WorldWideScience

Sample records for normal gonadotropin responsiveness

  1. [Serum testosterone response to chorionic gonadotropin (HCG) injection in normal and cryptorchid children (author's transl)].

    Science.gov (United States)

    Fideleff, H L; Baigorri, A M; Guitelman, A; Hollander, T; Villuendas, V; Espínola, B

    1980-01-01

    Plasma testosterone (ng/ml) was measured in a group of prepuberal children with intrascrotal testes (n = 15) and in a group of prepuberal cryptorchid children (7 unilateral and 3 bilateral; n = 10) before and after stimulus with 3000IU of HCG (Group A) and with 5000IU (Group B). The serum testosterone before HCG stimulus was similar in normal (Group A: 1.10 +/- 0.03: Group B: 1.18 +/- 0.31) as well as in those of the cryptorchid children (Group A: 1 +/- 0.28; Group B: 1.19 +/- 0.36). The stimulus with 3000IU of HCG did not significantly raise the plasma testosterone in both normal (2.42 +/- 1.09) and cryptorchid children (1.70 +/- 0.5). The stimulus with 5000IU of HCG increased the plasma testosterone to 3.52 +/- 1 in normal children and 3.26 +/- 1.2 in cryptorchid children (p less than 0.05 with respect to the pre HCG values), with no difference in the response between the normal and the cryptorchid children.

  2. Primary pulmonary choriocarcinoma after human chorionic gonadotropin normalization following hydatidiform mole

    DEFF Research Database (Denmark)

    Maestá, Izildinha; Leite, Fábio Vicente; Michelin, Odair Carlito

    2010-01-01

    BACKGROUND: Primary pulmonary choriocarcinoma (PPC) is rare and frequently leads to death. CASES: Two young patients presented with previous molar pregnancy and spontaneous serum human chorionic gonadotropin (hCG) normalization. Patient 1 was referred to our center after partial response to chemo......BACKGROUND: Primary pulmonary choriocarcinoma (PPC) is rare and frequently leads to death. CASES: Two young patients presented with previous molar pregnancy and spontaneous serum human chorionic gonadotropin (hCG) normalization. Patient 1 was referred to our center after partial response...... 3 years after diagnosis. Patient 2 presented with persistently high hCG, though the affected organ was not identified. Chemotherapy was unsuccessful. Patient reevaluation showed an isolated pulmonary mass. Pulmonary lobectomy was performed; 2 weeks later, hCG was normal and consolidation with 2...

  3. Bone phenotypes in response to gonadotropin misexpression: the role for gonadotropins in postmenopausal osteoporosis

    OpenAIRE

    Mansell, Jason

    2008-01-01

    Jason P MansellDepartment of Oral and Dental Sciences, Division of Oral Medicine, University of Bristol Dental School, Lower Maudlin Street, Bristol, BS1 2LY, UKAbstract: Scant attention has been paid to the potential role of gonadotropins in bone tissue homeostasis. The focus on estrogen and estrogen replacement therapy for osteoporosis as far back as the 1940’s may account for the paucity of gonadotropin studies in bone biology. It is conceivable that prevailing dogma may have sub...

  4. Polymorphisms in gonadotropin and gonadotropin receptor genes as markers of ovarian reserve and response in in vitro fertilization.

    Science.gov (United States)

    La Marca, Antonio; Sighinolfi, Giovanna; Argento, Cindy; Grisendi, Valentina; Casarini, Livio; Volpe, Annibale; Simoni, Manuela

    2013-03-15

    Since gonadotropins are the fundamental hormones that control ovarian activity, genetic polymorphisms may alter gonadal responsiveness to glycoproteins; hence they are important regulators of hormone activity at the target level. The establishment of the pool of primordial follicles takes place during fetal life and is mainly under genetic control. Consequently, single nucleotide polymorphisms (SNPs) in gonadotropins and their receptors do not seem to be associated with any significant modification in the endowment of nongrowing follicles in the ovary. Indeed, the age at menopause, a biological characteristic strongly related to ovarian reserve, as well as markers of functional ovarian reserve such as anti-Müllerian hormone and antral follicle count, are not different in women with different genetic variants. Conversely, some polymorphisms in FSH receptor (FSHR) seem to be associated with modifications in ovarian activity. In particular, studies suggest that the Ser680 genotype for FSHR is a factor of relative resistance to FSH stimulation resulting in slightly higher FSH serum levels, thus leading to a prolonged duration of the menstrual cycle. Moreover, some FSHR gene polymorphisms show a positive association with ovarian response to exogenous gonadotropin administration, hence exhibiting some potential for a pharmacogenetic estimation of the FSH dosage in controlled ovarian stimulation. The study of SNPs of the FSHR gene is an interesting field of research that could provide us with new information about the way each woman responds to exogenous gonadotropin administration during ovulation induction.

  5. Development of gonadotropin-releasing hormone secretion and pituitary response.

    Science.gov (United States)

    Glanowska, Katarzyna M; Burger, Laura L; Moenter, Suzanne M

    2014-11-05

    Acquisition of a mature pattern of gonadotropin-releasing hormone (GnRH) secretion from the CNS is a hallmark of the pubertal process. Little is known about GnRH release during sexual maturation, but it is assumed to be minimal before later stages of puberty. We studied spontaneous GnRH secretion in brain slices from male mice during perinatal and postnatal development using fast-scan cyclic voltammetry (FSCV) to detect directly the oxidation of secreted GnRH. There was good correspondence between the frequency of GnRH release detected by FSCV in the median eminence of slices from adults with previous reports of in vivo luteinizing hormone (LH) pulse frequency. The frequency of GnRH release in the late embryonic stage was surprisingly high, reaching a maximum in newborns and remaining elevated in 1-week-old animals despite low LH levels. Early high-frequency GnRH release was similar in wild-type and kisspeptin knock-out mice indicating that this release is independent of kisspeptin-mediated excitation. In vivo treatment with testosterone or in vitro treatment with gonadotropin-inhibitory hormone (GnIH) reduced GnRH release frequency in slices from 1-week-old mice. RF9, a putative GnIH antagonist, restored GnRH release in slices from testosterone-treated mice, suggesting that testosterone inhibition may be GnIH-dependent. At 2-3 weeks, GnRH release is suppressed before attaining adult patterns. Reduction in early life spontaneous GnRH release frequency coincides with the onset of the ability of exogenous GnRH to induce pituitary LH secretion. These findings suggest that lack of pituitary secretory response, not lack of GnRH release, initially blocks downstream activation of the reproductive system.

  6. The Forkhead Transcription Factor, FOXP3, Is Required for Normal Pituitary Gonadotropin Expression in Mice1

    Science.gov (United States)

    Jung, Deborah O.; Jasurda, Jake S.; Egashira, Noboru; Ellsworth, Buffy S.

    2012-01-01

    ABSTRACT The hypothalamic-pituitary-gonadal axis is central to normal reproductive function. This pathway begins with the release of gonadotropin-releasing hormone in systematic pulses by the hypothalamus. Gonadotropin-releasing hormone is bound by receptors on gonadotroph cells in the anterior pituitary gland and stimulates the synthesis and secretion of luteinizing hormone and, to some extent, follicle-stimulating hormone. Once stimulated by these glycoprotein hormones, the gonads begin gametogenesis and the synthesis of sex hormones. In humans, mutations of the forkhead transcription factor, FOXP3, lead to an autoimmune disorder known as immunodysregulation, polyendocrinopathy, and enteropathy, X-linked syndrome. Mice with a mutation in the Foxp3 gene have a similar autoimmune syndrome and are infertile. To understand why FOXP3 is required for reproductive function, we are investigating the reproductive phenotype of Foxp3 mutant mice (Foxp3sf/Y). Although the gonadotroph cells appear to be intact in Foxp3sf/Y mice, luteinizing hormone beta (Lhb) and follicle-stimulating hormone beta (Fshb) expression are significantly decreased, demonstrating that these mice exhibit a hypogonadotropic hypogonadism. Hypothalamic expression of gonadotropin-releasing hormone is not significantly decreased in Foxp3sf/Y males. Treatment of Foxp3sf/Y males with a gonadotropin-releasing hormone receptor agonist does not rescue expression of Lhb or Fshb. Interestingly, we do not detect Foxp3 expression in the pituitary or hypothalamus, suggesting that the infertility seen in Foxp3sf/Y males is a secondary effect, possibly due to loss of FOXP3 in immune cells. Pituitary expression of glycoprotein hormone alpha (Cga) and prolactin (Prl) are significantly reduced in Foxp3sf/Y males, whereas the precursor for adrenocorticotropic hormone, pro-opiomelanocortin (Pomc), is increased. Human patients diagnosed with IPEX often exhibit thyroiditis due to destruction of the thyroid gland by

  7. Elevation of plasma gonadotropin concentration in response to mammalian gonadotropin releasing hormone (GRH) treatment of the male brown trout as determined by radioimmunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Grim, L.W.; Cluett, D.M.

    1974-01-01

    Rapid increase of the plasma gonadotropin concentration as measured by radioimmunoassay has been demonstrated in response to GRH treatment of the sexually mature male brown trout. Peak gonadotropin values were observed within 15 minutes of GRH treatment, however, the return to baseline values was prolonged compared with the mammalian response. These data support the concept that the brain, operating via releasing hormones, plays a role in the control of pituitary hormone secretion in fish.

  8. Estradiol potentiation of gonadotropin-releasing hormone responsiveness in the anterior pituitary is mediated by an increase in gonadotropin-releasing hormone receptors

    Energy Technology Data Exchange (ETDEWEB)

    Menon, M.; Peegel, H.; Katta, V.

    1985-02-15

    In order to investigate the mechanism by which 17 beta-estradiol potentiates the action of gonadotropin-releasing hormone on the anterior pituitary in vitro, cultured pituitary cells from immature female rats were used as the model system. Cultures exposed to estradiol at concentrations ranging from 10(-10) to 10(-6) mol/L exhibited a significant augmentation of luteinizing hormone release in response to a 4-hour gonadotropin-releasing hormone (10 mumol/L) challenge at a dose of 10(-9) mol/L compared to that of control cultures. The estradiol augmentation of luteinizing hormone release was also dependent on the duration of estradiol exposure. When these cultures were incubated with tritium-labeled L-leucine, an increase in incorporation of radiolabeled amino acid into total proteins greater than that in controls was observed. A parallel stimulatory effect of estradiol on iodine 125-labeled D-Ala6 gonadotropin-releasing hormone binding was observed. Cultures incubated with estradiol at different concentrations and various lengths of time showed a significant increase in gonadotropin-releasing hormone binding capacity and this increase was abrogated by cycloheximide. Analysis of the binding data showed that the increase in gonadotropin-releasing hormone binding activity was due to a change in the number of gonadotropin-releasing hormone binding sites rather than a change in the affinity. These results suggest that (1) estradiol treatment increases the number of pituitary receptors for gonadotropin-releasing hormone, (2) the augmentary effect of estradiol on luteinizing hormone release at the pituitary level might be mediated, at least in part, by the increase in the number of binding sites of gonadotropin-releasing hormone, and (3) new protein synthesis may be involved in estradiol-mediated gonadotropin-releasing hormone receptor induction.

  9. Dual trigger with combination of gonadotropin-releasing hormone agonist and human chorionic gonadotropin significantly improves the live-birth rate for normal responders in GnRH-antagonist cycles

    National Research Council Canada - National Science Library

    Lin, Ming-Huei; Wu, Frank Shao-Ying; Lee, Robert Kuo-Kuang; Li, Sheng-Hsiang; Lin, Shyr-Yeu; Hwu, Yuh-Ming

    2013-01-01

    ...) agonist and human chorionic gonadotropin (hCG) can improve the live-birth rate for normal responders in GnRH-antagonist in vitro fertilization/intracytoplasmic sperm injection (IVF-ICSI) cycles...

  10. Responsiveness of adenylate cyclase to pituitary gonadotropins and evidence of a hormone-induced desensitization in the lizard ovary.

    Science.gov (United States)

    Borrelli, L; De Stasio, R; Bovenzi, V; Parisi, E; Filosa, S

    1997-07-01

    Gonadotropins (FSH and LH) affect several mammalian gonadal functions. In particular, FSH stimulates oogonial proliferation and oocyte growth, while LH regulates ovulation and progesterone secretion. In lacertilian reptiles, gonadal function is also regulated by pituitary gonadotropins, but which hormone controls ovarian activities and the mechanisms of action are unknown. The present study aimed to clarify mechanisms of action of pituitary gonadotropins on the ovary of Podarcis sicula (Lacertilia). The data demonstrate that mammalian gonadotropins FSH and LH produce a threefold stimulation of adenylate cyclase activity in follicular membranes, while hCG and TSH are less effective, causing a twofold increase in adenylate cyclase activity. Neurotransmitters such as dopamine, serotonin, and catecholamines have no effect on enzyme activity. The action of mammalian FSH and LH on the ovary mimics the effect of homologous hormones: in lizard ovaries incubated in vitro in the presence of isolated homologous pituitary glands, the intracellular cAMP level increased by 50% with respect to control ovaries. Mammalian gonadotropins appear homologous to lizard gonadotropin(s): Southern blot analyses show that the lizard genome contains nucleotide sequences homologous to those encoding for mammalian beta FSH and beta LH. Both homologous and heterologous desensitization of adenylate cyclase activity occurs in the lizard ovary. In fact, responsiveness of adenylate cyclase to gonadotropin stimulation is abolished in animals 2 hr after in vivo treatment with FSH. Sensitivity to gonadotropin stimulation is restored 2 weeks after the beginning of the in vivo treatment. Desensitization was also observed in ovaries incubated in vitro with mammalian FSH or with isolated pituitary glands.

  11. Adult height in short normal girls treated with gonadotropin-releasing hormone analogs and growth hormone.

    Science.gov (United States)

    Pasquino, A M; Pucarelli, I; Roggini, M; Segni, M

    2000-02-01

    Combined treatment with GH and GnRH analogs (GnRHa) has been proposed to improve final adult height in true precocious puberty, GH deficiency, and short normal subjects with early or normal timing of puberty with still controversial results. We treated 12 girls with idiopathic short stature and normal or early puberty with GH and GnRHa and followed them to adult height; 12 girls comparable for auxological and laboratory characteristics treated with GH alone served to better evaluate the efficacy of addition of GnRHa. At the start of combined treatment, the chronological age of the girls (CA; mean +/- SD) was 10.2 +/- 0.9 yr, bone age (BA) was 10.6 +/- 1.9 yr, height SD score for BA was - 1.81 +/- 0.8, PAH was 146.3 +/- 5.0 cm. PAH was significantly lower than target height (TH 152.7 +/- 3.6 cm; P < 0.005). GH was given at a dose of 0.3 mg/kg x week, sc, 6 days weekly, and GnRHa (depot-triptorelin) was given at a dose of 100 microg/kg every 21 days, im. The 12 girls were treated with GH alone at the same dose; at the start of therapy their CA was 10.7 +/- 1.0, BA was 10.1 +/- 1.4 yr, height SD score for BA was - 1.65 +/- 0.8, PAH was 145.6 +/- 4.4 cm, and TH was 155.8 +/- 4.6 cm. Pubertal Tanner stage in both groups was B2P2 or B3P3. LHRH test and pelvic ultrasound showed the beginning of puberty. The GH response to standard provocative tests was 10 g/L or more. The mean period of treatment was 4.6 +/- 1.7 yr in the group treated with GH plus GnRHa and 4.9 +/- 1.4 yr in the group treated with GH alone; both groups discontinued treatment at comparable CA and BA. Adult height was considered to be attained when growth during the preceding year was less than 1 cm, with a BA of over 15 yr. Patients in the group treated with GH plus GnRHa showed an adult height significantly higher (P < 0.001) than the pretreatment PAH (156.3 +/- 5.9 vs. 146.3 +/- 5 cm); the gain in centimeters calculated between pretreatment PAH and adult height was 10 +/- 2.9 cm, and 7 of 12 girls had a

  12. Serum testosterone and gonadotropins levels in patients with premature ejaculation: A comparison with normal men

    Directory of Open Access Journals (Sweden)

    Mohammad G Mohseni

    2014-01-01

    Conclusion: Patients with PE have higher FT and FSH levels compared with normal men. The causative relationship between these entities and also the clinical importance of this finding has to be determined by more comprehensive studies.

  13. Serotoninergic involvement in gonadotropin and TSH secretion in normal cycling and postmenopausal women.

    Science.gov (United States)

    Krause, B T; Möller, S; Schmeisser, J O

    1998-01-01

    We investigated the influence of a specific serotonin receptor blockade on pituitary hormone secretion in normal cycling women and postmenopausal women not receiving hormone replacement therapy. Serotonin receptor blockade was performed by using the HT-3 receptor subtype antagonist ondansetron as an i.v. bolus injection of 8 mg. Blood samples were taken before as well as 20, 30 and 40 min after ondansetron administration for the estimation of LH, FSH, and TSH. We could not find any hormonal changes in the normal cycling women. The postmenopausal women showed a significant decline in LH secretion, whereas FSH and TSH levels remained unchanged. Our results suggest serotoninergic involvement in LH secretion in postmenopausal hypoestrogenic hypergonadism.

  14. Serum testosterone and gonadotropins levels in patients with premature ejaculation: A comparison with normal men

    Science.gov (United States)

    Mohseni, Mohammad G.; Hosseini, Seyed Reza; Alizadeh, Farshid; Rangzan, Nazir

    2014-01-01

    Background: To investigate the role of testosterone (T) in the pathogenesis of ejaculatory symptoms, particularly premature ejaculation (PE). Materials and Methods: A total of 41 male patients with PE as well as 41 controls with no sexual dysfunction were recruited in this cross-sectional study. We used the stopwatch measurement to monitor the intravaginal ejaculatory latency time (IELT). Patients with mean IELT values lower than 60 s were considered to have PE. Serum levels of follicle stimulating hormone (FSH), luteinizing hormone (LH), prolactin (PRL), total testosterone (TT) and free testosterone (FT) were measured in patients as well as controls. Patients with thyroid dysfunction, hypogonadism, hypertension and dyslipidemia were excluded from the study. Results: The serum levels of FT and FSH were significantly higher in cases (P = 0.036 and 0.003, respectively). There was no significant difference between TT, LH and PRL levels of the two groups. Conclusion: Patients with PE have higher FT and FSH levels compared with normal men. The causative relationship between these entities and also the clinical importance of this finding has to be determined by more comprehensive studies. PMID:24592360

  15. Ovarian Hyper-Response to Administration of an GnRH-Agonist Without Gonadotropins

    OpenAIRE

    Park, Hyun Tae; Bae, Hyo Sook; Kim, Tak; Kim, Sun Haeng

    2011-01-01

    Several case reports have indicated that a small subgroup of patients may develop ovarian hyperstimulation following the administration of gonadotropin-releasing hormone agonists (GnRHa) without gonadotropins. However, since only few such cases have been published, it is unclear what course to follow in subsequent cycles after ovarian hyperstimulation in the first cycle using only GnRHa. A 33-yr-old woman was referred to in vitro fertilization for oocyte donation. A depot preparation (3.75 mg...

  16. Chorionic gonadotropin and its receptor are both expressed in human retina, possible implications in normal and pathological conditions.

    Directory of Open Access Journals (Sweden)

    Sladjana Dukic-Stefanovic

    Full Text Available Extra-gonadal role of gonadotropins has been re-evaluated over the last 20 years. In addition to pituitary secretion of luteinizing hormone (LH and follicle stimulating hormone (FSH, the CNS has been clearly identified as a source of hCG acting locally to influence behaviour. Here we demonstrated that human retina is producing this gonadotropin that acts as a neuroactive molecule. Müller glial and retinal pigmented epithelial (RPE cells are producing hCG that may affects neighbour cells expressing its receptor, namely cone photoreceptors. It was previously described that amacrine and retinal ganglion (RGC cells are targets of the gonadotropin releasing hormone that control the secretion of all gonadotropins. Therefore our findings suggest that a complex neuroendocrine circuit exists in the retina, involving hCG secreting cells (glial and RPE, hCG targets (photoreceptors and hCG-release controlling cells (amacrine and RGC. The exact physiological functions of this circuit have still to be identified, but the proliferation of photoreceptor-derived tumor induced by hCG demonstrated the need to control this neuroendocrine loop.

  17. Dual trigger with combination of gonadotropin-releasing hormone agonist and human chorionic gonadotropin significantly improves the live-birth rate for normal responders in GnRH-antagonist cycles.

    Science.gov (United States)

    Lin, Ming-Huei; Wu, Frank Shao-Ying; Lee, Robert Kuo-Kuang; Li, Sheng-Hsiang; Lin, Shyr-Yeu; Hwu, Yuh-Ming

    2013-11-01

    To investigate whether dual triggering of final oocyte maturation with a combination of gonadotropin-releasing hormone (GnRH) agonist and human chorionic gonadotropin (hCG) can improve the live-birth rate for normal responders in GnRH-antagonist in vitro fertilization/intracytoplasmic sperm injection (IVF-ICSI) cycles. Retrospective cohort study. Infertility unit of a university-affiliated medical center. Normal responders to controlled ovarian hyperstimulation who were undergoing IVF-ICSI with a GnRH antagonist protocol. Standard dosage of hCG trigger (6,500 IU of recombinant hCG) versus dual trigger (0.2 mg of triptorelin and 6,500 IU of recombinant hCG). Live-birth, clinical pregnancy, and implantation rates per cycle. A total of 376 patients with 378 completed cycles with embryo transfer were enrolled (hCG trigger/control group: n = 187; dual trigger/study group: n = 191). The dual trigger group demonstrated statistically significantly higher implantation (29.6% vs. 18.4%), clinical pregnancy (50.7% vs. 40.1%), and live-birth (41.3% vs. 30.4%) rates as compared with the hCG trigger group. There was no statistically significant difference in terms of patient demographics, cycle parameters, or embryo quality. Dual trigger of final oocyte maturation with a GnRH-agonist and a standard dosage of hCG in normal responders statistically significantly improves implantation, clinical pregnancy, and live-birth rates in GnRH-antagonist IVF cycles. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  18. Mutations of gonadotropins and gonadotropin receptors: elucidating the physiology and pathophysiology of pituitary-gonadal function

    NARCIS (Netherlands)

    I.T. Huhtaniemi; A.P.N. Themmen (Axel)

    2000-01-01

    textabstractThe recent unraveling of structures of genes for the gonadotropin subunits and gonadotropin receptors has provided reproductive endocrinologists with new tools to study normal and pathological functions of the hypothalamic-pituitary-gonadal axis. Rare inacti

  19. Mutations of gonadotropins and gonadotropin receptors: elucidating the physiology and pathophysiology of pituitary-gonadal function

    NARCIS (Netherlands)

    I.T. Huhtaniemi; A.P.N. Themmen (Axel)

    2000-01-01

    textabstractThe recent unraveling of structures of genes for the gonadotropin subunits and gonadotropin receptors has provided reproductive endocrinologists with new tools to study normal and pathological functions of the hypothalamic-pituitary-gonadal axis. Rare

  20. Assessing the adequacy of gonadotropin-releasing hormone agonist leuprolide to trigger oocyte maturation and management of inadequate response.

    Science.gov (United States)

    Chang, Frank E; Beall, Stephanie A; Cox, Jeris M; Richter, Kevin S; DeCherney, Alan H; Levy, Michael J

    2016-10-01

    To compare outcomes of in vitro fertilization (IVF) cycles with adequate versus inadequate response to the gonadotropin-releasing hormone (GnRH) agonist trigger rescued with the use of human chorionic gonadotropin (hCG) retrigger, and to identify risk factors associated with an inadequate trigger. Retrospective cohort study. Private practice. Women at high risk for ovarian hyperstimulation syndrome who underwent an autologous IVF cycle and used GnRH agonist to trigger oocyte maturation before oocyte retrieval. Patients were triggered with GnRH agonist for final oocyte maturation before retrieval. Patients with an inadequate response, defined by low post-trigger serum LH and P concentrations or failure to recover oocytes after aspiration of several follicles, were retriggered with hCG. Number of oocytes retrieved, fertilization rate, clinical pregnancy, and live birth. Two percent of patients triggered with GnRH agonist had an inadequate response and were retriggered with hCG. There was no statistically significant difference in clinical outcomes between the cycles that were retriggered with hCG and successful GnRH agonist triggers. Low body mass index, low baseline LH, and higher total dosage of gonadotropins required for stimulation were associated with an increased risk of having an inadequate response to the GnRH agonist trigger. A small minority of patients triggered with GnRH agonist had an inadequate response. Rescheduling of oocyte retrieval after hCG retrigger yielded similar IVF outcomes. Evaluation of trigger response based on serum LH and P concentrations is time dependent. Patient characteristics suggestive of hypothalamic hypofunction were predictive of an inadequate response to the GnRH agonist trigger. Copyright © 2016 American Society for Reproductive Medicine. All rights reserved.

  1. New trends in combined use of gonadotropin-releasing hormone antagonists with gonadotropins or pulsatile gonadotropin-releasing hormone in ovulation induction and assisted reproductive technologies.

    Science.gov (United States)

    Gordon, K; Danforth, D R; Williams, R F; Hodgen, G D

    1992-10-01

    The use of gonadotropin-releasing hormone agonists as adjunctive therapy with gonadotropins for ovulation induction in in vitro fertilization and other assisted reproductive technologies has become common clinical practice. With the recent advent of potent gonadotropin-releasing hormone antagonists free from the marked histamine-release effects that stymied earlier compounds, an attractive alternative method may be available. We have established the feasibility of combining gonadotropin-releasing hormone antagonist-induced inhibition of endogenous gonadotropins with exogenous gonadotropin therapy for ovulation induction in a nonhuman primate model. Here, the principal benefits to be gained from using the gonadotropin-releasing hormone antagonist rather than the gonadotropin-releasing hormone agonist are the immediate inhibition of pituitary gonadotropin secretion without the "flare effect," which brings greater safety and convenience for patients and the medical team and saves time and money. We have also recently demonstrated the feasibility of combining gonadotropin-releasing hormone antagonist with pulsatile gonadotropin-releasing hormone therapy for the controlled restoration of gonadotropin secretion and gonadal steroidogenesis culminating in apparently normal (singleton) ovulatory cycles. This is feasible only with gonadotropin-releasing hormone antagonists because, unlike gonadotropin-releasing hormone agonists, they achieve control of the pituitary-ovarian axis without down regulation of the gonadotropin-releasing hormone receptor system. This capacity to override gonadotropin-releasing hormone antagonist-induced suppression of pituitary-ovarian function may allow new treatment modalities to be employed for women who suffer from chronic hyperandrogenemia with polycystic ovarian disease.

  2. Extracellular signal-regulated kinase mediates gonadotropin subunit gene expression and LH release responses to endogenous gonadotropin-releasing hormones in goldfish.

    Science.gov (United States)

    Klausen, Christian; Booth, Morgan; Habibi, Hamid R; Chang, John P

    2008-08-01

    The possible involvement of extracellular signal-regulated kinase (ERK) in mediating the stimulatory actions of two endogenous goldfish gonadotropin-releasing hormones (salmon (s)GnRH and chicken (c)GnRH-II) on gonadotropin synthesis and secretion was examined. Western blot analysis revealed the presence of ERK and phosphorylated (p)ERK in goldfish brain, pituitary, liver, ovary, testis and muscle tissue extracts, as well as extracts of dispersed goldfish pituitary cells and HeLa cells. Interestingly, a third ERK-like immunoreactive band of higher molecular mass was detected in goldfish tissue and pituitary cell extracts in addition to the ERK1-p44- and ERK2-p42-like immunoreactive bands. Incubation of primary cultures of goldfish pituitary cells with either a PKC-activating 4beta-phorbol ester (TPA) or a synthetic diacylglycerol, but not a 4alpha-phorbol ester, elevated the ratio of pERK/total (t)ERK for all three ERK isoforms. The stimulatory effects of TPA were attenuated by the PKC inhibitor GF109203X and the MEK inhibitor PD98059. sGnRH and cGnRH-II also elevated the ratio of pERK/tERK for all three ERK isoforms, in a time-, dose- and PD98059-dependent manner. In addition, treatment with PD98059 reduced the sGnRH-, cGnRH-II- and TPA-induced increases in gonadotropin subunit mRNA levels in Northern blot studies and sGnRH- and cGnRH-II-elicited LH release in cell column perifusion studies with goldfish pituitary cells. These results indicate that GnRH and PKC can activate ERK through MEK in goldfish pituitary cells. More importantly, the present study suggests that GnRH-induced gonadotropin subunit gene expression and LH release involve MEK/ERK signaling in goldfish.

  3. Seasonal variation in the gonadotropin-releasing hormone response to kisspeptin in sheep: possible kisspeptin regulation of the kisspeptin receptor.

    Science.gov (United States)

    Li, Qun; Roa, Alexandra; Clarke, Iain J; Smith, Jeremy T

    2012-01-01

    Kisspeptin signaling in the hypothalamus appears critical for the onset of puberty and driving the reproductive axis. In sheep, reproduction is seasonal, being activated by short days and inhibited by long days. During the non-breeding (anestrous) season, gonadotropin-releasing hormone (GnRH) and gonadotropin secretion is reduced, as is the expression of Kiss1 mRNA in the brain. Conversely, the luteinizing hormone response to kisspeptin during this time is greater. To determine whether the GnRH response to kisspeptin is increased during anestrus, we utilized hypophysial portal blood sampling. In anestrus ewes, the GnRH and LH responses to kisspeptin were greater compared to the breeding season (luteal phase). To ascertain whether this difference reflects a change in Kiss1r, we measured its expression on GnRH neurons using in situ hybridization. The level of Kiss1r was greater during the non-breeding season compared to the breeding season. To further examine the mechanism underlying this change in Kiss1r, we examined Kiss1r/GnRH expression in ovariectomized ewes (controlling for sex steroids) during the breeding and non-breeding seasons, and also ovariectomized non-breeding season ewes with or without estradiol replacement. In both experiments, Kiss1r expression on GnRH neurons was unchanged. Finally, we examined the effect of kisspeptin treatment on Kiss1r. Kiss1r expression on GnRH neurons was reduced by kisspeptin infusion. These studies indicate the kisspeptin response is indeed greater during the non-breeding season and this may be due in part to increased Kiss1r expression on GnRH neurons. We also show that kisspeptin may regulate the expression of its own receptor.

  4. Comparison of second-trimester maternal serum free-β-human chorionic gonadotropin and α-fetoprotein between normal singleton and twin pregnancies: a population-based study

    Institute of Scientific and Technical Information of China (English)

    ZHENG Ming-ming; ZHONG Xiao-ling; HU Ya-li; ZHANG Chun-yan; RU Tong; LIU Qi-lan; XU Bi-yun; CHEN Qi-guang; XU Zheng-feng; ZHANG Yin

    2010-01-01

    Background The second-trimester maternal serum screening in twin pregnancy is still controversial, as the serum marker levels in twins are not as clear as those in singletons. This study aimed to evaluate the relationship between the levels of the second-trimester maternal serum free p-human chorionic gonadotropin (free β-HCG) and a-fetoprotein (AFP) in normal twin and singleton pregnancies and to estimate feasible analysis methods for utilizing these markers in second trimester screening for twin pregnancy. Methods On the basis of a prospective population-based study of second-trimester maternal serum screening, the concentrations of maternal serum AFP and free β-HCG of 195 normal twin pregnancy and 26 512 singleton controls at gestational weeks 15 to 20 were measured by time-resolved fluoroimmunoassay in one laboratory. The levels of markers were compared between the twins and singletons using weight-correction and gestational age-specific model. Results According to the research protocol, 95 communities were randomly sampled, which covered the whole Jiangsu province, the east of China. A total of 26 803 pregnant women (98%), from the target population accepted prenatal screening for maternal serum AFP, β-HCG detection, and all babies were followed up for at least six months. There were 197 (0.73%) twin pregnancies, of which one case had fetal trisomy 18, and one case with fetal anencephaly. The others were normal twin pregnancy. From a total enrollment of 26 803 women participants, 26 512 women with normal singleton pregnancies were selected as the model controls. The other 291 pregnancies, including trisomy 21, neural tube defect (NTD), trisomy 18, and other fetal abnormalities, were excluded. No significant differences were found in the medians of gestational age-specific maternal serum free β-hCG and AFP in normal twin pregnancy comparing with twice those in model controls with the exception of the medians for free β-hCG during the 16th gestational week

  5. Gonadotropin-releasing hormone receptor (Gnrhr) gene knock out: Normal growth and development of sensory, motor and spatial orientation behavior but altered metabolism in neonatal and prepubertal mice

    Science.gov (United States)

    Busby, Ellen R.; Sherwood, Nancy M.

    2017-01-01

    Gonadotropin-releasing hormone (GnRH) is important in the control of reproduction, but its actions in non-reproductive processes are less well known. In this study we examined the effect of disrupting the GnRH receptor in mice to determine if growth, metabolism or behaviors that are not associated with reproduction were affected. To minimize the effects of other hormones such as FSH, LH and sex steroids, the neonatal-prepubertal period of 2 to 28 days of age was selected. The study shows that regardless of sex or phenotype in the Gnrhr gene knockout line, there was no significant difference in the daily development of motor control, sensory detection or spatial orientation among the wildtype, heterozygous or null mice. This included a series of behavioral tests for touch, vision, hearing, spatial orientation, locomotory behavior and muscle strength. Neither the daily body weight nor the final weight on day 28 of the kidney, liver and thymus relative to body weight varied significantly in any group. However by day 28, metabolic changes in the GnRH null females compared with wildtype females showed a significant reduction in inguinal fat pad weight normalized to body weight; this was accompanied by an increase in glucose compared with wildtype females shown by Student-Newman-Keuls Multiple Comparison test and Student's unpaired t tests. Our studies show that the GnRH-GnRHR system is not essential for growth or motor/sensory/orientation behavior during the first month of life prior to puberty onset. The lack of the GnRH-GnRHR axis, however, did affect females resulting in reduced subcutaneous inguinal fat pad weight and increased glucose with possible insulin resistance; the loss of the normal rise of estradiol at postnatal days 15–28 may account for the altered metabolism in the prepubertal female pups. PMID:28346489

  6. Gonadotropin-releasing hormone receptor (Gnrhr) gene knock out: Normal growth and development of sensory, motor and spatial orientation behavior but altered metabolism in neonatal and prepubertal mice.

    Science.gov (United States)

    Busby, Ellen R; Sherwood, Nancy M

    2017-01-01

    Gonadotropin-releasing hormone (GnRH) is important in the control of reproduction, but its actions in non-reproductive processes are less well known. In this study we examined the effect of disrupting the GnRH receptor in mice to determine if growth, metabolism or behaviors that are not associated with reproduction were affected. To minimize the effects of other hormones such as FSH, LH and sex steroids, the neonatal-prepubertal period of 2 to 28 days of age was selected. The study shows that regardless of sex or phenotype in the Gnrhr gene knockout line, there was no significant difference in the daily development of motor control, sensory detection or spatial orientation among the wildtype, heterozygous or null mice. This included a series of behavioral tests for touch, vision, hearing, spatial orientation, locomotory behavior and muscle strength. Neither the daily body weight nor the final weight on day 28 of the kidney, liver and thymus relative to body weight varied significantly in any group. However by day 28, metabolic changes in the GnRH null females compared with wildtype females showed a significant reduction in inguinal fat pad weight normalized to body weight; this was accompanied by an increase in glucose compared with wildtype females shown by Student-Newman-Keuls Multiple Comparison test and Student's unpaired t tests. Our studies show that the GnRH-GnRHR system is not essential for growth or motor/sensory/orientation behavior during the first month of life prior to puberty onset. The lack of the GnRH-GnRHR axis, however, did affect females resulting in reduced subcutaneous inguinal fat pad weight and increased glucose with possible insulin resistance; the loss of the normal rise of estradiol at postnatal days 15-28 may account for the altered metabolism in the prepubertal female pups.

  7. Serum gonadotropins after gonadotropin-releasing hormone injection in bulls subjected to spacial restriction.

    Science.gov (United States)

    Gwazdauskas, F C; Bindas, E M; Anderson, G W; McGilliard, M L

    1984-12-01

    Response patterns of luteinizing hormone, follicle-stimulating hormone, and testosterone after injection of gonadotropin-releasing hormone were investigated in bulls grouped by weight (250 to 459 kg body weight) and confined five per pen in 9.2 or 6.4 m2 space per bull in two replicates. Blood samples were collected for 1 h prior to injection of 100 micrograms gonadotropin releasing hormone and 5 h after injection at 15-min intervals. Overall mean luteinizing hormone concentrations were not affected by spacial restriction or replicate. Interaction of treatment by time revealed that luteinizing hormone response curves were not similar. Restricted bulls had a higher response of luteinizing hormone to gonadotropin-releasing hormone. Follicle-stimulating hormone increased in all groups within 15 min and peaked at 219.4 ng/ml at 45 min. Both gonadotropin responses returned to preinjection concentrations by 4 h. Testosterone was affected by treatment, replicate, and time of sampling. Testosterone was higher in restricted bulls and higher in replicate 2. Mean testosterone peak following gonadotropin-releasing hormone was 3.86 ng/ml and occurred between 105 and 120 min which was approximately 90 min after the gonadotropin peaks. It appears that hormone responses to gonadotropin-releasing hormone were not depressed by spacial restriction, and additional spacial restriction of young bulls could be used commercially.

  8. Gonadotropin-releasing hormone receptor (Gnrhr) gene knock out: Normal growth and development of sensory, motor and spatial orientation behavior but altered metabolism in neonatal and prepubertal mice

    OpenAIRE

    Busby, Ellen R.; Sherwood, Nancy M.

    2017-01-01

    Gonadotropin-releasing hormone (GnRH) is important in the control of reproduction, but its actions in non-reproductive processes are less well known. In this study we examined the effect of disrupting the GnRH receptor in mice to determine if growth, metabolism or behaviors that are not associated with reproduction were affected. To minimize the effects of other hormones such as FSH, LH and sex steroids, the neonatal-prepubertal period of 2 to 28 days of age was selected. The study shows that...

  9. Klinefelter syndrome with low gonadotropin levels.

    Science.gov (United States)

    Cherian, Kripa Elizabeth; Jebasingh, Felix K; Kapoor, Nitin; Paul, Thomas Vizhalil

    2015-12-29

    Klinefelter syndrome is usually characterised by the presence of a eunuchoid body habitus and testes that are usually small and firm, with low testosterone, and elevated luteinising hormone and follicle-stimulating hormone levels, consistent with hypergonadotropic hypogonadism. Low levels of gonadotropins in karyotypically proven cases are not expected, they are extremely rare occurrences. We report a case of a patient who was diagnosed to have Klinefelter syndrome (47 XXY) with low gonadotropin levels. The rest of his anterior pituitary hormonal profile was normal with no lesions in the pituitary gland on imaging. He was continued on androgen replacement therapy.

  10. Dexamethasone as a Supplement for Exogenous Gonadotropin to Improve Ovarian Response of Women over 35 Years Undergoing IVF/ICSI Cycles

    Directory of Open Access Journals (Sweden)

    Mahnaz Ashrafi

    2007-01-01

    Full Text Available Background: With aging, the ovarian reserve is decreased and that is a major contributor to poor ovarian response to exogenous gonadotropins. The aim of the present study is to evaluate the role of Dexamethasone on ovarian response in infertile patients aged over 35 years undergoing IVF/ICSI cycles.Materials and Methods: In this triple blind placbo-control clinical trial study, a total of 72 infertile women over age 35, undergoing IVF/ICSI cycles, referred to Royan Institute from May 2000 to May 2002 were selected. Dexamethasone co-treatment (1mg/d was started on the 21st of their preceding menstrual cycle and it was continued until oocyte aspiration. The main outcome measures were number of retrieved oocytes, number of fertilized and transferred embryos, number of used HMG, serum E2 level on HCG injection day, and pregnancy rate.Results: There was no significant statistical difference in age, duration of infertility, Body mass index, hormonal tests, number of retrieved oocytes and transferred embryos. However, the number of used HMG was significantly lower in Dexamethasone group compared to placebo group (30.6±13.39 versus 41.64 ± 18.34 (p<0.05.Conclusion: The addition of dexamethasone 1mg/d to standard long protocol decreased the number of HMG used in patients over 35 years who hold known risk of low ovarian response.

  11. Ovulation induction with pulsatile gonadotropin-releasing hormone (GnRH) or gonadotropins in a case of hypothalamic amenorrhea and diabetes insipidus.

    Science.gov (United States)

    Georgopoulos, N A; Markou, K B; Pappas, A P; Protonatariou, A; Vagenakis, G A; Sykiotis, G P; Dimopoulos, P A; Tzingounis, V A

    2001-12-01

    Hypothalamic amenorrhea is a treatable cause of infertility. Our patient was presented with secondary amenorrhea and diabetes insipidus. Cortisol and prolactin responded normally to a combined insulin tolerance test (ITT) and thyrotropin-releasing hormone (TRH) challenge, while thyroid-stimulating hormone (TSH) response to TRH was diminished, and no response of growth hormone to ITT was detected. Both luteinizing hormone (LH) and follicle-stimulating hormone (FSH) levels increased following gonadotropin-releasing hormone (GnRH) challenge. No response of LH to clomiphene citrate challenge was detected. Magnetic resonance imaging findings demonstrated a midline mass occupying the inferior hypothalamus, with posterior lobe not visible and thickened pituitary stalk. Ovulation induction was carried out first with combined human menopausal gonadotropins (hMG/LH/FSH) (150 IU/day) and afterwards with pulsatile GnRH (150 ng/kg/pulse). Ovulation was achieved with both pulsatile GnRH and combine gonadotropin therapy. Slightly better results were achieved with the pulsatile GnRH treatment.

  12. Hindbrain lactate regulates preoptic gonadotropin-releasing hormone (GnRH) neuron GnRH-I protein but not AMPK responses to hypoglycemia in the steroid-primed ovariectomized female rat.

    Science.gov (United States)

    Shrestha, P K; Briski, K P

    2015-07-09

    Steroid positive-feedback activation of the gonadotropin-releasing hormone (GnRH)-pituitary luteinizing hormone (LH) neuroendocrine axis propagates the pre ovulatory LH surge, a crucial component of female reproduction. Our work shows that this key event is restrained by inhibitory metabolic input from hindbrain A2 noradrenergic neurons. GnRH neurons express the ultra-sensitive energy sensor adenosine 5'-monophosphate-activated protein kinase (AMPK); here, we investigated the hypothesis that GnRH nerve cell AMPK and peptide neurotransmitter responses to insulin-induced hypoglycemia are controlled by hindbrain lack of the oxidizable glycolytic end-product L-lactate. Data show that hypoglycemic inhibition of LH release in steroid-primed ovariectomized female rats was reversed by coincident caudal hindbrain lactate infusion. Western blot analyses of laser-microdissected A2 neurons demonstrate hypoglycemic augmentation [Fos, estrogen receptor-beta (ER-β), phosphoAMPK (pAMPK)] and inhibition (dopamine-beta-hydroxylase, GLUT3, MCT2) of protein expression in these cells, responses that were normalized by insulin plus lactate treatment. Hypoglycemia diminished rostral preoptic GnRH nerve cell GnRH-I protein and pAMPK content; the former, but not the latter response was reversed by lactate. Results implicate caudal hindbrain lactoprivic signaling in hypoglycemia-induced suppression of the LH surge, demonstrating that lactate repletion of that site reverses decrements in A2 catecholamine biosynthetic enzyme and GnRH neuropeptide precursor protein expression. Lack of effect of lactate on hypoglycemic patterns of GnRH AMPK activity suggests that this sensor is uninvolved in metabolic-inhibition of positive-feedback-stimulated hypophysiotropic signaling to pituitary gonadotropes.

  13. Microdose gonadotropin-releasing hormone agonist in the absence of exogenous gonadotropins is not sufficient to induce multiple follicle development.

    Science.gov (United States)

    Chung, Karine; Fogle, Robin; Bendikson, Kristin; Christenson, Kamilee; Paulson, Richard

    2011-01-01

    Because the effectiveness of the "microdose flare" stimulation protocol often is attributed to the dramatic endogenous gonadotropin release induced by the GnRH agonist, the aim of this study was to determine whether use of microdose GnRH agonist alone could induce multiple ovarian follicle development in normal responders. Based on these data, the duration of gonadotropin rise is approximately 24 to 48 hours and is too brief to sustain continued multiple follicle growth.

  14. The rate of high ovarian response in women identified at risk by a high serum AMH level is influenced by the type of gonadotropin.

    Science.gov (United States)

    Arce, Joan-Carles; Klein, Bjarke M; La Marca, Antonio

    2014-06-01

    The aim was to compare ovarian response and clinical outcome of potential high-responders after stimulation with highly purified menotropin (HP-hMG) or recombinant follicle-stimulating hormone (rFSH) for in vitro fertilisation/intracytoplasmic sperm injection. Retrospective analysis was performed on data collected in two randomized controlled trials, one conducted following a long GnRH agonist protocol and the other with an antagonist protocol. Potential high-responders (n = 155 and n = 188 in the agonist and antagonist protocol, respectively) were defined as having an initial anti-Müllerian hormone (AMH) value >75th percentile (5.2 ng/ml). In both protocols, HP-hMG stimulation in women in the high AMH category was associated with a significantly lower occurrence of high response (≥15 oocytes retrieved) than rFSH stimulation; 33% versus 51% (p = 0.025) and 31% versus 49% (p = 0.015) in the long agonist and antagonist protocol, respectively. In the potential high-responder women, trends for improved live birth rate were observed with HP-hMG compared with rFSH (long agonist protocol: 33% versus 20%, p = 0.074; antagonist protocol: 34% versus 23%, p = 0.075; overall population: 34% versus 22%, p = 0.012). In conclusion, the type of gonadotropin used for ovarian stimulation influences high-response rates and potentially clinical outcome in women identified as potential high-responders.

  15. Testosterone Secretion in Response to Human Chorionic Gonadotropin (hCG) in Eugonadal and Hypogonadal Men

    Institute of Scientific and Technical Information of China (English)

    李江源; 郭爱岩

    1994-01-01

    Two injections of hCG in dose of 2000 IU were administered in an interval of 96 hours, and venous blood samples were drawn at 0, 1, 2, 3, 4, 6, 24, 48, 72 and 96 hr for testosterone determination. A biphasic curve of testosterone release was foand in normal adult men (n=4), patients with Klinefelter syndrome (n=10) and patients with hypogonadism due to pituitary tumor (n=8), respeetively, but not in prepubertal boys (n=4) and patients with IHH(n=9). Only after the second loading of hCG the first peak of testosterone secretion emerged in the latter two groups. The second peak values after the second injection of hCG were signfieantly greater than those after the first injection in all groups. Whereas the maximal increments of the second peak were much lower in normal adult men and patients with Klinefelter syndrome than those in other 3 groups.It was suggested that (1) the first peak of testosterone secretion was depending upon the previous exposure to high concentration of hCG or LH; (2) repeated administration of hCG had a setf-priming effect on testosterone release; and (3) the desensitization of Leydig cells existed after a single injection of hCG and its removal was incomplete after an intermission of 96 hours.

  16. Insight into the neuroendocrine site and cellular mechanism by which cortisol suppresses pituitary responsiveness to gonadotropin-releasing hormone.

    Science.gov (United States)

    Breen, Kellie M; Davis, Tracy L; Doro, Lisa C; Nett, Terry M; Oakley, Amy E; Padmanabhan, Vasantha; Rispoli, Louisa A; Wagenmaker, Elizabeth R; Karsch, Fred J

    2008-02-01

    Stress-like elevations in plasma glucocorticoids rapidly inhibit pulsatile LH secretion in ovariectomized sheep by reducing pituitary responsiveness to GnRH. This effect can be blocked by a nonspecific antagonist of the type II glucocorticoid receptor (GR) RU486. A series of experiments was conducted to strengthen the evidence for a mediatory role of the type II GR and to investigate the neuroendocrine site and cellular mechanism underlying this inhibitory effect of cortisol. First, we demonstrated that a specific agonist of the type II GR, dexamethasone, mimics the suppressive action of cortisol on pituitary responsiveness to GnRH pulses in ovariectomized ewes. This effect, which became evident within 30 min, documents mediation via the type II GR. We next determined that exposure of cultured ovine pituitary cells to cortisol reduced the LH response to pulse-like delivery of GnRH by 50% within 30 min, indicating a pituitary site of action. Finally, we tested the hypothesis that suppression of pituitary responsiveness to GnRH in ovariectomized ewes is due to reduced tissue concentrations of GnRH receptor. Although cortisol blunted the amplitude of GnRH-induced LH pulses within 1-2 h, the amount of GnRH receptor mRNA or protein was not affected over this time frame. Collectively, these observations provide evidence that cortisol acts via the type II GR within the pituitary gland to elicit a rapid decrease in responsiveness to GnRH, independent of changes in expression of the GnRH receptor.

  17. Response to gonadotropin-releasing hormone challenge: Seasonal variation in steroid production in a viviparous lizard, Tiliqua nigrolutea.

    Science.gov (United States)

    Edwards, Ashley; Jones, Susan M

    2017-04-01

    The hypothalamic-pituitary-gonadal axis plays a central role in the regulation of gamete maturation, sex steroid production and the stimulation of reproductive behaviours in vertebrates. In seasonal breeders, the timely activation and deactivation of this control system is important to ensure successful reproduction: this process is not well understood in species which breed irregularly. Males of the viviparous blotched blue-tongued lizard, Tiliqua nigrolutea, breed annually, while females display a multiennial cycle. We investigated seasonal variation in hypothalamic-pituitary-gonadal axis responsiveness in both sexes of T. nigrolutea. We measured changes in plasma concentrations of testosterone and estrogen in response to a single intraperitoneal injection of a GnRH agonist, chicken-II LH-RH, at three reproductively distinct times of year. Plasma testosterone concentrations in males were significantly increased during gonadal quiescence, but not initial or final spermatogenesis. There was no estrogen response in males at any time of year. Conversely, in females, there was an increase in plasma testosterone, but not estrogen, concentration, in reproductively quiescent females several months in advance of a successful pregnancy. These results indicate clear variation in HPG axis activity with sex, season and reproductive condition in this seasonally breeding viviparous lizard. This study opens the way for further investigation into the mechanisms by which internal (body condition) and external seasonal cues (temperature and photoperiod) are coordinated to regulate reproduction in irregularly-breeding reptiles.

  18. Normal Caloric Responses during Acute Phase of Vestibular Neuritis

    Science.gov (United States)

    Lee, Sun-Uk; Park, Seong-Ho; Kim, Hyo-Jung; Koo, Ja-Won

    2016-01-01

    Background and Purpose We report a novel finding of caloric conversion from normal responses into unilateral paresis during the acute phase of vestibular neuritis (VN). Methods We recruited 893 patients with a diagnosis of VN at Dizziness Clinic of Seoul National University Bundang Hospital from 2003 to 2014 after excluding 28 patients with isolated inferior divisional VN (n=14) and those without follow-up tests despite normal caloric responses initially (n=14). We retrospectively analyzed the neurotological findings in four (0.5%) of the patients who showed a conversion from initially normal caloric responses into unilateral paresis during the acute phase. Results In those four patients, the initial caloric tests were performed within 2 days of symptom onset, and conversion into unilateral caloric paresis was documented 1–4 days later. The clinical and laboratory findings during the initial evaluation were consistent with VN in all four patients except for normal findings in bedside head impulse tests in one of them. Conclusions Normal findings in caloric tests should be interpreted with caution during the acute phase of suspected VN. Follow-up evaluation should be considered when the findings of the initial caloric test are normal, but VN remains the most plausible diagnosis. PMID:26932259

  19. The apparent paradox of the negative and positive feedback control system on gonadotropin secretion.

    Science.gov (United States)

    Yen, S S; Lein, A

    1976-12-01

    The separate and interactive effects of estradiol (E2) and luteinizing hormone-releasing factor (LRF) on the dynamics of LH storage and release were studied. Measurements were made of the serum gonadotropin responses to submaximal doses of LRF, given as brief pulses or infused over an extended period to normal women at various stages of the follicular phase of their menstrual cycles and to hypogonadal women with and without estrogen treatment. The two-pool concept of pituitary gonadotropin was verified; the dynamic responses of the two pools to the inputs of LRF and E2 were investigated and related to pituitary properties of sensitivity and reserve. Our results indicate that LRF appears to serve as a primary drive on the gonadotrophs, stimulating gonadotropin synthesis and storage (second pool), as well as release (first). E2 for the most part, amplifies the action of LRF except that it impedes LRF-induced release of gonadotropin. E2 augments the second pool activity (reserve) preferentially, and the relative activity of the first pool appears to be influenced by the E2-dependent self-priming effect of LRF. The interactions of the various elements of the system, when combined, provide a U-shaped curve to describe the over-all capacity of the gonadotrophs as a function of a broad range of E2 inputs. Negative and possitive feedback of E2 are revealed to operate by different mechanisms and to represent different segments of a single U-shaped curve rather than paradoxically disparate actions.

  20. Normalization of cell responses in cat striate cortex

    Science.gov (United States)

    Heeger, D. J.

    1992-01-01

    Simple cells in the striate cortex have been depicted as half-wave-rectified linear operators. Complex cells have been depicted as energy mechanisms, constructed from the squared sum of the outputs of quadrature pairs of linear operators. However, the linear/energy model falls short of a complete explanation of striate cell responses. In this paper, a modified version of the linear/energy model is presented in which striate cells mutually inhibit one another, effectively normalizing their responses with respect to stimulus contrast. This paper reviews experimental measurements of striate cell responses, and shows that the new model explains a significantly larger body of physiological data.

  1. Genetically modified mouse models addressing gonadotropin function.

    Science.gov (United States)

    Ratner, Laura D; Rulli, Susana B; Huhtaniemi, Ilpo T

    2014-03-01

    The development of genetically modified animals has been useful to understand the mechanisms involved in the regulation of the gonadotropin function. It is well known that alterations in the secretion of a single hormone is capable of producing profound reproductive abnormalities. Human chorionic gonadotropin (hCG) is a glycoprotein hormone normally secreted by the human placenta, and structurally and functionally it is related to pituitary LH. LH and hCG bind to the same LH/hCG receptor, and hCG is often used as an analog of LH to boost gonadotropin action. There are many physiological and pathological conditions where LH/hCG levels and actions are elevated. In order to understand how elevated LH/hCG levels may impact on the hypothalamic-pituitary-gonadal axis we have developed a transgenic mouse model with chronic hCG hypersecretion. Female mice develop many gonadal and extragonadal phenotypes including obesity, infertility, hyperprolactinemia, and pituitary and mammary gland tumors. This article summarizes recent findings on the mechanisms involved in pituitary gland tumorigenesis and hyperprolactinemia in the female mice hypersecreting hCG, in particular the relationship of progesterone with the hyperprolactinemic condition of the model. In addition, we describe the role of hyperprolactinemia as the main cause of infertility and the phenotypic abnormalities in these mice, and the use of dopamine agonists bromocriptine and cabergoline to normalize these conditions. Copyright © 2014 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  2. -Human Chorionic Gonadotropin Production

    Directory of Open Access Journals (Sweden)

    Michael J. Russell

    2008-01-01

    Full Text Available Dedifferentiated liposarcomas may display a variety of “heterologous” lines of differentiation, including osseous, vascular, skeletal, and/or smooth muscular. There have been six previously reported examples of leiomyosarcomas associated with high levels of serum human chorionic gonadotropin (hCG production, comprised of cases originating from the retroperitoneum, spermatic cord, small intestine, and uterus. This report describes the first example of a dedifferentiated liposarcoma that combined both of the aforementioned features: extensive heterologous (leiomyosarcomatous differentiation and -hCG production (maximum serum levels 1046 mIU/ml, reference <5 mIU/ml. The tumor, which originated in the retroperitoneum in the region of the right kidney, was rapidly progressive and ultimately fatal within three months of its diagnosis. In addition to characteristic morphologic features, lipogenic and smooth muscle differentiation were confirmed with immunohistochemical stains for MDM2 and smooth muscle actin, respectively. The tumor also displayed diffuse immunoreactivity for -hCG in both primary and metastatic sites. This case further expands the clinicopathologic spectrum of lipogenic tumors.

  3. Regional frequency response analysis under normal and emergency conditions

    Energy Technology Data Exchange (ETDEWEB)

    Bevrani, Hassan [Department of Electrical and Computer Engineering, University of Kurdistan, Sanandaj, PO Box 416 (Iran); Ledwich, Gerard; Ford, Jason J. [School of Engineering Systems, Queensland University of Technology, Brisbane, Qld 4001 (Australia); Dong, Zhao Yang [Department of Electrical Engineering, The Hong Kong Polytechnic University (China)

    2009-05-15

    This paper presents a frequency response analysis approach suitable for a power system control area in a wide range of operating conditions. The analytic approach uses the well-known system frequency response model for the turbine-governor and load units to obtain the mathematical representation of the basic concepts. Primary and supplementary frequency controls are properly considered and the effect of emergency control/protection schemes is included. Therefore, the proposed analysis/modeling approach could be grainfully used for the power system operation during the contingency and normal conditions. Time-domain nonlinear simulations with a power system example showed that the results agree with those predicted analytically. (author)

  4. Relationships between nonlinear normal modes and response to random inputs

    Science.gov (United States)

    Schoneman, Joseph D.; Allen, Matthew S.; Kuether, Robert J.

    2017-02-01

    The ability to model nonlinear structures subject to random excitation is of key importance in designing hypersonic aircraft and other advanced aerospace vehicles. When a structure is linear, superposition can be used to construct its response to a known spectrum in terms of its linear modes. Superposition does not hold for a nonlinear system, but several works have shown that a system's dynamics can still be understood qualitatively in terms of its nonlinear normal modes (NNMs). This work investigates the connection between a structure's undamped nonlinear normal modes and the spectrum of its response to high amplitude random forcing. Two examples are investigated: a spring-mass system and a clamped-clamped beam modeled within a geometrically nonlinear finite element package. In both cases, an intimate connection is observed between the smeared peaks in the response spectrum and the frequency-energy dependence of the nonlinear normal modes. In order to understand the role of coupling between the underlying linear modes, reduced order models with and without modal coupling terms are used to separate the effect of each NNM's backbone from the nonlinear couplings that give rise to internal resonances. In the cases shown here, uncoupled, single-degree-of-freedom nonlinear models are found to predict major features in the response with reasonable accuracy; a highly inexpensive approximation such as this could be useful in design and optimization studies. More importantly, the results show that a reduced order model can be expected to give accurate results only if it is also capable of accurately predicting the frequency-energy dependence of the nonlinear modes that are excited.

  5. Normal neurodynamic responses of the femoral slump test.

    Science.gov (United States)

    Lai, Weng-Hang; Shih, Yi-Fen; Lin, Pei-Ling; Chen, Wen-Yin; Ma, Hsiao-Li

    2012-04-01

    Femoral slump test is a neurodynamic testing, which could be used to assess the mechanosensitivity of the femoral component of the nervous system. Although Trainor and Pinnington reported the diagnosis accuracy of the femoral slump test, the neurodynamic responses of the femoral slump test have never been studied. The purposes of this study were to evaluate whether maneuvers that changed the nerve tension altered the responses of the femoral slump test and if these responses were influenced by gender and leg dominance; and to identify the correlations between flexibility and measured hip extension angle. Thirty-two asymptomatic subjects (16 males, 16 females) were recruited. The femoral slump test was performed in trunk slump and neutral positions, and cervical extension was used as the structure differential technique. Hip extension angle and visual analog scale (VAS) of thigh pain was measured during the test. Our results showed the decrease of nerve tension significantly increased hip extension ROM (P  0.05). These findings indicated that femoral slump test resulted in normal neurodynamic responses in individuals free of lower extremity problems, and these responses were independent of the influence of muscle flexibility or gender. Future research should emphasize the use of femoral slump test in patient groups such as low back and anterior knee pain.

  6. Regulation of gonadotropins by corticotropin-releasing factor and urocortin

    Directory of Open Access Journals (Sweden)

    Kazunori eKageyama

    2013-02-01

    Full Text Available While stress activates the hypothalamic-pituitary-adrenal (HPA axis, it suppresses the hypothalamic-pituitary-gonadal (HPG axis. Corticotropin-releasing factor (CRF is a major regulatory peptide in the HPA axis during stress. Urocortin1 (Ucn1, a member of the CRF family of peptides, has a variety of physiological functions and both CRF and Ucn1 contribute to the stress response via G protein-coupled seven transmembrane receptors. Ucn2 and Ucn3, which belong to a separate paralogous lineage from CRF, are highly selective for the CRF type 2 receptor (CRF2 receptor. The HPA and HPG axes interact with each other, and gonadal function and reproduction are suppressed in response to various stressors. In this review, we focus on the regulation of gonadotropins by CRF and Ucn2 in pituitary gonadotrophs and of gonadotropin-releasing hormone (GnRH via CRF receptors in the hypothalamus. In corticotrophs, stress-induced increases in CRF stimulate Ucn2 production, which leads to the inhibition of gonadotropin secretion via the CRF2 receptor in the pituitary. GnRH in the hypothalamus is regulated by a variety of stress conditions. CRF is also involved in the suppression of the HPG axis, especially the GnRH pulse generator, via CRF receptors in the hypothalamus. Thus, complicated regulation of GnRH in the hypothalamus and gonadotropins in the pituitary via CRF receptors contributes to stress responses and adaptation of gonadal functions.

  7. Antimüllerian hormone in gonadotropin releasing-hormone antagonist cycles

    DEFF Research Database (Denmark)

    Arce, Joan-Carles; La Marca, Antonio; Mirner Klein, Bjarke

    2013-01-01

    To assess the relationships between serum antimüllerian hormone (AMH) and ovarian response and treatment outcomes in good-prognosis patients undergoing controlled ovarian stimulation using a gonadotropin-releasing hormone (GnRH) antagonist protocol.......To assess the relationships between serum antimüllerian hormone (AMH) and ovarian response and treatment outcomes in good-prognosis patients undergoing controlled ovarian stimulation using a gonadotropin-releasing hormone (GnRH) antagonist protocol....

  8. Ovarian hyperstimulation syndrome prevention strategies: oral contraceptive pills-dual gonadotropin-releasing hormone agonist suppression with step-down gonadotropin protocols.

    Science.gov (United States)

    Damario, Mark A

    2010-11-01

    The identification of patients at high risk for excessive responses to ovarian stimulation for in vitro fertilization and embryo transfer is essential in the tailoring of safe and effective treatment strategies. Known factors associated with increased sensitivity to gonadotropins include polycystic ovary syndrome, young age, prior ovarian hyperstimulation syndrome (OHSS), high baseline antral follicle count, and high baseline ovarian volume. Although several treatment strategies have been proposed for these patients, this report describes the experience using the dual suppression with gonadotropin step-down protocol. This protocol uses oral contraceptive pretreatment in combination with a long gonadotropin-releasing hormone agonist followed by a programmed step-down in gonadotropin dosing. Hormonal characteristics of dual suppression include an improved luteinizing hormone-to-follicle-stimulating hormone ratio and lower serum androgens, particularly dehydroepiandrosterone sulfate. Clinical characteristics of the protocol include a lower cancellation rate and favorable clinical and ongoing pregnancy rates per initiated cycle while mitigating the risk of OHSS.

  9. Regulation of tonic gonadotropin release in prepubertal female hamsters

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S.G.; Matt, K.S.; Prestowitz, W.F.; Stetson, M.H.

    1982-04-01

    Basal serum gonadotropin levels were monitored weekly in female hamsters from birth to 10 weeks of age. Hamsters raised on three different photoperiods presented uniform pre- and postpubertal patterns of serum LH and FSH, suggesting that gonadotropin release in the young hamster occurs independently of ambient photoperiod. In all groups, serum LH levels increased gradually in animals up to 4 weeks of age, after which levels plateaued at 50--100 ng/ml. Serum FSH was markedly elevated in 2- and 3-week-old hamsters (800--1200 ng/ml), but remained at 200--400 ng/ml in all other groups. We next examined the change in the responsiveness of the pituitary to exogenous gonadotropin-releasing hormone (GnRH) challenge. Female hamsters 2 days of age failed to respond to any dose (0.025--1000 ng) of GnRH, while 10-day old females responded in typical dose-dependent fashion. GnRH-stimulated LH release first occurred in 6-day-old hamsters and was maximal by day 9, whereas FSH release first occurred on day 8 and was maximal by day 9. The prepubertal pattern of gonadotropin release can, in part, be explained on the basis of the development of pituitary GnRH sensitivity, which occurs independently of photoperiod.

  10. The effect of dietary monensin on th luteinizing hormone response of prepuberal heifers given a multiple gonadotropin-releasing hormone challenge.

    Science.gov (United States)

    Randel, R D; Rhodes, R C

    1980-10-01

    Ten prepuberal Simmental X Brahman-Hereford heifers (average weight 208 +/- 4 kg) were randomly assigned to receive either 2.7 kg/head/day of ground milo containing 0 mg monensin sodium (C) or 2.7 kg/head/day of ground milo containing 200 mg monensin sodium (M). Both groups of animals (n = 5) received Coastal bermudagrass hay ad libitum throughout the trial. On day 21 of the feeding period all heifers were fitted with jugular cannulas. Immediately after cannulation, the heifers were injected IM with 100 microgram of gonadotropin-releasing hormone (GnRH) and blood was collected every 10 min for 4 hours. Four hours after the first GnRH challenge, a second 100-microgram GnRH injection was administered, and blood samples were collected at 10-min intervals for an additional 5 hours. Serum was stored at -20 C until radioimmunoassayed for luteinizing hormone (LH). The amount of LH released after each GnRH injection was greater in the heifers fed M than in the controls (P less than .05). Peak LH after the first GnRH challenge was greater (P less than .05) in heifers fed M than in controls. The area under th first GnRH induced LH curve tended (P less than .20) to be greater for the M group than for the controls. Peak LH concentration was greater in heifers fed M than in control heifers, as the duration (P less than .05) and area under the second GnRH-induced LH curve. In prepuberal heifers, dietary monensin appears to increase hypophyseal capability of releasing LH after a first and second GnRH challenge.

  11. The steroid response to human chorionic gonadotropin (hCG) stimulation in men with Klinefelter syndrome does not change using immunoassay or mass spectrometry.

    Science.gov (United States)

    Roli, L; Santi, D; Belli, S; Tagliavini, S; Cavalieri, S; De Santis, M C; Baraldi, E; Fanelli, F; Mezzullo, M; Granata, A R; Pagotto, U; Pasquali, R; Rochira, V; Carani, C; Simoni, M; Trenti, T

    2017-08-01

    Liquid-chromatography tandem mass-spectrometry (LC-MS/MS) was developed in parallel to Immunoassays (IAs) and today is proposed as the "gold standard" for steroid assays. Leydig cells of men with Klinefelter syndrome (KS) are able to respond to human chorionic gonadotropin (hCG) stimulation, even if testosterone (T) production was impaired. The aim was to evaluate how results obtained by IAs and LC-MS/MS can differently impact on the outcome of a clinical research on gonadal steroidogenesis after hCG stimulation. A longitudinal, prospective, case-control clinical trial. (clinicaltrial.gov NCT02788136) was carried out, enrolling KS men and healthy age-matched controls, stimulated by hCG administration. Serum steroids were evaluated at baseline and for 5 days after intramuscular injection of 5000 IU hCG using both IAs and LC-MS/MS. 13 KS patients (36 ± 9 years) not receiving T replacement therapy and 14 controls (32 ± 8 years) were enrolled. T, progesterone, cortisol, 17-hydroxy-progesterone (17OHP) and androstenedione, were significantly higher using IAs than LC-MS/MS. IAs and LC-MS/MS showed direct correlation for all five steroids, although the constant overestimation detected by IAs. Either methodology found the same 17OHP and T increasing profile after hCG stimulation, with equal areas under the curves (AUCs). Although a linearity between IA and LC-MS/MS is demonstrated, LC-MS/MS is more sensitive and accurate, whereas IA shows a constant overestimation of sex steroid levels. This result suggests the need of reference intervals built on the specific assay. This fundamental difference between these two methodologies opens a deep reconsideration of what is needed to improve the accuracy of steroid hormone assays.

  12. A high response to controlled ovarian stimulation induces premature luteinization with a negative impact on pregnancy outcomes in a gonadotropin-releasing hormone antagonist cycle.

    Science.gov (United States)

    Koo, Hwa Seon; Cha, Sun Hwa; Kim, Hye Ok; Song, In Ok; Min, Eung Gi; Yang, Kwang Moon; Park, Chan Woo

    2015-12-01

    The goal of this study was to investigate the relationship between serum progesterone (P4) levels on the day of human chorionic gonadotropin (hCG) administration and the pregnancy rate among women undergoing controlled ovarian stimulation for in vitro fertilization (IVF) or intracytoplasmic sperm injection-embryo transfer (ICSI-ET) using a flexible antagonist protocol. This prospective study included 200 IVF and ICSI-ET cycles in which a flexible antagonist protocol was used. The patients were divided into five distinct groups according to their serum P4 levels at the time of hCG administration (0.80, 0.85, 0.90, 0.95, and 1.00 ng/mL). The clinical pregnancy rate (CPR) was calculated for each P4 interval. Statistically significant differences were observed at a serum P4 level of 0.9 ng/mL. These data suggest that a serum P4 concentration of 0.9 ng/mL may represent the optimal threshold level for defining premature luteinization (PL) based on the presence of a significant negative impact on the CPR. The CPR for each round of ET was significantly lower in the PL group defined using this threshold (25.8% vs. 41.8%; p=0.019), and the number of oocytes retrieved was significantly higher than in the non-PL group (17.3±7.2 vs. 11.0±7.2; p=0.001). Elevated serum P4 levels on the day of hCG administration were associated with a reduced CPR, despite the retrieval of many oocytes. Measuring serum P4 values at the time of hCG administration is necessary in order to determine the optimal strategy for embryo transfer.

  13. Defective Gonadotropin-Dependent Ovarian Folliculogenesis and Granulosa Cell Gene Expression in Inhibin-Deficient Mice

    Science.gov (United States)

    Nagaraja, Ankur K.; Middlebrook, Brooke S.; Rajanahally, Saneal; Myers, Michelle; Li, Qinglei; Matzuk, Martin M.; Pangas, Stephanie A.

    2010-01-01

    Inhibin-α knockout (Inha−/−) female mice develop sex cord-stromal ovarian cancer with complete penetrance and previous studies demonstrate that the pituitary gonadotropins (FSH and LH) are influential modifiers of granulosa cell tumor development and progression in inhibin-deficient females. Recent studies have demonstrated that Inha−/− ovarian follicles develop precociously to the early antral stage in prepubertal mice without any increase in serum FSH. These studies suggest that in the absence of inhibins, granulosa cells differentiate abnormally and thus at sexual maturity may undergo an abnormal response to gonadotropin signaling contributing to tumor development. To test this hypothesis, we stimulated immature wild-type and Inha−/− female mice with gonadotropin analogs prior to tumor formation and subsequently examined gonadotropin-induced ovarian follicle development as well as preovulatory and human chorionic gonadotropin-induced gene expression changes in granulosa cells. We find that at 3 wk of age, inhibin-deficient ovaries do not show further antral development or undergo cumulus expansion. In addition, there are widespread alterations in the transcriptome of gonadotropin-treated Inha−/− granulosa cells, with significant changes in genes involved in extracellular matrix and cell-cell communication. These data indicate the gonadotropins initiate an improper program of cell differentiation prior to tumor formation in the absence of inhibins. PMID:20739397

  14. Adjuvant Growth Hormone for Ovulation Induction with Gonadotropins in the Treatment of a Woman with Hypopituitarism

    Directory of Open Access Journals (Sweden)

    Ariadne Daniel

    2012-01-01

    Full Text Available Objective. To report the prestimulation use of adjuvant GH for gonadotropin ovulation induction in a woman with hypopituitarism and GH deficiency who previously failed to respond. Design, Patients, and Measurements. A 31-year-old nulliparous woman presented with hypopituitarism and GH deficiency after failing ovulation induction with high dose gonadotropins. A trial of GH was undertaken for 5 months prior to ovulation induction resulting in normalization of IGF-I levels. Results. Women with hypopituitarism are known to have lower pregnancy rates after ovulation induction with need for higher doses of gonadotropins. A small subset of these patients do not ovulate. This patient had successful ovulation induction and pregnancy with prestimulation GH. Conclusions. This case suggests that the use of adjuvant GH in a GH-deficient patient several months before the use of human menopausal gonadotropin results in ovulation and pregnancy.

  15. Human Chorionic Gonadotropin (hCG) Regression Curve for Predicting Response to EMA/CO (Etoposide, Methotrexate, Actinomycin D, Cyclophosphamide and Vincristine) Regimen in Gestational Trophoblastic Neoplasia.

    Science.gov (United States)

    Rattanaburi, Athithan; Boonyapipat, Sathana; Supasinth, Yuthasak

    2015-01-01

    An hCG regression curve has been used to predict the natural history and response to chemotherapy in gestational trophoblastic disease. We constructed hCG regression curves in high-risk gestational trophoblastic neoplasia (GTN) treated with EMA/CO and identified an optimal hCG level to detect EMA/CO resistance in GTN. Eighty-one women with GTN treated with EMA/CO were classified as primary high-risk GTN (n=65) and single agent-resistance GTN (n=16). The hCG levels prior to each course of chemotherapy were plotted in the 10th, 50th, and 90th percentiles to construct the hCG regression curves. Diagnostic performance was evaluated for an optimal cut-off value. The median hCG levels were 264,482 mIU/mL mIU/mL and 495.5 mIU/mL mIU/mL for primary high-risk GTN and single agent-resistance GTN, respectively. The 50th percentile of the hCG level in primary high-risk GTN and single agent-resistance turned to normal before the 4th and the 2nd course of chemotherapy, respectively. The 90th percentile of the hCG level in primary high-risk GTN and single agent-resistance turned to normal before the 9th and the 2nd course of chemotherapy, respectively. The hCG level of ≥118.6 mIU/mL mIU/mL at the 5thcourse of EMA/CO predicted the EMA/CO resistance in primary high-risk GTN patients with a sensitivity of 85.7% and a specificity of 100%. EMA/CO resistance in primary high-risk GTN can be predicted by using an hCG regression curve in combination with the cut-off value of 118.6 mIU/mL at the 5thcourse of chemotherapy.

  16. Effect of gonadotropin secretion rate on the radiosensitivity of the rat luteinizing hormone-releasing hormone neuron and gonadotroph

    Energy Technology Data Exchange (ETDEWEB)

    Winterer, J.; Barnes, K.M.; Lichter, A.S.; Deluca, A.M.; Loriaux, D.L.; Cutler, G.B. Jr.

    1988-03-01

    To test the hypothesis that the functional state of hypothalamic LHRH neurons and pituitary gonadotrophs might alter their radiosensitivity, we determined the experimental conditions under which the gonadotropin response to castration could be impaired by a single dose of cranial irradiation. Single doses of cranial irradiation greater than 2000 rads were lethal to unshielded rats. Shielding of the oropharynx and esophagus allowed the animals to survive doses up to 5000 rads. Doses between 2000 and 5000 rads had no effect on basal gonadotropin levels for as long as 3 months after irradiation. Irradiation caused a dose- and time-dependent impairment, however, in the gonadotropin response to castration. Impairment of the gonadotropin levels of castrate animals occurred in animals that were irradiated either before or after castration. However, rats irradiated in the castrate state showed a decreased susceptibility to irradiation damage. Additionally, stimulation of the pituitary by LHRH agonist (LHRHa) 3 h before irradiation significantly reduced the impairment of gonadotropin secretion 12-20 weeks after irradiation (P less than 0.05). Thus, increased functional activity of the rat hypothalamus or pituitary at the time of irradiation, induced by either castration or acute LHRHa administration, was associated with some protection against the gonadotropin-lowering effect of irradiation. Based upon these data, we hypothesize that stimulation of gonadotropin secretion at the time of therapeutic cranial irradiation in humans might protect against subsequent impairment of gonadotropin secretion.

  17. Bilateral undescended testes classified according to preoperative and postoperative status of gonadotropins and inhibin B in relation to testicular histopathology at bilateral orchiopexy in infant boys

    DEFF Research Database (Denmark)

    Thorup, Jørgen Mogens; Petersen, Bodil Laub; Kvist, Kolja;

    2012-01-01

    In recent series of boys with cryptorchidism gonadotropin levels have been higher and serum inhibin B levels have been lower than normal. To some extent the serum values of inhibin B reflect the state of germinative epithelium in cryptorchid testes. We evaluated whether blood samples of gonadotro...... of gonadotropins and inhibin B as well as histopathology could be used to classify undescended testes....

  18. Pattern of human chorionic gonadotropin binding in the polycystic ovary

    Energy Technology Data Exchange (ETDEWEB)

    Brawer, J.; Richard, M.; Farookhi, R. (McGill Univ., Montreal, Quebec (Canada))

    1989-08-01

    The histologic evolution of polycystic ovaries in the estradiol valerate-treated rat coincides with the development of a unique plasma pattern of luteinizing hormone. To assess the role of luteinizing hormone in polycystic ovaries, it is necessary to evaluate the luteinizing hormone sensitivity of the specific tissues in the polycystic ovary. Therefore, we examined the pattern of luteinizing hormone binding sites in polycystic ovaries. Rats at 4 or 8 weeks after estradiol valerate treatment each received an intrajugular injection of iodine 125-labeled human chorionic gonadotropin. Some rats also received a 1000-fold excess of unlabeled human chorionic gonadotropin in the same injection. Ovaries were prepared for autoradiography. Dense accumulations of grains occurred over the theca of normal and atretic secondary follicles in all ovaries and over clusters of secondary interstitial cells. The iodine label was variable over the typically hypertrophied theca of precystic follicles. The theca of definitive cysts showed little or no label. These results indicate that cyst formation coincides with the loss of luteinizing hormone/human chorionic gonadotropin binding to the affected follicles.

  19. Repetitive thinking and depressive symptoms in a normal population : responses to normal negative events

    OpenAIRE

    Larsen, Simen Mjøen

    2016-01-01

    Some theories view repetitive thinking as a maladaptive coping response that exacerbates depressive symptoms and explains the sex difference in depression. Other theories view repetitive thinking as the chief mechanism for solving complex social problems. A central theoretical assumption in evolutionary psychology is that psychological mechanisms are sensitive to modern cues to ancestral fitness-relevant contexts. The measures that are currently used to probe repetitive thinking does not refl...

