WorldWideScience

Sample records for normal gonadotropin responsiveness

  1. Primary pulmonary choriocarcinoma after human chorionic gonadotropin normalization following hydatidiform mole

    DEFF Research Database (Denmark)

    Maestá, Izildinha; Leite, Fábio Vicente; Michelin, Odair Carlito

    2010-01-01

    BACKGROUND: Primary pulmonary choriocarcinoma (PPC) is rare and frequently leads to death. CASES: Two young patients presented with previous molar pregnancy and spontaneous serum human chorionic gonadotropin (hCG) normalization. Patient 1 was referred to our center after partial response to chemo...

  2. Application of radioreceptor assay for chorionic gonadotropin in diagnosis of normal and disturbed pregnancy

    International Nuclear Information System (INIS)

    Koch, R.; Schmidt-Gollwitzer, M.; Nevinny-Stickel, J.

    1977-01-01

    For diagnoses of normal and disturbed pregnancy, a radioreceptor assay (RRA) for the detection of chorionic gonadotropin (HLG) has been developed. The hormone was labelled with 125 I. Compared with biological and immunological methods, the RRA has a higher sensitivity and a shorter evaluation time. (orig./VJ) [de

  3. The Forkhead Transcription Factor, FOXP3, Is Required for Normal Pituitary Gonadotropin Expression in Mice1

    Science.gov (United States)

    Jung, Deborah O.; Jasurda, Jake S.; Egashira, Noboru; Ellsworth, Buffy S.

    2012-01-01

    ABSTRACT The hypothalamic-pituitary-gonadal axis is central to normal reproductive function. This pathway begins with the release of gonadotropin-releasing hormone in systematic pulses by the hypothalamus. Gonadotropin-releasing hormone is bound by receptors on gonadotroph cells in the anterior pituitary gland and stimulates the synthesis and secretion of luteinizing hormone and, to some extent, follicle-stimulating hormone. Once stimulated by these glycoprotein hormones, the gonads begin gametogenesis and the synthesis of sex hormones. In humans, mutations of the forkhead transcription factor, FOXP3, lead to an autoimmune disorder known as immunodysregulation, polyendocrinopathy, and enteropathy, X-linked syndrome. Mice with a mutation in the Foxp3 gene have a similar autoimmune syndrome and are infertile. To understand why FOXP3 is required for reproductive function, we are investigating the reproductive phenotype of Foxp3 mutant mice (Foxp3sf/Y). Although the gonadotroph cells appear to be intact in Foxp3sf/Y mice, luteinizing hormone beta (Lhb) and follicle-stimulating hormone beta (Fshb) expression are significantly decreased, demonstrating that these mice exhibit a hypogonadotropic hypogonadism. Hypothalamic expression of gonadotropin-releasing hormone is not significantly decreased in Foxp3sf/Y males. Treatment of Foxp3sf/Y males with a gonadotropin-releasing hormone receptor agonist does not rescue expression of Lhb or Fshb. Interestingly, we do not detect Foxp3 expression in the pituitary or hypothalamus, suggesting that the infertility seen in Foxp3sf/Y males is a secondary effect, possibly due to loss of FOXP3 in immune cells. Pituitary expression of glycoprotein hormone alpha (Cga) and prolactin (Prl) are significantly reduced in Foxp3sf/Y males, whereas the precursor for adrenocorticotropic hormone, pro-opiomelanocortin (Pomc), is increased. Human patients diagnosed with IPEX often exhibit thyroiditis due to destruction of the thyroid gland by

  4. Gestational trophoblastic neoplasia after spontaneous human chorionic gonadotropin normalization following molar pregnancy evacuation.

    Science.gov (United States)

    Braga, Antonio; Maestá, Izildinha; Matos, Michelle; Elias, Kevin M; Rizzo, Julianna; Viggiano, Maurício Guilherme Campos

    2015-11-01

    To evaluate the risk of gestational trophoblastic neoplasia (GTN) after spontaneous human chorionic gonadotropin normalization in postmolar follow-up. Retrospective chart review of 2284 consecutive cases of hydatidiform mole with spontaneous normalization of hCG following uterine evacuation treated at one of five Brazilian reference centers from January 2002 to June 2013. After hCG normalization, GTN occurred in 10/2284 patients (0.4%; 95% CI 0.2%-0.8%). GTN developed in 9/1424 patients (0.6%; 95% CI 0.3%-1.2%) after a complete hydatidiform mole, in 1/849 patients (0.1%; 95% CInormalization was 18months, and no diagnoses were made before six months of postmolar surveillance. Patients who required more than 56days to achieve a normal hCG value had a ten-fold increased risk of developing GTN after hCG normalization (9/1074; 0.8%; 95% CI 0.4%-1.6%) compared to those who reached a normal hCG level in fewer than 56days (1/1210;0.08%; 95% CInormalization following molar pregnancy is exceedingly rare, and the few patients who do develop GTN after achieving a normal hCG value are likely to be diagnosed after completing the commonly recommended six months of postmolar surveillance. Current recommendations for surveillance after hCG normalization should be revisited. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Using the ovarian sensitivity index to define poor, normal, and high response after controlled ovarian hyperstimulation in the long gonadotropin-releasing hormone-agonist protocol: suggestions for a new principle to solve an old problem.

    Science.gov (United States)

    Huber, Malin; Hadziosmanovic, Nermin; Berglund, Lars; Holte, Jan

    2013-11-01

    To explore the utility of using the ratio between oocyte yield and total dose of FSH, i.e., the ovarian sensitivity index (OSI), to define ovarian response patterns. Retrospective cross-sectional study. University-affiliated private center. The entire unselected cohort of 7,520 IVF/intracytoplasmic sperm injection treatments (oocyte pick-ups [OPUs]) during an 8-year period (long GnRH agonist-recombinant FSH protocol). None. The distribution of the OSI (oocytes recovered × 1,000/total dose of FSH), the cutoff levels for poor and high response, set at ±1 SD, and the relationship between OSI and treatment outcome. OSI showed a log-normal distribution with cutoff levels for poor and high response at 1.697/IU and 10.07/IU, respectively. A nomogram is presented. Live-birth rates per OPU were 10.5 ± 0.1%, 26.9 ± 0.6%, and 36.0 ± 1.4% for poor, normal, and high response treatments, respectively. The predictive power (C-statistic) for OSI to predict live birth was superior to that of oocyte yield. The OSI improves the definition of ovarian response patterns because it takes into account the degree of stimulation. The nomogram presents evidence-based cutoff levels for poor, normal, and high response and could be used for unifying study designs involving ovarian response patterns. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  6. Elevation of plasma gonadotropin concentration in response to mammalian gonadotropin releasing hormone (GRH) treatment of the male brown trout as determined by radioimmunoassay

    International Nuclear Information System (INIS)

    Crim, L.W.; Cluett, D.M.

    1974-01-01

    Rapid increase of the plasma gonadotropin concentration as measured by radioimmunoassay has been demonstrated in response to GRH treatment of the sexually mature male brown trout. Peak gonadotropin values were observed within 15 minutes of GRH treatment, however, the return to baseline values was prolonged compared with the mammalian response. These data support the concept that the brain, operating via releasing hormones, plays a role in the control of pituitary hormone secretion in fish

  7. Estradiol potentiation of gonadotropin-releasing hormone responsiveness in the anterior pituitary is mediated by an increase in gonadotropin-releasing hormone receptors

    International Nuclear Information System (INIS)

    Menon, M.; Peegel, H.; Katta, V.

    1985-01-01

    In order to investigate the mechanism by which 17 beta-estradiol potentiates the action of gonadotropin-releasing hormone on the anterior pituitary in vitro, cultured pituitary cells from immature female rats were used as the model system. Cultures exposed to estradiol at concentrations ranging from 10(-10) to 10(-6) mol/L exhibited a significant augmentation of luteinizing hormone release in response to a 4-hour gonadotropin-releasing hormone (10 mumol/L) challenge at a dose of 10(-9) mol/L compared to that of control cultures. The estradiol augmentation of luteinizing hormone release was also dependent on the duration of estradiol exposure. When these cultures were incubated with tritium-labeled L-leucine, an increase in incorporation of radiolabeled amino acid into total proteins greater than that in controls was observed. A parallel stimulatory effect of estradiol on iodine 125-labeled D-Ala6 gonadotropin-releasing hormone binding was observed. Cultures incubated with estradiol at different concentrations and various lengths of time showed a significant increase in gonadotropin-releasing hormone binding capacity and this increase was abrogated by cycloheximide. Analysis of the binding data showed that the increase in gonadotropin-releasing hormone binding activity was due to a change in the number of gonadotropin-releasing hormone binding sites rather than a change in the affinity. These results suggest that (1) estradiol treatment increases the number of pituitary receptors for gonadotropin-releasing hormone, (2) the augmentary effect of estradiol on luteinizing hormone release at the pituitary level might be mediated, at least in part, by the increase in the number of binding sites of gonadotropin-releasing hormone, and (3) new protein synthesis may be involved in estradiol-mediated gonadotropin-releasing hormone receptor induction

  8. Laparoscopic ovarian cystectomy of endometriomas does not affect the ovarian response to gonadotropin stimulation.

    Science.gov (United States)

    Marconi, Guillermo; Vilela, Martín; Quintana, Ramiro; Sueldo, Carlos

    2002-10-01

    To evaluate the ovarian response cycles of IVF-ET in patients who previously underwent laparoscopic cystectomy for endometriomas. Retrospective study with prospective selection of participants and controls. Instituto de Ginecología y Fertilidad Buenos Aires, Argentina. Thirty-nine patients underwent an operation for ovarian endometriomas by atraumatic removal of the pseudocapsule with minimal bipolar cauterization of small bleeders and an IVF-ET cycle (group A) and 39 control patients of similar age underwent an IVF-ET cycle for tubal factor infertility (group B). Laparoscopic endometrioma cystectomy, IVF-ET cycle. E(2) levels, number of gonadotropin ampoules, follicles, oocytes retrieved, number and quality of embryos transferred, and clinical pregnancy rate. There were no differences in all the parameters studied (E(2) levels, number of follicles, oocytes retrieved, number and quality of embryos transferred, and clinical pregnancy rate) except for the number of gonadotropin ampoules needed for ovarian hyperstimulation, which was significantly higher in group A than in group B. Our results indicate that laparoscopic cystectomy for endometriomas is an appropriate treatment since it did not negatively affect the ovarian response for IVF-ET.

  9. Gonadotropin-releasing hormone radioimmunoassay and its measurement in normal human plasma, secondary amenorrhea, and postmenopausal syndrome

    International Nuclear Information System (INIS)

    Rosenblum, N.G.; Schlaff, S.

    1976-01-01

    A sensitive and specific double antibody radioimmunoassay for gonadotropin-releasing hormone (GnRH) has been developed for measurement in ethanol extracts of human plasma. Iodinated hormone was prepared with the use of the chloramine-T method, and antibodies were developed in rabbits over a six-month period with a GnRH synthetic copolymer immunogen. A Scatchard plot revealed at least three species of antibody. The assay can measure conservatively at the 5 pg. per milliliter level and shows no cross-reactivity with other available hypothalamic and pituitary hormones. The releasing hormone was quantitatively recovered from human plasma with immunologic identity to native hormone. Unextracted plasma could not be used because of nonspecific displacement. The measurement of GnRH in individuals receiving 100 μg of intravenous bolus infusions of the synthetic decapeptide show extremely elevated values with two half-lives: one of two to four minutes and another of 35 to 40 minutes. In our experiments, we have found measurable GnRH in patients with secondary amenorrhea and at the midcycle in normal women. In the normal cycling woman during the follicular and luteal phases, GnRH was undetectable. In postmenopausal women with extreme hypoestrogenism and markedly elevated luteinizing hormone values, GnRH was also undetectable. No bursts of GnRH could be detected in normal men when sampled every ten minutes over a two-hour period and every two hours throughout the day

  10. Serum testosterone and gonadotropins levels in patients with premature ejaculation: A comparison with normal men

    Directory of Open Access Journals (Sweden)

    Mohammad G Mohseni

    2014-01-01

    Conclusion: Patients with PE have higher FT and FSH levels compared with normal men. The causative relationship between these entities and also the clinical importance of this finding has to be determined by more comprehensive studies.

