: The temperature gradients from the healthy subjects were reproducible within 1.5%–3.2 % and that from a burned skin showed a significant difference (9%–13%) from the normal skin. We have an IRB approved protocol to image head and neck patients scheduled for radiation therapy

  4. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  5. Anti-oxidant defence mechanism in vitiliginous skin increases with skin type

    NARCIS (Netherlands)

    Briganti, S.; Caron-Schreinemachers, A.-L. D. B.; Picardo, M.; Westerhof, W.

    2012-01-01

    Background Vitiligo skin shows different burning capacity in people with different phototype. In normal skin antioxidant status is correlated to skin phototype, but unexpectedly it appears that there is a gradual decrease in burning susceptibility of depigmented skin of individuals with increasing

  6. ICRP-26 and skin contamination

    International Nuclear Information System (INIS)

    Finnigan, T.; Huda, W.; Newbery, G.R.

    1979-01-01

    The experience of dealing with skin contamination incidents at The Radiochemical Centre over a 3-year period is presented. Data are given for the primary isotopes involved, the duration of skin contamination, and the skin doses that arise from these incidents. The methods employed in performing dosimetry for skin contamination are discussed and examples involving the isotopes carbon-14 and indium-111 are described. For skin contamination incidents, the mode of penetration of the activity into skin is normally not known and this can be of major significance for the final skin dose estimate. The operational health physics difficulties encountered in complying with both ICRP-26 and UK legislation for skin contamination are considered. In the event of multiple exposure (i.e. skin doses calculated from whole body film badges, extremity TLD dose meters and skin contamination) there is ambiguity in the precise meaning of the skin dose. The usefulness of Derived Working Levels is also discussed. Experience at The Radiochemical Centre has shown that good plant design, proper training and prompt action in dealing with contamination incidents ensures that overexposures to skin from accidental contamination are rare occurrences. (author)

  7. Temperament affects sympathetic nervous function in a normal population.

    Science.gov (United States)

    Kim, Bora; Lee, Jae-Hon; Kang, Eun-Ho; Yu, Bum-Hee

    2012-09-01

    Although specific temperaments have been known to be related to autonomic nervous function in some psychiatric disorders, there are few studies that have examined the relationship between temperaments and autonomic nervous function in a normal population. In this study, we examined the effect of temperament on the sympathetic nervous function in a normal population. Sixty eight healthy subjects participated in the present study. Temperament was assessed using the Korean version of the Cloninger Temperament and Character Inventory (TCI). Autonomic nervous function was determined by measuring skin temperature in a resting state, which was recorded for 5 minutes from the palmar surface of the left 5th digit using a thermistor secured with a Velcro® band. Pearson's correlation analysis and multiple linear regression were used to examine the relationship between temperament and skin temperature. A higher harm avoidance score was correlated with a lower skin temperature (i.e. an increased sympathetic tone; r=-0.343, p=0.004) whereas a higher persistence score was correlated with a higher skin temperature (r=0.433, p=0.001). Hierarchical linear regression analysis revealed that harm avoidance was able to predict the variance of skin temperature independently, with a variance of 7.1% after controlling for sex, blood pressure and state anxiety and persistence was the factor predicting the variance of skin temperature with a variance of 5.0%. These results suggest that high harm avoidance is related to an increased sympathetic nervous function whereas high persistence is related to decreased sympathetic nervous function in a normal population.

  8. Skin Picking Disorder

    Directory of Open Access Journals (Sweden)

    Pinar Cetinay Aydin

    2014-08-01

    Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428

  9. Short-term effects of a low glycemic index carob-containing snack on energy intake, satiety, and glycemic response in normal-weight, healthy adults: Results from two randomized trials.

    Science.gov (United States)

    Papakonstantinou, Emilia; Orfanakos, Nickolaos; Farajian, Paul; Kapetanakou, Anastasia E; Makariti, Ifigenia P; Grivokostopoulos, Nikolaos; Ha, Marie-Ann; Skandamis, Panagiotis N

    2017-10-01

    The potential positive health effects of carob-containing snacks are largely unknown. Therefore, the aims of these studies were to determine the glycemic index (GI) of a carob snack compared with chocolate cookie containing equal amounts of available carbohydrates and to compare the effects of a carob versus chocolate cookie preload consumed as snack before a meal on (a) short-term satiety response measured by subsequent ad libitum meal intake, (b) subjective satiety as assessed by visual analog scales and (c) postprandial glycemic response. Ten healthy, normal-weight volunteers participated in GI investigation. Then, 50 healthy, normal-weight individuals consumed, crossover, in random order, the preloads as snack, with 1-wk washout period. Ad libitum meal (lunch and dessert) was offered. Capillary blood glucose samples were collected at baseline, 2 h after breakfast, just before preload consumption, 2 h after preload, 3 h after preload, just before meal (lunch and dessert), 1 h after meal, and 2 h after meal consumption. The carob snack was a low GI food, whereas the chocolate cookie was a high GI food (40 versus 78, respectively, on glucose scale). Consumption of the carob preload decreased the glycemic response to a following meal and to the individual's feelings of hunger, desire to eat, preoccupation with food, and thirst between snack and meal, as assessed with the use of visual analog scales. Subsequently, participants consumed less amounts of food (g) and had lower total energy intake at mealtimes. The carob snack led to increased satiety, lower energy intake at meal, and decreased postmeal glycemic response possibly due to its low GI value. Identifying foods that promote satiety and decrease glycemic response without increasing the overall energy intake may offer advantages to body weight and glycemic control. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Electrical measurement of the hydration state of the skin surface in vivo.

    Science.gov (United States)

    Tagami, H

    2014-09-01

    Healthy skin surface is smooth and soft, because it is covered by the properly hydrated stratum corneum (SC), an extremely thin and soft barrier membrane produced by the underlying normal epidermis. By contrast, the skin surfaces covering pathological lesions exhibit dry and scaly changes and the SC shows poor barrier function. The SC barrier function has been assessed in vivo by instrumentally measuring transepidermal water loss (TEWL). However, there was a lack of any appropriate method for evaluating the hydration state of the skin surface in vivo until 1980 when we reported the feasibility of employing high-frequency conductance or capacitance to evaluate it quickly and accurately. With such measurements, we can assess easily the moisturizing efficacy of various topical agents in vivo as well as the distribution pattern of water in the SC by combining it with a serial tape-stripping procedure of the skin surface. © 2014 The Author BJD © 2014 British Association of Dermatologists.

  11. The glycan-specific sulfotransferase (R77W)GalNAc-4-ST1 putatively responsible for peeling skin syndrome has normal properties consistent with a simple sequence polymorphisim.

    Science.gov (United States)

    Fiete, Dorothy; Mi, Yiling; Beranek, Mary; Baenziger, Nancy L; Baenziger, Jacques U

    2017-05-01

    Expanded access to DNA sequencing now fosters ready detection of site-specific human genome alterations whose actual significance requires in-depth functional study to rule in or out disease-causing mutations. This is a particular concern for genomic sequence differences in glycosyltransferases, whose implications are often difficult to assess. A recent whole-exome sequencing study identifies (c.229 C > T) in the GalNAc-4-ST1 glycosyltransferase (CHST8) as a disease-causing missense R77W mutation yielding the genodermatosis peeling skin syndrome (PSS) when homozygous. Cabral et al. (Genomics. 2012;99:202-208) cite this sequence change as reducing keratinocyte GalNAc-4-ST1 activity, thus decreasing glycosaminoglycan sulfation, as the mechanism for this blistering disorder. Such an identification could point toward potential clinical and/or prenatal diagnosis of a harmful medical condition. However, GalNAc-4-ST1 has minimal activity toward glycosaminoglycans, instead modifying terminal β1,4-linked GalNAc on N- and O-linked oligosaccharides on specific glycoproteins. We find expression, processing and catalytic activity of GalNAc-4-ST1 completely equivalent between wild type and (R77W) sulfotransferases. Moreover, keratinocytes have little or no GalNAc-4-ST1 mRNA, indicating that they do not express GalNAc-4-ST1. In addition, loss-of-function of GalNAc-4-ST1 primarily presents as reproductive system aberrations rather than skin effects. These findings, an allele frequency of 0.004357, and a 10-fold difference in prevalence of CHST8 (c.299 C > T, R77W) across different ethnic groups, suggest that this sequence represents a "passenger" distributed polymorphism, a simple sequence variant form of the enzyme having normal activity, rather than a "driver" disease-causing mutation that accounts for PSS. This study presents an example for guiding biomedical research initiatives, as well as medical and personal/family perspectives, regarding newly-identified genomic sequence

  12. The effect of skin thickness determined using breast CT on mammographic dosimetry

    International Nuclear Information System (INIS)

    Huang Shihying; Boone, John M.; Yang, Kai; Kwan, Alexander L. C.; Packard, Nathan J.

    2008-01-01

    The effect of breast skin thickness on dosimetry in mammography was investigated. Breast computed tomography (CT) acquisition techniques, combined with algorithms designed for determining specific breast metrics, were useful for estimating skin thickness. A radial-geometry edge detection scheme was implemented on coronal reconstructed breast CT (bCT) images to measure the breast skin thickness. Skin thickness of bilateral bCT volume data from 49 women and unilateral bCT volume data from 2 women (10 healthy women and 41 women with BIRADS 4 and 5 diagnoses) was robustly measured with the edge detection scheme. The mean breast skin thickness (±inter-breast standard deviation) was found to be 1.45±0.30 mm. Since most current published normalized glandular dose (D gN ) coefficients are based on the assumption of a 4-mm breast skin thickness, the D gN values computed with Monte Carlo techniques will increase up to 18% due to the thinner skin layers (e.g., 6-cm 50% glandular breast, 28 kVp Mo-Mo spectrum). The thinner skin dimensions found in this study suggest that the current D gN values used for mammographic dosimetry lead to a slight underestimate in glandular dose

  13. Trait Positive Affect Buffers the Effects of Acute Stress on Skin Barrier Recovery

    Science.gov (United States)

    Robles, Theodore F.; Brooks, Kathryn P.; Pressman, Sarah D.

    2010-01-01

    Objective This study examines the role of self-reported trait positive affect (PA) on skin barrier recovery after skin disruption, and whether the role of trait PA in wound healing is consistent with the direct effects model or the stress-buffering model of PA and health. Design Sixty healthy participants (mean age 22.7 ± 3.9 years) completed a self-report measure of trait positive and negative affect, underwent a “tape-stripping” procedure that disrupts normal skin barrier function, and were randomly assigned to a Stress (Trier Social Stress Test) or No Stress (reading task) condition. Main Outcome Measures Skin barrier recovery was assessed by measuring transepidermal water loss up to 2 hr after skin disruption. Results Multilevel modeling indicated that greater trait PA was related to faster skin barrier recovery (p < .05). The effects of PA on skin barrier recovery were independent of levels of trait NA. Conclusion These findings suggest that trait PA may influence skin barrier recovery following a brief stressor. In addition, these results provide additional evidence that trait PA can positively impact objective health outcomes. PMID:19450044

  14. Eating Healthy

    Science.gov (United States)

    ... There is much we can do to promote healthy eating habits. Together we can prevent or delay onset of diabetes, obesity and other chronic conditions and diseases. Benefits Helps maintain a healthy weight A healthy weight reduces risk of chronic ...