  20. A survey of Sertoli cell differentiation in men after gonadotropin suppression and in testicular cancer

    DEFF Research Database (Denmark)

    Tarulli, Gerard A; Stanton, Peter G; Loveland, Kate L

    2013-01-01

    It is widely held that the somatic cell population that is responsible for sperm development and output (Sertoli cells) is terminally differentiated and unmodifiable in adults. It is postulated, with little evidence, that Sertoli cells are not terminally differentiated in some phenotypes...... of infertility and testicular cancer. This study sought to compare markers of Sertoli cell differentiation in normospermic men, oligospermic men (undergoing gonadotropin suppression) and testicular carcinoma in situ (CIS) and seminoma samples. Confocal microscopy was used to assess the expression of markers...... of proliferation (PCNA and Ki67) and functional differentiation (androgen receptor). As additional markers of differentiation, the organization of Sertoli cell tight junction and associated proteins were assessed in specimens with carcinoma in situ. In normal men, Sertoli cells exhibited a differentiated phenotype...

  1. Rapid Anti-Inflammatory Effects of Gonadotropin-Releasing Hormone Antagonism in Rheumatoid Arthritis Patients with High Gonadotropin Levels in the AGRA Trial.

    Directory of Open Access Journals (Sweden)

    Anita Kåss

    Full Text Available Gonadotropin-releasing hormone (GnRH and pituitary gonadotropins, which appear to be proinflammatory, undergo profound secretory changes during events associated with rheumatoid arthritis (RA onset, flares, or improvement e.g. menopausal transition, postpartum, or pregnancy. Potential anti-inflammatory effects of GnRH-antagonists may be most pronounced in patients with high GnRH and gonadotropin levels. Therefore, we investigated the efficacy and safety of a GnRH-antagonist, cetrorelix, in RA patients with high gonadotropin levels.We report intention-to-treat post hoc analyses among patients with high gonadotropin levels (N = 53, i.e. gonadotropin levels>median, from our proof-of-concept, double-blind AGRA-study (N = 99. Patients with active longstanding RA, randomized to subcutaneous cetrorelix (5mg days1-2; 3mg days 3-5 or placebo, were followed through day 15. Only predefined primary and secondary endpoints were analyzed.The primary endpoint, Disease Activity Score of 28-joint counts with C-reactive protein (DAS28-CRP, improved with cetrorelix compared with placebo by day 5 (-1.0 vs. -0.4, P = 0∙010. By day 5, more patients on cetrorelix achieved at least a 20% improvement in the American College of Rheumatology scale (44% vs. 19%, P = 0.049, DAS28-CRP≤3.2 (24% vs. 0%, P = 0.012, and European League against Rheumatism 'Good-responses' (19% vs. 0%, P = 0.026. Tumor necrosis factor-α, interleukin-1β, interleukin-10, and CRP decreased with cetrorelix (P = 0.045, P = 0.034, P = 0.020 and P = 0.042 respectively compared with placebo by day 15. Adverse event rates were similar between groups.GnRH-antagonism produced rapid anti-inflammatory effects in RA patients with high gonadotropin levels. GnRH should be investigated further in RA.ClinicalTrials.gov NCT00667758.

  2. Beta-Human Chorionic Gonadotropin Producing Osteosarcoma of the Sacrum in a 26-Year-Old Woman: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Ryan Glass

    2015-01-01

    Full Text Available Ectopic secretion of beta-human chorionic gonadotropin is considered a poor prognostic marker in epithelial tumors. However, very few cases have been reported in sarcomas. We present the case of a 26-year-old female who presented with a metastatic osteosarcoma. She underwent usual testing prior to starting treatment and was found to have elevated levels of beta-human chorionic gonadotropin. As the patient was not pregnant, another source of beta-human chorionic gonadotropin secretion had to be considered. The tumor cells demonstrated positive staining for beta-human chorionic gonadotropin by immunohistochemistry, and serum levels of beta-human chorionic gonadotropin were used to monitor tumor progression and response to chemotherapy. We review the literature and discuss a potential role of beta-human chorionic gonadotropin in the treatment of such patients.

  3. Is the assumption of normality or log-normality for continuous response data critical for benchmark dose estimation?

    Science.gov (United States)

    Shao, Kan; Gift, Jeffrey S; Setzer, R Woodrow

    2013-11-01

    Continuous responses (e.g. body weight) are widely used in risk assessment for determining the benchmark dose (BMD) which is used to derive a U.S. EPA reference dose. One critical question that is not often addressed in dose-response assessments is whether to model the continuous data as normally or log-normally distributed. Additionally, if lognormality is assumed, and only summarized response data (i.e., mean±standard deviation) are available as is usual in the peer-reviewed literature, the BMD can only be approximated. In this study, using the "hybrid" method and relative deviation approach, we first evaluate six representative continuous dose-response datasets reporting individual animal responses to investigate the impact on BMD/BMDL estimates of (1) the distribution assumption and (2) the use of summarized versus individual animal data when a log-normal distribution is assumed. We also conduct simulation studies evaluating model fits to various known distributions to investigate whether the distribution assumption has influence on BMD/BMDL estimates. Our results indicate that BMDs estimated using the hybrid method are more sensitive to the distribution assumption than counterpart BMDs estimated using the relative deviation approach. The choice of distribution assumption has limited impact on the BMD/BMDL estimates when the within dose-group variance is small, while the lognormality assumption is a better choice for relative deviation method when data are more skewed because of its appropriateness in describing the relationship between mean and standard deviation. Additionally, the results suggest that the use of summarized data versus individual response data to characterize log-normal distributions has minimal impact on BMD estimates.

  4. Is the assumption of normality or log-normality for continuous response data critical for benchmark dose estimation?

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Kan, E-mail: Shao.Kan@epa.gov [ORISE Postdoctoral Fellow, National Center for Environmental Assessment, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Gift, Jeffrey S. [National Center for Environmental Assessment, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Setzer, R. Woodrow [National Center for Computational Toxicology, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)

    2013-11-01

    Continuous responses (e.g. body weight) are widely used in risk assessment for determining the benchmark dose (BMD) which is used to derive a U.S. EPA reference dose. One critical question that is not often addressed in dose–response assessments is whether to model the continuous data as normally or log-normally distributed. Additionally, if lognormality is assumed, and only summarized response data (i.e., mean ± standard deviation) are available as is usual in the peer-reviewed literature, the BMD can only be approximated. In this study, using the “hybrid” method and relative deviation approach, we first evaluate six representative continuous dose–response datasets reporting individual animal responses to investigate the impact on BMD/BMDL estimates of (1) the distribution assumption and (2) the use of summarized versus individual animal data when a log-normal distribution is assumed. We also conduct simulation studies evaluating model fits to various known distributions to investigate whether the distribution assumption has influence on BMD/BMDL estimates. Our results indicate that BMDs estimated using the hybrid method are more sensitive to the distribution assumption than counterpart BMDs estimated using the relative deviation approach. The choice of distribution assumption has limited impact on the BMD/BMDL estimates when the within dose-group variance is small, while the lognormality assumption is a better choice for relative deviation method when data are more skewed because of its appropriateness in describing the relationship between mean and standard deviation. Additionally, the results suggest that the use of summarized data versus individual response data to characterize log-normal distributions has minimal impact on BMD estimates. - Highlights: • We investigate to what extent the distribution assumption can affect BMD estimates. • Both real data analysis and simulation study are conducted. • BMDs estimated using hybrid method are more

  5. Empathy, normality and responsiveness among street-level bureaucrats

    DEFF Research Database (Denmark)

    Møller, Marie Østergaard; Nielsen, Vibeke Lehmann

    2014-01-01

    Within the public sector it is a permanent dilemma that we on one hand – on the grounds of effectiveness and flexibility – want employees to have discretion and autonomy, but at the same time want to make sure that citizens and clients of the public sector are treated equally and independent of w...... this paper discusses and analyzes how perceptions of local target group’s problem portfolio (normality perceptions) conditions the behavioral effects of personal attributes/personality traits (differences in empathy)....

  6. Leg contracture in mice: an assay of normal tissue response

    Energy Technology Data Exchange (ETDEWEB)

    Stone, H.B.

    1984-07-01

    Leg contracture, defined as the difference in extensibility of the control and irradiated hind legs of mice, was found to correlate with single doses of radiation from about 20 to 80 Gy. The time of development of the early phase of the response coincided with that reported for the appearance of the acute skin response, and in some cases, partially reversed as this reaction healed. The contracture then progressed again at a moderate rate through 90 days, and then more slowly through one year. Skin contraction, measured by decrease in intertattoo distance, was assayed in the same mice. It followed the same time course as leg contracture, but had a different dose-response relationship. To determine the contribution of skin contraction to the overall leg contracture response, mice were sacrificed and the leg contracture measured before and after the removal of the skin of the leg. After doses of up to 30 Gy, little contracture remained from skinning the leg, indicating that skin contraction was largely responsible for leg contracture in this dose range. After doses of about 45 Gy and above, some contracture remained in the skinned legs, although less than in intact legs. There was little or no enhancement of either skin contraction or leg contracture by the hypoxic cell sensitizers metronidazole or misonidazole.

  7. Characterization of renal response to prolonged immersion in normal man

    Science.gov (United States)

    Epstein, M.; Denunzio, A. G.; Ramachandran, M.

    1980-01-01

    ?jDuring the initial phase of space flight, there is a translocation of fluid from the lower parts of the body to the central vascular compartment with a resultant natriuresis, diuresis, and weight loss. Because water immersion is regarded as an appropriate model for studying the redistribution of fluid that occurs in weightlessness, an immersion study of relatively prolonged duration was carried out in order to characterize the temporal profile of the renal adaptation to central hypervolemia. Twelve normal male subjects underwent an immersion study of 8-h duration in the sodium-replete state. Immersion resulted in marked natriuresis and diuresis which were sustained throughout the immersion period. The failure of that natriuresis and diuresis of immersion to abate or cease despite marked extracellular fluid volume contraction as evidenced by a mean weight loss of -2.2 + or - 0.3 kg suggests that central blood volume was not restored to normal and that some degree of central hypervolemia probably persisted.

  8. Normal and Malignant Cells Exhibit Differential Responses to Calcium Electroporation

    DEFF Research Database (Denmark)

    Frandsen, Stine K; Krüger, Mie B; Mangalanathan, Uma M

    2017-01-01

    tissue after calcium electroporation but decreased in skin tissue 4 hours after treatment to levels comparable with untreated controls, whereas calcium content endured at high levels in tumor tissue. Mechanistic experiments in vitro indicated that calcium influx was similar in fibroblasts and cancer...... necrosis, with a range of sensitivities observed (36%-88%) 2 days after treatment. Necrosis was induced using calcium concentrations of 100-500 mmol/L and injection volumes 20%-80% of tumor volume. Notably, only limited effects were seen in normal tissue. Calcium content increased >7-fold in tumor and skin......Calcium electroporation may offer a simple general tool for anticancer therapy. Transient permeabilization of cancer cell membranes created by applying short, high-voltage pulses in tumors enables high calcium influxes that trigger cell death. In this study, we compared the relative sensitivity...

  9. Transcriptional Analysis of Normal Human Fibroblast Responses to Microgravity Stress

    Institute of Scientific and Technical Information of China (English)

    Yongqing Liu; Eugenia Wang

    2008-01-01

    To understand the molecular mechanism (s) of how spaceflight affects cellular signaling pathways, quiescent normal human WI-38 fibroblasts were flown on the STS-93 space shuttle mission. Subsequently, RNA samples from the space flown and ground-control cells were used to construct two cDNA libraries, which were then processed for suppression subtractive hybridization (SSH) to identify spaceflight-specific gene expression. The SSH data show that key genes related to oxidative stress, DNA repair, and fatty acid oxidation are activated by spaceflight, suggesting the induction of cellular oxidative stress. This is further substantiated by the up-regulation of neuregulin 1 and the calcium-binding protein calmodulin 2. Another obvious stress sign is that spaceflight evokes the Ras/mitogen-activated protein kinase and phosphatidylinositol-3 kinase signaling pathways, along with up-regulating several G1-phase cell cycle traverse genes. Other genes showing up regulation of expression are involved in protein synthesis and pro-apoptosis, as well as pro-survival. Interactome analysis of functionally related genes shows that c-Myc is the "hub" for those genes showing significant changes. Hence, our results suggest that microgravity travel may impact changes in gene expression mostly associated with cellular stress signaling, directing cells to either apoptotic death or premature senescence.

  10. The Study on Immuno-response and Antisera Properties of Recombinant β-subunit of Human Chorionic Gonadotropin in C57 Black Mouse

    Institute of Scientific and Technical Information of China (English)

    周清平; 申庆祥; 李卫华; 丁训诚

    1997-01-01

    In this study, the immuno-response of recombinant hCG-β and natural hCCwas compctratively investigated by using Freund's adjuvant. The results showed that, the properties and merits of the antibodies elicited by both kinds of hCG-β were similar. The antisera had high affinity for binding with hCG (Kαγβ=5.86×106/mol/L, Kαγβ=8.18×106/mol/L), and were found to be effective in in hibiting the binding of 125I-hCG to receptors in rat testes. Results also indicated that, similar to the antisera induced by natural hCG-β, the recombinant hCG-β induced antisera had capacity of neutralizing the biological activities of hCG. Recombinant hCG-β could be used as an immunogen for contraceptive vaccine.

  11. A regulator of G Protein signaling, RGS3, inhibits gonadotropin-releasing hormone (GnRH-stimulated luteinizing hormone (LH secretion

    Directory of Open Access Journals (Sweden)

    Musgrove Lois C

    2001-11-01

    Full Text Available Abstract Background Luteinizing hormone secreted by the anterior pituitary gland regulates gonadal function. Luteinizing hormone secretion is regulated both by alterations in gonadotrope responsiveness to hypothalamic gonadotropin releasing hormone and by alterations in gonadotropin releasing hormone secretion. The mechanisms that determine gonadotrope responsiveness are unknown but may involve regulators of G protein signaling (RGSs. These proteins act by antagonizing or abbreviating interaction of Gα proteins with effectors such as phospholipase Cβ. Previously, we reported that gonadotropin releasing hormone-stimulated second messenger inositol trisphosphate production was inhibited when RGS3 and gonadotropin releasing hormone receptor cDNAs were co-transfected into the COS cell line. Here, we present evidence for RGS3 inhibition of gonadotropin releasing hormone-induced luteinizing hormone secretion from cultured rat pituitary cells. Results A truncated version of RGS3 (RGS3T = RGS3 314–519 inhibited gonadotropin releasing hormone-stimulated inositol trisphosphate production more potently than did RSG3 in gonadotropin releasing hormone receptor-bearing COS cells. An RSG3/glutathione-S-transferase fusion protein bound more 35S-Gqα than any other member of the G protein family tested. Adenoviral-mediated RGS3 gene transfer in pituitary gonadotropes inhibited gonadotropin releasing hormone-stimulated luteinizing hormone secretion in a dose-related fashion. Adeno-RGS3 also inhibited gonadotropin releasing hormone stimulated 3H-inositol phosphate accumulation, consistent with a molecular site of action at the Gqα protein. Conclusions RGS3 inhibits gonadotropin releasing hormone-stimulated second messenger production (inositol trisphosphate as well as luteinizing hormone secretion from rat pituitary gonadotropes apparently by binding and suppressing the transduction properties of Gqα protein function. A version of RGS3 that is amino

  12. Specific activity of radioiodine-labelled human chorionic gonadotropin ligand

    Energy Technology Data Exchange (ETDEWEB)

    Crespi, M. (South African Inst. for Medical Research, Sandringham. National Inst. for Virology); Kay, G.W.; Van der Walt, L.A. (South African Inst. for Medical Research, Johannesburg. Dept. of Pathology)

    1983-10-01

    The article deals with the determination of the specific activity of radioiodine-labelled human chorionic gonadotropin ligand. The iodiation of human chorionic gonadotropin and the counting efficiency of /sup 125/I are discussed.

  13. Adrenocorticotropic hormone elicits gonadotropin secretion in premenopausal women

    NARCIS (Netherlands)

    J. Aleknavičiūtė (Jūratė); J.H.M. Tulen (Joke); Timmermans, M. (Mirjam); Y.B. de Rijke (Yolanda); E.F.C. van Rossum (Liesbeth); F.H. de Jong (Frank); S.A. Kushner (Steven)

    2016-01-01

    textabstractSTUDY QUESTION Does adrenocorticotropic hormone (ACTH) induce gonadotropin release in premenopausal women? SUMMARY ANSWER Administration of ACTH stimulates gonadotropin release, most likely by stimulation of the production of cortisol, in premenopausal women. WHAT IS KNOWN ALREADY In

  14. Analysis of a Dynamic Viscoelastic Contact Problem with Normal Compliance, Normal Damped Response, and Nonmonotone Slip Rate Dependent Friction

    Directory of Open Access Journals (Sweden)

    Mikaël Barboteu

    2016-01-01

    Full Text Available We consider a mathematical model which describes the dynamic evolution of a viscoelastic body in frictional contact with an obstacle. The contact is modelled with a combination of a normal compliance and a normal damped response law associated with a slip rate-dependent version of Coulomb’s law of dry friction. We derive a variational formulation and an existence and uniqueness result of the weak solution of the problem is presented. Next, we introduce a fully discrete approximation of the variational problem based on a finite element method and on an implicit time integration scheme. We study this fully discrete approximation schemes and bound the errors of the approximate solutions. Under regularity assumptions imposed on the exact solution, optimal order error estimates are derived for the fully discrete solution. Finally, after recalling the solution of the frictional contact problem, some numerical simulations are provided in order to illustrate both the behavior of the solution related to the frictional contact conditions and the theoretical error estimate result.

  15. Effect of certain toxicants on gonadotropin-induced ovarian non-esterified cholesterol depletion and steroidogenic enzyme stimulation of the common carp Cyprinus carpio in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Mukherjee, D.; Guha, D.; Kumar, V. (Department of Zoology, University of Kalyani (India))

    1992-06-01

    Isolated ovarian tissues from the common carp, Cyprinus carpio were incubated in vitro to obtain a discrete effect of four common toxicants of industrial origin, namely phenol, sulfide, mercuric chloride and cadmium chloride, on gonadotropin-induced alteration of nonesterified and esterified cholesterol and steroidogenic enzymes, delta 5-3 beta-HSD and 17 beta-HSD activity. Stage II ovarian tissue containing 30-40% mature oocytes were shown to be most responsive to gonadotropins in depleting only nonesterified cholesterol moiety and stimulating the activity of both. Safe doses of above mentioned toxicants when added separately to stage II ovarian tissue with oLH (1 microgram/incubation) gonadotropin-induced depletion of nonesterified cholesterol and gonadotropin-induced stimulation of the activity of both enzymes was significantly inhibited. Esterified cholesterol remained almost unaltered. Findings clearly indicate the impairment of gonadotropin induced fish ovarian steroidogenesis by the four toxicants separately.

  16. Evaluating the ovarian cancer gonadotropin hypothesis

    DEFF Research Database (Denmark)

    Lee, Alice W; Tyrer, Jonathan P; Doherty, Jennifer A

    2015-01-01

    OBJECTIVE: Ovarian cancer is a hormone-related disease with a strong genetic basis. However, none of its high-penetrance susceptibility genes and GWAS-identified variants to date are known to be involved in hormonal pathways. Given the hypothesized etiologic role of gonadotropins, an assessment o...

  17. Regulation of gonadotropin receptor gene expression

    NARCIS (Netherlands)

    A.P.N. Themmen (Axel); R. Kraaij (Robert); J.A. Grootegoed (Anton)

    1994-01-01

    textabstractThe receptors for the gonadotropins differ from the other G protein-coupled receptors by having a large extracellular hormone-binding domain, encoded by nine or ten exons. Alternative splicing of the large pre-mRNA of approximately 100 kb can result in mRNA species that encode truncated

  18. Adult onset pseudohypoparathyroidism type-1b with normal phosphaturic response to exogenous parathyroid hormone

    Directory of Open Access Journals (Sweden)

    Sandeep Kharb

    2011-01-01

    Full Text Available Pseudohypoparathyroidism type-1b is a hereditary disorder of clinical hypoparathyroidism without AHO phenotype, characterized by blunted nephrogenous cyclic-AMP (cAMP response to exogenous parathyroid hormone (PTH. Here we report a young adult presenting with hypocalcemic tetany with raised PTH levels. His urinary cAMP response to exogenous PTH (recombinant 1-34 was blunted; however, phosphaturic response was normal.

  19. Polymorphism of gonadotropin action: clinical implications

    Institute of Scientific and Technical Information of China (English)

    IlpoT.Huhtaniemi

    2000-01-01

    It has recently became apparent that the structural heterogeneity of gonadotropin molecules can contribute to variations of their action in different physiological and pathophysiological conditions. One reason for the structural variations of circulating gonadotropin molecules is the rnicroheterogeneity caused by the variability of glycosylation of individual gonadotropin molecules. The carbohydrate moieties of gonadotropins are important for their intrinsic bioactivity, as reflected by measurement of their bioactivity to immunoreactivity (B/I) ratios. We have reassessed this phenomenon by improved in vitro bioassay and immunoassay methods, and it appears that the intrinsic bioactivity of gonadotropins, in particular of LH, is more constant than previously assumed. Many of the previously documented differences, some even considered diagnostic for certain clinical conditions, have turned out to be methodological artifacts. The first part of this review summarizes our recent findings on the B/I ratios of LH, with special reference to the male. The second part of this review describes a common polymorphism that was recently discovered in the gene of the LH β-subtmit. The variant LHβ allele contains two point mutations, which introduce to LH two amino acid changes and an extra glycosylation site. The LH variant is common world-wide, with carrier frequency varying from 0 to 52% in various ethnic groups. The LH variant differs functionally from wild-type LH, and it seems to predispose its carriers,both men and women, to mild aberrations of reproductive function. It is important for the clinician to be aware of this variant LH form, not detected by all immunoassays, because it may explain some aberrant results of LH measurements in patient samples. (Asian J Androl 2000 Dec;2:241-246)

  20. Induction of Gonadotropins for Reproductive Control

    Directory of Open Access Journals (Sweden)

    Elza Ibrahim Auerkari

    2015-10-01

    Full Text Available Much of the recent research on gonadotropin – related control processes of reproduction and reproductive maturation has concentrated on the neuronal and molecular biology of gonadotropin release. The reproductive development of healthy mammals requires appropriate fetal develompment and migration of the neural network controlling and including the gonadotropin releasing hormone (GnRH – producing neurons that are needed to regulate GnRH and luteinizing hormone (LH release. GnRH is also necessary for the development of the gonadotropin – producing pituitary gland. The fetal gonads respon to GnRH – induced LH production by producing the gonadal steroids required for further reproductive differentiation. Pubertal maturation is characterised by increases in LH levels, representing the corresponding pulsatile release of GnRH. This GnRH pulse generator appears to be an intrinsic property of the arcuate nucleus at the medial basal hypothalamus. The generator activity can be mediated by the neurotransmitter aspartate which activates neurons of the hypothalamus, inducing acuate releases of GnRH and hence initiates puberty. A major factor in human reproductive maturation is the decrease in the age of puberty, caused by improvement of nutritional conditions due to the socio – economic development. This implies that the pubertal activation of GnRH secretion depends on metabolic conditions. Of the substances that mediate the metabolic condition to the neuronal network regulating GnRH secretion, the role of the neuropeptide Y (NPY appears instrumental : for healthy mammals less food means more NPY, and accumulated NPY makes food to become sex. NPY does this by regulating the appropriate hypothalamic functions including the neuroendocrine control of gonadotropin release.

  1. Capturing Abnormal Personality With Normal Personality Inventories: An Item Response Theory Approach

    OpenAIRE

    2008-01-01

    Correlational and factor-analytic methods indicate that abnormal and normal personality constructs may be tapping the same underlying latent trait. However, they do not systematically demonstrate that measures of abnormal personality capture more extreme ranges of the latent trait than measures of normal range personality. Item Response Theory (IRT) methods, in contrast, do provide this information. In the present study, we use IRT methods to evaluate the range of the latent trait assessed wi...

  2. Plasma vanillylmandelic acid level as an index of psychological stress response in normal subjects.

    Science.gov (United States)

    Fukuda, M; Hata, A; Niwa, S; Hiramatsu, K; Honda, H; Nakagome, K; Iwanami, A

    1996-06-26

    The relationships between psychological stress responses and plasma levels of vanillylmandelic acid (VMA), 3-methoxy-4-hydroxyphenylglycol (MHPG), homovanillic acid (HVA), and 5-hydroxyindolacetic acid (5-HIAA) were investigated in normal volunteers. Two questionnaires were used to measure stress: the Psychological Stress Response Scale (PSRS) and the State-Trait Anxiety Inventory (STAI). Plasma levels of VMA--but not MHPG, HVA, and 5-HIAA--showed significant positive correlations with PSRS emotional and cognitive-behavioral stress and STAI state anxiety. Significant positive correlations were also found between plasma levels of VMA and MHPG and psychological stress responses measured repeatedly in a longitudinal study of an Olympic swimmer. Plasma VMA measurements, which reflect the level of activity of the peripheral sympathetic nervous system, may provide a useful biochemical index of psychological stress responses in normal subjects.

  3. Normalization of the heart rate response to exercise 6 months after cardiac transplantation.

    Science.gov (United States)

    Buendía Fuentes, F; Martínez-Dolz, L; Almenar Bonet, L; Sánchez-Lázaro, I; Navarro Manchón, J; Sánchez-Gómez, J M; Raso Raso, R; Agüero-Ramón-Llin, J; Sancho-Tello de Carranza, M J; Salvador Sanz, A

    2010-10-01

    Heart transplant recipients show an abnormal heart rate (HR) response to exercise due to complete cardiac denervation after surgery. They present elevated resting HR, minimal increase in HR during exercise, with maximal HR reached during the recovery period. The objective of this study was to study the frequency of normalization of the abnormal HR in the first 6 months after transplantation. We prospectively studied 27 heart transplant recipients who underwent treadmill exercise tests at 2 and 6 months after heart transplantation (HT). HR responses to exercise were classified as normal or abnormal, depending on achieving all of the following criteria: (1) increased HR for each minute of exercise, (2) highest HR at the peak exercise intensity, and (3) decreased HR for each minute of the recovery period. The HR response at 2 months was compared with the results at 6 months post-HT. At 2 months post-HT, 96.3% of the patients showed abnormal HR responses to exercise. Four months later, 11 patients (40.7%) had normalized HR responses (Pexercise (124.4±63.8 seconds in the first test and 55.6±44.6 seconds in the second). A significant improvement in exercise capacity and chronotropic competence was also shown in tests performed at 6 months after surgery. We observed important improvements in HR responses to exercise at 6 months after HT, which may represent early functional cardiac reinnervation. Copyright © 2010 Elsevier Inc. All rights reserved.

  4. Precocious puberty due to human chorionic gonadotropin secreting germinoma

    Directory of Open Access Journals (Sweden)

    Daiane J Nascimento

    2012-01-01

    Full Text Available This study aims to report a rare case of precocious puberty (PP due to a human chorionic gonadotropin (hCG-producing germinoma located in the suprasellar region. A 10-year-old male patient presented with sexual precocity, headache, drowsiness, loss of appetite, and papilledema. Significant acceleration of bone age in relation to chronological age, high serum total testosterone levels, and hypopituitarism (unresponsiveness to stimulation test were observed. Magnetic resonance imaging (MRI of the brain showed a large suprasellar tumor and triventricular dilatation. High hCG levels were found in both blood and cerebrospinal fluid. Hormone replacement therapy and transcranial surgery associated with radiotherapy were performed, with complete regression of sexual characteristics and normal laboratory tests post-operatively. Clinical and laboratory findings, in addition to MRI scans, led to the diagnosis of an hCG-producing tumor and PP, which represents a rare report in the literature.

  5. Capturing abnormal personality with normal personality inventories: an item response theory approach.

    Science.gov (United States)

    Walton, Kate E; Roberts, Brent W; Krueger, Robert F; Blonigen, Daniel M; Hicks, Brian M

    2008-12-01

    Correlational and factor-analytic methods indicate that abnormal and normal personality constructs may be tapping the same underlying latent trait. However, they do not systematically demonstrate that measures of abnormal personality capture more extreme ranges of the latent trait than measures of normal range personality. Item Response Theory (IRT) methods, in contrast, do provide this information. In the present study, we use IRT methods to evaluate the range of the latent trait assessed with a normal personality measure and a measure of psychopathy as one example of an abnormal personality construct. Contrary to the expectation that the measure of psychopathy would be more extreme than the measure of normal personality traits, the measures overlapped substantially in terms of the regions of the latent trait for which they provide information. Moreover, both types of inventories were limited in terms of measurement bandwidth, such that they did not provide information across the entire latent trait continuum. Implications and future directions are discussed.

  6. The gonadotropin-releasing hormone antagonist protocol--the protocol of choice for the polycystic ovary syndrome patient undergoing controlled ovarian stimulation

    DEFF Research Database (Denmark)

    Kol, Shahar; Homburg, Roy; Alsbjerg, Birgit

    2012-01-01

    Polycystic ovary syndrome (PCOS) patients are prone to develop ovarian hyperstimulation syndrome (OHSS), a condition which can be minimized or completely eliminated by the use of a gonadotropin-releasing hormone agonist (GnRHa) trigger. In this commentary paper, we maintain that the gonadotropin-releasing...... hormone antagonist protocol should be the protocol of choice for the PCOS patient undergoing ovarian stimulation with gonadotropins for in vitro fertilization. If an excessive ovarian response is encountered, the clinician will always have two options: either to trigger final oocyte maturation...

  7. Pitch-induced responses in the right auditory cortex correlate with musical ability in normal listeners.

    Science.gov (United States)

    Puschmann, Sebastian; Özyurt, Jale; Uppenkamp, Stefan; Thiel, Christiane M

    2013-10-23

    Previous work compellingly shows the existence of functional and structural differences in human auditory cortex related to superior musical abilities observed in professional musicians. In this study, we investigated the relationship between musical abilities and auditory cortex activity in normal listeners who had not received a professional musical education. We used functional MRI to measure auditory cortex responses related to auditory stimulation per se and the processing of pitch and pitch changes, which represents a prerequisite for the perception of musical sequences. Pitch-evoked responses in the right lateral portion of Heschl's gyrus were correlated positively with the listeners' musical abilities, which were assessed using a musical aptitude test. In contrast, no significant relationship was found for noise stimuli, lacking any musical information, and for responses induced by pitch changes. Our results suggest that superior musical abilities in normal listeners are reflected by enhanced neural encoding of pitch information in the auditory system.

  8. Laboratory observations of fault strength in response to changes in normal stress

    Science.gov (United States)

    Kilgore, Brian D.; Lozos, Julian; Beeler, Nicholas M.; Oglesby, David

    2012-01-01

    Changes in fault normal stress can either inhibit or promote rupture propagation, depending on the fault geometry and on how fault shear strength varies in response to the normal stress change. A better understanding of this dependence will lead to improved earthquake simulation techniques, and ultimately, improved earthquake hazard mitigation efforts. We present the results of new laboratory experiments investigating the effects of step changes in fault normal stress on the fault shear strength during sliding, using bare Westerly granite samples, with roughened sliding surfaces, in a double direct shear apparatus. Previous experimental studies examining the shear strength following a step change in the normal stress produce contradictory results: a set of double direct shear experiments indicates that the shear strength of a fault responds immediately, and then is followed by a prolonged slip-dependent response, while a set of shock loading experiments indicates that there is no immediate component, and the response is purely gradual and slip-dependent. In our new, high-resolution experiments, we observe that the acoustic transmissivity and dilatancy of simulated faults in our tests respond immediately to changes in the normal stress, consistent with the interpretations of previous investigations, and verify an immediate increase in the area of contact between the roughened sliding surfaces as normal stress increases. However, the shear strength of the fault does not immediately increase, indicating that the new area of contact between the rough fault surfaces does not appear preloaded with any shear resistance or strength. Additional slip is required for the fault to achieve a new shear strength appropriate for its new loading conditions, consistent with previous observations made during shock loading.

  9. Evidence for cAMP as a mediator of gonadotropin secretion from male pituitaries

    Energy Technology Data Exchange (ETDEWEB)

    Bourne, G.A.; Baldwin, D.M.

    1987-09-01

    The purpose of this study was to use sodium flufenamate, a compound that inhibits gonadotropin-releasing hormone (GnRH)-stimulated adenosine 3',5'-cyclic monophosphate (cAMP) production in the pituitary, to evaluate the potential role of cAMP as a mediator of GnRH-stimulated gonadotropin secretion from male pituitaries. Quartered male pituitaries were perifused at 37/sup 0/C and sequential effluent fractions collected every 10 min. Infusions of GnRH resulted in a twofold increase in luteinizing hormone (LH) and follicle-stimulating hormone (FSH) secretion. Cycloheximide, 5 ..mu..M, completely inhibited the GnRH-stimulated LH and FSH secretion. Infusions of 0.1 mM flufenamate had similar effects on gonadotropin secretion as cycloheximide, whereas the administration of 5 mM dibutyryl cAMP in combination with GnRH and flufenamate restored the secretory responses of both hormones. The flufenamate-inhibited GnRH stimulated LH and FSH release, which was restored by DBcAMP and appeared to be protein synthesis dependent and specific for cAMP.These results suggest an indirect role for cAMP as a mediator of gonadotropin secretion from male pituitaries. However, in contrast to female pituitaries, the secretion of these hormones form male pituitaries is completely dependent on cAMP and de novo protein synthesis.

  10. Secretion of beta-human chorionic gonadotropin by non-small cell lung cancer: a case report

    Directory of Open Access Journals (Sweden)

    Varma Seema

    2011-01-01

    Full Text Available Abstract Introduction We describe a case of non-small cell lung cancer that was found to stain positive for beta-human chorionic gonadotropin on immunohistochemistry. Only a few case reports have described lung cancers that secrete beta-human chorionic gonadotropin. Case presentation A 68-year-old Caucasian man presented with symptoms of weakness, fatigue and weight loss for the past two months. On examination, he was found to have generalized lymphadenopathy, and radiologic workup revealed numerous metastases in the lungs, liver and kidneys. Biopsy of the supraclavicular lymph node revealed metastatic large cell lung cancer with beta-human chorionic gonadotropin hormone positivity. The serum beta-human chorionic gonadotropin level was 11,286 mIU/ml (upper limit of normal, 0.5 mIU/ml in non-pregnant females. He was diagnosed with stage 4 lung non-small cell lung cancer. The patient refused chemotherapy. He was discharged home with hospice care. Conclusion The markedly elevated serum values of beta-human chorionic gonadotropin initially prompted the medical team to investigate germinal tumors. In the presence of a negative testicular ultrasound, workup was performed to find an extratesticular source of the tumor. Finally, the diagnosis was made with a tissue biopsy. This case illustrates that atypical markers can be seen in many cancers, emphasizing the role of immunohistochemistry and tissue biopsy in establishing the diagnosis.

  11. Normalizing and scaling of data to derive human response corridors from impact tests.

    Science.gov (United States)

    Yoganandan, Narayan; Arun, Mike W J; Pintar, Frank A

    2014-06-01

    It is well known that variability is inherent in any biological experiment. Human cadavers (Post-Mortem Human Subjects, PMHS) are routinely used to determine responses to impact loading for crashworthiness applications including civilian (motor vehicle) and military environments. It is important to transform measured variables from PMHS tests (accelerations, forces and deflections) to a standard or reference population, termed normalization. The transformation process should account for inter-specimen variations with some underlying assumptions used during normalization. Scaling is a process by which normalized responses are converted from one standard to another (example, mid-size adult male to large-male and small-size female adults, and to pediatric populations). These responses are used to derive corridors to assess the biofidelity of anthropomorphic test devices (crash dummies) used to predict injury in impact environments and design injury mitigating devices. This survey examines the pros and cons of different approaches for obtaining normalized and scaled responses and corridors used in biomechanical studies for over four decades. Specifically, the equal-stress equal-velocity and impulse-momentum methods along with their variations are discussed in this review. Methods ranging from subjective to quasi-static loading to different approaches are discussed for deriving temporal mean and plus minus one standard deviation human corridors of time-varying fundamental responses and cross variables (e.g., force-deflection). The survey offers some insights into the potential efficacy of these approaches with examples from recent impact tests and concludes with recommendations for future studies. The importance of considering various parameters during the experimental design of human impact tests is stressed.

  12. Neurological damage disrupts normal sex differences in psychophysiological responsiveness to music.

    Science.gov (United States)

    Belfi, Amy M; Chen, Kuan-Hua; Schneider, Brett; Tranel, Daniel

    2016-01-01

    Men and women often display different physiological responses to emotional stimuli, and these responses can be affected by brain damage. Here, we investigated how brain damage differentially affects electrodermal responses based on sex. We studied neurologically normal, healthy adults and a sample of neurological patients. Participants listened to music, an emotional stimulus that reliably elicits skin conductance responses (SCRs). Electrodermal activity was recorded while participants listened to musical clips. When analyzing the data without regard to sex, there were no differences between healthy and brain-damaged participants in their SCRs. However, we found a significant interaction between brain injury status and sex. For men, brain damage significantly reduced SCRs. For women, there were no differences between brain-damaged participants and neurologically healthy participants. These findings illustrate the importance of including demographic variables, such as sex, when investigating brain-behavior relationships with a psychophysiological dependent variable.

  13. Optimization of correlated multi-response quality engineering by the upside-down normal loss function

    Science.gov (United States)

    Zeybek, Melis; Köksoy, Onur

    2016-08-01

    Most of the published literature on robust design is basically concerned with a single response. However, the reality is that common industrial problems usually involve several quality characteristics, which are often correlated. Traditional approaches to multidimensional quality do not offer much information on how much better or worse a process is when finding optimal settings. Köksoy and Fan [Engineering Optimization 44 (8): 935-945] pointed out that the upside-down normal loss function provides a more reasonable risk assessment to the losses of being off-target in product engineering research. However, they only consider the single-response case. This article generalizes their idea to more than one response under possible correlations and co-movement effects of responses on the process loss. The response surface methodology has been adapted, estimating the expected multivariate upside-down normal loss function of a multidimensional system to find the optimal control factor settings of a given problem. The procedure and its merits are illustrated through an example.

  14. Normal and abnormal face selectivity of the M170 response in developmental prosopagnosics.

    Science.gov (United States)

    Harris, Alison M; Duchaine, Bradley C; Nakayama, Ken

    2005-01-01

    Developmental prosopagnosia is a lifelong impairment in face recognition despite normal low-level visual processing. Here we used magnetoencephalography (MEG) to examine the M170 response, a component occurring approximately 170 ms after stimulus onset, in a group of five developmental prosopagnosics. In normal subjects, the M170 is "face-selective", with a consistently higher amplitude to faces than to a wide variety of other visual stimulus categories; the N170, a component recorded using event-related potentials (ERP) and thought to be analogous to the M170, also shows this "face selectivity". Two previous ERP studies with developmental prosopagnosics have found attenuation or absence of face selectivity in the N170 response of these subjects [Bentin, S., Deouell, L. Y., and Soroker, N. (1999). Selective visual streaming in face recognition: Evidence from developmental prosopagnosia. Neuroreport, 10, 823-827; Kress, T., and Daum, I. (2003). Event-related potentials reflect impaired face recognition in patients with congenital prosopagnosia. Neuroscience Letters, 352, 133-136]. Three of our developmental prosopagnosic group showed this non-selective pattern at the M170 while the remaining two prosopagnosics were indistinguishable from normal controls. Thus, impaired face recognition is not necessarily correlated with an absence of the "face-selective" M170. Furthermore, ERP recordings collected simultaneously in the two developmental prosopagnosics with seemingly selective M170s also showed N170s within the same normal selective range, demonstrating that the face-selective signals found with MEG are not due to differences between MEG and ERP. While the presence of face selectivity at these neurophysiological markers is insufficient for predicting normal behavioral performance with faces, it could help to distinguish different classes of face recognition deficits.

  15. Differentiating shunt-responsive normal pressure hydrocephalus from Alzheimer disease and normal aging: pilot study using automated MRI brain tissue segmentation.

    Science.gov (United States)

    Serulle, Yafell; Rusinek, Henry; Kirov, Ivan I; Milch, Hannah; Fieremans, Els; Baxter, Alexander B; McMenamy, John; Jain, Rajan; Wisoff, Jeffrey; Golomb, James; Gonen, Oded; George, Ajax E

    2014-10-01

    Evidence suggests that normal pressure hydrocephalus (NPH) is underdiagnosed in day to day radiologic practice, and differentiating NPH from cerebral atrophy due to other neurodegenerative diseases and normal aging remains a challenge. To better characterize NPH, we test the hypothesis that a prediction model based on automated MRI brain tissue segmentation can help differentiate shunt-responsive NPH patients from cerebral atrophy due to Alzheimer disease (AD) and normal aging. Brain segmentation into gray and white matter (GM, WM), and intracranial cerebrospinal fluid was derived from pre-shunt T1-weighted MRI of 15 shunt-responsive NPH patients (9 men, 72.6 ± 8.0 years-old), 17 AD patients (10 men, 72.1 ± 11.0 years-old) chosen as a representative of cerebral atrophy in this age group; and 18 matched healthy elderly controls (HC, 7 men, 69.7 ± 7.0 years old). A multinomial prediction model was generated based on brain tissue volume distributions. GM decrease of 33% relative to HC characterized AD (P normal GM volumes characterized NPH. A multinomial regression model based on gender, GM and ventricular volume had 96.3% accuracy differentiating NPH from AD and HC. In conclusion, automated MRI brain tissue segmentation differentiates shunt-responsive NPH with high accuracy from atrophy due to AD and normal aging. This method may improve diagnosis of NPH and improve our ability to distinguish normal from pathologic aging.

  16. Influence of ventilation and hypocapnia on sympathetic nerve responses to hypoxia in normal humans.

    Science.gov (United States)

    Somers, V K; Mark, A L; Zavala, D C; Abboud, F M

    1989-11-01

    The sympathetic response to hypoxia depends on the interaction between chemoreceptor stimulation (CRS) and the associated hyperventilation. We studied this interaction by measuring sympathetic nerve activity (SNA) to muscle in 13 normal subjects, while breathing room air, 14% O2, 10% O2, and 10% O2 with added CO2 to maintain isocapnia. Minute ventilation (VE) and blood pressure (BP) increased significantly more during isocapnic hypoxia (IHO) than hypocapnic hypoxia (HHO). In contrast, SNA increased more during HHO [40 +/- 10% (SE)] than during IHO (25 +/- 19%, P less than 0.05). To determine the reason for the lesser increase in SNA with IHO, 11 subjects underwent voluntary apnea during HHO and IHO. Apnea potentiated the SNA responses to IHO more than to HHO. SNA responses to IHO were 17 +/- 7% during breathing and 173 +/- 47% during apnea whereas SNA responses to HHO were 35 +/- 8% during breathing and 126 +/- 28% during apnea. During ventilation, the sympathoexcitation of IHO (compared with HHO) is suppressed, possibly for two reasons: 1) because of the inhibitory influence of activation of pulmonary afferents as a result of a greater increase in VE, and 2) because of the inhibitory influence of baroreceptor activation due to a greater rise in BP. Thus in humans, the ventilatory response to chemoreceptor stimulation predominates and restrains the sympathetic response. The SNA response to chemoreceptor stimulation represents the net effect of the excitatory influence of the chemoreflex and the inhibitory influence of pulmonary afferents and baroreceptor afferents.

  17. Proprietary tomato extract improves metabolic response to high-fat meal in healthy normal weight subjects

    Directory of Open Access Journals (Sweden)

    Xavier Deplanque

    2016-10-01

    Full Text Available Background: Low-density lipoprotein (LDL oxidation is a risk factor for atherosclerosis. Lycopene and tomato-based products have been described as potent inhibitors of LDL oxidation. Objectives: To evaluate the effect of a 2-week supplementation with a carotenoid-rich tomato extract (CRTE standardized for a 1:1 ratio of lycopene and phytosterols, on post-prandial LDL oxidation after a high-fat meal. Design: In a randomized, double-blind, parallel-groups, placebo-controlled study, 146 healthy normal weight individuals were randomly assigned to a daily dose of CRTE standardized for tomato phytonutrients or placebo during 2 weeks. Oxidized LDL (OxLDL, glucose, insulin, and triglyceride (TG responses were measured for 8 h after ingestion of a high-fat meal before and at the end of intervention. Results: Plasma lycopene, phytofluene, and phytoene were increased throughout the study period in the CRTE group compared to placebo. CRTE ingestion significantly improved changes in OxLDL response to high-fat meal compared to placebo after 2 weeks (p<0.0001. Changes observed in glucose, insulin, and TG responses were not statistically significant after 2 weeks of supplementation, although together they may suggest a trend of favorable effect on metabolic outcomes after a high-fat meal. Conclusions: Two-week supplementation with CRTE increased carotenoids levels in plasma and improved oxidized LDL response to a high-fat meal in healthy normal weight individuals.

  18. Proprietary tomato extract improves metabolic response to high-fat meal in healthy normal weight subjects

    Science.gov (United States)

    Deplanque, Xavier; Muscente-Paque, Delphine; Chappuis, Eric

    2016-01-01

    Background Low-density lipoprotein (LDL) oxidation is a risk factor for atherosclerosis. Lycopene and tomato-based products have been described as potent inhibitors of LDL oxidation. Objectives To evaluate the effect of a 2-week supplementation with a carotenoid-rich tomato extract (CRTE) standardized for a 1:1 ratio of lycopene and phytosterols, on post-prandial LDL oxidation after a high-fat meal. Design In a randomized, double-blind, parallel-groups, placebo-controlled study, 146 healthy normal weight individuals were randomly assigned to a daily dose of CRTE standardized for tomato phytonutrients or placebo during 2 weeks. Oxidized LDL (OxLDL), glucose, insulin, and triglyceride (TG) responses were measured for 8 h after ingestion of a high-fat meal before and at the end of intervention. Results Plasma lycopene, phytofluene, and phytoene were increased throughout the study period in the CRTE group compared to placebo. CRTE ingestion significantly improved changes in OxLDL response to high-fat meal compared to placebo after 2 weeks (p<0.0001). Changes observed in glucose, insulin, and TG responses were not statistically significant after 2 weeks of supplementation, although together they may suggest a trend of favorable effect on metabolic outcomes after a high-fat meal. Conclusions Two-week supplementation with CRTE increased carotenoids levels in plasma and improved oxidized LDL response to a high-fat meal in healthy normal weight individuals. PMID:27707453

  19. Gonadotropin-releasing hormone stimulates prolactin release from lactotrophs in photoperiodic species through a gonadotropin-independent mechanism.

    Science.gov (United States)

    Henderson, Helen L; Hodson, David J; Gregory, Susan J; Townsend, Julie; Tortonese, Domingo J

    2008-02-01

    Previous studies have provided evidence for a paracrine interaction between pituitary gonadotrophs and lactotrophs. Here, we show that GnRH is able to stimulate prolactin (PRL) release in ovine primary pituitary cultures. This effect was observed during the breeding season (BS), but not during the nonbreeding season (NBS), and was abolished by the application of bromocriptine, a specific dopamine agonist. Interestingly, GnRH gained the ability to stimulate PRL release in NBS cultures following treatment with bromocriptine. In contrast, thyrotropin-releasing hormone, a potent secretagogue of PRL, stimulated PRL release during both the BS and NBS and significantly enhanced the PRL response to GnRH during the BS. These results provide evidence for a photoperiodically modulated functional interaction between the GnRH/gonadotropic and prolactin axes in the pituitary gland of a short day breeder. Moreover, the stimulation of PRL release by GnRH was shown not to be mediated by the gonadotropins, since immunocytochemical, Western blotting, and PCR studies failed to detect pituitary LH or FSH receptor protein and mRNA expressions. Similarly, no gonadotropin receptor expression was observed in the pituitary gland of the horse, a long day breeder. In contrast, S100 protein, a marker of folliculostellate cells, which are known to participate in paracrine mechanisms within this tissue, was detected throughout the pituitaries of both these seasonal breeders. Therefore, an alternative gonadotroph secretory product, a direct effect of GnRH on the lactotroph, or another cell type, such as the folliculostellate cell, may be involved in the PRL response to GnRH in these species.

  20. Estimating Non-Normal Latent Trait Distributions within Item Response Theory Using True and Estimated Item Parameters

    Science.gov (United States)

    Sass, D. A.; Schmitt, T. A.; Walker, C. M.

    2008-01-01

    Item response theory (IRT) procedures have been used extensively to study normal latent trait distributions and have been shown to perform well; however, less is known concerning the performance of IRT with non-normal latent trait distributions. This study investigated the degree of latent trait estimation error under normal and non-normal…

  1. Estimating Non-Normal Latent Trait Distributions within Item Response Theory Using True and Estimated Item Parameters

    Science.gov (United States)

    Sass, D. A.; Schmitt, T. A.; Walker, C. M.

    2008-01-01

    Item response theory (IRT) procedures have been used extensively to study normal latent trait distributions and have been shown to perform well; however, less is known concerning the performance of IRT with non-normal latent trait distributions. This study investigated the degree of latent trait estimation error under normal and non-normal…

  2. The normal breast epithelium of women with breast cancer displays an aberrant response to estradiol.

    Science.gov (United States)

    Khan, S A; Sachdeva, A; Naim, S; Meguid, M M; Marx, W; Simon, H; Halverson, J D; Numann, P J

    1999-10-01

    Breast epithelial response to estradiol may play an important role in breast cancer etiology. We have examined the relationship between serum estradiol and progesterone levels and normal breast epithelial expression of estrogen receptor (ER) alpha, progesterone receptor (PgR), and epithelial proliferation (as reflected by the Ki-67 labeling index) in 121 women (50 newly diagnosed breast cancer cases and 71 benign breast disease controls). Simultaneous samples of grossly normal breast tissue and venous blood were obtained from women undergoing breast surgery. Serum estradiol and progesterone levels were measured by radioimmunoassay; breast epithelial ER, PgR, and Ki-67 expression was measured by immunohistochemistry. Linear regression, controlled for patient age and ductal and lobular composition of the tissue, showed that the breast epithelium of control women displayed an inverse correlation between serum estradiol and ER-alpha, which was not seen in case women (P for the difference in regression slopes = 0.001). PgR expression displayed a significant positive correlation with serum estradiol in cases, but not in controls. Epithelial proliferation had no relationship to either estradiol or progesterone in both cases and controls but showed an inverse relationship with ER in controls and a direct relationship in cases (P for the difference in regression slopes = 0.066). These results suggest a dysregulation of hormonal response in the normal breast epithelium of high-risk women, with lack of regulation of ER by estradiol, increased estrogen responsiveness as reflected by PgR expression, and a dissociation of ER expression and proliferative response.

  3. Relationship Between Psychophysiological Responses to Aversive Odors and Nutritional Status During Normal Aging.

    Science.gov (United States)

    Joussain, Pauline; Ferdenzi, Camille; Djordjevic, Jelena; Bensafi, Moustafa

    2017-07-01

    Psychophysiological responses to disgusting and pleasant smells are one of the most important aspects of olfaction. These emotional signals can constitute an alert against toxic substances, and they may play a major role in food selection and nutritional intake. The aim of this study was to test this hypothesis by examining whether individual physiological responses to odors could predict the subject's nutritional status. Because aging is associated with changes in emotional response to smells, we also examined how aging affects the relationship between olfaction and nutrition. Twenty young and 20 old participants perceived a series of odorants while their psychophysiological responses were simultaneously measured, and completed the Mini-Nutritional Assessment (MNA) questionnaire. Regression between individual correlation coefficients (r-values between odor perceptual ratings and physiological parameters) and individual MNA scores revealed that appropriateness of the physiological responses to aversive odors predicted nutritional status (R2 = 0.22, P nutritional status. Furthermore, this relationship was significant in old (R2 = 0.45, P 0.44). Taken together, preserved functioning of somatic markers in response to odors during normal aging is associated with better nutritional status, and may facilitate healthier food selection. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Use of the Hayling Task to Measure Inhibition of Prepotent Responses in Normal Aging and Alzheimer's Disease

    Science.gov (United States)

    Belleville, Sylvie; Rouleau, Nancie; Van der Linden, Martial

    2006-01-01

    This study measures the effect of Alzheimer's disease (AD) and normal aging on the inhibition of prepotent responses. AD patients, normal aged controls, and young subjects were tested with the Hayling task, which measures the ability to inhibit a semantically constrained response, and with the Stroop procedure. AD patients showed a severe deficit…

  5. Indentation loading response of a resonance sensor--discriminating prostate cancer and normal tissue.

    Science.gov (United States)

    Jalkanen, Ville; Andersson, Britt M; Bergh, Anders; Ljungberg, Börje; Lindahl, Olof A

    2013-10-01

    Prostate cancer is the most common type of cancer among men worldwide. Mechanical properties of prostate tissue are promising for distinguishing prostate cancer from healthy prostate tissue. The aim was to investigate the indentation loading response of a resonance sensor for discriminating prostate cancer tissue from normal tissue. Indentation measurements were done on prostate tissue specimens ex vivo from 10 patients from radical prostatectomy. The measurement areas were analysed using standard histological methods. The stiffness parameter was linearly dependent on the loading force (average R(2 )= 0.90) and an increased loading force caused a greater stiffness contrast of prostate cancer vs normal tissue. The accuracy of the stiffness contrast was assessed by the ROC curve with the area under the curve being 0.941 for a loading force of 12.8 mN. The results are promising for the development of a resonance sensor instrument for detecting prostate cancer.

  6. Differential regulation of two forms of gonadotropin-releasing hormone messenger ribonucleic acid by gonadotropins in human immortalized ovarian surface epithelium and ovarian cancer cells.

    Science.gov (United States)

    Choi, Jung-Hye; Choi, Kyung-Chul; Auersperg, Nelly; Leung, Peter C K

    2006-06-01

    Although gonadotropin-releasing hormone (GnRH) has been shown to play a role as an autocrine/ paracrine regulator of cell growth in ovarian surface epithelium and ovarian cancer, the factors which regulate the expression of GnRH and its receptor in these cells are not well characterized. In the present study, we employed real-time PCR to determine the potential regulatory effect of gonadotropins on the expression levels of GnRH I (the mammalian GnRH), GnRH II (a second form of GnRH) and their common receptor (GnRHR) in immortalized ovarian surface epithelial (IOSE-80 and IOSE-80PC) cells and ovarian cancer cell lines (A2780, BG-1, CaOV-3, OVCAR-3 and SKOV-3). The cells were treated with increasing concentrations (100 and 1000 ng/ml) of recombinant follicle-stimulating hormone (FSH) or luteinizing hormone (LH) for 24 h. Treatment with FSH or LH reduced GnRH II mRNA levels in both IOSE cell lines and in three out of five ovarian cancer cell lines (A2780, BG-1 and OVCAR-3). A significant decrease in GnRHR mRNA levels was observed in IOSE and ovarian cancer cells, except CaOV-3 cells, following treatment with FSH or LH. In contrast, treatment with either FSH or LH had no effect on GnRH I mRNA levels in these cells, suggesting that gonadotropins regulate the two forms of GnRH and its receptor differentially. In separate experiments, the effect of gonadotropins on the anti-proliferative action of GnRH I and GnRH II agonists in IOSE-80, OVCAR-3 and SKOV-3 cells was investigated. The cells were pretreated with FSH or LH (100 ng/ml) for 24 h after which they were treated with either GnRH I or GnRH II (100 ng/ml) for 2 days, and cell growth was assessed by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide] assay. Pretreatment of the cells with FSH or LH significantly reversed the growth inhibitory effect of GnRH I and GnRH II agonists in these cell types. These results provide the first demonstration of a potential interaction between gonadotropins and the

  7. Landscape response to normal fault growth and linkage in the Southern Apennines, Italy.

    Science.gov (United States)

    Roda-Boluda, Duna; Whittaker, Alex

    2016-04-01

    It is now well-established that landscape can record spatial and temporal variations in tectonic rates. However, decoding this information to extract detailed histories of fault growth is often a complex problem that requires careful integration of tectonic and geomorphic data sets. Here, we present new data addressing both normal fault evolution and coupled landscape response for two normal faults in the Southern Apennines: the Vallo di Diano and East Agri faults. By integrating published constraints with new data, we show that these faults have total throws of up to 2100 m, and Holocene throw rates of up to 1 mm/yr at their maximum. We demonstrate that geomorphology is effectively recording tectonics, with relief, channel and catchment slopes varying along fault strike as normal fault activity does. Therefore, valuable information about fault growth and interaction can be extracted from their geomorphic expression. We use the spatial distribution of knickpoints on the footwall channels to infer two episodes of base level change, which can be associated with distinct fault interaction events. From our detailed fault throw profiles, we reconstruct the amount of throw accumulated after each of these events, and the segments involved in each, and we use slip rate enhancement factors derived from fault interaction theory to estimate the magnitude of the tectonic perturbation in each case. From this approach, we are able to reconstruct pre-linkage throw rates, and we estimate that fault linkage events likely took place 0.7 ± 0.2 Ma and 1.9 ± 0.6 Ma in the Vallo di Diano fault, and 1.1 ± 0.1 and 2.3 ± 0.9 Ma in the East Agri fault. Our study suggests that both faults started their activity at 3.6 ± 0.5 Ma. These fault linkage scenarios are consistent with the knickpoint heights, and may relate to soft-linkage interaction with the Southern Apennines normal fault array, the existence of which has been the subject of considerable debate. Our combined geomorphic and

  8. Humoral immune response to an allogenic foetus in normal fertile women and recurrent aborters

    Directory of Open Access Journals (Sweden)

    Mishra LC

    2002-08-01

    Full Text Available Abstract Background Several humoral immune factors are responsible for a successful pregnancy. There are a few studies, which demonstrate the role of antipaternal cytotoxic antibodies (APCA and mixed lymphocyte reaction blocking factor (MLR-Bf in the maintenance of pregnancy. However, these factors have not been studied in women with history of recurrent spontaneous abortion (RSA. We designed this study to review the role of APCA and MLR-Bf in normal pregnancy as well as in women with a history of RSA. Methods One hundred and five women with unexplained recurrent spontaneous abortion were included in the present study. These women were screened for all other known causes of recurrent abortion. We also included 60 normal fertile women, fifteen from each trimester and fifteen women during the post partum period (up to six months. RSA and controls (normal pregnancy were matched for age, caste, and socio economic background and also for parity. APCA and MLR-Bf were evaluated in all the groups. All women with RSA who conceived during the study period were on follow up. Results We have analyzed the status of APCA and MLR-Bf in normal pregnancy (different gestational periods and during post partum, and in women with history of RSA. Our results show that APCA was significantly higher in controls as compared to RSA women. MLR-Bf was directed against the husbands' cells in normal pregnancy and was virtually absent in RSA women. Conclusion Our results indicate that there is a significantly low titer of APCA and MLR-Bf in women with recurrent spontaneous abortion. This highlights the role of these factors in the maintenance of successful pregnancy.

  9. Gonadotropin-releasing hormone in the ovary.

    Science.gov (United States)

    Metallinou, Chryssa; Asimakopoulos, Byron; Schröer, Andreas; Nikolettos, Nikos

    2007-12-01

    Gonadotropin-releasing hormone (GnRH) plays a pivotal role in the physiology of reproduction in mammals. GnRH acts by binding to the GnRH receptor (GnRHR). In humans, only 1 conventional GnRH receptor subtype (type I GnRH receptor) has been found. In the human genome, 2 forms of GnRH have been identified, GnRH-I (mammal GnRH) and GnRH-II (chicken GnRH II). Both forms and their common receptor are expressed, apart from the hypothalamus, in various compartments of the human ovary. Gonadal steroids, gonadotropins, and GnRH itself controls the regulation of the GnRH/GnRHR system gene expression in the human ovary. The 2 types of GnRH acting paracrinally/autocrinally influence ovarian steroidogenesis, decrease the proliferation, and induce apoptosis of ovarian cells. In this review, the biology of GnRH/GnRHR system in humans, the potential roles of GnRH, and the direct effects of GnRH analogues in ovarian cells are discussed.

  10. Acute fructose administration decreases the glycemic response to an oral glucose tolerance test in normal adults.

    Science.gov (United States)

    Moore, M C; Cherrington, A D; Mann, S L; Davis, S N

    2000-12-01

    In animal models, a small (catalytic) dose of fructose administered with glucose decreases the glycemic response to the glucose load. Therefore, we examined the effect of fructose on glucose tolerance in 11 healthy human volunteers (5 men and 6 women). Each subject underwent an oral glucose tolerance test (OGTT) on 2 separate occasions, at least 1 week apart. Each OGTT consisted of 75 g glucose with or without 7.5 g fructose (OGTT+F or OGTT-F), in random order. Arterialized blood samples were obtained from a heated dorsal hand vein twice before ingestion of the carbohydrate and every 15 min for 2 h afterward. The area under the curve (AUC) of the change in plasma glucose was 19% less in OGTT+F vs. OGTT-F (P: Glucose tolerance was improved by fructose in 9 subjects and worsened in 2. All 6 subjects with the largest glucose AUC during OGTT-F had a decreased response during OGTT+F (31 +/- 5% decrease). The insulin AUC did not differ between the 2 studies. Of the 9 subjects with improved glucose tolerance during the OGTT+F, 5 had smaller insulin AUC during the OGTT+F than the OGTT-F. Plasma glucagon concentrations declined similarly during OGTT-F and OGTT+F. The blood lactate response was about 50% greater during the OGTT+F (P: fructose improves the glycemic response to an oral glucose load in normal adults without significantly enhancing the insulin or triglyceride response. Fructose appears most effective in those normal individuals who have the poorest glucose tolerance.

  11. Accuracy of Cortical Evoked Response Audiometry in estimating normal hearing thresholds

    Directory of Open Access Journals (Sweden)

    Mahdavi M E

    2007-07-01

    Full Text Available Background: Cortical Evoked Response Audiometry (CERA refers to prediction of behavioral pure-tone thresholds (500-4000 Hz obtained by recording the N1-P2 complex of auditory long latency responses. CERA is the preferred method for frequency–specific estimation of audiogram in conscious adults and older children. CERA has an increased accuracy of determination of the hearing thresholds of alert patients with elevated hearing thresholds with sensory hearing loss; however few publications report studies regarding the use of CERA for estimating normal hearing thresholds. The purpose of this research was to further study the accuracy of CERA in predicting hearing thresholds when there is no hearing loss. Methods: Behavioral hearing thresholds of 40 alert normal hearing young adult male (40 ears screened at 20 dB HL in 500-8000Hz, predicted by recording N1-P2 complex of auditory evoked long latency responses to 10-30-10 ms tone bursts. After CERA, pure tone audiometry performed by other audiologist. All judgments about presence of responses performed visually. Stimulus rate variation and temporary interruption of stimulus presentation was used for preventing amplitude reduction of the responses. 200-250 responses were averaged near threshold. Results: In 95% of the hearing threshold predictions, N1-P2 thresholds were within 0-15 dB SL of true hearing thresholds. In the other 5%, the difference between the CERA threshold and true hearing threshold was 20-25 dB. The mean threshold obtained for tone bursts of 0.5, 1, 2 and 4 kHz were 12.6 ± 4.5, 10.9 ± 5.8, 10.8 ± 6.5 and 11.2 ± 4.1 dB, respectively, above the mean behavioral hearing thresholds for air-conducted pure tone stimuli. Conclusion: On average, CERA has a relatively high accuracy for the prediction of normal hearing sensitivity, comparable to that of previous studies performed on CERA in hearing-impaired populations.

  12. Evidence for cAMP as a mediator of gonadotropin secretion from female pituitaries

    Energy Technology Data Exchange (ETDEWEB)

    Bourne, G.A.; Baldwin, D.M.

    1987-09-01

    Sodium flufenamate, which inhibited gonadotropin-releasing hormone (GnRH)-stimulated increases in adenosine 3',5'-cyclic monophosphate (cAMP), was used to evaluate the potential role of cAMP as a mediator of GnRH-stimulated gonadotropin secretion. Quartered pituitaries from diestrous II female rats were perifused at 37/sup 0/C, and sequential effluent fractions were collected every 10 min. Administration of GnRH resulted in a characteristic biphasic response for both luteinizing hormone (LH) and follicle-stimulating hormone (FSH), whereas 5 ..mu..M cycloheximide inhibited the secondary augmented responses (phase II) of both hormones. Infusions of 0.1 mM flufenamate inhibited GnRH-stimulated gonadotropin secretion in a manner similar to that of cycloheximide, whereas the administration of 5 mM dibutyryl cAMP in combination with GnRH and flufenamate resulted in the restoration of LH and FSH secretion. The dibutyryl cAMP-restored response appeared to be protein synthesis dependent and specific for cAMP. These results suggest that although the cyclic nucleotide is not involved in the acute release of LH and FSH, it does appear to play a pivotal but indirect role in phase II release of the hormones, by effects involving the stimulation of de novo protein synthesis.

  13. Lack of shunt response in suspected idiopathic normal pressure hydrocephalus with Alzheimer disease pathology.

    Science.gov (United States)

    Hamilton, Roy; Patel, Sunil; Lee, Edward B; Jackson, Eric M; Lopinto, Joanna; Arnold, Steven E; Clark, Christopher M; Basil, Anuj; Shaw, Leslie M; Xie, Sharon X; Grady, M Sean; Trojanowski, John Q

    2010-10-01

    To determine the impact of cortical Alzheimer disease pathology on shunt responsiveness in individuals treated for idiopathic normal pressure hydrocephalus (iNPH), 37 patients clinically diagnosed with iNPH participated in a prospective study in which performance on neurologic, psychometric, and gait measures before and 4 months after shunting was correlated with amyloid β plaques, neuritic plaques, and neurofibrillary tangles observed in cortical biopsies obtained during shunt insertion. No complications resulted from biopsy acquisition. Moderate to severe pathology was associated with worse baseline cognitive performance and diminished postoperative improvement on NPH symptom severity scales, gait measures, and cognitive instruments compared to patients lacking pathology.

  14. Postprandial glucose response to selected tropical fruits in normal glucose-tolerant Nigerians.

    Science.gov (United States)

    Edo, A; Eregie, A; Adediran, O; Ohwovoriole, A; Ebengho, S

    2011-01-01

    The glycemic response to commonly eaten fruits in Nigeria has not been reported. Therefore, this study assessed the plasma glucose response to selected fruits in Nigeria. Ten normal glucose-tolerant subjects randomly consumed 50 g carbohydrate portions of three fruits: banana (Musa paradisiaca), pineapple (Ananus comosus), and pawpaw (Carica papaya), and a 50-g glucose load at 1-week intervals. Blood samples were collected in the fasting state and half-hourly over a 2-h period post-ingestion of the fruits or glucose. The samples were analyzed for plasma glucose concentrations. Plasma glucose responses were assessed by the peak plasma glucose concentration, maximum increase in plasma glucose, 2-h postprandial plasma glucose level, and incremental area under the glucose curve and glycemic index (GI). The results showed that the blood glucose response to these three fruits was similar in terms of their incremental areas under the glucose curve, maximum increase in plasma glucose, and glycemic indices (GIs). The 2-h postprandial plasma glucose level of banana was significantly higher than that of pineapple, P fruits may be used as fruit exchanges with pineapple having the most favorable glycemic response.

  15. Active immunization against gonadotropin-releasing hormone : an effective tool to block the fertility axis in mammals

    NARCIS (Netherlands)

    Turkstra, Jouwert Anne

    2005-01-01

    Gonadotropin releasing hormone (GnRH) plays a pivotal role in fertility and reproduction in mammals. It induces the release of luteinising hormone (LH) en follicle stimulating hormone (FSH) from the pituitary. These hormones are responsible for gonadal steroid production and indirectly for gametogen

  16. Metabolic response of normal man and insulin-infused diabetics to postprandial exercise.

    Science.gov (United States)

    Nelson, J D; Poussier, P; Marliss, E B; Albisser, A M; Zinman, B

    1982-05-01

    Physical exercise is often performed during absorption of meals. We have characterized the metabolic response to 45 min of moderate exercise (approximately 55% of estimated maximal oxygen uptake) beginning 30 min after breakfast in seven healthy controls. Nine insulin-dependent diabetes were studied in an identical manner, with glycemia controlled by a closed-loop "artificial endocrine pancreas" controlled by a closed-loop "artificial endocrine pancreas" (AEP). Responses were compared to those during breakfast without exercise. In the controls, onset of exercise rapidly reversed the rise in both glycemia and insulin (IRI) that occurred with breakfast alone, both returning to fasting levels (glycemia, 80 +/- 3 mg/dl; IRI, 0.38 +/- 0.10 ng/ml). After exercise, small and transient increments occurred (glycemia, 33 +/- 6 mg/dl; IRI, 0.81 +/- 0.15 ng/ml). In the diabetics, prior overnight intravenous insulin normalized fasting glycemia (98 +/- 4 mg/dl), and its postbreakfast excursion was identical to that of controls, as were those of most measured substrates. Similarly, with exercise, glycemia returned rapidly to fasting levels, accompanied by an appropriate decrease in insulin infusion rates. "Free" IRI levels mirrored changes in infusion rates by the AEP, with a decrease in insulin requirement of 30% during exercise as compared to breakfast alone (P less than 0.05). Thus, in both diabetics treated with the AEP and in normals, the responses to postprandial exercise required rapid modulation of insulin delivery. To demonstrate the effect of postprandial exercise on preprogrammed open-loop insulin replacement, four diabetic subjects were studied during breakfast with and without exercise while receiving a fixed open-loop insulin infusion pattern (6.1 +/- 0.7 U over 140 +/- 8 min). The glycemic response to breakfast alone was entirely normalized. However, symptomatic hypoglycemia occurred in all subjects when exercise was initiated 30 min after breakfast. The diabetic

  17. Inhibitory effect of submaximal doses of ghrelin on gonadotropin secretion in women.

    Science.gov (United States)

    Messini, C I; Dafopoulos, K; Malandri, M; Georgoulias, P; Anifandis, G; Messinis, I E

    2014-01-01

    The effect of ghrelin on gonadotropin secretion has been equivocal. Recent data have shown an inhibitory effect of repeated injections of ghrelin on nocturnal LH and FSH secretion in women. The aim of this study was to investigate the effect of submaximal doses of ghrelin on the diurnal secretion of gonadotropins. Ten normally cycling women received 2 consecutive dosages of ghrelin (0.15 μg/kg and 0.30 μg/kg) intravenously in the early and late follicular phases of the cycle. Saline was injected in the preceding cycle. Blood samples in relation to ghrelin or saline administration (time 0 and 90 min) were taken at -15, 0, 30, 90, 120, 150, and 180 min. Serum estradiol concentrations were significantly higher in the late than in the early follicular phase. Following ghrelin administration, serum LH and FSH levels decreased significantly, in relation to the saline injection, in the late (pghrelin on diurnal gonadotropin secretion throughout the follicular phase of the cycle.

  18. Whey protein enhances normal inflammatory responses during cutaneous wound healing in diabetic rats

    Directory of Open Access Journals (Sweden)

    Ebaid Hossam

    2011-12-01

    Full Text Available Abstract Background Prolonged wound healing is a complication of diabetes that contributes to mortality. Impaired wound healing occurs as a consequence of excessive reactive oxygen species (ROS production. Whey protein (WP is able to reduce the oxygen radicals and increase the levels of the antioxidant glutathione. Thus, the aim of this study was to determine whether dietary supplementation with WP could enhance normal inflammatory responses during wound healing in diabetic rats. Animals were assigned into a wounded control group (WN, a wounded diabetic group (WD and a wounded diabetic group orally supplemented with whey protein (WDWP at a dose of 100 mg/kg body weight. Results Whey protein was found to significantly decrease the levels of malondialdehyde (MDA, nitric oxide (NO and ROS. A significant restoration of the glutathione level was observed in WDWP rats. During the early wound healing stage, IL-1β, TNF-α, IL-6, IL-4 and neutrophil infiltration were significantly decreased in WD mice. WP supplementation was found to restore the levels of these inflammatory markers to the levels observed in control animals. In addition, the time required for wound healing was significantly prolonged in diabetic rats. WP was found to significantly decrease the time required for wound healing in WDWP rats. Conclusion In conclusion, dietary supplementation with WP enhances the normal inflammatory responses during wound healing in diabetic mice by restoring the levels of oxidative stress and inflammatory cytokines.

  19. Drosophila hematopoiesis under normal conditions and in response to immune stress.

    Science.gov (United States)

    Letourneau, Manon; Lapraz, Francois; Sharma, Anurag; Vanzo, Nathalie; Waltzer, Lucas; Crozatier, Michèle

    2016-11-01

    The emergence of hematopoietic progenitors and their differentiation into various highly specialized blood cell types constitute a finely tuned process. Unveiling the genetic cascades that control blood cell progenitor fate and understanding how they are modulated in response to environmental changes are two major challenges in the field of hematopoiesis. In the last 20 years, many studies have established important functional analogies between blood cell development in vertebrates and in the fruit fly, Drosophila melanogaster. Thereby, Drosophila has emerged as a powerful genetic model for studying mechanisms that control hematopoiesis during normal development or in pathological situations. Moreover, recent advances in Drosophila have highlighted how intricate cell communication networks and microenvironmental cues regulate blood cell homeostasis. They have also revealed the striking plasticity of Drosophila mature blood cells and the presence of different sites of hematopoiesis in the larva. This review provides an overview of Drosophila hematopoiesis during development and summarizes our current knowledge on the molecular processes controlling larval hematopoiesis, both under normal conditions and in response to an immune challenge, such as wasp parasitism. © 2016 Federation of European Biochemical Societies.

  20. Neuroendocrine regulation of gonadotropin secretion in seasonally breeding birds

    Directory of Open Access Journals (Sweden)

    Takayoshi eUbuka

    2013-03-01

    Full Text Available Seasonally breeding birds detect environmental signals, such as light, temperature, food availability and presence of mates to time reproduction. Hypothalamic neurons integrate external and internal signals, and regulate reproduction by releasing neurohormones to the pituitary gland. The pituitary gland synthesizes and releases gonadotropins which in turn act on the gonads to stimulate gametogenesis and sex steroid secretion. Accordingly, how gonadotropin secretion is controlled by the hypothalamus is key to our understanding of the mechanisms of seasonal reproduction. A hypothalamic neuropeptide, gonadotropin-releasing hormone (GnRH, activates reproduction by stimulating gonadotropin synthesis and release. Another hypothalamic neuropeptide, gonadotropin-inhibitory hormone (GnIH, inhibits gonadotropin synthesis and release directly by acting on the pituitary gland or indirectly by decreasing the activity of GnRH neurons. Therefore, the next step to understand seasonal reproduction is to investigate how the activities of GnRH and GnIH neurons in the hypothalamus and their receptors in the pituitary gland are regulated by external and internal signals. It is possible that locally-produced triiodothyronine resulting from the action of type 2 iodothyronine deiodinase on thyroxine stimulates the release of gonadotropins, perhaps by action on GnRH neurons. The function of GnRH neurons is also regulated by transcription of the GnRH gene. Melatonin, a nocturnal hormone, stimulates the synthesis and release of GnIH and GnIH may therefore regulate a daily rhythm of gonadotropin secretion. GnIH may also temporally suppress gonadotropin secretion when environmental conditions are unfavorable. Environmental and social milieus fluctuate seasonally in the wild. Accordingly, complex interactions of various neuronal and hormonal systems need to be considered if we are to understand the mechanisms underlying seasonal reproduction.

  1. Attenuated insulin response and normal insulin sensitivity in lean patients with ankylosing spondylitis.

    Science.gov (United States)

    Penesova, A; Rovensky, J; Zlnay, M; Dedik, L; Radikova, Z; Koska, J; Vigas, M; Imrich, R

    2005-01-01

    Chronic low-grade inflammation is associated with insulin resistance. The aim of this study was to determine insulin response to intravenous glucose load and insulin sensitivity in patients with ankylosing spondylitis (AS). Fourteen nonobese male patients with AS and 14 matched healthy controls underwent frequent-sampling intravenous glucose tolerance test (FSIVGTT). Insulin secretion and insulin sensitivity were calculated using the computer-minimal and homeostasis-model assessment 2 (HOMA2) models. Fasting glucose, insulin, cholesterol, high-density lipoprotein and low-density lipoprotein cholesterol, triglyceride levels, HOMA2, glucose effectiveness, insulin sensitivity and insulin response to FSIVGTT did not differ between patients and controls. Tumor necrosis factor-alpha and interleukin (IL)-6 concentrations tended to be higher in AS patients than in controls. Second-phase beta-cell responsiveness was 37% lower (p = 0.05) in AS patients than in controls. A negative correlation was found between the percentage of beta-cell secretion and IL-6 in all subjects (r = -0.54, p = 0.006). We found normal insulin sensitivity but attenuated glucose utilization in the second phase of FSIVGTT in AS patients. Our results indicate that elevated IL-6 levels may play a pathophysiological role in attenuating beta-cell responsiveness, which may explain the association between elevated IL-6 levels and increased risk for type 2 diabetes.

  2. Upper normal values of blood pressure response to exercise in Olympic athletes.

    Science.gov (United States)

    Caselli, Stefano; Vaquer Segui, Antonia; Quattrini, Filippo; Di Gacinto, Barbara; Milan, Alberto; Assorgi, Riccardo; Verdile, Luisa; Spataro, Antonio; Pelliccia, Antonio

    2016-07-01

    Exercise test is widespread performed in athletes to assess cardiovascular adaptations during effort; however, scarce information exists relative to the behavior of blood pressure during exercise in athletes. We sought to define the normal values and upper limits of blood pressure response to exercise in a large population of elite, healthy athletes. A total of 1,876 healthy, normotensive elite athletes (aged 25 ± 6 years, 64% male) underwent a comprehensive clinical evaluation including maximal bicycle exercise test. At maximum exercise, the systolic blood pressure increased significantly (Δ = +69 ± 18 mm Hg; Phigh blood pressure response to exercise, that is, increase in systolic and/or diastolic blood pressure above the 95th percentile. Multivariate logistic regression analysis showed that endurance and mixed sport disciplines, body mass index, and baseline systolic blood pressure were the strongest determinants for high blood pressure response to exercise. The gender-specific reference values for systolic and diastolic blood pressure at maximum exercise in athletes were defined. A small subset (7.5%) of athletes showed higher blood pressure response, in the absence of target organ disease or metabolic abnormalities, and associated with superior physical performance and larger cardiac remodeling. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Assessment of cardiovascular response to treadmill exercise in normal healthy Indian adolescents.