  11. Exaggerated gonadotropin response to luteinizing hormone-releasing hormone in amenorrheic runners.

    Science.gov (United States)

    Yahiro, J; Glass, A R; Fears, W B; Ferguson, E W; Vigersky, R A

    1987-03-01

    Most studies of exercise-induced amenorrhea have compared amenorrheic athletes (usually runners) with sedentary control subjects. Such comparisons will identify hormonal changes that develop as a result of exercise training but cannot determine which of these changes play a role in causing amenorrhea. To obviate this problem, we assessed reproductive hormone status in a group of five amenorrheic runners and compared them to a group of six eumenorrheic runners matched for body fatness, training intensity, and exercise performance. Compared to the eumenorrheic runners, the amenorrheic runners had lower serum estradiol concentrations, similar basal serum luteinizing hormone and follicle-stimulating hormone concentrations, and exaggerated responses of serum gonadotropins after administration of luteinizing hormone-releasing hormone (100 micrograms intravenous bolus). Serum prolactin levels, both basally and after thyrotropin-releasing hormone administration (500 micrograms intravenous bolus) or treadmill exercise, was similar in the two groups, as were serum thyroid function tests (including thyrotropin response to thyrotropin-releasing hormone). Changes in serum cortisol levels after short-term treadmill exercise were similar in both groups, and serum testosterone levels increased after exercise only in the eumenorrheic group. In neither group did such exercise change serum luteinizing hormone, follicle-stimulating hormone, or thyrotropin levels. We concluded that exercise-induced amenorrhea is not solely related to the development of increased prolactin output after exercise training. The exaggerated gonadotropin response to luteinizing hormone-releasing hormone seen in amenorrheic runners in comparison with matched eumenorrheic runners is consistent with a hypothalamic etiology for the menstrual dysfunction, analogous to that previously described in "stress-induced" or "psychogenic" amenorrhea.

  12. Gonadotropin-Releasing Hormone Modulates Vomeronasal Neuron Response to Male Salamander Pheromone

    Directory of Open Access Journals (Sweden)

    Celeste R. Wirsig-Wiechmann

    2012-01-01

    Full Text Available Electrophysiological studies have shown that gonadotropin-releasing hormone (GnRH modifies chemosensory neurons responses to odors. We have previously demonstrated that male Plethodon shermani pheromone stimulates vomeronasal neurons in the female conspecific. In the present study we used agmatine uptake as a relative measure of the effects of GnRH on this pheromone-induced neural activation of vomeronasal neurons. Whole male pheromone extract containing 3 millimolar agmatine with or without 10 micromolar GnRH was applied to the nasolabial groove of female salamanders for 45 minutes. Immunocytochemical procedures were conducted to visualize and quantify relative agmatine uptake as measured by labeling density of activated vomeronasal neurons. The relative number of labeled neurons did not differ between the two groups: pheromone alone or pheromone-GnRH. However, vomeronasal neurons exposed to pheromone-GnRH collectively demonstrated higher labeling intensity, as a percentage above background (75% as compared with neurons exposed to pheromone alone (63%, P < 0.018. Since the labeling intensity of agmatine within neurons signifies the relative activity levels of the neurons, these results suggest that GnRH increases the response of female vomeronasal neurons to male pheromone.

  13. New trends in combined use of gonadotropin-releasing hormone antagonists with gonadotropins or pulsatile gonadotropin-releasing hormone in ovulation induction and assisted reproductive technologies.

    Science.gov (United States)

    Gordon, K; Danforth, D R; Williams, R F; Hodgen, G D

    1992-10-01

    The use of gonadotropin-releasing hormone agonists as adjunctive therapy with gonadotropins for ovulation induction in in vitro fertilization and other assisted reproductive technologies has become common clinical practice. With the recent advent of potent gonadotropin-releasing hormone antagonists free from the marked histamine-release effects that stymied earlier compounds, an attractive alternative method may be available. We have established the feasibility of combining gonadotropin-releasing hormone antagonist-induced inhibition of endogenous gonadotropins with exogenous gonadotropin therapy for ovulation induction in a nonhuman primate model. Here, the principal benefits to be gained from using the gonadotropin-releasing hormone antagonist rather than the gonadotropin-releasing hormone agonist are the immediate inhibition of pituitary gonadotropin secretion without the "flare effect," which brings greater safety and convenience for patients and the medical team and saves time and money. We have also recently demonstrated the feasibility of combining gonadotropin-releasing hormone antagonist with pulsatile gonadotropin-releasing hormone therapy for the controlled restoration of gonadotropin secretion and gonadal steroidogenesis culminating in apparently normal (singleton) ovulatory cycles. This is feasible only with gonadotropin-releasing hormone antagonists because, unlike gonadotropin-releasing hormone agonists, they achieve control of the pituitary-ovarian axis without down regulation of the gonadotropin-releasing hormone receptor system. This capacity to override gonadotropin-releasing hormone antagonist-induced suppression of pituitary-ovarian function may allow new treatment modalities to be employed for women who suffer from chronic hyperandrogenemia with polycystic ovarian disease.

  14. Calcium-independent phosphatidylinositol response in gonadotropin-releasing-hormone-stimulated pituitary cells.

    OpenAIRE

    Naor, Z; Molcho, J; Zakut, H; Yavin, E

    1985-01-01

    This paper describes the effect of gonadotropin-releasing hormone (GnRH, gonadoliberin) on phospholipid metabolism in cultured rat pituitary cells. The cells were incubated with [32P]Pi to label endogenous phospholipids (10-60 min) and then stimulated with GnRH for up to 60 min. Cellular phospholipids were separated by two-dimensional t.l.c. and the radioactivity was determined. Phosphatidylinositol (PI), a minor constituent of cellular phospholipids (7.7%), was the major labelled phospholipi...

  15. Resumption of menstruation and pituitary response to gonadotropin-releasing hormone in functional hypothalamic amenorrhea subjects undertaking estrogen replacement therapy.

    Science.gov (United States)

    Shen, Z Q; Xu, J J; Lin, J F

    2013-11-01

    Functional hypothalamic amenorrhea (FHA) refers to a functional menstrual disorder with various causes and presentations. Recovery of menstrual cyclicity is common in long-term follow-up but the affecting factors remain unknown. To explore factors affecting the menstrual resumption and to evaluate the pituitary response to gonadotropin-releasing hormone (GnRH) in FHA. Thirty cases with FHA were recruited. All subjects were put on continuous 1 mg/day estradiol valerate orally and followed up monthly. Recovery was defined as the occurrence of at least three consecutive regular cycles. Responder referred to those who recovered within two years of therapy. Gonadotropin response to the 50 μg GnRH challenge was tested every three months. Nineteen (63.3%) subjects recovered with a mean time to recovery of 26.8 months. Time to recovery was negatively correlated with body mass index (BMI) before and by amenorrhea. Twentyone cases had undertaken therapy for more than two years and 10 of them recovered. BMI before and by amenorrhea were negatively correlated with the recovery. Significant increase of serum luteinizing hormone (LH) and LH response to GnRH were noted after recovery. Menstrual resumption was common in FHA undertaking estrogen replacement therapy (ERT). The likelihood of recovery was affected by their BMI before and by amenorrhea but not by the weight gain during therapy. Low serum LH and attenuated LH response to GnRH were the main features of pituitary deficiency in FHA. The menstrual resumption in FHA was accompanied by the recovery of serum LH and the LH response to GnRH.

  16. Gonadotropin-releasing hormone receptor (Gnrhr gene knock out: Normal growth and development of sensory, motor and spatial orientation behavior but altered metabolism in neonatal and prepubertal mice.

    Directory of Open Access Journals (Sweden)

    Ellen R Busby

    Full Text Available Gonadotropin-releasing hormone (GnRH is important in the control of reproduction, but its actions in non-reproductive processes are less well known. In this study we examined the effect of disrupting the GnRH receptor in mice to determine if growth, metabolism or behaviors that are not associated with reproduction were affected. To minimize the effects of other hormones such as FSH, LH and sex steroids, the neonatal-prepubertal period of 2 to 28 days of age was selected. The study shows that regardless of sex or phenotype in the Gnrhr gene knockout line, there was no significant difference in the daily development of motor control, sensory detection or spatial orientation among the wildtype, heterozygous or null mice. This included a series of behavioral tests for touch, vision, hearing, spatial orientation, locomotory behavior and muscle strength. Neither the daily body weight nor the final weight on day 28 of the kidney, liver and thymus relative to body weight varied significantly in any group. However by day 28, metabolic changes in the GnRH null females compared with wildtype females showed a significant reduction in inguinal fat pad weight normalized to body weight; this was accompanied by an increase in glucose compared with wildtype females shown by Student-Newman-Keuls Multiple Comparison test and Student's unpaired t tests. Our studies show that the GnRH-GnRHR system is not essential for growth or motor/sensory/orientation behavior during the first month of life prior to puberty onset. The lack of the GnRH-GnRHR axis, however, did affect females resulting in reduced subcutaneous inguinal fat pad weight and increased glucose with possible insulin resistance; the loss of the normal rise of estradiol at postnatal days 15-28 may account for the altered metabolism in the prepubertal female pups.

  17. The steroidogenic response and corpus luteum expression of the steroidogenic acute regulatory protein after human chorionic gonadotropin administration at different times in the human luteal phase.

    Science.gov (United States)

    Kohen, Paulina; Castro, Olga; Palomino, Alberto; Muñoz, Alex; Christenson, Lane K; Sierralta, Walter; Carvallo, Pilar; Strauss, Jerome F; Devoto, Luigi

    2003-07-01

    StAR mRNA (3.5-fold) and protein (1.8-fold). Collectively, these data indicate that 1) the hCG-stimulated steroidogenic response is dependent on the age of the CL; 2) the early luteal phase CL is relatively insensitive to exogenous hCG in the presence of normal pituitary gonadotropin support, but becomes responsive when the latter is withdrawn; 3) the hCG-stimulated steroidogenic response in the mid- and late luteal phase is correlated with increased StAR mRNA and protein abundance; and 4) there are differential responses of small and large luteal cells to hCG stimulation that depend upon the age of the CL.

  18. Factors that predict a positive response on gonadotropin-releasing hormone stimulation test for diagnosing central precocious puberty in girls

    Directory of Open Access Journals (Sweden)

    Junghwan Suh

    2013-12-01

    Full Text Available PurposeThe rapid increase in the incidence of precocious puberty in Korea has clinical and social significance. Gonadotropin-releasing hormone (GnRH stimulation test is required to diagnose central precocious puberty (CPP, however this test is expensive and time-consuming. This study aimed to identify factors that can predict a positive response to the GnRH stimulation test.MethodsClinical and laboratory parameters, including basal serum luteinizing hormone (LH, follicle-stimulating hormone (FSH, and estradiol (E2, were measured in 540 girls with clinical signs of CPP.ResultsTwo hundred twenty-nine of 540 girls with suspected CPP had a peak serum LH level higher than 5 IU/L (the CPP group. The CPP group had advanced bone age (P<0.001, accelerated yearly growth rate (P<0.001, increased basal levels of LH (P=0.02, FSH (P<0.001, E2 (P=0.001, and insulin-like growth factor-I levels (P<0.001 compared to the non-CPP group. In contrast, body weight (P<0.001 and body mass index (P<0.001 were lower in the CPP group. Although basal LH was significantly elevated in the CPP group compared to the non-CPP group, there was considerable overlap between the 2 groups. Cutoff values of basal LH (0.22 IU/L detected CPP with 87.8% sensitivity and 20.9% specificity.ConclusionNo single parameter can predict a positive response on the GnRH stimulation test with both high sensitivity and specificity. Therefore, multiple factors should be considered in evaluation of sexual precocity when deciding the timing of the GnRH stimulation test.