  15. Dry Skin Relief

    Science.gov (United States)

    ... on a budget Skin care products Skin care secrets Skin lighteners Skin of color Summer skin problems ... condition, such as eczema. Additional related information Dermatologists' top tips for relieving dry skin FIND A DERMATOLOGIST ...

  16. Is the Fractional Laser Still Effective in Assisting Cutaneous Macromolecule Delivery in Barrier-Deficient Skin? Psoriasis and Atopic Dermatitis as the Disease Models.

    Science.gov (United States)

    Lee, Woan-Ruoh; Shen, Shing-Chuan; Sung, Calvin T; Liu, Pei-Ying; Fang, Jia-You

    2018-04-26

    Most of the investigations into laser-assisted skin permeation have used the intact skin as the permeation barrier. Whether the laser is effective in improving cutaneous delivery via barrier-defective skin is still unclear. In this study, ablative (Er:YAG) and non-ablative (Er:glass) lasers were examined for the penetration of peptide and siRNA upon topical application on in vitro skin with a healthy or disrupted barrier. An enhanced peptide flux (6.9 fold) was detected after tape stripping of the pig stratum corneum (SC). A further increase of flux to 11.7 fold was obtained after Er:YAG laser irradiation of the SC-stripped skin. However, the application of Er:glass modality did not further raise the flux via the SC-stripped skin. A similar trend was observed in the case of psoriasiform skin. Conversely, the flux was enhanced 3.7 and 2.6 fold after treatment with the Er:YAG and the Er:glass laser on the atopic dermatitis (AD)-like skin. The 3-D skin structure captured by confocal microscopy proved the distribution of peptide and siRNA through the microchannels and into the surrounding tissue. The fractional laser was valid for ameliorating macromolecule permeation into barrier-disrupted skin although the enhancement level was lower than that of normal skin.

  17. Soluble intercellular adhesion molecule-1 (sICAM-1) and soluble interleukin-2 receptors (sIL-2R) in scleroderma skin

    DEFF Research Database (Denmark)

    Søndergaard, Klaus; Deleuran, Mette; Heickendorff, Lene

    1998-01-01

    In order to investigate whether soluble intercellular adhesion molecule-1 (sICAM-1) and soluble interleukin-2 receptors (sIL-2R) were present in scleroderma skin, and to compare their levels to concentrations measured in plasma and clinical parameters, we examined suction blister fluid and plasma...... from 13 patients with systemic sclerosis and 11 healthy volunteers. Suction blisters and biopsies were from the transition zone between normal skin and scleroderma, and uninvolved abdominal skin. The levels of sICAM-1 and sIL-2R were significantly increased in both plasma and suction blister fluid from...

  18. Skin graft viability test

    International Nuclear Information System (INIS)

    Wahner, H.W.; Robertson, J.S.

    1983-01-01

    With respect to skin pedicles (tubular pedicle or direct flap), an estimation of the blood supply is of great importance in making a decision as to when to perform the separation from the original blood supply. This decision is based on empiric observation of the normal time of healing and varies greatly with the site and the concepts of the individual surgery. A number of methods have been proposed for testing the circulation of pedicle skin flaps or tubes, and these methods all seem more complicated and less accurate than the isotope method that is described in this chapter

  19. Skin cancer

    International Nuclear Information System (INIS)

    Yamada, Michiko

    1992-01-01

    This chapter reviews the development of skin cancer associated with radiation, focusing on the knowledge of A-bomb radiation-induced skin cancer. Since the discovery of X radiation in 1895, acute and chronic radiation dermatitis has been the first matter of concern. Then, in 1902, skin cancer found among radiological personnel has posed a social problem. In earlier study determining the relationship between skin cancer and A-bomb radiation, there is no increase in the incidence of either skin cancer or precancerous condition during the first 20 years after A-bombing. More recent studies have showed that there is a significant correlation between the incidence of skin cancer and distance from the hypocenter; and the incidence of skin cancer is found to be remarkably increased since 1975 in the group exposed at ≤2,000 m. Excess relative risk is 2.2 at one Gy dose. The incidence of skin cancer is also found to be extremely increased with aging. Relative risk is high in younger A-bomb survivors at the time of exposure. Histologically, basal cell carcinoma is more senstitive to ionizing radiation than squamous cell carcinoma. (N.K.)

  20. CD4+, CD8+, CD3+ cell counts and CD4+/CD8+ ratio among patients with mycobacterial diseases (leprosy, tuberculosis), HIV infections, and normal healthy adults: a comparative analysis of studies in different regions of India.

    Science.gov (United States)

    Hussain, Tahziba; Kulshreshtha, K K; Yadav, V S; Katoch, Kiran

    2015-01-01

    In this study, we estimated the CD4+, CD8+, CD3+ cell counts and the CD4/CD8 ratio among normal healthy controls (adults and children), leprosy patients (without any complications and during reactional states), TB patients (with and without HIV), and HIV-positive patients (early infection and full-blown AIDS) and correlated the changes with disease progression. In our study, it was observed that among adults, CD4+ cell counts ranged from 518-1098, CD8+ from 312-952, whereas CD4/CD8 ratio from 0.75-2.30. Among children, both CD4+ and CD8+ cells were more and the CD4/CD8 ratio varied from 0.91-3.17. With regard to leprosy patients, we observed that CD4+ and CD8+ cell counts were lower among PB (pauci-bacillary) and MB (multi-bacillary) patients. CD4/CD8 ratio was 0.99 ± 0.28 among PB patients while the ratio was lower, 0.78 ± 0.20, among MB patients. CD4+ cell counts were raised during RR (reversal reactions) and ENL (erythema nodosum leprosum) among the PB and MB patients whereas the CD8+ cell counts were lower among PB and MB patients. CD4/CD8 ratio doubled during reactional episodes of RR and ENL. Among the HIV-negative tuberculosis (TB) patients, both the CD4+ and CD8+ cell counts were found to be less and the CD4/CD8 ratio varied between 0.53-1.75. Among the HIV-positive TB patients and HIV-positive patients, both the CD4+ and CD8+ cells were very less and ratio drops significantly. In the initial stages of infection, as CD4+ counts drop, an increase in the CD8+ cell counts was observed and the ratio declines. In full-blown cases, CD4+ cell counts were very low, 3-4 to 54 cells, CD8+ cells from 12-211 and the ratio drops too low. This study is the first of its kind in this region of the country and assumes importance since no other study has reported the values of CD4+ and CD8+ T-lymphocyte counts among patients with mycobacterial diseases (leprosy and TB), HIV infections along with normal healthy individuals of the region, and correlation with clinical

  1. Sympathetic skin response evoked by laser skin stimulation

    OpenAIRE

    Rossi, P.; Truini, A.; Serrao, M.; Iannetti, G. D.; Parisi, L.; Pozzessere, G.; Cruccu, G.

    2002-01-01

    The objective of this study was to evoke sympathetic skin responses (SSRs) in healthy subjects using laser stimulation and to compare these responses with those induced by conventional electrical stimuli. Twenty healthy subjects were investigated. SSRs were obtained using electrical and laser stimuli delivered to the wrist controlateral to the recording site. The sympathetic sudomotor conduction velocity (SSFCV) was measured in 8 subjects by simultaneously recording the SSR from the hand and ...

  2. Effects of polydextrose with breakfast or with a midmorning preload on food intake and other appetite-related parameters in healthy normal-weight and overweight females: An acute, randomized, double-blind, placebo-controlled, and crossover study.

    Science.gov (United States)

    Ibarra, Alvin; Olli, Kaisa; Pasman, Wilrike; Hendriks, Henk; Alhoniemi, Esa; Raza, Ghulam Shere; Herzig, Karl-Heinz; Tiihonen, Kirsti

    2017-03-01

    Polydextrose (PDX) reduces subsequent energy intake (EI) when administered at midmorning in single-blind trials of primarily normal-weight men. However, it is unclear if this effect also occurs when PDX is given at breakfast time. Furthermore, for ecological validity, it is desirable to study a female population, including those at risk for obesity. We studied the effects of PDX, served as part of a breakfast or midmorning preload, on subsequent EI and other appetite-related parameters in healthy normal-weight and overweight females. Per earlier studies, the primary outcome was defined as the difference in subsequent EI when PDX was consumed at midmorning versus placebo. Thirty-two volunteers were enrolled in this acute, double-blind, placebo-controlled, randomized, and crossover trial to examine the effects of 12.5 g of PDX, administered as part of a breakfast or midmorning preload, on subsequent EI, subjective feelings of appetite, well-being, and mood. Gastric emptying rates and the blood concentrations of glucose, insulin, cholecystokinin, ghrelin, glucagon-like peptide 1 (GLP-1), and peptide tyrosine-tyrosine were measured in the group that received PDX as part of their breakfast. There were no differences in EI between volunteers who were fed PDX and placebo. PDX intake with breakfast tended to elevate blood glucose (P = 0.06) during the postabsorptive phase, significantly lowered insulin by 15.7% (P = 0.04), and increased GLP-1 by 39.9% (P = 0.02); no other effects on blood parameters or gastric emptying rates were observed. PDX intake at midmorning reduced hunger by 31.4% during the satiation period (P = 0.02); all other subjective feelings of appetite were unaffected. Volunteers had a uniform mood profile during the study. PDX was well tolerated, causing one mild adverse event throughout the trial. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Quantification of thermal damage in skin tissue

    Institute of Scientific and Technical Information of China (English)

    Xu Feng; Wen Ting; Lu Tianjian; Seffen Keith

    2008-01-01

    Skin thermal damage or skin burns are the most commonly encountered type of trauma in civilian and military communities. Besides, advances in laser, microwave and similar technologies have led to recent developments of thermal treatments for disease and damage involving skin tissue, where the objective is to induce thermal damage precisely within targeted tissue structures but without affecting the surrounding, healthy tissue. Further, extended pain sensation induced by thermal damage has also brought great problem for burn patients. Thus, it is of great importance to quantify the thermal damage in skin tissue. In this paper, the available models and experimental methods for quantification of thermal damage in skin tissue are discussed.