    Science.gov (United States)

    Pande, Sushma S; Pande, Santosh R; Dhore, Rajendra B; Daphale, Ajay V; Parate, Vrushali R; Patel, Shishir S; Agrekar, Sushil H

    2012-01-01

    The study aims to assess the cardiovascular response to treadmill exercise test in healthy Indian adolescents. A group of 50 healthy adolescents took part in the study. Cardiovascular response was assessed by using treadmill exercise test as per Bruce protocol. Pulse rate, blood pressure and ECG were recorded before, during and after undertaking the treadmill test. Mean age and body mass index (BMI) were 18.7 +/- 0.51 yrs. and 21.4 +/- 3.44 kg/m2 respectively. Karl Pearson Correlation analysis showed highly significant negative correlation between BMI and exercise time (r = -0.598, PExercise Time (r = -0.424, Pexercise pulse and SBP rose and DBP fell. SBP rose from mean 122 to 175 (rise by 53 mm of Hg) and DBP fell from mean 78 to 65 (fall by 13 mm of Hg). One min recovery pulse was 156 indicating 22% fall from target heart rate. All the parameters returned to near resting value at 6 min recovery. In 30% students DBP showed exaggerated response i.e. rise during exercise. These students had more BMI and higher resting DBP as compared to other students, which could be the reason for exaggerated response in these participants. In ECG there were no significant ST/T changes during exercise or recovery period. This study provides normal data for small sample of healthy Indian adolescents when subjected to treadmill exercise test.

  4. High-throughput screening normalized to biological response: application to antiviral drug discovery.

    Science.gov (United States)

    Patel, Dhara A; Patel, Anand C; Nolan, William C; Huang, Guangming; Romero, Arthur G; Charlton, Nichole; Agapov, Eugene; Zhang, Yong; Holtzman, Michael J

    2014-01-01

    The process of conducting cell-based phenotypic screens can result in data sets from small libraries or portions of large libraries, making accurate hit picking from multiple data sets important for efficient drug discovery. Here, we describe a screen design and data analysis approach that allow for normalization not only between quadrants and plates but also between screens or batches in a robust, quantitative fashion, enabling hit selection from multiple data sets. We independently screened the MicroSource Spectrum and NCI Diversity Set II libraries using a cell-based phenotypic high-throughput screening (HTS) assay that uses an interferon-stimulated response element (ISRE)-driven luciferase-reporter assay to identify interferon (IFN) signal enhancers. Inclusion of a per-plate, per-quadrant IFN dose-response standard curve enabled conversion of ISRE activity to effective IFN concentrations. We identified 45 hits based on a combined z score ≥2.5 from the two libraries, and 25 of 35 available hits were validated in a compound concentration-response assay when tested using fresh compound. The results provide a basis for further analysis of chemical structure in relation to biological function. Together, the results establish an HTS method that can be extended to screening for any class of compounds that influence a quantifiable biological response for which a standard is available.

  5. The response to sodium valproate of patients with sinus headaches with normal endoscopic and CT findings.

    Science.gov (United States)

    Dadgarnia, Mohammad Hossein; Atighechi, Saeed; Baradaranfar, Mohammad Hossein

    2010-03-01

    The objectives of this study are to evaluate the patients who have sinus headaches, either self-ascribed or physician-diagnosed, and to determinate the response to sodium valproate in a prophylactic treatment of the patients without positive sino-nasal findings. "Sinus headache" is a patient's complaint or physician-diagnosis that can have a variety of underlying causes. The patients are often treated with multiple courses of antibiotics and occasionally undergo a sinus surgery, often with little or no relief of their symptoms. One hundred and four patients with "sinus headaches" were evaluated prospectively. The patients with a normal rigid nasal endoscopy and a paranasal sinus computed tomography scan were treated with sodium valproate as a prophylactic treatment. After a 3-month follow-up, the patients' response to the treatment was evaluated. Seventy-two patients (69.2%) did not have any positive sino-nasal findings in the nasal endoscopy and the computed tomography scanning. The response rate to the treatment for these patients was as follows: significant improvement in 44 patients (61.1%), partial response (9.7%), no response (15.3%), and ten patients (13.9%) withdrew or failed to follow-up. According to Wilcoxon test, the patients' response rate to sodium valproate was statistically significant (P = 0.001). In conclusion, a majority of "sinus headache" patients do not show any positive sino-nasal pathologic finding. Therefore, we have to consider migraine headache as a considerable cause and sodium valproate as an effective conservative treatment.

  6. Cochlear Responses and Auditory Brainstem Response Functions in Adults with Auditory Neuropathy/ Dys-Synchrony and Individuals with Normal Hearing

    Directory of Open Access Journals (Sweden)

    Zahra Jafari

    2007-06-01

    Full Text Available Background and Aim: Physiologic measures of cochlear and auditory nerve function may be of assis¬tance in distinguishing between hearing disorders due primarily to auditory nerve impairment from those due primarily to cochlear hair cells dysfunction. The goal of present study was to measure of co-chlear responses (otoacoustic emissions and cochlear microphonics and auditory brainstem response in some adults with auditory neuropathy/ dys-synchrony and subjects with normal hearing. Materials and Methods: Patients were 16 adults (32 ears in age range of 14-30 years with auditory neu¬ropathy/ dys-synchrony and 16 individuals in age range of 16-30 years from both sexes. The results of transient otoacoustic emissions, cochlear microphonics and auditory brainstem response measures were compared in both groups and the effects of age, sex, ear and degree of hearing loss were studied. Results: The pure-tone average was 48.1 dB HL in auditory neuropathy/dys-synchrony group and the fre¬quency of low tone loss and flat audiograms were higher among other audiogram's shapes. Transient oto¬acoustic emissions were shown in all auditory neuropathy/dys-synchrony people except two cases and its average was near in both studied groups. The latency and amplitude of the biggest reversed co-chlear microphonics response were higher in auditory neuropathy/dys-synchrony patients than control peo¬ple significantly. The correlation between cochlear microphonics amplitude and degree of hearing loss was not significant, and age had significant effect in some cochlear microphonics measures. Audi-tory brainstem response had no response in auditory neuropathy/dys-synchrony patients even with low stim¬uli rates. Conclusion: In adults with speech understanding worsen than predicted from the degree of hearing loss that suspect to auditory neuropathy/ dys-synchrony, the frequency of low tone loss and flat audiograms are higher. Usually auditory brainstem response is absent in

  7. Estrogen normalizes perinatal nicotine-induced hypertensive responses in adult female rat offspring.

    Science.gov (United States)

    Xiao, Daliao; Huang, Xiaohui; Yang, Shumei; Zhang, Lubo

    2013-06-01

    Perinatal nicotine exposure caused a sex-dependent heightened vascular response to angiotensin II (Ang II) and increased blood pressure in adult male but not in female rat offspring. The present study tested the hypothesis that estrogen normalizes perinatal nicotine-induced hypertensive response to Ang II in female offspring. Nicotine was administered to pregnant rats via subcutaneous osmotic minipumps from day 4 of gestation to day 10 after birth. Ovariectomy and 17β-estradiol replacement were performed on 8-week-old female offspring. At 5 months of age, Ang II-induced blood pressure responses were not changed by nicotine treatment in the sham groups. In contrast, nicotine significantly enhanced Ang II-induced blood pressure responses as compared with saline control in the ovariectomy groups, which was associated with increased Ang II-induced vascular contractions. These heightened responses were abrogated by 17β-estradiol replacement. In addition, nicotine enhanced Ang II receptor type I, NADPH (nicotinamide adenine dinucleotide phosphate) oxidase type 2 protein expressions, and reactive oxygen species production of aortas as compared with saline control in the ovariectomy groups. Antioxidative agents, both apocynin and tempol, inhibited Ang II-induced vascular contraction and eliminated the differences of contractions between nicotine-treated and control ovariectomy rats. These findings support a key role of estrogen in the sex difference of perinatal nicotine-induced programming of vascular dysfunction, and suggest that estrogen may counteract heightened reactive oxygen species production, leading to protection of females from development programming of hypertensive phenotype in adulthood.

  8. Cognitive impairment predicts worse short-term response to spinal tap test in normal pressure hydrocephalus.

    Science.gov (United States)

    Wolfsegger, Thomas; Topakian, Raffi

    2017-08-15

    In patients with idiopathic normal pressure hydrocephalus (iNPH), the spinal tap test (STT) is commonly used to predict ventriculoperitoneal shunt responsiveness. Clinical improvement following STT usually is measured by testing gait function. In our study, we investigated the impact of cognitive impairment on gait improvement after STT. 22 patients with the clinical and radiological diagnosis of iNPH underwent gait analyses (mobile measuring system Medilogic) before and 2-4h after STT in self-paced gait velocity over 7m. Prior to STT, cognition was evaluated by the Mini Mental State Examination (MMSE). MMSESTT vs. after STT were analyzed with ANOVA with repeated measures. 1. Baseline gait parameters did not differ between the two groups: patients with iNPH and normal cognition (n=11) and patients with iNPH-CI (n=11). 2. Following STT, there was significant improvement of gait parameters in patients without cognitive impairment, while patients with iNPH-CI did not benefit from STT. Subjects with iNPH have a higher probability of lack of gait improvement 2-4h following STT, if cognitive impairment is present. Further studies are needed to elucidate the associations of cognitive impairment and quantitative gait parameters measured early and at later time points after STT. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Interferon response in normal and Aleutian disease virus-infected mink.

    Science.gov (United States)

    Wiedbrauk, D L; Hadlow, W J; Ewalt, L C; Lodmell, D L

    1986-08-01

    Studies were done to determine whether differences in interferon production are responsible for the resistance of pastel mink to Aleutian disease. The abilities of normal pastel and sapphire mink to produce interferon when inoculated with either Newcastle disease virus or a synthetic polyribonucleotide, poly (I):poly (C), were identical, even to the production of a novel, acid-labile interferon. The resistance of pastel mink to Aleutian disease did not correlate with interferon production, because neither sapphire nor pastel mink produced detectable amounts of interferon when infected with either the Pullman strain of Aleutian disease virus (ADV) or the highly virulent Utah I strain. Sapphire mink infected with the Pullman strain responded normally to poly (I):poly (C) early in the course of the disease, but interferon production was impaired late, when the mink were hypergammaglobulinemic and had renal, vascular, and hepatic lesions. These data suggest that ADV Pullman neither stimulates nor interferes with interferon production in infected mink and may represent a mechanism whereby ADV can more readily establish infection.

  10. An investigation of body part as object (BPO) responses in normal and brain-damaged adults.

    Science.gov (United States)

    Duffy, R J; Duffy, J R

    1989-07-01

    A test of simple pantomime was administered to three groups of adults and comparisons were made across groups of the incidence of subjects who exhibited body part as object (BPO) responses and of the mean frequency of occurrence of BPO in each group. The three groups were left-hemisphere-damaged aphasics (N = 28), right-hemisphere-damaged (N = 24), and normal controls (N = 28). The results indicated no significant differences among groups on the BPO measures. Also, to test the strength of association between the frequency of occurrence of BPO and measures of limb apraxia and severity of aphasia for the left-hemisphere-damaged aphasic group, correlation coefficients were obtained. The correlations were low and nonsignificant. The results of this investigation do not support the common clinical assumption that the occurrence of BPO during the performance of simple pantomimes is pathognomic for left-hemisphere pathology or associated with limb apraxia.

  11. Abnormal Auditory Brainstem Response (ABR Findings in a Near-Normal Hearing Child with Noonan Syndrome

    Directory of Open Access Journals (Sweden)

    Bahram Jalaei

    2017-01-01

    Full Text Available Introduction: Noonan syndrome (NS is a heterogeneous genetic disease that affects many parts of the body. It was named after Dr. Jacqueline Anne Noonan, a paediatric cardiologist.Case Report: We report audiological tests and auditory brainstem response (ABR findings in a 5-year old Malay boy with NS. Despite showing the marked signs of NS, the child could only produce a few meaningful words. Audiological tests found him to have bilateral mild conductive hearing loss at low frequencies. In ABR testing, despite having good waveform morphology, the results were atypical. Absolute latency of wave V was normal but interpeak latencies of wave’s I-V, I-II, II-III were prolonged. Interestingly, interpeak latency of waves III-V was abnormally shorter.Conclusion:Abnormal ABR results are possibly due to abnormal anatomical condition of brainstem and might contribute to speech delay.

  12. Numerical study of the ocean response to normal shore wind stress

    Science.gov (United States)

    Ortíz Bañuelos, A.; Velazquez, F.; Modelación numerica

    2013-05-01

    This work shows the results of numerical model forced by wind perpendicular to the coast (towards land-sea). Numerical domain is used as a rectangular basin with flat bottom (Lx = 1,200 km, Ly = 1,000 km, H = 1,000 m), Coriolis constant and uniform horizontal stratification profile. The initial condition is resting, and the model is forced only with a wind stress of a short temporal pulse. Four different cases of wind are considered: 1) Offshore wind: straight path perpendicular to the boundary; 2) Inertial wind: wind trajectory affected by the Coriolis force; 3) Fan-shape wind: wind trajectory affected by atmospheric pressure gradient causing curvature in both sides; 4) Realistic wind: with contribution of inertial and fan-shape winds. The numerical results for all winds shows emerge of two geostrophic eddies, one anticyclonic and its counterpart cyclonic in both sides of the wind jet and cooling in sea surface temperature under the wind. The inertial wind ocean response shows greater asymmetry that other cases, with high contributing in size and intensity of the eddies. Also, the inertial wind contributes to higher upper and lower sea level and thermocline displacement, and more cooling under wind jet and the higher velocity of vertical-integrated offshore current. The fan-shape wind produces a significant cooling near the boundary due to coastal upwelling, but the ocean response is near to the case of normal wind. However, in the realistic wind case, the ocean response is nearer than the offshore and fan-shape wind cases. Although the inertial wind has a highest contribution for the asymmetric ocean response, the realistic wind is not as asymmetric as we expected. Then, the realistic wind must have a different percent of inertial and fan-shape contribution. In our numerical study, we use equal contribution for both winds (50% each).

  13. Management of Nonpregnant Women with Elevated Human Chorionic Gonadotropin

    Directory of Open Access Journals (Sweden)

    Bernd C. Schmid

    2013-01-01

    Full Text Available Human chorionic gonadotropin (hCG is useful in evaluating and monitoring early pregnancy as well as trophoblastic disease. Here we describe the management of women with elevated serum human chorionic gonadotropin in a case of a 51-year-old female who was unsuccessfully treated for ectopic pregnancy. She was subsequently diagnosed with pituitary hCG production, which should be considered as differential diagnosis before treatment is initiated.

  14. Gonadotropins in European sea bass: Endocrine roles and biotechnological applications.

    Science.gov (United States)

    Mazón, María José; Molés, Gregorio; Rocha, Ana; Crespo, Berta; Lan-Chow-Wing, Olivier; Espigares, Felipe; Muñoz, Iciar; Felip, Alicia; Carrillo, Manuel; Zanuy, Silvia; Gómez, Ana

    2015-09-15

    Follicle stimulating hormone (Fsh) and luteinizing hormone (Lh) are central endocrine regulators of the gonadal function in vertebrates. They act through specific receptors located in certain cell types found in the gonads. In fish, the differential roles of these hormones are being progressively elucidated due to the development of suitable tools for their study. In European sea bass (Dicentrarchus labrax), isolation of the genes coding for the gonadotropin subunits and receptors allowed in first instance to conduct expression studies. Later, to overcome the limitation of using native hormones, recombinant dimeric gonadotropins, which show different functional characteristics depending on the cell system and DNA construct, were generated. In addition, single gonadotropin beta-subunits have been produced and used as antigens for antibody production. This approach has allowed the development of detection methods for native gonadotropins, with European sea bass being one of the few species where both gonadotropins can be detected in their native form. By administering recombinant gonadotropins to gonad tissues in vitro, we were able to study their effects on steroidogenesis and intracellular pathways. Their administration in vivo has also been tested for use in basic studies and as a biotechnological approach for hormone therapy and assisted reproduction strategies. In addition to the production of recombinant hormones, gene-based therapies using somatic gene transfer have been offered as an alternative. This approach has been tested in sea bass for gonadotropin delivery in vivo. The hormones produced by the genes injected were functional and have allowed studies on the action of gonadotropins in spermatogenesis. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Pituitary gonadotropin and testicular gonadotropin receptor expression in Atlantic cod (Gadusmorhua L.) during the first reproductive season: Effects of photoperiod modulation.

    Science.gov (United States)

    de Almeida, Fernanda Ferreira Loureiro; Andersson, Eva; Mittelholzer, Christian; Karlsen, Orjan; Taranger, Geir Lasse; Schulz, Rüdiger W

    2011-08-01

    Pituitary mRNA levels of gonadotropin β-subunits and of their cognate receptors in the testis were studied during puberty in Atlantic cod under normal and experimental photoperiod conditions that suppressed, delayed or accelerated testis maturation. Results are discussed in context with changes in testicular histology and plasma androgen levels, considered as end points of gonadotropic regulation. Up-regulation of fshb was closely associated with the onset of puberty, decreased when spermatogenesis was completed and reached minimum levels after spawning. These results demonstrate, for the first time using an experimental approach, that activation of Fsh-dependent signaling is associated with spermatogonial proliferation and formation of spermatogenic cysts. Changes in fshr expression were less prominent and could be explained by changes in the cellular composition and RNA content of cod testis tissue. At more advanced stages of development (spermiogenesis, spermiation and spawning), lhb and, one month later, lhcgr transcript levels increased and reached peak values in spawning fish, in a positive feedback loop involving plasma androgens and Lh/Lhcgr-dependent signaling. This loop was broken by a loss of lhb expression at the end of the spawning season. Continuous light (LL) from summer solstice, ~8 months prior to spawning, suppressed the start of testis maturation and the changes in gonadotropin and receptor mRNA levels, while LL from winter solstice initially up-regulated lhb and lhcgr expression, before resulting in a precocious termination of the spawning season and low expression of all four genes. Our studies provide experimental evidence for a clear functional discrimination of cod gonadotropins.

  16. Pseudomonas aeruginosa suppresses interferon response to rhinovirus infection in cystic fibrosis but not in normal bronchial epithelial cells.

    Science.gov (United States)

    Chattoraj, Sangbrita S; Ganesan, Shyamala; Faris, Andrea; Comstock, Adam; Lee, Wai-Ming; Sajjan, Umadevi S

    2011-10-01

    Despite increased morbidity associated with secondary respiratory viral infections in cystic fibrosis (CF) patients with chronic Pseudomonas aeruginosa infection, the underlying mechanisms are not well understood. Here, we investigated the effect of P. aeruginosa infection on the innate immune responses of bronchial epithelial cells to rhinovirus (RV) infection. CF cells sequentially infected with mucoid P. aeruginosa (MPA) and RV showed lower levels of interferons (IFNs) and higher viral loads than those of RV-infected cells. Unlike results for CF cells, normal bronchial epithelial cells coinfected with MPA/RV showed higher IFN expression than RV-infected cells. In both CF and normal cells, the RV-stimulated IFN response requires phosphorylation of Akt and interferon response factor 3 (IRF3). Preinfection with MPA inhibited RV-stimulated Akt phosphorylation and decreased IRF3 phosphorylation in CF cells but not in normal cells. Compared to normal, unstimulated CF cells or normal cells treated with CFTR inhibitor showed increased reactive oxygen species (ROS) production. Treatment of CF cells with antioxidants prior to MPA infection partially reversed the suppressive effect of MPA on the RV-stimulated IFN response. Together, these results suggest that MPA preinfection inhibits viral clearance by suppressing the antiviral response particularly in CF cells but not in normal cells. Further, increased oxidative stress in CF cells appears to modulate the innate immune responses to coinfection.

  17. Stimulation of contacts in ventral but not dorsal subthalamic nucleus normalizes response switching in Parkinson's disease.

    Science.gov (United States)

    Greenhouse, Ian; Gould, Sherrie; Houser, Melissa; Aron, Adam R

    2013-06-01

    Switching between responses is a key executive function known to rely on the frontal cortex and the basal ganglia. Here we aimed to establish with greater anatomical specificity whether such switching could be mediated via different possible frontal-basal-ganglia circuits. Accordingly, we stimulated dorsal vs. ventral contacts of electrodes in the subthalamic nucleus (STN) in Parkinson's patients during switching performance, and also studied matched controls. The patients underwent three sessions: once with bilateral dorsal contact stimulation, once with bilateral ventral contact stimulation, and once Off stimulation. Patients Off stimulation showed abnormal patterns of switching, and stimulation of the ventral contacts but not the dorsal contacts normalized the pattern of behavior relative to controls. This provides some of the first evidence in humans that stimulation of dorsal vs. ventral STN DBS contacts has differential effects on executive function. As response switching is an executive function known to rely on prefrontal cortex, these results suggest that ventral contact stimulation affected an executive/associative cortico-basal ganglia circuit.

  18. Cellular and humoral antibody responses of normal pastel and sapphire mink to goat erythrocytes.

    Science.gov (United States)

    Lodmell, D L; Bergman, R K; Hadlow, W J; Munoz, J J

    1971-02-01

    This study was undertaken to determine whether normal sapphire and royal pastel mink differ immunologically at the cellular and humoral levels. Two days after primary intraperitoneal (ip) inoculation of goat erythrocytes (GE), essentially no 19 or 7S plaque-forming cells (PFC) per 10(6) cells were detected in spleen or in abdominal and peripheral lymph nodes of either color phase. On the 4th day, more 19S PFC were detected in pastel than in sapphire tissues; pastel tissues also contained 7S PFC, whereas essentially none was present in sapphires until the 6th day. After an ip booster inoculation, the number of PFC was markedly different between the two color phases. These differences were most apparent in spleen and peripheral lymph nodes. In parallel with differences observed in PFC responses between the color phases, total hemolysin and 2-mercaptoethanol-resistant hemolysin titers of pastels exceeded those of sapphires in all but one interval after the primary, and at every interval after the booster, inoculation. These data indicate that sapphire mink are not immunological cripples, nor are they immunologically hyperactive, but that differences do exist between sapphire and royal pastel mink, especially in the response to booster injections of GE.

  19. Normal response function method for mass and stiffness matrix updating using complex FRFs

    Science.gov (United States)

    Pradhan, S.; Modak, S. V.

    2012-10-01

    Quite often a structural dynamic finite element model is required to be updated so as to accurately predict the dynamic characteristics like natural frequencies and the mode shapes. Since in many situations undamped natural frequencies and mode shapes need to be predicted, it has generally been the practice in these situations to seek updating of only mass and stiffness matrix so as to obtain a reliable prediction model. Updating using frequency response functions (FRFs) has been one of the widely used approaches for updating, including updating of mass and stiffness matrices. However, the problem with FRF based methods, for updating mass and stiffness matrices, is that these methods are based on use of complex FRFs. Use of complex FRFs to update mass and stiffness matrices is not theoretically correct as complex FRFs are not only affected by these two matrices but also by the damping matrix. Therefore, in situations where updating of only mass and stiffness matrices using FRFs is required, the use of complex FRFs based updating formulation is not fully justified and would lead to inaccurate updated models. This paper addresses this difficulty and proposes an improved FRF based finite element model updating procedure using the concept of normal FRFs. The proposed method is a modified version of the existing response function method that is based on the complex FRFs. The effectiveness of the proposed method is validated through a numerical study of a simple but representative beam structure. The effect of coordinate incompleteness and robustness of method under presence of noise is investigated. The results of updating obtained by the improved method are compared with the existing response function method. The performance of the two approaches is compared for cases of light, medium and heavily damped structures. It is found that the proposed improved method is effective in updating of mass and stiffness matrices in all the cases of complete and incomplete data and

  20. [The response of free alpha-subunit of glycoprotein hormones to LH-RH administration (author's transl)].

    Science.gov (United States)

    Hamamoto, T; Nishimura, R; Ashitaka, Y; Tojo, S

    1982-05-20

    The responses of immunoreactive free alpha-subunit of glycoprotein hormones to LH-RH administration were studied in normal men and women, and in patients with hypergonadotropic hypogonadism, hypogonadotropic hypogonadism, trophoblastic disease and isolated ectopic alpha-subunit producing tumor. In patients with hypergonadotropic hypergonadism, basal levels of serum alpha-subunit were elevated and the responses to LH-RH were also excessive compared to those of normal men and women. Conversely, in hypogonadotropic hypogonadism, basal levels of alpha-subunit were significantly low and its response to LH-RH was barely detectable. The response of alpha-subunit to constant intravenous infusion of LH-RH (1 microgram/kg/h) was studied in 4 normal men. Both LH and alpha-subunit revealed biphasic patterns of elevation. Its releasing pattern suggests the possibility that two pools of gonadotropin are involved in the production and secretion of alpha-subunit. In patients with trophoblastic disease secreting low levels of hCG (18 mIU/ml), the responses of alpha-subunit as well as pituitary gonadotropin to LH-RH were normal. However, in cases of high concentrations of hCG (1000 mIU/ml), the responses of alpha-subunit and gonadotropin were suppressed. After the administration of LH-RH to a patient with an isolated ectopic alpha-subunit producing tumor, the serum concentration of pituitary gonadotropin increased within the normal range, although that of alpha-subunit did not show a significant change. These results suggest that the production of alpha-subunit by tumors may be autonomous in contrast with a regulatory production in the pituitary.

  1. Role of gonadotropin-releasing hormone analogues in metastatic male breast cancer: results from a pooled analysis.

    Science.gov (United States)

    Di Lauro, Luigi; Pizzuti, Laura; Barba, Maddalena; Sergi, Domenico; Sperduti, Isabella; Mottolese, Marcella; Amoreo, Carla Azzurra; Belli, Franca; Vici, Patrizia; Speirs, Valerie; Santini, Daniele; De Maria, Ruggero; Maugeri-Saccà, Marcello

    2015-05-17

    Male breast cancer is a rare malignancy. Despite the lack of prospectively generated data from trials in either the adjuvant or metastatic setting, patients are commonly treated with hormone therapies. Much controversy exists over the use of gonadotropin-releasing hormone analogues in metastatic male breast cancer patients. We conducted this study to provide more concrete ground on the use of gonadotropin-releasing hormone analogues in this setting. We herein present results from a pooled analysis including 60 metastatic male breast cancer patients treated with either an aromatase inhibitor or cyproterone acetate as a monotherapy (23 patients) or combined with a gonadotropin-releasing hormone analogue (37 patients). Overall response rate was 43.5% in patients treated with monotherapy and 51.3% with combination therapy (p = 0.6). Survival outcomes favored combination therapy in terms of median progression-free survival (11.6 months versus 6 months; p = 0.05), 1-year progression-free survival rate (43.2% versus 21.7%; p = 0.05), median overall survival (29.7 months versus 22 months; p = 0.05), and 2-year survival rate (64.9% versus 43.5%; p = 0.05). In metastatic male breast cancer patients, the combined use of gonadotropin-releasing hormone analogues and aromatase inhibitors or antiandrogens seems to be associated with greater efficacy, particularly in terms of survival outcomes, compared with monotherapy. Collectively, these results encourage considering these agents in the metastatic setting.

  2. [Stimulation test of the adenohypophysis with arginine, gonadotropin-releasing hormone (GRH), and thyrotropin-releasing hormone (TRH) in 45, XO patients with Turner's syndrome (author's transl)].

    Science.gov (United States)

    Rudolf, K; Kyank, H; Göretzlehner, G; Kunkel, S

    1980-01-01

    Pituitary stimulation tests with arginine, gonadotropin-releasing hormone (GRH) and thyrotropin-releasing hormone (TRH) were performed in five 45, XO patients with Turner's syndrome. Their ages ranged from 12--17 years. Serum levels of LH, FSH, PRL, HGH, and TSH were measured by RIA. The hypothalamo-pituitary system appeared normal in the patients with Turner's syndrome.

  3. Modeling the response of normal and ischemic cardiac tissue to electrical stimulation

    Science.gov (United States)

    Kandel, Sunil Mani

    Heart disease, the leading cause of death worldwide, is often caused by ventricular fibrillation. A common treatment for this lethal arrhythmia is defibrillation: a strong electrical shock that resets the heart to its normal rhythm. To design better defibrillators, we need a better understanding of both fibrillation and defibrillation. Fundamental mysteries remain regarding the mechanism of how the heart responds to a shock, particularly anodal shocks and the resultant hyperpolarization. Virtual anodes play critical roles in defibrillation, and one cannot build better defibrillators until these mechanisms are understood. We are using mathematical modeling to numerically simulate observed phenomena, and are exploring fundamental mechanisms responsible for the heart's electrical behavior. Such simulations clarify mechanisms and identify key parameters. We investigate how systolic tissue responds to an anodal shock and how refractory tissue reacts to hyperpolarization by studying the dip in the anodal strength-interval curve. This dip is due to electrotonic interaction between regions of depolarization and hyperpolarization following a shock. The dominance of the electrotonic mechanism over calcium interactions implies the importance of the spatial distribution of virtual electrodes. We also investigate the response of localized ischemic tissue to an anodal shock by modeling a regional elevation of extracellular potassium concentration. This heterogeneity leads to action potential instability, 2:1 conduction block (alternans), and reflection-like reentry at the boarder of the normal and ischemic regions. This kind of reflection (reentry) occurs due to the delay between proximal and distal segments to re-excite the proximal segment. Our numerical simulations are based on the bidomain model, the state-of-the-art mathematical description of how cardiac tissue responds to shocks. The dynamic LuoRudy model describes the active properties of the membrane. To model ischemia

  4. Physiological roles of gonadotropin-inhibitory hormone signaling in the control of mammalian reproductive axis: studies in the NPFF1 receptor null mouse.

    Science.gov (United States)

    León, Silvia; García-Galiano, David; Ruiz-Pino, Francisco; Barroso, Alexia; Manfredi-Lozano, María; Romero-Ruiz, Antonio; Roa, Juan; Vázquez, María J; Gaytan, Francisco; Blomenrohr, Marion; van Duin, Marcel; Pinilla, Leonor; Tena-Sempere, Manuel

    2014-08-01

    RF-amide-related peptide-3 (RFRP-3), the mammalian ortholog of the avian gonadotropin-inhibiting hormone (GnIH), operates via the NPFF1 receptor (NPFF1R) to repress the reproductive axis, therefore acting as counterpart of the excitatory RF-amide peptide, kisspeptin (ligand of Gpr54). In addition, RFRP-3 modulates feeding and might contribute to the integrative control of energy homeostasis and reproduction. Yet, the experimental evidence supporting these putative functions is mostly indirect, and the physiological roles of RFRP-3 remain debatable and obscured by the lack of proper analytical tools and models. To circumvent these limitations, we characterize herein the first mouse line with constitutive inactivation of NPFF1R. Ablation of NPFF1R did not compromise fertility; rather, litters from NPFF1R null mice were larger than those from wild-type animals. Pubertal timing was not altered in NPFF1R deficient mice; yet, pre-pubertal knockout (KO) males displayed elevated LH levels, which normalized after puberty. Adult NPFF1R null male mice showed increased Kiss1 expression in the hypothalamic arcuate nucleus, higher serum FSH levels, and enhanced LH responses to GnRH. However, genetic elimination of NPFF1R was unable to reverse the state of hypogonadism caused by the lack of kisspeptin signaling, as revealed by double NPFF1R/Gpr54 KO mice. NPFF1R null mice displayed altered feedback responses to gonadal hormone withdrawal. In addition, metabolic challenges causing gonadotropin suppression, such as short-term fasting and high-fat diet, were less effective in dampening LH secretion in NPFF1R-deficient male mice, suggesting that absence of this inhibitory pathway partially prevented gonadotropin suppression by metabolic stress. Our data are the first to document the impact of elimination of GnIH signaling on reproductive parameters and their modulation by metabolic challenges. Whereas, in keeping with its inhibitory role, the NPFF1R pathway seems dispensable for

  5. Chorionic gonadotropin and uterine dialogue in the primate

    Directory of Open Access Journals (Sweden)

    Strakova Zuzana

    2004-07-01

    Full Text Available Abstract Implantation is a complex spatio-temporal interaction between the growing embryo and the mother, where both players need to be highly synchronized to be able to establish an effective communication to ensure a successful pregnancy. Using our in vivo baboon model we have shown that Chorionic Gonadotropin (CG, as the major trophoblast derived signal, not only rescues the corpus luteum but also modulates the uterine environment in preparation for implantation. This response is characterized by an alteration in both the morphological and biochemical activity in the three major cell types: luminal and glandular epithelium and stromal fibroblasts. Furthermore, CG and factors from the ovary have a synergistic effect on the receptive endometrium. Novel local effects of CG which influence the immune system to permit the survival of the fetal allograft and prevent endometrial cell death are also discussed in this review. An alternate extracellular signal-regulated kinase (ERK activation pathway observed in epithelial endometrial cells and the possibility of differential expression of the CG/LH-R isoforms during gestation, open many questions regarding the mechanism of action of CG and its signal transduction pathway within the primate endometrium.

  6. Identification and validation of reference genes for transcript normalization in strawberry (Fragaria × ananassa) defense responses.

    Science.gov (United States)

    Amil-Ruiz, Francisco; Garrido-Gala, José; Blanco-Portales, Rosario; Folta, Kevin M; Muñoz-Blanco, Juan; Caballero, José L

    2013-01-01

    Strawberry (Fragaria spp) is an emerging model for the development of basic genomics and recombinant DNA studies among rosaceous crops. Functional genomic and molecular studies involve relative quantification of gene expression under experimental conditions of interest. Accuracy and reliability are dependent upon the choice of an optimal reference control transcript. There is no information available on validated endogenous reference genes for use in studies testing strawberry-pathogen interactions. Thirteen potential pre-selected strawberry reference genes were tested against different tissues, strawberry cultivars, biotic stresses, ripening and senescent conditions, and SA/JA treatments. Evaluation of reference candidate's suitability was analyzed by five different methodologies, and information was merged to identify best reference transcripts. A combination of all five methods was used for selective classification of reference genes. The resulting superior reference genes, FaRIB413, FaACTIN, FaEF1α and FaGAPDH2 are strongly recommended as control genes for relative quantification of gene expression in strawberry. This report constitutes the first systematic study to identify and validate optimal reference genes for accurate normalization of gene expression in strawberry plant defense response studies.

  7. Middle latency auditory evoked responses in normal term infants: a longitudinal study.

    Science.gov (United States)

    Rogers, S H; Edwards, D A; Henderson-Smart, D J; Pettigrew, A G

    1989-05-01

    Middle latency auditory evoked responses (MLAERs) were measured in 21 normal term infants, three to five days after birth and then at 6 weeks, 7 months and 1 year of age. A polyphasic waveform was elicited during natural sleep in all infants at each recording session by monaural click stimulation at a rate of 9 per second. A 70 dBHL stimulus was found to be optimal as the MLAER became less well defined when the stimulus intensity approached the threshold hearing level. The first 60 to 70 msec of the waveform was found to be most stable, with decreasing detectability of peaks at longer latencies. There was no change in wave latency or reproducibility of MLAERs recorded during different sleep states. Waves Po and Na showed a significant decrease in latency with increasing stimulus intensity at term and/or 6 weeks of age. This was not evident for the remainder of the waveform. Waves Po, Na, Pa, Nb, Pb and Nc exhibited significant decreases in latency with age, attaining values indistinguishable from adults by 7 months of age.

  8. Activin receptor subunits in normal and dysfunctional adult human testis

    DEFF Research Database (Denmark)

    Dias, V.; Meachem, S.; Rajpert-De, Meyts E.

    2008-01-01

    , carcinoma in situ (CIS), seminoma, non-seminoma and gonadotropin-deprived human testis. ActRIIA mRNA was localized by in situ hybridization. RESULTS: ALK2, ALK4 and ActRIIB proteins were observed in Sertoli cells, spermatogonia and some spermatocytes within normal and gonadotropin-suppressed adult human...... testis; all three receptor subunits were also detected in CIS, seminoma and non-seminoma cells. ActRIIA immunoreactivity was faint to absent in the normal testis and in CIS and non-seminoma cells, whereas some seminoma cells displayed a strong signal. Also in contrast to the normal testis, a majority...

  9. Gonadotropin releasing hormone agonists: Expanding vistas

    Directory of Open Access Journals (Sweden)

    Navneet Magon

    2011-01-01

    Full Text Available Gonadotropin-releasing hormone (GnRH agonists are derived from native GnRH by amino acid substitution which yields the agonist resistant to degradation and increases its half-life. The hypogonadotropic hypogonadal state produced by GnRH agonists has been often dubbed as "pseudomenopause" or "medical oophorectomy," which are both misnomers. GnRH analogues (GnRH-a work by temporarily "switching off" the ovaries. Ovaries can be "switched off" for the therapy and therapeutic trial of many conditions which include but are not limited to subfertility, endometriosis, adenomyosis, uterine leiomyomas, precocious puberty, premenstrual dysphoric disorder, chronic pelvic pain, or the prevention of menstrual bleeding in special clinical situations. Rapidly expanding vistas of usage of GnRH agonists encompass use in sex reassignment of male to female transsexuals, management of final height in cases of congenital adrenal hyperplasia, and preserving ovarian function in women undergoing cytotoxic chemotherapy. Hypogonadic side effects caused by the use of GnRH agonists can be tackled with use of "add-back" therapy. Goserelin, leuprolide, and nafarelin are commonly used in clinical practice. GnRH-a have provided us a powerful therapeutic approach to the treatment of numerous conditions in reproductive medicine. Recent synthesis of GnRH antagonists with a better tolerability profile may open new avenues for both research and clinical applications. All stakeholders who are partners in women′s healthcare need to join hands to spread awareness so that these drugs can be used to realize their full potential.

  10. 21 CFR 862.1155 - Human chorionic gonadotropin (HCG) test system.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Human chorionic gonadotropin (HCG) test system... Test Systems § 862.1155 Human chorionic gonadotropin (HCG) test system. (a) Human chorionic gonadotropin (HCG) test system intended for the early detection of pregnancy—(1) Identification. A human...

  11. A comparison of cytokine responses during prolonged cycling in normal and hot environmental conditions

    Directory of Open Access Journals (Sweden)

    Ludmila M Cosio-Lima

    2011-01-01

    Full Text Available Ludmila M Cosio-Lima, Bhargav V Desai, Petra B Schuler, Lesley Keck, Logan ScheelerDepartment of Health, Leisure, and Exercise Science, University of West Florida, Pensacola, FL, USAPurpose: Components of immune function are affected by physical activity in an adverse environment. The purpose of this study was to compare plasma differences in inflammatory cytokines including tumor necrosis factor α (TNF-α and interleukin 6 (IL-6, in addition to the stress hormone cortisol, during prolonged cycling under normal and hot environmental conditions in elite cyclists.Methods and design: Six trained elite male cyclists (27 ± 8 years; 75.5 ± 4 kg; maximum oxygen uptake [VO2max] = 66 ± 6 mL/kg/min, mean ± SD. The cyclists biked for 2.5 h at their prescribed 60% maximum exercise workload (Wmax or 75% VO2max either in an environmental chamber set at 15°C and 40% relative humidity (NEUTRAL or at 35°C and 40% relative humidity (HOT. The cyclists were given 4 mL of water/kg body weight every 15 min under both conditions.Results: Total cortisol concentrations were elevated (P < 0.05 immediately postexercise and 12 h postexercise in both the NEUTRAL and HOT conditions. TNF-α concentrations were only significantly (P = 0.045 elevated postexercise in HOT conditions. During the HOT conditions, a significant (P = 0.006 and 0.007, respectively difference in IL-6 was seen immediately after and 12 h postexercise. During the NEUTRAL condition, IL-6 was only significantly elevated postexercise (P < 0.05.Conclusions: Heat exposure during a long bout of exercise is sufficient to elicit stress response in elite cyclists. However, the degree of release of anti-inflammatory and proinflammatory cytokines might be related to several factors that include the athlete’s fitness level, hydration status, exercise intensity, and length of exposure to hot environments.Keywords: cytokines, inflammation, heat, exercise, performance 

  12. Evaluation of different normalization procedures for the calculation of the standardized uptake value in therapy response monitoring studies

    NARCIS (Netherlands)

    Vriens, Dennis; de Geus-Oei, Lioe-Fee; van Laarhoven, Hanneke W; Timmer-Bonte, Johanna N H; Krabbe, Paul F M; Visser, Eric P; Oyen, Wim J G

    2009-01-01

    OBJECTIVES: The aim of this prospective study was to assess the influence of different normalization procedures on relative changes in standardized uptake values (SUV) of F-2-fluoro-2-deoxy-D-glucose positron emission tomography (FDG-PET) for the assessment of chemotherapy response in patients with

  13. In vitro embryo production through modification of time and gonadotropin hormone during oocytes maturation

    Directory of Open Access Journals (Sweden)

    Endang Triwulaninngsih

    2001-10-01

    Full Text Available This research has been conducted at the laboratory of in vitro fertilization of the University of Wisconsin, USA. These embryos can be used for improving genetic value of Indonesian cattle. There is transportation constraint in importing oocytes from USA. It takes more than 24 hours to bring it to Indonesia. In fact, oocytes maturation and ready to be fertilized normally requires only 24 hours in 5% CO2 incubator at 38.5°C. Therefore, this research is needed to study the effect of gonadotropin hormone and time for oocyte maturity and ready to be fertilized at a period more than 24 hours. If this problem could be solved then the importation of oocytes could be cheaper and easier than importation of life animals or embryos. Ovaries were collected from slaughterhouse in Wisconsin. Oocytes were matured in TCM-199 medium in 5% CO2 incubator and at 30°C enriched with FSH 10 μl/ml, oestradiol 17 β 1μl/ml and 10 % FCS as control of gonadotropin hormone treatment (A; with FSH 10 μl/ml (B; with oestradiol 17 β 1μl/ml (C and without gonadotropin hormone (D for 24 hours, 30 hours and 36 hours as time of maturation treatment I, II and III respectively. The oocytes were fertilized in vitro with motile sperm selection by Percoll gradient and incubation between sperm and oocytes in fertilization media (TALP for 20 hours. All zygotes were cultured in modification of KSOM medium up to blastocyst and were fed serum 5 μl/50 μl medium on day 6. Data were analyzed by SAS program. Percentage of cleavage between time of maturation were significant (p0.05. Percentage of blastocyst between time of maturation were not significant (p>0.05, but between gonadotropin hormone treatment A vs B and A vs C and B vs D and C vs D were significant (p0.05. Percentage of cleavage, morula, blastocyst, expanded blastocyst and unertilized ova on this study are 66.73%, 22.43%, 40.33%, 0.81% and 32.51 for 24 hours incubation (I; 61.55%, 25.69%, 32.69%, 0.54% and 27.61% for 30

  14. Effects of meta-chlorophenylpiperazine on neuroendocrine and behavioral responses in male schizophrenic patients and normal volunteers.

    Science.gov (United States)

    Maes, M; Meltzer, H Y

    1996-10-16

    Functional alterations in the central serotonergic system, including presynaptic and postsynaptic function, have been reported in schizophrenia. Recently, there have been conflicting reports that the increase in plasma cortisol or prolactin concentrations induced by meta-chlorophenylpiperazine (mCPP) was significantly blunted in schizophrenic patients compared with normal volunteers. Studies of the behavioral effects of mCPP, a serotonin (5-HT) receptor partial agonist with high affinity for 5-HT1C binding sites, have also yielded conflicting results in schizophrenic patients. The purpose of this study was to examine plasma levels of prolactin and cortisol, body temperature, and behavioral responses to mCPP and placebo in a single-blind study in 25 schizophrenic and 15 normal men. No differences either between schizophrenic patients and normal volunteers or between paranoid and undifferentiated/residual subtypes of schizophrenia were found in mCPP-induced prolactin, cortisol, or temperature responses. Schizophrenic patients and normal volunteers reported significant increases in feeling calm and feeling strange of comparable magnitude following mCPP. No significant differences between normal volunteers and schizophrenic patients were found in post-mCPP behavioral ratings, such as anxiety, irritability, depression, restlessness, or arousal.

  15. Discrete element modeling of Martian pit crater formation in response to extensional fracturing and dilational normal faulting

    Science.gov (United States)

    Smart, Kevin J.; Wyrick, Danielle Y.; Ferrill, David A.

    2011-04-01

    Pit craters, circular to elliptical depressions that lack a raised rim or ejecta deposits, are common on the surface of Mars. Similar structures are also found on Earth, Venus, the Moon, and smaller planetary bodies, including some asteroids. While it is generally accepted that these pits form in response to material drainage into a subsurface void space, the primary mechanism(s) responsible for creating the void is a subject of debate. Previously proposed mechanisms include collapse into lave tubes, dike injection, extensional fracturing, and dilational normal faulting. In this study, we employ two-dimensional discrete element models to assess both extensional fracturing and dilational normal faulting as mechanisms for forming pit craters. We also examine the effect of mechanical stratigraphy (alternating strong and weak layers) and variation in regolith thickness on pit morphology. Our simulations indicate that both extensional fracturing and dilational normal faulting are viable mechanisms. Both mechanisms lead to generally convex (steepening downward) slope profiles; extensional fracturing results in generally symmetric pits, whereas dilational normal faulting produces strongly asymmetric geometries. Pit width is established early, whereas pit depth increases later in the deformation history. Inclusion of mechanical stratigraphy results in wider and deeper pits, particularly for the dilational normal faulting, and the presence of strong near-surface layers leads to pits with distinct edges as observed on Mars. The modeling results suggest that a thicker regolith leads to wider but shallower pits that are less distinct and may be more difficult to detect in areas of thick regolith.

  16. Gonadotropin-releasing hormone (GnRH) agonist triptorelin inhibits estradiol-induced serum response element (SRE) activation and c-fos expression in human endometrial, ovarian and breast cancer cells.

    Science.gov (United States)

    Gründker, Carsten; Günthert, Andreas R; Hellriegel, Martin; Emons, Günter

    2004-11-01

    The majority of human endometrial (>80%), ovarian (>80%) and breast (>50%) cancers express GnRH receptors. Their spontaneous and epidermal growth-factor-induced proliferation is dose- and time-dependently reduced by treatment with GnRH and its agonists. In this study, we demonstrate that the GnRH agonist triptorelin inhibits estradiol (E2)-induced cancer cell proliferation. The proliferation of quiescent estrogen receptor alpha (ER alpha)-/ER beta-positive, but not of ER alpha-negative/ER beta-positive endometrial, ovarian and breast cancer cell lines, was significantly stimulated (P<0.001) (ANOVA) after treatment with E2 (10(-8) M). This effect was time- and dose-dependently antagonized by simultaneous treatment with triptorelin. The inhibitory effect was maximal at 10(-5) M concentration of triptorelin (P<0.001). In addition, we could show that, in ER alpha-/ER beta-positive cell lines, E2 induces activation of serum response element (SRE) and expression of the immediate early-response gene c-fos. These effects were blocked by triptorelin (P<0.001). E2-induced activation of estrogen-response element (ERE) was not affected by triptorelin. The transcriptional activation of SRE by E2 is due to ER alpha activation of the mitogen-activated protein kinase (MAPK) pathway. This pathway is impeded by GnRH, resulting in a reduction of E2-induced SRE activation and, in consequence, a reduction of E2-induced c-fos expression. This causes downregulation of E2-induced cancer cell proliferation.

  17. Absence of diurnal variation in visceromotor response to colorectal distention in normal Long Evans rats [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Sara Botschuijver

    2016-01-01

    Full Text Available Background: Enhanced colorectal sensitivity (i.e. visceral hypersensitivity is thought to be a pathophysiological mechanism in irritable bowel syndrome (IBS. In healthy men a circadian variation in rectal perception to colonic distention was described. Disturbed day and night rhythms, which occur in shift work and trans meridian flights, are associated with the prevalence of IBS. This raises the question whether disruptions of circadian control are responsible for the observed pathology in IBS. Prior to investigating altered rhythmicity in relation to visceral hypersensitivity in a rat model for IBS, it is relevant to establish whether normal rats display circadian variation similar to healthy men.  Methodology and findings: In rodents colorectal distension leads to reproducible contractions of abdominal musculature. We used quantification of this so called visceromotor response (VMR by electromyography (EMG to assess visceral sensitivity in rats. We assessed the VMR in normal male Long Evans rats at different time points of the light/dark cycle. Although a control experiment with male maternal separated rats confirmed that intentionally inflicted (i.e. stress induced changes in VMR can be detected, normal male Long Evans rats showed no variation in VMR along the light/dark cycle in response to colorectal distension. Conclusions: In the absence of a daily rhythm of colorectal sensitivity in normal control rats it is not possible to investigate possible aberrancies in our rat model for IBS.

  18. The molecular and cellular response of normal and progressed human bronchial epithelial cells to HZE particles

    Science.gov (United States)

    Story, Michael; Ding, Liang-Hao; Minna, John; Park, Seong-mi; Larsen, Jill

    We have used a model of non-oncogenically immortalized normal human bronchial epithelial cells to determine the response of such cells to particles found outside the protection of the earth’s electromagnetic field. We have identified an enhanced frequency of cellular transformation, as measured by growth in soft agar, for both 56Fe and 28Si (1 GeV/n) that is maximal (4-6 fold) at 0.25 Gy and 0.40 Gy, respectively. At 4 months post-irradiation 38 individual soft agar clones were isolated. These clones were characterized extensively for cellular and molecular changes. Gene expression analysis suggested that these clones had down-regulated several genes associated with anti-oxidant pathways including GLS2, GPX1 and 4, SOD2, PIG3, and NQO1 amongst others. As a result, many of these transformed clones were exposed to high levels of intracellular radical oxygen species (ROS), although there appeared not to be any enhanced mitochondrial ROS. DNA repair pathways associated with ATM/ATR signaling were also upregulated. However, these transformants do not develop into tumors when injected into immune-compromised mice, suggesting that they have not progressed sufficiently to become oncogenic. Therefore we chose 6 soft agar clones for continuous culture for an additional 14 months. Amongst the 6 clones, only one clone showed any significant change in phenotype. Clone 3kt-ff.2a, propagated for 18 months, were 2-fold more radioresistant, had a shortened doubling time and the background rate of transformation more than doubled. Furthermore, the morphology of transformed clones changed. Clones from this culture are being compared to the original clone as well as the parental HBEC3KT and will be injected into immune-compromised mice for oncogenic potential. Oncogenically progressed HBECs, HBEC3KT cells that overexpress a mutant RAS gene and where p53 has been knocked down, designated HBEC3KTR53, responded quite differently to HZE particle exposure. First, these cells are more

  19. The effectiveness of natural and gonadotropin stimulation of young gilts

    Directory of Open Access Journals (Sweden)

    Jan DYBAŁA

    2017-03-01

    Full Text Available The aim of the study was to compare the effectiveness of stimulation of gilts puberty by natural method and with gonadotropins. The results of reproduction parameters of gilts were also compared. Gilts were also supported by diet with easilly assimilated carbohydrates. The study was carried out on the group of 80 gilts which were divided into 2 groups (A and B according to the method of inducing puberty: by using mature boar or gonadotropins eCG and hCG. In each group were isolated two subgroups in which gilts were mated in first or second estrus (A1, A2 and B1, B2. The first estrus occured earlier in gilts induced naturally. More numerous litters were obtained from gilts mated in the second estrus independently of method of puberty stimulation. The highest effectiveness of mating was obtained in gilts induced by gonadotropins in second estrus and the lowest also in gilts stimulated by gonadotropins but mated in first estrus. More piglets for 21st day were reared by gilts mated in second estrus independently on puberty induction method.

  20. Chorionic gonadotropin induces dendritic cells to express a tolerogenic phenotype

    NARCIS (Netherlands)

    H. Wan (Hui); M.A. Versnel (Marjan); L.M.E. Leijten (Lonneke); C.G. van Helden-Meeuwsen; D. Fekkes (Durk); P.J. Leenen (Pieter); N.A. Khan (Nisar Ahmed); R. Benner (Robbert); R.C.M. Kiekens (Rebecca)

    2008-01-01

    textabstractThe pregnancy hormone human chorionic gonadotropin (hCG) has been suggested to play an immunoregulatory role in addition to its endocrine function, thus contributing to the prevention of fetal rejection. We hypothesized that hCG is involved in the maternal-fetal immune tolerance by the r

  1. The fibrinolytic response in injured animal tissues normally low in fibrinolytic activity

    NARCIS (Netherlands)

    Smokovitis, A.; Astrup, T.

    1980-01-01

    Rabbit skin, normally of low fibrinolytic activity, and guinea-pig skin, of medium activity, after crush injury or after the intradermal or subcutaneous injection of aluminum hydroxide, show a remarkable increase in fibrinolytic activity. The activity is caused by a plasminogen activator and is

  2. Using an APOS Framework to Understand Teachers' Responses to Questions on the Normal Distribution

    Science.gov (United States)

    Bansilal, Sarah

    2014-01-01

    This study is an exploration of teachers' engagement with concepts embedded in the normal distribution. The participants were a group of 290 in-service teachers enrolled in a teacher development program. The research instrument was an assessment task that can be described as an "unknown percentage" problem, which required the application…

  3. Factors affecting pituitary gonadotropin function in users of oral contraceptive steroids.

    Science.gov (United States)

    Scott, J A; Brenner, P F; Kletzky, O A; Mishell, D R

    1978-04-01

    In order to determine whether certain factors influence the direct pituitary suppressive effect of contraceptive steroid, 50 subjects who had used various formulations of oral contraceptive steroids for periods of time ranging from one to nine years were stimulated with 50 microgram of gonadotropin-releasing hormone (GnRH) during the last week of oral contraceptive ingestion. The response of lutinizing hormone (LH) and follicle-stimulating hormone (FSH) was compared to the results obtained in nine control subjects with regard to: (1) age of subject. (2) type of contraceptive formulation used, and (3) length of use. Prestimulation levels of LH and FSH, respectively, were significantly decreased in 37 (74 per cent) and 42 (84 per cent) of the subjects. Following GnRH stimulation, peak responses of serum LH and FSH, respectively, were also significantly lower than those in the control subjects in 40 (80 per cent) and 45 (90 per cent of the subjects. The degree of suppression of pituitary gonadotropins, both before and after GnRH administration was significantly correlated with the type of steroid formulation used, being greatest with a combination of d-norgestrel and ethinyl estradiol. No correlation was found with length of use of oral contraceptives or age of the subjects.

  4. Clinical objectives and normal tissue responses in combined chemotherapy and radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Peckham, M.J.; Collis, C.H. (Institute of Cancer Research, Sutton (UK). Surrey Branch; Royal Marsden Hospital, London (UK))

    1981-01-01

    It is clear that the risk of toxicity to normal tissues in combined therapy is reduced by separating drug administration and radiation exposure in time. The short-term interaction of drugs and radiation aimed at producing enhanced tumour cell kill is difficult to demonstrate in vivo in animal experiments and unlikely to be important in clinical practice. Increased toxicity of normal tissues in man has been manifest both in terms of early and late reactions and probably also in carcinogenesis. In the latter context choice of drug and possibly sequencing may be important in minimising the risk of tumour induction. There are few experimental studies examining moderately long time intervals between drug and radiation exposure. The administration of chemotherapy prior to irradiation may be less toxic than the converse sequence, although clinical data supporting this contention are limited at the present time.

  5. Comparing of letrozole versus clomiphene citrate combined with gonadotropins in intrauterine insemination cycles

    Directory of Open Access Journals (Sweden)

    Fatemeh Ayazi Roozbahani

    2012-01-01

    Full Text Available Background: Clomiphene citrate (CC an agonist and antagonist of estrogen, is the first line treatment in ovarian stimulation. Anti-estrogenic effect of CC in endometrial thickness and cervical mucus has negative effect on pregnancy rate. Letrozole is an Aromatase Inhibitor has been seen that has acceptable pregnancy rate compared to CC.Objective: The aim of this study was to compare the efficacy of letrozole and clomiphene citrate (CC with gonadotropins for ovarian stimulation in women candidate for intrauterine insemination (IUI.Materials and Methods: One hundred sixty patients eligible to IUI therapy enrolled in this study. Patients randomized to two groups: group A (received letrozole-gonadotropin and group B (received CC-gonadotropin. In group A (n=80 letrozole was given on days 3-7 of the menstrual cycles. In group B clomiphen citrate was given like letrozole combined with human menopausal gonadotropin (hMG administered every day starting on day 8. Ovulation was triggered with urinary HCG when the leading follicle (s reached 18 mm in diameter. A single IUI was performed 36-40 hours later. The ovarian stimulation response (E2 levels and number of follicles, clinical pregnancy and endometrial thickness was primary outcome.Results: Both groups were similar in demographic characteristics. There was a significantly lower peak serum E2 level in the letrozole group compared with CC. (236±86 Vs. 283±106 pg/mL, respectively; p18 mm preovulatory follicles was significantly higher in CC group than letrozole group (2.2±.68 Vs. 2.02±0.63 respectively; p=0.025. Endometrial thickness measured at the time of hCG administration was significantly higher in letrozole group. (9.08±1.2 mm Vs. 8.1±1.9 mm; p=0.0001. The clinical pregnancy rate was comparable between two groups.Conclusion: Letrozole is a good and cost-effective alternative to CC in IUI cycles

  6. An overview of the Normal Ogive Harmonic Analysis Robust Method (NOHARM approach to item response theory

    Directory of Open Access Journals (Sweden)

    Lee, J. J.

    2016-01-01

    Full Text Available Here we provide a description of the IRT estimation method known as Normal Ogive Harmonic Analysis Robust Method (NOHARM. Although in some ways this method has been superseded by new computer programs that also adopt a specifically factor-analytic approach, its fundamental principles remain useful in certain applications, which include calculating the residual covariance matrix and rescaling the distribution of the common factor (latent trait. These principles can be applied to parameter estimates obtained by any method.

  7. An Extended Normalization Model of Attention Accounts for Feature-Based Attentional Enhancement of Both Response and Coherence Gain.

    Science.gov (United States)

    Schwedhelm, Philipp; Krishna, B Suresh; Treue, Stefan

    2016-12-01

    Paying attention to a sensory feature improves its perception and impairs that of others. Recent work has shown that a Normalization Model of Attention (NMoA) can account for a wide range of physiological findings and the influence of different attentional manipulations on visual performance. A key prediction of the NMoA is that attention to a visual feature like an orientation or a motion direction will increase the response of neurons preferring the attended feature (response gain) rather than increase the sensory input strength of the attended stimulus (input gain). This effect of feature-based attention on neuronal responses should translate to similar patterns of improvement in behavioral performance, with psychometric functions showing response gain rather than input gain when attention is directed to the task-relevant feature. In contrast, we report here that when human subjects are cued to attend to one of two motion directions in a transparent motion display, attentional effects manifest as a combination of input and response gain. Further, the impact on input gain is greater when attention is directed towards a narrow range of motion directions than when it is directed towards a broad range. These results are captured by an extended NMoA, which either includes a stimulus-independent attentional contribution to normalization or utilizes direction-tuned normalization. The proposed extensions are consistent with the feature-similarity gain model of attention and the attentional modulation in extrastriate area MT, where neuronal responses are enhanced and suppressed by attention to preferred and non-preferred motion directions respectively.

  8. An Extended Normalization Model of Attention Accounts for Feature-Based Attentional Enhancement of Both Response and Coherence Gain.

    Directory of Open Access Journals (Sweden)

    Philipp Schwedhelm

    2016-12-01

    Full Text Available Paying attention to a sensory feature improves its perception and impairs that of others. Recent work has shown that a Normalization Model of Attention (NMoA can account for a wide range of physiological findings and the influence of different attentional manipulations on visual performance. A key prediction of the NMoA is that attention to a visual feature like an orientation or a motion direction will increase the response of neurons preferring the attended feature (response gain rather than increase the sensory input strength of the attended stimulus (input gain. This effect of feature-based attention on neuronal responses should translate to similar patterns of improvement in behavioral performance, with psychometric functions showing response gain rather than input gain when attention is directed to the task-relevant feature. In contrast, we report here that when human subjects are cued to attend to one of two motion directions in a transparent motion display, attentional effects manifest as a combination of input and response gain. Further, the impact on input gain is greater when attention is directed towards a narrow range of motion directions than when it is directed towards a broad range. These results are captured by an extended NMoA, which either includes a stimulus-independent attentional contribution to normalization or utilizes direction-tuned normalization. The proposed extensions are consistent with the feature-similarity gain model of attention and the attentional modulation in extrastriate area MT, where neuronal responses are enhanced and suppressed by attention to preferred and non-preferred motion directions respectively.

  9. Role of vascular density and normalization in response to neoadjuvant bevacizumab and chemotherapy in breast cancer patients

    OpenAIRE

    Tolaney, Sara M.; Boucher, Yves; Duda, Dan G.; Martin, John D.; Seano, Giorgio; Ancukiewicz, Marek; Barry, William T.; Goel, Shom; Lahdenrata, Johanna; Isakoff, Steven J.; Yeh, Eren D.; Jain, Saloni R.; Golshan, Mehra; Brock, Jane; Snuderl, Matija

    2015-01-01

    Emerging evidence indicates patients who benefit from antiangiogenic therapies have improved vessel function. To determine how bevacizumab modulates vessel morphology to improve vessel function we conducted a phase II trial of preoperative bevacizumab followed by bevacizumab combined with chemotherapy in HER2-negative breast cancer patients. Our results suggest that the clinical response to bevacizumab may occur through an increase in the extent of vascular normalization primarily in patients...

  10. Auditory brainstem responses to CE-Chirp® stimuli for normal ears and those with sensorineural hearing loss.

    Science.gov (United States)

    Cho, Sung-Woo; Han, Kyu-Hee; Jang, Hyun-Kyung; Chang, Sun O; Jung, Hyunseo; Lee, Jun Ho

    2015-01-01

    Evaluation of the characteristic differences between click-and CE-Chirp-evoked auditory brainstem responses (ABRs) in normal hearing and sensorineural hearing loss. A prospective study. Ears with normal hearing and with sensorineural hearing loss were evaluated. Pure-tone audiometry and click-and CE-Chirp evoked ABRs exams were conducted for all ears. Visual detection levels, wave-V amplitudes, and latencies of the ABRs were assessed. Twenty-two ears with normal hearing and 22 ears with sloping type sensorineural hearing loss were examined. In normal-hearing ears, mean amplitudes were larger for CE-chirps than for clicks at all intensities until 80 dB nHL, at which the amplitudes dropped off, presumably due to upward spread of excitation. In ears with sensorineural hearing loss, however the drop-off was less significant at 80 dB nHL. Comparisons with pure-tone audiometry findings revealed ABRs to CE-Chirps to correlate at 0.5, 1, 2, and 3 kHz, and to clicks at 1, 2, 3, and 4 kHz. The CE-Chirp has advantages over clicks for examining normal ears. However, under high-level stimulation, these advantages are no longer present. In ears with sensorineural hearing loss, the upward spread of excitation is less prominent. The CE-Chirps results correlate significantly to low frequency audiometric findings at 0.5 kHz, while clicks do not.

  11. Impact of gonadotropin-releasing hormone antagonist addition on pregnancy rates in gonadotropin-stimulated intrauterine insemination cycles

    Directory of Open Access Journals (Sweden)

    Shikha Jain

    2016-01-01

    Full Text Available OBJECTIVES: The objective of the study is to evaluate the efficacy of gonadotropin-releasing hormone (GnRH antagonist in improving clinical pregnancy rate in gonadotropin-stimulated intrauterine insemination (IUI cycles in patients of unexplained infertility. STUDY DESIGN: This was a prospective, randomized case-controlled study. SETTINGS: The study was conducted in the infertility clinic of a tertiary care center. MATERIALS AND METHODS: Four hundred twenty-seven women undergoing IUI following controlled ovarian stimulation with gonadotropins (recombinant follicle-stimulating hormone [r-FSH] 75 IU/day were randomly divided into two groups. Women in Group I received GnRH antagonist (Cetrorelix 0.25 mg/day in a multiple dose flexible protocol. Women in Group II received r-FSH alone. Ovulatory trigger was given with human chorionic gonadotropin 5000 IU when dominant follicle was ≥18 mm. IUI was performed within 44-48 h. Both groups received similar luteal phase support. Primary outcome measure was clinical pregnancy rate. The trial was powered to detect an absolute increase in clinical pregnancy rate by 13% from an assumed 20% clinical pregnancy rate in the control group, with an alpha error level of 0.05 and a beta error level of 0.20. RESULTS: Clinical pregnancy rate in Groups I and II was 27.6% (n = 56 and 26.5% (n = 54, respectively (P=0.800. Ongoing pregnancy and multiple pregnancy rates were likewise similar between the groups. CONCLUSIONS: Addition of GnRH antagonist to gonadotropin-stimulated IUI cycles results in no significant difference in clinical pregnancy rate.

  12. [Visual evoked responses with flash pattern in normal subjects (author's transl)].

    Science.gov (United States)

    Samson-Dollfus, D; Parain, D; Mihout, B; Menard, J F; Weber, J; Neheli, F

    1981-11-01

    Visual evoked responses to flash pattern simulations have been observed in young healthy adults. Stimulations of whole visual fields (37 subjects) and half-fields (11 subjects) have been performed. These responses are reproductible from one subject to another and show very clear waves in the occipital and central regions. On central leads, whatever the stimulation (stimulation of total visual fields or half-fields), the responses are always the same: a negative peak at 70 msec. followed by a positive peak at 90 msec, then a negative peak at 116-120 msec. On occipital leads, stimulation of the whole visual field shows a diphasic response: a positive wave at 100 msec and a negative wave at 140-150 msec. However, half-field stimulation shows different responses on the ipsi- and contralateral hemispheres, with a disappearance of the positive 100 msec wave in the ipsilateral occipital region. Thus, flash pattern stimulations seem to be useful in clinical practice because they evoke different types of responses in occipital and central regions.

  13. Matched-Comparative Modeling of Normal and Diseased Human Airway Responses Using a Microengineered Breathing Lung Chip.

    Science.gov (United States)

    Benam, Kambez H; Novak, Richard; Nawroth, Janna; Hirano-Kobayashi, Mariko; Ferrante, Thomas C; Choe, Youngjae; Prantil-Baun, Rachelle; Weaver, James C; Bahinski, Anthony; Parker, Kevin K; Ingber, Donald E

    2016-11-23

    Smoking represents a major risk factor for chronic obstructive pulmonary disease (COPD), but it is difficult to characterize smoke-induced injury responses under physiological breathing conditions in humans due to patient-to-patient variability. Here, we show that a small airway-on-a-chip device lined by living human bronchiolar epithelium from normal or COPD patients can be connected to an instrument that "breathes" whole cigarette smoke in and out of the chips to study smoke-induced pathophysiology in vitro. This technology enables true matched comparisons of biological responses by culturing cells from the same individual with or without smoke exposure. These studies led to identification of ciliary micropathologies, COPD-specific molecular signatures, and epithelial responses to smoke generated by electronic cigarettes. The smoking airway-on-a-chip represents a tool to study normal and disease-specific responses of the human lung to inhaled smoke across molecular, cellular and tissue-level responses in an organ-relevant context. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Birth weight and gestation influence striatal morphology and motor response in normal six-year-old boys.

    Science.gov (United States)

    Qiu, Anqi; Rifkin-Graboi, Anne; Zhong, Jidan; Phua, Desiree Yee-Ling; Lai, Yap Kai; Meaney, Michael J

    2012-01-16

    The relation between fetal growth and attention deficit hyperactivity disorder (ADHD) cuts across the normal range of birth weights suggesting that subtle variations in fetal development may influence brain and cognitive function. We investigated the relation of ADHD-related endophenotypes, such as the striatum morphology, motor response and inhibition, with birth weight and gestational age in healthy children. 157 Six-year-old boys born at term (37 to 41 weeks) within the normal range for birth weight (2500 to 4630 g) underwent magnetic resonance imaging (MRI) and performed the stop signal task. Linear regression was used to examine effects of birth weight, gestational age, and their interaction on striatal volumes and shapes as well as motor response and inhibition. Interactive effects of birth weight and gestational age, even within the normal range, predicted caudate volumes and shapes. Boys with relatively low birth weight and shorter gestation had smaller caudate volumes, reflected by shape contraction in the middle body, and in addition performed worst in motor response, reflected by mean reaction time and its variability. Our results supported the idea that prenatal influences on neurocognitive and brain development are not limited to the extreme range, but occur across the entire population. Variations in brain structure and cognitive endophenotypes associated with childhood ADHD psychopathology are sensitive to subtle prenatal influences, which provides guidance for intervention research to improve mental health of children.

  15. Effects of leptin on gonadotropin-releasing hormone release from hypothalamic-infundibular explants and gonadotropin release from adenohypophyseal primary cell cultures: further evidence that fully nourished cattle are resistant to leptin.

    Science.gov (United States)

    Amstalden, M; Harms, P G; Welsh, T H; Randel, R D; Williams, G L

    2005-01-01

    In rodents and pigs, leptin stimulates the release of gonadotropin-releasing hormone (GnRH) from hypothalamus, gonadotropins from adenohypophyseal (AP) explants and cells, and luteinizing hormone (LH) from full-fed animals. In the current studies, we investigated whether leptin could stimulate the release of GnRH from bovine hypothalamic-infundibular (HYP) explants and gonadotropins from bovine adenohypophyseal cells. In Experiment 1A, HYP explants collected from 17 bulls and seven steers were incubated with Krebs-Ringer bicarbonate buffer (KRB) containing 0, 10, 100, or 1000 ng/ml recombinant ovine leptin (oleptin) for 30 min after a 3-h period of equilibration. None of the doses of leptin affected (P > 0.05) GnRH release into the media. In Experiment 1B, HYP explants collected from six steers were incubated with KRB containing 0 or 1000 ng/ml oleptin for two consecutive 30-min periods and challenged with 60 mM K(+) afterwards. Leptin did not affect (P > 0.05) basal or K(+)-stimulated release of GnRH. In Experiment 2, adenohypophyses from steers were collected at slaughter and cells dispersed and cultured for 4 days. On day 5, cells were treated with media alone (control) or media containing 10(-11), 10(-10), 10(-9), and 10(-8)M oleptin. Three independent replications were performed. None of the doses of leptin stimulated (P > 0.05) the release of LH. Although leptin at 10(-11), 10(-10), and 10(-9)M increased (P release of FSH compared to control-treated cells in one replicate, this effect was not confirmed in the other two replicates. Results support the hypothesis that leptin has limited effects on the release of GnRH and gonadotropins in full-fed cattle and reiterate important species differences in responsiveness to leptin.

  16. Efficacy and safety of gonadotropin-releasing hormone agonists used in the treatment of prostate cancer

    Directory of Open Access Journals (Sweden)

    Choi S

    2011-12-01

    Full Text Available Seungtaek Choi, Andrew K LeeDepartment of Radiation Oncology, MD Anderson Cancer Center, Houston, TX, USAAbstract: Androgen deprivation therapy (ADT is the most effective systemic treatment for prostate cancer. ADT has been shown to have a high rate of response and to improve overall survival in patients with metastatic prostate cancer. In addition, multiple studies have shown that adding ADT to external beam radiation therapy leads to improvement in cure rates and overall survival in prostate cancer patients. The most commonly used ADT is gonadotropin-releasing hormone (GnRH agonist therapy. Although GnRH agonist therapy has significant benefits for patients with prostate cancer, it has also been shown to have significant side effects, including fatigue, hot flashes, decreased libido, decreased quality of life, obesity, diabetes mellitus, coronary artery disease, decreased bone mineral density, and increased risk of fractures. Therefore, it is crucial that the benefits of ADT be weighed against its potential adverse effects before its use.Keywords: androgen deprivation therapy, gonadotropin-releasing hormone agonists, prostate cancer

  17. The presence of gonadotropin binding sites in the intracellular organelles of human ovaries.

    Science.gov (United States)

    Rao, C V; Mitra, S; Sanfilippo, J; Carman, F R

    1981-03-15

    The nuclei (N), plasma membranes (PM), mitochondria-lysosomes, rough endoplasmic reticulum, and combined (light, medium, and heavy) Golgi (G) fractions were isolated from human ovaries. The purities of these fractions were evaluated by assays of appropriate marker enzymes, which revealed that some fractions were very pure but that others had minor contamination. When tested, all of the fractions exhibited 125I-labeled human chorionic gonadotropin (125I-hCG)-specific binding. This intracellular 125I-hCG binding was not due to PM contamination because: (1) N, which had no detectable 5'-nucleotidase (5'-NE) activity, a marker for PM, exhibited 125I-hCG-specific binding; (2) the G, which had only a fraction of the 5'-NE activity of PM, exhibited as much binding as PM; and (3) the ratios between specific 125I-hCG binding and 5'-NE activity in other fractions were not the same as for PM. They should have been the same if PM contamination was responsible for the 125I-hCG binding observed in other organelles. In conclusion, our results demonstrate that gonadotropin-binding sites are present in various intracellular organelles as well as in PM of human ovaries.

  18. "Good" Students and "Involved" Mothers: Latin@ Responses to Normalization Pressures in Schools

    Science.gov (United States)

    Cuero, Kimberley Kennedy; Valdez, Veronica E.

    2012-01-01

    Drawing from two in-depth qualitative studies, we used a sociocultural lens for a cross-case analysis examining how Latin@s' participation in schools is affected by ideological messages that subordinately position them in terms of their ethnicity, class, and immigrant status. We identified a range of dynamic responses to the school's normalization…

  19. Ovarian response in consecutive cycles of ovarian stimulation in normally ovulating women.

    Science.gov (United States)

    Ahmed Ebbiary, N A; Morgan, C; Martin, K; Afnan, M; Newton, J R

    1995-03-01

    Ovarian stimulation combined with intra-uterine insemination (IUI) is an effective treatment of non-tubal infertility but most women undergo several cycles of treatment to achieve a pregnancy. This prospective study was designed to assess the consistency (or variation) of ovarian responses and the effect of various ovarian stimulation protocols on this consistency in consecutive cycles of ovarian stimulation and IUI in women with non-ovulatory infertility. A total of 86 regularly menstruating ovulating patients each completed three to six cycles of ovarian stimulation and IUI (n = 347 cycles). Ovarian stimulation was achieved by sequential clomiphene citrate/human menopausal gonadotrophin (HMG), HMG-only or combined gonadotrophin-releasing hormone analogue--HMG protocols in 33, 29 and 24 patients respectively, and each patient used the same protocol consistently throughout the study. Standard methods were used to monitor ovarian response and to perform IUI. Using each patient as her own control, repeated measurements analysis of variance revealed consistency of ovarian response in consecutive ovarian stimulation cycles, as shown by the number and mean diameter of maturing pre-ovulatory follicles, peak plasma oestradiol, duration of stimulation and mean HMG requirements. This consistency existed using any of the ovarian stimulation protocols. We conclude that regularly menstruating and ovulating women are likely to have similar ovarian responses in consecutive cycles of ovarian stimulation and IUI if the same ovarian stimulation protocol is used consistently.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Photoperiod-gonadotropin mismatches induced by treatment with acyline or FSH in Siberian hamsters: impacts on ovarian structure and function.

    Science.gov (United States)

    Zysling, D A; Park, S-U; McMillan, E L; Place, N J

    2012-11-01

    Many seasonal breeders time their reproductive efforts to specific times of the year to ensure adequate resources for the production and care of young. For long-day (LD) breeders, females born before the summer solstice (LDs) reach sexual maturity quickly and often breed that same year, whereas females born after the summer solstice (short days (SDs)) may delay reproductive development to the following spring when environmental conditions are favorable for reproduction. In Siberian hamsters, development in SD is associated with structural and functional differences in the ovary compared with females held in LD, including a greater number of primordial follicles and an abundance of hypertrophied granulosa cells (HGCs), which are immunoreactive for anti-Müllerian hormone. The goal of this study was to determine whether SD-induced gonadotropin suppression is responsible for these phenotypic differences. Gonadotropin levels were suppressed in LD hamsters using the GNRH antagonist acyline. Conversely, to determine whether the SD ovarian phenotype is completely reversed by gonadotropin stimulation, recombinant human FSH (rhFSH) was administered. Our treatments were successful in mimicking FSH concentrations of the opposite photoperiod, but they did not produce a comparable change in the ovarian phenotype. Most notable was the lack of HGCs in the ovaries of acyline-treated LD females. Similarly, HGCs were maintained in the ovaries of SD females treated with rhFSH. Our data suggest that gonadotropins alone do not account for the SD ovarian phenotype. Future studies will determine whether SD-induced changes in other factors underlie these phenotypic changes.

  1. Forward modeling and inversion of responses for borehole normal and lateral electrode arrangements

    Energy Technology Data Exchange (ETDEWEB)

    Kim, J.H.

    1986-01-01

    The finite difference method is used to solve the forward problems which simulate the borehole normal and lateral electrode arrangements for the combined boundary (2-D) earth model which has both horizontal and cylindrical boundaries. The ridge regression estimator is then applied to solve the inverse problems which determine the earth parameters such as bed boundaries, extent of invaded zones, and vertical and horizontal resistivity profiles from the borehole normal and lateral resistivity logs. The apparent resistivity values in the presence of borehole mud, invaded zone, and horizontal bed boundaries can be obtained from an earth geometry provided that the model is symmetric around the borehole axis. The quick and accurate forward calculations are achieved by using a gradually expanding grid system and a terminal resistance type boundary condition, and by using a two-dimensional average resistivity scheme in a grid block. The finite difference solutions are verified against analytical solutions for limiting cases, and excellent agreement in obtained. The finite difference forward modeling also can be used for investigation into the effects of the earth parameter variations on the apparent resistivities. Inverse modeling is tested on synthetic and field data. The field data are inverted to a horizontally layered (1-D) model, and the theoretical data are inverted to a 2-D model. The test results indicate that the thickness and the resistivity of each layer can be determined simultaneously. For the practical inversion of field data, the 1-D model inversion results can be used as a first try model of the 2-d inversion. Interactive inverse modeling can be used for an automatic interpretation of the resistivity logs, with models constrained by logging and geologic information.

  2. Optimisation of an oviposition protocol employing human chorionic and pregnant mare serum gonadotropins in the Barred Frog Mixophyes fasciolatus (Myobatrachidae

    Directory of Open Access Journals (Sweden)

    Clulow John

    2012-08-01

    Full Text Available Abstract Background Protocols for the hormonal induction of ovulation and oviposition are essential tools for managing threatened amphibians with assisted reproduction, but responses vary greatly between species and even broad taxon groups. Consequently, it is necessary to assess effectiveness of such protocols in representative species when new taxa become targets for induction. The threatened genus Mixophyes (family Myobatrachidae has amongst the highest proportion of endangered species of all the Australian amphibians. This study developed and optimised the induction of oviposition in a non-threatened member of this taxon, the great barred frog (Mixophyes fasciolatus. Methods Gravid female M. fasciolatus were induced to oviposit on one or more occasions by administration of human chorionic gonadotropin (hCG with or without priming with pregnant mare serum gonadotropin (PMSG. Treatments involved variations in hormone doses and combinations (administered via injection into the dorsal lymph sacs, and timing of administration. Pituitary homogenates from an unrelated bufonid species (Rhinella marina were also examined with hCG. Results When injected alone, hCG (900 to 1400 IU induced oviposition. However, priming with two time dependent doses of PMSG (50 IU, 25 IU increased responses, with lower doses of hCG (200 IU. Priming increased response rates in females from around 30% (hCG alone to more than 50% (p = 0.035, and up to 67%. Increasing the interval between the first PMSG dose and first hCG dose from 3 to 6 days also produced significant improvement (p Conclusions This study found that M. fasciolatus is amongst the few amphibian species (including Xenopus (Silurana and some bufonids that respond well to the induction of ovulation utilising mammalian gonadotropins (hCG. The optimal protocol for M. fasciolatus involved two priming doses of PMSG (50 IU and 25 IU administered at 6 and 4 days respectively, prior to two doses of hCG (100 IU, 24

  3. Decreased neuroendocrine responses to meta-chlorophenylpiperazine (m-CPP) but normal responses to ipsapirone in marathon runners.