  19. Human chorionic gonadotropin triggers angiogenesis via the modulation of endometrial stromal cell responsiveness to interleukin 1: a new possible mechanism underlying embryo implantation.

    Science.gov (United States)

    Bourdiec, Amélie; Shao, Rong; Rao, C V; Akoum, Ali

    2012-09-01

    Deep functional changes occurring within the endometrium during implantation are orchestrated by embryonic and maternal signals. Human chorionic gonadotropin (hCG), a major embryonic signal, plays a critical role in the initiation and maintenance of pregnancy. Interleukin (IL) 1, one of the earliest embryonic signals, appears to exert a direct impact on the receptive endometrium and to induce major molecular changes that are essential for embryo implantation. Herein we investigate whether hCG can modulate endometrial stromal cell (ESC) receptivity to IL1 during the implantation window and assess the impact on angiogenesis in vitro. Primary cultures of ESCs from normal fertile women during the implantation window were treated for 24 h with different concentrations of hCG (0-100 ng/ml) and stimulated for 24 h with IL1B (0-0.1 ng/ml). IL1 receptors (IL1Rs), IL1R antagonist (IL1RA), and monocyte chemotactic protein (MCP) 1 were analyzed by real-time PCR, ELISA, and Western blotting. The angiogenic activity in vitro was studied using human microvascular endothelial cell line, scratch wound assay, and cell proliferation via BrdU incorporation into DNA. Human CG induced a dose-dependent imbalance in ESC receptivity to IL1 by significantly upregulating the functional signaling IL1R1 and concomitantly downregulating the decoy inhibitory IL1R2 and IL1RA upon subsequent exposure to IL1B. Prior exposure to hCG amplified MCP1 secretion by ESCs in response to IL1B and triggered the release of angiogenic activity in vitro in which MCP1 appeared to play a significant role. Overexpression of IL1R2 using cell transfection inhibited IL1 and hCG/IL1B-mediated MCP1 secretion. These findings suggest that hCG coordinates embryonic signal interaction with the maternal endometrium, and point to a new possible pathway by which it may promote embryonic growth.

  20. Response to the gonadotropin releasing hormone agonist leuprolide in immature female sheep androgenized in utero

    Directory of Open Access Journals (Sweden)

    SERGIO E RECABARREN

    2005-01-01

    Full Text Available Similar to women with Polycystic Ovary Syndrome (PCOS, female sheep treated prenatally with testosterone (T-females are hypergonadotropic, exhibit neuroendocrine defects, multifollicular ovarian morphology, hyperinsulinemia and cycle defects. Hypergonadotropism and multifollicular morphology may in part be due to developmentally regulated increase in pituitary responsiveness to GnRH and may culminate in increased ovarian estradiol production. In this study, we utilized a GnRH agonist, leuprolide, to determine the developmental impact of prenatal testosterone exposure on pituitary-gonadal function and to establish if prenatal exposure produces changes in the reproductive axis similar to those described for women with PCOS. Eight control and eight T-females were injected intravenously with 0.1 mg of leuprolide acetate per kilogram of body weight at 5, 10 and 20 weeks of age. Blood samples were collected by means of an indwelling jugular vein catheter at 0, 3, 6, 9, 12, 18, 24, 30, 36, 42 and 48 hours after leuprolide. Area under the curve (AUC of LH response to leuprolide increased progressively between the three ages studied (P<0.05. AUC of LH in T-females was higher than in control females of the same age at 5 and 10 weeks of age (P<0.05, but similar at 20 weeks of age. AUC of estradiol response was lower at 10 but higher at 20 weeks of age in T-females compared to controls of the same age (P<0.05. Our findings suggest that prenatal T treatment alters the pituitary and ovarian responsiveness in a manner comparable to that observed in women with PCOS.

  1. Regulatory Architecture of the LβT2 Gonadotrope Cell Underlying the Response to Gonadotropin-Releasing Hormone

    Directory of Open Access Journals (Sweden)

    Frederique Ruf-Zamojski

    2018-02-01

    Full Text Available The LβT2 mouse pituitary cell line has many characteristics of a mature gonadotrope and is a widely used model system for studying the developmental processes and the response to gonadotropin-releasing hormone (GnRH. The global epigenetic landscape, which contributes to cell-specific gene regulatory mechanisms, and the single-cell transcriptome response variation of LβT2 cells have not been previously investigated. Here, we integrate the transcriptome and genome-wide chromatin accessibility state of LβT2 cells during GnRH stimulation. In addition, we examine cell-to-cell variability in the transcriptional response to GnRH using Gel bead-in-Emulsion Drop-seq technology. Analysis of a bulk RNA-seq data set obtained 45 min after exposure to either GnRH or vehicle identified 112 transcripts that were regulated >4-fold by GnRH (FDR < 0.05. The top regulated transcripts constitute, as determined by Bayesian massive public data integration analysis, a human pituitary-relevant coordinated gene program. Chromatin accessibility [assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq] data sets generated from GnRH-treated LβT2 cells identified more than 58,000 open chromatin regions, some containing notches consistent with bound transcription factor footprints. The study of the most prominent open regions showed that 75% were in transcriptionally active promoters or introns, supporting their involvement in active transcription. Lhb, Cga, and Egr1 showed significantly open chromatin over their promoters. While Fshb was closed over its promoter, several discrete significantly open regions were found at −40 to −90 kb, which may represent novel upstream enhancers. Chromatin accessibility determined by ATAC-seq was associated with high levels of gene expression determined by RNA-seq. We obtained high-quality single-cell Gel bead-in-Emulsion Drop-seq transcriptome data, with an average of >4,000 expressed genes

  2. Responses of catecholestrogen metabolism to acute graded exercise in normal menstruating women before and after training.

    Science.gov (United States)

    De Crée, C; Ball, P; Seidlitz, B; Van Kranenburg, G; Geurten, P; Keizer, H A

    1997-10-01

    It has been hypothesized that exercise-related hypo-estrogenemia occurs as a consequence of increased competition of catecholestrogens (CE) for catechol-O-methyltransferase (COMT). This may result in higher norepinephrine (NE) concentrations, which could interfere with normal gonadotropin pulsatility. The present study investigates the effects of training on CE responses to acute exercise stress. Nine untrained eumenorrheic women (mean percentage of body fat +/-SD: 24.8 +/- 3.1%) volunteered for an intensive 5-day training program. Resting, submaximal, and maximal (tmax) exercise plasma CE, estrogen, and catecholamine responses were determined pre- and post training in both the follicular (FPh) and luteal phase (LPh). Acute exercise stress increased total primary estrogens (E) but had little effect on total 2-hydroxyestrogens (2-OHE) and 2-hydroxyestrogen-monomethylethers (2-MeOE) (= O-methylated CE after competition for catechol-O-methyltransferase). This pattern was not significantly changed by training. However, posttraining LPh mean (+/-SE) plasma E, 2-OHE, and 2-MeOE concentrations were significantly lower (P Training produced opposite effects on 2-OHE:E ratios (an estimation of CE formation) during acute exercise in the FPh (reduction) and LPh (increase). The 2-MeOE:2-OHE ratio (an estimation of CE activity) showed significantly higher values at tmax in both menstrual phases after training (FPh: +11%; LPh: +23%; P training, NE values were significantly higher (P training lowers absolute concentrations of plasma estrogens and CE; the acute exercise challenge altered plasma estrogens but had little effect on CE; estimation of the formation and activity of CE suggests that formation and O-methylation of CE proportionately increases. These findings may be of importance for NE-mediated effects on gonadotropin release.

  3. Altered neuroendocrine regulation of gonadotropin secretion in women distance runners.

    Science.gov (United States)

    Veldhuis, J D; Evans, W S; Demers, L M; Thorner, M O; Wakat, D; Rogol, A D

    1985-09-01

    We tested the hypothesis that the neuroendocrine control of gonadotropin secretion is altered in certain women distance runners with secondary amenorrhea. To this end, we quantitated the frequency and amplitude of spontaneous pulsatile LH secretion during a 24-h interval in nine such women. The ability of the pituitary gland to release LH normally was assessed by administration of graded bolus doses of GnRH during the subsequent 8 h. Compared to normally menstruating women, six of nine amenorrheic distance runners had a distinct reduction in spontaneous LH pulse frequency, with one, three, six, five, four, or two pulses per 24 h (normal, 8-15 pulses/24 h). This reduction in LH pulse frequency occurred without any significant alterations in plasma concentrations of estradiol and free testosterone or 24-h integrated serum concentrations of LH, FSH, or PRL. Moreover, in long-distance runners, the capacity of the pituitary gland to release LH was normal or accentuated in response to exogenous pulses of GnRH. In the six women athletes with diminished spontaneous LH pulsatility, acute ovarian responsiveness also was normal, since serum estradiol concentrations increased normally in response to the GnRH-induced LH pulses. Although long-distance runners had significantly lower estimated percent body fat compared to control women, specific changes in pulsatile gonadotropin release did not correlate with degree of body leanness. In summary, certain long-distance runners with secondary amenorrhea or severe oligomenorrhea have unambiguously decreased spontaneous LH pulse frequency with intact pituitary responsiveness to GnRH. This neuroendocrine disturbance may be relevant to exercise-associated amenorrhea, since pulsatile LH release is a prerequisite for cyclic ovarian function. We speculate that such alterations in pulsatile LH release in exercising women reflect an adaptive response of the hypothalamic pulse generator controlling the intermittent GnRH signal to the

  4. Differential responsiveness of luteinized human granulosa cells to gonadotropins and insulin-like growth factor I for induction of aromatase activity

    International Nuclear Information System (INIS)

    Christman, G.M.; Randolph, J.F. Jr.; Peegel, H.; Menon, K.M.