  4. Variation of Biophysical Parameters of the Skin with Age, Gender, and Body Region

    Science.gov (United States)

    Firooz, Alireza; Sadr, Bardia; Babakoohi, Shahab; Sarraf-Yazdy, Maryam; Fanian, Ferial; Kazerouni-Timsar, Ali; Nassiri-Kashani, Mansour; Naghizadeh, Mohammad Mehdi; Dowlati, Yahya

    2012-01-01

    Background. Understanding the physiological, chemical, and biophysical characteristics of the skin helps us to arrange a proper approach to the management of skin diseases. Objective. The aim of this study was to measure 6 biophysical characteristics of normal skin (sebum content, hydration, transepidermal water loss (TEWL), erythema index, melanin index, and elasticity) in a normal population and assess the effect of sex, age, and body location on them. Methods. Fifty healthy volunteers in 5 age groups (5 males and females in each) were enrolled in this study. A multifunctional skin physiology monitor (Courage & Khazaka electronic GmbH, Germany) was used to measure skin sebum content, hydration, TEWL, erythema index, melanin index, and elasticity in 8 different locations of the body. Results. There were significant differences between the hydration, melanin index, and elasticity of different age groups. Regarding the locations, forehead had the highest melanin index, where as palm had the lowest value. The mean values of erythema index and melanin index and TEWL were significantly higher in males and anatomic location was a significant independent factor for all of 6 measured parameters. Conclusion. Several biophysical properties of the skin vary among different gender, age groups, and body locations. PMID:22536139

  5. X-ray microanalysis of psoriatic skin

    International Nuclear Information System (INIS)

    Grundin, T.G.; Roomans, G.M.; Forslind, B.; Lindberg, M.; Werner, Y.

    1985-01-01

    Electron probe x-ray microanalysis was used to study elemental distribution in uninvolved and involved skin from patients with psoriasis, and in skin from healthy controls. Significant differences were found between the involved and uninvolved psoriatic skin. In the involved skin, the concentrations of Mg, P, and K were higher in the stratum germinativum, spinosum, and granulosum, compared to the corresponding strata in uninvolved skin. Neither involved nor uninvolved psoriatic stratum germinativum differed markedly from nonpsoriatic control stratum germinativum. In uninvolved psoriatic skin only a lower level of K was noted. In comparison to uninvolved psoriatic skin, the elemental composition of the various strata of involved psoriatic skin shows a pattern typical for highly proliferative, nonneoplastic cells

  6. Molecular subsets in the gene expression signatures of scleroderma skin.

    Directory of Open Access Journals (Sweden)

    Ausra Milano

    2008-07-01

    Full Text Available Scleroderma is a clinically heterogeneous disease with a complex phenotype. The disease is characterized by vascular dysfunction, tissue fibrosis, internal organ dysfunction, and immune dysfunction resulting in autoantibody production.We analyzed the genome-wide patterns of gene expression with DNA microarrays in skin biopsies from distinct scleroderma subsets including 17 patients with systemic sclerosis (SSc with diffuse scleroderma (dSSc, 7 patients with SSc with limited scleroderma (lSSc, 3 patients with morphea, and 6 healthy controls. 61 skin biopsies were analyzed in a total of 75 microarray hybridizations. Analysis by hierarchical clustering demonstrates nearly identical patterns of gene expression in 17 out of 22 of the forearm and back skin pairs of SSc patients. Using this property of the gene expression, we selected a set of 'intrinsic' genes and analyzed the inherent data-driven groupings. Distinct patterns of gene expression separate patients with dSSc from those with lSSc and both are easily distinguished from normal controls. Our data show three distinct patient groups among the patients with dSSc and two groups among patients with lSSc. Each group can be distinguished by unique gene expression signatures indicative of proliferating cells, immune infiltrates and a fibrotic program. The intrinsic groups are statistically significant (p<0.001 and each has been mapped to clinical covariates of modified Rodnan skin score, interstitial lung disease, gastrointestinal involvement, digital ulcers, Raynaud's phenomenon and disease duration. We report a 177-gene signature that is associated with severity of skin disease in dSSc.Genome-wide gene expression profiling of skin biopsies demonstrates that the heterogeneity in scleroderma can be measured quantitatively with DNA microarrays. The diversity in gene expression demonstrates multiple distinct gene expression programs in the skin of patients with scleroderma.

  7. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin

    OpenAIRE

    Li, Z; Hu, L; Elias, PM; Man, M-Q

    2018-01-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...

  8. Imaging Blood Vessel Morphology in Skin

    DEFF Research Database (Denmark)

    Schuh, Sandra; Holmes, Jon; Ulrich, Martina

    2017-01-01

    Conventional optical coherence tomography (OCT) enables the visualization of morphological changes of skin cancer. The use of OCT in the diagnostic investigation and in the therapy decision of non-melanoma skin cancer and other skin changes is already established, and has found its way into routine...... practice. With the development of speckle-variance OCT, also named dynamic OCT (D-OCT), the vascular architecture and the blood flow of the skin can be displayed in vivo and in 3D. This novel angiographic variant of OCT offers the ability to visualize and measure vessel morphology providing a new insight...... into healthy, inflammatory and neoplastic skin lesions such as malignant melanoma. This review focuses on the possibilities of using D-OCT on healthy and diseased skin. We suggest and illustrate key diagnostic characteristics by analyzing the initial publications and preliminary unpublished data on vessel...

  9. Supplementation with Eskimo Skin Care improves skin elasticity in women. A pilot study.

    Science.gov (United States)

    Segger, Dörte; Matthies, Andreas; Saldeen, Tom

    2008-01-01

    To investigate the question of whether supplementation with an oral oil formulation rich in natural stable fish oil can alter skin elasticity, transepidermal water loss (TEWL), and skin roughness in healthy women. Twenty-four healthy women aged 40-60 years participated in a single-blind randomized trial for testing the effect of a proprietary oral supplement for skin nutrition (Eskimo Skin Care) on skin elasticity, TEWL, and skin roughness. Skin elasticity was measured by an optical cutometer, TEWL by a water-loss module based upon the vapour gradient principle, and skin roughness with a three-dimensional microtopography imaging system. Skin elasticity increased by 10% after 3 months of treatment with the supplement, a statistically significant increase in comparison with the control group (p=0.0298). There was a trend, though not statistically significant, towards a positive influence on the skin's barrier function. No effect on the skin roughness was observed. Eskimo Skin Care, an oral preparation rich in natural stable fish oil, can improve skin elasticity.

  10. Skin Dictionary

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  11. Hyperelastic skin

    Science.gov (United States)

    ... is most often seen in people who have Ehlers-Danlos syndrome. People with this disorder have very elastic skin. ... any member of your family been diagnosed with Ehlers-Danlos syndrome? What other symptoms are present? Genetic counseling may ...

  12. Skin Cancer

    Science.gov (United States)

    ... sunlamps. There are 2 types of UV rays: UVA rays (long-wave) – UVA rays penetrate clouds and glass. They penetrate the ... to cancer. But studies have shown that both UVA and UVB damage the skin and can cause ...

  13. About Skin-to-Skin Care (Kangaroo Care)

    Science.gov (United States)

    ... Our Sponsors Ages & Stages Ages & Stages Ages and Stages Prenatal Baby (0-12 mos.) Toddler 1-3yrs. Preschool 3-5yrs Grade School 5-12yrs. Teen 12- ... the Word Shop AAP Find a Pediatrician Ages & Stages Prenatal Baby Bathing & Skin ... Teen Young Adult Healthy Children > Ages & Stages > ...

  14. Quantification of thermal damage in skin tissue

    Institute of Scientific and Technical Information of China (English)

    徐峰; 文婷; 卢天健; Seffen; Keith

    2008-01-01

    Skin thermal damage or skin burns are the most commonly encountered type of trauma in civilian and military communities. Besides, advances in laser, microwave and similar technologies have led to recent developments of thermal treatments for disease and damage involving skin tissue, where the objective is to induce thermal damage precisely within targeted tissue structures but without affecting the surrounding, healthy tissue. Further, extended pain sensation induced by thermal damage has also brought great...

  15. The Microbiome in Skin Health and Disease

    Indian Academy of Sciences (India)

    Souvik Mukherjee

    Differential Skin Microbiome profile in Caesarean babies is associated with risk of immune/metabolic .... Indicator. Genus. Cheek Sebum. (μg/cm2) p-value. Forehead Hydration. [Age adjusted] (a.u.) p-value .... Key Inferences. The Healthy Skin ...

  16. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease ...

  17. Healthy Living

    Science.gov (United States)

    ... Health Menu Topics Environment & Health Healthy Living Pollution Reduce, Reuse, Recycle Science – How It Works The Natural World Games ... Lessons Topics Expand Environment & Health Healthy Living Pollution Reduce, Reuse, Recycle Science – How It Works The Natural World Games ...

  18. UVB 311 nm tolerance of vitiligo skin increases with skin photo type

    NARCIS (Netherlands)

    Caron-Schreinemachers, Anne-Lou D. B.; Kingswijk, Melanie M.; Bos, Jan D.; Westerhof, Wiete

    2005-01-01

    It is assumed that skin is protected against sunburn by melanin. In patients with vitiligo, there are white patches in the normal pigmented skin. We noticed that there is a difference in burning capacity of these white patches between people with different skin types. With UVB 311 nm lamps, we

  19. Regional cerebral blood flow as assessed by principal component analysis and 99mTc-HMPAO SPET in healthy subjects at rest: normal distribution and effect of age and gender

    International Nuclear Information System (INIS)

    Pagani, M.; Salmaso, D.; Jonsson, C.; Hatherly, R.; Larsson, S.A.; Jacobsson, H.; Waegner, A.

    2002-01-01

    The increasing implementation of standardisation techniques in brain research and clinical diagnosis has highlighted the importance of reliable baseline data from normal control subjects for inter-subject analysis. In this context, knowledge of the regional cerebral blood flow (rCBF) distribution in normal ageing is a factor of the utmost importance. In the present study, rCBF was investigated in 50 healthy volunteers (25 men, 25 women), aged 31-78 years, who were examined at rest by means of single-photon emission tomography (SPET) using technetium-99m d,l-hexamethylpropylene amine oxime (HMPAO). After normalising the CBF data, 27 left and 27 right volumes of interest (VOIs) were selected and automatically outlined by standardisation software (computerised brain atlas). The heavy load of flow data thus obtained was reduced in number and grouped in factors by means of principal component analysis (PCA). PCA extracted 12 components explaining 81% of the variance and including the vast majority of cortical and subcortical regions. Analysis of variance and regression analyses were performed for rCBF, age and gender before PCA was applied and subsequently for each single extracted factor. There was a significantly higher CBF on the right side than on the left side (P<0.001). In the overall analysis, a significant decrease was found in CBF (P=0.05) with increasing age, and this decrease was particularly evident in the left hemisphere (P=0.006). When gender was specifically analysed, CBF was found to decrease significantly with increasing age in females (P=0.037) but not in males. Furthermore, a significant decrease in rCBF with increasing age was found in the brain vertex (P=0.05), left frontotemporal cortex (P=0.012) and temporocingulate cortex (P=0.003). By contrast, relative rCBF in central structures increased with age (P=0.001). The ability of standardisation software and PCA to identify functionally connected brain regions might contribute to a better

  20. Regional cerebral blood flow as assessed by principal component analysis and {sup 99m}Tc-HMPAO SPET in healthy subjects at rest: normal distribution and effect of age and gender