    Science.gov (United States)

    Broocks, A; Meyer, T; George, A; Hillmer-Vogel, U; Meyer, D; Bandelow, B; Hajak, G; Bartmann, U; Gleiter, C H; Rüther, E

    1999-02-01

    Several clinical studies suggest antidepressive and anxiolytic effects of regular aerobic exercise. To study the effects of exercise on central serotonergic receptor sensitivity, we performed neuroendocrine challenges using oral doses of meta-chlorophenylpiperazine (m-CPP, 0.4 mg/kg), ipsapirone (0.3 mg/kg) and placebo in 12 marathon runners and 12 healthy controls not practicing regular exercise. After administration of the nonselective serotonergic agonist m-CPP, which exerts a number of well-reproducible effects mainly by means of its action on 5-HT2C receptors, marathon runners showed a significantly reduced cortisol response in comparison to the control group. There was also a statistical trend toward a blunted prolactin response after m-CPP in the athlete group. In contrast, the increase of cortisol and the hypothermia observed after administration of the 5-HT1A agonist ipsapirone were of the same magnitude in both groups. The behavioral response to m-CPP or ipsapirone and the mean maximal increases of plasma adrenaline and noradrenaline did not differ between the marathon and the control group. In conclusion, exercise-induced downregulation of 5-HT2C receptors could play an important role in mediating the anxiolytic and antidepressive effects of exercise.

  4. Pretreatment of normal responders in fresh in vitro fertilization cycles: A comparison of transdermal estradiol and oral contraceptive pills.

    Science.gov (United States)

    Pereira, Nigel; Petrini, Allison C; Zhou, Zhen N; Lekovich, Jovana P; Kligman, Isaac; Rosenwaks, Zev

    2016-12-01

    The aim of this study was to investigate the impact of pretreatment with transdermal estradiol (E2) compared to oral contraceptive pills (OCPs) on controlled ovarian stimulation (COS) response in normal responders undergoing fresh in vitro fertilization (IVF)-embryo transfer (ET) cycles. A retrospective cohort study was performed of normal responders undergoing fresh IVF-ET cycles who received pretreatment with transdermal E2 versus OCPs prior to fresh IVF-ET. The total days of ovarian stimulation, total dosage of gonadotropins, total number of oocytes, and mature oocytes retrieved were noted. Pregnancy outcomes after ET were also recorded. A total of 2,092 patients met the inclusion criteria: 1,057 and 1,035 patients in the transdermal E2 and OCP groups, respectively. Patients in the OCP group had a longer duration of COS (10.7±1.63 days, p<0.01) than the E2 group (9.92±1.94 days). Patients in the OCP group also required higher cumulative doses of gonadotropins (2,657.3±1,187.9 IU) than those in the E2 group (2,550.1±1,270.2 IU, p=0.002). No statistically significant differences were found in the total and mature oocytes retrieved or in the rates of biochemical pregnancy, clinical pregnancy, spontaneous miscarriage, and live birth between the groups. Our findings suggest that compared to OCPs, pretreatment with transdermal E2 is associated with a shorter duration of ovarian stimulation and lower gonadotropin utilization, without compromising the oocyte yield or pregnancy outcomes in normal-responder patients undergoing fresh IVF.

  5. Pretreatment of normal responders in fresh in vitro fertilization cycles: A comparison of transdermal estradiol and oral contraceptive pills

    Science.gov (United States)

    Petrini, Allison C.; Zhou, Zhen N.; Lekovich, Jovana P.; Kligman, Isaac; Rosenwaks, Zev

    2016-01-01

    Objective The aim of this study was to investigate the impact of pretreatment with transdermal estradiol (E2) compared to oral contraceptive pills (OCPs) on controlled ovarian stimulation (COS) response in normal responders undergoing fresh in vitro fertilization (IVF)-embryo transfer (ET) cycles. Methods A retrospective cohort study was performed of normal responders undergoing fresh IVF-ET cycles who received pretreatment with transdermal E2 versus OCPs prior to fresh IVF-ET. The total days of ovarian stimulation, total dosage of gonadotropins, total number of oocytes, and mature oocytes retrieved were noted. Pregnancy outcomes after ET were also recorded. Results A total of 2,092 patients met the inclusion criteria: 1,057 and 1,035 patients in the transdermal E2 and OCP groups, respectively. Patients in the OCP group had a longer duration of COS (10.7±1.63 days, p<0.01) than the E2 group (9.92±1.94 days). Patients in the OCP group also required higher cumulative doses of gonadotropins (2,657.3±1,187.9 IU) than those in the E2 group (2,550.1±1,270.2 IU, p=0.002). No statistically significant differences were found in the total and mature oocytes retrieved or in the rates of biochemical pregnancy, clinical pregnancy, spontaneous miscarriage, and live birth between the groups. Conclusion Our findings suggest that compared to OCPs, pretreatment with transdermal E2 is associated with a shorter duration of ovarian stimulation and lower gonadotropin utilization, without compromising the oocyte yield or pregnancy outcomes in normal-responder patients undergoing fresh IVF. PMID:28090462

  6. Dynamic Responses of A Semi-Type Offshore Floating Wind Turbine During Normal State and Emergency Shutdown

    Institute of Scientific and Technical Information of China (English)

    胡志强; 李良; 王晋; 胡秋皓; 沈马成

    2016-01-01

    This paper addresses joint wind-wave induced dynamic responses of a semi-type offshore floating wind turbine (OFWT) under normal states and fault event conditions. The analysis in this paper is conducted in time domain, using an aero-hydro-servo-elastic simulation code-FAST. Owing to the unique viscous features of the reference system, the original viscous damping model implemented in FAST is replaced with a quadratic one to gain an accurate capture of viscous effects. Simulation cases involve free-decay motion in still water, steady motions in the presence of regular waves and wind as well as dynamic response in operational sea states with and without wind. Simulations also include the cases for transient responses induced by fast blade pitching after emergency shutdown. The features of platform motions, local structural loads and a typical mooring line tension force under a variety of excitations are obtained and investigated.

  7. Dynamic responses of a semi-type offshore floating wind turbine during normal state and emergency shutdown

    Science.gov (United States)

    Hu, Zhi-qiang; Li, Liang; Wang, Jin; Hu, Qiu-hao; Shen, Ma-cheng

    2016-03-01

    This paper addresses joint wind-wave induced dynamic responses of a semi-type offshore floating wind turbine (OFWT) under normal states and fault event conditions. The analysis in this paper is conducted in time domain, using an aero-hydro-servo-elastic simulation code-FAST. Owing to the unique viscous features of the reference system, the original viscous damping model implemented in FAST is replaced with a quadratic one to gain an accurate capture of viscous effects. Simulation cases involve free-decay motion in still water, steady motions in the presence of regular waves and wind as well as dynamic response in operational sea states with and without wind. Simulations also include the cases for transient responses induced by fast blade pitching after emergency shutdown. The features of platform motions, local structural loads and a typical mooring line tension force under a variety of excitations are obtained and investigated.

  8. Effects of food on the central and peripheral haemodynamic response to upright exercise in normal volunteers.

    OpenAIRE

    Yi, J. J.; Fullwood, L.; Stainer, K; Cowley, A. J.; Hampton, J R

    1990-01-01

    The central and peripheral haemodynamic effects of a modest meal were investigated in healthy volunteers at rest and in response to submaximal exercise. The meal increased heart rate, cardiac output, oxygen consumption, carbon dioxide production, and minute ventilation at rest and during exercise. The effects of food were additive to those induced by the exercise. Food had no effect on limb blood flow and lowered total systemic vascular resistance suggesting that there were no compensatory ch...

  9. Pial artery and subarachnoid width response to apnoea in normal humans.

    Science.gov (United States)

    Wszedybyl-Winklewska, Magdalena; Wolf, Jacek; Swierblewska, Ewa; Kunicka, Katarzyna; Gruszecki, Marcin; Guminski, Wojciech; Winklewski, Pawel J; Frydrychowski, Andrzej F; Bieniaszewski, Leszek; Narkiewicz, Krzysztof

    2015-09-01

    Little is known about intracranial pressure (ICP)-cerebral haemodynamic interplay during repetitive apnoea. A recently developed method based on near-infrared transillumination/backscattering sounding (NIR-T/BSS) noninvasively measures changes in pial artery pulsation (cc-TQ) as well as subarachnoid width (sas-TQ) in humans. We tested the complex response of the pial artery and subarachnoid width to apnoea using this method. The pial artery and subarachnoid width response to consecutive apnoeas lasting 30, 60 s and maximal breath-hold (91.1 ± 23.1 s) were studied in 20 healthy volunteers. The cc-TQ and sas-TQ were measured using NIR-T/BSS; cerebral blood flow velocity (CBFV), pulsatility index and resistive index were measured using Doppler ultrasound of the left internal carotid artery; heart rate (HR) and beat-to-beat SBP and DBP blood pressure were recorded using a Finometer; end-tidal CO2 (EtCO2) was measured using a medical gas analyser. Apnoea evoked a multiphasic response in blood pressure, pial artery compliance and ICP. First, SBP declined, which was accompanied by an increase in cc-TQ and sas-TQ. Directly after these changes, SBP exceeded baseline values, which was followed by a decline in cc-TQ and the return of sas-TQ to baseline. During these initial changes, CBFV remained stable. Towards the end of the apnoea, BP, cc-TQ and CBFV increased, whereas pulsatility index, resistive index and sas-TQ declined. Changes in sas-TQ were linked to changes in EtCO2, HR and SBP. Apnoea is associated with ICP swings, closely reflecting changes in EtCO2, HR and peripheral BP. The baroreflex influences the pial artery response.

  10. Ocular mucosal CD11b+ and CD103+ mouse dendritic cells under normal conditions and in allergic immune responses.

    Directory of Open Access Journals (Sweden)

    Payal Khandelwal

    Full Text Available Steady state dendritic cells (DC found in non-lymphoid tissue sites under normal physiologic conditions play a pivotal role in triggering T cell responses upon immune provocation. CD11b+ and CD103+ DC have received considerable attention in this regard. However, still unknown is whether such CD11b+ and CD103+ DC even exist in the ocular mucosa, and if so, what functions they have in shaping immune responses. We herein identified in the ocular mucosa of normal wild-type (WT and Flt3-/- mice the presence of a CD11b+ DC (i.e., CD11c+ MHCII+ CD11b+ CD103- F4/80+ Sirp-a+. CD103+ DC (i.e. CD11c+ MHCII+ CD11b low CD103+ CD8a+ DEC205+ Langerin+ were also present in WT, but not in Flt3-/- mice. These CD103+ DC expressed high levels of Id2 and Flt3 mRNA; whereas CD11b+ DC expressed high Irf4, Csfr, and Cx3cr1 mRNA. Additionally, the functions of these DC differed in response to allergic immune provocation. This was assessed utilizing a previously validated model, which includes transferring specific populations of exogenous DC into the ocular mucosa of ovalbumin (OVA/alum-primed mice. Interestingly, in such mice, topical OVA instillation following engraftment of exogenous CD11b+ DC led to dominant allergic T cell responses and clinical signs of ocular allergy relative to those engrafted with CD103+ DC. Thus, although CD11b+ and CD103+ DC are both present in the normal ocular mucosa, the CD11b+ DC subset plays a dominant role in a mouse model of ocular allergy.

  11. Estimation of low-dose radiation-responsive proteins in the absence of genomic instability in normal human fibroblast cells.

    Science.gov (United States)

    Yim, Ji-Hye; Yun, Jung Mi; Kim, Ji Young; Nam, Seon Young; Kim, Cha Soon

    2017-07-25

    Low-dose radiation has various biological effects such as adaptive responses, low-dose hypersensitivity, as well as beneficial effects. However, little is known about the particular proteins involved in these effects. Here, we sought to identify low-dose radiation-responsive phosphoproteins in normal fibroblast cells. We assessed genomic instability and proliferation of fibroblast cells after γ-irradiation by γ-H2AX foci and micronucleus formation analyses and BrdU incorporation assay, respectively. We screened fibroblast cells 8 h after low-dose (0.05 Gy) γ-irradiation using Phospho Explorer Antibody Microarray and validated two differentially expressed phosphoproteins using Western blotting. Cell proliferation proceeded normally in the absence of genomic instability after low-dose γ-irradiation. Phospho antibody microarray analysis and Western blotting revealed increased expression of two phosphoproteins, phospho-NFκB (Ser536) and phospho-P70S6K (Ser418), 8 h after low-dose radiation. Our findings suggest that low-dose radiation of normal fibroblast cells activates the expression of phospho-NFκB (Ser536) and phospho-P70S6K (Ser418) in the absence of genomic instability. Therefore, these proteins may be involved in DNA damage repair processes.

  12. The Comparison of the Average Thresholds of Auditory Steady-State Response in Adult Subjective Idiopathic Tinnitus and Normal Subjects

    Directory of Open Access Journals (Sweden)

    Zahra Ghasem Ahmad

    2009-12-01

    Full Text Available Background and Aim: Tinnitus is a common symptom among lots of people but little is known about its origins. This study was aimed at comparing the Auditory Steady-State Response (ASSR thresholds in normal cases and patients with subjective idiopathic tinnitus (SIT in order to diagnose its real origins.Materials and Methods: This case-control study was conducted on 19 patients with tinnitus and 24 normal cases aged 18-40 yr.The patients underwent broad medical tests to roll out any background reason for their tinnitus. ASSR thresholds were estimated in both groups at 20 and 40 amplitude modulation. The patients were selected from tinnitus patients in Research Center in Hazrat Rasoul Hospital, Tehran, Iran.Results: The mean ASSR thresholds at 40HZ modulation were worse in tinnitus patients compared to normal ones (p<0.05 but no significant statistical differences was detected at 20HZ. These results were found in both situations in which we averaged both ears thresholds and when we estimated the thresholds of the ears separately.Conclusion: It seems that the origin of the responses of the modulation of 40Hz, primary auditory cortex, midbrain regions and subcortical areas, in these patients is involved or the origin of their tinnitus is related to some kind of problems in these areas, although more investigation is needed about 20Hz.

  13. Responses of the trunk to multidirectional perturbations during unsupported sitting in normal adults.

    Science.gov (United States)

    Thrasher, T Adam; Sin, Vivian W; Masani, Kei; Vette, Albert H; Craven, B Cathy; Popovic, Milos R

    2010-08-01

    Understanding how the human body responds to unexpected force perturbations during quiet sitting is important to the science of motor behavior and the design of neuroprostheses for sitting posture. In this study, the performance characteristics of the neck and trunk in healthy individuals were assessed by measuring the kinematic responses to sudden, unexpected force perturbations applied to the thorax. Perturbations were applied in eight horizontal directions. It was hypothesized that displacement of the trunk, settling time and steady-state error would increase when the perturbation direction was diagonal (i.e., anterior-lateral or posterior-lateral) due to the increased complexity of asymmetrical muscle responses. Perturbation forces were applied manually. The neck and trunk responded in a synchronized manner in which all joints achieved peak displacement simultaneously then returned directly to equilibrium. Displacement in the direction of perturbation and perpendicular to the direction of perturbation were both significantly greater in response to diagonal perturbations (p<.001). The center of mass returned to equilibrium in 3.64±1.42 s after the onset of perturbation. Our results suggest that the trunk sometimes behaves like an underdamped oscillator and is not controlled by simple stiffness when subjected to loads of approximately 200 N. The results of this study are intended to be used to develop a neuroprosthesis for artificial control of trunk stability in individuals with spinal cord injury.

  14. Immunoglobulin G–mediated Inflammatory Responses Develop Normally in Complement-deficient Mice

    Science.gov (United States)

    Sylvestre, Diana; Clynes, Raphael; Ma, Minga; Warren, Henry; Carroll, Michael C.; Ravetch, Jeffrey V.

    1996-01-01

    The role of complement in immunoglobulin G–triggered inflammation was studied in mice genetically deficient in complement components C3 and C4. Using the reverse passive Arthus reaction and experimental models of immune hemolytic anemia and immune thrombocytopenia, we show that these mice have types II and III inflammatory responses that are indistinguishable from those of wild-type animals. Complement-deficient and wild-type animals exhibit comparable levels of erythrophagocytosis and platelet clearance in response to cytotoxic anti–red blood cell and antiplatelet antibodies. Furthermore, in the reverse passive Arthus reaction, soluble immune complexes induce equivalent levels of hemmorhage, edema, and neutrophillic infiltration in complement-deficient and wild-type animals. In contrast, mice that are genetically deficient in the expression of Fc receptors exhibit grossly diminished reactions by both cytotoxic antibodies and soluble immune complexes. These studies provide strong evidence that the activation of cell-based FcγR receptors, but not complement, are required for antibody-triggered murine inflammatory responses. PMID:8976192

  15. Neuroendocrine function in survivors of childhood acute lymphocytic leukemia and non-Hodgkins lymphoma: a study of pulsatile growth hormone and gonadotropin secretions

    Energy Technology Data Exchange (ETDEWEB)

    Mauras, N.; Sabio, H.; Rogol, A.D.

    To assess the neuroendocrine function of long-term survivors of childhood hematologic malignancies, 10 patients who had acute lymphocytic leukemia and two who had non-Hodgkins lymphoma (NHL) (mean age 13.5 +/- 1 year) were studied, who were treated with similar chemotherapeutic regimens with or without 2400 rads of prophylactic cranial irradiation. Pharmacologic growth hormone (GH) stimulation tests and three graded doses of the GH-releasing hormone (1-40-OH-GRH, 0.1, 0.3, and 1 microgram/kg) were administered. Venous sampling for GH and gonadotropin determinations was done at 20-min intervals for 24 h, and a new computerized pulse detection algorithm was used to analyze pulses. All the patients who had neuroendocrine abnormalities were in the cranially irradiated group. Two of the 12 patients were GH deficient, and had abnormal 24-h secretory profiles, blunted GH responses to pharmacologic stimuli, and minimal responses to the three doses of GRH. The pulsatile properties of luteinizing hormone (LH) were normal in 10 of the 12 nongonadally irradiated patients, irrespective of previous cranial irradiation and pubertal stage, when compared with available normative data.

  16. Horizontal vestibuloocular reflex evoked by high-acceleration rotations in the squirrel monkey. I. Normal responses

    Science.gov (United States)

    Minor, L. B.; Lasker, D. M.; Backous, D. D.; Hullar, T. E.; Shelhamer, M. J. (Principal Investigator)

    1999-01-01

    The horizontal angular vestibuloocular reflex (VOR) evoked by high-frequency, high-acceleration rotations was studied in five squirrel monkeys with intact vestibular function. The VOR evoked by steps of acceleration in darkness (3,000 degrees /s(2) reaching a velocity of 150 degrees /s) began after a latency of 7.3 +/- 1.5 ms (mean +/- SD). Gain of the reflex during the acceleration was 14.2 +/- 5.2% greater than that measured once the plateau head velocity had been reached. A polynomial regression was used to analyze the trajectory of the responses to steps of acceleration. A better representation of the data was obtained from a polynomial that included a cubic term in contrast to an exclusively linear fit. For sinusoidal rotations of 0.5-15 Hz with a peak velocity of 20 degrees /s, the VOR gain measured 0.83 +/- 0.06 and did not vary across frequencies or animals. The phase of these responses was close to compensatory except at 15 Hz where a lag of 5.0 +/- 0.9 degrees was noted. The VOR gain did not vary with head velocity at 0.5 Hz but increased with velocity for rotations at frequencies of >/=4 Hz (0. 85 +/- 0.04 at 4 Hz, 20 degrees /s; 1.01 +/- 0.05 at 100 degrees /s, P < 0.0001). No responses to these rotations were noted in two animals that had undergone bilateral labyrinthectomy indicating that inertia of the eye had a negligible effect for these stimuli. We developed a mathematical model of VOR dynamics to account for these findings. The inputs to the reflex come from linear and nonlinear pathways. The linear pathway is responsible for the constant gain across frequencies at peak head velocity of 20 degrees /s and also for the phase lag at higher frequencies being less than that expected based on the reflex delay. The frequency- and velocity-dependent nonlinearity in VOR gain is accounted for by the dynamics of the nonlinear pathway. A transfer function that increases the gain of this pathway with frequency and a term related to the third power of head

  17. Luteinizing hormone and human chorionic gonadotropin: origins of difference.

    Science.gov (United States)

    Choi, Janet; Smitz, Johan

    2014-03-01

    Luteinizing hormone (LH) and human chorionic gonadotropin (hCG) are widely recognized for their roles in ovulation and the support of early pregnancy. Aside from the timing of expression, however, the differences between LH and hCG have largely been overlooked in the clinical realm because of their similar molecular structures and shared receptor. With technologic advancements, including the development of highly purified and recombinant gonadotropins, researchers now appreciate that these hormones are not as interchangeable as once believed. Although they bind to a common receptor, emerging evidence suggests that LH and hCG have disparate effects on downstream signaling cascades. Increased understanding of the inherent differences between LH and hCG will foster more effective diagnostic and prognostic assays for use in a variety of clinical contexts and support the individualization of treatment strategies for conditions such as infertility.

  18. A Dose-Response Strategy Reveals Differences between Normal-Weight and Obese Men in Their Metabolic and Inflammatory Responses to a High-Fat Meal.

    OpenAIRE

    Schwander, Flurina; Kopf-Bolanz, Katrin A.; Buri, Caroline; Portmann, Reto; Egger, Lotti; Chollet, Magali; McTernan, P.G.; Piya, Milan K.; Gijs, Martin A. M.; Vionnet, Nathalie; Pralong, Franc̨ois; Laederach, Kurt; Vergeres, Guy

    2014-01-01

    A dose-response strategy may not only allow investigation of the impact of foods and nutrients on human health but may also reveal differences in the response of individuals to food ingestion based on their metabolic health status. In a randomized crossover study, we challenged 19 normal-weight (BMI: 20-25 kg/m(2)) and 18 obese (BMI: >30 kg/m(2)) men with 500, 1000, and 1500 kcal of a high-fat (HF) meal (60.5% energy from fat). Blood was taken at baseline and up to 6 h postprandially and a...

  19. Cloning of partial putative gonadotropin hormone receptor sequence from fish

    Indian Academy of Sciences (India)

    G Kumaresan; T Venugopal; A Vikas; T J Pandian; S M Athavan

    2000-03-01

    A search for the presence of mariner-like elements in the Labeo rohita genome by polymerase chain reaction led to the amplification of a partial DNA sequence coding for a putative transmembrane domain of gonadotropin hormone receptor. The amplified DNA sequence shows a high degree of homology to the available turkey and human luteinizing and follicle stimulating hormone receptor coding sequences. This is the first report on cloning such sequences of piscine origin.

  20. Gene profiling characteristics of radioadaptive response in AG01522 normal human fibroblasts.

    Directory of Open Access Journals (Sweden)

    Jue Hou

    Full Text Available Radioadaptive response (RAR in mammalian cells refers to the phenomenon where a low-dose ionizing irradiation alters the gene expression profiles, and protects the cells from the detrimental effects of a subsequent high dose exposure. Despite the completion of numerous experimental studies on RAR, the underlying mechanism has remained unclear. In this study, we aimed to have a comprehensive investigation on the RAR induced in the AG01522 human fibroblasts first exposed to 5 cGy (priming dose and then followed by 2 Gy (challenge dose of X-ray through comparisons to those cells that had only received a single 2 Gy dose. We studied how the priming dose affected the expression of gene transcripts, and to identify transcripts or pathways that were associated with the reduced chromosomal damages (in terms of the number of micronuclei after application of the challenging dose. Through the mRNA and microRNA microarray analyses, the transcriptome alteration in AG01522 cells was examined, and the significantly altered genes were identified for different irradiation procedures using bioinformatics approaches. We observed that a low-dose X-ray exposure produced an alert, triggering and altering cellular responses to defend against subsequent high dose-induced damages, and accelerating the cell repair process. Moreover, the p53 signaling pathway was found to play critial roles in regulating DNA damage responses at the early stage after application of the challenging dose, particularly in the RAR group. Furthermore, microRNA analyses also revealed that cell communication and intercellular signaling transduction played important roles after low-dose irradiation. We conclude that RAR benefits from the alarm mechanisms triggered by a low-dose priming radation dose.

  1. Neural and vascular variability and the fMRI-BOLD response in normal aging.

    Science.gov (United States)

    Kannurpatti, Sridhar S; Motes, Michael A; Rypma, Bart; Biswal, Bharat B

    2010-05-01

    Neural, vascular and structural variables contributing to the blood oxygen level-dependent (BOLD) signal response variability were investigated in younger and older humans. Twelve younger healthy human subjects (six male and six female; mean age: 24 years; range: 19-27 years) and 12 older healthy subjects (five male and seven female; mean age: 58 years; range: 55-71 years) with no history of head trauma and neurological disease were scanned. Functional magnetic resonance imaging measurements using the BOLD contrast were made when participants performed a motor, cognitive or a breath hold (BH) task. Activation volume and the BOLD response amplitude were estimated for the younger and older at both group and subject levels. Mean activation volume was reduced by 45%, 40% and 38% in the elderly group during the motor, cognitive and BH tasks, respectively, compared to the younger. Reduction in activation volume was substantially higher compared to the reduction in the gray matter volume of 14% in the older compared to the younger. A significantly larger variability in the intersubject BOLD signal change occurred during the motor task, compared to the cognitive task. BH-induced BOLD signal change between subjects was significantly less-variable in the motor task-activated areas in the younger compared to older whereas such a difference between age groups was not observed during the cognitive task. Hemodynamic scaling using the BH signal substantially reduced the BOLD signal variability during the motor task compared to the cognitive task. The results indicate that the origin of the BOLD signal variability between subjects was predominantly vascular during the motor task while being principally a consequence of neural variability during the cognitive task. Thus, in addition to gray matter differences, the type of task performed can have different vascular variability weighting that can influence age-related differences in brain functional response.

  2. A long-term "memory" of HIF induction in response to chronic mild decreased oxygen after oxygen normalization

    Directory of Open Access Journals (Sweden)

    Green Dixy E

    2007-01-01

    Full Text Available Abstract Background Endothelial dysfunction (ED is functionally characterized by decreased vasorelaxation, increased thrombosis, increased inflammation, and altered angiogenic potential, has been intimately associated with the progression and severity of cardiovascular disease. Patients with compromised cardiac function oftentimes have a state of chronic mild decreased oxygen at the level of the vasculature and organs, which has been shown to exacerbate ED. Hypoxia inducible factor (HIF is a transcription factor complex shown to be the master regulator of the cellular response to decreased oxygen levels and many HIF target genes have been shown to be associated with ED. Methods Human endothelial and aortic smooth muscle cells were exposed either to A normoxia (21% O2 for three weeks, or to B mild decreased oxygen (15% O2 for three weeks to mimic blood oxygen levels in patients with heart failure, or to C mild decreased oxygen for two weeks followed by one week of normoxia ("memory" treatment. Levels of HIF signaling genes (HIF-1α, HIF-2α, VEGF, BNIP3, GLUT-1, PAI-1 and iNOS were measured both at the protein and mRNA levels. Results It was found that chronic exposure to mild decreased oxygen resulted in significantly increased HIF signaling. There was also a "memory" of HIF-1α and HIF target gene induction when oxygen levels were normalized for one week, and this "memory" could be interrupted by adding a small molecule HIF inhibitor to the last week of normalized oxygen. Finally, levels of ubiquitylated HIF-1α were reduced in response to chronic mild decreased oxygen and were not full restored after oxygen normalization. Conclusion These data suggest that HIF signaling may be contributing to the pathogenesis of endothelial dysfunction and that normalization of oxygen levels may not be enough to reduce vascular stress.

  3. Comparison of Therapeutic Response and Clinical Outcome between HCV Patients with Normal and Abnormal Alanine Transaminase Levels.

    Directory of Open Access Journals (Sweden)

    Cheng-Kung Wu

    Full Text Available Patients with chronic hepatitic C (HCV infection and normal serum alanine transaminase (ALT levels were considered to have mild disease. In Taiwan, these patients were not suggested for interferon (IFN based therapies. The aim of study is to compare therapeutic outcomes between HCV patients with normal and elevated ALT levels.We conducted a retrospective study on 3241 HCV patients treated by IFN based therapies. Patients with normal ALT levels were classified as group A (n = 186 while those with elevated ALT levels were group B (n = 3055.At baseline, incidence of diabetes mellitus, low platelet counts and cirrhosis were significantly higher in group B patients. The sustained virologic response (SVR rate was comparable between the 2 groups (65.3% vs. 65.3%, P = .993. But significantly higher incidence of HCC development after HCV treatment was observed in group B (7.4% vs. 3.2%, P = .032. No significant differences with respect to the outcome of liver decompensation, spontaneous bacterial peritonitis, and mortality were noted between 2 groups. Multivariate analysis showed younger age, female gender, non-HCV genotype 1, lower viral load, higher platelet counts and non-cirrhosis were favorable factors for achieving SVR, rather than ALT levels. Further analysis revealed older age, cirrhosis, lower platelet levels and non- peg-interferon treatment are risk factors of HCC development.HCV patients with normal ALT levels had similar response to antiviral therapy and low rate of HCC development after therapy. Antiviral therapies begun at early course of HCV infection may be beneficial to prevent disease progression.

  4. Neuronal networks and mediators of cortical neurovascular coupling responses in normal and altered brain states.

    Science.gov (United States)

    Lecrux, C; Hamel, E

    2016-10-05

    Brain imaging techniques that use vascular signals to map changes in neuronal activity, such as blood oxygenation level-dependent functional magnetic resonance imaging, rely on the spatial and temporal coupling between changes in neurophysiology and haemodynamics, known as 'neurovascular coupling (NVC)'. Accordingly, NVC responses, mapped by changes in brain haemodynamics, have been validated for different stimuli under physiological conditions. In the cerebral cortex, the networks of excitatory pyramidal cells and inhibitory interneurons generating the changes in neural activity and the key mediators that signal to the vascular unit have been identified for some incoming afferent pathways. The neural circuits recruited by whisker glutamatergic-, basal forebrain cholinergic- or locus coeruleus noradrenergic pathway stimulation were found to be highly specific and discriminative, particularly when comparing the two modulatory systems to the sensory response. However, it is largely unknown whether or not NVC is still reliable when brain states are altered or in disease conditions. This lack of knowledge is surprising since brain imaging is broadly used in humans and, ultimately, in conditions that deviate from baseline brain function. Using the whisker-to-barrel pathway as a model of NVC, we can interrogate the reliability of NVC under enhanced cholinergic or noradrenergic modulation of cortical circuits that alters brain states.This article is part of the themed issue 'Interpreting BOLD: a dialogue between cognitive and cellular neuroscience'.

  5. The human vertical translational vestibulo-ocular reflex. Normal and abnormal responses.

    Science.gov (United States)

    Liao, Ke; Walker, Mark F; Joshi, Anand; Reschke, Millard; Strupp, Michael; Leigh, R John

    2009-05-01

    Geometric considerations indicate that the human translational vestibulo-ocular reflex (tVOR) should have substantially different properties than the angular vestibulo-ocular reflex (aVOR). Specifically, tVOR cannot simultaneously stabilize images of distant and near objects on the retina. Most studies make the tacit assumption that tVOR acts to stabilize foveal images even though, in humans, tVOR is reported to compensate for less than 60% of foveal image motion. We have determined that the compensation gain (eye rotational velocity/required eye rotational velocity to maintain foveal target fixation) of tVOR is held steady at approximately 0.6 during viewing of either near or distant targets during vertical (bob) translations in ambient illumination. We postulate that tVOR evolved not to stabilize the image of the target on the fovea, but rather to minimize retinal image motion between objects lying in different depth planes, in order to optimize motion parallax information. Such behavior is optimized when binocular visual cues of both near and distant targets are available in ambient light. Patients with progressive supranuclear palsy or cerebellar ataxia show impaired ability to increase tVOR responses appropriately when they view near targets. In cerebellar patients, impaired ability to adjust tVOR responses to viewing conditions occurs despite intact ability to converge at near. Loss of the ability to adjust tVOR according to viewing conditions appears to represent a distinct disorder of vestibular function.

  6. Food preference and intake in response to ambient odours in overweight and normal-weight females.

    Science.gov (United States)

    Zoon, Harriët F A; He, Wei; de Wijk, René A; de Graaf, Cees; Boesveldt, Sanne

    2014-06-22

    In our food abundant environment, food cues play an important role in the regulation of energy intake. Odours can be considered as external cues that can signal energy content in the anticipatory phase of eating. This study aims to determine whether exposure to olfactory cues associated with energy dense foods leads to increased food intake and greater preference for energy-dense foods. In addition, we assessed whether BMI and hunger state modulated this effect. Twenty-five overweight (mean BMI: 31.3 kg/m(2), S.E.: 0.6) and 25 normal-weight (mean BMI: 21.9 kg/m(2), S.E.: 0.4) females, matched on age and restraint score, participated. In 6 separate sessions they were exposed to odours of three different categories (signalling non-food, high-energy food and low-energy food) in two motivational states (hungry and satiated). After 10 min of exposure food preference was assessed with a computerized two-item forced choice task and after 20 min a Bogus Taste Test was used to determine energy intake (kcal and g). In a hungry state, the participants ate more (ppreferred high-energy products significantly more often (pfood preference of overweight participants was less affected by their internal state (p=.068). Neither energy intake (kcal: p=.553; g: p=.683) nor food preference (p=.280) was influenced by ambient exposure to odours signalling different categories. Future studies need to explore whether food odours can indeed induce overeating. More insight is needed regarding the possible influence of context (e.g. short exposure duration, large variety of food) and personality traits (e.g. restraint, impulsive) on odour-induced overeating. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Renal response to intravenous somatostatin in insulin-dependent diabetic patients and normal subjects

    Energy Technology Data Exchange (ETDEWEB)

    Vora, J.; Owens, D.R.; Luzio, S.; Atiea, J.; Ryder, R.; Hayes, T.M.

    1987-05-01

    The acute effects of iv somatostatin (SRIH; 100 micrograms/h) on the urinary flow (Uvol), effective renal plasma flow (RPF), and glomerular filtration rate (GFR) were compared with those of a control infusion of 0.15 M NaCl in nine insulin-dependent diabetic (IDD) patients of less than 10 yr disease duration and six normal subjects (NS). RPF and GFR were measured using a standard primed constant isotope infusion of (/sup 125/I)iodohippurate and (51Cr)chromium EDTA. Uvol, RPF, and GFR were measured during 20-min clearance periods. During the NaCl infusion mean Uvol, RPF, and GFR were 14.1 +/- 0.2 (+/- SEM), 708 +/- 4, and 150 +/- 1 mL/min in the IDD group and 12.7 +/- 0.4, 568 +/- 5, and 110 +/- 2 mL/min in the NS group, respectively. In the IDD patients Uvol, RPF, and GFR decreased from 16.6 +/- 1.8, 670 +/- 30, 146 +/- 4 mL/min pre-SRIH to 9.2 +/- 1, 553 +/- 25 (P less than 0.001), and 130 +/- 5 mL/min, respectively, at 120 min during the SRIH infusion. Similarly, in the NS group mean Uvol, RPF, and GFR were 14.2 +/- 0.6, 552 +/- 15, and 112 +/- 5 mL/min pre-SRIH and decreased to 7.4 +/- 0.6, 422 +/- 7, and 93 +/- 3 mL/min, respectively, after 120 min of the SRIH infusion. SRIH, therefore, had a profound effect on renal function in both IDD patients and NS, resulting in a reduction in RPF, GFR, and, as a consequence, Uvol.

  8. Differential responses of normal human melanocytes to intra- and extracellular dsRNA.

    Science.gov (United States)

    Wang, Suiquan; Liu, Dongyin; Jin, Rong; Zhu, Yiping; Xu, Aie

    2015-06-01

    Viral factor has been implicated in the etiopathogenesis of vitiligo. To elucidate the effects of viral double-stranded RNA (dsRNA) on melanocytes and to explore the underlying mechanisms, primary cultured normal human melanocytes were treated with synthetic viral dsRNA analog poly(I:C). The results demonstrated that poly(I:C)-triggered apoptosis when transfected into melanocytes, while extracellular poly(I:C) did not have that effect. Intracellular poly(I:C)-induced melanocyte death was decreased by RIG-I or MDA5 siRNA, but not by TLR3 siRNA. Both intracellular and extracellular poly(I:C) induced the expression of IFNB, TNF, IL6, and IL8. However, extracellular poly(I:C) demonstrated a much weaker induction capacity of cytokine genes than intracellular poly(I:C). Further analysis revealed that phosphorylation of TBK1, IRF3, IRF7, and TAK1 was differentially induced by intra- or extracellular poly(I:C). NFκB inhibitor Bay 11-7082 decreased the induction of all the cytokines by poly(I:C), suggesting the ubiquitous role of NFκB in the process. Poly(I:C) treatment also induced the phosphorylation of p38 and JNK in melanocytes. Both JNK and p38 inhibitors showed suppression on the cytokine induction by intra- or extracellular poly(I:C). However, only the JNK inhibitor decreased the intracellular poly(I:C)-induced melanocyte death. Taken together, this study provides the possible mechanism of viral factor in the pathogenesis of vitiligo.

  9. Activation of the innate immune response against DENV in normal non-transformed human fibroblasts.

    Directory of Open Access Journals (Sweden)

    José Bustos-Arriaga

    2011-12-01

    Full Text Available BACKGROUND: When mosquitoes infected with DENV are feeding, the proboscis must traverse the epidermis several times ("probing" before reaching a blood vessel in the dermis. During this process, the salivary glands release the virus, which is likely to interact first with cells of the various epidermal and dermal layers, cells which could be physiologically relevant to DENV infection and replication in humans. However, important questions are whether more abundant non-hematopoietic cells such as fibroblasts become infected, and whether they play any role in antiviral innate immunity in the very early stages of infection, or even if they might be used by DENV as primary replication cells. METHODOLOGY/PRINCIPAL FINDINGS: Fibroblasts freshly released from healthy skin and infected 12 hours after their isolation show a positive signal for DENV. In addition, when primary skin fibroblast cultures were established and subsequently infected, we showed DENV-2 antigen-positive intracellular signal at 24 hours and 48 hours post-infection. Moreover, the fibroblasts showed productive infection in a conventional plaque assay. The skin fibroblasts infected with DENV-2 underwent potent signaling through both TLR3 and RIG- 1, but not Mda5, triggering up-regulation of IFNβ, TNFα, defensin 5 (HB5 and β defensin 2 (HβD2. In addition, DENV infected fibroblasts showed increased nuclear translocation of interferon (IFN regulatory factor 3 (IRF3, but not interferon regulatory factor 7 (IRF7, when compared with mock-infected fibroblasts. CONCLUSIONS/SIGNIFICANCE: In this work, we demonstrated the high susceptibility to DENV infection by primary fibroblasts from normal human skin, both in situ and in vitro. Our results suggest that these cells may contribute to the pro-inflammatory and anti-viral microenvironment in the early stages of interaction with DENV-2. Furthermore, the data suggest that fibroblast may also be used as a primary site of DENV replication and

  10. Difference in leptin hormone response to nutritional status in normal adult male albino rats.

    Science.gov (United States)

    Al-Sowyan, Noorah S

    2009-01-15

    The present study investigated the effect of 14 days diet, enriched in butter, vitamin E (vit. E) and green tea, on the major regulators of energy expenditure. Leptin is the product OB gene. This 16 KDa protein is produced by mature adipocytes and is secreted in plasma. Its plasma levels are strongly correlated with adipose mass in rodents as well as in humans. Leptin inhibit food intake, reduces body weight and stimulates energy expenditure. In order to evaluate the effect of diet enriched in butter, vit. E and green tea on body weight, adipose tissue weight and organs weight, serum lipids, lipoproteins content and serum leptin levels in male albino rats supplemented for 14 days on the previous diet. This study showed that high fat diet significantly increased body weight and adipose tissue weight, while vit. E and green tea enriched diet significantly lowered body weight and adipose tissue weight, kidney and spleen weights didn't show significant changes in all the experimental groups. While liver weight decreased in diet supplemented with high fat diet. Also, the results showed that high fat diet and vit. E supplemented diet induced significant increase in total cholesterol, LDLc., triglyceride level with significant decrease in HDLc. level as compared to normal control rats. Finally green tea supplemented diet induced significant decrease in total cholesterol, LDLc., triglyceride level with insignificant increase in HDLc. level in control rats. On the other hand, high fat supplemented diet significantly increased serum leptin levels in rats compared to control group, while vit. E and green tea enriched diet significantly lowered serum leptin levels at the end of experimental period. In conclusion, improving the biological activity of leptin by diet modification may exist as a practical strategy for the treatment of obesity and related disorders and a diet rich in green tea to reduce the risk of cardiovascular disease (CVD) obesity and also protect the liver

  11. Proximal Tubule Glutamine Synthetase Expression is Necessary for the Normal Response to Dietary Protein Restriction.

    Science.gov (United States)

    Lee, Hyun-Wook; Osis, Gunars; Handlogten, Mary E; Verlander, Jill W; Weiner, I David

    2017-03-22

    Dietary protein restriction has multiple benefits in kidney disease. Because protein intake is a major determinant of endogenous acid production, it is important that net acid excretion change in parallel during changes in dietary protein intake. Dietary protein restriction decreases endogenous acid production and ¬decreases urinary ammonia excretion, a major component of net acid excretion. Glutamine synthetase (GS) catalyzes the reaction of NH4+ and glutamate, which regenerates the essential amino acid glutamine and decreases net ammonia generation. Because renal proximal tubule GS expression increases during dietary protein restriction, this could contribute to the decreased ammonia excretion. The current study's purpose was to determine proximal tubule GS's role in the renal response to protein restriction. We generated mice with proximal tubule-specific GS deletion (PT-GS-KO) using Cre-loxP techniques. Cre-negative (Control) and PT-GS-KO mice in metabolic cages were provided 20% protein diet for 2 days and were then changed to low protein (6%) diet for the next 7 days. Additional PT-GS-KO mice were maintained on 20% protein diet. Dietary protein restriction caused a rapid decrease in urinary ammonia excretion in both genotypes, but PT-GS-KO blunted this adaptive response significantly. This occurred despite no significant genotype-dependent differences in urinary pH or in serum electrolytes. There were no significant differences between Control and PT-GS-KO mice in expression of multiple other proteins involved in renal ammonia handling. We conclude that proximal tubule glutamine synthetase expression is necessary for the appropriate decrease in ammonia excretion during dietary protein restriction.

  12. Arg-Phe-amide-related peptides influence gonadotropin-releasing hormone neurons

    Institute of Scientific and Technical Information of China (English)

    Haluk Kelestimur; Emine Kacar; Aysegul Uzun; Mete Ozcan; Selim Kutlu

    2013-01-01

    The hypothalamic Arg-Phe-amide-related peptides, gonadotropin-inhibitory hormone and orthologous mammalian peptides of Arg-Phe-amide, may be important regulators of the hypothalamus-pituitary-gonadal reproductive axis. These peptides may modulate the effects of kisspeptins because they are presently recognized as the most potent activators of the hypothalamus-pituitary-gonadal axis. However, their effects on gonadotropin-releasing hormone neurons have not been investigated. In the current study, the GT1–7 cell line-expressing gonadotropin-releasing hormone was used as a model to explore the effects of Arg-Phe- amide-related peptides on kisspeptin activation. Intracellular calcium concentration was quantified using the calcium-sensitive dye, fura-2 acetoxymethyl ester. Gonadotropin-releasing hormone released into the medium was detected via enzyme-linked immunosorbent assay. Results showed that 100 nmol/L kisspeptin-10 significantly increased gonadotropin-releasing hormone levels (at 120 minutes of exposure) and intracellular calcium concentrations. Co-treatment of kisspeptin with 1 μmol/L gonadotropin-inhibitory hormone or 1 μmol/L Arg-Phe-amide-related peptide-1 significantly attenuated levels of kisspeptin-induced gonadotropin-releasing hormone but did not affect kisspeptin-induced elevations of intracellular calcium concentration. Overall, the results suggest that gonadotropin-inhibitory hormone and Arg-Phe-amide-related peptide-1 may have inhibitory effects on kisspeptin-activated gonadotropin-releasing hormone neurons independent of the calcium signaling pathway.

  13. 77 FR 55413 - New Animal Drugs; Chorionic Gonadotropin; Naloxone; Oxymorphone; Oxytocin

    Science.gov (United States)

    2012-09-10

    ... Gonadotropin; Naloxone; Oxymorphone; Oxytocin AGENCY: Food and Drug Administration, HHS. ACTION: Final rule.... Painters Dr., Chadds Ford, PA 19317. 046-822 VETOCIN (oxytocin) United Vaccines, A Harlan...

  14. Dynamics of oligodendrocyte responses to anterograde axonal (Wallerian) and terminal degeneration in normal and TNF-transgenic mice

    DEFF Research Database (Denmark)

    Drøjdahl, Nina; Fenger, Christina; Nielsen, Helle H

    2004-01-01

    degeneration and lesion-induced axonal sprouting in the hippocampal dentate gyrus in TNF-transgenic mice with the response in genetically normal mice. Transectioning of the entorhino-dentate perforant path axonal projection increased hippocampal TNF mRNA expression in both types of mice, but to significantly...... larger levels in the TNF-transgenics. At 5 days after axonal transection, numbers of oligodendrocytes and myelin basic protein (MBP) mRNA expression in the denervated dentate gyrus in TNF-transgenic mice had increased to the same extent as in nontransgenic littermates. At this time, transgenics showed...

  15. Artichoke compound cynarin differentially affects the survival, growth and stress response of normal, immortalized and cancerous human cells

    DEFF Research Database (Denmark)

    Gezer, Ceren; Yücecan, Sevinç; Rattan, Suresh Inder Singh

    2015-01-01

    Cynarin (CYN) is the main derivative of caffeoylquinic acid, found in leaves and heads of artichoke. Potential health-beneficial effects of CYN include as being choloretic-cholesterol lowering, hepatoprotective, anti-atherosclerotic, and antioxidative. We have tested the effects of various doses...... of CYN on the proliferative potential, survival, morphology, and stress response (SR) markers haemoxygenase-1 (HO-1) and heat shock protein-70 (HSP70) in normal human skin fibroblasts (FSF-1), telomerase-immortalized mesenchymal stem cells (hTERT-MSC) and cervical cancer cells, HeLa. Effects of CYN...

  16. Artichoke compound cynarin differentially affects the survival, growth and stress response of normal, immortalized and cancerous human cells

    DEFF Research Database (Denmark)

    Gezer, Ceren; Yücecan, Sevinç; Rattan, Suresh Inder Singh

    2015-01-01

    Cynarin (CYN) is the main derivative of caffeoylquinic acid, found in leaves and heads of artichoke. Potential health-beneficial effects of CYN include as being choloretic-cholesterol lowering, hepatoprotective, anti-atherosclerotic, and antioxidative. We have tested the effects of various doses...... of CYN on the proliferative potential, survival, morphology, and stress response (SR) markers haemoxygenase-1 (HO-1) and heat shock protein-70 (HSP70) in normal human skin fibroblasts (FSF-1), telomerase-immortalized mesenchymal stem cells (hTERT-MSC) and cervical cancer cells, HeLa. Effects of CYN...

  17. Thyroiditis in T cell-depleted rats: suppression of the autoallergic response by reconstitution with normal lymphoid cells.

    Science.gov (United States)

    Penhale, W J; Irvine, W J; Inglis, J R; Farmer, A

    1976-07-01

    Qualititive, quantitative and functional differences were found in lymphoid cells of female thymectomized and irradiated (Tx-X) PVG/c strain rats as compared to normal females of the same strain. Tx-X rats were lymphopenic and had reduced numbers of cells within spleen and cervical lymph nodes, depressed transformation responses of peripheral blood lymphocytes to PHA and lower percentage killing of their spleen cells by anti-T-cell serum and complement. There was an increased percentage of immunoglobulin-bearing cells in the lymph nodes. Reconstitution of Tx-X rats by the intravenous route using syngeneic lymph node cells, spleen cells or thymocytes abrogated the autoimmune responses to thyroid components generally observed in this state. Lymph node and spleen cells, but not thymocytes, also prevented thyroid changes when given intraperitoneally. In contrast, bone marrow cells appeared to give enhanced responses. Quntitative studies showed that the relative proportions of the suppressor or autoregulatory cells in various lymphoid tissues were lymph node greater than spleen greater than thymus. Complete abrogation of the autoimmune responses was possible only when cells were administered within a short time of final dose of irradiation and moderate thyroid change was again seen if transfer was delayed for 14 days post-irradiation. At 28 days reconstitution had no influence on the development of the autoimmune responses. Preliminary characterization studies using an anti-T-cell serum and fractionation of lymph node cells on a linear Ficoll gradient suggested that autoregulatory cell is a large T cell.

  18. Normal cortisol response to cold pressor test, but lower free thyroxine, after recovery from undernutrition.

    Science.gov (United States)

    Martins, Vinicius J B; Neves, Andrea P O; Garcia, Márcia C; Spadari, Regina C; Clemente, Ana Paula G; de Albuquerque, Maria P; Hoffman, Daniel J; Sawaya, Ana L

    2016-01-14

    Undernutrition is a stressor with long-term consequences, and the effect of nutritional recovery on cortisol and thyroid hormone status is unknown. To investigate basal thyroid hormones and the cortisol response to a cold pressor test in children recovered from undernutrition, a cross-sectional study was undertaken on children (6-16 years) separated into four groups: control (n 41), stunted (n 31), underweight (n 27) and recovered (n 31). Salivary cortisol was collected over the course of 10 h: upon awakening, before and after an unpleasant and a pleasant stimulus. Cortisol upon awakening was highest in the stunted and lowest in the underweight groups: control=5·05 (95% CI 3·71, 6·89) nmol/l, stunted=6·62 (95% CI 3·97, 11·02) nmol/l, underweight=2·51 (95% CI 1·75, 3·63) nmol/l and recovered=3·46 (95% CI 2·46, 4·90) nmol/l (P=0·005). Girls had higher cortisol concentrations upon awakening compared with boys (P=0·021). The undernourished groups showed an elevated cortisol response both to the unpleasant stimulus and at the last measurement (16.00 hours) compared with that of the recovered group: AUC, control=2·07 (95% CI 1·69, 2·45) nmol/l×30 min, stunted=2·48 (95% CI 1·91, 3·06) nmol/l×30 min, underweight=2·52 (95% CI 2·07, 2·97) nmol/l×30 min, recovered=1·68 (95% CI 1·26, 2·11) nmol/l×30 min (P=0·042); and control=2·03 (95% CI 1·75, 2·39) nmol/l×30 min, stunted=2·51 (95% CI 1·97, 3·19) nmol/l×30 min, underweight=2·61 (95% CI 2·16, 3·16) nmol/l×30 min, recovered=1·70 (95% CI 1·42, 2·03) nmol/l×30 min (P=0·009). Lower free thyroxine (T4) was found in the recovered and stunted groups: control=1·28 (95% CI 1·18, 1·39) pmol/l, stunted=0·98 (95% CI 0·87, 1·10) pmol/l, underweight=1·10 (95% CI 1·01, 1·21) pmol/l and recovered=0·90 (95% CI 0·83, 0·99) pmol/l (Pcortisol concentration along 10 h (06.00-16.00 hours) in the recovered compared with the other groups (P=0·017), and similar concentrations between the

  19. Kisspeptin regulates gonadotropin-releasing hormone secretion in gonadotropin-releasing hormone/enhanced green fluorescent protein transgenic rats

    Institute of Scientific and Technical Information of China (English)

    Haogang Xue; Chunying Yang; Xiaodong Ge; Weiqi Sun; Chun Li; Mingyu Qi

    2013-01-01

    Kisspeptin is essential for activation of the hypothalamo-pituitary-gonadal axis. In this study, we established gonadotropin-releasing hormone/enhanced green fluorescent protein transgenic rats. Rats were injected with 1, 10, or 100 pM kisspeptin-10, a peptide derived from full-length kisspeptin, into the arcuate nucleus and medial preoptic area, and with the kisspeptin antagonist peptide 234 into the lateral cerebral ventricle. The results of immunohistochemical staining revealed that pulsatile luteinizing hormone secretion was suppressed after injection of antagonist peptide 234 into the lateral cerebral ventricle, and a significant increase in luteinizing hormone level was observed after kisspeptin-10 injection into the arcuate nucleus and medial preoptic area. The results of an enzyme-linked immunosorbent assay showed that luteinizing hormone levels during the first hour of kisspeptin-10 infusion into the arcuate nucleus were significantly greater in the 100 pM kisspeptin-10 group than in the 10 pM kisspeptin-10 group. These findings indicate that kisspeptin directly promotes gonadotropin-releasing hormone secretion and luteinizing hormone release in gonadotropin-releasing hormone/enhanced green fluorescent protein transgenic rats. The arcuate nucleus is a key component of the kisspeptin-G protein-coupled receptor 54 signaling pathway underlying regulating luteinizing hormone pulse secretion.

  20. Quantum Effects in Plasma Dielectric Response: Plasmons and Shielding in Normal Systems and Graphene

    Science.gov (United States)

    Horing, Norman J. M.

    A brief review of quantum plasma theory and phenomenology in solid-state plasmas is presented here, with attention to dynamic and nonlocal features of dielectric response. Focussing on the random-phase approximation, we discuss the RPA screening and dielectric functions in three, two, and one dimensions corresponding to bulk, quantum well, and quantum wire plasmas, respectively, taking care to distinguish quantum effects from classical ones mandated by the correspondence principle. In particular, we exhibit plasmon dispersion, damping, and static shielding in these various dimensionalities. We also review Landau-quantized magnetoplasma phenomenology, with emphasis on de Haas-van Alphen oscillatory features in intermediate strength magnetic fields and the quantum strong field limit in which only the lowest Landau eigenstate is populated. Graphene is an exceptionally device-friendly material, with a massless relativistic Dirac energy spectrum for electrons and holes. We exhibit its RPA dynamic, nonlocal dielectric function in detail, discussing Graphene plasmons and electromagnetic modes in the THz range, self-energy, fast particle energy loss spectroscopy, atom/van der Waals interaction, and static shielding of impurity scatterers limiting dc transport in Graphene.

  1. Glycemic index and postprandial blood glucose response to Japanese strawberry jam in normal adults.

    Science.gov (United States)

    Kurotobi, Tomoka; Fukuhara, Kimiaki; Inage, Hiroko; Kimura, Shuichi

    2010-01-01

    We investigated in 30 healthy adults the glycemic index (GI) of five strawberry jams made from various sugar compositions. The jam containing the highest ratio of glucose showed a high GI, while that containing a high ratio of fructose, a jam made from polydextrose, showed a low GI. There was a high correlation (r=0.969, p=0.006) between the GI and the predicted GI calculated from the sugar composition of the jams. Moreover, the influence on postprandial blood glucose response after an intake of only 20 g of jam and one slice of bread with 20 g jam was measured in 8 healthy adults. The blood glucose level after an intake of 20 g of the high GI jam containing the high glucose ratio was higher than that of other jams at 15 min, but there was no significant difference after 30 min. Regardless of whether the GI was low or high, differences in the jams were not observed in the postprandial blood glucose level or the area under the curve after eating either one slice of bread (60 g) or one slice of bread with less than 20 g of jam.

  2. Field Measurement of Wind Speeds and Wind-Induced Responses atop the Shanghai World Financial Center under Normal Climate Conditions

    Directory of Open Access Journals (Sweden)

    Yong Quan

    2013-01-01

    Full Text Available Field measurement data on wind velocities and wind-induced acceleration responses at the top of the 492 m high Shanghai World Financial Center (SWFC under normal climate conditions are studied. Characteristics of the mean wind speeds and turbulence intensities, gust factors, power spectral densities, and turbulence integral scales of the fluctuating wind speed are analyzed in different observation time intervals. Power spectral densities of wind-induced acceleration are also investigated. The basic natural frequencies and structural damping ratios of the building are identified based on Hilbert-Huang transform method and random decrement method. The field measurement results of wind-induced responses of the SWFC are finally compared with those from the corresponding high-frequency force balance wind tunnel test study.

  3. Dynamic response characteristics of high temperature superconducting maglev systems: Comparison between Halbach-type and normal permanent magnet guideways

    Energy Technology Data Exchange (ETDEWEB)

    Wang, B. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Zheng, J., E-mail: jzheng@swjtu.cn [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Che, T. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Zheng, B.T.; Si, S.S. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); School of Electrical Engineering, Southwest Jiaotong University, Chengdu 610031, P R China (China); Deng, Z.G., E-mail: deng@swjtu.cn [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China)

    2015-12-15

    Highlights: • The loading weight affects the RF tremendously. • Reducing the FCH can improve the stability of the maglev vehicle. • The Halbach-type PMG has better loading capacity than the conventional PMG. • Pre-load is an effective way to enhance the dynamic characteristic of the HTS maglev vehicle. - Abstract: The permanent magnet guideway (PMG) is very important for the performance of the high temperature superconducting (HTS) system in terms of electromagnetic force and operational stability. The dynamic response characteristics of a HTS maglev model levitating on two types of PMG, which are the normal PMG with iron flux concentration and Halbach-type PMG, were investigated by experiments. The dynamic signals for different field-cooling heights (FCHs) and loading/unloading processes were acquired and analyzed by a vibration analyzer and laser displacement sensors. The resonant frequency, stiffness and levitation height of the model were discussed. It was found that the maglev model on the Halbach-type PMG has higher resonant frequency and higher vertical stiffness compared with the normal PMG. However, the low lateral stiffness of the model on the Halbach-type PMG indicates poor lateral stability. Besides, the Halbach-type PMG has better loading capacity than the normal PMG. These results are helpful to design a suitable PMG for the HTS system in practical applications.

  4. Differential responses of tumors and normal brain to the combined treatment of 2-DG and radiation in glioablastoma.

    Science.gov (United States)

    Prasanna, Venkatesh K; Venkataramana, Neelam K; Dwarakanath, B S; Santhosh, Vani

    2009-09-01

    2-Deoxy-D-glucose (2-DG), an inhibitor of glucose transport and glycolysis, enhances radiation damage selectively in tumor cells by modulating damage response pathways resulting in cell death in vitro and local tumor control. Phase I and II clinical trials in patients with malignant glioma have shown excellent tolerance to a combined treatment of orally administered 2-DG and hypofractionated radiotherapy without any acute toxicity and late radiation damage. Phase III efficacy trials are currently at an advanced stage. Re-exploratory surgery performed in 13 patients due to persistent symptoms of elevated ICP and mass effect at different follow-up periods revealed extensive tumor necrosis with well-preserved normal brain tissue adjoining the tumor included in the treatment volume as revealed by a histological examination. These observations are perhaps the first clinical evidences for differential effects of 2-DG on tumors and normal tissues in conformity with earlier in vitro and in vivo studies in normal and tumor-bearing mice.

  5. Psychomotor slowing, neuroendocrine responses, and behavioral changes after oral administration of meta-chlorophenylpiperazine in normal volunteers.

    Science.gov (United States)

    Sabbe, B; Hulstijn, W; Maes, M; Pier, M; Scharpé, S; Zitman, F

    2001-12-31

    The mixed 5-HT receptor agonist/antagonist meta-chlorophenylpiperazine (mCPP) is known to suppress locomotor activity in mice and rats. This study aimed: (1) to determine whether mCPP induces cognitive and motor changes in normal human volunteers and how these changes relate to the neuroendocrine effects of mCPP; and (2) to compare these cognitive and motor changes to the known cognitive and motor slowing patterns in depression and schizophrenia. A computerized method (used in previous research) analyzed fine motor behavior during figure-copying tasks. In 14 normal male volunteers behavioral responses, body temperature, plasma levels of prolactin and cortisol, and cognitive and motor performance during figure-copying tasks were measured after a single oral dose of mCPP (0.5 mg/kg). mCPP-induced prolongation of the reaction times in all copying tasks, parallel to increases in cortisol and prolactin and some self-reported behavioral effects. There were no changes in the movement times or the velocities of the writing movements. In conclusion, mCPP induced cognitive, but not motor slowing, in normal male volunteers. This indicates that the human serotonin system is also implicated in psychomotor behavior. This pattern of slowing was different from that in depressed and schizophrenic patients.

  6. Brainstem auditory evoked response characteristics in normal-hearing subjects with chronic tinnitus and in non-tinnitus group

    Directory of Open Access Journals (Sweden)

    Shadman Nemati

    2014-06-01

    Full Text Available Background and Aim: While most of the people with tinnitus have some degrees of hearing impairment, a small percent of patients admitted to ear, nose and throat clinics or hearing evaluation centers are those who complain of tinnitus despite having normal hearing thresholds. This study was performed to better understanding of the reasons of probable causes of tinnitus and to investigate possible changes in the auditory brainstem function in normal-hearing patients with chronic tinnitus.Methods: In this comparative cross-sectional, descriptive and analytic study, 52 ears (26 with and 26 without tinnitus were examined. Components of the auditory brainstem response (ABR including wave latencies and wave amplitudes were determined in the two groups and analyzed using appropriate statistical methods.Results: The mean differences between the absolute latencies of waves I, III and V was less than 0.1 ms between the two groups that was not statistically significant. Also, the interpeak latency values of waves I-III, III-V and I-V in both groups had no significant difference. Only, the V/I amplitude ratio in the tinnitus group was significantly higher (p=0.04.Conclusion: The changes observed in amplitude of waves, especially in the latter ones, can be considered as an indication of plastic changes in neuronal activity and its possible role in generation of tinnitus in normal-hearing patients.

  7. Gene expression arrays as a tool to unravel mechanisms of normal tissue radiation injury and prediction of response

    Institute of Scientific and Technical Information of China (English)

    Jacqueline JCM Kruse; Fiona A Stewart

    2007-01-01

    Over the past 5 years there has been a rapid increase in the use of microarray technology in the field of cancer research. The majority of studies use microarray analysis of tumor biopsies for profiling of molecular characteristics in an attempt to produce robust classifiers for prognosis. There are now several published gene sets that have been shown to predict for aggressive forms of breast cancer, where patients are most likely to benefit from adjuvant chemotherapy and tumors most likely to develop distant metastases, or be resistant to treatment. The number of publications relating to the use of microarrays for analysis of normal tissue damage, after cancer treatment or genotoxic exposure, is much more limited. A PubMed literature search was conducted using the following keywords and combination of terms: radiation, normal tissue, microarray, gene expression profiling, prediction. With respect to normal tissue radiation injury, microarrays have been used in three ways: (1) to generate gene signatures to identify sensitive and resistant populations (prognosis); (2) to identify sets of biomarker genes for estimating radiation exposure, either accidental or as a result of terrorist attack (diagnosis); (3) to identify genes and pathways involved in tissue response to injury (mechanistic). In this article we will review all (relevant) papers that covered our literature search criteria on microarray technology as it has been applied to normal tissue radiation biology and discuss how successful this has been in defining predisposition markers for radiation sensitivity or how it has helped us to unravel molecular mechanisms leading to acute and late tissue toxicity. We also discuss some of the problems and limitations in application and interpretation of such data.

  8. Ulcerative dermatitis in C57BL/6 mice exhibits an oxidative stress response consistent with normal wound healing.

    Science.gov (United States)

    Williams, Lisa K; Csaki, Lauren S; Cantor, Rita M; Reue, Karen; Lawson, Greg W

    2012-06-01

    Ulcerative dermatitis (UD) is a common syndrome of unknown etiology that results in profound morbidity in C57BL/6 mice and lines on a C57BL/6 background. The lesions are due to severe pruritus-induced self-trauma, progressing from superficial excoriations to deep ulcerations. UD may be behavioral in origin, with ulcerative lesions resulting from self-mutilating behavior in response to unresolved inflammation or compulsion. Alternatively, abnormal oxidative damage may be a mechanism underlying UD. To evaluate whether UD behaves similarly to normal wounds, consistent with a secondary self-inflicted lesion, or is a distinct disorder with abnormal wound response, we evaluated expression levels of genes representing various arms of the oxidative stress response pathway UD-affected and unwounded C57BL/6J mice. No evidence indicated that UD wounds have a defect in the oxidative stress response. Our findings are consistent with an understanding of C57BL/6 UD lesions as typical rather than atypical wounds.

  9. Functional brain response to food images in successful adolescent weight losers compared with normal-weight and overweight controls.

    Science.gov (United States)

    Jensen, Chad D; Kirwan, C Brock

    2015-03-01

    Research conducted with adults suggests that successful weight losers demonstrate greater activation in brain regions associated with executive control in response to viewing high-energy foods. No previous studies have examined these associations in adolescents. Functional neuroimaging was used to assess brain response to food images among groups of overweight (OW), normal-weight (NW), and successful weight-losing (SWL) adolescents. Eleven SWL, 12 NW, and 11 OW participants underwent functional magnetic resonance imaging while viewing images of high- and low-energy foods. When viewing high-energy food images, SWLs demonstrated greater activation in the dorsolateral prefrontal cortex (DLPFC) compared with OW and NW controls. Compared with NW and SWL groups, OW individuals demonstrated greater activation in the ventral striatum and anterior cingulate in response to food images. Adolescent SWLs demonstrated greater neural activation in the DLPFC compared with OW/NW controls when viewing high-energy food stimuli, which may indicate enhanced executive control. OW individuals' brain responses to food stimuli may indicate greater reward incentive processes than either SWL or NW groups. © 2015 The Obesity Society.

  10. Gonadotropin regulation of the rat proopiomelanocortin promoter: characterization by transfection of primary ovarian granulosa cells.

    Science.gov (United States)

    Young, S L; Nielsen, C P; Lundblad, J R; Roberts, J L; Melner, M H

    1989-01-01

    To characterize the transcriptional effects of human (h)FSH and hCG on the POMC gene, primary rat granulosa cells were transiently transfected with a chloramphenicol acetyltransferase (CAT) reporter plasmid under the control of the POMC promoter and 5' region. POMC-CAT contains a fragment of the rat POMC gene, extending from nucleotide -704 to nucleotide +63, fused to the CAT gene. Treatment of POMC-CAT-transfected cells with either hFSH (20 ng/ml) or hCG (10 ng/ml) significantly increased CAT enzyme activity; however, neither hCG nor hFSH increased CAT enzyme activity in cells transfected with pSV2-CAT, a reporter plasmid under the control of the SV40 virus promoter and 5' region. The phosphodiesterase inhibitor isobutylmethylxanthine or the nonhydrolyzable cAMP analog cAMP-chlorothiophenyl significantly increased CAT activity in POMC-CAT-transfected granulosa cells. Human FSH stimulated transcription 10, 20, and 40 h after treatment, but FSH stimulation at the two earlier time points was 2.5- to 5.5-fold greater than that at 40 h. Gonadotropin-stimulated steroidogenesis was equivalent in POMC-CAT-transfected granulosa cells, untransfected, and mock-transfected cells. This indicates that transfection left the physiological hormone response intact. These data demonstrate the following. 1) 767 basepairs of the rat POMC gene are enough to confer gonadotropin stimulation on the CAT marker gene in granulosa cells. 2) Although the POMC promotor lacks a well conserved cAMP response element, either of two different pharmacological manipulations of granulosa cells that raise intracellular cAMP can also stimulate POMC-driven CAT expression. 3) Transfected primary cultures of granulosa cells provide a nontransformed, physiologically relevant model with which to study hormone-regulated gene expression.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Modulation of gonadotropin secretion by Sertoli cell inhibin, LHRH, and sex steroids.

    Science.gov (United States)

    Massicotte, J; Lagacé, L; Labrie, F; Dorrington, J H

    1984-10-01

    Sertoli cell culture media (SCM) from 10-, 20-, 30-, 35-, and 40-day-old male Wistar rats were assayed to determine the inhibin activity in anterior pituitary cells in culture. In agreement with previous data, SCM did not affect the luteinizing hormone (LH) spontaneous release at all ages studied, whereas it inhibited specifically follicle-stimulating hormone (FSH) spontaneous release by 40% for the 40-day-old rats. Younger animals (10-, 20-, and 30-day-old) showed a 60% inhibition of the FSH basal release. The inhibin activity was also different at all stages studied, the IC50 being markedly displaced to the right as the age increased, leading to a fivefold difference between 10- and 30- to 40-day-old rats. The same pattern was observed when the LH and FSH responses to 0.3 nM LH-releasing hormone (LHRH) were studied. SCM from 35-day-old rats did not alter total LH, whereas total FSH was markedly reduced, thus suggesting a reduced FSH synthesis in the presence of inhibin. SCM exerts an additive inhibitory effect with dihydrotestosterone on the LH response to LHRH, whereas it reverses the stimulatory effect of the androgen on spontaneous and LHRH-induced FSH release. Moreover, SCM reversed the stimulatory effect of 17 beta-estradiol on both spontaneous and LHRH-induced LH and FSH release, whereas the stimulatory effect of progesterone on FSH release was 50-80% inhibited. The present data show that inhibin activity of Sertoli cell origin can exert marked interactions with sex steroids in the control of gonadotropin secretion. These data also demonstrate that the inhibin component is an important factor in sexual maturation of the rat and that high FSH levels of 10-day-old rats could suggest a modulation by a nonandrogenic factor of gonadotropin secretion in developing rats.

  12. Characterization of global transcription profile of normal and HPV-immortalized keratinocytes and their response to TNF treatment

    Directory of Open Access Journals (Sweden)

    Colo Anna

    2008-06-01

    Full Text Available Abstract Background Persistent infection by high risk HPV types (e.g. HPV-16, -18, -31, and -45 is the main risk factor for development of cervical intraepithelial neoplasia and cervical cancer. Tumor necrosis factor (TNF is a key mediator of epithelial cell inflammatory response and exerts a potent cytostatic effect on normal or HPV16, but not on HPV18 immortalized keratinocytes. Moreover, several cervical carcinoma-derived cell lines are resistant to TNF anti-proliferative effect suggesting that the acquisition of TNF-resistance may constitute an important step in HPV-mediated carcinogenesis. In the present study, we compared the gene expression profiles of normal and HPV16 or 18 immortalized human keratinocytes before and after treatment with TNF for 3 or 60 hours. Methods In this study, we determined the transcriptional changes 3 and 60 hours after TNF treatment of normal, HPV16 and HPV18 immortalized keratinocytes by microarray analysis. The expression pattern of two genes observed by microarray was confirmed by Northern Blot. NF-κB activation was also determined by electrophoretic mobility shift assay (EMSA using specific oligonucleotides and nuclear protein extracts. Results We observed the differential expression of a common set of genes in two TNF-sensitive cell lines that differs from those modulated in TNF-resistant ones. This information was used to define genes whose differential expression could be associated with the differential response to TNF, such as: KLK7 (kallikrein 7, SOD2 (superoxide dismutase 2, 100P (S100 calcium binding protein P, PI3 (protease inhibitor 3, skin-derived, CSTA (cystatin A, RARRES1 (retinoic acid receptor responder 1, and LXN (latexin. The differential expression of the KLK7 and SOD2 transcripts was confirmed by Northern blot. Moreover, we observed that SOD2 expression correlates with the differential NF-κB activation exhibited by TNF-sensitive and TNF-resistant cells. Conclusion This is the first in

  13. Revisiting the slow force response: the role of the PKG signaling pathway in the normal and the ischemic heart.

    Science.gov (United States)

    Castro-Ferreira, Ricardo; Neves, João Sérgio; Ladeiras-Lopes, Ricardo; Leite-Moreira, André M; Neiva-Sousa, Manuel; Almeida-Coelho, João; Ferreira-Martins, João; F Leite-Moreira, Adelino

    2014-09-01

    The myocardial response to acute stretch consists of a two-phase increase in contractility: an acute increase by the Frank-Starling mechanism and a gradual and time-dependent increase in force generated known as the slow force response (SFR). The SFR is actively modulated by different signaling pathways, but the role of protein kinase G (PKG) signaling is unknown. In this study we aim to characterize the role of the PKG signaling pathway in the SFR under normal and ischemic conditions. Rabbit papillary muscles were stretched from 92 to 100% of maximum length (Lmax) under basal conditions, in the absence (1) or presence of: a PKG agonist (2) and a PKG inhibitor (3); under ischemic conditions in the absence (4) or presence of: a PKG agonist (5); a nitric oxide (NO) donor (6) and a phosphodiesterase 5 (PDE5) inhibitor (7). Under normoxia, the SFR was significantly attenuated by inhibition of PKG and remained unaltered with PKG activation. Ischemia induced a progressive decrease in myocardial contractility after stretch. Neither the PKG agonist nor the NO donor altered the myocardial response to stretch under ischemic conditions. However, the use of a PDE5 inhibitor in ischemia partially reversed the progressive deterioration in contractility. PKG activity is essential for the SFR. During ischemia, a progressive decline in the force is observed in response to acute myocardial stretch. This dysfunctional response can be partially reversed by the use of PDE5 inhibitors. Copyright © 2013 Sociedade Portuguesa de Cardiologia. Published by Elsevier España. All rights reserved.

  14. A dose-response strategy reveals differences between normal-weight and obese men in their metabolic and inflammatory responses to a high-fat meal.

    Science.gov (United States)

    Schwander, Flurina; Kopf-Bolanz, Katrin A; Buri, Caroline; Portmann, Reto; Egger, Lotti; Chollet, Magali; McTernan, Philip G; Piya, Milan K; Gijs, Martin A M; Vionnet, Nathalie; Pralong, François; Laederach, Kurt; Vergères, Guy

    2014-10-01

    A dose-response strategy may not only allow investigation of the impact of foods and nutrients on human health but may also reveal differences in the response of individuals to food ingestion based on their metabolic health status. In a randomized crossover study, we challenged 19 normal-weight (BMI: 20-25 kg/m(2)) and 18 obese (BMI: >30 kg/m(2)) men with 500, 1000, and 1500 kcal of a high-fat (HF) meal (60.5% energy from fat). Blood was taken at baseline and up to 6 h postprandially and analyzed for a range of metabolic, inflammatory, and hormonal variables, including plasma glucose, lipids, and C-reactive protein and serum insulin, glucagon-like peptide-1, interleukin-6 (IL-6), and endotoxin. Insulin was the only variable that could differentiate the postprandial response of normal-weight and obese participants at each of the 3 caloric doses. A significant response of the inflammatory marker IL-6 was only observed in the obese group after ingestion of the HF meal containing 1500 kcal [net incremental AUC (iAUC) = 22.9 ± 6.8 pg/mL × 6 h, P = 0.002]. Furthermore, the net iAUC for triglycerides significantly increased from the 1000 to the 1500 kcal meal in the obese group (5.0 ± 0.5 mmol/L × 6 h vs. 6.0 ± 0.5 mmol/L × 6 h; P = 0.015) but not in the normal-weight group (4.3 ± 0.5 mmol/L × 6 h vs. 4.8 ± 0.5 mmol/L × 6 h; P = 0.31). We propose that caloric dose-response studies may contribute to a better understanding of the metabolic impact of food on the human organism. This study was registered at clinicaltrials.gov as NCT01446068. © 2014 American Society for Nutrition.

  15. A Dose-Response Strategy Reveals Differences between Normal-Weight and Obese Men in Their Metabolic and Inflammatory Responses to a High-Fat Meal123

    Science.gov (United States)

    Schwander, Flurina; Kopf-Bolanz, Katrin A.; Buri, Caroline; Portmann, Reto; Egger, Lotti; Chollet, Magali; McTernan, Philip G.; Piya, Milan K.; Gijs, Martin A. M.; Vionnet, Nathalie; Pralong, François; Laederach, Kurt; Vergères, Guy

    2014-01-01

    A dose-response strategy may not only allow investigation of the impact of foods and nutrients on human health but may also reveal differences in the response of individuals to food ingestion based on their metabolic health status. In a randomized crossover study, we challenged 19 normal-weight (BMI: 20–25 kg/m2) and 18 obese (BMI: >30 kg/m2) men with 500, 1000, and 1500 kcal of a high-fat (HF) meal (60.5% energy from fat). Blood was taken at baseline and up to 6 h postprandially and analyzed for a range of metabolic, inflammatory, and hormonal variables, including plasma glucose, lipids, and C-reactive protein and serum insulin, glucagon-like peptide-1, interleukin-6 (IL-6), and endotoxin. Insulin was the only variable that could differentiate the postprandial response of normal-weight and obese participants at each of the 3 caloric doses. A significant response of the inflammatory marker IL-6 was only observed in the obese group after ingestion of the HF meal containing 1500 kcal [net incremental AUC (iAUC) = 22.9 ± 6.8 pg/mL × 6 h, P = 0.002]. Furthermore, the net iAUC for triglycerides significantly increased from the 1000 to the 1500 kcal meal in the obese group (5.0 ± 0.5 mmol/L × 6 h vs. 6.0 ± 0.5 mmol/L × 6 h; P = 0.015) but not in the normal-weight group (4.3 ± 0.5 mmol/L × 6 h vs. 4.8 ± 0.5 mmol/L × 6 h; P = 0.31). We propose that caloric dose-response studies may contribute to a better understanding of the metabolic impact of food on the human organism. This study was registered at clinicaltrials.gov as NCT01446068. PMID:24812072

  16. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.

    1985-12-01

    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  17. Adaptive immune response in JAM-C-deficient mice: normal initiation but reduced IgG memory.