    1991-01-01

    The objective of this study was to examine the in vitro responsiveness of cultured luteinized human granulosa cells over time to insulin-like growth factor 1 (IGF-1), human follicle-stimulating hormone (FSH), and human chorionic gonadotropin (hCG) for the induction of aromatase activity. Granulosa cells were retrieved from preovulatory follicles in patients undergoing in vitro fertilization. Cells were cultured for a period of 72 hours or 10 days. The ability of hCG, human FSH, and/or IGF-I to induce aromatase activity was assayed by the stereospecific release of tritium from [1B-3H]androstenedione. Short-term cultures (72 hours) demonstrated a marked rise in aromatase activity in response to human FSH and IGF-I, whereas a smaller response to hCG was observed. In contrast, 10-day cultures demonstrated responsiveness predominantly to hCG rather than human FSH for the induction of aromatase activity with no remarkable effect of IGF-I. Luteinized human granulosa cells undergo a transformation from an initial human FSH and IGF-I responsive state to an hCG responsive state in long-term cultures

  5. Evidence that obesity and androgens have independent and opposing effects on gonadotropin production from puberty to maturity

    Science.gov (United States)

    Rosenfield, Robert L; Bordini, Brian

    2010-01-01

    Optimal fat mass is necessary for normal gonadotropin levels in adults, and both undernutrition and overnutrition suppress gonadotropins: thus, the gonadotropin response to relative adipose mass is biphasic. Adult obesity is associated with blunted luteinizing hormone (LH) pulse amplitude that is partially attributable to increased LH clearance rate. Testosterone appears to have a biphasic effect on gonadotropin production in females. Moderate elevations of testosterone appear to stimulate LH production at both the hypothalamic and pituitary level, while very high levels of testosterone suppress LH. Thus, obesity per se appears to suppress gonadotropin production, and moderate hyperandrogenemia in women appears to stimulate LH. The ordinary hypergonadotropic hyperandrogenism of obese women appears to be an exception to this model because it is usually due to polycystic ovary syndrome (PCOS), a condition in which intrinsic functional ovarian hyperandrogenism and excess adiposity share a common origin that involves insulin-resistant hyperinsulinemia. LH elevation seems to be secondary to hyperandrogenemia and is absent in the most obese cases. Overweight early pubertal girls have significant blunting of sleep-related LH production, which is the first hormonal change of puberty. The data are compatible with the possibility that excess adiposity may paradoxically subtly suppress hypothalamic-pituitary-gonadal function in early puberty although it is known to contribute to the early onset of puberty. PMID:20816944

  6. Ovulation induction with pulsatile gonadotropin-releasing hormone (GnRH) or gonadotropins in a case of hypothalamic amenorrhea and diabetes insipidus.

    Science.gov (United States)

    Georgopoulos, N A; Markou, K B; Pappas, A P; Protonatariou, A; Vagenakis, G A; Sykiotis, G P; Dimopoulos, P A; Tzingounis, V A

    2001-12-01

    Hypothalamic amenorrhea is a treatable cause of infertility. Our patient was presented with secondary amenorrhea and diabetes insipidus. Cortisol and prolactin responded normally to a combined insulin tolerance test (ITT) and thyrotropin-releasing hormone (TRH) challenge, while thyroid-stimulating hormone (TSH) response to TRH was diminished, and no response of growth hormone to ITT was detected. Both luteinizing hormone (LH) and follicle-stimulating hormone (FSH) levels increased following gonadotropin-releasing hormone (GnRH) challenge. No response of LH to clomiphene citrate challenge was detected. Magnetic resonance imaging findings demonstrated a midline mass occupying the inferior hypothalamus, with posterior lobe not visible and thickened pituitary stalk. Ovulation induction was carried out first with combined human menopausal gonadotropins (hMG/LH/FSH) (150 IU/day) and afterwards with pulsatile GnRH (150 ng/kg/pulse). Ovulation was achieved with both pulsatile GnRH and combine gonadotropin therapy. Slightly better results were achieved with the pulsatile GnRH treatment.

  7. The rate of high ovarian response in women identified at risk by a high serum AMH level is influenced by the type of gonadotropin.

    Science.gov (United States)

    Arce, Joan-Carles; Klein, Bjarke M; La Marca, Antonio

    2014-06-01

    The aim was to compare ovarian response and clinical outcome of potential high-responders after stimulation with highly purified menotropin (HP-hMG) or recombinant follicle-stimulating hormone (rFSH) for in vitro fertilisation/intracytoplasmic sperm injection. Retrospective analysis was performed on data collected in two randomized controlled trials, one conducted following a long GnRH agonist protocol and the other with an antagonist protocol. Potential high-responders (n = 155 and n = 188 in the agonist and antagonist protocol, respectively) were defined as having an initial anti-Müllerian hormone (AMH) value >75th percentile (5.2 ng/ml). In both protocols, HP-hMG stimulation in women in the high AMH category was associated with a significantly lower occurrence of high response (≥15 oocytes retrieved) than rFSH stimulation; 33% versus 51% (p = 0.025) and 31% versus 49% (p = 0.015) in the long agonist and antagonist protocol, respectively. In the potential high-responder women, trends for improved live birth rate were observed with HP-hMG compared with rFSH (long agonist protocol: 33% versus 20%, p = 0.074; antagonist protocol: 34% versus 23%, p = 0.075; overall population: 34% versus 22%, p = 0.012). In conclusion, the type of gonadotropin used for ovarian stimulation influences high-response rates and potentially clinical outcome in women identified as potential high-responders.

  8. Subcutaneous injection of kisspeptin-54 acutely stimulates gonadotropin secretion in women with hypothalamic amenorrhea, but chronic administration causes tachyphylaxis.

    Science.gov (United States)

    Jayasena, Channa N; Nijher, Gurjinder M K; Chaudhri, Owais B; Murphy, Kevin G; Ranger, Amita; Lim, Adrian; Patel, Daksha; Mehta, Amrish; Todd, Catriona; Ramachandran, Radha; Salem, Victoria; Stamp, Gordon W; Donaldson, Mandy; Ghatei, Mohammad A; Bloom, Stephen R; Dhillo, Waljit S

    2009-11-01

    Kisspeptin is a critical regulator of normal reproductive function. A single injection of kisspeptin in healthy human volunteers potently stimulates gonadotropin release. However, the effects of kisspeptin on gonadotropin release in women with hypothalamic amenorrhea (HA) and the effects of repeated administration of kisspeptin to humans are unknown. The aim of this study was to determine the effects of acute and chronic kisspeptin administration on gonadotropin release in women with HA. We performed a prospective, randomized, double-blinded, parallel design study. Women with HA received twice-daily sc injections of kisspeptin (6.4 nmol/kg) or 0.9% saline (n = 5 per group) for 2 wk. Changes in serum gonadotropin and estradiol levels, LH pulsatility, and ultrasound measurements of reproductive activity were assessed. On the first injection day, potent increases in serum LH and FSH were observed after sc kisspeptin injection in women with HA (mean maximal increment from baseline within 4 h after injection: LH, 24.0 +/- 3.5 IU/liter; FSH, 9.1 +/- 2.5 IU/liter). These responses were significantly reduced on the 14th injection day (mean maximal increment from baseline within 4 h postinjection: LH, 2.5 +/- 2.2 IU/liter, P < 0.05; FSH, 0.5 +/- 0.5 IU/liter, P < 0.05). Subjects remained responsive to GnRH after kisspeptin treatment. No significant changes in LH pulsatility or ultrasound measurements of reproductive activity were observed. Acute administration of kisspeptin to women with infertility due to HA potently stimulates gonadotropin release, but chronic administration of kisspeptin results in desensitization to its effects on gonadotropin release. These data have important implications for the development of kisspeptin as a novel therapy for reproductive disorders in humans.

  9. Response of lactating dairy cows with or without purulent vaginal discharge to gonadotropin-releasing hormone and prostaglandin F2α.

    Science.gov (United States)

    Voelz, B E; Rocha, L; Scortegagna, F; Stevenson, J S; Mendonça, L G D

    2018-02-15

    Purulent vaginal discharge (PVD) is a common uterine disease in dairy cattle that has negative effects on reproductive performance. Reproductive management programs that synchronize ovulation use gonadotropin-releasing hormone (GnRH) to induce ovulation and prostaglandin F2α (PGF2α) to induce luteolysis. The objectives of this study were to evaluate ovarian response to treatment with GnRH and the odds of bearing a corpus luteum or being inseminated in dairy cows with or without PVD. Another objective was to determine the hazard of insemination after administration of PGF2α in dairy cows with or without PVD. Primiparous (n = 291) and multiparous (n = 402) cows were evaluated for PVD using a Metricheck device at 46 ± 3 and 35 ± 3 days in milk (DIM) (study day 0), respectively. On study day 14, primiparous (n = 107) and multiparous (n = 197) cows were treated with GnRH and subsequent ovulation was recorded. Primiparous (n = 178) and multiparous (n = 368) cows not inseminated by study day 21 were administered PGF2α and response to PGF2α treatment was determined by detection of estrus. Furthermore, cows were categorized by the presence of a CL or being inseminated by study days 14, 21, and 35. Overall prevalence of PVD was 28.5% and 13.4% for primiparous and multiparous cows, respectively. Projected 305-d milk yield was less (P PVD+ multiparous cows compared with PVD- multiparous cows, however, no (P = 0.26) difference was detected between primiparous PVD+ and PVD- cows. Ovulatory response to GnRH treatment was 51.8% and 47.8% for primiparous and multiparous cows, respectively. Primiparous PVD- cows tended (P = 0.06) to be less likely to ovulate to GnRH than primiparous PVD+ cows, whereas multiparous PVD+ cows were less (P = 0.04) likely to ovulate to GnRH than PVD- multiparous cows. The odds of bearing a corpus luteum or being inseminated by study days 14, 21, or 35 was not associated with PVD in primiparous cows. In contrast, the odds of bearing a corpus luteum

  10. A Box-Cox normal model for response times

    NARCIS (Netherlands)

    Klein Entink, R.H.; Fox, J.P.; Linden, W.J. van der

    2009-01-01

    The log-transform has been a convenient choice in response time modelling on test items. However, motivated by a dataset of the Medical College Admission Test where the lognormal model violated the normality assumption, the possibilities of the broader class of Box–Cox transformations for response

  11. A Box-Cox normal model for response times.

    Science.gov (United States)

    Klein Entink, R H; van der Linden, W J; Fox, J-P

    2009-11-01

    The log-transform has been a convenient choice in response time modelling on test items. However, motivated by a dataset of the Medical College Admission Test where the lognormal model violated the normality assumption, the possibilities of the broader class of Box-Cox transformations for response time modelling are investigated. After an introduction and an outline of a broader framework for analysing responses and response times simultaneously, the performance of a Box-Cox normal model for describing response times is investigated using simulation studies and a real data example. A transformation-invariant implementation of the deviance information criterium (DIC) is developed that allows for comparing model fit between models with different transformation parameters. Showing an enhanced description of the shape of the response time distributions, its application in an educational measurement context is discussed at length.

  12. -Human Chorionic Gonadotropin Production

    Directory of Open Access Journals (Sweden)

    Michael J. Russell

    2008-01-01

    Full Text Available Dedifferentiated liposarcomas may display a variety of “heterologous” lines of differentiation, including osseous, vascular, skeletal, and/or smooth muscular. There have been six previously reported examples of leiomyosarcomas associated with high levels of serum human chorionic gonadotropin (hCG production, comprised of cases originating from the retroperitoneum, spermatic cord, small intestine, and uterus. This report describes the first example of a dedifferentiated liposarcoma that combined both of the aforementioned features: extensive heterologous (leiomyosarcomatous differentiation and -hCG production (maximum serum levels 1046 mIU/ml, reference <5 mIU/ml. The tumor, which originated in the retroperitoneum in the region of the right kidney, was rapidly progressive and ultimately fatal within three months of its diagnosis. In addition to characteristic morphologic features, lipogenic and smooth muscle differentiation were confirmed with immunohistochemical stains for MDM2 and smooth muscle actin, respectively. The tumor also displayed diffuse immunoreactivity for -hCG in both primary and metastatic sites. This case further expands the clinicopathologic spectrum of lipogenic tumors.

  13. Evaluation of normal tissue responses to high-LET radiations

    International Nuclear Information System (INIS)

    Halnan, K.E.

    1979-01-01

    Clinical results presented have been analysed to evaluate normal tissue responses to high-LET radiations. Damage to brain, spinal cord, gut, skin, connective tissue and bone has occurred. A high RBE is probable for brain and possible for spinal cord and gut but other reasons for damage are also discussed. A net gain seems likely. Random controlled trials are advocated. (author)

  14. Normalization of cell responses in cat striate cortex

    Science.gov (United States)

    Heeger, D. J.