    Energy Technology Data Exchange (ETDEWEB)

    Pagani, M. [Inst. of Neurobiology and Molecular Medicine, CNR, Rome (Italy); Dept. of Hospital Physics, Karolinska Hospital, Stockholm (Sweden); Salmaso, D. [Inst. of Psychology, CNR, Rome (Italy); Jonsson, C.; Hatherly, R.; Larsson, S.A. [Dept. of Hospital Physics, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Dept. of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Waegner, A. [Dept. of Clinical Neuroscience, Karolinska Institutet, Stockholm (Sweden); Dept. of Clinical Neuroscience, Karolinska Hospital, Stockholm (Sweden)

    2002-01-01

    The increasing implementation of standardisation techniques in brain research and clinical diagnosis has highlighted the importance of reliable baseline data from normal control subjects for inter-subject analysis. In this context, knowledge of the regional cerebral blood flow (rCBF) distribution in normal ageing is a factor of the utmost importance. In the present study, rCBF was investigated in 50 healthy volunteers (25 men, 25 women), aged 31-78 years, who were examined at rest by means of single-photon emission tomography (SPET) using technetium-99m d,l-hexamethylpropylene amine oxime (HMPAO). After normalising the CBF data, 27 left and 27 right volumes of interest (VOIs) were selected and automatically outlined by standardisation software (computerised brain atlas). The heavy load of flow data thus obtained was reduced in number and grouped in factors by means of principal component analysis (PCA). PCA extracted 12 components explaining 81% of the variance and including the vast majority of cortical and subcortical regions. Analysis of variance and regression analyses were performed for rCBF, age and gender before PCA was applied and subsequently for each single extracted factor. There was a significantly higher CBF on the right side than on the left side (P<0.001). In the overall analysis, a significant decrease was found in CBF (P=0.05) with increasing age, and this decrease was particularly evident in the left hemisphere (P=0.006). When gender was specifically analysed, CBF was found to decrease significantly with increasing age in females (P=0.037) but not in males. Furthermore, a significant decrease in rCBF with increasing age was found in the brain vertex (P=0.05), left frontotemporal cortex (P=0.012) and temporocingulate cortex (P=0.003). By contrast, relative rCBF in central structures increased with age (P=0.001). The ability of standardisation software and PCA to identify functionally connected brain regions might contribute to a better

  1. Optical coherence tomography for imaging of skin and skin diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studi...... technical solutions are being pursued to further improve the quality of the images and the data provided, and OCT is being integrated in multimodal imaging devices that would potentially be able to provide a quantum leap to the imaging of skin in vivo....

  2. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  3. Benefits of optical coherence tomography for imaging of skin diseases

    Directory of Open Access Journals (Sweden)

    Utz S.R.

    2015-09-01

    Full Text Available Aim: working out the methods of visualization of information obtained during optical coherent tomography in normal skin and in series of inflammatory disorders. Materials and Methods. OCS1300SS (made in Thorlabs, USA was used in which the source of emission of radiation was a super-luminiscent diode with mean wavelength of 1325 nm. 12 patients with different skin conditions and 5 virtually healthy volunteers were examined with ОСТ procedure in OPD and IPD settings. High resolution USG numerical system DUB (TPM GmbH, Germany was used for comparative USG assessment. Results. ОСТ demonstrated considerably more detailed picture of the objects scanned compared to USG investigation. Image obtained with the help of ОСТ contains vital information about sizes of macro-morphological elements, status of vascular elements and their density in different depths of the skin. Conclusion. Additional results obtained from ОСТ of the skin lesions in plane section improves attraction for ОСТ in practical dermatology.

  4. Dietary water affects human skin hydration and biomechanics.

    Science.gov (United States)

    Palma, Lídia; Marques, Liliana Tavares; Bujan, Julia; Rodrigues, Luís Monteiro

    2015-01-01

    It is generally assumed that dietary water might be beneficial for the health, especially in dermatological (age preventing) terms. The present study was designed to quantify the impact of dietary water on major indicators of skin physiology. A total of 49 healthy females (mean 24.5±4.3 years) were selected and characterized in terms of their dietary daily habits, especially focused in water consumption, by a Food Frequency Questionnaire. This allowed two groups to be set - Group 1 consuming less than 3,200 mL/day (n=38), and Group 2 consuming more than 3,200 mL/day (n=11). Approximately 2 L of water were added to the daily diet of Group 2 individuals for 1 month to quantify the impact of this surplus in their skin physiology. Measurements involving epidermal superficial and deep hydration, transepidermal water loss, and several biomechanical descriptors were taken at day 0 (T0), 15 (T1), and 30 (T2) in several anatomical sites (face, upper limb, and leg). This stress test (2 L/day for 30 days) significantly modified superficial and deep skin hydration, especially in Group 1. The same impact was registered with the most relevant biomechanical descriptors. Thus, in this study, it is clear that higher water inputs in regular diet might positively impact normal skin physiology, in particular in those individuals with lower daily water consumptions.

  5. Nickel deposited on the skin-visualization by DMG test.

    Science.gov (United States)

    Julander, Anneli; Skare, Lizbet; Vahter, Marie; Lidén, Carola

    2011-03-01

    Nickel is the most common cause of contact allergy and an important risk factor for hand eczema. Visualization techniques may be powerful in showing exposures. The dimethylglyoxime (DMG) test might be used to establish skin exposure to nickel. To develop and evaluate methods for visualization of nickel on the skin by the DMG test and hand imprints. Nickel solutions at different concentrations were applied in duplicate on the hands in healthy subjects (n = 5). The DMG test and acid wipe sampling for quantification were then performed. Hand imprints were taken after manipulation of nickel-releasing tools (n = 1), and in workers performing their normal tasks (n = 7). The imprints were developed by the DMG test. The DMG test on hands gave positive results in all subjects. The lowest concentration giving rise to a colour change was set to 0.13 µg/cm(2) for DMG testing on skin. DMG test-developed imprints worked well except when hands were heavily contaminated by other particles/dust. The DMG test may be used as a simple and powerful tool for visualization of nickel on skin. DMG test-developed hand imprints may, in the future, be used for semi-quantitative or quantitative exposure assessment. © 2011 John Wiley & Sons A/S.

  6. Neurogenic inflammation in human and rodent skin

    DEFF Research Database (Denmark)

    Schmelz, M; Petersen, Lars Jelstrup

    2001-01-01

    The combination of vasodilation and protein extravasation following activation of nociceptors has been termed "neurogenic inflammation." In contrast to rodents, no neurogenic protein extravasation can be elicited in healthy human skin. Dermal microdialysis has considerably increased our knowledge...... about neurogenic inflammation in human skin, including the involvement of mast cells.......The combination of vasodilation and protein extravasation following activation of nociceptors has been termed "neurogenic inflammation." In contrast to rodents, no neurogenic protein extravasation can be elicited in healthy human skin. Dermal microdialysis has considerably increased our knowledge...

  7. The outcomes of barrier protection in periwound skin and stoma care.

    Science.gov (United States)

    Stephen-Haynes, Jackie

    This article considers the anatomy and physiology of the skin,wound healing, excoriation, maceration, peristomal skin and the importance of periwound protection. The results of a 54-patient study of the use of barrier film forming skin protection in periwound skin are presented and a 10-patient healthy volunteer experimental evaluation. The results confirm the effectiveness of barrier protection in healthy skin in an experimental evaluation and a 54-patient study requiring periwound protection.

  8. Analysis of assistance procedures to normal birth in primiparous

    Directory of Open Access Journals (Sweden)

    Joe Luiz Vieira Garcia Novo

    2016-04-01

    Full Text Available Introduction: Current medical technologies in care in birth increased maternal and fetal benefits persist, despite numerous unnecessary procedures. The purpose of the normal childbirth care is to have healthy women and newborns, using a minimum of safe interventions. Objective: To analyze the assistance to normal delivery in secondary care maternity. Methodology: A total of 100 primiparous mothers who had vaginal delivery were included, in which care practices used were categorized: 1 according to the WHO classification for assistance to normal childbirth: effective, harmful, used with caution and used inappropriately; 2 associating calculations with the Bologna Index parameters: presence of a birth partner, partograph, no stimulation of labor, delivery in non-supine position, and mother-newborn skin-to-skin contact. Results: Birth partners (85%, correctly filled partographs (62%, mother-newborn skin-to-skin contact (36%, use of oxytocin (87%, use of parenteral nutrition during labor (86% and at delivery (74%, episiotomy (94% and uterine fundal pressure in the expulsion stage (58%. The overall average value of the Bologna Index of the mothers analyzed was 1.95. Conclusions: Some effective procedures recommended by WHO (presence of a birth partner, some effective and mandatory practices were not complied with (partograph completely filled, potentially harmful or ineffective procedures were used (oxytocin in labor/post-partum, as well as inadequate procedures (uterine fundal pressure during the expulsion stage, use of forceps and episiotomy. The maternity’s care model did not offer excellence procedures in natural birth to their mothers in primiparity, (BI=1.95.

  9. The effectiveness of a skin care program for the prevention of contact dermatitis in health care workers (the Healthy Hands Project): study protocol for a cluster randomized controlled trial.

    Science.gov (United States)

    Soltanipoor, Maryam; Kezic, Sanja; Sluiter, Judith K; Rustemeyer, Thomas

    2017-02-28

    Health care workers (HCW) are at high risk for developing occupational hand dermatitis (HD) due to frequent exposure to 'wet work'. Amongst HCWs, nurses are at highest risk, with an estimated point prevalence of HD ranging between 12 and 30%. The burden of disease is high with chronicity, sick leave, risk of unemployment and impaired quality of life. Despite evidence from the medical literature on the risk factors and the importance of skin care in the prevention of HD, in practice, compliance to skin care protocols are below 30%. New preventive strategies are obviously needed. This is a cluster randomized controlled trial, focusing on nurses performing wet work. In total, 20 wards are recruited to include 504 participating nurses in the study at baseline. The wards will be randomized to an intervention or a control group and followed up for 18 months. The intervention consists of the facilitation of creams being available at the wards combined with the continuous electronic monitoring of their consumption with regular feedback on skin care performance in teams of HCWs. Both the intervention and the control group receive basic education on skin protection (as 'care as usual'). Every 6 months, participants of both groups will fill in the questionnaires regarding exposure to wet work and skin protective behavior. Furthermore, skin condition will be assessed and samples of the stratum corneum collected. The effect of the intervention will be measured by comparing the change in Hand Eczema Severity Index (HECSI score) from baseline to 12 months. The Natural Moisturizing Factor (NMF) levels, measured in the stratum corneum as an early biomarker of skin barrier damage, and the total consumption of creams per ward will be assessed as a secondary outcome. This trial will assess the clinical effectiveness of an intervention program to prevent hand dermatitis among health care workers TRIAL REGISTRATION: Netherlands Trial Register (NTR), identification number NTR5564