    Science.gov (United States)

    Zimmerli, Claudia; Lee, Boris P L; Palmer, Gaby; Gabay, Cem; Adams, Ralf; Aurrand-Lions, Michel; Imhof, Beat A

    2009-04-15

    We have recently shown that junctional adhesion molecule (JAM)-C-deficient mice have leukocytic pulmonary infiltrates, disturbed neutrophil homeostasis, and increased postnatal mortality. This phenotype was partially rescued when mice were housed in ventilated isolators, suggesting an inability to cope with opportunistic infections. In the present study, we further examined the adaptive immune responses in JAM-C(-/-) mice. We found that murine conventional dendritic cells express in addition to Mac-1 and CD11c also JAM-B as ligand for JAM-C. By in vitro adhesion assay, we show that murine DCs can interact with recombinant JAM-C via Mac-1. However, this interaction does not seem to be necessary for dendritic cell migration and function in vivo, even though JAM-C is highly expressed by lymphatic sinuses of lymph nodes. Nevertheless, upon immunization and boosting with a protein Ag, JAM-C-deficient mice showed decreased persistence of specific circulating Abs although the initial response was normal. Such a phenotype has also been observed in a model of Ag-induced arthritis, showing that specific IgG2a Ab titers are reduced in the serum of JAM-C(-/-) compared with wild-type mice. Taken together, these data suggest that JAM-C deficiency affects the adaptive humoral immune response against pathogens, in addition to the innate immune system.

  18. Graft enhancement and antiidiotypic antibody. Lymphocytes from long-term rat renal allograft recipients have normal responsiveness in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Fitch, F.W.; Weiss, A.; McKearn, T.J.; Stuart, F.P.

    1978-06-01

    Treatment of allograft recipients with antigen Ag and antibody Ab causes a transient appearance of anti-Id antibody, and kidneys transplanted at the time of peak anti-Id response fare better than those transplanted earlier or later. Since these observations suggested a role for anti-Id Ab in rat renal allograft enhancement, the immunologic reactivity of lymphocytes from animals bearing long-term, enhanced renal allografts was studied. The survival of long-term enhanced renal allografts remains an enigma. Although anti-Id Ab is produced as a result of the initial treatment used for induction of enhancement, such Ab is not detected in long-term recipients. The reactivity of cells from such recipients is not that reported for animals actively producing anti-Id Ab. The responsiveness of lymphocytes in vitro from long-term allograft recipients appears to be normal, not increased as observed in sensitized rats or absent as observed in neonatally tolerant rats. It is not known why these cells fail to respond to graft antigens in the enhanced allograft recipient. Inhibitory processes that function in the intact animal seem to be inactive in the experimental systems used for measurement of lymphocyte responsiveness in culture.

  19. Gonadotropin therapy in assisted reproduction: an evolutionary perspective from biologics to biotech.

    Science.gov (United States)

    Leão, Rogério de Barros F; Esteves, Sandro C

    2014-01-01

    Gonadotropin therapy plays an integral role in ovarian stimulation for infertility treatments. Efforts have been made over the last century to improve gonadotropin preparations. Undoubtedly, current gonadotropins have better quality and safety profiles as well as clinical efficacy than earlier ones. A major achievement has been introducing recombinant technology in the manufacturing processes for follicle-stimulating hormone, luteinizing hormone, and human chorionic gonadotropin. Recombinant gonadotropins are purer than urine-derived gonadotropins, and incorporating vial filling by mass virtually eliminated batch-to-batch variations and enabled accurate dosing. Recombinant and fill-by-mass technologies have been the driving forces for launching of prefilled pen devices for more patient-friendly ovarian stimulation. The most recent developments include the fixed combination of follitropin alfa + lutropin alfa, long-acting FSH gonadotropin, and a new family of prefilled pen injector devices for administration of recombinant gonadotropins. The next step would be the production of orally bioactive molecules with selective follicle-stimulating hormone and luteinizing hormone activity.

  20. Gonadotropin therapy in assisted reproduction: an evolutionary perspective from biologics to biotech

    Directory of Open Access Journals (Sweden)

    Rogériode Barros F. Leão

    2014-04-01

    Full Text Available Gonadotropin therapy plays an integral role in ovarian stimulation for infertility treatments. Efforts have been made over the last century to improve gonadotropin preparations. Undoubtedly, current gonadotropins have better quality and safety profiles as well as clinical efficacy than earlier ones. A major achievement has been introducing recombinant technology in the manufacturing processes for follicle-stimulating hormone, luteinizing hormone, and human chorionic gonadotropin. Recombinant gonadotropins are purer than urine-derived gonadotropins, and incorporating vial filling by mass virtually eliminated batch-to-batch variations and enabled accurate dosing. Recombinant and fill-by-mass technologies have been the driving forces for launching of prefilled pen devices for more patient-friendly ovarian stimulation. The most recent developments include the fixed combination of follitropin alfa + lutropin alfa, long-acting FSH gonadotropin, and a new family of prefilled pen injector devices for administration of recombinant gonadotropins. The next step would be the production of orally bioactive molecules with selective follicle-stimulating hormone and luteinizing hormone activity.

  1. A review of luteinising hormone and human chorionic gonadotropin when used in assisted reproductive technology

    DEFF Research Database (Denmark)

    Ezcurra, Diego; Humaidan, Peter

    2014-01-01

    Gonadotropins extracted from the urine of post-menopausal women have traditionally been used to stimulate folliculogenesis in the treatment of infertility and in assisted reproductive technology (ART). Products, such as human menopausal gonadotropin (hMG), consist not only of a mixture of the hor...

  2. A single dose of the potent gonadotropin-releasing hormone antagonist acyline suppresses gonadotropins and testosterone for 2 weeks in healthy young men.

    Science.gov (United States)

    Herbst, Karen L; Coviello, Andrea D; Page, Stephanie; Amory, John K; Anawalt, Bradley D; Bremner, William J

    2004-12-01

    Acyline is a novel GnRH antagonist that reliably inhibits gonadotropins and testosterone (T) levels in men for 48 h after a single dose up to 75 microg/kg. In this study we examined gonadotropin and T levels in 28 healthy young men administered acyline as single doses of 150 or 300 microg/kg or serial injections of 75 microg/kg. A single 300 microg/kg dose of acyline suppressed gonadotropins and T to castrate levels for 15 d (baseline, 21.1 +/- 3.1; nadir, 1.95 +/- 0.4 nmol/liter; mean +/- sem; P gonadotropins for more than 20 d (nadir T, 1.06 +/- 0.17 nmol/liter; P hormonal male contraceptive or for treatment of hormonally dependent disease.

  3. Evaluation of auditory brain-stem evoked response in middle: Aged type 2 diabetes mellitus with normal hearing subjects

    Directory of Open Access Journals (Sweden)

    Debadatta Mahallik

    2014-01-01

    Full Text Available Background: Diabetes mellitus (DM is commonly metabolic disorders of carbohydrate in which blood glucose levels are abnormally high due to relative or absolute insulin deficiency. In addition, it is characterized by abnormal metabolism of fat, protein resulting from insulin deficit or insulin action, or both. There are two broad categories of DM are designated as type 1 and type 2. Type 2 diabetes is due to predominantly insulin resistance with relative insulin deficiency noninsulin-dependent DM. Type 2 diabetes is much more common than insulin-dependent DM. Objectives: The aim of this study was to assess, if there is any abnormality in neural conduction in auditory brain-stem pathway in type 2 DM patients having normal hearing sensitivity when compared to age-matched healthy populations. Materials and Methods: This study included middle - aged 25 subjects having normal hearing with diabetes type 2 mellitus. All were submitted to the full audiological history taking, otological examination, basic audiological evaluation and auditory brain-stem response audiometry which was recorded in both ears, followed by calculation of the absolute latencies of wave I, III and V, as well as interpeak latencies I-III, III-V, I-V. Results: Type 2 DM patients showed significant prolonged absolute latencies of I, III (P = 0.001 and interpeak latencies I-III, III-V and I-V in left ear (P = 0.001 and absolute latencies of I, V (P = 0.001, interpeak latencies III-V was statistically significant in right ear. Conclusions: The prolonged absolute latencies and interpeak latencies suggests abnormal neural firing synchronization or in the transmission in the auditory pathways in normal hearing type 2 diabetes mellitus patients.

  4. Heart rate recovery normality data recorded in response to a maximal exercise test in physically active men.

    Science.gov (United States)

    Vicente-Campos, Davinia; Martín López, Aurora; Nuñez, María Jesús; López Chicharro, Jose

    2014-06-01

    Despite a growing clinical interest in determining the heart rate recovery (HRR) response to exercise, the limits of a normal HRR have not yet been well established. This study was designed to examine HRR following a controlled maximal exercise test in healthy, physically active adult men. The subjects recruited (n = 789) performed a maximal stress test on a treadmill. HRR indices were calculated by subtracting the first and third minute heart rates (HRs) during recovery from the maximal HR obtained during stress testing and designated these as HRR-1 and HRR-3, respectively. The relative change in HRR was determined as the decrease in HR produced at the time points 1 and 3 min after exercise as a percentage of the peak HR (%HRR-1/HR(peak) and %HRR-3/HR(peak), respectively). Percentile values of HRR-1 and HRR-3 were generated for the study population. Mean HHR-1 and HHR-3 were 15.24 ± 8.36 and 64.58 ± 12.17 bpm, respectively, and %HRR-1/HR(peak) and %HRR-3/HR(peak) were 8.60 ± 4.70 and 36.35 ± 6.79%, respectively. Significant correlation was detected between Peak VO2 and HRR-3 (r = 0.36; p < 0.001) or %HRR-3/HR(peak) (r = 0.23; p < 0.001). Our study provides normality data for HRR following a maximal Ergometry test obtained in a large population of physically active men.

  5. Numerical Study on Dynamic Response of a Horizontal Layered-Structure Rock Slope under a Normally Incident Sv Wave

    Directory of Open Access Journals (Sweden)

    Zhifa Zhan

    2017-07-01

    Full Text Available Several post-earthquake investigations have indicated that the slope structure plays a leading role in the stability of rock slopes under dynamic loads. In this paper, the dynamic response of a horizontal layered-structure rock slope under harmonic Sv wave is studied by making use of the Fast Lagrangian Analysis of Continua method (FLAC. The suitability of FLAC for studying wave transmission across rock joints is validated through comparison with analytical solutions. After parametric studies on Sv wave transmission across the horizontal layered-structure rock slope, it is found that the acceleration amplification coefficient η, which is defined as the ratio of the acceleration at the monitoring point to the value at the toe, wavily increases with an increase of the height along the slope surface. Meanwhile, the fluctuation weakens with normalized joint stiffness K increasing and enhances with normalized joint spacing ξ increasing. The acceleration amplification coefficient of the slope crest ηcrest does not monotonously increase with the increase of ξ, but decreases with the increase of K. Additionally, ηcrest is more sensitive to ξ compared to K. From the contour figures, it can also be found that the contour figures of η take on rhythm, and the effects of ξ on the acceleration amplification coefficient are more obvious compared to the effects on K.

  6. Measurement of normalized spectral responsivity of digital imaging devices by using a LED-based tunable uniform source.

    Science.gov (United States)

    Mahmoud, Khaled; Park, Seongchong; Park, Seung-Nam; Lee, Dong-Hoon

    2013-02-20

    We present an instrumentation solution for measurement of normalized spectral responsivity of digital imaging sensors and cameras. The instrument consists of multiple light-emitting diodes (LEDs), a single-grating monochromator, and a small-size integrating sphere. Wavelength tuning is achieved by a proper selection of LED in accordance with the monochromator setting in a range from 380 to 900 nm. High spectral purity with a bandwidth of 5 nm is realized without using double gratings and order-sorting filters. Experimental characteristics and calibration of the instrument are described with the related error and uncertainty sources. The performance is demonstrated by measuring a monochrome charge-coupled device and a trichromatic complementary metal-oxide-semiconductor device. The measurement uncertainty is evaluated to be less than 1% (k=2) except several wavelengths with low LED power.

  7. The FSHB -211G>T variant attenuates serum FSH levels in the supraphysiological gonadotropin setting of Klinefelter syndrome.

    Science.gov (United States)

    Busch, Alexander S; Tüttelmann, Frank; Zitzmann, Michael; Kliesch, Sabine; Gromoll, Jörg

    2015-05-01

    Klinefelter syndrome (47, XXY) is the most frequent genetic cause of male infertility and individuals share the endocrine hallmark of hypergonadotropic hypogonadism. Single-nucleotide polymorphisms located within the FSHB/FSHR gene were recently shown to impact serum follicle-stimulating hormone (FSH) levels and other reproductive parameters in men. The objective of this study was to analyse the effect of FSHB-211G>T (c.-280G>T, rs10835638) as well as FSHR c.2039G>A (rs6166) and FSHR c.-29G>A (rs1394205) on endocrine and reproductive parameters in untreated and testosterone-treated Klinefelter patients. Patients were retrospectively selected from the clientele attending a university-based andrology centre. A total of 309 non-mosaic Klinefelter individuals between 18 and 65 years were included and genotyped for the variants by TaqMan assays. The untreated group comprised 248 men, in which the FSHB -211G>T allele was significantly associated with the reduced serum follicle-stimulating hormone levels (-6.5 U/l per T allele, P=1.3 × 10(-3)). Testosterone treatment (n=150) abolished the observed association. When analysing patients before and under testosterone treatment (n=89), gonadotropin levels were similarly suppressed independently of the FSHB genotype. The FSHR polymorphisms did not exhibit any significant influence in any group, neither on the endocrine nor reproductive parameters. In conclusion, a hypergonadotropic setting such as Klinefelter syndrome does not mask the FSHB -211G>T genotype effects on the follicle-stimulating hormone serum levels. The impact was indeed more pronounced compared with normal or infertile men, whereas gonadotropin suppression under testosterone treatment seems to be independent of the genotype. Thus, the FSHB -211G>T genotype is a key determinant in the regulation of gonadotropins in different reproductive-endocrine pathopyhsiologies.

  8. Investigation of Adaptive Responses in Bystander Cells in 3D Cultures Containing Tritium-Labeled and Unlabeled Normal Human Fibroblasts

    Science.gov (United States)

    Pinto, Massimo; Azzam, Edouard I.; Howell, Roger W.

    2010-01-01

    The study of radiation-induced bystander effects in normal human cells maintained in three-dimensional (3D) architecture provides more in vivo-like conditions and is relevant to human risk assessment. Linear energy transfer, dose and dose rate have been considered as critical factors in propagating radiation-induced effects. This investigation uses an in vitro 3D tissue culture model in which normal AG1522 human fibroblasts are grown in a carbon scaffold to investigate induction of a G1 arrest in bystander cells that neighbor radiolabeled cells. Cell cultures were co-pulse-labeled with [3H]deoxycytidine (3HdC) to selectively irradiate a minor fraction of cells with 1–5 keV/μm β particles and bromodeoxyuridine (BrdU) to identify the radiolabeled cells using immunofluorescence. The induction of a G1 arrest was measured specifically in unlabeled cells (i.e. bystander cells) using a flow cytometry-based version of the cumulative labeling index assay. To investigate the relationship between bystander effects and adaptive responses, cells were challenged with an acute 4 Gy γ-radiation dose after they had been kept under the bystander conditions described above for several hours, and the regulation of the radiation-induced G1 arrest was measured selectively in bystander cells. When the average dose rate in 3HdC-labeled cells (bystander effects or adaptive bystander effects were observed as measured by magnitude of the G1 arrest, micronucleus formation, or changes in mitochondrial membrane potential. Higher dose rates and/or higher LET may be required to observe stressful bystander effects in this experimental system, whereas lower dose rates and challenge doses may be required to detect adaptive bystander responses. PMID:20681788

  9. Feedback inhibition of gonadotropins by testosterone in men with hypogonadotropic hypogonadism: comparison to the intact pituitary-testicular axis in primary hypogonadism.

    Science.gov (United States)

    Shimon, Ilan; Lubina, Alexandra; Gorfine, Malka; Ilany, Jacob

    2006-01-01

    Men with hypogonadotropic hypogonadism (HH) due to hypothalamic-pituitary disease present with low serum testosterone levels combined with undetectable, low, or normal gonadotropin levels. Treatment consists of testosterone replacement to reverse the symptoms of androgen deficiency. The aim of this study was to examine the dynamics and feedback inhibition of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) in relation to testosterone in 38 men with HH treated with testosterone. Findings were compared with 11 men with primary hypergonadism (PH). Testosterone replacement led to a suppression of FSH levels from 2.8 IU/L at baseline to 1.1 IU/L and to a suppression of LH levels from 2.3 to 0.8 IU/L. There was a linear correlation between levels of FSH and LH (after natural log transformation for both) and testosterone levels in both the HH and PH groups. However, the differences in intercepts and slopes between the groups were significant. To determine whether nonsuppressed FSH or LH during testosterone replacement reduces the probability of eugonadism, as reflected by normal testosterone levels, gonadotropin levels were measured and categorized as low (2 IU/L). The higher FSH or LH levels were found to significantly decrease the chance for achieving eugonadism. In conclusion, in men with HH due to hypothalamic-pituitary disease or injury, the pituitary-testicular hormonal axis maintains its physiological negative feedback between testosterone and gonadotropins. Thus, gonadotropin levels in men with HH might be useful, together with testosterone concentrations, for assessing the adequacy of androgen replacement.

  10. Acute injection and chronic perfusion of kisspeptin elicit gonadotropins release but fail to trigger ovulation in the mare.

    Science.gov (United States)

    Decourt, Caroline; Caraty, Alain; Briant, Christine; Guillaume, Daniel; Lomet, Didier; Chesneau, Didier; Lardic, Lionel; Duchamp, Guy; Reigner, Fabrice; Monget, Philippe; Dufourny, Laurence; Beltramo, Massimiliano; Dardente, Hugues

    2014-02-01

    Kisspeptin has emerged as the most potent gonadotropin-releasing hormone (GnRH) secretagogue and appears to represent the penultimate step in the central control of reproduction. In the sheep, we showed that kisspeptin could be used to manipulate gonadotropin secretion and control ovulation. Prompted by these results, we decided to investigate whether kisspeptin could be used as an ovulation-inducing agent in another photoperiodic domestic mammal, the horse. Equine kisspeptin-10 (eKp10) was administered intravenously as bolus injections or short- to long-term perfusions to Welsh pony mares, either during the anestrus season or at various stages of the cycle during the breeding season. In all the experimental conditions, eKp10 reliably increased peripheral concentrations of both luteinizing hormone and follicle-stimulating hormone. The nature of the response to eKp10 was consistent across experimental conditions and physiological states: the increase in gonadotropins was always rapid and essentially transient even when eKp10 was perfused for prolonged periods. Furthermore, eKp10 consistently failed to induce ovulation in the mare. To gain insights into the underlying mechanisms, we used acute injections or perfusions of GnRH. We also cloned the equine orthologues of the kisspeptin precursor and Kiss1r; this was justified by the facts that the current equine genome assembly predicted an amino acid difference between eKp10 and Kp10 in other species while an equine orthologue for Kiss1r was missing altogether. In light of these findings, potential reasons for the divergence in the response to kisspeptin between ewe and mare are discussed. Our data highlight that kisspeptin is not a universal ovulation-inducing agent.

  11. The role of kisspeptin and gonadotropin inhibitory hormone in the seasonal regulation of reproduction in sheep.

    Science.gov (United States)

    Smith, J T

    2012-08-01

    Sheep are seasonal breeders, experiencing an annual period of reproductive quiescence in response to increased photoperiod during the late-winter into spring and renaissance during the late summer. The nonbreeding (anestrous) season is characterized by a reduction in the pulsatile secretion of GnRH from the brain, in part because of an increase in negative feedback activity of estrogen. Neuronal populations in the hypothalamus that produce kisspeptin and gonadotropin-inhibitory hormone (GnIH) appear to be important for the seasonal shift in reproductive activity, and the former are also mandatory for puberty onset. Kisspeptin cells in the arcuate nucleus (ARC) and preoptic area appear to regulate GnRH neurons and transmit sex-steroid feedback signals to these neurons. Moreover, kisspeptin expression in the ARC is markedly up-regulated at the onset of the breeding season, as too are the number of kisspeptin fibers in close apposition to GnRH neurons. The lower levels of kisspeptin seen during the nonbreeding season can be "corrected" by infusion of kisspeptin, which causes ovulation in seasonally acyclic females. The role of GnIH is less clear, but mounting evidence supports a role for this neuropeptide in the inhibitory regulation of both GnRH secretion and gonadotropin release from the pituitary gland. Contrary to kisspeptin, GnIH expression is markedly reduced at the onset of the breeding season. In addition, the number of GnIH fibers in close apposition to GnRH neurons also decreases during this time. Importantly, exogenous GnIH treatment can block both the pulsatile release of LH and the preovulatory LH surge during the breeding season. In summary, it is most likely the integrated function of both these neuropeptide systems that modulate the annual shift in photoperiod to a physiological change in fertility.

  12. Adeno-associated virus activates an innate immune response in normal human cells but not in osteosarcoma cells.

    Science.gov (United States)

    Laredj, Leila N; Beard, Peter

    2011-12-01

    Adeno-associated virus (AAV) is a small, DNA-containing dependovirus with promising potential as a gene delivery vehicle. Given the variety of applications of AAV-based vectors in the treatment of genetic disorders, numerous studies have focused on the immunogenicity of recombinant AAV. In general, AAV vectors appear not to induce strong inflammatory responses. We have found that AAV2, when it infects the osteosarcoma cells U2OS, can initiate part of its replicative cycle in the absence of helper virus. This does not occur in untransformed cells. We set out to test whether the cellular innate antiviral defenses control this susceptibility and found that, in nonimmune normal human fibroblasts, AAV2 induces type I interferon production and release and the accumulation of nuclear promyelocytic leukemia bodies. AAV fails to mobilize this defense pathway in the U2OS cells. This permissiveness is in large part due to impairment of the viral sensing machinery in these cells. Our investigations point to Toll-like receptor 9 as a potential intracellular sensor that detects AAV2 and triggers the antiviral state in AAV-infected untransformed cells. Efficient sensing of the AAV genome and the ensuing activation of an innate antiviral response are thus crucial cellular events dictating the parvovirus infectivity in host cells.

  13. Gonadotropin-releasing hormone agonist-induced pituitary apoplexy

    Directory of Open Access Journals (Sweden)

    Fergus Keane

    2016-06-01

    Full Text Available Pituitary apoplexy represents an uncommon endocrine emergency with potentially life-threatening consequences. Drug-induced pituitary apoplexy is a rare but important consideration when evaluating patients with this presentation. We describe an unusual case of a patient with a known pituitary macroadenoma presenting with acute-onset third nerve palsy and headache secondary to tumour enlargement and apoplexy. This followed gonadotropin-releasing hormone (GNRH agonist therapy used to treat metastatic prostate carcinoma. Following acute management, the patient underwent transphenoidal debulking of his pituitary gland with resolution of his third nerve palsy. Subsequent retrospective data interpretation revealed that this had been a secretory gonadotropinoma and GNRH agonist therapy resulted in raised gonadotropins and testosterone. Hence, further management of his prostate carcinoma required GNRH antagonist therapy and external beam radiotherapy. This case demonstrates an uncommon complication of GNRH agonist therapy in the setting of a pituitary macroadenoma. It also highlights the importance of careful, serial data interpretation in patients with pituitary adenomas. Finally, this case presents a unique insight into the challenges of managing a hormonal-dependent prostate cancer in a patient with a secretory pituitary tumour.

  14. Basic understanding of gonadotropin-releasing hormone-agonist triggering.

    Science.gov (United States)

    Casper, Robert F

    2015-04-01

    A single bolus of human chorionic gonadotropin (hCG) at midcycle has been the gold standard for triggering final oocyte maturation and ovulation in assisted reproductive technology cycles. More recently, gonadotropin-releasing hormone (GnRH)-agonist (GnRH-a) triggering has been introduced. The GnRH-a trigger may allow a more physiologic surge of both luteinizing hormone (LH) and follicle-stimulating hormone, although whether the combined surge will result in improved oocyte and embryo quality remains to be seen. However, the short duration of the LH surge with the GnRH-a trigger (approximately 34 hours) has been shown to be beneficial for preventing ovarian hyperstimulation syndrome in GnRH antagonist in vitro fertilization (IVF) cycles when compared with the prolonged elevation of hCG (≥6 days) after exposure to an hCG bolus. This review discusses the physiologic basis for the use of a GnRH-a trigger in IVF cycles.

  15. Advances in recombinant gonadotropin production for use in bovine superovulation.

    Science.gov (United States)

    Hesser, M W; Morris, J C; Gibbons, J R

    2011-10-01

    Bovine ovarian hyperstimulation is a process that currently relies on pituitary-derived follicle stimulating hormone (FSH) to facilitate the maturation of multiple follicles to achieve dominance and eventual ovulation. The prevalence of this process, also called superovulation, has more than doubled in the past 10 years, but the efficiency of recovered transferable embryos has remained low at ~6 per collection. The use of pituitary-derived products presents other problems including contamination from other hormones, inconsistencies within and among batches, and the possibility of the spread of disease-transmitting agents. Recombinant gonadotropins have been engineered to yield varieties of FSH and luteinizing hormone from a myriad of heterologous hosts with the resulting products demonstrating various levels of biological activity. Research has also been devoted to alternative delivery methods to reduce the frequency of injections required in current superovulatory protocols. Together, recombinant gonadotropins and alternative delivery approaches potentially provide an economical alternative to the use of pituitary-derived products. © 2011 Blackwell Verlag GmbH.

  16. Evaluation of the relation between triceps surae H-reflex, M-response latencies and thigh length in normal population

    Directory of Open Access Journals (Sweden)

    Saeid Khosrawi

    2013-01-01

    Full Text Available Background: The H-reflex is a useful electrophysiological procedure for evaluating the status of the peripheral nervous system, especially at the proximal segment of the peripheral nerve. The purpose of this study is to investigate the relation between triceps surae H-reflex and M- response latencies and thigh length in normal population, in order to determine if there is any regression equation between them. Materials and Methods: After screening 75 volunteers by considering inclusion and exclusion criteria, 72 of them were selected to enroll into our study (34 men and 38 women with the mean age of 36.04 ± 7.7 years. In all of the subjects H-reflex and M-response latencies were recorded by standard electrophysiological techniques and thigh length was measured. Finally, our data was analyzed for its relations with respect to ages in both sexes by appropriate statistical and mathematical methods. Results: Mean ± SD for H-reflex latency was 27.94 ± 1.6 ms. We found a significant correlation between H-reflex latency and M-latency (r = 0.28, no significant correlation was found between H-reflex latency and thigh length (r = -0.051. Finally based on our findings we introduce a new formula in this paper.Conclusion: We found a significant correlation among of M-response latency and other variables (H-reflex latency and thigh length. Despite this it was eliminated from our formula. The relationship between H-reflex latency and age was significant. Further studies are required to delineate the clinical usage and interpretation of the formula, which we found in this study.

  17. Bystander normal human fibroblasts reduce damage response in radiation targeted cancer cells through intercellular ROS level modulation

    Energy Technology Data Exchange (ETDEWEB)

    Widel, Maria, E-mail: maria.widel@polsl.pl [Biosystem Group, Department of Automatics, Electronics and Informatics, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Przybyszewski, Waldemar M., E-mail: wmp@io.gliwice.pl [Center for Translational Research and Molecular Biology, Maria Sklodowska-Curie Memorial Cancer Center and Institute of Oncology, Branch Gliwice, 15 Wybrzeze Armii Krajowej, 44-101 Gliwice (Poland); Cieslar-Pobuda, Artur [Biosystem Group, Department of Automatics, Electronics and Informatics, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Saenko, Yuri V. [Department of Pharmacology and Biochemistry, Center of Nanotechnology and Materials, Ulyanovsk State University (Russian Federation); Rzeszowska-Wolny, Joanna [Biosystem Group, Department of Automatics, Electronics and Informatics, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland)

    2012-03-01

    The radiation-induced bystander effect is a well-established phenomenon which results in damage in non-irradiated cells in response to signaling from irradiated cells. Since communication between irradiated and bystander cells could be reciprocal, we examined the mutual bystander response between irradiated cells and co-cultured with them non-irradiated recipients. Using a transwell culture system, irradiated human melanoma (Me45) cells were co-cultured with non-irradiated Me45 cells or normal human dermal fibroblasts (NHDF) and vice versa. The frequency of micronuclei and of apoptosis, ROS level, and mitochondrial membrane potential were used as the endpoints. Irradiated Me45 and NHDF cells induced conventional bystander effects detected as modest increases of the frequency of micronuclei and apoptosis in both recipient neighbors; the increase of apoptosis was especially high in NHDF cells co-cultured with irradiated Me45 cells. However, the frequencies of micronuclei and apoptosis in irradiated Me45 cells co-cultured with NHDF cells were significantly reduced in comparison with those cultured alone. This protective effect was not observed when irradiated melanomas were co-cultured with non-irradiated cells of the same line, or when irradiated NHDF fibroblasts were co-cultured with bystander melanomas. The increase of micronuclei and apoptosis in irradiated Me45 cells was paralleled by an increase in the level of intracellular reactive oxygen species (ROS), which was reduced significantly when they were co-cultured for 24 h with NHDF cells. A small but significant elevation of ROS level in NHDF cells shortly after irradiation was also reduced by co-culture with non-irradiated NHDF cells. We propose that in response to signals from irradiated cells, non-irradiated NHDF cells trigger rescue signals, whose nature remains to be elucidated, which modify the redox status in irradiated cells. This inverse bystander effect may potentially have implications in clinical

  18. Cerebrospinal fluid pulse pressure amplitude during lumbar infusion in idiopathic normal pressure hydrocephalus can predict response to shunting

    Directory of Open Access Journals (Sweden)

    Brean Are

    2010-02-01

    Full Text Available Abstract Background We have previously seen that idiopathic normal pressure hydrocephalus (iNPH patients having elevated intracranial pressure (ICP pulse amplitude consistently respond to shunt surgery. In this study we explored how the cerebrospinal fluid pressure (CSFP pulse amplitude determined during lumbar infusion testing, correlates with ICP pulse amplitude determined during over-night ICP monitoring and with response to shunt surgery. Our goal was to establish a more reliable screening procedure for selecting iNPH patients for shunt surgery using lumbar intrathecal infusion. Methods The study population consisted of all iNPH patients undergoing both diagnostic lumbar infusion testing and continuous over-night ICP monitoring during the period 2002-2007. The severity of iNPH was assessed using our NPH grading scale before surgery and 12 months after shunting. The CSFP pulse was characterized from the amplitude of single pressure waves. Results Totally 62 iNPH patients were included, 45 of them underwent shunt surgery, in whom 78% were shunt responders. Among the 45 shunted patients, resistance to CSF outflow (Rout was elevated (≥ 12 mmHg/ml/min in 44. The ICP pulse amplitude recorded over-night was elevated (i.e. mean ICP wave amplitude ≥ 4 mmHg in 68% of patients; 92% of these were shunt responders. In those with elevated overnight ICP pulse amplitude, we found also elevated CSFP pulse amplitude recorded during lumbar infusion testing, both during the opening phase following lumbar puncture and during a standardized period of lumbar infusion (15 ml Ringer over 10 min. The clinical response to shunting after 1 year strongly associated with the over-night ICP pulse amplitude, and also with the pulsatile CSFP during the period of lumbar infusion. Elevated CSFP pulse amplitude during lumbar infusion thus predicted shunt response with sensitivity of 88 and specificity of 60 (positive and negative predictive values of 89 and 60

  19. Expression of luteinizing hormone/chorionic gonadotropin receptor in the rat pineal gland.

    Science.gov (United States)

    Itoh, Masanori T; Hosaka, Takeshi; Takahashi, Noriyuki; Ishizuka, Bunpei

    2006-08-01

    Luteinizing hormone (LH) influences the secretion of melatonin (N-acetyl-5-methoxytryptamine) from the pineal gland. The present study examined the possible presence of LH/chorionic gonadotropin (CG) receptor in the pineal gland of adult female rats. Reverse transcriptase-polymerase chain reaction analyses demonstrated that LH/CG receptor mRNA is expressed in the pineal gland. Western blotting showed that the pineal gland, like the ovary, contains an 80 kDa receptor protein. Immunohistochemistry revealed that LH/CG receptor, arylalkylamine N-acetyltransferase (a regulatory enzyme in melatonin biosynthesis) and serotonin (a melatonin precursor) are localized primarily to the same cells of the pineal gland. We further found that the levels of pineal LH/CG receptor protein in normal cycling female rats change significantly during the estrous cycle, being lowest at early metestrus. These results demonstrate that LH/CG receptor is expressed in the pineal gland, primarily in melatonin-synthesizing cells, namely pinealocytes. Furthermore, it is suggested that LH influences pineal melatonin secretion through binding to this receptor. In addition, LH/CG receptor levels in the pineal gland are regulated during the estrous cycle under normal physiological conditions.

  20. Suppression of boar taint in cryptorchid pigs using a vaccine against the gonadotropin-releasing hormone.

    Science.gov (United States)

    Gutzwiller, A; Ampuero Kragten, S

    2013-12-01

    Thirteen unilaterally cryptorchid Large White pigs, which had been immunized at 4 and 8 weeks of age and a third time at 64 ± 4 kg body weight against the gonadotropin releasing hormone with the vaccine Improvac®, were slaughtered at the age of 170 ± 9 days at a body weight of 102 ± 12 kg. Twelve pigs tested negative in the olfactory test of the salivary gland; their descended testicles were small and their fat androstenone concentration was low compared to normally developed boars of a previous experiment which had been vaccinated twice with Improvac® according the manufacturer's recommendation. One cryptorchid boar, which tested positive in the olfactory test and whose testicular weight and fat androstenone concentration corresponded to values of unvaccinated boars of the same age, obviously had not responded to the vaccination. It is an open question if the vaccination protocol for normal boars is sufficient to prevent boar taint in the majority of cryptorchid pigs, too.

  1. Response of remotely sensed Normalized Difference Water Deviation Index to the 2006 Drought of eastern Sichuan Basin

    Institute of Scientific and Technical Information of China (English)

    ZHANG WenJiang; LU QiFeng; GAO ZhiQiang; PENG Jian

    2008-01-01

    One of the most serious droughts in last century occurred in eastern Sichuan Basin in the summer of 2006 (hereinafter called the Drought). The response of Moderate Resolution Imaging Spectroradiometer (MODIS, boarding on NASA satellites of Terra and Aqua) to the Drought was analyzed in order to reach one practicable monitoring solution for regional soil moisture. Temporal process and spatial extension of the Drought were firstly estimated with ground meteorological and hydrological observations. Then, for the whole region of Sichuan and Chongqing, the remotely sensed Normalized Difference Water In-dex (NDWI) for the summers of 2001-2006 were calculated based on 8-day composite MODIS products, which were further used to construct a new water index (Normalized Difference Water Deviation Index, NDWDI) to examine the sensitivity of remote sensing in the Drought. The study showed that the NDWDI is more sensitive to regional drought than other absolute-soil-moisture-based indices. With the new index, the study extracted the spatial-temporal characteristics of the 2006 Drought, and explored its developing and withdrawing processes, which agreed with related statistics. Compared with ground method of drought observation, the NDWDI-based remote sensing solution of this paper is more pref-erable and practicable in that the local soil properties of water consumption and supply are implicitly taken into account, and the spatial representativity limit of ground observation is circumvented to a degree as satellite remotely senses the earth surface in a way of two-dimensional pixel matrix. So, the NDWDI-based method can be used to monitor regional soil water stress situation more practically and efficiently.

  2. Response of remotely sensed Normalized Difference Water Deviation Index to the 2006 Drought of eastern Sichuan Basin

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    One of the most serious droughts in last century occurred in eastern Sichuan Basin in the summer of 2006 (hereinafter called the Drought). The response of Moderate Resolution Imaging Spectroradiometer (MODIS, boarding on NASA satellites of Terra and Aqua) to the Drought was analyzed in order to reach one practicable monitoring solution for regional soil moisture. Temporal process and spatial extension of the Drought were firstly estimated with ground meteorological and hydrological observations. Then, for the whole region of Sichuan and Chongqing, the remotely sensed Normalized Difference Water In- dex (NDWI) for the summers of 2001―2006 were calculated based on 8-day composite MODIS products, which were further used to construct a new water index (Normalized Difference Water Deviation Index, NDWDI) to examine the sensitivity of remote sensing in the Drought. The study showed that the NDWDI is more sensitive to regional drought than other absolute-soil-moisture-based indices. With the new index, the study extracted the spatial-temporal characteristics of the 2006 Drought, and explored its developing and withdrawing processes, which agreed with related statistics. Compared with ground method of drought observation, the NDWDI-based remote sensing solution of this paper is more pref- erable and practicable in that the local soil properties of water consumption and supply are implicitly taken into account, and the spatial representativity limit of ground observation is circumvented to a degree as satellite remotely senses the earth surface in a way of two-dimensional pixel matrix. So, the NDWDI-based method can be used to monitor regional soil water stress situation more practically and efficiently.

  3. Mitochondria from cultured cells derived from normal and thiamine-responsive megaloblastic anemia individuals efficiently import thiamine diphosphate

    Directory of Open Access Journals (Sweden)

    Singleton Charles K

    2002-04-01

    Full Text Available Abstract Background Thiamine diphosphate (ThDP is the active form of thiamine, and it serves as a cofactor for several enzymes, both cytosolic and mitochondrial. Isolated mitochondria have been shown to take up thiamine yet thiamine diphosphokinase is cytosolic and not present in mitochondria. Previous reports indicate that ThDP can also be taken up by rat mitochondria, but the kinetic constants associated with such uptake seemed not to be physiologically relevant. Results Here we examine ThDP uptake by mitochondria from several human cell types, including cells from patients with thiamine-responsive megaloblastic anemia (TRMA that lack a functional thiamine transporter of the plasma membrane. Although mitochondria from normal lymphoblasts took up thiamine in the low micromolar range, surprisingly mitochondria from TRMA lymphoblasts lacked this uptake component. ThDP was taken up efficiently by mitochondria isolated from either normal or TRMA lymphoblasts. Uptake was saturable and biphasic with a high affinity component characterized by a Km of 0.4 to 0.6 μM. Mitochondria from other cell types possessed a similar high affinity uptake component with variation seen in uptake capacity as revealed by differences in Vmax values. Conclusions The results suggest a shared thiamine transporter for mitochondria and the plasma membrane. Additionally, a high affinity component of ThDP uptake by mitochondria was identified with the apparent affinity constant less than the estimates of the cytosolic concentration of free ThDP. This finding indicates that the high affinity uptake is physiologically significant and may represent the main mechanism for supplying phosphorylated thiamine for mitochondrial enzymes.

  4. Mitochondria from cultured cells derived from normal and thiamine-responsive megaloblastic anemia individuals efficiently import thiamine diphosphate

    Science.gov (United States)

    Song, Qilin; Singleton, Charles K

    2002-01-01

    Background Thiamine diphosphate (ThDP) is the active form of thiamine, and it serves as a cofactor for several enzymes, both cytosolic and mitochondrial. Isolated mitochondria have been shown to take up thiamine yet thiamine diphosphokinase is cytosolic and not present in mitochondria. Previous reports indicate that ThDP can also be taken up by rat mitochondria, but the kinetic constants associated with such uptake seemed not to be physiologically relevant. Results Here we examine ThDP uptake by mitochondria from several human cell types, including cells from patients with thiamine-responsive megaloblastic anemia (TRMA) that lack a functional thiamine transporter of the plasma membrane. Although mitochondria from normal lymphoblasts took up thiamine in the low micromolar range, surprisingly mitochondria from TRMA lymphoblasts lacked this uptake component. ThDP was taken up efficiently by mitochondria isolated from either normal or TRMA lymphoblasts. Uptake was saturable and biphasic with a high affinity component characterized by a Km of 0.4 to 0.6 μM. Mitochondria from other cell types possessed a similar high affinity uptake component with variation seen in uptake capacity as revealed by differences in Vmax values. Conclusions The results suggest a shared thiamine transporter for mitochondria and the plasma membrane. Additionally, a high affinity component of ThDP uptake by mitochondria was identified with the apparent affinity constant less than the estimates of the cytosolic concentration of free ThDP. This finding indicates that the high affinity uptake is physiologically significant and may represent the main mechanism for supplying phosphorylated thiamine for mitochondrial enzymes. PMID:12014993

  5. Transient activation of mucosal effector immune responses by resident intestinal bacteria in normal hosts is regulated by interleukin-10 signalling.

    Science.gov (United States)

    Wu, Cong; Sartor, R Balfour; Huang, Kehe; Tonkonogy, Susan L

    2016-07-01

    Interleukin-10 (IL-10) is a key regulator of mucosal homeostasis. In the current study we investigated the early events after monoassociating germ-free (GF) wild-type (WT) mice with an Escherichia coli strain that we isolated previously from the caecal contents of a normal mouse housed under specific pathogen-free conditions. Our results show that interferon-γ (IFN-γ) secreted by mesenteric lymph node (MLN) cells from both IL-10 deficient mice and WT mice, stimulated ex vivo with E. coli lysate, was dramatically higher at day 4 after monoassociation compared with IFN-γ secreted by cells from GF mice without E. coli colonization. Production of IFN-γ rapidly and progressively declined after colonization of WT but not IL-10-deficient mice. The E. coli lysate-stimulated WT MLN cells also produced IL-10 that peaked at day 4 and subsequently declined, but not as precipitously as IFN-γ. WT cells that express CD4, CD8 and NKp46 produced IFN-γ; WT CD4-positive cells and B cells produced IL-10. Recombinant IL-10 added to E. coli-stimulated MLN cell cultures inhibited IFN-γ secretion in a dose-dependent fashion. MLN cells from WT mice treated in vivo with neutralizing anti-IL-10 receptor antibody produced more IFN-γ compared with MLN cells from isotype control antibody-treated mice. These findings show that a resident E. coli that induces chronic colitis in monoassociated IL-10-deficient mice rapidly but transiently activates the effector immune system in normal hosts, in parallel with induction of protective IL-10 produced by B cells and CD4(+) cells that subsequently suppresses this response to mediate mucosal homeostasis. © 2016 John Wiley & Sons Ltd.

  6. Gonadotropin-secreting pituitary adenoma with concomitant hypersecretion of testosterone and elevated sperm count. Treatment with LRH agonist.

    Science.gov (United States)

    Zárate, A; Fonseca, M E; Mason, M; Tapia, R; Miranda, R; Kovacs, K; Schally, A V

    1986-09-01

    Hypersecretion of both FSH and LH was demonstrated in a man with pituitary macroadenoma, who also presented elevated levels of blood testosterone and an increased sperm count. The patient underwent transsphenoidal surgery followed immediately by cranial irradiation. Immunocytochemical analysis of the tumour revealed the presence of FSH, LH, TSH and the alpha-subunit. Gel chromatography of the serum on Sephadex G-100 revealed immunoactive FSH, LH and the alpha-subunit which coeluted with the labelled standards of corresponding hormones. Blood levels of both gonadotropins and testosterone remained persistently elevated up to one year following surgical decompression of the tumour and radiotherapy. It was decided to treat this patient with sc administration of 100 micrograms D-Trp6-LRH biweekly. After 20 weeks, LRH-analogue treatment resulted in the reduction of serum FSH and LH levels and a diminishing in tumour size as assessed by computed tomography scan of the pituitary. This report shows that in a patient with clinically and biochemically documented gonadotropin-secreting adenoma, inducing a state of persistent gonadal hyperfunction, pituitary surgery and cranial irradiation failed to normalize the biochemical abnormality; however, therapy with D-Trp6-LRH agonist induced clinical, biochemical and radiologic improvement.

  7. Familial idiopathic gonadotropin deficiency not linked to gene for gonadotropin-releasing hormone (GnRH) in Brazilian kindred

    Energy Technology Data Exchange (ETDEWEB)

    Faraco, J.; Francke, U.; Toledo, S. [Stanford Univ. School of Medicine, CA (United States)

    1994-09-01

    Familial idiopathic gonadotropin deficiency (FIGD) is an autosomal recessive disorder which results in failure to develop secondary sexual characteristics. The origin is a hypothalamic defect resulting in insufficient secretion of gonadotropin-releasing hormone GnRH (also called LHRH, luteinizing hormone releasing hormone) and follicle-stimuating hormone (FSH). FIGD has been determined to be a separate entity from Kallmann syndrome which presents with hypogonadism as well as anosmia. The FIGD phenotype appears to be analogous to the phenotype of the hpg (hypogonadal) mouse. Because the hpg phenotype is the result of a structurally abnormal GnRH gene, we have studied the GnRH gene in individuals from a previously reported Brazilian FIGD family. An informative dimorphic marker in the signal peptide sequence of the GnRH gene allowed assessment of linkage between the disease gene and the GnRH locus in this pedigree. We have concluded that the GnRH locus is not linked to the disease-causing mutation in these hypogonadal individuals. Recent evidence suggests that neuropeptide Y (NPY) may play a role in the initiation of puberty. We hypothesize that mutations in NPY may result in failure to secrete GnRH. We have characterized three diallelic frequent-cutter restriction fragment length polymorphisms within the human NPY locus, and are currently using these markers to determine if the NPY gene is linked to, and possibly the site of the disease mutation in this kindred.

  8. Treatment of cryptorchidism with human chorionic gonadotropin or gonadotropin releasing hormone. A double-blind controlled study of 243 boys

    DEFF Research Database (Denmark)

    Christiansen, P; Müller, J; Buhl, S;

    1988-01-01

    We have conducted a modified double-blind study on the effect of human chorionic gonadotropin (hCG), gonadotropin releasing hormone (GnRH) and placebo on bilateral and unilateral maldescended testes. One hundred and fifty-five boys with bilateral and 88 boys with unilateral cryptorchidism fulfilled...... the inclusion criteria and completed the treatment protocol. The boys were between 1 and 13 years of age. hCG was administered as intramuscular injections twice weekly for 3 weeks. GnRH and placebo were given intranasally. hCG was superior to GnRH and placebo in the treatment of bilateral maldescended testes (p......% after placebo and GnRH, respectively (p = 0.07). The testis had moved to a more distal position in 46% of the boys treated with hCG. There was no significant difference between the treatment groups with regard to age or initial position of the testes. We conclude that a success rate of 25% justifies...

  9. Fertility Rates of Ewes Treated with Medroxyprogesterone and Injected with Equine Chorionic Gonadotropin plus Human Chorionic Gonadotropin in Anoestrous Season

    Directory of Open Access Journals (Sweden)

    I. W. Santos

    2010-01-01

    Full Text Available The aim of the present paper was to investigate the efficiency of the equine chorionic gonadotropin (eCG plus human chorionic gonadotropin (hCG associated with medroxyprogesterone acetate (MAP to estrous ewes synchronization. Ninety Texel ewes were investigated during seasonal anoestrous. The ewes received intravaginal sponges containing MAP (60 mg for nine days. At the time of sponges' withdrawal, the ewes were divided into three groups (G: (1 receiving 2 mL of saline i.m. (n=30, (2 receiving eCG 400 IU i.m. (n=30, and (3 receiving eCG 400 IU plus hCG 200 IU i.m. (n=30. Twelve h after sponges' removal, teaser rams were used to estrus check and remained with the ewes for 96 h. The artificial insemination was made with fresh semen 10 h after estrus detection. The effect of the treatment was not significant for the estrous rates among the groups: 73%, 90%, and 86%, respectively. The main effect was observed in the pregnancy and lambing rates among the groups: 70%, 86%, 56%, and 80%, 120%, 56%, respectively. Based on these results from our study, the use of the MAP—eCG is the best choice to improve the fertility rate on ewes.

  10. Reference genes selection and normalization of oxidative stress responsive genes upon different temperature stress conditions in Hypericum perforatum L.

    Science.gov (United States)

    Velada, Isabel; Ragonezi, Carla; Arnholdt-Schmitt, Birgit; Cardoso, Hélia

    2014-01-01

    Reverse transcription-quantitative real-time PCR (RT-qPCR) is a widely used technique for gene expression analysis. The reliability of this method depends largely on the suitable selection of stable reference genes for accurate data normalization. Hypericum perforatum L. (St. John's wort) is a field growing plant that is frequently exposed to a variety of adverse environmental stresses that can negatively affect its productivity. This widely known medicinal plant with broad pharmacological properties (anti-depressant, anti-tumor, anti-inflammatory, antiviral, antioxidant, anti-cancer, and antibacterial) has been overlooked with respect to the identification of reference genes suitable for RT-qPCR data normalization. In this study, 11 candidate reference genes were analyzed in H. perforatum plants subjected to cold and heat stresses. The expression stability of these genes was assessed using GeNorm, NormFinder and BestKeeper algorithms. The results revealed that the ranking of stability among the three algorithms showed only minor differences within each treatment. The best-ranked reference genes differed between cold- and heat-treated samples; nevertheless, TUB was the most stable gene in both experimental conditions. GSA and GAPDH were found to be reliable reference genes in cold-treated samples, while GAPDH showed low expression stability in heat-treated samples. 26SrRNA and H2A had the highest stabilities in the heat assay, whereas H2A was less stable in the cold assay. Finally, AOX1, AOX2, CAT1 and CHS genes, associated with plant stress responses and oxidative stress, were used as target genes to validate the reliability of identified reference genes. These target genes showed differential expression profiles over time in treated samples. This study not only is the first systematic analysis for the selection of suitable reference genes for RT-qPCR studies in H. perforatum subjected to temperature stress conditions, but may also provide valuable information

  11. Reference genes selection and normalization of oxidative stress responsive genes upon different temperature stress conditions in Hypericum perforatum L.

    Directory of Open Access Journals (Sweden)

    Isabel Velada

    Full Text Available Reverse transcription-quantitative real-time PCR (RT-qPCR is a widely used technique for gene expression analysis. The reliability of this method depends largely on the suitable selection of stable reference genes for accurate data normalization. Hypericum perforatum L. (St. John's wort is a field growing plant that is frequently exposed to a variety of adverse environmental stresses that can negatively affect its productivity. This widely known medicinal plant with broad pharmacological properties (anti-depressant, anti-tumor, anti-inflammatory, antiviral, antioxidant, anti-cancer, and antibacterial has been overlooked with respect to the identification of reference genes suitable for RT-qPCR data normalization. In this study, 11 candidate reference genes were analyzed in H. perforatum plants subjected to cold and heat stresses. The expression stability of these genes was assessed using GeNorm, NormFinder and BestKeeper algorithms. The results revealed that the ranking of stability among the three algorithms showed only minor differences within each treatment. The best-ranked reference genes differed between cold- and heat-treated samples; nevertheless, TUB was the most stable gene in both experimental conditions. GSA and GAPDH were found to be reliable reference genes in cold-treated samples, while GAPDH showed low expression stability in heat-treated samples. 26SrRNA and H2A had the highest stabilities in the heat assay, whereas H2A was less stable in the cold assay. Finally, AOX1, AOX2, CAT1 and CHS genes, associated with plant stress responses and oxidative stress, were used as target genes to validate the reliability of identified reference genes. These target genes showed differential expression profiles over time in treated samples. This study not only is the first systematic analysis for the selection of suitable reference genes for RT-qPCR studies in H. perforatum subjected to temperature stress conditions, but may also provide

  12. Comparison of pure tone audiometry and auditory steady-state responses in subjects with normal hearing and hearing loss.

    Science.gov (United States)

    Ozdek, Ali; Karacay, Mahmut; Saylam, Guleser; Tatar, Emel; Aygener, Nurdan; Korkmaz, Mehmet Hakan

    2010-01-01

    The objective of this study is to compare pure tone audiometry and auditory steady-state response (ASSR) thresholds in normal hearing (NH) subjects and subjects with hearing loss. This study involved 23 NH adults and 38 adults with hearing loss (HI). After detection of behavioral thresholds (BHT) with pure tone audiometry, each subject was tested for ASSR responses in the same day. Only one ear was tested for each subject. The mean pure tone average was 9 ± 4 dB for NH group and 57 ± 14 for HI group. There was a very strong correlation between BHT and ASSR measurements in HI group. However, the correlation was weaker in the NH group. The mean differences of pure tone average of four frequencies (0.5, 1, 2, and 4 kHz) and ASSR threshold average of same frequencies were 13 ± 6 dB in NH group and 7 ± 5 dB in HI group and the difference was significant (P = 0.01). It was found that 86% of threshold difference values were less than 20 dB in NH group and 92% of threshold difference values were less than 20 dB in HI group. In conclusion, ASSR thresholds can be used to predict the configuration of pure tone audiometry. Results are more accurate in HI group than NH group. Although ASSR can be used in cochlear implant decision-making process, findings do not permit the utilization of the test for medico-legal reasons.

  13. Insulin-resistant subjects have normal angiogenic response to aerobic exercise training in skeletal muscle, but not in adipose tissue.

    Science.gov (United States)

    Walton, R Grace; Finlin, Brian S; Mula, Jyothi; Long, Douglas E; Zhu, Beibei; Fry, Christopher S; Westgate, Philip M; Lee, Jonah D; Bennett, Tamara; Kern, Philip A; Peterson, Charlotte A

    2015-06-01

    Reduced vessel density in adipose tissue and skeletal muscle is associated with obesity and may result in decreased perfusion, decreased oxygen consumption, and insulin resistance. In the presence of VEGFA, Angiopoietin-2 (Angpt2) and Angiopoietin-1 (Angpt1) are central determinants of angiogenesis, with greater Angpt2:Angpt1 ratios promoting angiogenesis. In skeletal muscle, exercise training stimulates angiogenesis and modulates transcription of VEGFA, Angpt1, and Angpt2. However, it remains unknown whether exercise training stimulates vessel growth in human adipose tissue, and it remains unknown whether adipose angiogenesis is mediated by angiopoietin signaling. We sought to determine whether insulin-resistant subjects would display an impaired angiogenic response to aerobic exercise training. Insulin-sensitive (IS, N = 12) and insulin-resistant (IR, N = 14) subjects had subcutaneous adipose and muscle (vastus lateralis) biopsies before and after 12 weeks of cycle ergometer training. In both tissues, we measured vessels and expression of pro-angiogenic genes. Exercise training did not increase insulin sensitivity in IR Subjects. In skeletal muscle, training resulted in increased vessels/muscle fiber and increased Angpt2:Angpt1 ratio in both IR and IS subjects. However, in adipose, exercise training only induced angiogenesis in IS subjects, likely due to chronic suppression of VEGFA expression in IR subjects. These results indicate that skeletal muscle of IR subjects exhibits a normal angiogenic response to exercise training. However, the same training regimen is insufficient to induce angiogenesis in adipose tissue of IR subjects, which may help to explain why we did not observe improved insulin sensitivity following aerobic training.

  14. Structural brain mutant of Drosophila melanogaster with reduced cell number in the medulla cortex and with normal optomotor yaw response

    Science.gov (United States)

    Fischbach, K. F.; Heisenberg, M.

    1981-01-01

    KS58, one out of six known alleles of the small optic lobes (sol) gene in Drosophila melanogaster, reduces the cell number in the medulla cortex by degeneration of ganglion cells in the pupae to about 50%. Also, about half the volume of the medulla and lobula complex neuropils is missing. Many Golgistained cells in the mutant optic lobes resemble their homologues in wild type. However, special classes of transmedullary columnar neurons projecting to the lobula or to both lobula and lobula plate are not seen in the mutant. Some neurons linking the lobula complex to the central brain send branches to the medulla (the branches do not exist in wild type); some other types seem to be missing. The fate mapping of the KS58 focus reveals a location ventral to the head bristles and in sine oculis (so) flies the mutation further reduces the rudiments of the optic lobes normally seen. Therefore the sol phenotype is not induced by mutant eyes and the primary gene action seems to be on nervous tissue. The structural alterations of the small optic lobes are reflected in visual orientation behavior. The optomotor yaw response, however, is almost quantitatively preserved. The respective neural network should still be present in the mutant optic lobes. Images PMID:16592962

  15. Disparity in neural and subjective responses to food images in women with obesity and normal-weight women.

    Science.gov (United States)

    Carbine, Kaylie A; Larson, Michael J; Romney, Lora; Bailey, Bruce W; Tucker, Larry A; Christensen, William F; LeCheminant, James D

    2017-02-01

    Self-reports tend to differ from objective measurements of food intake, particularly in adults with obesity; however, no studies have examined how neural responses to food (an objective measure) and subjective ratings of food differ by BMI status. This study tested normal-weight women (NWW) and women with obesity (OBW) for group differences in neural indices of attention towards food pictures, subjective ratings of these pictures, and the disparity between objective and subjective measurements. Twenty-two NWW (21.8 ± 1.7 kg/m(2) ) and 22 OBW (37.0 ± 5.7 kg/m(2) ) viewed food and flower pictures while late positive potential amplitude, an event-related potential, was recorded. Participants rated pictures for arousal and valence. Late positive potential amplitude was larger toward food than flower pictures. OBW self-reported flower pictures as more pleasant than food; NWW showed no difference for pleasantness. There were no significant main effects or interactions for arousal. Standardized scores showed that only on subjective, but not objective, measures did OBW compared with NWW disproportionately indicate food pictures as less pleasant than flowers. Compared with NWW, OBW showed larger discrepancies between neural and subjective reports of attention towards food. Inaccurate self-reports of attention towards food may reduce the efficiency of health interventions. © 2016 The Obesity Society.

  16. Linear response of heat conductivity of normal-superfluid interface of a polarized Fermi gas to orbital magnetic field

    Energy Technology Data Exchange (ETDEWEB)

    Ebrahimian, N., E-mail: n.ebrahimian@aut.ac.ir [Physics Department, Amirkabir University of Technology, Tehran 15914 (Iran, Islamic Republic of); Mehrafarin, M., E-mail: mehrafar@aut.ac.ir [Physics Department, Amirkabir University of Technology, Tehran 15914 (Iran, Islamic Republic of); Afzali, R., E-mail: afzali@kntu.ac.ir [Physics Department, K.N. Toosi University of Technology, Tehran 15418 (Iran, Islamic Republic of)

    2012-01-01

    Using perturbed Bogoliubov equations, we study the linear response to a weak orbital magnetic field of the heat conductivity of the normal-superfluid interface of a polarized Fermi gas at sufficiently low temperature. We consider the various scattering regions of the BCS regime and analytically obtain the transmission coefficients and the heat conductivity across the interface in an arbitrary weak orbital field. For a definite choice of the field, we consider various values of the scattering length in the BCS range and numerically obtain the allowed values of the average and species-imbalance chemical potentials. Thus, taking Andreev reflection into account, we describe how the heat conductivity is affected by the field and the species imbalance. In particular, we show that the additional heat conductivity due to the orbital field increases with the species imbalance, which is more noticeable at higher temperatures. Our results indicate how the heat conductivity may be controlled, which is relevant to sensitive magnetic field sensors/regulators at the interface.

  17. Practice guideline: Idiopathic normal pressure hydrocephalus: Response to shunting and predictors of response: Report of the Guideline Development, Dissemination, and Implementation Subcommittee of the American Academy of Neurology.

    Science.gov (United States)

    Halperin, John J; Kurlan, Roger; Schwalb, Jason M; Cusimano, Michael D; Gronseth, Gary; Gloss, David

    2015-12-08

    We evaluated evidence for utility of shunting in idiopathic normal pressure hydrocephalus (iNPH) and for predictors of shunting effectiveness. We identified and classified relevant published studies according to 2004 and 2011 American Academy of Neurology methodology. Of 21 articles, we identified 3 Class I articles. Shunting is possibly effective in iNPH (96% chance subjective improvement, 83% chance improvement on timed walk test at 6 months) (3 Class III). Serious adverse event risk was 11% (1 Class III). Predictors of success included elevated Ro (1 Class I, multiple Class II), impaired cerebral blood flow reactivity to acetazolamide (by SPECT) (1 Class I), and positive response to either external lumbar drainage (1 Class III) or repeated lumbar punctures. Age may not be a prognostic factor (1 Class II). Data are insufficient to judge efficacy of radionuclide cisternography or aqueductal flow measurement by MRI. Clinicians may choose to offer shunting for subjective iNPH symptoms and gait (Level C). Because of significant adverse event risk, risks and benefits should be carefully weighed (Level B). Clinicians should inform patients with iNPH with elevated Ro and their families that they have an increased chance of responding to shunting compared with those without such elevation (Level B). Clinicians may counsel patients with iNPH and their families that (1) positive response to external lumbar drainage or to repeated lumbar punctures increases the chance of response to shunting, and (2) increasing age does not decrease the chance of shunting being successful (both Level C). © 2015 American Academy of Neurology.

  18. Follicle profile and plasma gonadotropin concentration in pubertal female ponies

    Directory of Open Access Journals (Sweden)

    Nogueira G.P.

    2004-01-01

    Full Text Available Twelve female ponies were examined daily for 30 days and classified as ovulating (OV; N = 6; 197 ± 6 kg or prepubertal (PP; N = 6; 196 ± 9 kg. Follicles were detected by ultrasound and gonadotropins quantified by radioimmunoassay. The mean diameter of the largest follicles was significantly larger in OV (38 ± 1 mm than in PP (26 ± 2 mm but there was no difference between groups in the size of the second largest follicle. There were more small follicles (29 mm than the OV fillies. Follicle-stimulating hormone (FSH levels did not differ between groups but PP fillies had lower luteinizing hormone (LH peak (8 ± 1 ng/ml and basal (4 ± 0.5 ng/ml levels, lower peak magnitude (2 ± 0.2 ng/ml and period average (5 ± 0.6 ng/ml than OV fillies (32 ± 4.5, 8 ± 1.2, 17.1 ± 6, and 15 ± 2.3 ng/ml, respectively. The PP group, in contrast to the OV group, showed no relationship between FSH surge and follicle wave emergence. We conclude that an LH concentration higher than 8 ng/ml is needed for follicle growth to a preovulatory size. Wave emergence and FSH secretion seem to be independent events, probably due to an inhibitory neural system in these PP animals. PP fillies may provide a physiological model for the study of follicle wave emergence which apparently does not depend on gonadotropin levels.

  19. International Normalized Ratio Response Subsequent to Modest Increase in Vitamin K Intake in Patients Treated with Warfarin

    Directory of Open Access Journals (Sweden)

    Mona Foroughi

    2016-05-01

    Full Text Available Background: Warfarin is an effective oral anticoagulant which exert its effect by blocking the utilization of vitamin K. Warfarin therapy requires ongoing monitoring using the international normalized ratio (INR. In this study, effect of modest increase in vitamin K intake from vegetables on INR values was evaluated in warfarin treated patients.Methods: A single-center study involving 24 outpatients (mean age, 62 years with two last INR in therapeutic range in which INR variations was less than 0.5. Patients were selected based on their VKORC1 1639G→A polymorphism so that 8 patients from each of GG, AA or GA genotypes were recruited. Patients were asked to consume a vegetable mix (including lettuce, peeled cucumber and tomato containing approximately 100 µg vitamin K (divided in two meals, lunch and dinner daily for one week when INR response was measured.Results: Daily consumption of vegetable mix decreased patient’s INR from 2.43±0.51 to 2.08± 0.46 (P<0.001. INR value had a significant decrease in each VKORC1 genotypes (from 2.55± 0.55 to 2.21± 0.54 in GG, 2.35± 0.33 to 2.00± 0.25 in AA, and  2.39± 0.65 to 2.00± 0.25 in GA but the values did not differ between genotypes.Conclusions: Daily increase in vegetable salad containing approximately 100 µg, decreased INR of patients. Therefore, avoiding variation in consumption of foods with even moderate content of vitamin K could help to prevent INR fluctuations in warfarin treated patients.

  20. Epigenetic marks in an adaptive water stress-responsive gene in tomato roots under normal and drought conditions.

    Science.gov (United States)

    González, Rodrigo M; Ricardi, Martiniano M; Iusem, Norberto D

    2013-08-01

    Tolerance to water deficits was evolutionarily relevant to the conquest of land by primitive plants. In this context, epigenetic events may have played important roles in the establishment of drought stress responses. We decided to inspect epigenetic marks in the plant organ that is crucial in the sensing of drought stress: the root. Using tomato as a crop model plant, we detected the methylated epialleles of Asr2, a protein-coding gene widespread in the plant kingdom and thought to alleviate restricted water availability. We found 3 contexts (CG, CNG, and CNN) of methylated cytosines in the regulatory region of Solanum lycopersicum Asr2 but only one context (CG) in the gene body. To test the hypothesis of a link between epigenetics marks and the adaptation of plants to drought, we explored the cytosine methylation status of Asr2 in the root resulting from water-deficit stress conditions. We found that a brief exposure to simulated drought conditions caused the removal of methyl marks in the regulatory region at 77 of the 142 CNN sites. In addition, the study of histone modifications around this model gene in the roots revealed that the distal regulatory region was rich in H3K27me3 but that its abundance did not change as a consequence of stress. Additionally, under normal conditions, both the regulatory and coding regions contained the typically repressive H3K9me2 mark, which was lost after 30 min of water deprivation. As analogously conjectured for the paralogous gene Asr1, rapidly acquired new Asr2 epialleles in somatic cells due to desiccation might be stable enough and heritable through the germ line across generations, thereby efficiently contributing to constitutive, adaptive gene expression during the evolution of desiccation-tolerant populations or species.

  1. The effect of palm oil, lard, and puff-pastry margarine on postprandial lipid and hormone responses in normal-weight and obese young women

    DEFF Research Database (Denmark)

    Jensen, Janne J. Dyrsborg; Bysted, Anette; Dawids, Steen

    1999-01-01

    , on postprandial lipid and hormone responses in normal-weight and obese young women. The study was performed as a randomized, crossover design. The fats differed in the content of palmitic acid, stearic acid, and traits monounsaturated fatty acids allowing a dietary comparison of different 'solid' fatty acids...... there was no significant difference between the two groups in the concentrations of total cholesterol or LDL-cholesterol. These results provide evidence that obese women have exaggerated lipid and hormone responses compared with normal-weight women but the different contents of saturated and trans monounsaturated fatty...

  2. Premature luteinization during gonadotropin-releasing hormone antagonist cycles and its relationship with in vitro fertilization outcome.

    Science.gov (United States)

    Bosch, Ernesto; Valencia, Iván; Escudero, Ernesto; Crespo, Juana; Simón, Carlos; Remohí, José; Pellicer, Antonio

    2003-12-01

    To determine the prevalence and the effect of premature luteinization in GnRH antagonist IVF-ET cycles. Prospective observational study. In vitro fertilization-embryo transfer (IVF-ET) program at the Instituto Valenciano de Infertilidad. Eighty-one infertile patients undergoing controlled ovarian hyperstimulation with gonadotropins and GnRH antagonist for IVF-ET. Gonadotropin-releasing hormone (GnRH) antagonist was administered from stimulation day 6. Serum P, E(2), and LH were determined on the day of hCG administration. Cycles were grouped according to serum P level on the day of hCG administration ( or =1.2 ng/mL). Clinical pregnancy and implantation rates were determined. The incidence of premature luteinization was 38.3%. Total recombinant FSH dose and stimulation days differed significantly between the groups. Pregnancy rate (25.8% vs. 54.0%) and implantation rate (13.8% vs. 32.0%) were significantly lower in the premature luteinization group. Premature luteinization during GnRH antagonist IVF-ET cycles is a frequent event that is associated with lower pregnancy and implantation rates. Progesterone elevations are not related to serum LH levels and may reflect the mature granulosa cell response to high FSH exposure.

  3. Human placental development is impaired by abnormal human chorionic gonadotropin signaling in trisomy 21 pregnancies.

    Science.gov (United States)

    Pidoux, Guillaume; Gerbaud, Pascale; Marpeau, Olivier; Guibourdenche, Jean; Ferreira, Fatima; Badet, Josette; Evain-Brion, Danièle; Frendo, Jean-Louis

    2007-11-01

    Placental development is markedly abnormal in women bearing a fetus with trisomy 21, with defective syncytiotrophoblast (ST) formation and function. The ST occurs from cytotrophoblast (CT) fusion and plays an essential role by secreting human chorionic gonadotropin (hCG), which is essential to placental development. In trisomy of chromosome 21 (T21) pregnancies, CTs do not fuse and differentiate properly into STs, leading to the secretion of an abnormal and weakly bioactive hCG. In this study we report for the first time, a marked decrease in the number of mature hCG receptor (LH/CG-R) molecules expressed at the surface of T21-affected CTs. The LH/CG-R seems to be functional based on sequencing that revealed no mutations or deletions and binding of recombinant hCG as well as endogenous hCG. We hypothesize that weakly bioactive hCG and lower LH/CG-R expression may be involved in the defect of ST formation. Interestingly, the defective ST formation is mimicked in normal CT cultures by using LH/CG-R small interfering RNA, which result in a lower hCG secretion. Furthermore, treatment of T21-affected CTs with recombinant hCG overcomes in vitro the T21 phenotype, allowing CTs to fuse and form a large ST. These results illustrate for the first time in trisomy 21 pathology, how abnormal endogenous hCG signaling impairs human placental development.

  4. Effects of a gonadotropin-releasing hormone antagonist on gonadotropin levels in Masu salmon and Sockeye salmon.

    Science.gov (United States)

    Amano, Masafumi; Ikuta, Kazumasa; Kitamura, Shoji

    2007-09-01

    The salmon gonadotropin-releasing hormone (sGnRH) is considered to be involved in gonadal maturation via gonadotropin (GTH) secretion in salmonid fishes. However, there is no direct evidence for endogenous sGnRH-stimulated GTH secretion in salmonids. In this study, to clarify whether endogenous sGnRH stimulates GTH secretion, we examined the effects of the mammalian GnRH (mGnRH) antagonist [Ac-Delta(3)-Pro(1), 4FD-Phe(2), D-Trp(3,6)]-mGnRH on luteinizing hormone (LH) levels in 0-year-old masu salmon Oncorhynchus masou and sockeye salmon Oncorhynchus nerka. First, the effects of the GnRH antagonist on LH release were examined in 0-year-old precocious male masu salmon. GnRH antagonist treatment for 3 hr significantly inhibited an increase in plasma LH levels that was artificially induced by exogenous sGnRH administration, indicating that the GnRH antagonist is effective in inhibiting LH release from the pituitary. Subsequently, we examined the effect of the GnRH antagonist on LH synthesis in 0-year-old immature sockeye salmon that were pretreated with exogenous testosterone for 42 days to increase the pituitary LH contents; the testosterone treatment did not affect the plasma LH levels. GnRH antagonist treatment slightly but significantly inhibited an increase in the testosterone-stimulated pituitary LH content levels. However, no significant differences in the plasma LH levels were observed between the GnRH antagonist-treated and control groups. These results suggest that endogenous sGnRH is involved in LH secretion in salmonid fishes.

  5. GONAD REMATURATION ON Pangasionodon hypophthalmus FEMALE THROUGH INJECTION OF PREGNANT MARE SERUM GONADOTROPIN AND HUMAN CHORIONIC GONADOTROPIN

    Directory of Open Access Journals (Sweden)

    Evi Tahapari

    2014-06-01

    Full Text Available The success of spawning is influenced by internal and external factors. One of the factors that affect the var iabi li ty of Pangasianodon hypophthalmus female reproductive is the change of seasons that cause disrupted continuity of the seed availability, especially in the dry season. In the present study, combination of PMSG (pregnant mare serum gonadotropin + HCG (hormone chorionic gonadotropin hormone injections was done to induce gonad development. The treatments in this study were without hormone injections as control (A, injection of PMSG 10 IU/kg + HCG 10 IU/kg (B, and injection of PMSG 20 IU/kg HCG + 10 IU/kg (C. Injections were conducted at intervals of two weeks as many as six times. The results showed that gonad maturation generally occurs 2-4 weeks after estradiol-17 peak. PMSG + HCG hormone injections gave a significant effect on increasing the quantity and quality of eggs production. The fecundity in the A, B, C treatments, were 233,700±220,676; 300,305±24,581 and 488,433±142,228; respectively. Number of larvae produced from the A, B, C treatments, were 156,979±170,838; 229,997±18,081 and 362,713±101,850; respectively. Combination of PMSG 20 IU/kg + HCG 10 IU/kg hormone injection gave the best result on fecundity and the number of larvae production.

  6. Negative Feedback Governs Gonadotrope Frequency-Decoding of Gonadotropin Releasing Hormone Pulse-Frequency

    OpenAIRE

    2009-01-01

    The synthesis of the gonadotropin subunits is directed by pulsatile gonadotropin-releasing hormone (GnRH) from the hypothalamus, with the frequency of GnRH pulses governing the differential expression of the common alpha-subunit, luteinizing hormone beta-subunit (LHbeta) and follicle-stimulating hormone beta-subunit (FSHbeta). Three mitogen-activated protein kinases, (MAPKs), ERK1/2, JNK and p38, contribute uniquely and combinatorially to the expression of each of these subunit genes. In this...

  7. Photosynthesis-dependent and -independent responses of stomata to blue, red and green monochromatic light: differences between the normally oriented and inverted leaves of sunflower.

    Science.gov (United States)

    Wang, Yin; Noguchi, Ko; Terashima, Ichiro

    2011-03-01

    The effects of growth light environment on stomatal light responses were analyzed. We inverted leaves of sunflower (Helianthus annuus) for 2 weeks until their full expansion, and measured gas exchange properties of the adaxial and abaxial sides separately. The sensitivity to light assessed as the increase in stomatal conductance was generally higher in the abaxial stomata than in the adaxial stomata, and these differences could not be completely changed by the inversion treatment. We also treated the leaves with DCMU to inhibit photosynthesis and evaluated the photosynthesis-dependent and -independent components of stomatal light responses. The red light response of stomata in both normally oriented and inverted leaves relied only on the photosynthesis-dependent component. The blue light response involved both the photosynthesis-dependent and photosynthesis-independent components, and the relative contributions of the two components differed between the normally oriented and inverted leaves. A green light response was observed only in the abaxial stomata, which also involved the photosynthesis-dependent and photosynthesis-independent components, strongly suggesting the existence of a green light receptor in sunflower leaves. Moreover, acclimation of the abaxial stomata to strong direct light eliminated the photosynthesis-independent component in the green light response. The results showed that stomatal responses to monochromatic light change considerably in response to growth light environment, although some of these responses appear to be determined inherently. © The Author 2011. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

  8. Meta-chlorophenylpiperazine attenuates formalin-induced nociceptive responses through 5-HT1/2 receptors in both normal and diabetic mice.

    OpenAIRE

    Takeshita, N; Yamaguchi, I.

    1995-01-01

    1. This study was designed to investigate the effect of meta-chlorophenylpiperazine (m-CPP; a 5-hydroxytryptamine (5-HT) receptor agonist) on the formalin-induced nociceptive responses in normal, insulin-dependent streptozotocin (STZ) diabetic and non-insulin dependent genetically diabetic (db/db) mice. 2. A subcutaneous injection of diluted formalin (1% formaldehyde in 0.9% saline, 10 microliters) under the plantar surface of the left hindpaw induced biphasic nociceptive responses, the first...

  9. Luteinizing Hormone Secretion during Gonadotropin-Releasing Hormone Stimulation Tests in Obese Girls with Central Precocious Puberty

    Science.gov (United States)

    Lee, Hae Sang; Yoon, Jong Seo; Hwang, Jin Soon

    2016-01-01

    Objective: Girls with precocious puberty have high luteinizing hormone (LH) levels and advanced bone age. Obese children enter puberty at earlier ages than do non-obese children. We analyzed the effects of obesity on LH secretion during gonadotropin-releasing hormone (GnRH) tests in girls with precocious puberty. Methods: A total of 981 subjects with idiopathic precocious puberty who had undergone a GnRH stimulation testing between 2008 and 2014 were included in the study. Subjects were divided into three groups based on body mass index (BMI). Auxological data and gonadotropin levels after the GnRH stimulation test were compared. Results: In Tanner stage 2 girls, peak stimulated LH levels on GnRH test were 11.9±7.5, 10.4±6.4, and 9.1±6.1 IU/L among normal-weight, overweight, and obese subjects, respectively (p=0.035 for all comparisons). In Tanner stage 3 girls, peak stimulated LH levels were 14.9±10.9, 12.8±7.9, and 9.6±6.0 IU/L, respectively (p=0.022 for all comparisons). However, in Tanner stage 4 girls, peak stimulated LH levels were not significantly different among normal, overweight, and obese children. On multivariate analysis, BMI standard deviation score was significantly and negatively associated with peak LH (β=-1.178, p=0.001). Conclusion: In girls with central precocious puberty, increased BMI was associated with slightly lower peak stimulated LH levels at early pubertal stages (Tanner stages 2 and 3). This association was not valid in Tanner stage 4 girls. PMID:27215137

  10. THE EXPRESSION OF THREE GONADOTROPIN SUBUNITS IN RESPONSE TO 17-ETHYNYLESTRADIOL IN MALEPELTEOBAGRUS FULVIDRACO%乙炔基雌二醇(EE2)对雄性黄颡鱼GtH 3个亚基基因表达的影响

    Institute of Scientific and Technical Information of China (English)

    谭号; 李英文; 饶剑军; 刘智皓

    2015-01-01

    In this paper, we investigated how 17α-Ethynylestradiol (EE2) regulated the expression of three gonadotropin subunits in malePelteobagrus fulvidraco. We cloned the full-length cDNA sequences of two subunits of gonadotropin hormone (FSHβ andLHβ) from the pituitary ofPelteobagrus fulvidracoby using RACE. We explored the tissue-specific and the seasonal pattern of expression of the genes. MalePelteobagrus fulvidraco (2 years old) were exposed to EE2 (100 ng/L) for 28 days. We found that the length ofFSHβ cDNA sequence was 528 bp and it contained a 399-bp open reading frame (ORF) which encoded a precursor protein of 132 amino acids (aa). The length ofLHβ cDNA sequence was 870 bp and it contained a 417 bp ORF that encoded a precursor protein of 138 aa. The sequence analysis showed that FSHβ had a predicted signal peptide of 17 aa, 2 N-glycosylation sites, and 13 cysteine residues. LHβ had a pre-dicted signal peptide of 18 aa, 1 N-glycosylation site, and 12 cysteine residues. The phylogenetic analysis showed that FSHβ and LHβ were closely related to other Siluriformes species. The tissue expression analysis suggested that all the gonadotropin subunits were expressed specifically in pituitary. The seasonal pattern of expression in both genders was thatGtHαandLHβmRNA peaked in May and then decreased gradually, and the expression ofFSHβin female also peaked in May but the expression in male remained unchanged. We applied semi-quantitative RT-PCR and demonstrated that the expression of the three gonadotropin subunits was dramatically suppressed by EE2. We speculated that EE2 might reduce the generation of FSH and LH in the pituitary of malePelteobagrus fulvidraco, which would probably inhibit spermatogenesis and the maturation of sperm and spermiation, and consequently impair the testicular develop-ment and reproduction.%为研究乙炔基雌二醇(EE2)是否能影响雄性黄颡鱼(Pelteobagrus fulvidraco)垂体中促性腺激素3个亚

  11. Estrus behavior and fecal steroid profiles in the Asiatic lion (Panthera leo persica) during natural and gonadotropin-induced estrus.