    1992-01-01

    Simple cells in the striate cortex have been depicted as half-wave-rectified linear operators. Complex cells have been depicted as energy mechanisms, constructed from the squared sum of the outputs of quadrature pairs of linear operators. However, the linear/energy model falls short of a complete explanation of striate cell responses. In this paper, a modified version of the linear/energy model is presented in which striate cells mutually inhibit one another, effectively normalizing their responses with respect to stimulus contrast. This paper reviews experimental measurements of striate cell responses, and shows that the new model explains a significantly larger body of physiological data.

  15. Microdose gonadotropin-releasing hormone agonist in the absence of exogenous gonadotropins is not sufficient to induce multiple follicle development.

    Science.gov (United States)

    Chung, Karine; Fogle, Robin; Bendikson, Kristin; Christenson, Kamilee; Paulson, Richard

    2011-01-01

    Because the effectiveness of the "microdose flare" stimulation protocol often is attributed to the dramatic endogenous gonadotropin release induced by the GnRH agonist, the aim of this study was to determine whether use of microdose GnRH agonist alone could induce multiple ovarian follicle development in normal responders. Based on these data, the duration of gonadotropin rise is approximately 24 to 48 hours and is too brief to sustain continued multiple follicle growth. Copyright © 2011 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  16. Measurement of human normal tissue and tumour responses

    International Nuclear Information System (INIS)

    Ross, G.; Yarnold, J.R.

    1988-01-01

    The scarcity of quantitative measures of normal tissue damage and tumour response in patients undergoing radiotherapy is an obstacle to the clinical evaluation of new treatment strategies. Retrospective studies of complications in critical normal tissues taught important lessons in the past concerning the potential dangers of hypofractionation. However, it is unethical to use serious complications as planned end-points in prospective studies. This paper reviews the desirable characteristics of clinical end-points required to compare alternative treatments employing radiotherapy, with emphasis on simple scales applied by clinicians or even the patients themselves

  17. Isometric exercise: cardiovascular responses in normal and cardiac populations.

    Science.gov (United States)

    Hanson, P; Nagle, F

    1987-05-01

    Isometric exercise produces a characteristic pressor increase in blood pressure which may be important in maintaining perfusion of muscle during sustained contraction. This response is mediated by combined central and peripheral afferent input to medullary cardiovascular centers. In normal individuals the increase in blood pressure is mediated by a rise in cardiac output with little or no change in systemic vascular resistance. However, the pressor response is also maintained during pharmacologic blockade or surgical denervation by increasing systemic vascular resistance. Left ventricular function is normally maintained or improves in normal subjects and cardiac patients with mild impairment of left ventricular contractility. Patients with poor left ventricular function may show deterioration during isometric exercise, although this pattern of response is difficult to predict from resting studies. Recent studies have shown that patients with uncomplicated myocardial infarction can perform submaximum isometric exercise such as carrying weights in the range of 30 to 50 lb without difficulty or adverse responses. In addition, many patients who show ischemic ST depression or angina during dynamic exercise may have a reduced ischemic response during isometric or combined isometric and dynamic exercise. Isometric exercises are frequently encountered in activities of daily living and many occupational tasks. Cardiac patients should be gradually exposed to submaximum isometric training in supervised cardiac rehabilitation programs. Specific job tasks that require isometric or combined isometric and dynamic activities may be evaluated by work simulation studies. This approach to cardiac rehabilitation may facilitate patients who wish to return to a job requiring frequent isometric muscle contraction. Finally, there is a need for additional research on the long-term effects of isometric exercise training on left ventricular hypertrophy and performance. The vigorous training

  18. Plasma catecholamine responses to physiologic stimuli in normal human pregnancy.

    Science.gov (United States)

    Barron, W M; Mujais, S K; Zinaman, M; Bravo, E L; Lindheimer, M D

    1986-01-01

    The dynamic response of the sympathoadrenal system was evaluated during and after pregnancy in 13 healthy women with a protocol that compared cardiovascular parameters and plasma catecholamine levels during the basal state, after postural maneuvers, and following isometric exercise. Plasma epinephrine and norepinephrine levels were similar during and after gestation when the women rested on their sides, but heart rate was greater in pregnancy. Ten minutes of supine recumbency produced minimal changes, but attenuation of the anticipated increases in heart rate and plasma norepinephrine levels during standing and isometric exercise were observed during pregnancy. In contrast, alterations in plasma epinephrine appeared unaffected by gestation. Plasma renin activity and aldosterone levels were, as expected, greater during pregnancy; however, increments in response to upright posture were similar in pregnant and postpartum women. To the extent that circulating catecholamines may be considered indices of sympathoadrenal function, these data suggest that normal pregnancy alters cardiovascular and sympathetic nervous system responses to physiologic stimuli.

  19. T lymphocytes and normal tissue responses to radiation

    International Nuclear Information System (INIS)

    Schaue, Dörthe; McBride, William H.

    2012-01-01

    There is compelling evidence that lymphocytes are a recurring feature in radiation damaged normal tissues, but assessing their functional significance has proven difficult. Contradictory roles have been postulated in both tissue pathogenesis and protection, although these are not necessarily mutually exclusive as the immune system can display what may seem to be opposing faces at any one time. While the exact role of T lymphocytes in irradiated normal tissue responses may still be obscure, their accumulation after tissue damage suggests they may be critical targets for radiotherapeutic intervention and worthy of further study. This is accentuated by recent findings that pathologically damaged “self,” such as occurs after exposure to ionizing radiation, can generate danger signals with the ability to activate pathways similar to those that activate adoptive immunity to pathogens. In addition, the demonstration of T cell subsets with their recognition radars tuned to “self” moieties has revolutionized our ideas on how all immune responses are controlled and regulated. New concepts of autoimmunity have resulted based on the dissociation of immune functions between different subsets of immune cells. It is becoming axiomatic that the immune system has the power to regulate radiation-induced tissue damage, from failure of regeneration to fibrosis, to acute and chronic late effects, and even to carcinogenesis. Our understanding of the interplay between T lymphocytes and radiation-damaged tissue may still be rudimentary but this is a good time to re-examine their potential roles, their radiobiological and microenvironmental influences, and the possibilities for therapeutic manipulation. This review will discuss the yin and yang of T cell responses within the context of radiation exposures, how they might drive or protect against normal tissue side effects and what we may be able do about it.

  20. Mathematical models of tumour and normal tissue response

    International Nuclear Information System (INIS)

    Jones, B.; Dale, R.G.; Charing Cross Group of Hospitals, London

    1999-01-01

    The historical application of mathematics in the natural sciences and in radiotherapy is compared. The various forms of mathematical models and their limitations are discussed. The Linear Quadratic (LQ) model can be modified to include (i) radiobiological parameter changes that occur during fractionated radiotherapy, (ii) situations such as focal forms of radiotherapy, (iii) normal tissue responses, and (iv) to allow for the process of optimization. The inclusion of a variable cell loss factor in the LQ model repopulation term produces a more flexible clonogenic doubling time, which can simulate the phenomenon of 'accelerated repopulation'. Differential calculus can be applied to the LQ model after elimination of the fraction number integers. The optimum dose per fraction (maximum cell kill relative to a given normal tissue fractionation sensitivity) is then estimated from the clonogen doubling times and the radiosensitivity parameters (or α/β ratios). Economic treatment optimization is described. Tumour volume studies during or following teletherapy are used to optimize brachytherapy. The radiation responses of both individual tumours and tumour populations (by random sampling 'Monte-Carlo' techniques from statistical ranges of radiobiological and physical parameters) can be estimated. Computerized preclinical trials can be used to guide choice of dose fractionation scheduling in clinical trials. The potential impact of gene and other biological therapies on the results of radical radiotherapy are testable. New and experimentally testable hypotheses are generated from limited clinical data by exploratory modelling exercises. (orig.)

  1. Memory, verbal fluency, and response inhibition in normal aging

    Directory of Open Access Journals (Sweden)

    Gaurav Thapliyal

    2016-01-01

    Full Text Available Background: The concepts of aging-related cognitive changes have appeared to be a major challenge in the society. In this context, the present study was planned to find out the functioning of aging population on different neurocognitive measures. Aims: The aim of the study was to find out the neurocognitive functioning, namely memory, verbal fluency, and response inhibition of normal aging population. Materials and Methods: Following purposive sampling technique, a total of 50 healthy subjects (30 males and 20 females in the age range of 60-70 years were recruited from Jaipur city of Rajasthan. Mini-mental state Examination, PGI memory scale, animal names test, and Stroop test were administered. Results: The findings reveal dysfunction in almost all the domains of memory, namely mental balance, attention and concentration, delayed recall, verbal retention for dissimilar pairs, visual retention and recognition, immediate recall, verbal retention for similar pairs, and visual retention. In domain of verbal fluency, all subjects gave low responses on the animal names test. In domain of response inhibition, all the subjects took less time in color test as compared to color word test on the Stroop task. Conclusions: Findings suggest that there are dysfunction in the area of memory, verbal fluency, and response inhibition in persons aged 60-70 years. However, recent and remote memory were found to be intact.

  2. Antimüllerian hormone in gonadotropin releasing-hormone antagonist cycles

    DEFF Research Database (Denmark)

    Arce, Joan-Carles; La Marca, Antonio; Mirner Klein, Bjarke

    2013-01-01

    To assess the relationships between serum antimüllerian hormone (AMH) and ovarian response and treatment outcomes in good-prognosis patients undergoing controlled ovarian stimulation using a gonadotropin-releasing hormone (GnRH) antagonist protocol....

  3. The combined effects of pituitary gonadotropin and estrogen on the ovarian response of rats to /sup 125/I-LH uptake

    Energy Technology Data Exchange (ETDEWEB)

    Hosomichi, T; Yoshida, H; Ichinohe, K [Wakayama Medical Coll. (Japan)

    1974-12-01

    It discussed the effect of estradiol on the ovarian response of mature rats and hypophysectomized mature rats to /sup 125/I-LH uptake and the combined effects of FSH and estradiol. The constant concentration on the change of blood concentration with time was maintained in about one hour when given with the intravenous infusion of /sup 125/I-LH prepared for radioimmunoassay. Moreover, increased uptake of /sup 125/I-LH was noted especially in ovaries, livers, kidneys and thyroid glands, and by giving estradiol the uptake was increased to a level which was about twice the normal. Of hypophysectomized rats, the uptake was increased to a level which was about four times the normal in the group of rats which were given estradiol for eight days and also in the group of rats which were given FSH for four days. The effect with four-day-estradiol administration following four-day-FSH administration was to increase to a level which was about six times the group which was given each single administration. These experimental results are apparently due to the effects of FSH and estradiol on follicles and thus follicles are ready for LH uptake.

  4. Gonadotropin-releasing hormone for infertility in women with primary hypothalamic amenorrhea. Toward a more-interventional approach.

    Science.gov (United States)

    Kesrouani, A; Abdallah, M A; Attieh, E; Abboud, J; Atallah, D; Makhoul, C

    2001-01-01

    To assess the effectiveness of a protocol of pulsatile gonadotropin releasing-hormone (GnRH) in treating infertility in women with primary hypothalamic amenorrhea. Retrospective analysis of 44 cycles treated at an infertility center. Twenty-four patients with primary hypothalamic amenorrhea were treated intravenously with pulsatile GnRH using 5 micrograms per bolus every 90 minutes. Ultrasound monitoring and cervical assessment by Insler's scoring system allowed timed injection of human chorionic gonadotropin (hCG) and intrauterine insemination if needed. Luteal support was provided with hCG. The ovulation rate was 95% with the 5-microgram dose. A single follicle was produced in 91% of cycles. The overall pregnancy rate per ovulatory cycle was 45%, and the pregnancy rate per patient was 83%. In patients treated previously with exogenous gonadotropins, poor results were observed. Only one case of mild overstimulation was reported. Pulsatile GnRH is an effective and safe method of treating infertility in women with primary hypothalamic amenorrhea, thus simulating normal ovulation; however, more-interventional management, including the qualitative estrogenic response, may lead to optimal results and increase the pregnancy rate.