  10. First genomic survey of human skin fungal diversity

    Science.gov (United States)

    Fungal infections of the skin affect 29 million people in the United States. In the first study of human fungal skin diversity, National Institutes of Health researchers sequenced the DNA of fungi that thrive at different skin sites of healthy adults to d

  11. Dietary water affects human skin hydration and biomechanics

    Directory of Open Access Journals (Sweden)

    Palma L

    2015-08-01

    Full Text Available Lídia Palma,1 Liliana Tavares Marques,1 Julia Bujan,2,3 Luís Monteiro Rodrigues1,4 1CBIOS – Research Center for Health Science and Technologies, Universidade Lusófona, Campo Grande, Lisboa, Portugal; 2Department of Medicine and Medical Specialities, Universidad de Alcalá de Henares, Madrid, Spain; 3CIBER-BBN, Madrid, España, Spain; 4Department of Pharmacological Sciences, School of Pharmacy, Universidade de Lisboa, Lisboa, Portugal Abstract: It is generally assumed that dietary water might be beneficial for the health, especially in dermatological (age preventing terms. The present study was designed to quantify the impact of dietary water on major indicators of skin physiology. A total of 49 healthy females (mean 24.5±4.3 years were selected and characterized in terms of their dietary daily habits, especially focused in water consumption, by a Food Frequency Questionnaire. This allowed two groups to be set – Group 1 consuming less than 3,200 mL/day (n=38, and Group 2 consuming more than 3,200 mL/day (n=11. Approximately 2 L of water were added to the daily diet of Group 2 individuals for 1 month to quantify the impact of this surplus in their skin physiology. Measurements involving epidermal superficial and deep hydration, transepidermal water loss, and several biomechanical descriptors were taken at day 0 (T0, 15 (T1, and 30 (T2 in several anatomical sites (face, upper limb, and leg. This stress test (2 L/day for 30 days significantly modified superficial and deep skin hydration, especially in Group 1. The same impact was registered with the most relevant biomechanical descriptors. Thus, in this study, it is clear that higher water inputs in regular diet might positively impact normal skin physiology, in particular in those individuals with lower daily water consumptions. Keywords: dietary water, water consume, skin hydration, TEWL, skin biomechanics

  12. Recommendations for determining the surface contamination of the skin and estimating radiation exposure of the skin after contamination

    International Nuclear Information System (INIS)

    1989-01-01

    The recommendations are applicable to the determination of surface contaminations of the skin and to the estimation of the expected radiation exposure of the skin of contaminated persons. According to the present recommendations, the radiation exposure can only be estimated for the intact and healthy skin

  13. Squamous cell skin cancer

    Science.gov (United States)

    ... that reflect light more, such as water, sand, concrete, and areas that are painted white. The higher ... - skin - squamous cell; Skin cancer - squamous cell; Nonmelanoma skin cancer - squamous ...

  14. Plants used to treat skin diseases

    Science.gov (United States)

    Tabassum, Nahida; Hamdani, Mariya

    2014-01-01

    Skin diseases are numerous and a frequently occurring health problem affecting all ages from the neonates to the elderly and cause harm in number of ways. Maintaining healthy skin is important for a healthy body. Many people may develop skin diseases that affect the skin, including cancer, herpes and cellulitis. Some wild plants and their parts are frequently used to treat these diseases. The use of plants is as old as the mankind. Natural treatment is cheap and claimed to be safe. It is also suitable raw material for production of new synthetic agents. A review of some plants for the treatment of skin diseases is provided that summarizes the recent technical advancements that have taken place in this area during the past 17 years. PMID:24600196

  15. The Microbiota of the Human Skin.

    Science.gov (United States)

    Egert, Markus; Simmering, Rainer

    2016-01-01

    The aim of this chapter is to sum up important progress in the field of human skin microbiota research that was achieved over the last years.The human skin is one of the largest and most versatile organs of the human body. Owing to its function as a protective interface between the largely sterile interior of the human body and the highly microbially contaminated outer environment, it is densely colonized with a diverse and active microbiota. This skin microbiota is of high importance for human health and well-being. It is implicated in several severe skin diseases and plays a major role in wound infections. Many less severe, but negatively perceived cosmetic skin phenomena are linked with skin microbes, too. In addition, skin microorganisms, in particular on the human hands, are crucial for the field of hygiene research. Notably, apart from being only a potential source of disease and contamination, the skin microbiota also contributes to the protective functions of the human skin in many ways. Finally, the analysis of structure and function of the human skin microbiota is interesting from a basic, evolutionary perspective on human microbe interactions.Key questions in the field of skin microbiota research deal with (a) a deeper understanding of the structure (species inventory) and function (physiology) of the healthy human skin microbiota in space and time, (b) the distinction of resident and transient skin microbiota members, (c) the distinction of beneficial skin microorganisms from microorganisms or communities with an adverse or sickening effect on their hosts, (d) factors shaping the skin microbiota and its functional role in health and disease, (e) strategies to manipulate the skin microbiota for therapeutic reasons.

  16. Quantitative assessment of combination bathing and moisturizing regimens on skin hydration in atopic dermatitis.

    Science.gov (United States)

    Chiang, Charles; Eichenfield, Lawrence F

    2009-01-01

    Standard recommendations for skin care for patients with atopic dermatitis stress the importance of skin hydration and the application of moisturizers. However, objective data to guide recommendations regarding the optimal practice methods of bathing and emollient application are scarce. This study quantified cutaneous hydration status after various combination bathing and moisturizing regimens. Four bathing/moisturizer regimens were evaluated in 10 subjects, five pediatric subjects with atopic dermatitis and five subjects with healthy skin. The regimens consisted of bathing alone without emollient application, bathing and immediate emollient application, bathing and delayed application, and emollient application alone. Each regimen was evaluated in all subjects, utilizing a crossover design. Skin hydration was assessed with standard capacitance measurements. In atopic dermatitis subjects, emollient alone yielded a significantly (p hydration over 90 minutes (206.2% baseline hydration) than bathing with immediate emollient (141.6%), bathing and delayed emollient (141%), and bathing alone (91.4%). The combination bathing and emollient application regimens demonstrated hydration values at 90 minutes not significantly greater than baseline. Atopic dermatitis subjects had a decreased mean hydration benefit compared with normal skin subjects. Bathing without moisturizer may compromise skin hydration. Bathing followed by moisturizer application provides modest hydration benefits, though less than that of simply applying moisturizer alone.

  17. Effects of water activity and low molecular weight humectants on skin permeability and hydration dynamics - a double-blind, randomized and controlled study.

    Science.gov (United States)

    Albèr, C; Buraczewska-Norin, I; Kocherbitov, V; Saleem, S; Lodén, M; Engblom, J

    2014-10-01

    The mammalian skin is a barrier that effectively separates the water-rich interior of the body from the normally dryer exterior. Changes in the external conditions, for example ambient humidity, have been shown to affect the skin barrier properties. The prime objective of this study was to evaluate the effect of water activity of a topical formulation on skin hydration and permeability. A second objective was to gain more understanding on how two commonly used humectants, urea and glycerol, affect skin barrier function in vivo. Simple aqueous formulations were applied under occlusion to the volar forearm of healthy volunteers. Following 4-h exposure, skin water loss (by transepidermal water loss measurements), skin hydration (by Corneometry) and skin permeability (by time to vasodilation due to benzyl nicotinate exposure) were monitored. The results demonstrate that a relatively small change in the water activity of a topical formulation is sufficient to induce considerable effects on stratum corneum hydration and permeability to exogenous substances. Exposing the skin to high water activity leads to increased skin hydration and also increased permeability. Furthermore, urea and glycerol promote skin hydration and permeability even at reduced water activity of the applied formulation. These results highlight the importance of considering the water activity in topically applied formulations and the potential benefit of using humectants. The results may impact formulation optimization in how to facilitate skin hydration and to modify skin permeability by temporarily open and close the skin barrier. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  18. Multiphoton STED and FRET in human skin: Resolving the skin barrier

    DEFF Research Database (Denmark)

    Antonescu, Irina; Dreier, Jes; Brewer, Jonathan R.

    intercellular spaces. Characterization of the structural and dynamical processes occurring across the skin barrier is essential for understanding healthy and diseased skin and for designing successful transdermal drug delivery strategies. In this study we use Stimulated emission depletion (STED), two photon...

  19. Image analysis of skin color heterogeneity focusing on skin chromophores and the age-related changes in facial skin.

    Science.gov (United States)

    Kikuchi, Kumiko; Masuda, Yuji; Yamashita, Toyonobu; Kawai, Eriko; Hirao, Tetsuji

    2015-05-01

    Heterogeneity with respect to skin color tone is one of the key factors in visual perception of facial attractiveness and age. However, there have been few studies on quantitative analyses of the color heterogeneity of facial skin. The purpose of this study was to develop image evaluation methods for skin color heterogeneity focusing on skin chromophores and then characterize ethnic differences and age-related changes. A facial imaging system equipped with an illumination unit and a high-resolution digital camera was used to develop image evaluation methods for skin color heterogeneity. First, melanin and/or hemoglobin images were obtained using pigment-specific image-processing techniques, which involved conversion from Commission Internationale de l'Eclairage XYZ color values to melanin and/or hemoglobin indexes as measures of their contents. Second, a spatial frequency analysis with threshold settings was applied to the individual images. Cheek skin images of 194 healthy Asian and Caucasian female subjects were acquired using the imaging system. Applying this methodology, the skin color heterogeneity of Asian and Caucasian faces was characterized. The proposed pigment-specific image-processing techniques allowed visual discrimination of skin redness from skin pigmentation. In the heterogeneity analyses of cheek skin color, age-related changes in melanin were clearly detected in Asian and Caucasian skin. Furthermore, it was found that the heterogeneity indexes of hemoglobin were significantly higher in Caucasian skin than in Asian skin. We have developed evaluation methods for skin color heterogeneity by image analyses based on the major chromophores, melanin and hemoglobin, with special reference to their size. This methodology focusing on skin color heterogeneity should be useful for better understanding of aging and ethnic differences. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Ultrastructural changes in human skin after exposure to a pulsed laser

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, H.; Tan, O.T.; Parrish, J.A.

    1985-05-01

    Selective vascular injury following irradiation using a pulsed laser source at 577 nm was examined using ultrastructural methods in the skin of 3 fair-skinned healthy human volunteers. This vascular-specific damage was confined to the papillary dermis. Red blood cells were altered in several ways. As well as an increase in the electron density, configurational distortion modified the normal biconcave forms to ameboid structures. The most interesting finding was the appearance within these altered cells of well-defined circular/oval electron-lucent areas of 800 A diameter, possibly representing a heat-fixed record of steam formation within the red blood cell. In addition, considerable degenerative changes were evident in endothelial cells and pericytes, while mast cells, neutrophils, histiocytes, and fibroblasts as well as collagen bundles immediately surrounding most laser-damaged blood vessels appeared normal.