    Science.gov (United States)

    Umapathy, Govindhaswamy; Sontakke, Sadanand D; Srinivasu, K; Kiran, Thomas; Kholkute, S D; Shivaji, S

    2007-10-01

    In this paper the behavior of the Asiatic lion was studied during natural and gonadotropin-induced estrus in relation to fecal estradiol and progesterone concentration. The average length of estrus was 5.4 days and no significant difference was observed between natural and gonadotropin-induced estrus. Vocalization and rolling were the major estrus behavioral activities of Asiatic lions and the frequency of these activities were similar in both natural and gonadotropin-induced estrus and treatment with exogenous gonadotropin did not alter estrus behavioral activities. A significant positive correlation was observed between fecal estradiol and frequency of estrus behavior during natural and gonadotropin-induced estrus. Following gonadotropin treatment estrus could be induced in 69% of animals and these induced animals ovulated following hCG treatment. This study reports for the first time the successful use of the non-invasive fecal steroid assay for monitoring the induction of estrus and ovulation in the Asiatic lion.

  12. Response Distortion in Normal Personality Assessment: Investigating Proposed Validity Scales for the NEO-PI-R in a College Student Sample

    Science.gov (United States)

    Fineran, Kerrie R. J.

    2009-01-01

    The NEO-PI-R (Costa & McCrae, 1992b) is an assessment of normal personality composition that is used in clinical counseling contexts as well as for personnel selection. There has been some debate regarding the necessity and usefulness of validity scales to detect response distortion on this instrument. Because the authors of the instrument,…

  13. A Near-Infrared Spectroscopy Study on Cortical Hemodynamic Responses to Normal and Whispered Speech in 3- to 7-Year-Old Children

    Science.gov (United States)

    Remijn, Gerard B.; Kikuchi, Mitsuru; Yoshimura, Yuko; Shitamichi, Kiyomi; Ueno, Sanae; Tsubokawa, Tsunehisa; Kojima, Haruyuki; Higashida, Haruhiro; Minabe, Yoshio

    2017-01-01

    Purpose: The purpose of this study was to assess cortical hemodynamic response patterns in 3- to 7-year-old children listening to two speech modes: normally vocalized and whispered speech. Understanding whispered speech requires processing of the relatively weak, noisy signal, as well as the cognitive ability to understand the speaker's reason for…

  14. Association of pentraxin 3 with insulin resistance and glucose response following maximal aerobic exercise in obese and normal-mass individuals.

    Science.gov (United States)

    Slusher, Aaron L; Huang, Chun-Jung

    2016-07-01

    Pentraxin 3 (PTX3), a cardioprotective protein, has recently been shown to be associated with improved insulin resistance (IR) and glucose metabolism. Therefore, the primary purpose of this study was to examine whether or not increased plasma PTX3 following maximal aerobic exercise would differ between obese and normal-mass subjects, and its association with the homeostatic model assessment of insulin resistance (HOMA-IR) and glucose response. Twenty-five untrained obese (n = 13 [6 males and 7 females]) and normal-mass (n = 12 [5 males and 7 females]) subjects performed an acute bout of maximal aerobic exercise to assess maximal oxygen consumption (VO2max). At baseline, plasma PTX3 concentrations are decreased in obese compared with normal-mass subjects and are negatively associated with plasma insulin and HOMA-IR values. In response to maximal exercise, plasma PTX3 responses were similar in obese and normal-mass subjects while the intensity of plasma PTX3 response as indicated by area under the curve analysis (AUCi) was not associated with HOMA-IR or glucose AUCi. However, PTX3 AUCi was positively associated with cardiorespiratory fitness levels (relative VO2max). These findings suggest that PTX3 could serve as a biomarker for both metabolic health, as well as a measurement to monitor the effectiveness of exercise interventions in obesity.

  15. Comparison of Multidimensional Item Response Models: Multivariate Normal Ability Distributions versus Multivariate Polytomous Ability Distributions. Research Report. ETS RR-08-45

    Science.gov (United States)

    Haberman, Shelby J.; von Davier, Matthias; Lee, Yi-Hsuan

    2008-01-01

    Multidimensional item response models can be based on multivariate normal ability distributions or on multivariate polytomous ability distributions. For the case of simple structure in which each item corresponds to a unique dimension of the ability vector, some applications of the two-parameter logistic model to empirical data are employed to…

  16. SU-E-J-212: MR Diffusion Tensor Imaging for Assessment of Tumor and Normal Brain Tissue Responses of Juvenile Pilocytic Astrocytoma Treated by Proton Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hou, P; Park, P; Li, H; Zhu, X; Mahajan, A; Grosshans, D [M.D. Anderson Cancer Center, Houston, TX (United States)

    2015-06-15

    Purpose: Diffusion tensor imaging (DTI) can measure molecular mobility at the cellular level, quantified by the apparent diffusion coefficient (ADC). DTI may also reveal axonal fiber directional information in the white matter, quantified by the fractional anisotropy (FA). Juvenile pilocytic astrocytoma (JPA) is a rare brain tumor that occurs in children and young adults. Proton therapy (PT) is increasingly used in the treatment of pediatric brain tumors including JPA. However, the response of both tumors and normal tissues to PT is currently under investigation. We report tumor and normal brain tissue responses for a pediatric case of JPA treated with PT assessed using DTI. Methods: A ten year old male with JPA of the left thalamus received passive scattered PT to a dose of 50.4 Gy (RBE) in 28 fractions. Post PT, the patient has been followed up in seven years. At each follow up, MRI imaging including DTI was performed to assess response. MR images were registered to the treatment planning CT and the GTV mapped onto each MRI. The GTV contour was then mirrored to the right side of brain through the patient’s middle line to represent normal brain tissue. ADC and FA were measured within the ROIs. Results: Proton therapy can completely spare contra lateral brain while the target volume received full prescribed dose. From a series of MRI ADC images before and after PT at different follow ups, the enhancement corresponding to GTV had nearly disappeared more than 2 years after PT. Both ADC and FA demonstrate that contralateral normal brain tissue were not affect by PT and the tumor volume reverted to normal ADC and FA values. Conclusion: DTI allowed quantitative evaluation of tumor and normal brain tissue responses to PT. Further study in a larger cohort is warranted.

  17. Normalization of Pain-Evoked Neural Responses Using Spontaneous EEG Improves the Performance of EEG-Based Cross-Individual Pain Prediction

    Science.gov (United States)

    Bai, Yanru; Huang, Gan; Tu, Yiheng; Tan, Ao; Hung, Yeung Sam; Zhang, Zhiguo

    2016-01-01

    An effective physiological pain assessment method that complements the gold standard of self-report is highly desired in pain clinical research and practice. Recent studies have shown that pain-evoked electroencephalography (EEG) responses could be used as a readout of perceived pain intensity. Existing EEG-based pain assessment is normally achieved by cross-individual prediction (i.e., to train a prediction model from a group of individuals and to apply the model on a new individual), so its performance is seriously hampered by the substantial inter-individual variability in pain-evoked EEG responses. In this study, to reduce the inter-individual variability in pain-evoked EEG and to improve the accuracy of cross-individual pain prediction, we examined the relationship between pain-evoked EEG, spontaneous EEG, and pain perception on a pain EEG dataset, where a large number of laser pulses (>100) with a wide energy range were delivered. Motivated by our finding that an individual's pain-evoked EEG responses is significantly correlated with his/her spontaneous EEG in terms of magnitude, we proposed a normalization method for pain-evoked EEG responses using one's spontaneous EEG to reduce the inter-individual variability. In addition, a nonlinear relationship between the level of pain perception and pain-evoked EEG responses was obtained, which inspired us to further develop a new two-stage pain prediction strategy, a binary classification of low-pain and high-pain trials followed by a continuous prediction for high-pain trials only, both of which used spontaneous-EEG-normalized magnitudes of evoked EEG responses as features. Results show that the proposed normalization strategy can effectively reduce the inter-individual variability in pain-evoked responses, and the two-stage pain prediction method can lead to a higher prediction accuracy. PMID:27148028

  18. Meta-chlorophenylpiperazine attenuates formalin-induced nociceptive responses through 5-HT1/2 receptors in both normal and diabetic mice.

    Science.gov (United States)

    Takeshita, N; Yamaguchi, I

    1995-12-01

    1. This study was designed to investigate the effect of meta-chlorophenylpiperazine (m-CPP; a 5-hydroxytryptamine (5-HT) receptor agonist) on the formalin-induced nociceptive responses in normal, insulin-dependent streptozotocin (STZ) diabetic and non-insulin dependent genetically diabetic (db/db) mice. 2. A subcutaneous injection of diluted formalin (1% formaldehyde in 0.9% saline, 10 microliters) under the plantar surface of the left hindpaw induced biphasic nociceptive responses, the first and second phases considered to represent acute and chronic pain, respectively. The former response in db/db mice was significantly lower than those in normal mice, and the latter responses in STZ and db/db mice were significantly lower than those in normal mice. 3. In normal mice, m-CPP (0.32-3.2 mg ml-1, p.o.) exhibited potent antinociceptive activity, dose-dependently attenuating the first and second phase; the ID50 value of the second phase was 0.4 mg kg-1. m-CPP (0.32-3.2 mg kg-1, p.o.) also dose-dependently attenuated the formalin-induced nociceptive responses in STZ-induced diabetic mice and genetically diabetic db/db mice, and the activities were comparable to those in normal mice. 4. The antinociceptive activities of m-CPP (1 mg kg-1, p.o.) were significantly inhibited by pretreatment with pindolol (a 5-HT1-receptor antagonist, 1 mg kg-1, i.p.) or ketanserin (a 5-HT2 receptor antagonist, 1 mg kg-1, i.p.) but were hardly affected by ICS205-930 (a 5-HT3 receptor antagonist, 1 mg kg-1, i.p.). 5. These results suggest that m-CPP inhibits not only acute but also chronic pain transmission through 5-HT1 and 5-HT2 receptors, and that the 5-hydroxytryptaminergic antinociceptive pathways are little affected by diabetes.

  19. Effect of telmisartan on VEGF-induced and VEGF-independent angiogenic responsiveness of coronary endothelial cells in normal and streptozotocin (STZ)-induced diabetic rats.

    Science.gov (United States)

    Chaudagar, Kiranj K; Mehta, Anita A

    2014-01-01

    Telmisartan possesses endothelial protective effects due to angiotensin II type 1 receptor antagonist, peroxisome proliferator-activated receptor γ (PPARγ) agonist and antioxidant action. Therefore, our objective was to study effect of telmisartan on angiogenic responsiveness of coronary endothelial cells (cECs) of normal and diabetic rats. Male Wistar rats were divided into six groups, normal rats, diabetic rats 30 d. (30 days after administration of STZ), diabetic rats 60 ds. (60 days after administration of STZ), telmisartan-treated normal rats (2 mg/kg, p.o., for 15 days before isolation of hearts), telmisartan-treated diabetic rats 30 ds, and telmisartan-treated diabetic rats 60 ds. Each group was further divided into two subgroups, sham rat hearts and ischemia-reperfused rat hearts. After isolation of cEC from each subgroup, angiogenic responsiveness and nitric oxide releasing properties were studied using chorioallantoic membrane (CAM) assay and Griess method, respectively. cEC of normal rats showed significant increase in angiogenic responsiveness in presence of vascular endothelial growth factor (VEGF) but not in absence of it. This activity was attenuated by pretreatment of cEC with l-NAME, wortmannin and chelerythrine. Diabetes and ischemia reperfusion injury suppressed angiogenic responsiveness of cEC. Telmisartan treatment showed significant increase in VEGF-induced angiogenic responsiveness and nitric oxide releasing properties of cECs of all subgroups as compared to their respective non-treated subgroups. These effects of telmisartan were significantly inhibited by pretreatment of cECs with L-NAME and wortmannin but not with chelerythrine. Our data suggest that telmisartan improves VEGF-induced coronary angiogenic activity in normal and diabetic rats via stimulation of PI3K/eNOS/NO pathway.

  20. Measuring the rate of change of haemodynamic response at the onset of exercise in normal limbs and those with intermittent claudication.

    Science.gov (United States)

    Meeson, S; Srodon, P D

    2005-12-01

    Patients with claudication have an inadequate haemodynamic response to exercise. Blood flow response will not only have a magnitude, but also a rate of change. There is scope for investigating these parameters, as manipulation of the factors which control them may benefit work to improve the treatment for claudication. This work compares the responses for patients with one normal limb and one with intermittent claudication. A custom-built ergometer allows unilateral, infragenicular plantar flexion exercise, whilst common femoral artery blood flow can be measured continuously by Duplex ultrasound. This apparatus was used to measure blood flow before, at the onset of and during a 5 W square-wave exercise stimulus in 15 patients. The claudicant group had a mean steady-state gain that was approximately half that of the normal group at around 170 ml min(-1) (p rate of change of blood flow during this response time was estimated to still be greater for the normal group, at 431.7 +/- 47.1 ml min(-2), than for the claudicant group. The differences in magnitude and rate of change of limb blood flow response to exercise in claudicants were significant and may have implications for the treatment of claudication.

  1. Enzymatic tracer damage during the gonadotropin releasing hormone radioimmunoassay: analytical and immunological assessment

    Energy Technology Data Exchange (ETDEWEB)

    O' Conner, J.L.; Lapp, C.A.; Clary, A.R.

    1985-09-23

    Hypothalamic supernatants from 60 day female rats were fractionated from Sephadex G-200 columns. The radioimmunoassay (RIA) for gonadotropin releasing hormone (GnRH) detected an apparently cross-reacting high molecular weight substance. The substance caused apparent displacement of iodinated GnRH binding in dose response fashion; however, no biological activity was observed in pituitary cell cultures. In order to determine whether the depressed binding might be caused by enzymatic degradation of iodinated GnRH during the RIA incubation, iodinated GnRH was preincubated under RIA conditions with either buffer or increasing concentrations of the GnRH cross-reacting material. Aliquots were subjected to polyacrylamide gel electrophoresis (PAGE) and the gels slices counted. Identical aliquots were subsequently used as iodinated hormone in the RIA of known quantities of synthetic GnRH. Tracer damage during the RIA-like preincubation period was reflected in the subsequent PAGE studies as decreased counts per minute in the intact GnRH peak and in the RIA studies as over-estimated quantification of the GnRH standards. This report describes such damage during the GnRH RIA and the data misinterpretations which result. 30 references, 6 figures, 1 table.

  2. Paper-based microfluidic devices for electrochemical immunofiltration analysis of human chorionic gonadotropin.

    Science.gov (United States)

    Cao, Liangli; Fang, Cheng; Zeng, Ruosheng; Zhao, Xiongjie; Jiang, Yuren; Chen, Zhencheng

    2017-02-02

    An electrochemical immunofiltration analysis was introduced into microfluidic paper-based analytical devices (μPADs) for the first time, which was based on photolithography and screen-printing technology. The hydrophilic test zones of the aldehyde-functionalized screen-printed electrodes (SPEs) were biofunctionalized with capture antibodies (Ab1). A sensitive immune detection method was developed by using primary signal antibody functionalized gold nanoparticles (GNPs/Ab2) and alkaline phosphatase conjugated secondary antibody (ALP-IgG). Differential pulse voltammetry (DPV) was performed to detect the electrochemical response. The microfluidic paper-based electrochemical immunosensor (μ-PEI) was optimized and characterized for the detection of human chorionic gonadotropin (HCG), a model analyte, in a linear range from 1.0mIUmL(-1) to 100.0 IU mL(-1) with a detection limit of 0.36mIUmL(-1). Additionally, the proposed μ-PEI was used to test HCG in real human serum and obtained satisfactory results. The disposable, efficient, sensitive and low-cost μ-PEI has exhibited great potential for the development of point-of-care testing (POCT) devices that can be applicated in healthcare monitoring.

  3. Targeting Gonadotropins: An Alternative Option for Alzheimer Disease Treatment

    Directory of Open Access Journals (Sweden)

    Gemma Casadesus

    2006-01-01

    Full Text Available Recent evidence indicates that, alongside oxidative stress, dysregulation of the cell cycle in neurons susceptible to degeneration in Alzheimer disease may play a crucial role in the initiation of the disease. As such, the role of reproductive hormones, which are closely associated with the cell cycle both during development and after birth, may be of key import. While estrogen has been the primary focus, the protective effects of hormone replacement therapy on cognition and dementia only during a “crucial period” led us to expand the study of hormonal influences to other members of the hypothalamic pituitary axis. Specifically, in this review, we focus on luteinizing hormone, which is not only increased in the sera of patients with Alzheimer disease but, like estrogen, is modulated by hormone replacement therapy and also influences cognitive behavior and pathogenic processing in animal models of the disease. Targeting gonadotropins may be a useful treatment strategy for disease targeting multiple pleiotropic downstream consequences.

  4. Associations between postprandial insulin and blood glucose responses, appetite sensations and energy intake in normal weight and overweight individuals: a meta-analysis of test meal studies

    DEFF Research Database (Denmark)

    Flint, Anne; Gregersen, Nikolaj T.; Gluud, Lise L.

    2007-01-01

    ) in normal weight and overweight participants. Data from seven test meal studies were used, including 136 healthy participants (ALL) (92 normal weight (NW) and 44 overweight or obese (OW)). All meals were served as breakfasts after an overnight fast, and appetite sensations and blood samples were obtained......, but the relationship is disrupted in the overweight and obese. We conclude that the postprandial insulin response may be an important satiety signal, and that central nervous system insulin resistance in overweight might explain the blunted effect on appetite....

  5. The early response of p53-dependent proteins during radiotherapy in human rectal carcinoma and in adjacent normal tissue

    NARCIS (Netherlands)

    Stift, A; Prager, G; Selzer, E; Widder, J; Kandioler, D; Friedl, J; Teleky, B; Herbst, F; Wrba, F; Bergmann, M

    2003-01-01

    The aim of this study was to investigate the activation of the p53 pathway and the induction of apoptosis during preoperative radiotherapy in normal human rectal tissue and in rectal carcinoma. Twelve patients with rectal cancer of the lower third were enrolled in this study. Tumor specimens and adj

  6. Psychomotor slowing, neuroendocrine responses, and behavioral changes after oral administration of meta-chlorophenylpiperazine in normal volunteers.

    NARCIS (Netherlands)

    Sabbe, B.G.C.; Hulstijn, W.; Maes, M.; Pier, M.P.B.I.; Scharpé, S.; Zitman, F.G.

    2001-01-01

    The mixed 5-HT receptor agonist/antagonist meta-chlorophenylpiperazine (mCPP) is known to suppress locomotor activity in mice and rats. This study aimed: (1) to determine whether mCPP induces cognitive and motor changes in normal human volunteers and how these changes relate to the neuroendocrine ef

  7. Psychomotor slowing, neuroendocrine responses, and behavioral changes after oral administration of meta-chlorophenylpiperazine in normal volunteers

    NARCIS (Netherlands)

    Sabbe, B.G.C.; Hulstijn, W.; Maes, M.; Pier, M.P.B.I.; Scharpé, S.; Zitman, F.G.

    2001-01-01

    The mixed 5-HT receptor agonist/antagonist meta-chlorophenylpiperazine (mCPP) is known to suppress locomotor activity in mice and rats. This study aimed: (1) to determine whether mCPP induces cognitive and motor changes in normal human volunteers and how these changes relate to the neuroendocrine ef

  8. Response of growth hormone (GH), FFA, blood sugar and insulin to exercise in obese patients and normal subjects

    NARCIS (Netherlands)

    Schwarz, F.; Haar, D.J. ter; Riet, H.G. van; Thijssen, J.H.H.

    1969-01-01

    Ergometer tests with a constant workload of 600 Kg./min. during 30 minutes were done on eight normal subjects, eight severely obese patients, and two women who had formerly been obese. Arterial blood was sampled three times before, four times during and three times after exercise. The incidence and

  9. Adrenal and gonadal steroids and pituitary response to LHRH in girls. II. Precocious puberty.

    Science.gov (United States)

    Pintor, C; Genazzani, A R; Ibba, P; Pecciarini-Snickars, L; Corda, R

    1978-04-01

    Three baby girls between 22 and 30 months of age, presenting with isosexual idiopathic precocious puberty apparently not due to any organic cause, were studied. Basal levels of plasma steroids of adrenal and gonadal origin, circadian rhythm of plasma cortisol, and pituitary response to 25 microgram of LHRH were evaluated. All cases were characterized by high levels of plasma gonadotropins and by a marked response to exogenous LHRH. Normal cortisol circadia rhythm was found in all cases, one of which characterized by slightly raised plasma values. The other adrenal steroids were all higher than those expected for the chronological age, corresponding to those of 5-6 years old girls. On the other hand, steroids of both adrenal and ovarian (A, T) or mainly ovarian origin (E2) and DHT were all found to be higher than those normally reported in girls at stage 2 of sexual development. These data indicate a hypersecretion of gonadotropins in idiopathic isosexual precocious puberty, with a marked gonadal steroidogenetic response. The secretion of adrenal androgens does not appear to have an important role in the etiology of this condition.

  10. Serum insulin-like factor 3 is highly correlated with intratesticular testosterone in normal men with acute, experimental gonadotropin deficiency stimulated with low-dose human chorionic gonadotropin

    DEFF Research Database (Denmark)

    Roth, Mara Y; Lin, Kat; Bay, Katrine

    2013-01-01

    To study the potential role for using serum biomarkers, including insulin-like factor 3 (INSL3), 17α-hydroxyprogesterone, antimüllerian hormone, and inhibin B, as correlates of intratesticular T (IT-T) concentrations in men....

  11. Separation of metabolic supply and demand: aerobic glycolysis as a normal physiological response to fluctuating energetic demands in the membrane.

    Science.gov (United States)

    Epstein, Tamir; Xu, Liping; Gillies, Robert J; Gatenby, Robert A

    2014-01-01

    Cancer cells, and a variety of normal cells, exhibit aerobic glycolysis, high rates of glucose fermentation in the presence of normal oxygen concentrations, also known as the Warburg effect. This metabolism is considered abnormal because it violates the standard model of cellular energy production that assumes glucose metabolism is predominantly governed by oxygen concentrations and, therefore, fermentative glycolysis is an emergency back-up for periods of hypoxia. Though several hypotheses have been proposed for the origin of aerobic glycolysis, its biological basis in cancer and normal cells is still not well understood. We examined changes in glucose metabolism following perturbations in membrane activity in different normal and tumor cell lines and found that inhibition or activation of pumps on the cell membrane led to reduction or increase in glycolysis, respectively, while oxidative phosphorylation remained unchanged. Computational simulations demonstrated that these findings are consistent with a new model of normal physiological cellular metabolism in which efficient mitochondrial oxidative phosphorylation supplies chronic energy demand primarily for macromolecule synthesis and glycolysis is necessary to supply rapid energy demands primarily to support membrane pumps. A specific model prediction was that the spatial distribution of ATP-producing enzymes in the glycolytic pathway must be primarily localized adjacent to the cell membrane, while mitochondria should be predominantly peri-nuclear. The predictions were confirmed experimentally. Our results show that glycolytic metabolism serves a critical physiological function under normoxic conditions by responding to rapid energetic demand, mainly from membrane transport activities, even in the presence of oxygen. This supports a new model for glucose metabolism in which glycolysis and oxidative phosphorylation supply different types of energy demand. Cells use efficient but slow-responding aerobic metabolism

  12. Laparoscopic oviductal artificial insemination improves pregnancy success in exogenous gonadotropin-treated domestic cats as a model for endangered felids.

    Science.gov (United States)

    Conforti, Valéria A; Bateman, Helen L; Schook, Mandi W; Newsom, Jackie; Lyons, Leslie A; Grahn, Robert A; Deddens, James A; Swanson, William F

    2013-07-01

    Artificial insemination (AI) in cats traditionally uses equine chorionic gonadotropin (eCG) and human chorionic gonadotropin (hCG) to induce follicular development and ovulation, with subsequent bilateral laparoscopic intrauterine insemination. However, long-acting hCG generates undesirable secondary ovulations in cats. Uterine AI also requires relatively high numbers of spermatozoa for fertilization (~8 × 10(6) sperm), and unfortunately, sperm recovery from felids is frequently poor. Using short-acting porcine luteinizing hormone (pLH) instead of hCG, and using the oviduct as the site of sperm deposition, could improve fertilization success while requiring fewer spermatozoa. Our objectives were to compare pregnancy and fertilization success between 1) uterine and oviductal inseminations and 2) eCG/hCG and eCG/pLH regimens in domestic cats. Sixteen females received either eCG (100 IU)/hCG (75 IU) or eCG (100 IU)/pLH (1000 IU). All females ovulated and were inseminated in one uterine horn and the contralateral oviduct using fresh semen (1 × 10(6) motile sperm/site) from a different male for each site. Pregnant females (11/16; 69%) were spayed approximately 20 days post-AI, and fetal paternity was genetically determined. The number of corpora lutea (CL) at AI was similar between hormone regimens, but hCG increased the number of CL at 20 days post-AI. Numbers of pregnancies and normal fetuses were similar between regimens. Implantation abnormalities were observed in the hCG group only. Finally, oviductal AI produced more fetuses than uterine AI. In summary, laparoscopic oviductal AI with low sperm numbers in eCG/hCG- or eCG/pLH-treated females resulted in high pregnancy and fertilization percentages in domestic cats. Our subsequent successes with oviductal AI in eCG/pLH-treated nondomestic felids to produce healthy offspring supports cross-species applicability.

  13. Final Oocyte Maturation in Assisted Reproduction with Human Chorionic Gonadotropin and Gonadotropin-releasing Hormone agonist (Dual Trigger).

    Science.gov (United States)

    Oliveira, Sofia Andrade de; Calsavara, Vinícius Fernando; Cortés, Gemma Castillón

    2016-12-01

    Final oocyte maturation with Human Chorionic Gonadotropin (hCG) and ovarian stimulation with Follicle Stimulation Hormone (FSH) combined with Gonadotrophin-releasing Hormone (GnRH) antagonist to block Luteinizing hormone (LH) surge is a standard procedure of in vitro Fertilization (IVF) and Intracytoplasmic Sperm Injection (ICSI). However, GnRH agonist has been replacing the use of hCG in certain situations, especially in patients at risk of Ovarian Hyperstimulation Syndrome (OHSS). Some studies have also shown advantages in the combined use of GnRH agonist concurrently with hCG in inducing final oocyte maturation, a treatment known as "Dual Trigger". In theory, this method combines the advantages of both induction regimens, and it has brought promising results. The objective of this study is to compare Dual Trigger with the use of hCG alone or the use of GnRH agonist alone. A systematic review of articles on Dual Trigger and a retrospective cohort study comparing the three methods of induction of final oocyte maturation have been conducted. It has been found that Dual Triggering for poor responder patients had a statistically significant increase in the number of retrieved oocytes, mature oocytes, and fertilized embryos in the positive beta hCG rate, implantation rate, and newborn/transferred embryo (TE) rate.

  14. Differential gene expression in human granulosa cells from recombinant FSH versus human menopausal gonadotropin ovarian stimulation protocols

    Directory of Open Access Journals (Sweden)

    Bietz Mandi G

    2010-03-01

    Full Text Available Abstract Background The study was designed to test the hypothesis that granulosa cell (GC gene expression response differs between recombinant FSH and human menopausal gonadotropin (hMG stimulation regimens. Methods Females Results After exclusions, 1736 genes exhibited differential expression between groups. Over 400 were categorized as signal transduction genes, ~180 as transcriptional regulators, and ~175 as enzymes/metabolic genes. Expression of selected genes was confirmed by RT-PCR. Differentially expressed genes included A kinase anchor protein 11 (AKAP11, bone morphogenetic protein receptor II (BMPR2, epidermal growth factor (EGF, insulin-like growth factor binding protein (IGFBP-4, IGFBP-5, and hypoxia-inducible factor (HIF-1 alpha. Conclusions Results suggest that major differences exist in the mechanism by which pure FSH alone versus FSH/LH regulate gene expression in preovulatory GC that could impact oocyte maturity and developmental competence.

  15. Endocrine disrupting effects of dichlorodiphenyltrichloroethane analogues on gonadotropin hormones in pituitary gonadotrope cells.

    Science.gov (United States)

    Zhou, Jinghua; Yang, Ye; Xiong, Kang; Liu, Jing

    2014-05-01

    It has been shown that exposure to dichlorodiphenyltrichloroethane (DDT) analogues leads to disharmony of follicle-stimulating hormone (FSH) and luteinizing hormone (LH). However, the effects and mechanisms of DDT analogues on the expression of gonadotropin genes (FSHβ, LHβ and Cgα), which is the rate-limiting step of FSH and LH biosynthesis, remain unknown. In this study, we assessed the effects of p,p'-DDT, o,p'-DDT, p,p'-dichlorodiphenyldichloroethylene (p,p'-DDE) and methoxychlor (MXC) on gonadotropin genes expression and hormones synthesis in gonadotrope cells. p,p'-DDT and MXC at test concentrations ranging from 10(-9) to 10(-7)mol/L, stimulated gonadotropin genes expression and hormones synthesis in a dose-dependent manner. The activation of extracellular signal-regulated kinase (ERK) was required for the induction of gonadotropin genes expression and hormones synthesis by p,p'-DDT or MXC exposure. This study showed for the first time that p,p'-DDT and MXC regulated gonadotropin genes expression and hormones synthesis through ERK pathway in gonadotrope cells.

  16. Pigment epithelium-derived factor enhances tumor response to radiation through vasculature normalization in allografted lung cancer in mice.

    Science.gov (United States)

    Xu, Z; Dong, Y; Peng, F; Yu, Z; Zuo, Y; Dai, Z; Chen, Y; Wang, J; Hu, X; Zhou, Q; Ma, H; Bao, Y; Gao, G; Chen, M

    2015-03-01

    This study aimed to explore the potential therapeutic effects of the combination of pigment epithelium-derived factor (PEDF) and radiation on lung cancer. The Lewis lung cancer (LLC) allografts in nude mice were treated with radiation, PEDF and PEDF combined with radiation. The morphologic changes of tumor vasculature and the hypoxic fraction of tumor tissues were evaluated. Significant inhibition of tumor growth was observed when radiation was applied between the 3rd and 7th day (the vasculature normalization window) after the initiation of PEDF treatment. During the vasculature normalization window, the tumor blood vessels in PEDF-treated mice were less tortuous and more uniform than those in the LLC allograft tumor treated with phosphate-buffered saline. Meanwhile, the thickness of the basement membrane was remarkably reduced and pericyte coverage was significantly increased with the PEDF treatment. We also found that tumor hypoxic fraction decreased during the 3rd to the 7th day after PEDF treatment, suggesting improved intratumoral oxygenation. Taken together, our results show that PEDF improved the effects of radiation therapy on LLC allografts by inducing a vascular normalization window from the 3rd to the 7th day after PEDF treatment. Our findings provide a basis for treating lung cancer with the combination of PEDF and radiation.

  17. Pupil responses derived from outer and inner retinal photoreception are normal in patients with hereditary optic neuropathy.

    Science.gov (United States)

    Kawasaki, Aki; Collomb, Sylvie; Léon, Lorette; Münch, Mirjam

    2014-03-01

    We compared the pupil responses originating from outer versus inner retinal photoreception between patients with isolated hereditary optic neuropathy (HON, n = 8) and healthy controls (n = 8). Three different testing protocols were used. For the first two protocols, a response function of the maximal pupil contraction versus stimulus light intensity was generated and the intensity at which half of the maximal pupil contraction, the half-max intensity, was determined. For the third protocol, the pupil size after light offset, the re-dilation rate and re-dilation amplitude were calculated to assess the post-light stimulus response. Patients with HON had bilateral, symmetric optic atrophy and significant reduction of visual acuity and visual field compared to controls. There were no significant mean differences in the response curve and pupil response parameters that reflect mainly rod, cone or melanopsin activity between patients and controls. In patients, there was a significant correlation between the half-max intensity of the red light sequence and visual field loss. In conclusion, pupil responses derived from outer or inner retinal photoreception in HON patients having mild-to moderate visual dysfunction are not quantitatively different from age-matched controls. However, an association between the degree of visual field loss and the half-max intensity of the cone response suggests that more advanced stages of disease may lead to impaired pupil light reflexes.

  18. Efecto de la administración de diferentes dosis de gonadotrofina coriónica equina sobre la respuesta ovárica y el desarrollo in vitro de embriones de ratón Effect of different doses of equine chorionic gonadotropin on ovary response and in vitro mouse embryo development

    Directory of Open Access Journals (Sweden)

    M. T. Teruel

    2006-12-01

    Full Text Available El objetivo del trabajo fue evaluar el efecto de diferentes dosis de gonadotrofina coriónica equina (eCG (5, 7,5 o 10 UI sobre parámetros ováricos y desarrollo in vitro de embriones de hembras ratón Balb C. El peso y diámetro ovárico fueron superiores en animales tratados con 7,5 y 10 UI de eCG que en animales controles (PThe aim of this study was to evaluate the effect of different doses of equine gonatotropin hormone (eCG (5, 7.5 or 10 IU on the ovary response and in vitro embryo development in Balb C mice. The ovary weight and diameter increased for 7.5 and 10 IU of eCG compared to control group (P0.05. In vitro, the differentiation was not modified by the dose level. The hatching rate at 96 h was higher for embryos from 7.5 IU compared to 10 IU (82.22 vs 64.39, P<0.05. We concluded that, the percentage of normal oocytes and morulae and the differentiation rate are not dependent of the dose of eCG, however, the hatching in vitro is dose eCG dependent.

  19. Gonadotropins in the Russian Sturgeon: Their Role in Steroid Secretion and the Effect of Hormonal Treatment on Their Secretion

    Science.gov (United States)

    Yom-Din, Svetlana; Hollander-Cohen, Lian; Aizen, Joseph; Boehm, Benjamin; Shpilman, Michal; Golan, Matan; Hurvitz, Avshalom; Degani, Gad; Levavi-Sivan, Berta

    2016-01-01

    In the reproduction process of male and female fish, pituitary derived gonadotropins (GTHs) play a key role. To be able to specifically investigate certain functions of Luteinizing (LH) and Follicle stimulating hormone (FSH) in Russian sturgeon (Acipenser gueldenstaedtii; st), we produced recombinant variants of the hormones using the yeast Pichia pastoris as a protein production system. We accomplished to create in vitro biologically active heterodimeric glycoproteins consisting of two associated α- and β-subunits in sufficient quantities. Three dimensional modelling of both GTHs was conducted in order to study the differences between the two GTHs. Antibodies were produced against the unique β-subunit of each of the GTHs, in order to be used for immunohistochemical analysis and to develop an ELISA for blood and pituitary hormone quantification. This detection technique revealed the specific localization of the LH and FSH cells in the sturgeon pituitary and pointed out that both cell types are present in substantially higher numbers in mature males and females, compared to immature fish. With the newly attained option to prevent cross-contamination when investigating on the effects of GTH administration, we compared the steroidogeneic response (estradiol and 11-Keto testosterone (11-KT) in female and males, respectively) of recombinant stLH, stFSH, and carp pituitary extract in male and female sturgeon gonads at different developmental stages. Finally, we injected commercially available gonadotropin releasing hormones analog (GnRH) to mature females, and found a moderate effect on the development of ovarian follicles. Application of only testosterone (T) resulted in a significant increase in circulating levels of 11-KT whereas the combination of GnRH + T did not affect steroid levels at all. The response pattern for estradiol demonstrated a similar situation. FSH levels showed significant increases when GnRH + T was administered, while no changes were present in

  20. "Normality of Residuals Is a Continuous Variable, and Does Seem to Influence the Trustworthiness of Confidence Intervals: A Response to, and Appreciation of, Williams, Grajales, and Kurkiewicz (2013"

    Directory of Open Access Journals (Sweden)

    Jason W. Osborne

    2013-09-01

    Full Text Available Osborne and Waters (2002 focused on checking some of the assumptions of multiple linear.regression. In a critique of that paper, Williams, Grajales, and Kurkiewicz correctly clarify that.regression models estimated using ordinary least squares require the assumption of normally.distributed errors, but not the assumption of normally distributed response or predictor variables..They go on to discuss estimate bias and provide a helpful summary of the assumptions of multiple.regression when using ordinary least squares. While we were not as precise as we could have been.when discussing assumptions of normality, the critical issue of the 2002 paper remains -' researchers.often do not check on or report on the assumptions of their statistical methods. This response.expands on the points made by Williams, advocates a thorough examination of data prior to.reporting results, and provides an example of how incremental improvements in meeting the.assumption of normality of residuals incrementally improves the accuracy of confidence intervals.

  1. Genome-wide screen of cell-cycle regulators in normal and tumor cells identifies a differential response to nucleosome depletion.

    Science.gov (United States)

    Sokolova, Maria; Turunen, Mikko; Mortusewicz, Oliver; Kivioja, Teemu; Herr, Patrick; Vähärautio, Anna; Björklund, Mikael; Taipale, Minna; Helleday, Thomas; Taipale, Jussi

    2017-01-17

    To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that tumor and normal cells are differentially sensitive to loss of the histone genes transcriptional regulator CASP8AP2. In cancer cells, loss of CASP8AP2 leads to a failure to synthesize sufficient amount of histones in the S-phase of the cell cycle, resulting in slowing of individual replication forks. Despite this, DNA replication fails to arrest, and tumor cells progress in an elongated S-phase that lasts several days, finally resulting in death of most of the affected cells. In contrast, depletion of CASP8AP2 in normal cells triggers a response that arrests viable cells in S-phase. The arrest is dependent on p53, and preceded by accumulation of markers of DNA damage, indicating that nucleosome depletion is sensed in normal cells via a DNA-damage -like response that is defective in tumor cells.

  2. Radiotherapy. Non-standard feactionated regimens improving cancer treatment. Part II. Response of normal tissues to fractioned irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Villar, A.; Hernandez, M.; Pera, J.; Cambray, M.; Villa, S.; Arnaiz, M.D.

    1988-01-01

    The phenomena participating in the response of tissues to fractionated irradiation are analized with special emphasis on the most relevant points influencing the design of non-standard fractionated regimens.

  3. Evaluation of fault-normal/fault-parallel directions rotated ground motions for response history analysis of an instrumented six-story building

    Science.gov (United States)

    Kalkan, Erol; Kwong, Neal S.

    2012-01-01

    According to regulatory building codes in United States (for example, 2010 California Building Code), at least two horizontal ground-motion components are required for three-dimensional (3D) response history analysis (RHA) of buildings. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHA analyses should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak responses of engineering demand parameters (EDPs) were obtained for rotation angles ranging from 0° through 180° for evaluating the FN/FP directions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

  4. Gonadotropin-releasing hormone agonists cotreatment during chemotherapy in borderline ovarian tumor and ovarian cancer patients

    Institute of Scientific and Technical Information of China (English)

    ZHU Hong-lan; WANG Yan; LI Xiao-ping; WANG Chao-hua; WANG Yue; CUI Heng; WANG Jian-liu

    2013-01-01

    Background Recently,conservative surgery is acceptable in young patients with borderline ovarian tumor and ovarian cancer.The preservation of these patients' future fertility has been the focus of recent interest.This study aimed to observe the effect of gonadotropin-releasing hormone agonists (GnRHa) cotreatment during chemotherapy in borderline ovarian tumor and ovarian cancer patients.Methods Sixteen patients who were treated with fertility preservation surgery for borderline ovarian tumor and ovarian cancer and then administered GnRHa during chemotherapy in Peking University People's Hospital from January 2006 to July 2010 were retrospectively analyzed.This group was compared with a control group of 16 women who were treated concurrently with similar chemotherapy (n=5) without GnRHa or were historical controls (n=11).The disease recurrence,the menstruation status and reproductive outcome were followed up and compared between the two groups.Results There were no significant differences between both groups regarding age,body weight,height,marriage status,classification of the tumors,stage of the disease,as were the cumulative doses of each chemotherapeutic agent.One (1/16) patient in the study group while 2 (2/16) patients in the control group relapsed 2 years after conclusion of the primary treatment (P >0.05).All of the 16 women in the study group compared with 11 of the 16 patients in the control group resumed normal menses 6 months after the termination of the treatment (P <0.05).There were 4 spontaneous pregnancies in the study group while 2 in the control group,all of the neonates were healthy.Conclusions GnRHa administration before and during chemotherapy in borderline ovarian tumor and ovarian cancer patients who had undergone fertility preservation operation may bring up higher rates of spontaneous resumption of menses and a better pregnancy rate.Long-term follow up and large scale clinical studies are required.

  5. Gonadotropin-releasing hormone 2 suppresses food intake in the zebrafish, Danio rerio

    Directory of Open Access Journals (Sweden)

    Ryo eNishiguchi

    2012-10-01

    Full Text Available Gonadotropin-releasing hormone (GnRH is an evolutionarily conserved neuropeptide with 10 amino acid residues, of which several structural variants exist. A molecular form known as GnRH2 ([His5 Trp7 Tyr8]GnRH, also known as chicken GnRH II is widely distributed in vertebrates except for rodents, and has recently been implicated in the regulation of feeding behavior in goldfish. However, the influence of GnRH2 on feeding behavior in other fish has not yet been studied. In the present study, therefore, we investigated the role of GnRH2 in the regulation of feeding behavior in a zebrafish model, and examined its involvement in food intake after intracerebroventricular (ICV administration. ICV injection of GnRH2 at 0.1 and 1 pmol/g body weight (BW induced a marked decrease of food consumption in a dose-dependent manner during 30 min after feeding. Cumulative food intake was significantly decreased by ICV injection of GnRH2 at 1 pmol/g BW during the 30-min post-treatment observation period. The anorexigenic action of GnRH2 was completely blocked by treatment with the GnRH type I receptor antagonist Antide at 50 pmol/g BW. We also examined the effect of feeding condition on the expression level of the GnRH2 transcript in the hypothalamus. Levels of GnRH2 mRNA obtained from fish that had been provided excess food for 7 days were higher than those in fish that had been fed normally. These results suggest that, in zebrafish, GnRH2 acts as an anorexigenic factor, as is the case in goldfish.

  6. The omega-3 fatty acid eicosapentaenoic acid is required for normal alcohol response behaviors in C. elegans.

    Directory of Open Access Journals (Sweden)

    Richard C Raabe

    Full Text Available Alcohol addiction is a widespread societal problem, for which there are few treatments. There are significant genetic and environmental influences on abuse liability, and understanding these factors will be important for the identification of susceptible individuals and the development of effective pharmacotherapies. In humans, the level of response to alcohol is strongly predictive of subsequent alcohol abuse. Level of response is a combination of counteracting responses to alcohol, the level of sensitivity to the drug and the degree to which tolerance develops during the drug exposure, called acute functional tolerance. We use the simple and well-characterized nervous system of Caenorhabditis elegans to model the acute behavioral effects of ethanol to identify genetic and environmental factors that influence level of response to ethanol. Given the strong molecular conservation between the neurobiological machinery of worms and humans, cellular-level effects of ethanol are likely to be conserved. Increasingly, variation in long-chain polyunsaturated fatty acid levels has been implicated in complex neurobiological phenotypes in humans, and we recently found that fatty acid levels modify ethanol responses in worms. Here, we report that 1 eicosapentaenoic acid, an omega-3 polyunsaturated fatty acid, is required for the development of acute functional tolerance, 2 dietary supplementation of eicosapentaenoic acid is sufficient for acute tolerance, and 3 dietary eicosapentaenoic acid can alter the wild-type response to ethanol. These results suggest that genetic variation influencing long-chain polyunsaturated fatty acid levels may be important abuse liability loci, and that dietary polyunsaturated fatty acids may be an important environmental modulator of the behavioral response to ethanol.

  7. Consensus statement on the use of gonadotropin-releasing hormone analogs in children

    DEFF Research Database (Denmark)

    Carel, Jean-Claude; Eugster, Erica A; Rogol, Alan;

    2009-01-01

    OBJECTIVE: Gonadotropin-releasing hormone analogs revolutionized the treatment of central precocious puberty. However, questions remain regarding their optimal use in central precocious puberty and other conditions. The Lawson Wilkins Pediatric Endocrine Society and the European Society...... for Pediatric Endocrinology convened a consensus conference to review the clinical use of gonadotropin-releasing hormone analogs in children and adolescents. PARTICIPANTS: When selecting the 30 participants, consideration was given to equal representation from North America (United States and Canada) and Europe...... assembly for final review. If consensus could not be reached, conclusions were based on majority vote. All participants approved the final statement. CONCLUSIONS: The efficacy of gonadotropin-releasing hormone analogs in increasing adult height is undisputed only in early-onset (girls

  8. Molecular Mechanisms of Gonadotropin-Releasing Hormone Signaling: Integrating Cyclic Nucleotides into the Network

    Directory of Open Access Journals (Sweden)

    Craig Alexander McArdle

    2013-11-01

    Full Text Available Gonadotropin-releasing hormone (GnRH is the primary regulator of mammalian reproductive function in both males and females. It acts via G-protein coupled receptors on gonadotropes to stimulate synthesis and secretion of the gonadotropin hormones luteinizing hormone and follicle-stimulating hormone. These receptors couple primarily via G-proteins of the Gq/11 family, driving activation of phospholipase C and mediating GnRH effects on gonadotropin synthesis and secretion. There is also good evidence that GnRH causes activation of other heterotrimeric G-proteins (Gs and Gi with consequent effects on cyclic AMP production, as well as for effects on the soluble and particulate guanylyl cyclases that generate cGMP. Here we provide an overview of these pathways. We emphasise mechanisms underpinning pulsatile hormone signaling and the possible interplay of GnRH and autocrine or paracrine regulatory mechanisms in control of cyclic nucleotide signaling.

  9. Relationship between stem cell factor and gonadotropin in ovarian follicles development during superovulation cycles

    Institute of Scientific and Technical Information of China (English)

    WANG Gui-hong; ZHAO Hai-bo; XIN Xiao-yan; LIN Guo-cheng

    2002-01-01

    Objective: To study whether stem cell factor (SCF) and gonadotropin work synergisticly in superovulation stimulation of an in-vitro fertilization and embryo transfer (IVF-ET) program. Methods: Total cycles of 30 IVF-ET patients with regular menstrual period were studied. The same superovulation regimen was employed. Enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA) were used to determine the levels of SCF, follicular-stimulating hormone (FSH) and luteinizing hormone (LH) in follicular fluid (FF) during ooeyte pick-up (OPU) and in serum before and after superovulation. Results: FF-SCF of follicles with diameter over 20 mm were different in three groups [(2. 6±0. 4), (4. 7±0. 5), and (5.3±0. 9), respectively, P<0. 01], whereas the total numbers of developing follicles (diametre≥5 mm) were similar. Conclusion: SCF and gonadotropin may have synergistic effects on the development of follicles during gonadotropin stimulation in IVF-ET program.

  10. The radiobiology of laser-driven particle beams: focus on sub-lethal responses of normal human cells

    Science.gov (United States)

    Manti, L.; Perozziello, F. M.; Borghesi, M.; Candiano, G.; Chaudhary, P.; Cirrone, G. A. P.; Doria, D.; Gwynne, D.; Leanza, R.; Prise, K. M.; Romagnani, L.; Romano, F.; Scuderi, V.; Tramontana, A.

    2017-03-01

    Accelerated proton beams have become increasingly common for treating cancer. The need for cost and size reduction of particle accelerating machines has led to the pioneering investigation of optical ion acceleration techniques based on laser-plasma interactions as a possible alternative. Laser-matter interaction can produce extremely pulsed particle bursts of ultra-high dose rates (>= 109 Gy/s), largely exceeding those currently used in conventional proton therapy. Since biological effects of ionizing radiation are strongly affected by the spatio-temporal distribution of DNA-damaging events, the unprecedented physical features of such beams may modify cellular and tissue radiosensitivity to unexplored extents. Hence, clinical applications of laser-generated particles need thorough assessment of their radiobiological effectiveness. To date, the majority of studies have either used rodent cell lines or have focussed on cancer cell killing being local tumour control the main objective of radiotherapy. Conversely, very little data exist on sub-lethal cellular effects, of relevance to normal tissue integrity and secondary cancers, such as premature cellular senescence. Here, we discuss ultra-high dose rate radiobiology and present preliminary data obtained in normal human cells following irradiation by laser-accelerated protons at the LULI PICO2000 facility at Laser Lab Europe, France.

  11. Gut microbiota and glucometabolic alterations in response to recurrent partial sleep deprivation in normal-weight young individuals.

    Science.gov (United States)

    Benedict, Christian; Vogel, Heike; Jonas, Wenke; Woting, Anni; Blaut, Michael; Schürmann, Annette; Cedernaes, Jonathan

    2016-12-01

    Changes to the microbial community in the human gut have been proposed to promote metabolic disturbances that also occur after short periods of sleep loss (including insulin resistance). However, whether sleep loss affects the gut microbiota remains unknown. In a randomized within-subject crossover study utilizing a standardized in-lab protocol (with fixed meal times and exercise schedules), we studied nine normal-weight men at two occasions: after two nights of partial sleep deprivation (PSD; sleep opportunity 02:45-07:00 h), and after two nights of normal sleep (NS; sleep opportunity 22:30-07:00 h). Fecal samples were collected within 24 h before, and after two in-lab nights, of either NS or PSD. In addition, participants underwent an oral glucose tolerance test following each sleep intervention. Microbiota composition analysis (V4 16S rRNA gene sequencing) revealed that after two days of PSD vs. after two days of NS, individuals exhibited an increased Firmicutes:Bacteroidetes ratio, higher abundances of the families Coriobacteriaceae and Erysipelotrichaceae, and lower abundance of Tenericutes (all P sleep loss induces subtle effects on human microbiota. To what extent the observed changes to the microbial community contribute to metabolic consequences of sleep loss warrants further investigations in larger and more prolonged sleep studies, to also assess how sleep loss impacts the microbiota in individuals who already are metabolically compromised.

  12. The photopic negative response of the blue-on-yellow flash-electroretinogram in glaucomas and normal subjects.

    Science.gov (United States)

    Wakili, Nina; Horn, Folkert K; Jünemann, Anselm G; Nguyen, Nhung X; Mardin, Christian Y; Korth, Matthias; Kremers, Jan

    2008-09-01

    The photopic negative response of the flash-electroretinogram driven by the middle- and long-wavelength cones has been shown to be reduced in non-human primates with experimental glaucoma and in human patients with glaucoma. The photopic negative response for the blue-sensitive response has been studied using a blue-green silent-substitution-technique on a red background. The aim of this study was to re-evaluate the value of the photopic negative response of the blue-sensitive pathway in glaucoma using a conventional flash-electroretinogram. In 37 eyes of 37 controls (age: 53 +/- 13.6 years) and 37 eyes of 37 patients with open-angle glaucoma of different perimetric visual field defects (age: 58.3 +/- 10 years; MD: 11.7 +/- 6.7 dB) of the Erlangen glaucoma registry Ganzfeld flash-electroretinograms (LKC, UTAS 3000) were recorded using blue Xenon-flashes of increasing photopic luminance (0.013, 0.018, 0.030, and 0.052 cd s/m(2); 440 nm) on a bright yellow background (238 cd/m(2); 550 nm) after 2 min of light adaptation. Amplitudes and implicit times of the photopic negative response and of L&M-cone- and S-cone-driven b-waves were compared between glaucomas and controls for all flash energies (unpaired t-test). The amplitudes of the photopic negative response were significantly reduced in glaucoma patients for all flash energies (P flash-electroretinogram are potentially useful in the evaluation of inner-retinal function in glaucoma.

  13. Vascular response to ischemia in the feet of falanga torture victims and normal controls--color and spectral Doppler findings

    DEFF Research Database (Denmark)

    Torp-Pedersen, Søren; Amris, Kirstine; Holm, Christian Cato;

    2009-01-01

    OBJECTIVE: To investigate whether signs of chronic compartment syndrome could be found in plantar muscles of falanga torture victims with painful feet and impaired gait. The hypothesis was that the muscular vascular response to two minutes ischemia would be decreased in torture victims compared......, the second was higher and the third was highest indicating that the response to ischemia was disappearing as measurements were made. There was a trend that the first RI was higher in torture victims than in controls. DISCUSSION: The study was not able to confirm the presence of chronic compartment syndrome...

  14. Stress increases putative gonadotropin inhibitory hormone and decreases luteinizing hormone in male rats.

    Science.gov (United States)

    Kirby, Elizabeth D; Geraghty, Anna C; Ubuka, Takayoshi; Bentley, George E; Kaufer, Daniela

    2009-07-07

    The subjective experience of stress leads to reproductive dysfunction in many species, including rodents and humans. Stress effects on reproduction result from multilevel interactions between the hormonal stress response system, i.e., the hypothalamic-pituitary-adrenal (HPA) axis, and the hormonal reproductive system, i.e., the hypothalamic-pituitary-gonadal (HPG) axis. A novel negative regulator of the HPG axis known as gonadotropin-inhibitory hormone (GnIH) was recently discovered in quail, and orthologous neuropeptides known as RFamide-related peptides (RFRPs) have also been identified in rodents and primates. It is currently unknown, however, whether GnIH/RFRPs influence HPG axis activity in response to stress. We show here that both acute and chronic immobilization stress lead to an up-regulation of RFRP expression in the dorsomedial hypothalamus (DMH) of adult male rats and that this increase in RFRP is associated with inhibition of downstream HPG activity. We also show that adrenalectomy blocks the stress-induced increase in RFRP expression. Immunohistochemistry revealed that 53% of RFRP cells express receptors for glucocorticoids (GCs), indicating that adrenal GCs can mediate the stress effect through direct action on RFRP cells. It is thought that stress effects on central control of reproduction are largely mediated by direct or indirect effects on GnRH-secreting neurons. Our data show that stress-induced increases in adrenal GCs cause an increase in RFRP that contributes to hypothalamic suppression of reproductive function. This novel insight into HPA-HPG interaction provides a paradigm shift for work on stress-related reproductive dysfunction and infertility, and indicates that future work on stress and reproductive system interactions must include investigation of the role of GnIH/RFRP.

  15. Gonadotropin promotion of adventitious root production on cuttings of Begonia semperflorens and Vitis vinifera.

    Science.gov (United States)

    Leshem, Y; Lunenfeld, B

    1968-03-01

    Adventitious rooting of Begonia semperflorens cv. Indian Maid and Vitis vinifera cv. Semillon stem cuttings was significantly promoted by human chorionic gonadotropin (HCG). Basal sections of HCG treated cuttings upon which promoted rooting took place had markedly less endogenous gibberellin (GA) activity than non-treated controls or apical sections of treated ones, while changes in auxin levels were not found. HCG also inhibited GA(3)-induced reducing sugar release from embryoless barley endosperm halves. These findings are discussed in the light of a possible analogy to gonadotropin action in animal systems.

  16. Gonadotropin Promotion of Adventitious Root Production on Cuttings of Begonia semperflorens and Vitis vinifera 1

    Science.gov (United States)

    Leshem, Y.; Lunenfeld, B.

    1968-01-01

    Adventitious rooting of Begonia semperflorens cv. Indian Maid and Vitis vinifera cv. Semillon stem cuttings was significantly promoted by human chorionic gonadotropin (HCG). Basal sections of HCG treated cuttings upon which promoted rooting took place had markedly less endogenous gibberellin (GA) activity than non-treated controls or apical sections of treated ones, while changes in auxin levels were not found. HCG also inhibited GA3-induced reducing sugar release from embryoless barley endosperm halves. These findings are discussed in the light of a possible analogy to gonadotropin action in animal systems. PMID:5641189

  17. [Activity of clobazam on plasma prolactin and gonadotropins after administration of sulpiride in the male rat].

    Science.gov (United States)

    Valli, M; Courtiere, A; Tamalet, C; Jadot, G

    1984-01-01

    The acute administration of the 1,5 benzodiazepine clobazam (20 and 100 mg/kg orally) reduces the sulpiride-induced release of prolactin in the male rat. The decrease in prolactin plasma level is respectively of 66 and 75% for the two doses, whereas it has minimal effects on the gonadotropins (FSH and LH). The clobazam induced prolactin lowering effect is compared to the one observed after diazepam administration. Finally, we have shown that the two benzodiazepines have no effect either on prolactin or on gonadotropins, when administered alone.

  18. Role of Gonadotropin-releasing Hormone Stimulation Test in Diagnosing Gonadotropin Deficiency in Both Males and Females with Delayed Puberty

    Institute of Scientific and Technical Information of China (English)

    Qi-Hong Sun; Yu Zheng; Xiao-Lin Zhang; Yi-Ming Mu

    2015-01-01

    Background:Delayed puberty can result either from constitutional delay of growth and puberty (CDP) or idiopathic hypogonadotropic hypogonadism (IHH).Gonadotropin-releasing hormone (GnRH) stimulation test has been generally accepted as a current method for diagnosing delayed puberty.The objective of this research was to assess the cut-off values and the efficacy of GnRH stimulation test in the diagnosis of delayed puberty in both males and females.Methods:A study of 91 IHH,27 CDP patients,6 prepubertal children,and 20 pubertal adults was undertaken.Blood samples were obtained at 0,30,60,and 120 min after GnRH administration and the levels of luteinizing hormone (LH) and follicle-stimulating hormone (FSH) were measured.For each parameter,the sensitivities and specificities were estimated,and the receiver operating characteristic (ROC) curves were constructed.Results:The ROC curves indicated that a serum basal LH <0.6 IU/L or peak LH <9.74 IU/L resulted in moderate sensitivity (73.8% or 80.0%) and specificity (90.9% or 86.4%) in the diagnosis of HH in males.Serum basal LH <0.85 IU/L or basal FSH <2.43 IU/L resulted in moderate sensitivity (80.0% or 100.0%) and specificity (75.0% or 50.0%) in the diagnosis of HH in females.Conclusions:Our data suggest that isolated use of the gonadorelin stimulation test is almost sufficient to discriminate between HH and CDP in males,but unnecessary in females.The most useful predictor is serum basal or peak LH to differentiate these two disorders in males,but serum basal LH or FSH in females.

  19. GnRH-induced Ca2+ signaling patterns and gonadotropin secretion in pituitary gonadotrophs. Functional adaptations to both ordinary and extraordinary physiological demands

    Directory of Open Access Journals (Sweden)

    María Luisa eDurán-Pastén

    2013-09-01

    Full Text Available Pituitary gonadotrophs are a small fraction of the anterior pituitary population, yet they synthesize gonadotropins: luteinizing (LH and follicle stimulating (FSH, essential for gametogenesis and steroidogenesis. LH is secreted via a regulated pathway while FSH release is mostly constitutive and controlled by synthesis. Although gonadotrophs fire action potentials spontaneously, the intracellular Ca2+ rises produced do not influence secretion, which is mainly driven by Gonadotropin Releasing Hormone (GnRH, a decapeptide synthesized in the hypothalamus and released in a pulsatile manner into the hypophyseal portal circulation. GnRH binding to G protein coupled receptors triggers Ca2+ mobilization from InsP3-sensitive intracellular pools, generating the global Ca2+ elevations necessary for secretion. Ca2+ signaling responses to increasing [GnRH] vary in stereotyped fashion from subthreshold to baseline spiking (oscillatory, to biphasic (spike-oscillatory or spike-plateau. This progression varies somewhat in gonadotrophs from different species and biological preparations. Both baseline spiking and biphasic GnRH-induced Ca2+ signals control LH/FSH synthesis and exocytosis. Estradiol and testosterone regulate gonadotropin secretion through feedback mechanisms, while FSH synthesis and release are influenced by activin, inhibin and follistatin. Adaptation to physiological events like the estrous cycle, involves changes in GnRH sensitivity and LH/FSH synthesis: in proestrus, estradiol feedback regulation abruptly changes from negative to positive, causing the pre-ovulatory LH surge. Similarly, when testosterone levels drop after orquiectomy the lack of negative feedback on pituitary and hypothalamus boosts both GnRH and LH secretion, gonadotrophs GnRH sensitivity increases and Ca2+ signaling patterns change. In addition, gonadotrophs proliferate and grow. These plastic changes denote a more vigorous functional adaptation in response to an extraordinary

  20. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  1. Intrahepatic and peripheral T-cell responses in genotype 1b hepatitis C virus-infected patients with persistently normal and elevated aminotransferase levels

    Institute of Scientific and Technical Information of China (English)

    Filiz Akyüz; Nuray Polat; Sabahattin Kaymakoglu; Nevzat Aksoy; Kadir Demir; Fatih Be(s)i(s)ik; Selim Badur; Yilmaz (C)akaloglu; Atilla (O)kten

    2005-01-01

    AIM: To evaluate whether the cytokine responses in liver and serum differ in chronic hepatitis C patients with normal and high alanine aminotransferase (ALT) levels.METHODS: Thirty-three (16 with normal ALT level as group 1 and 17 with elevated ALT level as group 2) patients infected with genotype 1b hepatitis C virus (HCV) were examined. Liver infiltrating lymphomononuclear cells (LILMCs) were isolated from liver biopsy by collagenase type 1 and stimulated with phytohemagglutinin and interleukin 2 (IL-2). IL-10, IL-12,interferon gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α) were determined in serum and LILMCs by ELISA.RESULTS: Serum cytokine levels were similar in both groups (P>0.05). Stimulated IFN-γ and TNF-α levels in LILMCs were increased in both groups. IL-12 and IL-10levels stimulated with IL-2 were higher in group 1 than in group 2 (P = 0.023). Histological activity index (HAI)and stage had a negative correlation with TNF-α and IFN-γ levels in group 2.CONCLUSION: Increased T-helper type 2 (Th2)cytokine response may regress inflammatory and biochemical activity. Progression of histological abnormalities in persons with elevated ALT probably depends on insufficient Th2 cytokine response, which does not balance Th1 cytokine response.

  2. Effects of acute beta-adrenoceptor blockade with metoprolol on the renal response to dopamine in normal humans

    DEFF Research Database (Denmark)

    Olsen, Niels Vidiendal; Lang-Jensen, T; Hansen, J M

    1994-01-01

    The present study investigated the contribution of adrenergic beta 1-receptor stimulation to the cardiovascular and renal effects of low-dose dopamine in eight normal, water-loaded humans. Metoprolol (100 mg) or placebo was administered orally at 08.00 h in a randomized, double-blind fashion on two...... different days. Renal clearance studies were performed during a 1 h baseline period, two 1 h periods with dopamine infusion (3 micrograms kg-1 min-1), and a 1 h recovery period. Cardiac output was measured by an ultrasonic Doppler method, and lithium clearance (CLLi) was used to estimate proximal tubular...... outflow. Baseline values of heart rate, systolic pressure and mean arterial pressure decreased with metoprolol compared with placebo, but cardiac output, effective renal plasma flow (ERPF) and glomerular filtration rate (GFR) were not significantly changed. Metoprolol significantly decreased baseline CLLi...

  3. A comparison of spent fuel shipping cask response to 10 CFR 71 normal conditions and realistic hot day extremes

    Energy Technology Data Exchange (ETDEWEB)

    Manson, S.J.; Gianoulakis, S.E. [Sandia National Labs., Albuquerque, NM (United States). Transportation Systems Development Dept.

    1994-04-01

    An examination of the effect of a realistic (though conservative) hot day environment on the thermal transient behavior of spent fuel shipping casks is made. These results are compared to those that develop under the prescribed normal thermal condition of 10 CFR 71. Of specific concern are the characteristics of propagating thermal waves, which are set up by diurnal variations of temperature and insolation in the outdoor environment. In order to arrive at a realistic approximation of these variations on a conservative hot day, actual temperature and insolation measurements have been obtained from the National Climatic Data Center (NCDC) for representatively hot and high heat flux days. Thus, the use of authentic meteorological data ensures the realistic approach sought. Further supporting the desired realism of the modeling effort is the use of realistic cask configurations in which multiple laminations of structural, shielding, and other materials are expected to attenuate the propagating thermal waves. The completed analysis revealed that the majority of wall temperatures, for a wide variety of spent fuel shipping cask configurations, fall well below those predicted by enforcement of the regulatory environmental conditions of 10 CFR 71. It was found that maximum temperatures at the cask surface occasionally lie above temperatures predicted under the prescribed regulatory conditions. However, the temperature differences are small enough that the normal conservative assumptions that are made in the course of typical cask evaluations should correct for any potential violations. The analysis demonstrates that diurnal temperature variations that penetrate the cask wall all have maxima substantially less than the corresponding regulatory solutions. Therefore it is certain that vital cask components and the spent fuel itself will not exceed the temperatures calculated by use of the conditions of 10 CFR 71.

  4. Responses of human normal osteoblast cells and osteoblast-like cell line, MG-63 cells, to pulse electromagnetic field (PEMF

    Directory of Open Access Journals (Sweden)

    Suttatip Kamolmatyakul

    2008-01-01

    Full Text Available The objective of this in vitro study is to investigate the effect of pulsed electromagnetic field (PEMF on cellular proliferation and osteocalcin production of osteoblast-like cell line, MG-63 cells, and human normal osteoblast cells (NHOC obtained from surgical bone specimens. The cells were placed in 24-well culture plates in the amount of 3x104 cell/wells with 2 ml αMEM media supplemented with 10% FBS. The experimental plates were placed between a pair of Helmoltz coils powered by a pulse generator (PEMF, 50 Hz, 1.5 mV/cm in the upper compartment of a dual incubator (Forma. The control plates were placed in the lower compartment of the incubator without Helmotz coils. After three days, the cell proliferation was measured by the method modified from Mossman (J. Immunol Methods 1983; 65: 55-63. Other sets of plates were used for osteocalcin production assessment. Media from these sets were collected after 6 days and assessed for osteocalcin production using ELISA kits. The data were analyzed using a one-way analysis of variance (ANOVA. The results showed that MG-63 cells from the experimental group proliferated significantly more than those from the control group (20% increase, p<0.05. No significant difference in osteocalcin production was detected between the two groups. On the other hand, NHOC from the experimental group produced larger amount of osteocalcin (25% increase, p<0.05 and proliferated significantly more than those from the control group (100% increase, p<0.05. In conclusion, PEMF effect on osteoblasts might depend on their cell type of origin. For osteoblast-like cell line, MG-63 cells, PEMF increased proliferation rate but not osteocalcin production of the cells. However, PEMF stimulation effect on human normal osteoblast cells was most likely associated with enhancement of both osteocalcin production and cell proliferation.

  5. A numerical modelling approach to investigate the surface processes response to normal fault growth in multi-rift settings

    Science.gov (United States)

    Pechlivanidou, Sofia; Cowie, Patience; Finch, Emma; Gawthorpe, Robert; Attal, Mikael

    2016-04-01

    This study uses a numerical modelling approach to explore structural controls on erosional/depositional systems within rifts that are characterized by complex multiphase extensional histories. Multiphase-rift related topography is generated by a 3D discrete element model (Finch et al., Basin Res., 2004) of normal fault growth and is used to drive the landscape evolution model CHILD (Tucker et al., Comput. Geosci., 2001). Fault populations develop spontaneously in the discrete element model and grow by both tip propagation and segment linkage. We conduct a series of experiments to simulate the evolution of the landscape (55x40 km) produced by two extensional phases that differ in the direction and in the amount of extension. In order to isolate the effects of fault propagation on the drainage network development, we conduct experiments where uplift/subsidence rates vary both in space and time as the fault array evolves and compare these results with experiments using a fixed fault array geometry with uplift rate/subsidence rates that vary only spatially. In many cases, areas of sediment deposition become uplifted and vise-versa due to complex elevation changes with respect to sea level as the fault array develops. These changes from subaerial (erosional) to submarine (depositional) processes have implications for sediment volumes and sediment caliber as well as for the sediment routing systems across the rift. We also explore the consequences of changing the angle between the two phases of extension on the depositional systems and we make a comparison with single-phase rift systems. Finally, we discuss the controls of different erodibilities on sediment supply and detachment-limited versus transport-limited end-member models for river erosion. Our results provide insights into the nature and distribution of sediment source areas and the sediment routing in rift systems where pre-existing rift topography and normal fault growth exert a fundamental control on

  6. Studies on responsiveness of hepatoma cells to catecholamines. II. Comparison of beta-adrenergic responsiveness of rat ascites hepatoma cells with cultured normal rat liver cells.

    Science.gov (United States)

    Miyamoto, K; Matsunaga, T; Takemoto, N; Sanae, F; Koshiura, R

    1985-05-01

    The pharmacological properties of beta-adrenoceptors in rat ascites hepatoma cells were compared with those in normal rat liver cells which were cultured for 24 hr after collagenase digestion. Adenylate cyclases in the homogenates of cultured normal rat liver cells and rat ascites hepatoma cells, AH44, AH66, AH109A, AH130 and AH7974, were all activated by isoproterenol or NaF to different degrees. The enzyme in rat liver cells was activated by several beta 2-agonists but those in all hepatoma cells hardly responded. Furthermore, salbutamol, a beta 2-partial agonist, antagonized the cyclase activation by isoproterenol in AH130 cells. The Kact value of isoproterenol for the activation of adenylate cyclase in AH130 cells was smaller than that in rat liver cells. A comparison of the Ki values of beta-antagonists for the inhibition of isoproterenol-stimulated cyclase activity shows that while the Ki values of propranolol and butoxamine in AH130 cells were similar to those in rat liver cells, a significant difference was observed in the values for beta 1-selective antagonists between AH130 cells and rat liver cells. The Ki values of metoprolol and atenolol for AH130 cells were 137- and 90-fold lower, respectively, than for normal rat liver cells. From these findings, it is strongly suggested that beta-adrenoceptors in rat ascites hepatoma cells including AH130 cells have similar properties to the mammalian beta 1-receptor.

  7. Tag-based Heart Rate Measurements of Harbor Porpoises During Normal and Noise-exposed Dives to Study Stress Responses

    Science.gov (United States)

    2014-09-30

    1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. Tag-based Heart Rate Measurements of Harbor Porpoises...The typical mammalian startle or stress response to an acoustic stressor is increased heart rate, cardiac output and ventilation rate (Graham 1979...routinely experience. Here we propose to examine the dive heart rate, ventilation rate and activity in both captive and wild porpoise to better understand

  8. Normal Hearing Ability but Impaired Auditory Selective Attention Associated with Prediction of Response to Donepezil in Patients with Alzheimer's Disease

    Science.gov (United States)

    Ouchi, Yoshitaka; Meguro, Kenichi; Akanuma, Kyoko; Kato, Yuriko; Yamaguchi, Satoshi

    2015-01-01

    Background. Alzheimer's disease (AD) patients have a poor response to the voices of caregivers. After administration of donepezil, caregivers often find that patients respond more frequently, whereas they had previously pretended to be “deaf.” We investigated whether auditory selective attention is associated with response to donepezil. Methods. The subjects were40 AD patients, 20 elderly healthy controls (HCs), and 15 young HCs. Pure tone audiometry was conducted and an original Auditory Selective Attention (ASA) test was performed with a MoCA vigilance test. Reassessment of the AD group was performed after donepezil treatment for 3 months. Results. Hearing level of the AD group was the same as that of the elderly HC group. However, ASA test scores decreased in the AD group and were correlated with the vigilance test scores. Donepezil responders (MMSE 3+) also showed improvement on the ASA test. At baseline, the responders had higher vigilance and lower ASA test scores. Conclusion. Contrary to the common view, AD patients had a similar level of hearing ability to healthy elderly. Auditory attention was impaired in AD patients, which suggests that unnecessary sounds should be avoided in nursing homes. Auditory selective attention is associated with response to donepezil in AD. PMID:26161001

  9. Influence of Melatonin on the Proliferative and Apoptotic Responses of the Prostate under Normal and Hyperglycemic Conditions

    Directory of Open Access Journals (Sweden)

    Marina G. Gobbo

    2015-01-01

    Full Text Available The antitumor properties of melatonin (MLT are known for prostate cancer cells. This study investigated whether MLT affects prostate maturation and interferes with tissue injuries induced by diabetes. MLT was administered to Wistar rats from 5 weeks of age in the drinking water (10 μg/kg b.w., and diabetes was induced at the 13th week by streptozotocin (4.5 mg/100g b.w., i.p.. The animals were euthanized in the 14th and 21st weeks. MLT reduced the immunostained cells for androgen receptor (AR by 10% in younger rats. Diabetes decreased cell proliferation and increased apoptosis. MLT treatment impeded apoptosis p=0.02 and augmented proliferation p=0.0008 and PCNA content in prostate following long-term diabetes due to restoration of testosterone levels and expression of melatonin receptor type 1B. The effect of MLT (500 µM, 5 mM, and 10 mM on androgen-dependent (22Rv1 and androgen-independent (PC3 cancer cells and human prostate epithelial cells (PNTA1 under normal and hyperglycemic conditions (HG, 450 mg/dL was analyzed. Contrary to PNTA1 and 22Rv1 cells, MLT improved the proliferation of PC3 cells in hyperglycemic medium. The combined data indicated that MLT had proliferative and antiapoptotic effects in prostate cells subjected to HG levels and it seems to involve specific MLT pathways rather than AR.

  10. Comparison of Dose Response Models for Predicting Normal Tissue Complications from Cancer Radiotherapy: Application in Rat Spinal Cord

    Energy Technology Data Exchange (ETDEWEB)

    Adamus-Górka, Magdalena; Mavroidis, Panayiotis, E-mail: panayiotis.mavroidis@ki.se; Lind, Bengt K.; Brahme, Anders [Department of Medical Radiation Physics, Karolinska Institutet and Stockholm University, Stockholm S-17176 (Sweden)

    2011-05-18

    Seven different radiobiological dose-response models have been compared with regard to their ability to describe experimental data. The first four models, namely the critical volume, the relative seriality, the inverse tumor and the critical element models are mainly based on cell survival biology. The other three models: the Lyman (Gaussian distribution), the parallel architecture and the Weibull distribution models are semi-empirical and rather based on statistical distributions. The maximum likelihood estimation was used to fit the models to experimental data and the χ{sup 2}-distribution, AIC criterion and F-test were applied to compare the goodness-of-fit of the models. The comparison was performed using experimental data for rat spinal cord injury. Both the shape of the dose-response curve and the ability of handling the volume dependence were separately compared for each model. All the models were found to be acceptable in describing the present experimental dataset (p > 0.05). For the white matter necrosis dataset, the Weibull and Lyman models were clearly superior to the other models, whereas for the vascular damage case, the Relative Seriality model seems to have the best performance although the Critical volume, Inverse tumor, Critical element and Parallel architecture models gave similar results. Although the differences between many of the investigated models are rather small, they still may be of importance in indicating the advantages and limitations of each particular model. It appears that most of the models have favorable properties for describing dose-response data, which indicates that they may be suitable to be used in biologically optimized intensity modulated radiation therapy planning, provided a proper estimation of their radiobiological parameters had been performed for every tissue and clinical endpoint.

  11. Comparison of Dose Response Models for Predicting Normal Tissue Complications from Cancer Radiotherapy: Application in Rat Spinal Cord

    Directory of Open Access Journals (Sweden)

    Magdalena Adamus-Górka

    2011-05-01

    Full Text Available Seven different radiobiological dose-response models have been compared with regard to their ability to describe experimental data. The first four models, namely the critical volume, the relative seriality, the inverse tumor and the critical element models are mainly based on cell survival biology. The other three models: the Lyman (Gaussian distribution, the parallel architecture and the Weibull distribution models are semi-empirical and rather based on statistical distributions. The maximum likelihood estimation was used to fit the models to experimental data and the χ2-distribution, AIC criterion and F-test were applied to compare the goodness-of-fit of the models. The comparison was performed using experimental data for rat spinal cord injury. Both the shape of the dose-response curve and the ability of handling the volume dependence were separately compared for each model. All the models were found to be acceptable in describing the present experimental dataset (p > 0.05. For the white matter necrosis dataset, the Weibull and Lyman models were clearly superior to the other models, whereas for the vascular damage case, the Relative Seriality model seems to have the best performance although the Critical volume, Inverse tumor, Critical element and Parallel architecture models gave similar results. Although the differences between many of the investigated models are rather small, they still may be of importance in indicating the advantages and limitations of each particular model. It appears that most of the models have favorable properties for describing dose-response data, which indicates that they may be suitable to be used in biologically optimized intensity modulated radiation therapy planning, provided a proper estimation of their radiobiological parameters had been performed for every tissue and clinical endpoint.

  12. Lack of evidence for low-LET radiation induced bystander response in normal human fibroblasts and colon carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Sowa, Marianne B.; Goetz, Wilfried; Baulch, Janet E.; Pyles, Dinah N.; Dziegielewski, J.; Yovino, Susannah; Snyder, Andrew R.; de Toledo, S. M.; Azzam, Edouard I.; Morgan, William F.

    2010-02-01

    The conventional paradigm in radiation biology has been that DNA is the primary target for energy deposition following exposure to ionizing radiation. However, studies focusing on the non-target effects of radiation, i.e. effects occurring in cells not directly exposed to radiation, imply that the target of exposure is larger than what has traditionally been assumed and could have significant implications for radiation health risks. We have conducted an extensive study of the low-LET bystander effect including multiple cell lines and endpoints and various radiation sources and exposure scenarios. In no instance do we see evidence of a low-LET induced bystander effect. However, direct comparison for alpha particle exposure showed a statistically significant media transfer bystander effect for high-LET but not for low-LET radiation. From our results it is evident that there are many confounding factors mitigating bystander responses as reported in the literature and for the cell lines we studied that there is a LET dependence for the observed responses. Our observations reflect the inherent variability in biological systems and the difficulties in extrapolating from in vitro models to radiation risks in humans.

  13. ID1 Is a Functional Marker for Intestinal Stem and Progenitor Cells Required for Normal Response to Injury

    Directory of Open Access Journals (Sweden)

    Ning Zhang

    2014-11-01

    Full Text Available LGR5 and BMI1 mark intestinal stem cells in crypt base columnar cells and +4 position cells, respectively, but characterization of functional markers in these cell populations is limited. ID1 maintains the stem cell potential of embryonic, neural, and long-term repopulating hematopoietic stem cells. Here, we show in both human and mouse intestine that ID1 is expressed in cycling columnar cells, +4 position cells, and transit-amplifying cells in the crypt. Lineage tracing revealed ID1+ cells to be self-renewing, multipotent stem/progenitor cells that are responsible for the long-term renewal of the intestinal epithelium. Single ID1+ cells can generate long-lived organoids resembling mature intestinal epithelium. Complete knockout of Id1 or selective deletion of Id1 in intestinal epithelium or in LGR5+ stem cells sensitizes mice to chemical-induced colon injury. These experiments identify ID1 as a marker for intestinal stem/progenitor cells and demonstrate a role for ID1 in maintaining the potential for repair in response to colonic injury.