  5. Anabolic steroid induced hypogonadism treated with human chorionic gonadotropin.

    OpenAIRE

    Gill, G. V.

    1998-01-01

    A case is presented of a young competitive body-builder who abused anabolic steroid drugs and developed profound symptomatic hypogonadotrophic hypogonadism. With the help of prescribed testosterone (Sustanon) he stopped taking anabolic drugs, and later stopped Sustanon also. Hypogonadism returned, but was successfully treated with weekly injections of human chorionic gonadotropin for three months. Testicular function remained normal thereafter on no treatment. The use of human chorionic gonad...

  6. Hypothalamic amenorrhea with normal body weight: ACTH, allopregnanolone and cortisol responses to corticotropin-releasing hormone test.

    Science.gov (United States)

    Meczekalski, B; Tonetti, A; Monteleone, P; Bernardi, F; Luisi, S; Stomati, M; Luisi, M; Petraglia, F; Genazzani, A R

    2000-03-01

    Hypothalamic amenorrhea (HA) is a functional disorder caused by disturbances in gonadotropin-releasing hormone (GnRH) pulsatility. The mechanism by which stress alters GnRH release is not well known. Recently, the role of corticotropin-releasing hormone (CRH) and neurosteroids in the pathophysiology of HA has been considered. The aim of the present study was to explore further the role of the hypothalamic-pituitary-adrenal axis in HA. We included 8 patients (aged 23.16+/-1.72 years) suffering from hypothalamic stress-related amenorrhea with normal body weight and 8 age-matched healthy controls in the follicular phase of the menstrual cycle. We measured basal serum levels of FSH, LH, and estradiol and evaluated ACTH, allopregnanolone and cortisol responses to CRH test in both HA patients and healthy women. Serum basal levels of FSH, LH, and estradiol as well as basal levels of allopregnanolone were significantly lower in HA patients than in controls (P<0.001) while basal ACTH and cortisol levels were significantly higher in amenorrheic patients with respect to controls (P<0.001). The response (area under the curve) of ACTH, allopregnanolone and cortisol to CRH was significantly lower in amenorrheic women compared with controls (P<0.001, P<0.05, P<0.05 respectively). In conclusion, women with HA, despite the high ACTH and cortisol levels and, therefore, hypothalamus-pituitary-adrenal axis hyperactivity, are characterized by low allopregnanolone basal levels, deriving from an impairment of both adrenal and ovarian synthesis. The blunted ACTH, allopregnanolone and cortisol responses to CRH indicate that, in hypothalamic amenorrhea, there is a reduced sensitivity and expression of CRH receptor. These results open new perspectives on the role of neurosteroids in the pathogenesis of hypothalamic amenorrhea.

  7. Canine tumor and normal tissue response to heat and radiation

    International Nuclear Information System (INIS)

    Gillette, E.L.; McChesney, S.L.

    1985-01-01

    Oral squamous cell carcinomas of dogs were treated with either irradiation alone or combined with hyperthermia. Tumor control was assessed as no evidence of disease one year following treatment. Dogs were randomized to variable radiation doses which were given in ten fractions three times a week for three weeks. Heat was given three hours after the first and third radiation dose each week for seven treatments. The attempt was made to achieve a minimum tumor temperature of 42 0 C for thirty minutes with a maximum normal tissue temperature of 40 0 C. It was usually possible to selectively heat tumors. The TCD 50 for irradiation alone was about 400 rads greater than for heat plus irradiation. The dose response curve for heat plus radiation was much steeper than for radiation alone indicating less heterogeneity of tumor response. That also implies a much greater effectiveness of radiation combined with heat at higher tumor control probabilities. Early necrosis caused by heating healed with conservative management. No increase in late radiation necrosis was observed

  8. The steroid response to human chorionic gonadotropin (hCG) stimulation in men with Klinefelter syndrome does not change using immunoassay or mass spectrometry.

    Science.gov (United States)

    Roli, L; Santi, D; Belli, S; Tagliavini, S; Cavalieri, S; De Santis, M C; Baraldi, E; Fanelli, F; Mezzullo, M; Granata, A R; Pagotto, U; Pasquali, R; Rochira, V; Carani, C; Simoni, M; Trenti, T

    2017-08-01

    Liquid-chromatography tandem mass-spectrometry (LC-MS/MS) was developed in parallel to Immunoassays (IAs) and today is proposed as the "gold standard" for steroid assays. Leydig cells of men with Klinefelter syndrome (KS) are able to respond to human chorionic gonadotropin (hCG) stimulation, even if testosterone (T) production was impaired. The aim was to evaluate how results obtained by IAs and LC-MS/MS can differently impact on the outcome of a clinical research on gonadal steroidogenesis after hCG stimulation. A longitudinal, prospective, case-control clinical trial. (clinicaltrial.gov NCT02788136) was carried out, enrolling KS men and healthy age-matched controls, stimulated by hCG administration. Serum steroids were evaluated at baseline and for 5 days after intramuscular injection of 5000 IU hCG using both IAs and LC-MS/MS. 13 KS patients (36 ± 9 years) not receiving T replacement therapy and 14 controls (32 ± 8 years) were enrolled. T, progesterone, cortisol, 17-hydroxy-progesterone (17OHP) and androstenedione, were significantly higher using IAs than LC-MS/MS. IAs and LC-MS/MS showed direct correlation for all five steroids, although the constant overestimation detected by IAs. Either methodology found the same 17OHP and T increasing profile after hCG stimulation, with equal areas under the curves (AUCs). Although a linearity between IA and LC-MS/MS is demonstrated, LC-MS/MS is more sensitive and accurate, whereas IA shows a constant overestimation of sex steroid levels. This result suggests the need of reference intervals built on the specific assay. This fundamental difference between these two methodologies opens a deep reconsideration of what is needed to improve the accuracy of steroid hormone assays.

  9. Adjuvant Growth Hormone for Ovulation Induction with Gonadotropins in the Treatment of a Woman with Hypopituitarism

    Directory of Open Access Journals (Sweden)

    Ariadne Daniel

    2012-01-01

    Full Text Available Objective. To report the prestimulation use of adjuvant GH for gonadotropin ovulation induction in a woman with hypopituitarism and GH deficiency who previously failed to respond. Design, Patients, and Measurements. A 31-year-old nulliparous woman presented with hypopituitarism and GH deficiency after failing ovulation induction with high dose gonadotropins. A trial of GH was undertaken for 5 months prior to ovulation induction resulting in normalization of IGF-I levels. Results. Women with hypopituitarism are known to have lower pregnancy rates after ovulation induction with need for higher doses of gonadotropins. A small subset of these patients do not ovulate. This patient had successful ovulation induction and pregnancy with prestimulation GH. Conclusions. This case suggests that the use of adjuvant GH in a GH-deficient patient several months before the use of human menopausal gonadotropin results in ovulation and pregnancy.

  10. GATA4 and GATA6 Knockdown During Luteinization Inhibits Progesterone Production and Gonadotropin Responsiveness in the Corpus Luteum of Female Mice.

    Science.gov (United States)

    Convissar, Scott M; Bennett, Jill; Baumgarten, Sarah C; Lydon, John P; DeMayo, Francesco J; Stocco, Carlos

    2015-12-01

    The surge of luteinizing hormone triggers the genomic reprogramming, cell differentiation, and tissue remodeling of the ovulated follicle, leading to the formation of the corpus luteum. During this process, called luteinization, follicular granulosa cells begin expressing a new set of genes that allow the resulting luteal cells to survive in a vastly different hormonal environment and to produce the extremely high amounts of progesterone (P4) needed to sustain pregnancy. To better understand the molecular mechanisms involved in the regulation of luteal P4 production in vivo, the transcription factors GATA4 and GATA6 were knocked down in the corpus luteum by crossing mice carrying Gata4 and Gata6 floxed genes with mice carrying Cre recombinase fused to the progesterone receptor. This receptor is expressed exclusively in granulosa cells after the luteinizing hormone surge, leading to recombination of floxed genes during follicle luteinization. The findings demonstrated that GATA4 and GATA6 are essential for female fertility, whereas targeting either factor alone causes subfertility. When compared to control mice, serum P4 levels and luteal expression of key steroidogenic genes were significantly lower in conditional knockdown mice. The results also showed that GATA4 and GATA6 are required for the expression of the receptors for prolactin and luteinizing hormone, the main luteotropic hormones in mice. The findings demonstrate that GATA4 and GATA6 are crucial regulators of luteal steroidogenesis and are required for the normal response of luteal cells to luteotropins. © 2015 by the Society for the Study of Reproduction, Inc.

  11. Induction of puberty with human chorionic gonadotropin and follicle-stimulating hormone in adolescent males with hypogonadotropic hypogonadism.

    Science.gov (United States)

    Barrio, R; de Luis, D; Alonso, M; Lamas, A; Moreno, J C

    1999-02-01

    To evaluate the clinical and hormonal responses of adolescent males with hypogonadotropic hypogonadism (HH) in response to gonadotropin replacement with the use of long-term combined hCG and FSH therapy. Prospective clinical study. Clinical pediatric department providing tertiary care. Seven prepubertal males with isolated HH with a mean (+/-SD) age of 15.44+/-1.97 years and seven prepubertal males with panhypopituitarism-associated HH with a mean (+/-SD) age of 18.1+/-3.24 years were studied. Human chorionic gonadotropin (1,000-1,500 IU IM) and FSH (75-100 IU SC) were administered every alternate day of the week until the total induction of puberty and spermatogenesis was achieved. Serum testosterone levels, testicular volume, penis length, and sperm count were evaluated after the administration of hCG and FSH. All patients achieved normal sexual maturation and normal or nearly normal adult male levels of testosterone. The increase in testicular size was significant in both groups. Positive sperm production was assessed in four of five patients with isolated HH and in three of three patients with panhypopituitarism-associated HH. Long-term combined hCG and FSH therapy is effective in inducing puberty, increasing testicular volume, and stimulating spermatogenesis in adolescent males with isolated HH and panhypopituitarism-associated HH.

  12. Effect of gonadotropin secretion rate on the radiosensitivity of the rat luteinizing hormone-releasing hormone neuron and gonadotroph

    International Nuclear Information System (INIS)

    Winterer, J.; Barnes, K.M.; Lichter, A.S.; Deluca, A.M.; Loriaux, D.L.; Cutler, G.B. Jr.

    1988-01-01

    To test the hypothesis that the functional state of hypothalamic LHRH neurons and pituitary gonadotrophs might alter their radiosensitivity, we determined the experimental conditions under which the gonadotropin response to castration could be impaired by a single dose of cranial irradiation. Single doses of cranial irradiation greater than 2000 rads were lethal to unshielded rats. Shielding of the oropharynx and esophagus allowed the animals to survive doses up to 5000 rads. Doses between 2000 and 5000 rads had no effect on basal gonadotropin levels for as long as 3 months after irradiation. Irradiation caused a dose- and time-dependent impairment, however, in the gonadotropin response to castration. Impairment of the gonadotropin levels of castrate animals occurred in animals that were irradiated either before or after castration. However, rats irradiated in the castrate state showed a decreased susceptibility to irradiation damage. Additionally, stimulation of the pituitary by LHRH agonist (LHRHa) 3 h before irradiation significantly reduced the impairment of gonadotropin secretion 12-20 weeks after irradiation (P less than 0.05). Thus, increased functional activity of the rat hypothalamus or pituitary at the time of irradiation, induced by either castration or acute LHRHa administration, was associated with some protection against the gonadotropin-lowering effect of irradiation. Based upon these data, we hypothesize that stimulation of gonadotropin secretion at the time of therapeutic cranial irradiation in humans might protect against subsequent impairment of gonadotropin secretion

  13. Biochemical response of normal albino rats to the addition of ...

    African Journals Online (AJOL)

    Experiments were conducted to determine the biochemical effect of Hibiscus cannabinus and Murraya koenigii extracts on normal albino rats using standard methods. Analyses carried out indicated that the aqueous leaf extract of H. cannabinus and M. koenigii exhibited significant hypolipideamic activity in normal rats.