  1. Healthy Weight

    Science.gov (United States)

    ... such diets limit your nutritional intake, can be unhealthy, and tend to fail in the long run. The key to achieving and maintaining a healthy weight isn't about short-term dietary changes. It's about a lifestyle that includes healthy eating, regular physical activity, and ...

  2. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  3. Matching the skin barrier to the skin type.

    Science.gov (United States)

    Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia

    Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.

  4. Skin Pigmentation Disorders

    Science.gov (United States)

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  5. Skin Cancer Foundation

    Science.gov (United States)

    ... Host a Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the ... Handbook A "Sunscreen Gene"? Skin Cancer Facts & Statistics Skin Cancer Treatment Glossary Information on medications and procedures ...

  6. Skin Cancer Treatment

    Science.gov (United States)

    ... Unusual Cancers of Childhood Treatment Genetics of Skin Cancer Skin color and being exposed to sunlight can increase ... is based on the type of nonmelanoma skin cancer or other skin condition diagnosed: Basal cell carcinoma Enlarge Basal cell ...

  7. Stages of Skin Cancer

    Science.gov (United States)

    ... Unusual Cancers of Childhood Treatment Genetics of Skin Cancer Skin color and being exposed to sunlight can increase ... is based on the type of nonmelanoma skin cancer or other skin condition diagnosed: Basal cell carcinoma Enlarge Basal cell ...

  8. Skin temperature during sunbathing--relevance for skin cancer

    DEFF Research Database (Denmark)

    Petersen, Bibi; Philipsen, Peter Alshede; Wulf, Hans Christian

    2014-01-01

    It has been found that exposure to heat and infrared radiation (IR) can be carcinogenic, and that a combination of ultraviolet radiation (UVR) and IR possibly amplifies carcinogenesis. To investigate how the skin temperature is affected by sunbathing, we measured the skin temperature on 20 healthy...... volunteers over 6 days' sun holiday in Egypt. Temperatures were measured with an infrared thermometer gun at 8 skin sites on the volunteers while they were indoors in the morning and when sunbathing during the day. Skin temperatures were higher during sunbathing (33.5 °C ± 2.1 °C) (mean ± SD) than when...... indoors in the morning (32.6 °C ± 1.4 °C) (mean ± SD) (P skin temperature for men was higher than for women by 0.40 °C in the morning (P = 0.02) and by 0.44 °C during sunbathing (P skin temperature, which possibly...

  9. Bacterial skin flora of diabetic patients in the Jos University Teaching ...

    African Journals Online (AJOL)

    Diabetics frequently are afflicted with bacterial skin infections because of the high circulating blood sugar. The frequent skin infections in these patients may be a result of change in normal skin flora. This study was carried out to find out the normal skin flora of these patients. Ninety four (50 study and 44 control) consecutive ...

  10. Laser Doppler line scanner for monitoring skin perfusion changes of port wine stains during vascular-targeted photodynamic therapy

    Science.gov (United States)

    Chen, Defu; Ren, Jie; Wang, Ying; Gu, Ying

    2014-11-01

    Vascular-targeted photodynamic therapy (V-PDT) is known to be an effective therapeutic modality for the treatment of port wine stains (PWS). Monitoring the PWS microvascular response to the V-PDT is crucial for improving the effectiveness of PWS treatment. The objective of this study was to use laser Doppler technique to directly assess the skin perfusion in PWS before and during V-PDT. In this study, 30 patients with PWS were treated with V-PDT. A commercially laser Doppler line scanner (LDLS) was used to record the skin perfusion of PWS immediately before; and at 1, 3, 5, 7, 10, 15 and 20 minutes during V-PDT treatment. Our results showed that there was substantial inter- and intra-patient perfusion heterogeneity in PWS lesion. Before V-PDT, the comparison of skin perfusion in PWS and contralateral healthy control normal skin indicated that PWS skin perfusion could be larger than, or occasionally equivalent to, that of control normal skin. During V-PDT, the skin perfusion in PWS significantly increased after the initiation of V-PDT treatment, then reached a peak within 10 minutes, followed by a slowly decrease to a relatively lower level. Furthermore, the time for reaching peak and the subsequent magnitude of decrease in skin perfusion varied with different patients, as well as different PWS lesion locations. In conclusion, the LDLS system is capable of assessing skin perfusion changes in PWS during V-PDT, and has potential for elucidating the mechanisms of PWS microvascular response to V-PDT.

  11. Personnel decontamination and preventive skin care

    International Nuclear Information System (INIS)

    Henning, Klaus; Gojowczyk, Peter

    2010-01-01

    Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)

  12. Electrolytically generated hydrogen warm water cleanses the keratin-plug-clogged hair-pores and promotes the capillary blood-streams, more markedly than normal warm water does

    Directory of Open Access Journals (Sweden)

    Yoshiharu Tanaka

    2018-01-01

    Full Text Available Biomedical properties of hydrogen water have been extensively investigated, but the effect of hydrogen on good healthy subjects remains unclear. This study was designed to explore the hygiene improvement by electrolytically generated hydrogen warm water (40°C on capillary blood streams, skin moisture, and keratin plugs in skin pores in normal good healthy subjects with their informed consents. Fingertip-capillary blood stream was estimated after hand-immersing in hydrogen warm water by videography using a CCD-based microscope, and the blood flow levels increased to about 120% versus normal warm water, after 60 minutes of the hand-immersing termination. Skin moisture of subjects was assessed using an electro-conductivity-based skin moisture meter. Immediately after taking a bath filled with hydrogen warm water, the skin moisture increased by 5–10% as compared to before bathing, which was kept on for the 7-day test, but indistinct, because of lower solubility of hydrogen in “warm” water than in room-temperature water. Cleansing of keratin plugs in skin-pores was assessed by stereoscopic microscopy and scanning electron microscopy. After hydrogen warm water bathing, the numbers of cleansed keratin plugs also increased on cheek of subjects 2.30- to 4.47-fold as many as the control for normal warm water. And areas of cleansed keratin plugs in the cheeks increased about 1.3-fold as much as the control. More marked improvements were observed on cheeks than on nostrils. Hydrogen warm water may thoroughly cleanse even keratin-plugs of residual amounts that could not be cleansed by normal warm water, through its permeability into wide-ranged portions of hair-pores, and promote the fingertip blood streams more markedly than merely through warmness due to normal warm water.

  13. Nanocarriers for skin delivery of cosmetic antioxidants

    Directory of Open Access Journals (Sweden)

    Lucia Montenegro

    2014-08-01

    Full Text Available The demand of natural skin care products is steadily growing since consumers perceive them as safe. Currently, cosmetic manufacturers are focusing their efforts on developing innovative natural products to address skin-aging signs, thus meeting consumers’ needs of healthy appearance and well-being. To prevent or treat skin aging, topical supplementation with antioxidant is regarded as one of the most promising strategies. However, most antioxidants presently used in skin care formulations show unfavorable physicochemical properties such as excessive lipophilicity or hydrophilicity, chemical instability and poor skin penetration that actively limit their effectiveness after topical application. Therefore, nanocarriers such as liposomes, niosomes, microemulsions and nanoparticles have been widely investigated as delivery systems for antioxidants to improve their beneficial effects in the treatment of skin aging. In this article, the antioxidants most commonly used in anti-aging cosmetic products will be reviewed along with the nanocarriers designed to improve their safety and effectiveness.

  14. Skin barrier disruption by sodium lauryl sulfate-exposure alters the expressions of involucrin, transglutaminase 1, profilaggrin, and kallikreins during the repair phase in human skin in vivo.

    Science.gov (United States)

    Törmä, Hans; Lindberg, Magnus; Berne, Berit

    2008-05-01

    Detergents are skin irritants affecting keratinocytes. In this study, healthy volunteers were exposed to water (vehicle) and 1% sodium lauryl sulfate (SLS) under occlusive patch tests for 24 hours. The messenger RNA (mRNA) expression of keratinocyte differentiation markers and of enzymes involved in corneodesmosome degradation was examined in skin biopsies (n=8) during the repair phase (6 hours to 7 days postexposure) using real-time reverse-transcription PCR. It was found that the expression of involucrin was increased at 6 hours, but then rapidly normalized. The expression of transglutaminase 1 exhibited a twofold increase after 24 hours in the SLS-exposed skin. Profilaggrin was decreased after 6 hours. Later (4-7 days), the expression in SLS-exposed areas was >50% above than in control areas. An increased and altered immunofluorescence pattern of involucrin, transglutaminase 1, and filaggrin was also found (n=4). At 6 hours post-SLS exposure, the mRNA expression of kallikrein-7 (KLK-7) and kallikrein-5 (KLK-5) was decreased by 50 and 75%, respectively, as compared with control and water-exposed areas. Thereafter, the expression pattern of KLK-7 and KLK-5 was normalized. Changes in protein expression of KLK-5 were also found. In conclusion, SLS-induced skin barrier defects induce altered mRNA expression of keratinocyte differentiation markers and enzymes degrading corneodesmosomes.

  15. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  16. [Skin hydration and hydrating products].

    Science.gov (United States)

    Duplan, H; Nocera, T

    2018-05-01

    One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.

  17. Systemic antioxidants and skin health.

    Science.gov (United States)

    Nguyen, Gloria; Torres, Abel

    2012-09-01

    Most dermatologists agree that antioxidants help fight free radical damage and can help maintain healthy skin. They do so by affecting intracellular signaling pathways involved in skin damage and protecting against photodamage, as well as preventing wrinkles and inflammation. In today's modern world of the rising nutraceutical industry, many people, in addition to applying topical skin care products, turn to supplementation of the nutrients missing in their diets by taking multivitamins or isolated, man-made nutraceuticals, in what is known as the Inside-Out approach to skin care. However, ingestion of large quantities of isolated, fragmented nutrients can be harmful and is a poor representation of the kind of nutrition that can be obtained from whole food sources. In this comprehensive review, it was found that few studies on oral antioxidants benefiting the skin have been done using whole foods, and that the vast majority of current research is focused on the study of compounds in isolation. However, the public stands to benefit greatly if more research were to be devoted toward the impact that physiologic doses of antioxidants (obtained from fruits, vegetables, and whole grains) can have on skin health, and on health in general.

  18. Histological Study on the Skin of Japanese Flounder Paralichthys olivaceus

    Institute of Scientific and Technical Information of China (English)

    ZHU Jie; ZHANG Xiumei; GAO Tianxiang

    2005-01-01

    Histological development of Japanese flounder Paralichthys olivaceus larval skin and ultrastructural difference of skin between reared normal and malpigmented Japanese flounder were studied with light microscopy (LM) and transmission electron microscopy (TEM). The results show that the skin develops slowly before the metamorphosis, while at the onset of metamorphosis, the skin develops quickly and becomes complete in structure till about 50 d after being hatched. Ultrastructural observation on the normal and malpigmented skins shows that the iridophore and melanophore are adjacent to each other. Profile and structure of the two kinds of pigment cells are more complete in the skin of normal ocular side than in the skin of pigmented blind side. The ultrastructure of typical chloride cell was observed in the skin of Japanese flounder larvae for the first time.