  14. Pharmacokinetics of human chorionic gonadotropin after i.m. administration in goats (Capra hircus).

    Science.gov (United States)

    Saleh, M; Shahin, M; Wuttke, W; Gauly, M; Holtz, W

    2012-07-01

    The present investigation addresses the pharmacokinetics of human chorionic gonadotropin (hCG), intramuscularly (i.m.) administered to goats. Nine pluriparous does of the Boer goat breed, 2-6 years of age and weighing 45-60 kg, were administered 500 IU hCG (2 ml Chorulon) deep into the thigh musculature 18 h after superovulatory FSH treatment. Blood samples were drawn from the jugular vein at 2  h intervals for the first 24h, at 6 h intervals until 42 h, and at 12 h intervals until 114 h after administration. After centrifugation, plasma hCG concentrations were determined by electrochemiluminescence immunoassay. Pharmacokinetical parameters were as follows: lag time, 0.4 (s.e.m. 0.1) h; absorption rate constant, 0.34 (s.e.m. 0.002) h; absorption half-life, 2.7 (s.e.m. 0.5) h; elimination rate constant, 0.02 (s.e.m. 0.002) h; biological half-life, 39.4 (s.e.m. 5.1) h; and apparent volume of distribution, 16.9 (s.e.m. 4.3) l. The plasma hCG profile was characterized by an absorption phase of 11.6 (s.e.m. 1.8) h and an elimination phase of 70.0 (s.e.m. 9.8) h, with considerable individual variation in bioavailability and pharmacokinetical parameters. Biological half-life was negatively correlated (P<0.05) with peak concentration (r=-0.76), absorption rate constant (r=-0.78), and elimination rate constant (r=-0.87). The results indicate that after rapid absorption, hCG remains in the circulation for an extended period. This has to be taken into account when assessing the stimulatory response to hCG treatment on an ovarian level.

  15. Toward developing recombinant gonadotropin-based hormone therapies for increasing fertility in the flatfish Senegalese sole

    Science.gov (United States)

    Chauvigné, François; Ollé, Judith; González, Wendy; Duncan, Neil; Giménez, Ignacio

    2017-01-01

    Captive flatfishes, such as the Senegalese sole, typically produce very low volumes of sperm. This situation is particularly prevalent in the first generation (F1) of reared sole males, which limits the development of artificial fertilization methods and the implementation of selective breeding programs. In this study, we investigated whether combined treatments with homologous recombinant follicle-stimulating (rFsh) and luteinizing (rLh) hormones, produced in a mammalian host system, could stimulate spermatogenesis and enhance sperm production in Senegalese sole F1 males. In an initial autumn/winter experiment, weekly intramuscular injections with increasing doses of rFsh over 9 weeks resulted in the stimulation of gonad weight, androgen release, germ cell proliferation and entry into meiosis, and the expression of different spermatogenesis-related genes, whereas a subsequent single rLh injection potentiated spermatozoa differentiation. In a second late winter/spring trial corresponding to the sole’s natural prespawning and spawning periods, we tested the effect of repeated rLh injections on the amount and quality of sperm produced by males previously treated with rFsh for 4, 6, 8 or 10 weeks. These latter results showed that the combination of rFsh and rLh treatments could increase sperm production up to 7 times, and slightly improve the motility of the spermatozoa, although a high variability in the response was found. However, sustained administration of rFsh during spawning markedly diminished Leydig cell survival and the steroidogenic potential of the testis. These data suggest that in vivo application of rFsh and rLh is effective at stimulating spermatogenesis and sperm production in Senegalese sole F1 males, setting the basis for the future establishment of recombinant gonadotropin-based hormone therapies to ameliorate reproductive dysfunctions of this species. PMID:28329024

  16. IMMUNE MODULATORY EFFECTS of HUMAN CHORIONIC GONADOTROPIN on DENDRITIC CELLS SUPPORTING FETAL SURVIVAL in MURINE PREGNANCY

    Directory of Open Access Journals (Sweden)

    Dominique Dauven

    2016-11-01

    Full Text Available Dendritic cells (DCs are critically involved in the determination of immunity versus tolerance. Hence, DCs are key regulators of immune responses either favoring or disfavoring fetal survival. Several factors were proposed to modulate DC phenotype and function during preg-nancy. Here, we studied whether the pregnancy hormone human Chorionic Gonadotropin (hCG is involved in DC regulation.In vitro, bone-marrow-derived DCs (BMDCs were stimulated in the presence or absence of urine-purified (uhCG or recombinant hCG (rhCG preparations. Subsequently, BMDC matu-ration was assessed. Cytokine secretion of activated BMDCs and their capability to enforce TH1, TH2, TH17 or Treg cell differentiation was determined after rhCG treatment. Moreover, the in vivo potential of hCG-modulated BMDCs to influence pregnancy outcome, Treg cell number and local cytokine expression was evaluated after adoptive transfer in a murine abor-tion-prone model before and after conception. Both hCG preparations impaired the maturation process of BMDCs. rhCG treatment did nei-ther alter cytokine secretion by BMDCs nor their ability to drive TH1, TH2 or TH17 differen-tiation. rhCG-treated BMDCs augmented the number of Treg cells within the T cell popula-tion. Adoptive transfer of rhCG-treated BMDCs after conception did not influence pregnancy outcome. However, transfer of hCG-treated BMDCs prior to mating had a protective effect on pregnancy. This positive effect was accompanied by increased Treg cell numbers and decidual IL-10 and TGF-β expression. Our results unveil the importance of hCG in retaining DCs in a tolerogenic state, thereby promoting Treg cell increment and supporting fetal survival.

  17. Immune Modulatory Effects of Human Chorionic Gonadotropin on Dendritic Cells Supporting Fetal Survival in Murine Pregnancy

    Science.gov (United States)

    Dauven, Dominique; Ehrentraut, Stefanie; Langwisch, Stefanie; Zenclussen, Ana Claudia; Schumacher, Anne

    2016-01-01

    Dendritic cells (DCs) are critically involved in the determination of immunity vs. tolerance. Hence, DCs are key regulators of immune responses either favoring or disfavoring fetal survival. Several factors were proposed to modulate DC phenotype and function during pregnancy. Here, we studied whether the pregnancy hormone human chorionic gonadotropin (hCG) is involved in DC regulation. In vitro, bone marrow-derived DCs (BMDCs) were stimulated in the presence or absence of urine-purified or recombinant hCG (rhCG) preparations. Subsequently, BMDC maturation was assessed. Cytokine secretion of activated BMDCs and their capability to enforce TH1, TH2, TH17, or Treg cell differentiation was determined after rhCG treatment. Moreover, the in vivo potential of hCG-modulated BMDCs to influence pregnancy outcome, Treg cell number, and local cytokine expression was evaluated after adoptive transfer in a murine abortion-prone model before and after conception. Both hCG preparations impaired the maturation process of BMDCs. rhCG treatment did neither alter cytokine secretion by BMDCs nor their ability to drive TH1, TH2, or TH17 differentiation. rhCG-treated BMDCs augmented the number of Treg cells within the T cell population. Adoptive transfer of rhCG-treated BMDCs after conception did not influence pregnancy outcome. However, transfer of hCG-treated BMDCs prior to mating had a protective effect on pregnancy. This positive effect was accompanied by increased Treg cell numbers and decidual IL-10 and TGF-β expression. Our results unveil the importance of hCG in retaining DCs in a tolerogenic state, thereby promoting Treg cell increment and supporting fetal survival. PMID:27895621

  18. Estimation of Extreme Response and Failure Probability of Wind Turbines under Normal Operation using Probability Density Evolution Method

    DEFF Research Database (Denmark)

    Sichani, Mahdi Teimouri; Nielsen, Søren R.K.; Liu, W. F.

    2013-01-01

    Estimation of extreme response and failure probability of structures subjected to ultimate design loads is essential for structural design of wind turbines according to the new standard IEC61400-1. This task is focused on in the present paper in virtue of probability density evolution method (PDEM......), which underlies the schemes of random vibration analysis and structural reliability assessment. The short-term rare failure probability of 5-mega-watt wind turbines, for illustrative purposes, in case of given mean wind speeds and turbulence levels is investigated through the scheme of extreme value...... distribution instead of any other approximate schemes of fitted distribution currently used in statistical extrapolation techniques. Besides, the comparative studies against the classical fitted distributions and the standard Monte Carlo techniques are carried out. Numerical results indicate that PDEM exhibits...

  19. A review of luteinising hormone and human chorionic gonadotropin when used in assisted reproductive technology.

    Science.gov (United States)

    Ezcurra, Diego; Humaidan, Peter

    2014-10-03

    Gonadotropins extracted from the urine of post-menopausal women have traditionally been used to stimulate folliculogenesis in the treatment of infertility and in assisted reproductive technology (ART). Products, such as human menopausal gonadotropin (hMG), consist not only of a mixture of the hormones, follicle-stimulating hormone (FSH), luteinising hormone (LH) and human chorionic gonadotropin (hCG), but also other biologically active contaminants, such as growth factors, binding proteins and prion proteins. The actual amount of molecular LH in hMG preparations varies considerably due to the purification process, thus hCG, mimicking LH action, is added to standardise the product. However, unlike LH, hCG plays a different role during the natural human menstrual cycle. It is secreted by the embryo and placenta, and its main role is to support implantation and pregnancy. More recently, recombinant gonadotropins (r-hFSH and r-hLH) have become available for ART therapies. Recombinant LH contains only LH molecules. In the field of reproduction there has been controversy in recent years over whether r-hLH or hCG should be used for ART. This review examines the existing evidence for molecular and functional differences between LH and hCG and assesses the clinical implications of hCG-supplemented urinary therapy compared with recombinant therapies used for ART.

  20. Structure and Function Relationship of Gonadotropin Releasing Hormone(GnRH) and its Potential Clinical Application

    Institute of Scientific and Technical Information of China (English)

    龚岳亭

    1992-01-01

    The structures of porcine, and ovine hypothalmic gonadotropin releasinghormone(GnRH) have been found to be identical It is a linear decapetide withdistinctive structural features and blocked N-and C-termini. Variants of GnRHare present in lower vertebrates (Table).

  1. Linear regression of postevacuation serum human chorionic gonadotropin concentrations predicts postmolar gestational trophoblastic neoplasia

    NARCIS (Netherlands)

    Lybol, C.; Sweep, F.C.; Ottevanger, P.B.; Massuger, L.F.A.G.; Thomas, C.M.G.

    2013-01-01

    OBJECTIVE: Currently, human chorionic gonadotropin (hCG) follow-up after evacuation of hydatidiform moles is essential to identify patients requiring chemotherapeutic treatment for gestational trophoblastic neoplasia (GTN). We propose a model based on linear regression of postevacuation serum hCG co

  2. Random mutagenesis and screening of complex glycoproteins : expression of human gonadotropins in Dictyostelium discoideum

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Grootenhuis, Peter D.J.; Blaauw, Mieke; Huisman-de Winkel, Bianca; Ravestein, Arno van; Haastert, Peter J.M. van; Heikoop, Judith C.

    1999-01-01

    The soil amoeba Dictyostelium discoideum is a host cell that provides simple genetics in combination with complex protein synthesis. We show that the complex human heterodimeric gonadotropins can be produced and secreted by this organism, Furthermore, both follicle stimulation hormone and choriogona

  3. Myth vs. Fact: The Human Chorionic Gonadotropin (hCG) Diet

    Science.gov (United States)

    ... exactly is hCG? Human chorionic gonadotropin is a hormone produced during pregnancy to help nourish the growing fetus. The U.S. Food and Drug Administration (FDA) approved hCG for a number of medical uses. ... understand that hormones are powerful and must be prescribed with caution. ...

  4. 76 FR 27888 - Implantation or Injectable Dosage Form New Animal Drugs; Gonadotropin Releasing Factor-Diphtheria...

    Science.gov (United States)

    2011-05-13

    ... drug regulations to reflect approval of a new animal drug application (NADA) filed by Pfizer, Inc. The NADA provides for the veterinary prescription use of gonadotropin releasing factor-diphtheria toxoid...-5755, filed NADA 141-322 that provides for the veterinary prescription use of IMPROVEST...

  5. 77 FR 4227 - Implantation or Injectable Dosage Form New Animal Drugs; Gonadotropin Releasing Factor Analog...

    Science.gov (United States)

    2012-01-27

    ... drug regulations to reflect approval of a supplemental new animal drug application (NADA) filed by Pfizer, Inc. The supplemental NADA extends the slaughter interval for intact male swine injected with..., filed a supplement to NADA 141-322 for IMPROVEST (gonadotropin releasing factor analog-diphtheria...

  6. [Persistence of immune memory to hepatitis B vaccine among infants with normal or high antibody response to primary vaccination: a five-year following-up study].

    Science.gov (United States)

    Zhang, Li; Yan, Bingyu; Liu, Jiaye; Lyu, Jingjing; Feng, Yi; Xu, Aiqiang; Song, Lizhi; Liang, Xiaofeng; Li, Li; Cui, Fuqiang; Zhang, Guomin; Wang, Fuzhen

    2015-12-01

    To examine the immune memory status to hepatitis B vaccine among infants with normal or high antibody response to primary vaccination, 5 years after the primary vaccination and the risk factors associated with the immune memory. Titers of the antibody against hepatitis B surface antigen (anti-HBs) were detected, five years after the primary vaccination among children who appeared normal or high response to hepatitis B primary vaccination in infancy. Those whose anti-HBs titers were low than protective level (10 mIU/ml) were given a challenge dose of hepatitis B vaccine and titers of anti-HBs were detected 14 days after the challenge. Positive rate and geometric mean titer (GMT) of anti-HBs were calculated. Level of the anti-HBs titers after primary vaccination, at following-up and after the challenge periods were divided into different levels, respectively. Risk factors associated with the levels of anti-HBs titer after the challenge were examined by univariate analysis that and multivariable analysis. Anti-HBs waned to the level below protective standard among 37.98% of the children with normal or high antibody response to hepatitis B primary vaccination; among those children whose anti-HBs were below the protection standard. The seroconversion rate and GMT of anti-HBs after the challenge dose were 98.95% (757/765) and 2 811.69 mIU/ml [95% Confidence Interval (CI) :2 513.55-3 145.19 mIU/ml] , respectively. Titers and levels of anti-HBs after the challenge, appeared an increase with anti-HBs after primary vaccination and the anti-HBs in the following-up (F=5.46, 10.23 respectively; Pimmune memory could be found among those children with normal or high responses to hepatitis B vaccination, 5 years after the primary vaccination. The intensity of immune memory might be associated with the anti-HBs titer after primary vaccination as well as the anti-HBs titers before the challenge dose was given.

  7. Concomitant intramuscular human chorionic gonadotropin preserves spermatogenesis in men undergoing testosterone replacement therapy.

    Science.gov (United States)

    Hsieh, Tung-Chin; Pastuszak, Alexander W; Hwang, Kathleen; Lipshultz, Larry I

    2013-02-01

    Testosterone replacement therapy results in decreased serum gonadotropins and intratesticular testosterone, and impairs spermatogenesis, leading to azoospermia in 40% of patients. However, intratesticular testosterone can be maintained during testosterone replacement therapy with co-administration of low dose human chorionic gonadotropin, which may support continued spermatogenesis in patients on testosterone replacement therapy. We retrospectively reviewed the records of hypogonadal men treated with testosterone replacement therapy and concomitant low dose human chorionic gonadotropin. Testosterone replacement consisted of daily topical gel or weekly intramuscular injection with intramuscular human chorionic gonadotropin (500 IU) every other day. Serum and free testosterone, estradiol, semen parameters and pregnancy rates were evaluated before and during therapy. A total of 26 men with a mean age of 35.9 years were included in the study. Mean followup was 6.2 months. Of the men 19 were treated with injectable testosterone and 7 were treated with transdermal gel. Mean serum hormone levels before vs during treatment were testosterone 207.2 vs 1,055.5 ng/dl (p testosterone 8.1 vs 20.4 pg/ml (p = 0.02) and estradiol 2.2 vs 3.7 pg/ml (p = 0.11). Pretreatment semen parameters were volume 2.9 ml, density 35.2 million per ml, motility 49.0% and forward progression 2.3. No differences in semen parameters were observed during greater than 1 year of followup. No impact on semen parameters was observed as a function of testosterone formulation. No patient became azoospermic during concomitant testosterone replacement and human chorionic gonadotropin therapy. Nine of 26 men contributed to pregnancy with the partner during followup. Low dose human chorionic gonadotropin appears to maintain semen parameters in hypogonadal men on testosterone replacement therapy. Concurrent testosterone replacement and human chorionic gonadotropin use may preserve fertility in hypogonadal males

  8. Cigarette smoke induces endoplasmic reticulum stress and the unfolded protein response in normal and malignant human lung cells

    Directory of Open Access Journals (Sweden)

    Yang Jin

    2008-08-01

    Full Text Available Abstract Background Although lung cancer is among the few malignancies for which we know the primary etiological agent (i.e., cigarette smoke, a precise understanding of the temporal sequence of events that drive tumor progression remains elusive. In addition to finding that cigarette smoke (CS impacts the functioning of key pathways with significant roles in redox homeostasis, xenobiotic detoxification, cell cycle control, and endoplasmic reticulum (ER functioning, our data highlighted a defensive role for the unfolded protein response (UPR program. The UPR promotes cell survival by reducing the accumulation of aberrantly folded proteins through translation arrest, production of chaperone proteins, and increased degradation. Importance of the UPR in maintaining tissue health is evidenced by the fact that a chronic increase in defective protein structures plays a pathogenic role in diabetes, cardiovascular disease, Alzheimer's and Parkinson's syndromes, and cancer. Methods Gene and protein expression changes in CS exposed human cell cultures were monitored by high-density microarrays and Western blot analysis. Tissue arrays containing samples from 110 lung cancers were probed with antibodies to proteins of interest using immunohistochemistry. Results We show that: 1 CS induces ER stress and activates components of the UPR; 2 reactive species in CS that promote oxidative stress are primarily responsible for UPR activation; 3 CS exposure results in increased expression of several genes with significant roles in attenuating oxidative stress; and 4 several major UPR regulators are increased either in expression (i.e., BiP and eIF2α or phosphorylation (i.e., phospho-eIF2α in a majority of human lung cancers. Conclusion These data indicate that chronic ER stress and recruitment of one or more UPR effector arms upon exposure to CS may play a pivotal role in the etiology or progression of lung cancers, and that phospho-eIF2α and BiP may have

  9. Seasonal differences in the parameters of luteinizing hormone release to exogenous gonadotropin releasing hormone in prepubertal Holstein heifers in Sapporo.

    Science.gov (United States)

    Kadokawa, Hiroya

    2007-02-01

    Stress due to summer heat has adverse effects on reproduction in Holstein dairy cattle. Summer suppression of reproduction of Holsteins can pose an important economic problem, even in Hokkaido prefecture located in the northern region of Japan. Hokkaido is one of the most important dairy farming areas of Japan. This study is an attempt to clarify the seasonal differences in the parameters of luteinizing hormone (LH) response to exogenous gonadotropin releasing hormone (GnRH) in Sapporo, Hokkaido, Japan. A total of 12 prepubertal heifers received an injection with GnRH analogue intramuscularly in either May (n=4, May group), July (n=4, July group), or November (n=4, November group), and serial blood samples were collected to analyze the parameters of the LH response curve after GnRH injection. The parameters were as follows: the basal LH concentration, peak LH concentration, duration from the time of GnRH injection to the time of the peak LH concentration, and area under the LH response curve (AUC). There were no significant differences in the basal and peak LH concentrations or the AUC among the three groups. The July group reached the LH peak significantly (P<0.05) faster than the May group, but there was no significant difference with the November group. Therefore, the results of the present study do not demonstrate an effect of summer heat on the LH response to the exogenous GnRH in Holstein heifers.

  10. Dynamical response of the "GGG" rotor to test the Equivalence Principle: theory, simulation and experiment. Part I: the normal modes

    CERN Document Server

    Comandi, G L; Chiofalo, M L; Nobili, A M; Polacco, E; Toncelli, R

    2006-01-01

    Recent theoretical work suggests that violation of the Equivalence Principle might be revealed in a measurement of the fractional differential acceleration $\\eta$ between two test bodies -of different composition, falling in the gravitational field of a source mass- if the measurement is made to the level of $\\eta\\simeq 10^{-13}$ or better. This being within the reach of ground based experiments, gives them a new impetus. However, while slowly rotating torsion balances in ground laboratories are close to reaching this level, only an experiment performed in low orbit around the Earth is likely to provide a much better accuracy. We report on the progress made with the "Galileo Galilei on the Ground" (GGG) experiment, which aims to compete with torsion balances using an instrument design also capable of being converted into a much higher sensitivity space test. In the present and following paper (Part I and Part II), we demonstrate that the dynamical response of the GGG differential accelerometer set into superc...

  11. The DNA damage response: a common pathway in the regulation of NKG2D and DNAM-1 ligand expression in normal, infected and cancer cells.

    Directory of Open Access Journals (Sweden)

    Cristina eCerboni

    2014-01-01

    Full Text Available NKG2D and DNAM-1 are two activating receptors, present on the surface of NK cells and other cells of the immune system. Their ligands – MICA, MICB, ULBP1-6 for NKG2D, PVR/CD155 and Nectin-2/CD112 for DNAM-1 - can be constitutively expressed at low levels in some normal cells, but they are more often defined as stress-induced, since different stimuli can positively regulate their expression. In this review, we describe the molecular mechanisms involved in the up-regulation of NKG2D and DNAM-1 ligands under different physiological and pathological stress conditions, including mitosis, viral infections, and cancer. We will focus on the DNA damage response, as recent advances in the field have uncovered its important role as a common signaling pathway in the regulation of both NKG2D and DNAM-1 ligand expression in response to very diverse conditions and stimuli.

  12. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for comput

  13. Etiology and therapeutic outcomes of children with gonadotropin-independent precocious puberty

    Science.gov (United States)

    Kang, Eungu; Cho, Ja Hyang; Choi, Jin-Ho

    2016-01-01

    Purpose This study was performed to investigate the etiology, clinical features, and outcomes of patients with gonadotropin-independent precocious puberty (GIPP). Methods The study included 16 patients (14 female and 2 male patients) who manifested secondary sexual characteristics, elevated sex hormones, or adrenal androgens with prepubertal luteinizing hormone levels after gonadotropin releasing hormone stimulation diagnosed between May 1994 and December 2015. Patients with congenital adrenal hyperplasia were excluded. Clinical features, laboratory findings, treatment modalities, and outcomes were retrospectively reviewed. Results The median age at diagnosis was 2.6 years (range, 0.7–7.9 years) and median follow-up duration was 4.6 years (range, 1 month–9.8 years). Patients with McCune-Albright syndrome (n=5) and functional ovarian cysts (n=4) presented with vaginal bleeding and elevated estradiol levels (23.3±17.5 pg/mL); adrenocortical tumors (n=4) with premature pubarche and elevated dehydroepiandrosterone sulfate levels (87.2–6,530 µg/dL); and human chorionic gonadotropin (hCG)-producing tumor (n=1) with premature pubarche and elevated β-human chorionic gonadotropin levels (47.4 mIU/mL). Two patients were idiopathic. Six patients transited to gonadotropin-dependent precocious puberty median 3.3 years (range, 0.3–5.1 years) after the onset of GIPP. Initial and follow-up height standard deviation scores (0.99±0.84 vs. 1.10±1.10, P=0.44) and bone age advancement (1.49±1.77 years vs. 2.02±1.95 years, P=0.06) were not significantly different. Conclusion The etiologies of GIPP are heterogeneous, and treatment and prognosis is quite different according to the etiology. Efficacy of treatment with aromatase inhibitors needs to be evaluated after long-term follow-up. PMID:27777905

  14. Salt-tolerant and -sensitive alfalfa (Medicago sativa) cultivars have large variations in defense responses to the lepidopteran insect Spodoptera litura under normal and salt stress condition.

    Science.gov (United States)

    Lei, Yunting; Liu, Qing; Hettenhausen, Christian; Cao, Guoyan; Tan, Qing; Zhao, Weiye; Lin, Honghui; Wu, Jianqiang

    2017-01-01

    In nature, plants are often exposed to multiple stress factors at the same time. Yet, little is known about how plants modulate their physiology to counteract simultaneous abiotic and biotic stresses, such as soil salinity and insect herbivory. In this study, insect performance bioassays, phytohormone measurements, quantification of transcripts, and protein determination were employed to study the phenotypic variations of two alfalfa (Medicago sativa) cultivars in response to insect Spodoptera litura feeding under normal and salt stress condition. When being cultivated in normal soil, the salt-tolerant alfalfa cultivar Zhongmu-1 exhibited lower insect resistance than did the salt-sensitive cultivar Xinjiang Daye. Under salinity stress, the defense responses of Xinjiang Daye were repressed, whereas Zhongmu-1 did not show changes in resistance levels. It is likely that salinity influenced the resistance of Xinjiang Daye through suppressing the accumulation of jasmonic acid-isoleucine (JA-Ile), which is the bioactive hormone inducing herbivore defense responses, leading to attenuated trypsin proteinase inhibitor (TPI) activity. Furthermore, exogenous ABA supplementation suppressed the insect herbivory-induced JA/JA-Ile accumulation and levels of JAR1 (jasmonate resistant 1) and TPI, and further decreased the resistance of Xinjiang Daye, whereas Zhongmu-1 showed very little response to the increased ABA level. We propose a mechanism, in which high levels of abscisic acid induced by salt treatment may affect the expression levels of JAR1 and consequently decrease JA-Ile accumulation and thus partly suppress the defense of Xinjiang Daye against insects under salt stress. This study provides new insight into the mechanism by which alfalfa responds to concurrent abiotic and biotic stresses.

  15. Salt-tolerant and -sensitive alfalfa (Medicago sativa) cultivars have large variations in defense responses to the lepidopteran insect Spodoptera litura under normal and salt stress condition

    Science.gov (United States)

    Lei, Yunting; Liu, Qing; Hettenhausen, Christian; Cao, Guoyan; Tan, Qing; Zhao, Weiye; Lin, Honghui

    2017-01-01

    In nature, plants are often exposed to multiple stress factors at the same time. Yet, little is known about how plants modulate their physiology to counteract simultaneous abiotic and biotic stresses, such as soil salinity and insect herbivory. In this study, insect performance bioassays, phytohormone measurements, quantification of transcripts, and protein determination were employed to study the phenotypic variations of two alfalfa (Medicago sativa) cultivars in response to insect Spodoptera litura feeding under normal and salt stress condition. When being cultivated in normal soil, the salt-tolerant alfalfa cultivar Zhongmu-1 exhibited lower insect resistance than did the salt-sensitive cultivar Xinjiang Daye. Under salinity stress, the defense responses of Xinjiang Daye were repressed, whereas Zhongmu-1 did not show changes in resistance levels. It is likely that salinity influenced the resistance of Xinjiang Daye through suppressing the accumulation of jasmonic acid-isoleucine (JA-Ile), which is the bioactive hormone inducing herbivore defense responses, leading to attenuated trypsin proteinase inhibitor (TPI) activity. Furthermore, exogenous ABA supplementation suppressed the insect herbivory-induced JA/JA-Ile accumulation and levels of JAR1 (jasmonate resistant 1) and TPI, and further decreased the resistance of Xinjiang Daye, whereas Zhongmu-1 showed very little response to the increased ABA level. We propose a mechanism, in which high levels of abscisic acid induced by salt treatment may affect the expression levels of JAR1 and consequently decrease JA-Ile accumulation and thus partly suppress the defense of Xinjiang Daye against insects under salt stress. This study provides new insight into the mechanism by which alfalfa responds to concurrent abiotic and biotic stresses. PMID:28719628

  16. Specificity of Tumor Necrosis Factor Toxicity for Human Mammary Carcinomas Relative to Normal Mammary Epithelium and Correlation with Response to Doxorubicin

    Science.gov (United States)

    Dollbaum, Charles; Creasey, Abla A.; Dairkee, Shahnaz H.; Hiller, Alan J.; Rudolph, Alfred R.; Lin, Leo; Vitt, Charles; Smith, Helene S.

    1988-07-01

    By using a unique short-term culture system capable of growing both normal and malignant breast epithelial tissue, human recombinant tumor necrosis factor (TNF) showed preferential cytotoxicity to malignant cells as compared to the corresponding nonmalignant cells. Most of the malignant specimens were sensitive to TNF with 13 of 18 specimens showing 90% inhibition of clonal growth (ID90) by TNF per ml of culture fluid. In contrast, all 13 nonmalignant specimens tested clustered at the resistant end of the TNF response spectrum, with ID90 values being >5000 units of TNF per ml of culture fluid. This differential sensitivity to TNF was seen in three cases in which malignant and nonmalignant breast epithelial tissues from the same patient were studied. To investigate the mechanism of resistance to TNF by normal cells, the presence of receptors for TNF was determined. Five of six cultures showed specific binding of 125I-labeled TNF and there was no relationship between the degree of resistance and the degree of specific binding. Simultaneous comparison of tumor responsiveness to doxorubicin and TNF revealed a positive correlation in ID90 values; these results may have important implications for the clinical use of TNF in cancer patients heavily pretreated with doxorubicin.

  17. BIM-23A760 influences key functional endpoints in pituitary adenomas and normal pituitaries: molecular mechanisms underlying the differential response in adenomas.

    Science.gov (United States)

    Ibáñez-Costa, Alejandro; López-Sánchez, Laura M; Gahete, Manuel D; Rivero-Cortés, Esther; Vázquez-Borrego, Mari C; Gálvez, María A; de la Riva, Andrés; Venegas-Moreno, Eva; Jiménez-Reina, Luis; Moreno-Carazo, Alberto; Tinahones, Francisco J; Maraver-Selfa, Silvia; Japón, Miguel A; García-Arnés, Juan A; Soto-Moreno, Alfonso; Webb, Susan M; Kineman, Rhonda D; Culler, Michael D; Castaño, Justo P; Luque, Raúl M

    2017-02-09

    Chimeric somatostatin/dopamine compounds such as BIM-23A760, an sst2/sst5/D2 receptors-agonist, have emerged as promising new approaches to treat pituitary adenomas. However, information on direct in vitro effects of BIM-23A760 in normal and tumoral pituitaries remains incomplete. The objective of this study was to analyze BIM-23A760 effects on functional parameters (Ca(2+) signaling, hormone expression/secretion, cell viability and apoptosis) in pituitary adenomas (n = 74), and to compare with the responses of normal primate and human pituitaries (n = 3-5). Primate and human normal pituitaries exhibited similar sst2/sst5/D2 expression patterns, wherein BIM-23A760 inhibited the expression/secretion of several pituitary hormones (specially GH/PRL), which was accompanied by increased sst2/sst5/D2 expression in primates and decreased Ca(2+) concentration in human cells. In tumoral pituitaries, BIM-23A760 also inhibited Ca(2+) concentration, hormone secretion/expression and proliferation. However, BIM-23A760 elicited stimulatory effects in a subset of GHomas, ACTHomas and NFPAs in terms of Ca(2+) signaling and/or hormone secretion, which was associated with the relative somatostatin/dopamine-receptors levels, especially sst5 and sst5TMD4. The chimeric sst2/sst5/D2 compound BIM-23A760 affects multiple, clinically relevant parameters on pituitary adenomas and may represent a valuable therapeutic tool. The relative ssts/D2 expression profile, particularly sst5 and/or sst5TMD4 levels, might represent useful molecular markers to predict the ultimate response of pituitary adenomas to BIM-23A760.

  18. BIM-23A760 influences key functional endpoints in pituitary adenomas and normal pituitaries: molecular mechanisms underlying the differential response in adenomas

    Science.gov (United States)

    Ibáñez-Costa, Alejandro; López-Sánchez, Laura M.; Gahete, Manuel D.; Rivero-Cortés, Esther; Vázquez-Borrego, Mari C.; Gálvez, María A.; de la Riva, Andrés; Venegas-Moreno, Eva; Jiménez-Reina, Luis; Moreno-Carazo, Alberto; Tinahones, Francisco J.; Maraver-Selfa, Silvia; Japón, Miguel A.; García-Arnés, Juan A.; Soto-Moreno, Alfonso; Webb, Susan M.; Kineman, Rhonda D.; Culler, Michael D.; Castaño, Justo P.; Luque, Raúl M.

    2017-01-01

    Chimeric somatostatin/dopamine compounds such as BIM-23A760, an sst2/sst5/D2 receptors-agonist, have emerged as promising new approaches to treat pituitary adenomas. However, information on direct in vitro effects of BIM-23A760 in normal and tumoral pituitaries remains incomplete. The objective of this study was to analyze BIM-23A760 effects on functional parameters (Ca2+ signaling, hormone expression/secretion, cell viability and apoptosis) in pituitary adenomas (n = 74), and to compare with the responses of normal primate and human pituitaries (n = 3–5). Primate and human normal pituitaries exhibited similar sst2/sst5/D2 expression patterns, wherein BIM-23A760 inhibited the expression/secretion of several pituitary hormones (specially GH/PRL), which was accompanied by increased sst2/sst5/D2 expression in primates and decreased Ca2+ concentration in human cells. In tumoral pituitaries, BIM-23A760 also inhibited Ca2+ concentration, hormone secretion/expression and proliferation. However, BIM-23A760 elicited stimulatory effects in a subset of GHomas, ACTHomas and NFPAs in terms of Ca2+ signaling and/or hormone secretion, which was associated with the relative somatostatin/dopamine-receptors levels, especially sst5 and sst5TMD4. The chimeric sst2/sst5/D2 compound BIM-23A760 affects multiple, clinically relevant parameters on pituitary adenomas and may represent a valuable therapeutic tool. The relative ssts/D2 expression profile, particularly sst5 and/or sst5TMD4 levels, might represent useful molecular markers to predict the ultimate response of pituitary adenomas to BIM-23A760. PMID:28181484

  19. A Dose-Response Strategy Reveals Differences between Normal-Weight and Obese Men in Their Metabolic and Inflammatory Responses to a High-Fat Meal 1 2 3

    OpenAIRE

    Schwander, Flurina; Kopf-Bolanz, Katrin A.; Buri, Caroline; Portmann, Reto; Egger, Lotti; Chollet, Magali; McTernan, Philip G.; Piya, Milan K.; Gijs, Martin A. M.; Vionnet, Nathalie; Pralong, François; Laederach, Kurt; Vergères, Guy

    2014-01-01

    A dose-response strategy may not only allow investigation of the impact of foods and nutrients on human health but may also reveal differences in the response of individuals to food ingestion based on their metabolic health status. In a randomized crossover study, we challenged 19 normal-weight (BMI: 20–25 kg/m2) and 18 obese (BMI: >30 kg/m2) men with 500, 1000, and 1500 kcal of a high-fat (HF) meal (60.5% energy from fat). Blood was taken at baseline and up to 6 h postprandially and analyzed...

  20. Delayed-type hypersensitivity (DTH test anergy does not impact CD4 reconstitution or normalization of DTH responses during antiretroviral therapy

    Directory of Open Access Journals (Sweden)

    Natascha M Minidis

    2014-02-01

    Full Text Available Introduction: Delayed-type hypersensitivity (DTH testing is an in vivo assessment of cell-mediated immunity. Although highly active antiretroviral therapy (HAART improves immunologic parameters, the relationship between DTH responsiveness and CD4 gains on HAART is not completely understood. We investigated CD4 reconstitution and the change in DTH responses from treatment baseline through 24 months of viral load (VL-suppressive HAART in the U.S. Military HIV Natural History Study. Methods: Treatment-naïve subjects with VL <400 copies/mL after ≥24 months on HAART were included (n=302. DTH testing consisted of ≥3 recall antigens, and responses were classified by the number of positive skin tests: anergic (0–1 or non-anergic (≥2. Pre-HAART DTH results were compared for the outcome of CD4 reconstitution at 24 months of HAART. Improvement in DTH responses was also analyzed for those anergic before HAART initiation. Results: Non-anergic responses were observed in 216 (72% participants, while 86 (28% individuals were anergic prior to HAART initiation. Demographically there were similar distributions of age at HIV diagnosis and HAART initiation, as well as gender and race or ethnicity. There were no significant differences between non-anergic and anergic participants in pre-HAART CD4 count (409 cells/μL, interquartile range (IQR 315–517 vs. 373 cells/μL, IQR 228–487; p=0.104 and VL (4.3 log10 copies/mL, IQR 3.4–4.9 vs. 4.4 log10 copies/mL, IQR 3.6–5.0; p=0.292. Median CD4 gains 24 months after HAART initiation were similar between the non-anergic (220 cells/μL, IQR 115–358 and anergic groups (246 cells/μL, IQR 136–358; p=0.498. For individuals anergic before HAART initiation, DTH normalization occurred at 24 months post-HAART in the majority of participants (51 of 86, 59%. Normalization of DTH responses was not associated with CD4 count at HAART initiation (OR 0.73, 95% CI 0.47, 1.09 per 100 cells; p=0.129 nor with AIDS diagnoses

  1. {sup 99m}Tc-sestamibi muscle scintigraphy to assess the response to neuromuscular electrical stimulation of normal quadriceps femoris muscle

    Energy Technology Data Exchange (ETDEWEB)

    Pekindil, Y.; Sarikaya, A.; Birtane, M.; Pekindil, G.; Salan, A. [Trakya Univ., Edirne (Turkey). Hospital

    2001-08-01

    Neuromuscular electrical stimulation (NMES) is widely used for improving muscle strength by simultaneous contraction in the prevention of muscle atrophy. Although there exist many clinical methods for evaluating the therapeutic response of muscles, {sup 99m}Tc-sestamibi which is a skeletal muscle perfusion and metabolism agent has not previously been used for this purpose. The aim of our work was to ascertain whether {sup 99m}Tc-sestamibi muscle scintigraphy is useful in the monitoring of therapeutic response to NMES in healthy women. The study included 16 women aged between 21 and 45, with a mean age of 32.7{+-}6.4. Both quadriceps femoris muscles (QFM) of each patient were studied. After randomization to remove the effect of the dominant side, one QFM of each patient was subjected to the NMES procedure for a period of 20 days. NMES was performed with an alternating biphasic rectangular current, from a computed electrical stimulator daily for 23 minutes. After measurement of skinfold thickness over the thigh, pre- and post-NMES girth measurements were assessed in centimeters. Sixty minutes after injections of 555 MBq {sup 99m}Tc-sestamibi, static images of the thigh were obtained for 5 minutes. The thigh-to-knee uptake ratio was calculated by semiquantitative analysis and normalized to body surface area (NUR=normalized uptake ratio). The difference between the pre and post NMES NUR values was significant (1.76{+-}0.31 versus 2.25{+-}0.38, p=0.0000). The percentage (%) increase in NUR values also well correlated with the % increase in thigh girth measurements (r=0.89, p=0.0000). These results indicated that {sup 99m}Tc-sestamibi muscle scintigraphy as a new tool may be useful in evaluating therapeutic response to NMES. (author)

  2. Response of right ventricular size, function, and pressure to supine exercise: a comparison of patients with chronic obstructive lung disease and normal subjects

    Energy Technology Data Exchange (ETDEWEB)

    Slutsky, R.; Hooper, W.; Ackerman, W.; Moser, K.

    1982-12-01

    The response of right ventricular ejection fraction (RVEF) and right ventricular end-diastolic volume (RVEDV) to exercise was studied in 11 patients with severe (FEV/sub 25/sub(%)sub(-)/sub 75/sub(%)=0.32+-0.13, mean+-SD) chronic obstructive pulmonary disease (COPD). Using gated radionuclide cardiac blood pool imaging techniques, the response of the patients with COPD was compared with that of 15 control subjects. Arterial blood gases, pulmonary arterial pressures, wedge pressure, and right ventricular pressures also were monitored in patients with COPD. The resting RVEF was lower and the resting RVEDV was higher in patients with COPD than in normals (both, P<0.01). Two of the 11 COPD patients had a RVEF during rest that was below lower limits, while 10 of 11 patients had RV dilation. Right ventricular end-diastolic pressure, measured during rest in patients with COPD, was normal (6.1+-2.1 mm Hg) and cardiac index was within normal limits (3.55+-0.82 l/min/m/sup 2/). With exercise this cardiac index rose to 5.52+-1.7/min/m/sup 2/(P<0.01) due to the increase in heart rate (83+-18 to 125+-25 beats/min; P<0.01) while stroke volume did not significantly change. During exercise, normal subjects showed an increase in RVEF while RVEDV did not change; in patients with COPD, the RVEF fell and the RVEDV increased. In the patients with COPD, mild resting arterial hypoxemia and hypercapnia were both exaggerated during exercise; and mild resting pulmonary arterial hypertension (PAm=24.3+-7.65 mm Hg) also worsened with exercise (PAm=41+-19 mm Hg, P<0.01). Correlation between change in RVEF and PAm was -0.58, and between change in RVEDV and PAm was 0.63. We conclude that patients with severe COPD often have right ventricular dilation at rest and commonly respond to supine exercise with a fall in FV ejection fraction and further dilation of the right ventricle.

  3. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  4. Review: Gonadotropin-inhibitory hormone action in the brain and pituitary

    Directory of Open Access Journals (Sweden)

    Takayoshi eUbuka

    2012-11-01

    Full Text Available Gonadotropin-inhibitory hormone (GnIH was first identified in the Japanese quail as a hypothalamic neuropeptide inhibitor of gonadotropin secretion. Subsequent studies have shown that GnIH is present in the brains of birds including songbirds, and mammals including humans. The identified avian and mammalian GnIH peptides universally possess an LPXRFamide (X = L or Q motif at their C-termini. Mammalian GnIH peptides are also designated as RFamide-related peptides from their structures. The receptor for GnIH is the G protein-coupled receptor 147 (GPR147, which is thought to be coupled to Gαi protein. Cell bodies of GnIH neurons are located in the paraventricular nucleus (PVN in birds and the dorsomedial hypothalamic area (DMH in mammals. GnIH neurons in the PVN or DMH project to the median eminence to control anterior pituitary function. GPR147 is expressed in the gonadotropes and GnIH suppresses synthesis and release of gonadotropins. It was further shown in immortalized mouse gonadotrope cell line (LT2 cells that GnIH inhibits gonadotropin-releasing hormone (GnRH induced gonadotropin subunit gene transcriptions by inhibiting adenylate cyclase/cAMP/PKA dependent ERK pathway. GnIH neurons also project to GnRH neurons in the preoptic area, and GnRH neurons express GPR147 in birds and mammals. Accordingly, GnIH may inhibit gonadotropin synthesis and release by decreasing the activity of GnRH neurons as well as directly acting on the gonadotropes. GnIH also inhibits reproductive behavior possibly by acting within the brain. GnIH expression is regulated by a nocturnal hormone melatonin and stress in birds and mammals. Accordingly, GnIH may play a role in translating environmental information to inhibit reproductive physiology and behavior of birds and mammals. Finally, GnIH has therapeutic potential in the treatment of reproductive cycle and hormone-dependent diseases, such as precocious puberty, endometriosis, uterine fibroids, and prostatic and

  5. Molecular cloning of pituitary glycoprotein alpha-subunit and follicle stimulating hormone and chorionic gonadotropin beta-subunits from New World squirrel monkey and owl monkey.

    Science.gov (United States)

    Scammell, Jonathan G; Funkhouser, Jane D; Moyer, Felricia S; Gibson, Susan V; Willis, Donna L

    2008-02-01

    The goal of this study was to characterize the gonadotropins expressed in pituitary glands of the New World squirrel monkey (Saimiri sp.) and owl monkey (Aotus sp.). The various subunits were amplified from total RNA from squirrel monkey and owl monkey pituitary glands by reverse transcription-polymerase chain reaction and the deduced amino acid sequences compared to those of other species. Mature squirrel monkey and owl monkey glycoprotein hormone alpha-polypeptides (96 amino acids in length) were determined to be 80% homologous to the human sequence. The sequences of mature beta subunits of follicle stimulating hormone (FSHbeta) from squirrel monkey and owl monkey (111 amino acids in length) are 92% homologous to human FSHbeta. New World primate glycoprotein hormone alpha-polypeptides and FSHbeta subunits showed conservation of all cysteine residues and consensus N-linked glycosylation sites. Attempts to amplify the beta-subunit of luteinizing hormone from squirrel monkey and owl monkey pituitary glands were unsuccessful. Rather, the beta-subunit of chorionic gonadotropin (CG) was amplified from pituitaries of both New World primates. Squirrel monkey and owl monkey CGbeta are 143 and 144 amino acids in length and 77% homologous with human CGbeta. The greatest divergence is in the C terminus, where all four sites for O-linked glycosylation in human CGbeta, responsible for delayed metabolic clearance, are predicted to be absent in New World primate CGbetas. It is likely that CG secreted from pituitary of New World primates exhibits a relatively short half-life compared to human CG.

  6. Correlation between Seminal Fluid Analysis and Levels of Gonadotropins in Serum and Seminal Plasma of Normozoospermic Men and Infertile Patients

    Directory of Open Access Journals (Sweden)

    Muhammad Baqir MR Fakhrildin

    2007-01-01

    Full Text Available Background: Levels of serum gonadotropins have direct effects on testicular functions and spermatogenesis. Assessment of levels of serum gonadotropins from fathered subjects and infertile patients indicates wide range diversity. In this study, we tried to find out whether the levels of seminal FSH and LH affect the parameters of seminal fluid analysis (SFA and if there is any correlation between levels of serum FSH and LH in healthy men and infertile patients.Materials and Methods: Levels of FSH and LH in serum and seminal plasma were assessed randomly, in addition to examination of seminal fluid analysis from 12 normozoospermic subjects (age range: 33-56 years and 66 infertile patients (age range: 20-62 years with duration of infertility (15-201 months. Macroscopic and microscopic parameters of semen specimens were determined. Data were statistically analyzed using multiple correlation and regression, and MANOVA tests.Results: Result of the present study observed significant positive correlation between FSH levels in serum and seminal plasma (r=0.984; p<0.001 of normozoospermic subjects as compared to other groups of infertile patients. No correlations were noticed between LH levels in serum and seminal plasma of normozoospermic subjects and groups of infertile patients. Significant and positive correlation was assessed between sperm concentration and levels of seminal FSH (r=0.822; p<0.05 and r=0.940; p<0.01 and seminal LH (r=0.989; p<0.001 and r=0.999; p<0.001 of asthenozoospermic and OAT patients respectively. In asthenozoospermic patients, significant and positive correlations were observed between seminal FSH and percentages of sperm motility, progressive motility, sperm normal morphology and total progressive motile sperm/ejaculate.Conclusion: This study shows a strong association and effect between seminal FSH and serum FSH and parameters of SFA for normozoospermic men and different groups of infertile patients. These finding may call

  7. A 15-year-old female with amenorrhea, abdominal distention, and elevated human chorionic gonadotropin: pregnancy, right? Not so fast….

    Science.gov (United States)

    Aggarwal, Arun; Ocon, Anthony J; Nibhanipudi, Kumara

    2012-10-01

    Nongestational choriocarcinoma, a rare ovarian tumor, may present in young women with amenorrhea, abdominal distention, and elevated urine human chorionic gonadotropin (hCG), all of which may be mistaken for pregnancy. A 15-year-old Hispanic female, who reported no sexual activity, presented with 6 months of amenorrhea, abdominal pain, and progressive abdominal distension. Initially, suspicion of pregnancy was considered. Physical examination was significant for abdominal distension, but no uterine fundus or fetal anatomy could be palpated, and auscultation did not reveal any fetal heart sounds or bruits. Laboratory values showed elevated urine hCG, cancer antigen 125, and cancer antigen 19.9 levels but normal serum hCG level and was inconsistent with pregnancy. Computed tomographic scans revealed a large abdominal heterogeneous mass and pleural effusions. Salpingo-oophorectomy with total omentectomy and inversion appendectomy removed a 21 × 20.5 × 16.5-cm tumor. Pathological testing determined it to be a nongestational choriocarcinoma. This rare tumor is more common in the pediatric adolescent population than in adults. Surgical resection and chemotherapy often result in a positive prognosis. In female adolescent patients presenting with elevated hCG level, amenorrhea, and abdominal distention, choriocarcinoma should be considered, especially in those with no history of sexual activity or before menarche.

  8. Treatment of idiopathic short stature: effects of gonadotropin-releasing hormone analogs, aromatase inhibitors and anabolic steroids.

    Science.gov (United States)

    Dunkel, Leo

    2011-01-01

    Modulation of sex steroid action on the growth plate can, at least theoretically, increase adult height in children and adolescents with idiopathic short stature. Gonadotropin-releasing hormone (GnRH) analog therapy during adolescence has been shown effective in a placebo-controlled study, but to obtain clinically significant increases in adult height, the treatment duration must be lengthy (several years). Furthermore, such treatment seems to compromise bone health and, because of the resulting delay in pubertal development, likely has psychosocial consequences. Therefore, GnRH analogs are no longer recommended to augment height in adolescents with short stature and normally timed puberty. Aromatase inhibitors are probably more effective than GnRH analogs in promoting increased adult height in children with short stature and, unlike GnRH analogs, do not delay pubertal development in males. However, due to a dearth of safety data with aromatase inhibitors for the treatment of short stature, their use outside a research setting is currently not recommended. Positive effects of anabolic steroids on adult height have not been documented.

  9. Effects of a gonadotropin-releasing hormone vaccine on ovarian cyclicity and uterine morphology of an Asian elephant (Elephas maximus).

    Science.gov (United States)

    Boedeker, Nancy C; Hayek, Lee-Ann C; Murray, Suzan; de Avila, David M; Brown, Janine L

    2012-09-01

    This report describes the successful use of a gonadotropin-releasing hormone (GnRH) vaccine to suppress ovarian steroidogenic activity and to treat hemorrhage and anemia associated with reproductive tract pathology in a 59-year-old Asian elephant (Elephas maximus). The Repro-BLOC GnRH vaccine was administered subcutaneously as a series of 4 boosters of increasing dose from 3 to 30 mg of recombinant ovalbumin-GnRH fusion protein given at variable intervals after initial vaccination with 3 mg protein. Efficacy was confirmed over a year after initial vaccination based on complete ovarian cycle suppression determined by serum progestagen analyses. Estrous cycle suppression was associated with a significant increase in GnRH antibody binding and subsequent decrease in serum luteinizing hormone and follicle-stimulating hormone concentrations. Ultrasonographic examinations of the reproductive tract documented a reduction in uterine size and vascularity after immunization. The hematocrit level normalized soon after the initial intrauterine hemorrhage, and no recurrence of anemia has been detected. No substantive adverse effects were associated with GnRH vaccination. The results indicate that GnRH vaccination in elephants shows potential for contraception and management of uterine pathology in older elephants.

  10. Elevated serum progesterone/ MII oocyte ratio on the day of human chorionic gonadotropin administration can predict impaired endometrial receptivity

    OpenAIRE

    2015-01-01

    Background: Increased serum progesterone on the day of human chorionic gonadotropin administration may affect in vitro fertilization (IVF) outcome. Objective: The aim of this study was to evaluate whether progesterone elevation on the day of human chorionic gonadotropin administration is associated with poor IVF outcome. Materials and Methods: To determine the relationship between serum progesterone on the day of HCG and the outcome of IVF-embryo transfer treatment, 378 infertile patients und...

  11. Wastewater treatment plant effluent alters pituitary gland gonadotropin mRNA levels in juvenile coho salmon (Oncorhynchus kisutch).

    Science.gov (United States)

    Harding, Louisa B; Schultz, Irvin R; da Silva, Denis A M; Ylitalo, Gina M; Ragsdale, Dave; Harris, Stephanie I; Bailey, Stephanie; Pepich, Barry V; Swanson, Penny

    2016-09-01

    It is well known that endocrine disrupting compounds (EDCs) present in wastewater treatment plant (WWTP) effluents interfere with reproduction in fish, including altered gonad development and induction of vitellogenin (Vtg), a female-specific egg yolk protein precursor produced in the liver. As a result, studies have focused on the effects of EDC exposure on the gonad and liver. However, impacts of environmental EDC exposure at higher levels of the hypothalamic-pituitary-gonad axis are less well understood. The pituitary gonadotropins, follicle-stimulating hormone (Fsh) and luteinizing hormone (Lh) are involved in all aspects of gonad development and are subject to feedback from gonadal steroids making them a likely target of endocrine disruption. In this study, the effects of WWTP effluent exposure on pituitary gonadotropin mRNA expression were investigated to assess the utility of Lh beta-subunit (lhb) as a biomarker of estrogen exposure in juvenile coho salmon (Oncorhynchus kisutch). First, a controlled 72-h exposure to 17α-ethynylestradiol (EE2) and 17β-trenbolone (TREN) was performed to evaluate the response of juvenile coho salmon to EDC exposure. Second, juvenile coho salmon were exposed to 0, 20 or 100% effluent from eight WWTPs from the Puget Sound, WA region for 72h. Juvenile coho salmon exposed to 2 and 10ng EE2L(-1) had 17-fold and 215-fold higher lhb mRNA levels relative to control fish. Hepatic vtg mRNA levels were dramatically increased 6670-fold, but only in response to 10ng EE2L(-1) and Fsh beta-subunit (fshb) mRNA levels were not altered by any of the treatments. In the WWTP effluent exposures, lhb mRNA levels were significantly elevated in fish exposed to five of the WWTP effluents. In contrast, transcript levels of vtg were not affected by any of the WWTP effluent exposures. Mean levels of natural and synthetic estrogens in fish bile were consistent with pituitary lhb expression, suggesting that the observed lhb induction may be due to

  12. Intracellular fate of Mycobacterium avium subspecies paratuberculosis in monocytes from normal and infected, interferon-responsive cows as determined by a radiometric method.

    Science.gov (United States)

    Zhao, B Y; Czuprynski, C J; Collins, M T

    1999-01-01

    The ability of Mycobacterium avium subsp. paratuberculosis to survive in bovine monocytes was studied using radiometric (BACTEC) culture, standard plate counting and microscopic counting of acid-fast stained monocyte monolayers. Results of microscopic counts sharply contrasted with results of viable counts determined both by plate counting and radiometric counting. We observed an early phase (the first 6 d after in vitro infection) of intracellular bacillary growth, followed by a later phase of mycobacteriostasis or killing (up to 12 d after in vitro infection) in monocytes from non-infected cows. The data suggest that multiplication and death of M. avium subsp. paratuberculosis occur simultaneously in bovine monocytes infected in vitro. Using the BACTEC method, we compared the ability of bovine monocytes from normal cows and cows infected with M. avium subsp. paratuberculosis and showing evidence of a strong Thl-like cellular immune response to ingest and inhibit the intracellular growth of M. avium subsp. paratuberculosis. There was a trend toward greater phagocytosis and faster killing of Mycobacterium avium subsp. paratuberculosis by monocytes from the infected, immune responder cows. However, the observed numbers of viable M. avium subsp. paratuberculosis at each time after monocyte infection were not significantly different between normal and infected cows.

  13. Phospholipase C signaling via the parathyroid hormone (PTH)/PTH-related peptide receptor is essential for normal bone responses to PTH.

    Science.gov (United States)

    Guo, Jun; Liu, Minlin; Yang, Dehong; Bouxsein, Mary L; Thomas, Clare C; Schipani, Ernestina; Bringhurst, F Richard; Kronenberg, Henry M

    2010-08-01

    We have previously shown that differentiation of hypertrophic chondrocytes is delayed in mice expressing a mutated PTH/PTHrP receptor (PTHR) (called DSEL here) that stimulates adenylyl cyclase normally but fails to activate phospholipase C (PLC). To better understand the role of PLC signaling via the PTHR in skeletal and mineral homeostasis, we examined these mice fed a normal or calcium-deficient diet. On a standard diet, DSEL mice displayed a modest decrease in bone mass. Remarkably, when fed a low-calcium diet or infused with PTH, DSEL mice exhibited strikingly curtailed peritrabecular stromal cell responses and attenuated new bone formation when compared with Wt mice. Attenuated in vitro colony formation was also observed in bone marrow cells derived from DSEL mice fed a low-calcium diet. Furthermore, PTH stimulated proliferation and increased mRNAs encoding cyclin D1 in primary osteoblasts derived from Wt but not from DSEL mice. Our data indicate that PLC signaling through the PTHR is required for skeletal homeostasis.

  14. A Comparison of Thresholds in Auditory Steady - State Response with Pure Tone Audiometry in Subjects with Normal Hearing and Those with Mild and Moderate Sensorineural Hearing los

    Directory of Open Access Journals (Sweden)

    Sadegh Jafarzadeh

    2008-06-01

    Full Text Available Background and Aim: Among all auditory assessment tools, auditory steady state response (ASSR is a modern test. Modulation frequency for this test is usually 80 Hz. The purpose of this study, was to examined adult subjects with 40 Hz and 80 Hz ASSR and compare the results.Materials and Methods: Thirty adult (60 ears were evaluated by ASSR and PTA test, Results were divided into three groups: normal hearing, mild and moderate sensorineural hearing loss. Results: In all groups, forty hertz ASSR thresholds were relatively closer to behavioral threshold than those of 80 Hz ASSR(p<0.05. Besides, the more severe hearing loss, the lower the difference between those two thresholds. Correlation coefficients were also higher in 40 Hz ASSR(p<0.05. Conclusion: Frequency modulation thresholds with 40 Hz are more likely to be closer to the behavioral thresholds. Moreover, it has better results than the thresholds with 80 Hz.

  15. Detection of Messenger RNA for Gonadotropin-Releasing Hormone (GnRH) but not for GnRH Receptors in Rat Pancreas

    Institute of Scientific and Technical Information of China (English)

    王雷; 谢莉萍; 黄威权; 张荣庆

    2001-01-01

    Although gonadotropin-releasing hormone (GnRH), GnRH-like molecule, and GnRH receptor (GnRH-R) have been reported to exist in several tissues other than brain or anterior pituitary, there are no reports concerning GnRH or GnRH-R gene expression in a normal pancreatic gland. In order to define the production of GnRH as well as GnRH-R in the pancreatic gland, we examined their gene expression in various developmental stages of rat pancreas using the reverse transcriptase-polymerase chain reaction (RT-PCR).GnRH mRNA transcripts were found in pancreas of male and female rats at different ages, expressing at about the same level, whereas GnRH-R mRNA transcripts could not be detected in any rat pancreatic gland samples. These results suggest a possible biological role of GnRH in rodent pancreas.

  16. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  17. Central precocious puberty and gonadotropin releasing hormone agonist treatment

    NARCIS (Netherlands)

    W. Oostdijk (Wilma)

    1996-01-01

    textabstractIn order to understand the processes occurring during precocious puberty, one needs to specify what is currently known about normal pubertal development. Puberty can be defined as a maturational process of the hypothalamic-pituitarygonadal axis, which results in the development of the go

  18. Phosphoprotein profiles of candidate markers for early cellular responses to low-dose γ-radiation in normal human fibroblast cells.

    Science.gov (United States)

    Yim, Ji-Hye; Yun, Jung Mi; Kim, Ji Young; Lee, In Kyung; Nam, Seon Young; Kim, Cha Soon

    2017-05-01

    Ionizing radiation causes biological damage that leads to severe health effects. However, the effects and subsequent health implications caused by exposure to low-dose radiation are unclear. The objective of this study was to determine phosphoprotein profiles in normal human fibroblast cell lines in response to low-dose and high-dose γ-radiation. We examined the cellular response in MRC-5 cells 0.5 h after exposure to 0.05 or 2 Gy. Using 1318 antibodies by antibody array, we observed ≥1.3-fold increases in a number of identified phosphoproteins in cells subjected to low-dose (0.05 Gy) and high-dose (2 Gy) radiation, suggesting that both radiation levels stimulate distinct signaling pathways. Low-dose radiation induced nucleic acid-binding transcription factor activity, developmental processes, and multicellular organismal processes. By contrast, high-dose radiation stimulated apoptotic processes, cell adhesion and regulation, and cellular organization and biogenesis. We found that phospho-BTK (Tyr550) and phospho-Gab2 (Tyr643) protein levels at 0.5 h after treatment were higher in cells subjected to low-dose radiation than in cells treated with high-dose radiation. We also determined that the phosphorylation of BTK and Gab2 in response to ionizing radiation was regulated in a dose-dependent manner in MRC-5 and NHDF cells. Our study provides new insights into the biological responses to low-dose γ-radiation and identifies potential candidate markers for monitoring exposure to low-dose ionizing radiation. © The Author 2017. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  19. [Diagnosis of ovum viability: comparative analysis between ultrasound and chorionic gonadotropin hormone].

    Science.gov (United States)

    Romero Gutiérrez, G; Farías Gómez, E; Castelazo Guemez, J M

    1991-08-01

    In a retrospective study carried out in the Hospital de Gineco-Obstetricia del Centro Médico León, Gto., Instituto Mexicano del Seguro Social, 61 patients were studied in order to compare the sensitivity and specificity values and the correlation coefficient between the hormonal assays (Human Chorionic Gonadotropin, HCG) and the ultrasound scanning. The qualitative concentrations of HCG had a sensitivity of 37.5% and a specificity of 100%. The levels of subunit beta of HCG had sensitivity of 25% and specificity of 100%. The whole correlation coefficient of the hormonal method (HCG) was R = 0.51 (P less than 0.01). The ultrasound monitoring had a sensitivity of 855 and specificity of 100%, with a correlation coefficient R = 0.88 (P less than 0.01). It was concluded that ultrasound scanning has a better sensitivity and higher correlation than human chorionic gonadotropin assays in the diagnosis of ovum vitality.

  20. Effects of dexamethasone and gonadotropins on the testis of the adrenalectomized lizard Mabuya carinata (Schn.)

    Science.gov (United States)

    Yajurvedi, H N; Chandramohan, K

    1994-02-01

    The effects of gonadotropins (LH + FSH) and dexamethasone on the spermatogenic and steroidogenic activity in the adrenalectomized Mabuya carinata have been studied. Secondary spermatocytes, spermatids, and spermatozoa were absent, and there was a significant decrease in the activity levels of delta 5-3 beta-hydroxysteroid dehydrogenase (delta 5-3 beta-HSDH) and glucose-6-phosphate dehydrogenase in the adrenalectomized lizards compared with those of controls. Administration of either dexamethasone or LH + FSH to adrenalectomized lizards resulted in restoration of testicular activity as revealed by the appearance of secondary spermatocytes, spermatids, and spermatozoa and a significant increase in the activity level of delta 5-3 beta-HSDH compared to that of adrenalectomized lizards. The results indicate that impairment in gonadotropin secretion might be a major factor in inducing testicular regression following adrenalectomy in M. carinata.

  1. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice.

    Directory of Open Access Journals (Sweden)

    Toru Takeo

    Full Text Available Superovulation is a reproductive technique generally used to produce genetically engineered mice. Superovulation in mice involves the administration of equine chorionic gonadotropin (eCG to promote follicle growth and then that of human chorionic gonadotropin (hCG to induce ovulation. Previously, some published studies reported that inhibin antiserum (IAS increased the number of ovulated oocytes in ddY and wild-derived strains of mice. However, the effect of IAS on the C57BL/6 strain, which is the most widely used inbred strain for the production of genetically engineered mice, has not been investigated. In addition, the combined effect of IAS and eCG (IASe on the number of ovulated oocytes in superovulation treatment has not been examined. In this study, we examined the effect of IAS and eCG on the number of ovulated oocytes in immature female mice of the C57BL/6 strain in superovulation treatment. Furthermore, we evaluated the quality of obtained oocytes produced by superovulation using IASe by in vitro fertilization (IVF with sperm from C57BL/6 or genetically engineered mice. The developmental ability of fresh or cryopreserved embryos was examined by embryo transfer. The administration of IAS or eCG had a similar effect on the number of ovulated oocytes in C57BL/6 female mice. The number of ovulated oocytes increased to about 3-fold by the administration of IASe than by the administration of IAS or eCG alone. Oocytes derived from superovulation using IASe normally developed into 2-cell embryos by IVF using sperm from C57BL/6 mice. Fresh or cryopreserved 2-cell embryos produced by IVF between oocytes of C57BL/6 mice and sperm from genetically engineered mice normally developed into live pups following embryo transfer. In summary, a novel technique of superovulation using IASe is extremely useful for producing a great number of oocytes and offspring from genetically engineered mice.

  2. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice.

    Science.gov (United States)

    Takeo, Toru; Nakagata, Naomi

    2015-01-01

    Superovulation is a reproductive technique generally used to produce genetically engineered mice. Superovulation in mice involves the administration of equine chorionic gonadotropin (eCG) to promote follicle growth and then that of human chorionic gonadotropin (hCG) to induce ovulation. Previously, some published studies reported that inhibin antiserum (IAS) increased the number of ovulated oocytes in ddY and wild-derived strains of mice. However, the effect of IAS on the C57BL/6 strain, which is the most widely used inbred strain for the production of genetically engineered mice, has not been investigated. In addition, the combined effect of IAS and eCG (IASe) on the number of ovulated oocytes in superovulation treatment has not been examined. In this study, we examined the effect of IAS and eCG on the number of ovulated oocytes in immature female mice of the C57BL/6 strain in superovulation treatment. Furthermore, we evaluated the quality of obtained oocytes produced by superovulation using IASe by in vitro fertilization (IVF) with sperm from C57BL/6 or genetically engineered mice. The developmental ability of fresh or cryopreserved embryos was examined by embryo transfer. The administration of IAS or eCG had a similar effect on the number of ovulated oocytes in C57BL/6 female mice. The number of ovulated oocytes increased to about 3-fold by the administration of IASe than by the administration of IAS or eCG alone. Oocytes derived from superovulation using IASe normally developed into 2-cell embryos by IVF using sperm from C57BL/6 mice. Fresh or cryopreserved 2-cell embryos produced by IVF between oocytes of C57BL/6 mice and sperm from genetically engineered mice normally developed into live pups following embryo transfer. In summary, a novel technique of superovulation using IASe is extremely useful for producing a great number of oocytes and offspring from genetically engineered mice.

  3. Impact of gene polymorphisms of gonadotropins and their receptors on human reproductive success.

    Science.gov (United States)

    Casarini, Livio; Santi, Daniele; Marino, Marco

    2015-12-01

    Gonadotropins and their receptors' genes carry several single-nucleotide polymorphisms resulting in endocrine genotypes modulating reproductive parameters, diseases, and lifespan leading to important implications for reproductive success and potential relevance during human evolution. Here we illustrate common genotypes of the gonadotropins and gonadotropin receptors' genes and their clinical implications in phenotypes relevant for reproduction such as ovarian cycle length, age of menopause, testosterone levels, polycystic ovary syndrome, and cancer. We then discuss their possible role in human reproduction and adaptation to the environment. Gonadotropins and their receptors' variants are differently distributed among human populations. Some hints suggest that they may be the result of natural selection that occurred in ancient times, increasing the individual chance of successful mating, pregnancy, and effective post-natal parental cares. The gender-related differences in the regulation of the reproductive endocrine systems imply that many of these genotypes may lead to sex-dependent effects, increasing the chance of mating and reproductive success in one sex at the expenses of the other sex. Also, we suggest that sexual conflicts within the FSH and LH-choriogonadotropin receptor genes contributed to maintain genotypes linked to subfertility among humans. Because the distribution of polymorphic markers results in a defined geographical pattern due to human migrations rather than natural selection, these polymorphisms may have had only a weak impact on reproductive success. On the contrary, such genotypes could acquire relevant consequences in the modern, developed societies in which parenthood attempts often occur at a later age, during a short, suboptimal reproductive window, making clinical fertility treatments necessary.

  4. Purification of toad (Bufo japonicus) gonadotropins and development of their homologous radioimmunoassays

    Energy Technology Data Exchange (ETDEWEB)

    Takada, Koji; Itoh, Masanori; Nishio, Hiroshi; Ishii, Susumu (Waseda Univ., Tokyo (Japan))

    1989-10-01

    We obtained three gonadotropin fractions with different electrophoretic mobilities named B1D, B3D and B5D from a glycoprotein fraction of toad (Bufo japonicus) pituitaries by cation exchange chromatography using the fast protein liquid chromatography (FPLC) system, chromatofocusing and gel filtration using the FPLC system. Gonadotropin activity was monitored by two radioreceptor assay (RRA) systems, one using bullfrog testis and bullfrog LH as the source of receptor and radioligand respectively, and the other using toad testis and bullfrog FSH respectively. Although, LH/FSH specificity was not complete in these RRAs, the fraction BID showed a higher potency in LH-RRA than in FSH-RRA, while B3D and B5D showed lower potencies in LH-RRA activity than in FSH-RRA. Furthermore, B1D had an activity to release androgen from the toad testis, while B3D and B5D had slight activities. All these fractions stimulated accumulation of cAMP in testis slices of the toad in vitro. These results suggest that B1D contains LH, and B3D and B5D contain FSH-like gonadotropin. SDS PAGE analysis in combination with immunoblot revealed that B1D was almost pure LH, but B3D seemed to be not homogeneous. Anti-B1D-serum and anti-B3D-serum were raised in rabbits, and radioimmunoassays (RIAs) for B1D and B3D were established. The cross reactivity of B3D and B5D in B1D-RIA was about 30% of B1D, while that of B1D in B3D-RIA was only 3% of B3D and B5D. These RIAs were sensitive enough to measure gonadotropins in plasma samples of Bufo japonicus. (author).

  5. Does Postevacuation β -Human Chorionic Gonadotropin Level Predict the Persistent Gestational Trophoblastic Neoplasia?

    OpenAIRE

    2014-01-01

    β -human chorionic gonadotropin (HCG) level is not a reliable marker for early identification of persistent gestational trophoblastic neoplasia (GTN) after evacuation of hydatidiform mole. Thus, this study was conducted to evaluate β -HCG regression after evacuation as a predictive factor of malignant GTN in complete molar pregnancy. Methods. In this cross-sectional study, we evaluated a total of 260 patients with complete molar pregnancy. Sixteen of the 260 patients were excluded. Serum leve...

  6. Glucocorticoid regulation of gonadotropin release from gonadotropes of ovine pituitary gland in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Nangalama, A.W.

    1989-01-01

    In order to understand the role of glucocorticoids in the regulation of gonadotropin release by the pituitary gland, the short-term effects of cortisol perifusion (1.5 h to 8 hrs) on GnRH-induced LH secretion were investigated. To determine the biochemical mechanism(s) by which cortisol can act to modulate GnRH-induced LH release, the interactions of cortisol and arachidonic acid in GnRH-stimulated LH release were examined. Cortisol perifusion for 1.5 hr had no effect on GnRH-induced LH release, but longer treatment periods (4 hr-8 hrs) significantly reduced GnRH-stimulated LH release (4.0 hr, p < 0.01; 6.0 hr, p < 0.001; 8.0 hr, p < 0.01). Treatment and animal effects were highly significant (p < 0.001). There were significant interactions (p < 0.001) between treatment and animal as determined by a two-way ANOVA. Cortisol treatment also produced progressive increases in basal LH secretion with time (1.5 hr, p < 0.05; 4.0 hr, p < 0.01; 6.0 hr, p < 0.01; 8.0 hr, p < 0.001). Incubation of pituitary tissue with arachidonic acid (AA) resulted in a linear dose-response of LH (p < 0.001). Cortisol infusion failed to inhibit GnRH-induced LH release in which 10{sup {minus}4}M AA was administered for 20 min before a 10 min, 10{sup {minus}10}M GnRH pulse. Like cortisol, chloroquine also failed to inhibit AA-induced LH release. Perifusion with 10{sup {minus}6}M cortisol for 6.0 hours significantly (p < 0.001) blocked GnRH-stimulated (H{sup 3})AA release 24% below the basal (100%) ({sup 3}H)AA secretion. Reduction of ({sup 3}H)AA release was accompanied by decreased GnRH-stimulated LH secretion.

  7. Gonadotropin-releasing hormone: regulation of the GnRH gene.

    Science.gov (United States)

    Lee, Vien H Y; Lee, Leo T O; Chow, Billy K C

    2008-11-01

    As the key regulator of reproduction, gonadotropin-releasing hormone (GnRH) is released by neurons in the hypothalamus, and transported via the hypothalamo-hypophyseal portal circulation to the anterior pituitary to trigger gonadotropin release for gonadal steroidogenesis and gametogenesis. To achieve appropriate reproductive function, mammals have precise regulatory mechanisms; one of these is the control of GnRH synthesis and release. In the past, the scarcity of GnRH neurons and their widespread distribution in the brain hindered the study of GnRH gene expression. Until recently, the development of GnRH-expressing cell lines with properties similar to those of in vivo GnRH neurons and also transgenic mice facilitated GnRH gene regulation research. This minireview provides a summary of the molecular mechanisms for the control of GnRH-I and GnRH-II gene expression. These include basal transcription regulation, which involves essential cis-acting elements in the GnRH-I and GnRH-II promoters and interacting transcription factors, and also feedback control by gonadotropins and gonadal sex steroids. Other physiological stimuli, e.g. insulin and melatonin, will also be discussed.

  8. Effect of Withania somnifera (L.) Dunal on Sex Hormone and Gonadotropin Levels in Addicted Male Rats

    Science.gov (United States)

    Rahmati, Batool; Ghosian Moghaddam, Mohammad Hassan; Khalili, Mohsen; Enayati, Ehsan; Maleki, Maryam; Rezaeei, Saeedeh

    2016-01-01

    Background Opioid consumption has been widely increasing across the globe; how- ever, it can cause adverse effects on the body. Morphine, an opioid, can reduce sex hor- mones and fertility. Withania somnifera (WS) is a traditional herb used to improve sexual activities. This study strives to investigate the effect of WS on sex hormones and gonado- tropins in addicted male rats. Materials and Methods In this experimental study, forty-eight male National Maritime Research Institute (NMRI) rats were randomly divided into four groups: i. Control group, ii. WS-treated control group, iii. Addicted group, and iv. WS-treated addicted group. Wa- ter-soluble morphine was given to rats for 21 days to induce addiction, concurrently the treated groups (2 and 4) also received WS plant-mixed pelleted food (6.25%). At the end of the treatment, the sex hormone and gonadotropin levels of the rats’ sera were deter- mined in all the groups. Results Except for follicle-stimulating hormone (FSH), morphine reduced most of the gonadotropin and sex hormone levels. Whereas WS caused a considerable increase in the hormones in the treated addicted group, there was only a slight increase in the treated control group. Conclusion WS increased sex hormones and gonadotropins-especially testosterone, es- trogen, and luteinizing hormone-in the addicted male rats and even increased the proges- terone level, a stimulant of most sex hormones in addicted male rats. PMID:27441058

  9. Success of frozen embryo transfer: Does the type of gonadotropin influence the outcome?

    Directory of Open Access Journals (Sweden)

    Hesham Al-Inany

    2010-05-01

    Full Text Available Hesham Al-Inany1, Pieter van Gelder21Egyptian IVF-ET Center, Maadi, Egypt; 2PSCT BV, Den Haag, The NetherlandsObjectives: To determine whether there is a difference in outcome between different ovulationinduced cycles after frozen-thawed embryo transfer (FET.Methods: We searched the Cochrane Menstrual Disorders and Subfertility Group’s trials register in May 2009, the Cochrane Central Register of Controlled Trials (Cochrane Library, Issue 1, 2008, ISI Web of Knowledge (1985 to August 2009, and reference lists of articles. Relevant conference proceedings were hand-searched and researchers in the field were contacted. Randomized controlled trials and retrospective studies were included, comparing the various cycle regimens and different methods during FET in assisted reproductive technology, ie, in vitro fertilization and intracytoplasmic sperm injection.Results: Using the agonist long protocol for downregulation, five trials provided extractable data for live-birth rates, ongoing pregnancy, and clinical pregnancy rates following FET. One trial provided extractable data for clinical pregnancy rate. There was no evidence of a significant difference in any outcome between the users of urinary gonadotropins versus recombinant follicle-stimulating hormone. Data on implantation and miscarriage rates following FET were not available for analysis.Conclusions: It seems that clinical pregnancy rate after FET is not influenced by the type of gonadotropins used. Research should be directed towards improving freezing and thawing techniques.Keywords: infertility, assisted reproductive technology, frozen embryo transfer, gonadotropins

  10. Noninvasive beat-to-beat finger arterial pressure monitoring during orthostasis: a comprehensive review of normal and abnormal responses at different ages.

    Science.gov (United States)

    van Wijnen, V K; Finucane, C; Harms, M P M; Nolan, H; Freeman, R L; Westerhof, B E; Kenny, R A; Ter Maaten, J C; Wieling, W

    2017-05-31

    Over the past 30 years, noninvasive beat-to-beat blood pressure (BP) monitoring has provided great insight into cardiovascular autonomic regulation during standing. Although traditional sphygmomanometric measurement of BP may be sufficient for detection of sustained orthostatic hypotension, it fails to capture the complexity of the underlying dynamic BP and heart rate responses. With the emerging use of noninvasive beat-to-beat BP monitoring for the assessment of orthostatic BP control in clinical and population studies, various definitions for abnormal orthostatic BP patterns have been used. Here, age-related changes in cardiovascular control in healthy subjects will be reviewed to define the spectrum of the most important abnormal orthostatic BP patterns within the first 180 s of standing. Abnormal orthostatic BP responses can be defined as initial orthostatic hypotension (a transient systolic BP fall of >40 mmHg within 15 s of standing), delayed BP recovery (an inability of systolic BP to recover to a value of >20 mmHg below baseline at 30 s after standing) and sustained orthostatic hypotension (a sustained decline in systolic BP of ≥20 mmHg occurring 60-180 s after standing). In the evaluation of patients with light-headedness, pre(syncope), (unexplained) falls or suspected autonomic dysfunction, it is essential to distinguish between normal cardiovascular autonomic regulation and these abnormal orthostatic BP responses. The prevalence, clinical relevance and underlying pathophysiological mechanisms of these patterns differ significantly across the lifespan. Initial orthostatic hypotension is important for identifying causes of syncope in younger adults, whereas delayed BP recovery and sustained orthostatic hypotension are essential for evaluating the risk of falls in older adults. © 2017 The Authors Journal of Internal Medicine published by John Wiley & Sons Ltd on behalf of Association for Publication of The Journal of Internal Medicine.

  11. Differential body weight, blood pressure and placental inflammatory responses to normal versus high-fat diet in melanocortin-4 receptor-deficient pregnant rats.