  14. Bilateral undescended testes classified according to preoperative and postoperative status of gonadotropins and inhibin B in relation to testicular histopathology at bilateral orchiopexy in infant boys

    DEFF Research Database (Denmark)

    Thorup, Jørgen Mogens; Petersen, Bodil Laub; Kvist, Kolja

    2012-01-01

    In recent series of boys with cryptorchidism gonadotropin levels have been higher and serum inhibin B levels have been lower than normal. To some extent the serum values of inhibin B reflect the state of germinative epithelium in cryptorchid testes. We evaluated whether blood samples of gonadotro...... of gonadotropins and inhibin B as well as histopathology could be used to classify undescended testes....

  15. Pattern of human chorionic gonadotropin binding in the polycystic ovary

    International Nuclear Information System (INIS)

    Brawer, J.; Richard, M.; Farookhi, R.

    1989-01-01

    The histologic evolution of polycystic ovaries in the estradiol valerate-treated rat coincides with the development of a unique plasma pattern of luteinizing hormone. To assess the role of luteinizing hormone in polycystic ovaries, it is necessary to evaluate the luteinizing hormone sensitivity of the specific tissues in the polycystic ovary. Therefore, we examined the pattern of luteinizing hormone binding sites in polycystic ovaries. Rats at 4 or 8 weeks after estradiol valerate treatment each received an intrajugular injection of iodine 125-labeled human chorionic gonadotropin. Some rats also received a 1000-fold excess of unlabeled human chorionic gonadotropin in the same injection. Ovaries were prepared for autoradiography. Dense accumulations of grains occurred over the theca of normal and atretic secondary follicles in all ovaries and over clusters of secondary interstitial cells. The iodine label was variable over the typically hypertrophied theca of precystic follicles. The theca of definitive cysts showed little or no label. These results indicate that cyst formation coincides with the loss of luteinizing hormone/human chorionic gonadotropin binding to the affected follicles

  16. Pattern of human chorionic gonadotropin binding in the polycystic ovary

    Energy Technology Data Exchange (ETDEWEB)

    Brawer, J.; Richard, M.; Farookhi, R. (McGill Univ., Montreal, Quebec (Canada))

    1989-08-01

    The histologic evolution of polycystic ovaries in the estradiol valerate-treated rat coincides with the development of a unique plasma pattern of luteinizing hormone. To assess the role of luteinizing hormone in polycystic ovaries, it is necessary to evaluate the luteinizing hormone sensitivity of the specific tissues in the polycystic ovary. Therefore, we examined the pattern of luteinizing hormone binding sites in polycystic ovaries. Rats at 4 or 8 weeks after estradiol valerate treatment each received an intrajugular injection of iodine 125-labeled human chorionic gonadotropin. Some rats also received a 1000-fold excess of unlabeled human chorionic gonadotropin in the same injection. Ovaries were prepared for autoradiography. Dense accumulations of grains occurred over the theca of normal and atretic secondary follicles in all ovaries and over clusters of secondary interstitial cells. The iodine label was variable over the typically hypertrophied theca of precystic follicles. The theca of definitive cysts showed little or no label. These results indicate that cyst formation coincides with the loss of luteinizing hormone/human chorionic gonadotropin binding to the affected follicles.

  17. Effect of gonadotropins on oocyte maturation in vitro: an animal model.

    Science.gov (United States)

    Sha, Wei; Xu, Bao-Zeng; Li, Mo; Liu, Di; Feng, Huai L; Sun, Qing-Yuan

    2010-03-15

    Analysis of the effects of human-derived gonadotropin drugs, FSH and LH (Repronex) and hCG (Novarel), on oocyte maturation, using a porcine oocyte in vitro maturation system as a culture model. Randomized research experimental study. Academic basic research laboratory. Prepubertal gilts that were slaughtered in the local slaughter house. Oocytes will be exposed to immunofluorescent staining and confocal laser scanning microscopy: Western blot analysis on cumulus-oocyte-complexes following treatment with different concentrations of the gonadotropin drugs Repronex, Novarel, and a Repronex and Novarel combination. Analysis of porcine oocyte spindle and chromosomal configuration with alpha-tubulin-fluorescein isothiocyanate antibody and propidium iodide staining. Porcine oocyte mitochondrial distribution and aggregation pattern staining was assessed with Mito Tracker Red CMXRox probe. Porcine oocyte cortical granule distribution was observed via peanut agglutinin-fluorescein isothiocyannate staining; Western blot analysis detected extra-cellular signal-regulated kinase 1/2 activation in cumulus cells. An increase of gonadotropin concentration in the culture medium resulted in an increase in the following: the percentage of oocytes reaching metaphase II, normal configuration of the spindle, normal chromosomal alignment, cortical granule migration, and mitochondrial aggregation. Levels of nuclear and cytoplasmic maturation peaked as the concentration of gonadotropins approached its threshold level. Addition of a threshold concentration of the gonadotropin drugs Repronex, Novarel, and a combination of the two can significantly improve porcine oocyte maturation in vitro. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  18. Thyrotropic action of human chorionic gonadotropin.

    Science.gov (United States)

    Yoshimura, M; Hershman, J M

    1995-10-01

    Hyperthyroidism or increased thyroid function has been reported in many patients with trophoblastic tumors. In these cases, greatly increased human chorionic gonadotropin (hCG) levels and suppressed TSH levels suggest that hCG has thyrotropic activity. Recent investigations have clarified the structural homology not only in the hCG and TSH molecules but also in their receptors, and this homology suggests the basis for the reactivity of hCG with the TSH receptor. The clinical significance of the thyrotropic action of hCG is now also recognized in normal pregnancy and hyperemesis gravidarum. Highly purified hLH binds to recombinant hTSH receptor and is about 10 times as potent as purified hCG in increasing cAMP. The beta-subunits of hCG and hLH share 85% sequence identity in their first 114 amino acids but differ in the carboxy-terminal peptide because hCG beta contains a 31-amino acid extension (beta-CTP). A recombinant mutant hCG that lacks beta-CTP showed almost identical potency to LH on stimulation of recombinant hTSH receptor. If intact hCG were as potent as hLH in regard to its thyrotropic activity, most pregnant women would become thyrotoxic. One of the roles of the beta-CTP may be to prevent overt hyperthyroidism in the first trimester of pregnancy when a large amount of hCG is produced by the placenta. Nicked hCG preparations, obtained from patients with trophoblastic disease or by enzymatic digestion of intact hCG, showed approximately 1.5- to 2-fold stimulation of recombinant hTSH receptor compared with intact hCG. This suggests that the thyrotropic activity of hCG may be influenced by the metabolism of the hCG molecule itself. Deglycosylation and/or desialylation of hCG enhances its thyrotropic potency. Basic hCG isoforms with lower sialic acid content extracted from hydatidiform moles were more potent in activating adenylate cyclase, and showed high bioactivity/immunoactivity (B/I) ratio in CHO cells expressing human TSH receptors. This is consistent

  19. Is the assumption of normality or log-normality for continuous response data critical for benchmark dose estimation?

    International Nuclear Information System (INIS)

    Shao, Kan; Gift, Jeffrey S.; Setzer, R. Woodrow

    2013-01-01

    Continuous responses (e.g. body weight) are widely used in risk assessment for determining the benchmark dose (BMD) which is used to derive a U.S. EPA reference dose. One critical question that is not often addressed in dose–response assessments is whether to model the continuous data as normally or log-normally distributed. Additionally, if lognormality is assumed, and only summarized response data (i.e., mean ± standard deviation) are available as is usual in the peer-reviewed literature, the BMD can only be approximated. In this study, using the “hybrid” method and relative deviation approach, we first evaluate six representative continuous dose–response datasets reporting individual animal responses to investigate the impact on BMD/BMDL estimates of (1) the distribution assumption and (2) the use of summarized versus individual animal data when a log-normal distribution is assumed. We also conduct simulation studies evaluating model fits to various known distributions to investigate whether the distribution assumption has influence on BMD/BMDL estimates. Our results indicate that BMDs estimated using the hybrid method are more sensitive to the distribution assumption than counterpart BMDs estimated using the relative deviation approach. The choice of distribution assumption has limited impact on the BMD/BMDL estimates when the within dose-group variance is small, while the lognormality assumption is a better choice for relative deviation method when data are more skewed because of its appropriateness in describing the relationship between mean and standard deviation. Additionally, the results suggest that the use of summarized data versus individual response data to characterize log-normal distributions has minimal impact on BMD estimates. - Highlights: • We investigate to what extent the distribution assumption can affect BMD estimates. • Both real data analysis and simulation study are conducted. • BMDs estimated using hybrid method are more

  20. Is the assumption of normality or log-normality for continuous response data critical for benchmark dose estimation?

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Kan, E-mail: Shao.Kan@epa.gov [ORISE Postdoctoral Fellow, National Center for Environmental Assessment, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Gift, Jeffrey S. [National Center for Environmental Assessment, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Setzer, R. Woodrow [National Center for Computational Toxicology, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)

    2013-11-01

    Continuous responses (e.g. body weight) are widely used in risk assessment for determining the benchmark dose (BMD) which is used to derive a U.S. EPA reference dose. One critical question that is not often addressed in dose–response assessments is whether to model the continuous data as normally or log-normally distributed. Additionally, if lognormality is assumed, and only summarized response data (i.e., mean ± standard deviation) are available as is usual in the peer-reviewed literature, the BMD can only be approximated. In this study, using the “hybrid” method and relative deviation approach, we first evaluate six representative continuous dose–response datasets reporting individual animal responses to investigate the impact on BMD/BMDL estimates of (1) the distribution assumption and (2) the use of summarized versus individual animal data when a log-normal distribution is assumed. We also conduct simulation studies evaluating model fits to various known distributions to investigate whether the distribution assumption has influence on BMD/BMDL estimates. Our results indicate that BMDs estimated using the hybrid method are more sensitive to the distribution assumption than counterpart BMDs estimated using the relative deviation approach. The choice of distribution assumption has limited impact on the BMD/BMDL estimates when the within dose-group variance is small, while the lognormality assumption is a better choice for relative deviation method when data are more skewed because of its appropriateness in describing the relationship between mean and standard deviation. Additionally, the results suggest that the use of summarized data versus individual response data to characterize log-normal distributions has minimal impact on BMD estimates. - Highlights: • We investigate to what extent the distribution assumption can affect BMD estimates. • Both real data analysis and simulation study are conducted. • BMDs estimated using hybrid method are more

  1. Empathy, normality and responsiveness among street-level bureaucrats

    DEFF Research Database (Denmark)

    Møller, Marie Østergaard; Nielsen, Vibeke Lehmann

    2014-01-01

    Within the public sector it is a permanent dilemma that we on one hand – on the grounds of effectiveness and flexibility – want employees to have discretion and autonomy, but at the same time want to make sure that citizens and clients of the public sector are treated equally and independent of w...... this paper discusses and analyzes how perceptions of local target group’s problem portfolio (normality perceptions) conditions the behavioral effects of personal attributes/personality traits (differences in empathy)....