  19. Healthy Places

    Centers for Disease Control (CDC) Podcasts

    Every person has a stake in environmental public health. As the environment deteriorates, so does the physical and mental health of the people within it. Healthy places are those designed and built to improve the quality of life for all people who live, work, worship, learn, and play within their borders -- where every person is free to make choices amid a variety of healthy, available, accessible, and affordable options. The CDC recognizes significant health issues and places that are vital in developing the Healthy Places program and provides examples in this report.

  20. Focal skin defect, limb anomalies and microphthalmia.

    NARCIS (Netherlands)

    Jackson, K.E.; Andersson, H.C.

    2004-01-01

    We describe two unrelated female patients with congenital single focal skin defects, unilateral microphthalmia and limb anomalies. Growth and psychomotor development were normal and no brain malformation was detected. Although eye and limb anomalies are commonly associated, clinical anophthalmia and

  1. Healthy Schools

    Science.gov (United States)

    ... Nutrition Facts School Meals Smart Snacks Celebrations & Rewards Food and Beverage Marketing Water Access Healthy Eating Learning Opportunities Staff ... Services Acute & Emergency Care Care Coordination Chronic Disease Management Family Engagement Chronic ... Allergies Oral Health Local School Wellness Policy Whole ...

  2. Use of high-frequency ultrasonography for evaluation of skin thickness in relation to hydration status and fluid distribution at various cutaneous sites in dogs.

    Science.gov (United States)

    Diana, Alessia; Guglielmini, Carlo; Fracassi, Federico; Pietra, Marco; Balletti, Erika; Cipone, Mario

    2008-09-01

    To assess the usefulness of high-frequency diagnostic ultrasonography for evaluation of changes of skin thickness in relation to hydration status and fluid distribution at various cutaneous sites in dogs. 10 clinically normal adult dogs (6 males and 4 females) of various breeds. Ultrasonographic examination of the skin was performed before and after hydration via IV administration of an isotonic crystalloid solution (30 mL/kg/h for 30 minutes). A 13-MHz linear-array transducer was used to obtain series of ultrasonographic images at 4 different cutaneous sites (the frontal, sacral, flank, and metatarsal regions). Weight and various clinicopathologic variables (PCV; serum osmolality; and serum total protein, albumin, and sodium concentrations) were determined before and after the infusion. These variables and ultrasonographic measurements of skin thickness before and after hydration were compared. Among the 10 dogs, mean preinfusion skin thickness ranged from 2,211 microm (metatarsal region) to 3,249 microm (sacral region). Compared with preinfusion values, weight was significantly increased, whereas PCV; serum osmolality; and serum total protein, albumin, and sodium concentrations were significantly decreased after infusion. After infusion, dermal echogenicity decreased and skin thickness increased significantly by 21%, 14%, 15%, and 13% in the frontal, sacral, flank, and metatarsal regions, respectively. Cutaneous site and hydration were correlated with cutaneous characteristics and skin thickness determined by use of high-frequency ultrasonography in dogs. Thus, diagnostic ultrasonography may be a useful tool for the noninvasive evaluation of skin hydration in healthy dogs and in dogs with skin edema.

  3. In vivo skin penetration of macromolecules in irritant contact dermatitis.

    Science.gov (United States)

    Abdel-Mottaleb, Mona M A; Lamprecht, Alf

    2016-12-30

    Recently, a selective preferential accumulation of polymeric nanoparticles (in the size range around 100nm) has been observed in the follicular system of dermatitis skin. The present investigation aimed at clearly investigating the effect of irritant contact dermatitis on the barrier permeability for colloidal systems below this size range, namely quantum dots and hydrophilic macromolecules. Irritant dermatitis was induced in mice and the penetrability of quantum dots (5nm) and hydrophilic dextran molecules has been tracked in both healthy and inflamed skin using confocal laser scanning microscopy. The selective accumulation of the quantum dots was clearly observed in inflamed skin while hydrophilic dextran behaved similarly in both healthy and inflamed skin. The therapeutic potential for the transdermal delivery of peptide drugs through inflamed skin has been also tested in rats. Results revealed that the transdermal permeation of insulin and calcitonin was not significantly enhanced in dermatitis compared to healthy skin. On the other side, permeation through stripped skin was significantly higher. However, the effect was limited and shorter compared to the SC injection where t min was 0.5h and 2h with a 70% and 46% reduction in blood glucose levels for the stripped skin and the SC injection respectively. Similarly, t min was 4h and 8h with area under the curve of 161±65% and 350±97% for the stripped skin and the SC injection respectively. In conclusion, the changes in skin permeability accompanied with skin inflammation did not affect its permeability to peptide drugs. Our findings also underline that experiments with the tape stripped skin model as a surrogate for inflamed skin can risk misleading conclusions due to significant difference of skin permeability between the tape stripped skin and inflamed skin. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Skin deposits in hereditary cystatin C amyloidosis

    DEFF Research Database (Denmark)

    Benedikz, Eirikur; Blöndal, H; Gudmundsson, G

    1990-01-01

    Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker...

  5. My Skin – a self-questionnaire for assessment of the emotional-cognitive representation of skin

    Directory of Open Access Journals (Sweden)

    Marlena M. Kossakowska

    2016-02-01

    Full Text Available Background The aims of this paper are: 1 to present the My Skin questionnaire, 2 to report the preliminary results of a study on the emotional-cognitive skin representation, and 3 to encourage dermatologists and other specialists to use the My Skin questionnaire in their research. The inspiration for a new tool measuring the emotional and cognitive representation of skin was the psychological conception of the ‘skin ego’. Participants and procedure My Skin, a self-questionnaire (MSQ, was used to measure the emotional and cognitive representation of an individual’s skin. It consists of two main scales: satisfaction with the skin condition (AB and awareness of the biopsychosocial functions of the skin (C. The Body Esteem Scale, Body Self Questionnaire and Self-Esteem Scale were used to validate the MSQ. The participants were: healthy individuals (n = 343 and dermatology patients (psoriasis, vitiligo, juvenile acne, n = 84. Results The psychometric parameters are presented in this article. The internal consistency reliabilities for subscales are in the range of .75 and .95. This article also presents preliminary basic statistics for the skin representation of dermatology patients and healthy people. Conclusions My Skin questionnaire is a valid tool for assessing cognitive and emotional representation of skin and may be used in psychodermatology and esthetic dermatology to assess satisfaction with and awareness of skin.

  6. Th erapeutic potential of d-Th erapeutic potential of d-δ-tocotrienol rich fraction -tocotrienol rich fraction on excisional skin wounds in diabetic rats

    Directory of Open Access Journals (Sweden)

    Bijo Elsy

    2017-10-01

    Full Text Available Introduction: Long-standing hyperglycemia in addition to many of its associated complications also hampers normal wound healing which may be further aggravated in the presence of infection and oxidative stress. Therefore, antioxidant supplementation appears to be strategically relevant for wound healing. This study is designed to explore the therapeutic potential of d-δ-tocotrienol rich fraction (d-δ-TRF on skin wound healing in both healthy and diabetic rats. Materials and Methods: Diabetes was induced through single subcutaneous injection of alloxan at the dose of 100 mg/kg at hip region. 24 albino rats were divided into four groups; healthy control, diabetic control, healthy treated and diabetic treated. d-δ-TRF was administered to treated groups (200 mg/kg, orally, daily for 3 weeks. Full thickness excisional skin wounds were. Wound area was studied by assessing the morphological, histomorphological and histological features at weekly intervals and biochemical analyses were performed at the end of 3rd week. Results: The findings of present study revealed that d-δ-TRF accelerated the skin wound healing by means of early regeneration of both epidermal and dermal components; enhancement of serum protein synthesis, improvement of antioxidant status, maintenance of glycemic condition and controlling serum creatinine levels in diabetic rats. Conclusion: It is concluded that d-δ-TRF has significant therapeutic potency on the healing of skin wounds in both healthy and diabetics.

  7. Effect of spirulina on the levels of zinc, vitamin E and linoleic acid in the palm skin extracts of people with prolonged exposure to arsenic

    Directory of Open Access Journals (Sweden)

    Mir Misbahuddin

    2013-03-01

    Full Text Available Spirulina, a dietary supplement, improves the symptoms of arsenical palmer keratosis. To understand its mechanism of action, palm skin extracts of moderate palmer arsenical keratosis (n=10, arsenic exposed controls (n=10 and healthy volunteers (n=10 were collected before and after treatment with spirulina powder 10 g/day orally for 12 weeks. The mean (±SD amount of zinc in the palm skin of healthy volunteers was 13.1 ± 5.7 ng/cm2, which was not changed significantly in patients (11.3 ± 5.3 ng/cm2. The amount of vitamin E in healthy volunteers was 6.0 ± 0.3 ng/cm2 which was severely reduced in patients (3.5 ± 0.6 ng/cm2. The amount of linoleic acid was lowered in patient (26.7 ± 17.1 ng/cm2 which was statistically significant in comparison to healthy volunteers (p=0.029. After supplementation of spirulina, zinc level in the palm skin of arsenic exposed controls was increased but it was not statistically significant (p=0.068. The vitamin E and linoleic acid levels were not changed significantly in the skin of palm. In conclusion, arsenical keratosis showed significantly low levels of vitamin E and linoleic acid without any significant change in zinc level. After supplementation of spirulina, low levels of these three compounds were not returned towards the normal levels.

  8. Structure, function and diversity of the healthy human microbiome.

    Science.gov (United States)

    2012-06-13

    Studies of the human microbiome have revealed that even healthy individuals differ remarkably in the microbes that occupy habitats such as the gut, skin and vagina. Much of this diversity remains unexplained, although diet, environment, host genetics and early microbial exposure have all been implicated. Accordingly, to characterize the ecology of human-associated microbial communities, the Human Microbiome Project has analysed the largest cohort and set of distinct, clinically relevant body habitats so far. We found the diversity and abundance of each habitat's signature microbes to vary widely even among healthy subjects, with strong niche specialization both within and among individuals. The project encountered an estimated 81-99% of the genera, enzyme families and community configurations occupied by the healthy Western microbiome. Metagenomic carriage of metabolic pathways was stable among individuals despite variation in community structure, and ethnic/racial background proved to be one of the strongest associations of both pathways and microbes with clinical metadata. These results thus delineate the range of structural and functional configurations normal in the microbial communities of a healthy population, enabling future characterization of the epidemiology, ecology and translational applications of the human microbiome.

  9. Anyone Can Get Skin Cancer

    Science.gov (United States)

    ... of Skin Cancer Skin Cancer Screening Research Anyone Can Get Skin Cancer Order the free Anyone Can ... rarely, younger children can develop skin cancer. How can people with dark skin get skin cancer? Although ...