    Science.gov (United States)

    Spradley, Frank T; Palei, Ana C; Granger, Joey P

    2016-10-01

    Although obesity increases the risk for hypertensive disorders of pregnancy, the mechanisms remain unclear. Neural melanocortin-4 receptor (MC4R) deficiency causes hyperphagia and obesity. Effects of MC4R deficiency on body weight, blood pressure (BP) and placental inflammatory responses to high-fat diet (HFD) are unknown. We tested two hypotheses: MC4R deficiency results in higher body weight, BP and placental inflammation under normal-fat diet (NFD) conditions and HFD exaggerates these responses in MC4R-deficient pregnant rats. MC4R and MC4R rats were maintained on NFD (13% kcal fat) or HFD (40% kcal fat) for ∼15 weeks, then measurements made on gestational day 19. MC4R pregnant rats had greater body mass and total body fat and visceral adipose tissue weights along with greater circulating total cholesterol (TC) and leptin levels than MC4R rats regardless of diet. On NFD, circulating adiponectin levels were lower and placental TNFα levels and BP (conscious with carotid catheter) were higher in these heavier rats. Circulating adiponectin levels were lower and placental TNFα levels and BP were higher in MC4R rats compared with NFD controls. These parameters were not affected by HFD in the already heavier and hypertensive MC4R pregnant rats. Obesity in MC4R deficiency and HFD in MC4R rats result in higher BP and placental inflammation during pregnancy. However, HFD did not exaggerate these responses in already obese MC4R pregnant rats. These data suggest that obesity and HFD are independently related to hypertension and placental inflammation in pregnancy.

  12. Histone deacetylases regulate gonadotropin-releasing hormone I gene expression via modulating Otx2-driven transcriptional activity.

    Directory of Open Access Journals (Sweden)

    Lu Gan

    Full Text Available BACKGROUND: Precise coordination of the hypothalamic-pituitary-gonadal axis orchestrates the normal reproductive function. As a central regulator, the appropriate synthesis and secretion of gonadotropin-releasing hormone I (GnRH-I from the hypothalamus is essential for the coordination. Recently, emerging evidence indicates that histone deacetylases (HDACs play an important role in maintaining normal reproductive function. In this study, we identify the potential effects of HDACs on Gnrh1 gene transcription. METHODOLOGY/PRINCIPAL FINDINGS: Inhibition of HDACs activities by trichostatin A (TSA and valproic acid (VPA promptly and dramatically repressed transcription of Gnrh1 gene in the mouse immortalized mature GnRH neuronal cells GT1-7. The suppression was connected with a specific region of Gnrh1 gene promoter, which contains two consensus Otx2 binding sites. Otx2 has been known to activate the basal and also enhancer-driven transcription of Gnrh1 gene. The transcriptional activity of Otx2 is negatively modulated by Grg4, a member of the Groucho-related-gene (Grg family. In the present study, the expression of Otx2 was downregulated by TSA and VPA in GT1-7 cells, accompanied with the opposite changes of Grg4 expression. Chromatin immunoprecipitation and electrophoretic mobility shift assays demonstrated that the DNA-binding activity of Otx2 to Gnrh1 gene was suppressed by TSA and VPA. Overexpression of Otx2 partly abolished the TSA- and VPA-induced downregulation of Gnrh1 gene expression. CONCLUSIONS/SIGNIFICANCE: Our data indicate that HDAC inhibitors downregulate Gnrh1 gene expression via repressing Otx2-driven transcriptional activity. This study should provide an insight for our understanding on the effects of HDACs in the reproductive system and suggests that HDACs could be potential novel targets for the therapy of GnRH-related diseases.

  13. Central and direct regulation of testicular activity by gonadotropin-inhibitory hormone and its receptor

    Directory of Open Access Journals (Sweden)

    Takayoshi eUbuka

    2014-01-01

    Full Text Available Gonadotropin-inhibitory hormone (GnIH was first identified in Japanese quail to be an inhibitor of gonadotropin synthesis and release. GnIH peptides have since been identified in all vertebrates, and all share an LPXRFamide (X = L or Q motif at their C-termini. The receptor for GnIH is the G protein-coupled receptor 147 (GPR147, which inhibits cAMP signaling. Cell bodies of GnIH neurons are located in the paraventricular nucleus (PVN in birds and the dorsomedial hypothalamic area (DMH in most mammals. GnIH neurons in the PVN or DMH project to the median eminence to control anterior pituitary function via GPR147 expressed in gonadotropes. Further, GnIH inhibits gonadotropin-releasing hormone (GnRH -induced gonadotropin subunit gene transcription by inhibiting the adenylate cyclase/cAMP/PKA -dependent ERK pathway in an immortalized mouse gonadotrope cell line (LT2 cells. GnIH neurons also project to GnRH neurons that express GPR147 in the preoptic area (POA in birds and mammals. Accordingly, GnIH can inhibit gonadotropin synthesis and release by decreasing the activity of GnRH neurons as well as by directly inhibiting pituitary gonadotrope activity. GnIH and GPR147 can thus centrally suppress testosterone secretion and spermatogenesis by acting in the hypothalamic-pituitary-gonadal axis. GnIH and GPR147 are also expressed in the testis of birds and mammals, possibly acting in an autocrine/paracrine manner to suppress testosterone secretion and spermatogenesis. GnIH expression is also regulated by melatonin, stress and social environment in birds and mammals. Accordingly, the GnIH-GPR147 system may play a role in transducing physical and social environmental information to regulate optimal testicular activity in birds and mammals. This review discusses central and direct inhibitory effects of GnIH and GPR147 on testosterone secretion and spermatogenesis in birds and mammals.

  14. Regulation of P450 oxidoreductase by gonadotropins in rat ovary and its effect on estrogen production

    Directory of Open Access Journals (Sweden)

    Uesaka Miki

    2008-12-01

    Full Text Available Abstract Background P450 oxidoreductase (POR catalyzes electron transfer to microsomal P450 enzymes. Its deficiency causes Antley-Bixler syndrome (ABS, and about half the patients with ABS have ambiguous genitalia and/or impaired steroidogenesis. POR mRNA expression is up-regulated when mesenchymal stem cells (MSCs differentiate into steroidogenic cells, suggesting that the regulation of POR gene expression is important for steroidogenesis. In this context we examined the regulation of POR expression in ovarian granulosa cells by gonadotropins, and its possible role in steroidogenesis. Methods Changes in gene expression in MSCs during differentiation into steroidogenic cells were examined by DNA microarray analysis. Changes in mRNA and protein expression of POR in the rat ovary or in granulosa cells induced by gonadotropin treatment were examined by reverse transcription-polymerase chain reaction and western blotting. Effects of transient expression of wild-type or mutant (R457H or V492E POR proteins on the production of estrone in COS-7 cells were examined in vitro. Effects of POR knockdown were also examined in estrogen producing cell-line, KGN cells. Results POR mRNA was induced in MSCs following transduction with the SF-1 retrovirus, and was further increased by cAMP treatment. Expression of POR mRNA, as well as Cyp19 mRNA, in the rat ovary were induced by equine chorionic gonadotropin and human chorionic gonadotropin. POR mRNA and protein were also induced by follicle stimulating hormone in primary cultured rat granulosa cells, and the induction pattern was similar to that for aromatase. Transient expression of POR in COS-7 cells, which expressed a constant amount of aromatase protein, greatly increased the rate of conversion of androstenedione to estrone, in a dose-dependent manner. The expression of mutant POR proteins (R457H or V492E, such as those found in ABS patients, had much less effect on aromatase activity than expression of wild

  15. Dynamical response of the Galileo Galilei on the ground rotor to test the equivalence principle: Theory, simulation, and experiment. I. The normal modes

    Science.gov (United States)

    Comandi, G. L.; Chiofalo, M. L.; Toncelli, R.; Bramanti, D.; Polacco, E.; Nobili, A. M.

    2006-03-01

    Recent theoretical work suggests that violation of the equivalence principle might be revealed in a measurement of the fractional differential acceleration η between two test bodies—of different compositions, falling in the gravitational field of a source mass—if the measurement is made to the level of η ≃10-13 or better. This being within the reach of ground based experiments gives them a new impetus. However, while slowly rotating torsion balances in ground laboratories are close to reaching this level, only an experiment performed in a low orbit around the Earth is likely to provide a much better accuracy. We report on the progress made with the "Galileo Galilei on the ground" (GGG) experiment, which aims to compete with torsion balances using an instrument design also capable of being converted into a much higher sensitivity space test. In the present and following articles (Part I and Part II), we demonstrate that the dynamical response of the GGG differential accelerometer set into supercritical rotation—in particular, its normal modes (Part I) and rejection of common mode effects (Part II)—can be predicted by means of a simple but effective model that embodies all the relevant physics. Analytical solutions are obtained under special limits, which provide the theoretical understanding. A simulation environment is set up, obtaining a quantitative agreement with the available experimental data on the frequencies of the normal modes and on the whirling behavior. This is a needed and reliable tool for controlling and separating perturbative effects from the expected signal, as well as for planning the optimization of the apparatus.

  16. Studies on responsiveness of hepatoma cells to catecholamines. III. Difference between the receptor-adenylate cyclase regulating systems in AH130 cells and cultured normal rat liver cells.

    Science.gov (United States)

    Sanae, F; Matsunaga, T; Miyamoto, K; Koshiura, R

    1986-10-01

    The responsiveness to three beta-adrenergic agonists, isoproterenol (IPN), epinephrine (Epi) and norepinephrine (NE) in AH13O cells was examined compared with that in normal rat liver cells which were cultured for 24 hr after collagenase digestion. As regards to the activation of adenylate cyclase in the cell homogenates, the relative affinity of the three agonists was in order of IPN greater than NE greater than Epi in AH130 cells and IPN greater than Epi greater than NE in cultured normal liver cells. While the efficacies of the three agonists were similar in cultured liver cells, those of NE and Epi were markedly lower than that of IPN in AH13O cells and were increased to the similar level of IPN by pretreatment with phentolamine, but not with prazosin. Clonidine inhibited the activation of adenylate cyclase by IPN in AH13O cells. When cells were preincubated with islet-activating protein (IAP), the activity of adenylate cyclase in the presence or absence of agonist in both cell lines increased. In IAP-treated AH13O cells, the efficacies of NE and Epi became close to that of IPN. Adenylate cyclase in IAP-treated AH13O cells was activated by GTP in a dose-dependent manner, but that in IAP-treated cultured liver cells was not. In the presence of IPN, biphasic (activatory and inhibitory) effects of GTP on the cyclase were observed, and the inhibitory phase was eliminated by the IAP-treatment in both cell lines.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Normal and tumour cervical cells respond differently to vaginal lactobacilli, independent of pH and lactate.

    Science.gov (United States)

    Motevaseli, Elahe; Shirzad, Mahdieh; Akrami, Seyed Mohammad; Mousavi, Azam-Sadat; Mirsalehian, Akbar; Modarressi, Mohammad Hossein

    2013-07-01

    Cervical cancer is a human papilloma virus (HPV)-related cancer, but most HPV infections are transient or intermittent and resolve spontaneously. Thus, other factors, such as cervical microflora, which are dominated by lactobacilli, must be involved in invasive cervical carcinoma development after HPV infection. Previous studies have demonstrated that lactobacilli have antitumour effects, and it is possible that vaginal lactobacilli prevent cervical cancer. Here we examined the proliferative and apoptotic responses of normal and tumour cervical cells to common vaginal lactobacilli components by investigating human normal fibroblast-like cervical (normal cervical) and HeLa (cervical tumour) cell responses to Lactobacillus gasseri and Lactobacillus crispatus. The effects of different lactobacilli components, such as culture supernatants, cytoplasmic extracts, cell-wall extracts and live cells, were determined by MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay, trypan blue staining, lactate dehydrogenase assay and colorimetric caspase-3 activity assay. Changes in caspase-3 and human chorionic gonadotropin β (hCGβ) expression were analysed by quantitative RT-PCR. Tumour cell growth inhibition by culture supernatants was higher than that by pH- and lactate-adjusted controls. However, the effects of the supernatants on normal cells were similar to those of lactate-adjusted controls. Apoptosis was inhibited by supernatants, which was consistent with higher hCGβ expression since hCG inhibits apoptosis. Our study demonstrated that common vaginal lactobacilli exert cytotoxic effects on cervical tumour cells, but not on normal cells, and that this cytotoxicity is independent of pH and lactate. Our results encourage further studies on the interaction between lactobacilli and cervical cells, and administration of common vaginal lactobacilli as probiotics.

  18. Heightened seizure susceptibility associated with brain dermoid cyst and the administration of human chorionic gonadotropin (hCG).

    Science.gov (United States)

    Milani, Paolo; Rocchi, Raffaele; Cerase, Alfonso; Rossi, Alessandro; Mazzocchio, Riccardo

    2007-07-15

    It is known that the intramuscular injection of human chorionic gonadotropin (hCG) lowers the threshold for motor evoked responses (MEPs) in the first dorsal interosseous (FDI) muscle to transcranial magnetic stimulation (TMS) in humans. We describe the case of a patient with a clinically silent left-sided nasofrontal dermoid cyst who, while being treated with hCG/LH for hypogonadotropic hypogonadism, presented with simple partial seizures, ipsilateral to the cyst, with secondary generalization. Motor cortex excitability was studied by single and paired TMS and MEPs were recorded from FDI. Resting motor threshold (RMT), active motor threshold (AMT), MEP size, intracortical inhibition (ICI) and intracortical facilitation (ICF) were tested during and after suspension of hormonal therapy. RMT and AMT were lower, MEP size was larger, ICI was decreased while ICF was slightly diminished during treatment. Overall, this indicated a reduced intracortical inhibition during hormonal therapy. It is concluded that treatment with hCG/LH may favour seizure onset in the presence of potentially epileptogenic lesions such as an intracranial dermoid cyst.

  19. Aromatase inhibitors with or without gonadotropin-releasing hormone analogue in metastatic male breast cancer: a case series

    Science.gov (United States)

    Zagouri, F; Sergentanis, T N; Koutoulidis, V; Sparber, C; Steger, G G; Dubsky, P; Zografos, G C; Psaltopoulou, T; Gnant, M; Dimopoulos, M-A; Bartsch, R

    2013-01-01

    Background: Data regarding the safety and effectiveness of aromatase inhibitors (AIs) as monotherapy or combined with gonadotropin-releasing hormone (GnRH) analogue in male breast cancer are scarce. Methods: In this retrospective chart review, cases of male breast cancer patients treated with AIs with or without a GnRH analogue were evaluated. Results: Twenty-three men were included into this case series. Aromatase inhibitors in combination with or without a GnRH analogue were given as first-line therapy in 60.9% and as second-line therapy in 39.1% of patients, respectively. All patients had visceral metastases, whereas in five of them bone lesions coexisted. In all cases AIs were tolerated well, and no case of grade 3 and 4 adverse events was reported. A partial response was observed in 26.1% of patients and stable disease in 56.5%. Median overall survival (OS) was 39 months and median progression-free survival (PFS) was 13 months. Regarding OS and PFS, no significant effects of GnRH analogue co-administration or type of AI were noted. Conclusion: Our study shows that AIs with or without GnRH analogues may represent an effective and safe treatment option for hormone-receptor positive, pretreated, metastatic, male breast cancer patients. PMID:23722469

  20. The effects of gonadotropin suppression and selective replacement on insulin-like factor 3 secretion in normal adult men

    DEFF Research Database (Denmark)

    Bay, Katrine; Matthiesson, Kati L; McLachlan, Robert I

    2006-01-01

    Gonadotropic regulation of the testicular Leydig cell hormone insulin-like factor 3 (INSL3) is incompletely characterized.......Gonadotropic regulation of the testicular Leydig cell hormone insulin-like factor 3 (INSL3) is incompletely characterized....

  1. Sterile trauma to normal human dermis invariably induces IL1beta, IL6 and IL8 in an innate response to "danger".

    Science.gov (United States)

    Sjögren, Florence; Anderson, Chris

    2009-01-01

    Microdialysis allows the study of the local production and temporal resolution of cytokines in living skin. Samples were taken from the normal skin of 10 healthy subjects for 24-28 h after insertion of a concentric microdialysis catheter, and analysed with a Luminex bead-based assay. Interleukin-1 beta (IL1b), IL6 and IL8 were seen in all subjects at all time-points after the first hour. Levels peaked at 5-8 h, equilibrating to lower levels at 24 h. Immunohistological double staining for human leukocyte antigen (HLA)-DR and intracellular cytokines on biopsies taken after catheter removal showed many stained cells in the dermis, in contrast to the few cells stained in the epidermis. This study demonstrates the reactive capability of the dermis when provoked separately from the epidermis. The production of IL1b, IL6 and IL8 occurs invariably in what can be termed an innate, dermal response to "danger"; in this case in the form of sterile needle trauma.

  2. Band gap engineering and optical response of the ACr2S4 (A=Fe, Co) normal spinels using PBE+U and TB-mBJ potentials

    Science.gov (United States)

    Samanta, Saurabh; Saini, Sapan Mohan

    2017-03-01

    The electronic and optical properties of the ACr2S4 (A=Fe, Co) normal spinels have been studied by use of the full-potential linearized augmented plane wave (FPLAPW) method based on density functional theory (DFT). The calculations were performed by two methods, namely, PBE+U and TB-mBJ, with the addition of spin-orbit coupling in both the schemes. The lattice constant and internal parameter of unit cell were optimized. Band structure obtained are analysed based on Density of States (DOS). We found that more pronounced splitting of A-d and Cr-d states in TB-mBJ scheme is responsible for the larger band gaps. The octahedral field surrounding Cr-atoms splits the Cr-d levels into t2g and eg states with some mixing between the two states. The calculated values of spin magnetic moment per formula unit are consistent with earlier report. Optical properties are calculated along the directions of lattice constants to analyze their anisotropic nature based on energy level transitions. We also studied the refractive index, n (ω), and the extinction coefficient, k (ω), by PBE+U and TB-mBJ scheme.

  3. Clinical characteristics and follow-up of 5 young Chinese males with gonadotropin-releasing hormone deficiency caused by mutations in the KAL1 gene

    Directory of Open Access Journals (Sweden)

    Juan Li

    2016-02-01

    Full Text Available Isolated gonadotropin-releasing hormone (GnRH deficiency (IGD pertains to a group of genetic disorders consisting of anosmic hypogonadotropic hypogonadism (Kallmann syndrome, KS and normosmic idiopathic hypogonadotropic hypogonadism (nIHH. KS is genetically heterogeneous. We hereby present 5 young male patients with GnRH deficiency caused by mutations in the KAL1 gene. Their ages ranged from 9 months to 16 years. They were referred to our department for an endocrine consultation for micropenis. Hormone assays showed low circulating gonadotropins and testosterone. Molecular studies revealed KAL1 mutations in all cases, three reported nonsense sequence variants in the KAL1 gene were detected in 4 patients, respectively (c.784C > T (p.Arg 262*, c.1267C > T (p.Arg423*, and c.1270C > T (p.Arg424*, and one patient harbored a novel hemizygous sequence variant [c.227G > A (p.Trp76*]. Only one patient presented short stature without growth hormone deficiency and anosmia. Another patient had bilateral eyelid ptosis, trichiasis, and refractive error. This is the first report on the co-occurrence of a KAL1 gene mutation and tent-like upper lip in four patients. All of our cases had normal olfactory bulbs and showed no renal agenesis, cleft lip/palate, and hearing impairment. These cases expand our knowledge of the phenotype associated with KAL1 sequence variations, although the precise mechanism by which KAL1 gene influences the development of this phenotype is still unknown.

  4. Determination of biological activity of gonadotropins hCG and FSH by Förster resonance energy transfer based biosensors.

    Science.gov (United States)

    Mazina, Olga; Allikalt, Anni; Tapanainen, Juha S; Salumets, Andres; Rinken, Ago

    2017-02-09

    Determination of biological activity of gonadotropin hormones is essential in reproductive medicine and pharmaceutical manufacturing of the hormonal preparations. The aim of the study was to adopt a G-protein coupled receptor (GPCR)-mediated signal transduction pathway based assay for quantification of biological activity of gonadotropins. We focussed on studying human chorionic gonadotropin (hCG) and follicle-stimulating hormone (FSH), as these hormones are widely used in clinical practice. Receptor-specific changes in cellular cyclic adenosine monophosphate (cAMP, second messenger in GPCR signalling) were monitored by a Förster resonance energy transfer (FRET) biosensor protein (T)Epac(VV) in living cells upon activation of the relevant gonadotropin receptor. The BacMam gene delivery system was used for biosensor protein expression in target cells. In the developed assay only biologically active hormones initiated GPCR-mediated cellular signalling. High assay sensitivities were achieved for detection of hCG (limit of detection, LOD: 5 pM) and FSH (LOD: 100 pM). Even the small-scale conformational changes caused by thermal inactivation and reducing the biological activity of the hormones were registered. In conclusion, the proposed assay is suitable for quantification of biological activity of gonadotropins and is a good alternative to antibody- and animal-testing-based assays used in pharmaceutical industry and clinical research.

  5. Determination of biological activity of gonadotropins hCG and FSH by Förster resonance energy transfer based biosensors

    Science.gov (United States)

    Mazina, Olga; Allikalt, Anni; Tapanainen, Juha S.; Salumets, Andres; Rinken, Ago

    2017-01-01

    Determination of biological activity of gonadotropin hormones is essential in reproductive medicine and pharmaceutical manufacturing of the hormonal preparations. The aim of the study was to adopt a G-protein coupled receptor (GPCR)-mediated signal transduction pathway based assay for quantification of biological activity of gonadotropins. We focussed on studying human chorionic gonadotropin (hCG) and follicle-stimulating hormone (FSH), as these hormones are widely used in clinical practice. Receptor-specific changes in cellular cyclic adenosine monophosphate (cAMP, second messenger in GPCR signalling) were monitored by a Förster resonance energy transfer (FRET) biosensor protein TEpacVV in living cells upon activation of the relevant gonadotropin receptor. The BacMam gene delivery system was used for biosensor protein expression in target cells. In the developed assay only biologically active hormones initiated GPCR-mediated cellular signalling. High assay sensitivities were achieved for detection of hCG (limit of detection, LOD: 5 pM) and FSH (LOD: 100 pM). Even the small-scale conformational changes caused by thermal inactivation and reducing the biological activity of the hormones were registered. In conclusion, the proposed assay is suitable for quantification of biological activity of gonadotropins and is a good alternative to antibody- and animal-testing-based assays used in pharmaceutical industry and clinical research. PMID:28181555

  6. Should ground-motion records be rotated to fault-normal/parallel or maximum direction for response history analysis of buildings?

    Science.gov (United States)

    Reyes, Juan C.; Kalkan, Erol

    2012-01-01

    In the United States, regulatory seismic codes (for example, California Building Code) require at least two sets of horizontal ground-motion components for three-dimensional (3D) response history analysis (RHA) of building structures. For sites within 5 kilometers (3.1 miles) of an active fault, these records should be rotated to fault-normal and fault-parallel (FN/FP) directions, and two RHAs should be performed separately—when FN and then FP direction are aligned with transverse direction of the building axes. This approach is assumed to lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. The validity of this assumption is examined here using 3D computer models of single-story structures having symmetric (torsionally stiff) and asymmetric (torsionally flexible) layouts subjected to an ensemble of near-fault ground motions with and without apparent velocity pulses. In this parametric study, the elastic vibration period is varied from 0.2 to 5 seconds, and yield-strength reduction factors, R, are varied from a value that leads to linear-elastic design to 3 and 5. Further validations are performed using 3D computer models of 9-story structures having symmetric and asymmetric layouts subjected to the same ground-motion set. The influence of the ground-motion rotation angle on several engineering demand parameters (EDPs) is examined in both linear-elastic and nonlinear-inelastic domains to form benchmarks for evaluating the use of the FN/FP directions and also the maximum direction (MD). The MD ground motion is a new definition for horizontal ground motions for use in site-specific ground-motion procedures for seismic design according to provisions of the American Society of Civil Engineers/Seismic Engineering Institute (ASCE/SEI) 7-10. The results of this study have important implications for current practice, suggesting that ground motions rotated to MD or FN/FP directions do not necessarily provide

  7. Effects of shortened photoperiod on gonadotropin-releasing hormone, gonadotropin, and vitellogenin gene expression associated with ovarian maturation in rainbow trout.

    Science.gov (United States)

    Choi, Sungchang; Lee, Cheul Ho; Park, Woodong; Kim, Dae-Jung; Sohn, Young Chang

    2010-01-01

    Reproductive activities of salmonids are synchronized by changes in photoperiod, which control the endocrine system via the brain-pituitary-gonadal axis. Gonadotropin-releasing hormone (GnRH) in the brain regulates synthesis and release of the pituitary gonadotropins (GTHs; FSH and LH). FSH and LH in turn stimulate the production of sex steroids for oocyte growth and maturation-Inducing steroid hormones for oocyte maturation and ovulation, respectively, in female salmonids. To clarify effects of long-term photoperiod manipulations on the reproductive activity of salmonids from early recrudescence to ovulation, we Investigated the gene expression profiles of GnRH, GTHs, and vitellogenin (VTG), and plasma sex steroids in female rainbow trout (Oncorhynchus mykiss). In addition, the percentages of eyed embryos and hatched alevins were examined together with the number of ovulated eggs to evaluate the effects of photoperiod regimes on egg quality. During late summer, the mRNA levels of GnRHs, GTHalpha, and LHbeta, and the plasma level of a maturational steroid (17alpha,20beta-dihydroxy-4-pregnen-3-one; 17,20beta-P) were significantly elevated by a gradually shortened photoperiod under constant temperature, in accordance with accelerated sexual maturation. The percentages of eyed embryos and hatched alevins from fish ovulated in August were comparable to those of control fish observed in December. These results clearly indicate that syntheses of GnRHs, LH, VTG, and 17,20beta-P are effectively accelerated by a programmed long-short photoperiod regime in early recrudescent female rainbow trout, without a marked deterioration in egg quality.

  8. Effects of lamprey PQRFamide peptides on brain gonadotropin-releasing hormone concentrations and pituitary gonadotropin-β mRNA expression.

    Science.gov (United States)

    Daukss, Dana; Gazda, Kristen; Kosugi, Takayoshi; Osugi, Tomohiro; Tsutsui, Kazuyoshi; Sower, Stacia A

    2012-06-01

    Within the RFamide peptide family, PQRFamide peptides that include neuropeptide FF and AF possess a C-terminal Pro-Gln-Arg-Phe-NH(2) motif. We previously identified PQRFamide peptides, lamprey PQRFa, PQRFa-related peptide (RP)-1 and -RP-2 by immunoaffinity purification in the brain of lamprey, one of the most ancient vertebrate species [13]. Lamprey PQRFamide peptide precursor mRNA was expressed in regions predicted to be involved in neuroendocrine regulation in the hypothalamus. However, the putative function(s) of lamprey PQRFamide peptides (PQRFa, PQRFa-RP-1 and PQRFa-RP-2) were not examined nor was the distribution of PQRFamide peptides examined in other tissues besides the brain. The objective of this study was to determine tissue distribution of lamprey PQRFamide peptide precursor mRNA, and to examine the effects of PQRFamide peptides on brain gonadotropin-releasing hormone (GnRH)-I, -II, and -III protein concentrations, and pituitary gonadotropin (GTH)-β mRNA expression in adult lampreys. Lamprey PQRFamide peptide precursor mRNA was expressed in the eye and the brain. Lamprey PQRFa at 100 μg/kg increased brain concentrations of lamprey GnRH-II compared with controls. PQRFa, PQRFa-RP-1 and PQRFa-RP-2 did not significantly change brain protein concentrations of either lamprey GnRH-I, -III, or lamprey GTH-β mRNA expression in the pituitary. These data suggest that one of the PQRFamide peptides may act as a neuroregulator of at least the lamprey GnRH-II system in adult female lamprey.

  9. Evaluation of dual trigger with gonadotropin-releasing hormone agonist and human chorionic gonadotropin in improving oocyte maturity rates: A prospective randomized study

    Directory of Open Access Journals (Sweden)

    Nalini Mahajan

    2016-01-01

    Full Text Available BACKGROUND: Mature oocytes are prerequisite for achieving the process of in vitro fertilization. Human chorionic gonadotropin (hCG is the standard trigger used for stimulating ovulation but is associated with ovarian hyperstimulation syndrome (OHSS. Gonadotropin-releasing hormone agonist trigger achieves oocyte maturation and lowers the incidence of OHSS, but it has limitations of higher pregnancy loss rate and miscarriage rates. Coadministration of both hormones is found to improve the pregnancy rates and the number of mature oocytes retrieved. We aimed to assess if the dual trigger is better than the conventional hCG in triggering oocyte maturation. METHODOLOGY: The study included 76 female patients aged 24–43 years who were randomly divided into two groups with 38 patients in each arm. The study included patients with antimullerian hormone (AMH 4 ng/ml and AFC/ovary >12 to avoid OHSS risk with hCG trigger. RESULTS: The study showed statistically insignificant differences between dual group versus hCG group in terms of the number of oocytes retrieved (10.0 ± 5.6 vs. 8.7 ± 5.0; P = 0.2816, the number of mature oocytes recovered (8.4 ± 5.0 vs. 7.2 ± 4.0; P = 0.2588, fertilization rate (5.9 ± 4.2 vs. 5.6 ± 3.3; P = 0.7390, and the number of usable embryos on day 3 (4.0 ± 3.0 vs. 4.0 ± 2.4; P = 0.8991. CONCLUSION: The dual trigger is equivalent to hCG in triggering oocyte maturation.

  10. Regulation of gonadotropins by corticotropin-releasing factor and urocortin

    OpenAIRE

    Kageyama, Kazunori

    2013-01-01

    While stress activates the hypothalamic–pituitary–adrenal (HPA) axis, it suppresses the hypothalamic–pituitary–gonadal (HPG) axis. Corticotropin-releasing factor (CRF) is a major regulatory peptide in the HPA axis during stress. Urocortin 1 (Ucn1), a member of the CRF family of peptides, has a variety of physiological functions and both CRF and Ucn1 contribute to the stress response via G protein-coupled seven transmembrane receptors. Ucn2 and Ucn3, which belong to a separate paralogous linea...

  11. body mass (ID 1412), reduction of post-prandial glycaemic responses (ID 1414), and maintenance of a normal blood lipid profile (1421) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to very low calorie diets (VLCDs) and reduction in body weight, reduction in the sense of hunger, reduction in body fat mass while maintaining lean body mass, reduction of post-prandial glycaemic responses, and maintenance of normal blood lipid profile. The scientific substantiation......), very low calorie diet is not sufficiently characterised in relation to: reduction of post-prandial glycaemic responses (ID 1414) and maintenance of normal blood lipid profile (ID 1421), mainly owing to the lack of standardisation of the type of available carbohydrates and of most of the fatty acids...... that formula foods for use in very low calorie diets should contain. The Panel concludes that a cause and effect relationship cannot be established between the consumption of a very low calorie diet and reduction of post-prandial glycaemic responses (ID 1414) and maintenance of normal blood lipid profile (ID...

  12. Maternal behavior in transgenic mice with reduced fibroblast growth factor receptor function in gonadotropin-releasing hormone neurons

    Directory of Open Access Journals (Sweden)

    Brooks Leah R

    2012-09-01

    Full Text Available Abstract Background Fibroblast growth factors (FGFs and their receptors (FGFRs are necessary for the proper development of gonadotropin-releasing hormone (GnRH neurons, which are key activators of the hypothalamo-pituitary-gonadal axis. Transgenic mice that have the targeted expression of a dominant negative FGFR (dnFGFR in GnRH neurons (dnFGFR mice have a 30% decrease of GnRH neurons. Additionally, only 30–40% of the pups born to the transgenic dams survive to weaning age. These data raised the possibility that FGFR defects in GnRH neurons could adversely affect maternal behavior via novel mechanisms. Methods We first determined if defective maternal behavior in dnFGFR mothers may contribute to poor pup survival by measuring pup retrieval and a battery of maternal behaviors in primiparous control (n = 10–12 and dnFGFR (n = 13–14 mothers. Other endocrine correlates of maternal behaviors, including plasma estradiol levels and hypothalamic pro-oxyphysin and GnRH transcript levels were also determined using enzyme-linked immunoassay and quantitative reverse transcription polymerase chain reaction, respectively. Results Maternal behaviors (% time crouching with pups, time off pups but not feeding, time feeding, and total number of nesting bouts were not significantly different in dnFGFR mice. However, dnFGFR dams were more likely to leave their pups scattered and took significantly longer to retrieve each pup compared to control dams. Further, dnFGFR mothers had significantly lower GnRH transcripts and circulating E2, but normal pro-oxyphysin transcript levels. Conclusions Overall, this study suggests a complex scenario in which a GnRH system compromised by reduced FGF signaling leads to not only suboptimal reproductive physiology, but also suboptimal maternal behavior.

  13. RNA interference of gonadotropin-inhibitory hormone gene induces arousal in songbirds.

    Directory of Open Access Journals (Sweden)

    Takayoshi Ubuka

    Full Text Available Gonadotropin-inhibitory hormone (GnIH was originally identified in quail as a hypothalamic neuropeptide inhibitor of pituitary gonadotropin synthesis and release. However, GnIH neuronal fibers do not only terminate in the median eminence to control anterior pituitary function but also extend widely in the brain, suggesting it has multiple roles in the regulation of behavior. To identify the role of GnIH neurons in the regulation of behavior, we investigated the effect of RNA interference (RNAi of the GnIH gene on the behavior of white-crowned sparrows, a highly social songbird species. Administration of small interfering RNA against GnIH precursor mRNA into the third ventricle of male and female birds reduced resting time, spontaneous production of complex vocalizations, and stimulated brief agonistic vocalizations. GnIH RNAi further enhanced song production of short duration in male birds when they were challenged by playbacks of novel male songs. These behaviors resembled those of breeding birds during territorial defense. The overall results suggest that GnIH gene silencing induces arousal. In addition, the activities of male and female birds were negatively correlated with GnIH mRNA expression in the paraventricular nucleus. Density of GnIH neuronal fibers in the ventral tegmental area was decreased by GnIH RNAi treatment in female birds, and the number of gonadotropin-releasing hormone neurons that received close appositions of GnIH neuronal fiber terminals was negatively correlated with the activity of male birds. In summary, GnIH may decrease arousal level resulting in the inhibition of specific motivated behavior such as in reproductive contexts.

  14. Negative feedback governs gonadotrope frequency-decoding of gonadotropin releasing hormone pulse-frequency.

    Directory of Open Access Journals (Sweden)

    Stefan Lim

    Full Text Available The synthesis of the gonadotropin subunits is directed by pulsatile gonadotropin-releasing hormone (GnRH from the hypothalamus, with the frequency of GnRH pulses governing the differential expression of the common alpha-subunit, luteinizing hormone beta-subunit (LHbeta and follicle-stimulating hormone beta-subunit (FSHbeta. Three mitogen-activated protein kinases, (MAPKs, ERK1/2, JNK and p38, contribute uniquely and combinatorially to the expression of each of these subunit genes. In this study, using both experimental and computational methods, we found that dual specificity phosphatase regulation of the activity of the three MAPKs through negative feedback is required, and forms the basis for decoding the frequency of pulsatile GnRH. A fourth MAPK, ERK5, was shown also to be activated by GnRH. ERK5 was found to stimulate FSHbeta promoter activity and to increase FSHbeta mRNA levels, as well as enhancing its preference for low GnRH pulse frequencies. The latter is achieved through boosting the ultrasensitive behavior of FSHbeta gene expression by increasing the number of MAPK dependencies, and through modulating the feedforward effects of JNK activation on the GnRH receptor (GnRH-R. Our findings contribute to understanding the role of changing GnRH pulse-frequency in controlling transcription of the pituitary gonadotropins, which comprises a crucial aspect in regulating reproduction. Pulsatile stimuli and oscillating signals are integral to many biological processes, and elucidation of the mechanisms through which the pulsatility is decoded explains how the same stimulant can lead to various outcomes in a single cell.

  15. Peritoneal Adhesion and Angiogenesis in Ovarian Carcinoma Are Inversely Regulated by Hyaluronan: The Role of Gonadotropins

    Directory of Open Access Journals (Sweden)

    Yael Chagit Tzuman

    2010-01-01

    Full Text Available Ovarian carcinoma is the leading cause of death among gynecologic cancers. Although transformation of the outer ovarian epithelium was linked with ovulation, the disease is significantly more prevalent and severe in postmenopausal women. We postulated that menopause could augment ovarian cancer progression through the effects of gonadotropins on multifocal seeding to the mesothelial layer lining the peritoneum. This seeding is mediated by integrins as well as by CD44 interaction with hyaluronan (HA. Here, we report the effect of gonadotropins on HA synthesis and degradation and on peritoneal adhesion. A significant concentration- and time-dependent induction in expression levels of HA synthases (HASs and hyaluronidases (Hyals was observed in vitro on stimulation of human epithelial ovarian carcinoma cells by gonadotropins. Hormonal regulation of HA-mediated adhesion was manifested in vivo as well, by fluorescence microscopy of stained MLS multicellular tumor spheroids. The number of spheroids adhered to the mesothelium of ovariectomized CD-1 nude mice 9.5 hours after intraperitoneal insertion was significantly higher than in nonovariectomized mice. Inhibition of HA synthesis by 6-diazo-5-oxo-1-norleucine (DON both in spheroids and ovariectomized mice significantly reduced the number of adhered spheroids. Thus, the change in the hormonal environment during menopause assists in HA-dependent adherence of ovarian cancer spheroids onto the peritoneum. However, HA is antiangiogenic and it can significantly suppress tumor progression. Accordingly, angiogenesis of the adhered spheroids was significantly elevated in DON-treated tumors. These results can explain the selective pressure that can lead to simultaneously increased tumor expression of both HASs and Hyals.

  16. Negative feedback governs gonadotrope frequency-decoding of gonadotropin releasing hormone pulse-frequency.

    Science.gov (United States)

    Lim, Stefan; Pnueli, Lilach; Tan, Jing Hui; Naor, Zvi; Rajagopal, Gunaretnam; Melamed, Philippa

    2009-09-29

    The synthesis of the gonadotropin subunits is directed by pulsatile gonadotropin-releasing hormone (GnRH) from the hypothalamus, with the frequency of GnRH pulses governing the differential expression of the common alpha-subunit, luteinizing hormone beta-subunit (LHbeta) and follicle-stimulating hormone beta-subunit (FSHbeta). Three mitogen-activated protein kinases, (MAPKs), ERK1/2, JNK and p38, contribute uniquely and combinatorially to the expression of each of these subunit genes. In this study, using both experimental and computational methods, we found that dual specificity phosphatase regulation of the activity of the three MAPKs through negative feedback is required, and forms the basis for decoding the frequency of pulsatile GnRH. A fourth MAPK, ERK5, was shown also to be activated by GnRH. ERK5 was found to stimulate FSHbeta promoter activity and to increase FSHbeta mRNA levels, as well as enhancing its preference for low GnRH pulse frequencies. The latter is achieved through boosting the ultrasensitive behavior of FSHbeta gene expression by increasing the number of MAPK dependencies, and through modulating the feedforward effects of JNK activation on the GnRH receptor (GnRH-R). Our findings contribute to understanding the role of changing GnRH pulse-frequency in controlling transcription of the pituitary gonadotropins, which comprises a crucial aspect in regulating reproduction. Pulsatile stimuli and oscillating signals are integral to many biological processes, and elucidation of the mechanisms through which the pulsatility is decoded explains how the same stimulant can lead to various outcomes in a single cell.

  17. Gastric Cancer in the Setting of Persistently Elevated Human Chorionic Gonadotropin: A Case Report

    Directory of Open Access Journals (Sweden)

    LaToya R. Walker

    2011-01-01

    Full Text Available A 35-year-old woman presented to the emergency room for the evaluation of failed surgical and medical management of a suspected ectopic pregnancy. When imaging studies were performed, she had lymphadenopathy and diffuse sclerosis of the osseous framework. Multiple biopsies were performed and revealed poorly differentiated metastatic carcinoma with signet ring features. Esophagogastroduodenoscopy confirmed the findings of a Stage IV gastric adenocarcinoma. Signs and symptoms of gastric carcinoma are vague. However, to our knowledge, an elevation in human chorionic gonadotropin (hCG is not an associated finding. Persistence of hCG has many causes from abnormal pregnancy to menopause and other forms of cancer.

  18. Gastric cancer in the setting of persistently elevated human chorionic gonadotropin: a case report.

    Science.gov (United States)

    Walker, Latoya R; Erler, Brian

    2011-01-01

    A 35-year-old woman presented to the emergency room for the evaluation of failed surgical and medical management of a suspected ectopic pregnancy. When imaging studies were performed, she had lymphadenopathy and diffuse sclerosis of the osseous framework. Multiple biopsies were performed and revealed poorly differentiated metastatic carcinoma with signet ring features. Esophagogastroduodenoscopy confirmed the findings of a Stage IV gastric adenocarcinoma. Signs and symptoms of gastric carcinoma are vague. However, to our knowledge, an elevation in human chorionic gonadotropin (hCG) is not an associated finding. Persistence of hCG has many causes from abnormal pregnancy to menopause and other forms of cancer.

  19. [Mechanism of regulation of synthesis and secretion of human chorionic gonadotropin (hCG) during pregnancy].

    Science.gov (United States)

    Barrera, David; Chirinos, Mayel; García-Becerra, Rocío

    2008-01-01

    Human chorionic gonadotropin (hCG) is an essential hormone for development and sustaining of gestation. Adequate hCG production is fundamental for pregnancy success since abnormal hCG serum concentrations have been correlated with pregnancy anomalies such as recurrent abortions and preeclampsia. Regulation of hCG production involves diverse molecules associated with different signaling pathways, which have complicated the establishment of the mechanisms involved in its production. The present study provides a critical review of the most relevant findings related to hCG production and functions during pregnancy, in order to help to understand some related pathologies and to treat them more adequately.

  20. Neural responses to visual food stimuli after a normal vs. higher protein breakfast in breakfast-skipping teens: a pilot fMRI study.

    Science.gov (United States)

    Leidy, Heather J; Lepping, Rebecca J; Savage, Cary R; Harris, Corey T

    2011-10-01

    This functional magnetic resonance imaging (fMRI) pilot study identified whether breakfast consumption would alter the neural activity in brain regions associated with food motivation and reward in overweight "breakfast skipping" (BS) adolescent girls and examined whether increased protein at breakfast would lead to additional alterations. Ten girls (Age: 15 ± 1 years; BMI percentile 93 ± 1%; BS 5 ± 1×/week) completed 3 testing days. Following the BS day, the participants were provided with, in randomized order, normal protein (NP; 18 ± 1 g protein) or higher protein (HP; 50 ± 1 g protein) breakfast meals to consume at home for 6 days. On day 7 of each pattern, the participants came to the laboratory to consume their respective breakfast followed by appetite questionnaires and an fMRI brain scan to identify brain activation responses to viewing food vs. nonfood images prior to lunch. Breakfast consumption led to enduring (i.e., 3-h post breakfast) reductions in neural activation in the hippocampus, amygdala, cingulate, and parahippocampus vs. BS. HP led to enduring reductions in insula and middle prefrontal cortex activation vs. NP. Hippocampal, amygdala, cingulate, and insular activations were correlated with appetite and inversely correlated with satiety. In summary, the addition of breakfast led to alterations in brain activation in regions previously associated with food motivation and reward with additional alterations following the higher-protein breakfast. These data suggest that increased dietary protein at breakfast might be a beneficial strategy to reduce reward-driven eating behavior in overweight teen girls. Due to the small sample size, caution is warranted when interpreting these preliminary findings.

  1. Predictive Value of Dental Maturity for a Positive Gonadotropin-Releasing Hormone Stimulation Test Result in Girls with Precocious Puberty

    Science.gov (United States)

    2017-01-01

    Dental maturity is associated with skeletal maturity, which is advanced in girls with central precocious puberty (CPP). We investigated the performance of dental maturity as a screening method for CPP using mandibular second premolar and molar calcification stages, assessed the associated anthropometric and laboratory factors, and evaluated pubertal response predictors using the gonadotropin-releasing hormone stimulation test (GnRHST) in prepubertal and pubertal girls. A prospective case-control study was conducted in girls, aged 7.0–8.9 years, classified into pubertal (peak luteinizing hormone [LH] after GnRHST ≥ 5 IU/L), prepubertal (peak LH < 5 IU/L), and control groups. Auxological and biochemical tests, panoramic radiographs, and GnRHSTs in participants with breast development were conducted. Dental maturity was assessed using the Demirjian index (DI). We included 103 girls (pubertal, 40; prepubertal, 19; control, 44). Chronological age (CA) was not significantly different between groups. Bone age (BA) and BA advancement was higher in the pubertal and prepubertal groups. Increased DI values at the mandibular second premolar and molar were significantly associated with CA, BA, BA advancement, height standard deviation score (SDS), peak LH after GnRHST, and insulin-like growth factor-I (IGF-I) (all P < 0.05). Moreover, odds ratio (OR) of the mandibular second premolar and molar (a DI value of ≥ E) for predicting a positive response to GnRHST was 8.7 (95% confidence intervals [CI], 2.9–26.1) and 5.2 (95% CI, 2.2–12.7), respectively. Dental maturity was a strong predictor for diagnosing CPP. Determining dental maturity in girls with suspected precocious puberty might help determine the performance of GnRHSTs. PMID:28049241

  2. Gonadotropin-releasing hormone positively regulates steroidogenesis via extracellular signal-regulated kinase in rat Leydig cells

    Institute of Scientific and Technical Information of China (English)

    Bing Yao; Hai-Yan Liu; Yu-Chun Gu; Shan-Shan Shi; Xiao-Qian Tao; Xiao-Jun Li; Yi-Feng Ge; Ying-Xia Cui; Guo-Bin Yang

    2011-01-01

    Gonadotropin-releasing hormone (GnRH) is secreted from neurons within the hypothalamus and is necessary for reproductive function in all vertebrates. GnRH is also found in organs outside of the brain and plays an important role in Leydig cell steroidogenesis in the testis. However, the signalling pathways mediating this function remain largely unknown. In this study, we investigated whether components of the mitogen-activated protein kinase (MAPK) pathways are involved in GnRH agonist (GnRHa)-induced testis steroidogenesis in rat Leydig cells. Primary cultures of rat Leydig cells were established. The expression of 3β-hydroxysteroid dehydrogenase (3β-HSD) and the production of testosterone in response to GnRHa were examined at different doses and for different durations by RT-PCR, Western blot analysis and radioimmunoassay (RIA). The effects of GnRHa on ERK1/2, JNK and p38 kinase activation were also investigated in the presence or absence of the MAPK inhibitor PD-98059 by Western blot analysis. GnRHa induced testosterone production and upregulated 3β-HSD expression at both the mRNA and protein levels; it also activated ERK1/2, but not JNK and p38 kinase. Although the maximum effects of GnRHa were observed at a concentration of 100 nmnol L-1 after 24 h, activation of ERK1/2 by GnRHa reached peak at 5 min and it returned to the basal level within 60 min. PD-98059 completely blocked the activation of ERK1/2, the upregulation of 3β-HSD and testosterone production. Our data show that GnRH positively regulates steroidogenesis via ERK signalling in rat Leydig cells. ERK1/2 activation by GnRH may be responsible for the induction of 3β-HSDgene expression and enzyme production, which may ultimately modulate steroidogenesis in rat Leydig cells.

  3. 正常豚鼠听性脑干反应与听性稳态反应的对比%Comparison of auditory brainstem response and auditory steady-state response in normal guinea pigs

    Institute of Scientific and Technical Information of China (English)

    鄢慧琴; 王海涛; 周枫; 黄利芬

    2011-01-01

    Objective To compare the difference of the threshold of normal guinea pigs between auditory brainstem response (ABR) and auditory steady state response (ASSR), and provide a theoretical basis for hearing research on guinea pigs.Methods 12 guinea pigs (24 ears) with normal hearing sedated by pentobarbital sodium were selected for the ABR and ASSR tests.The click- ABR stimulation rate was 11.1 beats/s, and the Ⅱ wave thresholds were recorded as the ABR response threshold.The carrier frequencies (CF) of ASSR were 0.5,1,2,3,4 and 6 kHz, the modulation frequency (MF) was 154 Hz, and the threshold of each carrier frequency was recorded.Results The threshold of ASSR was higher than that of ABR at 0.5-4 kHz CF in normal guinea pigs( P <0.01 ), but no significant difference was found at 6 kHz CF(P >0.05).Conclusion There are significant differences in most thresholds of ASSR and ABR in normal guinea pigs.However, there is no significant difference at 6 kHz CF.Therefore, the differences caused by different CF of ASSR must be noted when assessing the heating of guinea pigs.%目的 比较正常豚鼠听性脑干反应(ABR)和听性稳态反应(ASSR)阈值的差异,为利用豚鼠进行听力学研究提供理论依据.方法 选正常听力豚鼠12只(24耳),在戊巴比妥钠镇静状态下,分别行ABR和ASSR测试.ABR为click刺激声,刺激率为11.1次/s,记录ABR的Ⅱ渡反应阈值.ASSR载波频率(CF)为0.5、1、2、3、4、6 kHz,调制频率(MF)为154 Hz,记录各载频的反应阅值.结果 正常豚鼠ASSR反应阈值高于ABR反应阈值,CF:0.5.4 kHz时.ABR与ASSR阈值间有统计学差异(P0.05).结论 正常豚鼠ABR与ASSR阈值间存在较大差值,但ABR与6 kHz的ASSR阈值间无显著差异.故对豚鼠进行听阈评估时,要注意两者间由于ASSR载波频率不同所引起的差异.

  4. Extended Analyses of the German IVF Registry (DIR: Andrological Aspects, Medical-Economical Assumptions Related to the Shift from IVF to ICSI and Stimulation with Gonadotropins

    Directory of Open Access Journals (Sweden)

    Bals-Pratsch M

    2010-01-01

    Full Text Available In addition to the annual report of the German IVF Registry (D·I·R the database of 498,784 ART cycles between 1998 and 2008 was analysed for aspects regarding andrology, medical and economical aspects of ICSI and stimulation with gonadotropins. The indication for an ICSI procedure is related to the retrieval of sperm. Seven percent of all ART cycles in the DIR are already performed with epididymal or testicular sperm due to azoospermia. The analysis of cycles with testicular sperm revealed that fertilisation and pregnancy rates are reduced in comparison to ejaculated or frozen sperm, but miscarriage and birth rates do not increase. The data recording of lifestyle parameters can be valuable in the future. The analysis of the D·I·R data demonstrates that restrictions on the reimbursement for ART cycles have significant impact on the use of IVF and ICSI treatments. Medical indications rather than economic reasons seem to be responsible for the increase in ICSI treatment. Since the commercial launch of GnRH antagonists in 1999 and 2000 more than 90 % of IVF and ICSI protocols in Germany are now performed with GnRH agonists (54.8 % and GnRH antagonists (31.5 %. Approximately 90% of the IVF and ICSI cycles in Germany are performed with recombinant FSH (rFSH, highly purified menotropin (HP-hMG or a combination of both. Non-medical factors can influence the choice of gonadotropins for stimulation. Women beyond the age of 34 probably have better IVF or ICSI outcome when the stimulation is performed with rFSH. J

  5. Changes in gonadotropin-releasing hormone and gonadotropin-releasing hormone receptor gene expression after an increase in carbon monoxide concentration in the cavernous sinus of male wild boar and pig crossbread.

    Science.gov (United States)

    Romerowicz-Misielak, M; Tabecka-Lonczynska, A; Koziol, K; Gilun, P; Stefanczyk-Krzymowska, S; Och, W; Koziorowski, M

    2016-06-01

    Previous studies indicate that there are at least a few regulatory systems involved in photoperiodic synchronisation of reproductive activity, which starts with the retina and ends at the gonadotropin-releasing hormone (GnRH) pulse generator. Recently we have shown indicated that the amount of carbon monoxide (CO) released from the eye into the ophthalmic venous blood depends on the intensity of sunlight. The aim of this study was to test whether changes in the concentration of carbon monoxide in the ophthalmic venous blood may modulate reproductive activity, as measured by changes in GnRH and GnRH receptor gene expression. The animal model used was mature male swine crossbred from wild boars and domestic sows (n = 48). We conducted in vivo experiments to determine the effect of increased CO concentrations in the cavernous sinus of the mammalian perihypophyseal vascular complex on gene expression of GnRH and GnRH receptors as well as serum luteinizing hormone (LH) levels. The experiments were performed during long photoperiod days near the summer solstice (second half of June) and short photoperiod days near the winter solstice (second half of December). These crossbred swine demonstrated a seasonally-dependent marked variation in GnRH and GnRH receptor gene expression and systemic LH levels in response to changes in CO concentration in ophthalmic venous blood. These results seem to confirm the hypothesis of humoral phototransduction as a mechanism for some of bright light's effects in animal chronobiology and the effect of CO on GnRH and GnRH receptor gene expression.

  6. Oxytocin/vasopressin and gonadotropin-releasing hormone from cephalopods to vertebrates.

    Science.gov (United States)

    Minakata, Hiroyuki

    2010-07-01

    Recent advances in peptide search methods have revealed two peptide systems that have been conserved through metazoan evolution. Members of the oxytocin/vasopressin-superfamily have been identified from protostomian and deuterostomian animals, indicating that the oxytocin/vasopressin hormonal system represents one of the most ancient systems. In most protostomian animals, a single member of the superfamily shares oxytocin-like and vasopressin-like actions. Co-occurrence of two members has been discovered in modern cephalopods, octopus, and cuttlefish. We propose that cephalopods have developed two peptides in the molluscan evolutionary lineage like vertebrates have established two lineages in the oxytocin/vasopressin superfamily. The existence of gonadotropin-releasing hormone (GnRH) in protostomian animals was initially suggested by immunohistochemical analysis using chordate GnRH antibodies. A peptide with structural features similar to those of chordate GnRHs was originally isolated from octopus, and an identical peptide has been characterized from squid and cuttlefish. Novel forms of GnRH-like molecules from other molluscs, an annelid, arthropods, and nematodes demonstrate somewhat conserved structures at the N-terminal regions; but structures of the C-terminal regions critical to gonadotropin-releasing activity are diverse. These findings may be important for the study of the molecular evolution of GnRH in protostomian animals.

  7. Ovarian hyperstimulation syndrome prevention strategies: reducing the human chorionic gonadotropin trigger dose.

    Science.gov (United States)

    Kashyap, Sonya; Parker, Kasey; Cedars, Marcelle I; Rosenwaks, Zev

    2010-11-01

    This article reviews the biological plausibility and evidence for the use of a low triggering dose of human chorionic gonadotropin (hCG) in the prevention of ovarian hyperstimulation syndrome (OHSS). A systematic search of the literature revealed very little published data for or against the use of low-dose hCG in the prevention of OHSS after assisted reproductive technology. We have had success at avoiding OHSS as a result of gentle stimulation and low-dose sliding scale hCG trigger based on estradiol (E₂) levels. We therefore present the biological plausibility for such an approach by reviewing the relationship between OHSS, vascular endothelial growth factor, and hCG; the physiology of hCG; the relationship between risk of OHSS and E₂ at trigger; and the physiology of alternative methods of triggering such as recombinant luteinizing hormone and gonadotropin-releasing hormone agonist. We also present the results of a quasi-experimental before and after study of the sliding scale protocol for hCG trigger dose in in vitro fertilization with or without intracytoplasmic sperm injection cycles.

  8. Ovarian hyperstimulation syndrome prevention strategies: use of gonadotropin-releasing hormone antagonists.

    Science.gov (United States)

    Griesinger, Georg

    2010-11-01

    The most serious complication of ovarian stimulation for in vitro fertilization is severe ovarian hyperstimulation syndrome (OHSS), a rare but potentially life-threatening condition. The present review discusses the place of gonadotropin-releasing hormone antagonists (GnRH-ant) in primary, secondary, and tertiary prevention of OHSS. Sound evidence indicates that the routine use of GnRH-ant instead of GnRH agonists (GnRHa) during ovarian stimulation drastically reduces the relative risk of OHSS. GnRH-ant are therefore useful for primary OHSS prevention, and an increased use of antagonists should help reduce the overall incidence of severe OHSS with its associated risks and complications. In patients on antagonist protocols identified to be at risk of developing severe OHSS, replacing human chorionic gonadotropin with GnRHa as a trigger of final oocyte maturation has been proposed as an effective measure of secondary prevention. A concept of combining GnRHa triggering with cryopreservation of all oocytes or embryos has yielded promising results as far as total avoidance of OHSS is concerned while providing a good chance of pregnancy for the patient in later frozen-thawed embryo transfers. In patients with early onset of OHSS, reinitiation of GnRH-ant in the luteal phase as a measure of tertiary prevention might lead to rapid regression of the syndrome; however only limited data on this new concept are available in the literature.

  9. Pituitary thyrotropin and gonadotropin of coho salmon (Oncorhynchus kisutch): separation by chromatofocusing.

    Science.gov (United States)

    Swanson, P; Dickhoff, W W; Gorbman, A

    1987-02-01

    Thyrotropin (TSH) and gonadotropin (GTH) were isolated from adult female coho salmon pituitary glands. After final extraction in acidic alcohol and precipitation in 85% ethanol, proteins were fractionated using gel filtration chromatography and chromatofocusing. Homologous bioassay systems were used to monitor bioactivity during the purification procedures. TSH activity was measured in vivo in coho salmon parr. GTH (steroidogenic) activity was determined in vitro using cultures of adult coho salmon ovarian follicles. Using these procedures, TSH and GTH activities were separated. TSH activity eluted as one major peak at pH 6.3 whereas GTH activity eluted as five major peaks at pH's 5.4, 5.0, 4.7, 4.3, and after 1.0 M NaCl on chromatofocusing. Molecular weights of the TSH and GTHs were estimated by gel filtration chromatography as 35 and 40 kDa, respectively. Like other vertebrate TSHs and gonadotropins, the coho salmon TSH and GTHs appeared to consist of two subunits. Coho salmon TSH and bovine TSH (bTSH) were equipotent in the TSH bioassay. The five coho salmon GTHs exhibited similar potencies in stimulating ovarian estradiol synthesis in vitro. Further biochemical analysis and tests for other gonadotropic activities are warranted to determine if these five GTHs are isoforms of one GTH or if they can be distinguished functionally in other GTH bioassays. Sufficient quantities of coho salmon TSH were isolated in this study for future studies of the hypothalamic-pituitary-thyroid axis in fish.

  10. Treatment of canine pyometra with the gonadotropin-releasing hormone antagonist acyline: a case series.

    Science.gov (United States)

    Batista, Pablo R; Blanco, Paula G; Gobello, Cristina

    2015-03-01

    To describe the effect of the third-generation gonadotropin-releasing hormone antagonist acyline in the treatment of 4 diestrous bitches with the cystic endometrial hyperplasia-pyometra complex. The 4 bitches were treated with 330 μg/kg of subcutaneous acyline on day 0 and antibiotics, and followed up for 2 weeks. One closed-cervix case showed cervical dilatation 36 hours after treatment, and all the 4 animals showed resolution of clinical signs starting on day 3 posttreatment. Ultrasonographic uterine diameters and luminal contents decreased in the bitches having high progesterone serum concentrations before treatment but not in those with low levels. Serum progesterone importantly decreased from high to basal concentrations in the 3 "ultrasonographically cured" animals. No local or systemic side effects related to the treatment were observed. The gonadotropin-releasing hormone antagonist acyline may have a promising place for the medical treatment of cystic endometrial hyperplasia-pyometra complex in dogs. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Gonadotropin-releasing hormone modulates cholesterol synthesis and steroidogenesis in SH-SY5Y cells.

    Science.gov (United States)

    Rosati, Fabiana; Sturli, Niccolò; Cungi, Maria Chiara; Morello, Matteo; Villanelli, Fabio; Bartolucci, Gianluca; Finocchi, Claudia; Peri, Alessandro; Serio, Mario; Danza, Giovanna

    2011-04-01

    Neurosteroids are involved in Central Nervous System development, brain functionality and neuroprotection but little is known about regulators of their biosynthesis. Recently gonadotropins, Gonadotropin-releasing Hormone (GnRH) and their receptors have been localized in different brain regions, such as hippocampus and cortex. Using human neuronal-like cells we found that GnRH up-regulates the expression of key genes of cholesterol and steroid synthesis when used in a narrow range around 1.0 nM. The expression of Hydroxysterol D24-reductase (seladin-1/DHCR24), that catalyzes the last step of cholesterol biosynthesis, is increased by 50% after 90 min of incubation with GnRH. StAR protein and P450 side chain cleavage (P450scc) are up-regulated by 3.3 times after 90 min and by 3.5 times after 3 h, respectively. GnRH action is mediated by LH and 1.0 nM GnRH enhances the expression of LHβ as well. A two fold increase of cell cholesterol is induced after 90 min of GnRH incubation and 17β-estradiol (E2) production is increased after 24, 48 and 72 h. These data indicate for the first time that GnRH regulates both cholesterol and steroid biosynthesis in human neuronal-like cells and suggest a new physiological role for GnRH in the brain.

  12. Diurnal rhythm in serum levels of inhibin B in normal men

    DEFF Research Database (Denmark)

    Carlsen, E; Olsson, C; Petersen, J H

    1999-01-01

    Inhibin B is a testicular glycoprotein that is secreted from the Sertoli cells and believed to play a role in FSH secretion. We characterized the diurnal profile of serum inhibin B and the relation to gonadotropins and testicular steroids. Serum inhibin B was measured in 13 healthy normal male......-dimensional time-series analyses revealed a statistically significant influence of testosterone on inhibin B. In addition, estradiol and inhibin B had a significant influence on one another. In conclusion, we found a significant diurnal variation in inhibin B levels in normal men, with a pattern of higher values...

  13. Influence of estradiol, progesterone, and nutrition on concentrations of gonadotropins and GnRH receptors, and abundance of mRNA for GnRH receptors and gonadotropin subunits in pituitary glands of beef cows.

    Science.gov (United States)

    Looper, M L; Vizcarra, J A; Wettemann, R P; Malayer, J R; Braden, T D; Geisert, R D; Morgan, G L

    2003-01-01

    Nutritionally induced anovulatory cows (n = 28) were used to determine the effect of steroids on regulation of synthesis and secretion of gonadotropins. Anovulatory cows were ovariectomized and received intravaginal inserts containing estradiol (E2), progesterone (P4), E2 and P4 (E2P4), or a sham intravaginal insert (C) for 7 d. Concentrations of luteinizing hormone (LH) and follicle-stimulating hormone (FSH) were quantified in serum and E2 and P4 were quantified in plasma. Cows were exsanguinated within 1 to 2 h after removal of intravaginal inserts and pituitary glands were collected and stored at -80 degrees C until messenger ribonucleic acid (mRNA) for gonadotropin-releasing hormone receptor (GnRH-R) and gonadotropin subunits, pituitary content of GnRH-R, and LH and FSH were quantified. Pituitary glands from five proestrous cows were harvested to compare gonadotropin characteristics between ovariectomized, anovulatory cows and intact cows. Plasma concentrations of E2 were greater (P nutritionally induced anovulatory cows was increased (P nutritionally induced anovulatory cows with progesterone and estradiol may cause pulsatile secretion of LH.

  14. Association of basal serum testosterone levels with ovarian response and in vitro fertilization outcome

    Directory of Open Access Journals (Sweden)

    Sun Mei

    2011-01-01

    Full Text Available Abstract Background To evaluate basal testosterone (T levels during follicular phase of the menstrual cycle as a predictor for ovarian response and in vitro fertilization (IVF outcome. Method We analyzed data retrospectively from hospital-based IVF center including one thousand two hundred and sixty Chinese Han women under their first IVF cycle reached the ovum pick-up stage, without polycystic ovary syndrome (PCOS or endometriosis undergoing long IVF protocol. Patients were divided into 2 groups. Group 1: patients with diminished ovarian reserve (basal FSH >10 IU/L (n = 187; Group 2: patients with normal ovarian reserve (basal FSH Results Basal T levels were markly different between pregnant and non-pregnant women in Group 1; whereas not in Group 2. A testosterone level of 47.85 ng/dl was shown to predict pregnancy outcome with a sensitivity of 52.8% and specificity of 65.3%; and the basal T was correlated with the numbers of large follicles (> 14 mm on HCG day in Group 1. Significantly negative correlations were observed between basal T, days of stimulation and total dose of gonadotropins after adjusting for confounding factors in both groups. Conclusion In women with diminished ovarian reserve, basal T level was a predictor for the number of large follicles on HCG day and pregnancy outcome; but could not in those with normal serum FSH. Basal T levels were associated with both days of stimulation and total dose of gonadotropins, indicating that lower level of T might relate with potential ovarian poor response.

  15. Predicting the effect of gonadotropin-releasing hormone (GnRH) analogue treatment on uterine leiomyomas based on MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Matsuno, Y.; Yamashita, Y.; Takahashi, M. [Dept. of Radiology, Kumamoto Univ. School of Medicine, Kumamoto (Japan); Katabuchi, H.; Okamura, H. [Dept. of Gynecology and Obstetrics, Kumamoto Univ. School of Medicine, Kumamoto (Japan); Kitano, Y.; Shimamura, T. [Dept. of Gynecology and Obstetrics, Amakusa Chuou General Hospital, Hondo (Japan)

    1999-11-01

    Purpose: To test the hypothesis that the simple assessment of signal intensity on T2-weighted MR images is predictive of the effect of hormonal treatment with gonadotropin-releasing hormone (GnRH) analogue. Material and methods: The correlation between T2-weighted MR imaging of uterine leiomyomas and histologic findings was evaluated using 85 leiomyomas from 62 females who underwent myomectomy or hysterectomy. We also correlated the pretreatment MR images features obtained in 110 women with 143 leiomyomas with the effect of GnRH analogue treatment. The size (length x width x depth) of the leiomyoma was evaluated before and at 6 months after treatment by ultrasound. Results: The proportion of leiomyoma cell fascicles and that of extracellular matrix affected signal intensities of uterine leiomyomas on T2-weighted MR images. The amount of extracellular matrix was predominant in hypointense leiomyomas on T2-weighted images, while diffuse intermediate signal leiomyomas were predominantly composed of leiomyoma cell fascicles. Marked degenerative changes were noted in leiomyomas with heterogenous hyperintensity. The homogeneously intermediate signal intensity leiomyomas showed significant size reduction after treatment (size ratio; posttreatment volume/pretreatment volume 0.29{+-}0.11). The size ratio for the hypointense tumors was 0.82{+-}0.14, and 0.82{+-}0.18 for the heterogeneously hyperintense tumors. There was a significant difference in the response to treatment between the homogeneously intermediate signal intensity leiomyomas and the hypointense or heterogeneously hyperintense leiomyomas (both p<0.01). Conclusion: Signal intensity on T2-weighted MR images depends on the amount of leiomyoma cell fascicles and extracellular matrix. Simple assessment of the MR signal intensity is useful in predicting the effect of GnRH analogue on uterine leiomyomas. (orig.)

  16. The estrogen myth: potential use of gonadotropin-releasing hormone agonists for the treatment of Alzheimer's disease.

    Science.gov (United States)

    Casadesus, Gemma; Garrett, Matthew R; Webber, Kate M; Hartzler, Anthony W; Atwood, Craig S; Perry, George; Bowen, Richard L; Smith, Mark A

    2006-01-01

    Estrogen and other sex hormones have received a great deal of attention for their speculative role in Alzheimer's disease (AD), but at present a direct connection between estrogen and the pathogenesis of AD remains elusive and somewhat contradictory. For example, on one hand there is a large body of evidence suggesting that estrogen is neuroprotective and improves cognition, and that hormone replacement therapy (HRT) at the onset of menopause reduces the risk of developing AD decades later. However, on the other hand, studies such as the Women's Health Initiative demonstrate that HRT initiated in elderly women increases the risk of dementia. While estrogen continues to be investigated, the disparity of findings involving HRT has led many researchers to examine other hormones of the hypothalamic-pituitary-gonadal axis such as luteinising hormone (LH) and follicle-stimulating hormone. In this review, we propose that LH, rather than estrogen, is the paramount player in the pathogenesis of AD. Notably, both men and women experience a 3- to 4-fold increase in LH with aging, and LH receptors are found throughout the brain following a regional pattern remarkably similar to those neuron populations affected in AD. With respect to disease, serum LH level is increased in women with AD relative to non-diseased controls, and levels of LH in the brain are also elevated in AD. Mechanistically, we propose that elevated levels of LH may be a fundamental instigator responsible for the aberrant reactivation of the cell cycle that is seen in AD. Based on these aforementioned aspects, clinical trials underway with leuprolide acetate, a gonadotropin-releasing hormone agonist that ablates serum LH levels, hold great promise as a ready means of treatment in individuals afflicted with AD.

  17. Gradual reduction of testosterone using a gonadotropin-releasing hormone vaccination delays castration resistance in a prostate cancer model

    Science.gov (United States)

    Barranco, Jesús A. Junco; Millar, Robert P.; Fuentes, Franklin; Bover, Eddy; Pimentel, Eulogio; Basulto, Roberto; Calzada, Lesvia; Morán, Rolando; Rodríguez, Ayni; Garay, Hilda; Reyes, Osvaldo; Castro, Maria D.; Bringas, Ricardo; Arteaga, Niurka; Toudurí, Henio; Rabassa, Mauricio; Fernández, Yairis; Serradelo, Andrés; Hernández, Eduardo; Guillén, Gerardo E.

    2016-01-01

    In a previous study aimed to design a novel prostate cancer vaccine, the authors of the present study demonstrated the advantage of combining the adjuvants Montanide ISA 51 with very small size proteoliposomes (VSSP) to promote a significant humoral immune response to gonadotropin-releasing hormone (GnRH) in healthy animals. The present study compared the efficacy of this vaccine formulation versus the standard treatment currently available in terms of preventing the development of tumors in DD/S mice injected with Shionogi carcinoma (SC) 115 cells. The results demonstrated that 5 non-vaccinated control mice exhibited a fast tumor growth, and succumbed to the disease within 19–31 days. Mice immunized with the GnRH/Montanide ISA 51/VSSP vaccine exhibited a moderate decline in testosterone levels that was associated with a decrease in anti-GnRH antibody titers, which lead to a sustained tumor growth inhibition. In total, 2 mice in the immunized group exhibited complete remission of the tumor for the duration of the present study. In addition, castrated mice, which were used as a control for standard hormonal therapy, exhibited an accelerated decrease in tumor size. However, tumor relapse was observed between days 50 and 54, and between days 65 and 85, following the injection of SC 155 cells. Therefore, these mice were sacrificed at day 90. The present study concludes that the slow and moderate reduction of testosterone levels observed using the GnRH-based vaccine may delay the appearance of castration resistance in a Shionogi prostate cancer model. These findings suggest that this vaccine may be used to delay castration resistance in patients with prostate cancer. PMID:27446378

  18. Structural and Functional Divergence of Gonadotropin-Inhibitory Hormone (GnIH from Jawless Fish to Mammals

    Directory of Open Access Journals (Sweden)

    Satoshi eOgawa

    2014-10-01

    Full Text Available Gonadotropin-inhibitory hormone (GnIH was discovered as a novel hypothalamic peptide that inhibits gonadotropin release in the quail. The presence of GnIH-homologous peptides and its receptors (GnIHRs have been demonstrated in various vertebrate species including teleosts, suggesting that the GnIH-GnIHR family is evolutionarily conserved. In avian and mammalian brain, GnIH neurons are localised in the hypothalamic nuclei and their neural projections are widely distributed. GnIH acts on the pituitary and gonadotropin-releasing hormone (GnRH neurons to inhibit reproductive functions by decreasing gonadotropin release and synthesis. In addition, GnIH-GnIHR signalling is regulated by various factors such as environmental cues and stress. However, the function of fish GnIH-orthologs remain inconclusive because the physiological properties of fish GnIH peptides are debatable. This review summarizes the current research progress in GnIH-GnIHR signalling and their physiological functions in vertebrates with special emphasis on non-mammalian vertebrate species.

  19. Biological variation of free β chorionic gonadotropin and pregnancy-associated plasma protein A in first trimester pregnancies

    DEFF Research Database (Denmark)

    Sennels, Henriette P; Jørgensen, Finn Stener; Sørensen, Steen

    2011-01-01

    Abstract Background: Trisomy 21 risk estimation in first trimester pregnancies can be performed by a combined test based on ultrasound measurement of fetal nuchal translucency thickness and maternal plasma concentrations of free ß human chorionic gonadotropin (hCGß) and pregnancy-associated plasma...

  20. Biological variation of free β chorionic gonadotropin and pregnancy-associated plasma protein A in first trimester pregnancies

    DEFF Research Database (Denmark)

    Sennels, Henriette P; Jørgensen, Finn Stener; Sørensen, Steen

    2011-01-01

    Abstract Background: Trisomy 21 risk estimation in first trimester pregnancies can be performed by a combined test based on ultrasound measurement of fetal nuchal translucency thickness and maternal plasma concentrations of free β human chorionic gonadotropin (hCGβ) and pregnancy-associated plasma...

  1. P-fimbriae of Escherichia coli as carriers for gonadotropin releasing hormone: development of a recombinant contraceptive vaccine

    NARCIS (Netherlands)

    Zee, van der A.; Noordegraaf, C.V.; Bosch, van den H.; Gielen, J.; Bergmans, H.; Hoekstra, W.; Die, van I.

    1995-01-01

    The demand for an effective and low cost means of fertility control of domestic animals has raised interest in the development of contraceptive vaccines. A promising candidate for a vaccine component is the brain peptide gonadotropin releasing hormone (GnRH), which plays a central role in the regula

  2. Extension of the clomiphene citrate stair-step protocol to gonadotropin treatment in women with clomiphene resistant polycystic ovarian syndrome.

    Science.gov (United States)

    Horowitz, Eran; Levran, David; Weissman, Ariel

    2017-04-28

    Our objective was to evaluate the safety and efficacy of direct initiation of gonadotropin ovarian stimulation without prior withdrawal bleeding in anovulatory clomiphene citrate (CC) resistant polycystic ovarian syndrome (PCOS) patients. Eighteen PCOS patients underwent ovulation induction with CC using a stair-step regimen. Patients who failed to respond to the maximal dose of CC initiated gonadotropin stimulation without inducing withdrawal bleeding, using the chronic low dose regimen. The primary outcome measure was the time to ovulation from the beginning of CC treatment until the day of ovulatory trigger. This was compared with the time to ovulation calculated according to the traditional approach, which includes inducing progesterone withdrawal bleeding between each CC dose increment and before gonadotropin therapy. The time to ovulation in the study group was 67.0 ± 6.8 days. The estimated time to ovulation according to the traditional approach was approximately 110 days. The clinical pregnancy rate was 44% (8/18), and all pregnancies were singletons. One patient miscarried; hence the live birth rate was 38.9% (7/18). Direct initiation of gonadotropin therapy without prior induction of withdrawal bleeding in clomiphene resistant PCOS patients results in considerable reduction of the time to ovulation and is both safe and efficacious.

  3. Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

    Directory of Open Access Journals (Sweden)

    Rui Song

    2011-05-01

    Full Text Available Basic fibroblast growth factor (bFGF regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL. The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01. The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05, while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01. These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

  4. Hair-Normalized Cortisol Waking Response as a Novel Biomarker of Hypothalamic-Pituitary-Adrenal Axis Activity following Acute Trauma: A Proof-of-Concept Study with Pilot Results

    Directory of Open Access Journals (Sweden)

    David M. Walton

    2013-01-01

    Full Text Available The mechanisms underlying the development of persistent posttraumatic pain and disability remain elusive. Recent evidence suggests that disordered stress-system pathway (hypothalamic-pituitary-adrenal axis activity may be responsible for the genesis and maintenance of long-term sensory and emotional problems. However, confidence in current evidence is limited by the necessarily retrospective collection of data. Hair cortisol can serve as a calendar of HPA axis activity going back several months prior to injury. The purposes of this pilot study were to determine the feasibility of using hair cortisol and hair-normalized salivary cortisol as biomarkers of distress following traumatic injuries of whiplash or distal radius fracture. Ten subjects provided complete data within 3 weeks of injury. Hair cortisol, cortisol waking response (CWR, and mean daily cortisol (MDC were captured at inception, as were self-report indicators of pain, disability, and pain catastrophizing. Pain and disability were also captured 3 months after injury. Results indicate that cortisol waking response may be a useful biomarker of current distress as measured using the pain catastrophizing scale, especially when normalized to 3-month hair cortisol (r=0.77 raw, 0.93 normalized. Hair-normalized CWR may also have predictive capacity, correlating with 3-month self-reported disability at r=0.70. While promising, the results must be viewed in light of the small sample.

  5. Review: Regulatory mechanisms of gonadotropin-inhibitory hormone (GnIH synthesis and release in photoperiodic animals

    Directory of Open Access Journals (Sweden)

    Kazuyoshi eTsutsui

    2013-04-01

    Full Text Available Gonadotropin-inhibitory hormone (GnIH is a novel hypothalamic neuropeptide that was discovered in quail as an inhibitory factor for gonadotropin release. GnIH inhibits gonadotropin synthesis and release in birds through actions on gonadotropin-releasing hormone (GnRH neurons and gonadotropes, mediated via the GnIH receptor (GnIH-R, GPR147. Subsequently, GnIH was identified in mammals and other vertebrates. As in birds, mammalian GnIH inhibits gonadotropin secretion, indicating a conserved role for this neuropeptide in the control of the hypothalamic-pituitary-gonadal (HPG axis across species. Identification of the regulatory mechanisms governing GnIH expression and release is important in understanding the physiological role of the GnIH system. A nocturnal hormone, melatonin, appears to act directly on GnIH neurons through its receptor to induce expression and release of GnIH in quail, a photoperiodic bird. Recently, a similar, but opposite, action of melatonin on the inhibition of expression of mammalian GnIH was shown in hamsters and sheep, photoperiodic mammals. These results in photoperiodic animals demonstrate that GnIH expression is photoperiodically modulated via a melatonin-dependent process. Recent findings indicate that GnIH may be a mediator of stress-induced reproductive disruption in birds and mammals, pointing to a broad role for this neuropeptide in assessing physiological state and modifying reproductive effort accordingly. This paper summarizes the advances made in our knowledge regarding the regulation of GnIH synthesis and release in photoperiodic birds and mammals. This paper also discusses the neuroendocrine integration of environmental signals, such as photoperiods and stress, and internal signals, such as GnIH, melatonin and glucocorticoids, to control avian and mammalian reproduction.

  6. Two gonadotropin-releasing hormone receptor subtypes with distinct ligand selectivity and differential distribution in brain and pituitary in the goldfish (Carassius auratus)

    OpenAIRE

    Illing, Nicola; Troskie, Brigitte E.; Nahorniak, Carol S.; Janet P Hapgood; Peter, Richard E.; Millar, Robert P.

    1999-01-01

    In the goldfish (Carassius auratus) the two endogenous forms of gonadotropin-releasing hormone (GnRH), namely chicken GnRH II ([His5,Trp7,Tyr8]GnRH) and salmon GnRH ([Trp7,Leu8]GnRH), stimulate the release of both gonadotropins and growth hormone from the pituitary. This control is thought to occur by means of the stimulation of dist