  10. Antimicrobials from human skin commensal bacteria protect against Staphylococcus aureus and are deficient in atopic dermatitis

    Science.gov (United States)

    Nakatsuji, Teruaki; Chen, Tiffany H.; Narala, Saisindhu; Chun, Kimberly A.; Two, Aimee M.; Yun, Tong; Shafiq, Faiza; Kotol, Paul F.; Bouslimani, Amina; Melnik, Alexey V.; Latif, Haythem; Kim, Ji-Nu; Lockhart, Alexandre; Artis, Keli; David, Gloria; Taylor, Patricia; Streib, Joanne; Dorrestein, Pieter C.; Grier, Alex; Gill, Steven R.; Zengler, Karsten; Hata, Tissa R.; Leung, Donald Y. M.; Gallo, Richard L.

    2017-01-01

    The microbiome can promote or disrupt human health by influencing both adaptive and innate immune functions. We tested whether bacteria that normally reside on human skin participate in host defense by killing Staphylococcus aureus, a pathogen commonly found in patients with atopic dermatitis (AD) and an important factor that exacerbates this disease. High-throughput screening for antimicrobial activity against S.aureus was performed on isolates of coagulase-negative Staphylococcus (CoNS) collected from the skin of healthy and AD subjects. CoNS strains with antimicrobial activity were common on the normal population but rare on AD subjects. A low frequency of strains with antimicrobial activity correlated with colonization by S.aureus. The antimicrobial activity was identified as previously unknown antimicrobial peptides (AMPs) produced by CoNS species including Staphylococcus epidermidis and Staphylococcus hominis. These AMPs were strain-specific, highly potent, selectively killed S.aureus, and synergized with the human AMP LL-37. Application of these CoNS strains to mice confirmed their defense function in vivo relative to application of nonactive strains. Strikingly, reintroduction of antimicrobial CoNS strains to human subjects with AD decreased colonization by S.aureus. These findings show how commensal skin bacteria protect against pathogens and demonstrate how dysbiosis of the skin microbiome can lead to disease. PMID:28228596

  11. El sol: ¿enemigo de nuestra piel? The sun: enemy of our skin?

    Directory of Open Access Journals (Sweden)

    Moraima Mora Ochoa

    Full Text Available Actualmente existe una elevada mortalidad y morbilidad por cáncer de piel, lo cual representa un grave problema que va en aumento; por tal razón, en el presente estudio se revisó la bibliografía especializada sobre algunos aspectos de interés, tales como: interacción de las radiaciones solares sobre esta parte del organismo, efectos beneficiosos y perjudiciales, respuestas cutáneas normales y anormales, relación entre el cáncer de piel y las radiaciones ultravioletas, así como medidas de protección solar, las cuales permitirán mantener una piel sana y saludable.Currently, there is a high mortality and morbidity due to skin cancer, which represents an increasingly serious problem. Therefore, this study reviewed the specialized literature on some aspects of interest such as interaction of solar radiations on this part of the body, beneficial and harmful effects, normal and abnormal skin responses, relationship between skin cancer and ultraviolet radiations, as well as sun protection measures, which will allow us to maintain a healthy skin.

  12. Interaction between a normal shock wave and a turbulent boundary layer at high transonic speeds. Part 1: Pressure distribution. Part 2: Wall shear stress. Part 3: Simplified formulas for the prediction of surface pressures and skin friction

    Science.gov (United States)

    Adamson, T. C., Jr.; Liou, M. S.; Messiter, A. F.

    1980-01-01

    An asymptotic description is derived for the interaction between a shock wave and a turbulent boundary layer in transonic flow, for a particular limiting case. The dimensionless difference between the external flow velocity and critical sound speed is taken to be much smaller than one, but large in comparison with the dimensionless friction velocity. The basic results are derived for a flat plate, and corrections for longitudinal wall curvature and for flow in a circular pipe are also shown. Solutions are given for the wall pressure distribution and the shape of the shock wave. Solutions for the wall shear stress are obtained, and a criterion for incipient separation is derived. Simplified solutions for both the wall pressure and skin friction distributions in the interaction region are given. These results are presented in a form suitable for use in computer programs.

  13. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    Science.gov (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  14. Healthy Places

    Centers for Disease Control (CDC) Podcasts

    2007-04-10

    Every person has a stake in environmental public health. As the environment deteriorates, so does the physical and mental health of the people within it. Healthy places are those designed and built to improve the quality of life for all people who live, work, worship, learn, and play within their borders -- where every person is free to make choices amid a variety of healthy, available, accessible, and affordable options. The CDC recognizes significant health issues and places that are vital in developing the Healthy Places program and provides examples in this report.  Created: 4/10/2007 by CDC National Center for Environmental Health.   Date Released: 4/13/2007.

  15. A novel model of inflammatory pain in human skin involving topical application of sodium lauryl sulfate.

    Science.gov (United States)

    Petersen, L J; Lyngholm, A M; Arendt-Nielsen, L

    2010-09-01

    Sodium lauryl sulfate (SLS) is a known irritant. It releases pro-inflammatory mediators considered pivotal in inflammatory pain. The sensory effects of SLS in the skin remain largely unexplored. In this study, SLS was evaluated for its effect on skin sensory functions. Eight healthy subjects were recruited for this study. Skin sites were randomized to topical SLS 0.25, 0.5, 1, 2% and vehicle for 24 h. Topical capsaicin 1% was applied for 30 min at 24 h after SLS application. Assessments included laser Doppler imaging of local vasodilation and flare reactions, rating of spontaneous pain, assessment of primary thermal and tactile hyperalgesia, and determination of secondary dynamic and static hyperalgesia. SLS induced significant and dose-dependent local inflammation and primary hyperalgesia to tactile and thermal stimulation at 24 h after application, with SLS 2% treatment eliciting results comparable to those observed following treatment with capsaicin 1%. SLS induced no spontaneous pain, small areas of flare, and minimal secondary hyperalgesia. The primary hyperalgesia vanished within 2-3 days, whereas the skin inflammation persisted and was only partly normalized by Day 6. SLS induces profound perturbations of skin sensory functions lasting 2-3 days. SLS-induced inflammation may be a useful model for studying the mechanisms of inflammatory pain.

  16. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  17. Discrimination between basal cell carcinoma and hair follicles in skin tissue sections by Raman micro-spectroscopy

    Science.gov (United States)

    Larraona-Puy, M.; Ghita, A.; Zoladek, A.; Perkins, W.; Varma, S.; Leach, I. H.; Koloydenko, A. A.; Williams, H.; Notingher, I.

    2011-05-01

    Skin cancer is the most common human malignancy and basal cell carcinoma (BCC) represents approximately 80% of the non-melanoma cases. Current methods of treatment require histopathological evaluation of the tissues by qualified personnel. However, this method is subjective and in some cases BCC can be confused with other structures in healthy skin, including hair follicles. In this preliminary study, we investigated the potential of Raman micro-spectroscopy (RMS) to discriminate between hair follicles and BCC in skin tissue sections excised during Mohs micrographic surgery (MMS). Imaging and diagnosis of skin sections was automatically generated using ' a priori'-built spectral model based on LDA. This model had 90 ± 9% sensitivity and 85 ± 9% specificity for discrimination of BCC from dermis and epidermis. The model used selected Raman bands corresponding to the largest spectral differences between the Raman spectra of BCC and the normal skin regions, associated mainly with nucleic acids and collagen type I. Raman spectra corresponding to the epidermis regions of the hair follicles were found to be closer to those of healthy epidermis rather than BCC. Comparison between Raman spectral images and the gold standard haematoxylin and eosin (H&E) histopathology diagnosis showed good agreement. Some hair follicle regions were misclassified as BCC; regions corresponded mainly to the outermost layer of hair follicle (basal cells) which are expected to have higher nucleic acid concentration. This preliminary study shows the ability of RMS to distinguish between BCC and other tissue structures associated to healthy skin which can be confused with BCC due to their similar morphology.

  18. Malware Normalization

    OpenAIRE

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  19. Healthy living

    Science.gov (United States)

    ... living URL of this page: //medlineplus.gov/ency/article/002393.htm Healthy living To use the sharing features on this page, please enable JavaScript. Good health habits can allow you to avoid illness and improve your quality of life. The following steps will help you ...

  20. Skin color - patchy

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003224.htm Skin color - patchy To use the sharing features on this page, please enable JavaScript. Patchy skin color is areas where the skin color is irregular. ...

  1. Histoplasma skin test

    Science.gov (United States)

    Histoplasmosis skin test ... health care provider cleans an area of your skin, usually the forearm. An allergen is injected just below the cleaned skin surface. An allergen is a substance that causes ...

  2. Skin Condition Finder

    Science.gov (United States)

    ... SKIN CONDITIONS HEALTH TOPICS FOR PROFESSIONALS Rash and Skin Condition Finder 1 Select Age Group Infant Child ... Toe Toe Webspace Toe Nail CLOSE About the Skin Condition Finder Have a health question or concern? ...

  3. Skin Complications of IBD

    Science.gov (United States)

    ... Home > Resources > Skin Complications of IBD Go Back Skin Complications of IBD Email Print + Share After arthritis, ... about 5% of people with inflammatory bowel disease. SKIN DISORDERS COMMONLY SEEN IN IBD ERHTHEMA NODOSUM The ...

  4. Skin Peeling Syndrome

    Directory of Open Access Journals (Sweden)

    Sharma Rajeev

    2000-01-01

    Full Text Available Peeling of the skin is an uncommonly encountered disorder. Occurrence of vesicles and bullae in peeling skin syndrome is very rare. We report a case of idiopathic peeling skin syndrome with vesicular lesions.

  5. Histamine response and local cooling in the human skin: involvement of H1- and H2-receptors.

    Science.gov (United States)

    Grossmann, M; Jamieson, M J; Kirch, W

    1999-08-01

    Histamine may contribute locally to cutaneous blood flow control under normal and pathologic conditions. The objective of this study was to observe the influence of skin temperature on histamine vasodilation, and the roles of H1-and H2-receptors using novel noninvasive methods. Eleven healthy subjects received, double-blind, single doses of the H1-receptor antagonist cetirizine (10 mg), cetirizine (10 mg) plus the H2-receptor antagonist cimetidine (400 mg), or placebo on separate occasions. Histamine was dosed cumulatively by iontophoresis to the forearm skin at 34 degrees C and 14 degrees C. Laser-Doppler flux (LDF) was measured at the same sites using customised probeholder/iontophoretic chambers with Peltier cooling elements. Finger mean arterial pressure (MAP) was measured and cutaneous vascular conductance calculated as LDF/MAP. Histamine vasodilation was reduced in cold skin. Cetirizine shifted the histamine dose-response at both temperatures: statistically significantly at 14 degrees C only. Combined H1- and H2-receptor antagonism shifted the response significantly at both temperatures. H1- and H2-receptors mediate histamine-induced skin vasodilation. The sensitivity of these receptors, particularly the H1- receptor, is attenuated at low skin temperature. Whether th