  2. Features of natural and gonadotropin-releasing hormone antagonist-induced corpus luteum regression and effects of in vivo human chorionic gonadotropin.

    Science.gov (United States)

    Del Canto, Felipe; Sierralta, Walter; Kohen, Paulina; Muñoz, Alex; Strauss, Jerome F; Devoto, Luigi

    2007-11-01

    The natural process of luteolysis and luteal regression is induced by withdrawal of gonadotropin support. The objectives of this study were: 1) to compare the functional changes and apoptotic features of natural human luteal regression and induced luteal regression; 2) to define the ultrastructural characteristics of the corpus luteum at the time of natural luteal regression and induced luteal regression; and 3) to examine the effect of human chorionic gonadotropin (hCG) on the steroidogenic response and apoptotic markers within the regressing corpus luteum. Twenty-three women with normal menstrual cycles undergoing tubal ligation donated corpus luteum at specific stages in the luteal phase. Some women received a GnRH antagonist prior to collection of corpus luteum, others received an injection of hCG with or without prior treatment with a GnRH antagonist. Main outcome measures were plasma hormone levels and analysis of excised luteal tissue for markers of apoptosis, histology, and ultrastructure. The progesterone and estradiol levels, corpus luteum DNA, and protein contents in induced luteal regression resembled those of natural luteal regression. hCG treatment raised progesterone and estradiol in both natural luteal regression and induced luteal regression. The increase in apoptosis detected in induced luteal regression by cytochrome c in the cytosol, activated caspase-3, and nuclear DNA fragmentation, was similar to that observed in natural luteal regression. The antiapoptotic protein Bcl-2 was significantly lower during natural luteal regression. The proapoptotic proteins Bax and Bak were at a constant level. Apoptotic and nonapoptotic death of luteal cells was observed in natural luteal regression and induced luteal regression at the ultrastructural level. hCG prevented apoptotic cell death, but not autophagy. The low number of apoptotic cells disclosed and the frequent autophagocytic suggest that multiple mechanisms are involved in cell death at luteal

  3. Mouse genetic approaches applied to the normal tissue radiation response

    International Nuclear Information System (INIS)

    Haston, Christina K.

    2012-01-01

    The varying responses of inbred mouse models to radiation exposure present a unique opportunity to dissect the genetic basis of radiation sensitivity and tissue injury. Such studies are complementary to human association studies as they permit both the analysis of clinical features of disease, and of specific variants associated with its presentation, in a controlled environment. Herein I review how animal models are studied to identify specific genetic variants influencing predisposition to radiation-induced traits. Among these radiation-induced responses are documented strain differences in repair of DNA damage and in extent of tissue injury (in the lung, skin, and intestine) which form the base for genetic investigations. For example, radiation-induced DNA damage is consistently greater in tissues from BALB/cJ mice, than the levels in C57BL/6J mice, suggesting there may be an inherent DNA damage level per strain. Regarding tissue injury, strain specific inflammatory and fibrotic phenotypes have been documented for principally, C57BL/6 C3H and A/J mice but a correlation among responses such that knowledge of the radiation injury in one tissue informs of the response in another is not evident. Strategies to identify genetic differences contributing to a trait based on inbred strain differences, which include linkage analysis and the evaluation of recombinant congenic (RC) strains, are presented, with a focus on the lung response to irradiation which is the only radiation-induced tissue injury mapped to date. Such approaches are needed to reveal genetic differences in susceptibility to radiation injury, and also to provide a context for the effects of specific genetic variation uncovered in anticipated clinical association studies. In summary, mouse models can be studied to uncover heritable variation predisposing to specific radiation responses, and such variations may point to pathways of importance to phenotype development in the clinic.

  4. Congenital gonadotropin deficiency in boys: management during childhood.

    Science.gov (United States)

    Adan, L; Couto-Silva, A C; Trivin, C; Metz, C; Brauner, R

    2004-02-01

    To analyze the features of boys with congenital gonadotropin deficiency (CGD), and to determine the value of plasma inhibin B and anti-Müllerian hormone (AMH) for predicting testicular function and the effect of testosterone treatment. We followed 19 boys for CGD, including five with Kallmann syndrome. The boys were seen before 14 years of age for micropenis (9 boys) or later for delayed puberty (10 boys). No testis was palpable in the scrotum in 13 patients, bilaterally in seven of them. Luteinizing hormone (LH) peak after a gonadotropin releasing hormone (GnRH) test was between 0.5 and 5.6 U/l. Plasma inhibin B was low in the four patients evaluated at less than 1 year old. AMH was low in one of them and normal in four others. Of the older patients, three lad low plasma inhibin B and four had normal concentrations; plasma AMH was low in three of them and increased in four. Testosterone treatment restored penis length to normal in all patients. Low plasma inhibin B and AMH concentrations may indicate testicular damage in boys with CGD.

  5. Induction of spermatogenesis and fertility in hypogonadotropic azoospermic men by intravenous pulsatile gonadotropin-releasing hormone (GnRH).

    Science.gov (United States)

    Blumenfeld, Z; Makler, A; Frisch, L; Brandes, J M

    1988-06-01

    Gonadotropin-releasing hormone (GnRH) has only recently become a helpful tool in the medication of hypogonadotropic hypogonadism (HH). Two azoospermic patients with HH who had previously been treated with hCG/hMG because of delayed puberty and each of whom had fathered a child after previous gonadotropin therapy were referred due to secondary failure of hCG/hMG treatment to induce spermatogenesis and fertility. A pulse study where blood was drawn every 15 minutes for LH, FSH and PRL RIAs was performed in each patient, and afterwards a bolus of i.v. GnRH was injected to assess gonadotropin responsiveness. A portable GnRH pump was connected to each patient so that it administered 5-20 micrograms of GnRH i.v. every 89 minutes. Spermatogenesis was first detected after 42 and 78 days respectively in the 2 treated HH men and 4 1/2 months from the start of treatment their wives became pregnant. No thrombophlebitis or other complications of the i.v. therapy occurred. In the case of the first patient, the semen was washed and concentrated and intra-uterine inseminations were carried out in an attempt to shorten the time needed to achieve fertility. The first pregnancy was successfully terminated at 38 weeks with the delivery of 2 heterozygotic normal male babies. The second pregnancy ended in spontaneous delivery of a healthy female. We conclude that i.v. pulsatile, intermittent GnRH administration is a safe, efficient and highly successful means of treating azoospermic men with HH.

  6. Radiogenic responses of normal cells induced by fractionated irradiation -a simulation study. Pt. 2. Late responses

    International Nuclear Information System (INIS)

    Duechting, W.; Ulmer, W.; Ginsberg, T.; Kikhounga-N'Got, O.; Saile, C.

    1995-01-01

    Based on controlled theory, a computed simulation model has been constructed which describes the time course of slowly responding normal cells after irradiation exposure. Subsequently, different clinical irradiation schemes are compared in regard to their delayed radiogenic responses referred to as late effects in radiological terminology. A cybernetic model of a paraenchymal tissue consisting of dominantly resting functional cells has been developed and transferred into a computer model. The radiation effects are considered by characteristic cell parameters as well as by the linear-quadratic model. Three kinds of tissue (brain and lung parenchym of the mouse, liver parenchym of rat) have been irradiated in the model according to standard-, super-, hyperfractionation and a single high dose per week. The simulation studies indicate that the late reaction of brain parenchym to hyperfractionation (3 x 1.5 Gy per day) and of lung parenchym tissue with regard to all fractionation schemes applied is particularly severe. The behavior of liver parenchym is not unique. A comparison of the simulation results basing to the survival of cell numbers with clinical experience and practice shows that the clinical reality can qualitatively be represented by the model. This opens the door for connecting side effects to normal tissue with the corresponding tumor efficacy (discussed in previous papers). The model is open to further refinement and to discussions referring to the phenomenon of late effects. (orig.) [de

  7. A regulator of G Protein signaling, RGS3, inhibits gonadotropin-releasing hormone (GnRH-stimulated luteinizing hormone (LH secretion

    Directory of Open Access Journals (Sweden)

    Musgrove Lois C

    2001-11-01

    Full Text Available Abstract Background Luteinizing hormone secreted by the anterior pituitary gland regulates gonadal function. Luteinizing hormone secretion is regulated both by alterations in gonadotrope responsiveness to hypothalamic gonadotropin releasing hormone and by alterations in gonadotropin releasing hormone secretion. The mechanisms that determine gonadotrope responsiveness are unknown but may involve regulators of G protein signaling (RGSs. These proteins act by antagonizing or abbreviating interaction of Gα proteins with effectors such as phospholipase Cβ. Previously, we reported that gonadotropin releasing hormone-stimulated second messenger inositol trisphosphate production was inhibited when RGS3 and gonadotropin releasing hormone receptor cDNAs were co-transfected into the COS cell line. Here, we present evidence for RGS3 inhibition of gonadotropin releasing hormone-induced luteinizing hormone secretion from cultured rat pituitary cells. Results A truncated version of RGS3 (RGS3T = RGS3 314–519 inhibited gonadotropin releasing hormone-stimulated inositol trisphosphate production more potently than did RSG3 in gonadotropin releasing hormone receptor-bearing COS cells. An RSG3/glutathione-S-transferase fusion protein bound more 35S-Gqα than any other member of the G protein family tested. Adenoviral-mediated RGS3 gene transfer in pituitary gonadotropes inhibited gonadotropin releasing hormone-stimulated luteinizing hormone secretion in a dose-related fashion. Adeno-RGS3 also inhibited gonadotropin releasing hormone stimulated 3H-inositol phosphate accumulation, consistent with a molecular site of action at the Gqα protein. Conclusions RGS3 inhibits gonadotropin releasing hormone-stimulated second messenger production (inositol trisphosphate as well as luteinizing hormone secretion from rat pituitary gonadotropes apparently by binding and suppressing the transduction properties of Gqα protein function. A version of RGS3 that is amino

  8. Evaluating the ovarian cancer gonadotropin hypothesis

    DEFF Research Database (Denmark)

    Lee, Alice W; Tyrer, Jonathan P; Doherty, Jennifer A

    2015-01-01

    OBJECTIVE: Ovarian cancer is a hormone-related disease with a strong genetic basis. However, none of its high-penetrance susceptibility genes and GWAS-identified variants to date are known to be involved in hormonal pathways. Given the hypothesized etiologic role of gonadotropins, an assessment...... of how variability in genes involved in the gonadotropin signaling pathway impacts disease risk is warranted. METHODS: Genetic data from 41 ovarian cancer study sites were pooled and unconditional logistic regression was used to evaluate whether any of the 2185 SNPs from 11 gonadotropin signaling pathway...... genes was associated with ovarian cancer risk. A burden test using the admixture likelihood (AML) method was also used to evaluate gene-level associations. RESULTS: We did not find any genome-wide significant associations between individual SNPs and ovarian cancer risk. However, there was some...

  9. A heteroscedastic generalized linear model with a non-normal speed factor for responses and response times.

    Science.gov (United States)

    Molenaar, Dylan; Bolsinova, Maria

    2017-05-01

    In generalized linear modelling of responses and response times, the observed response time variables are commonly transformed to make their distribution approximately normal. A normal distribution for the transformed response times is desirable as it justifies the linearity and homoscedasticity assumptions in the underlying linear model. Past research has, however, shown that the transformed response times are not always normal. Models have been developed to accommodate this violation. In the present study, we propose a modelling approach for responses and response times to test and model non-normality in the transformed response times. Most importantly, we distinguish between non-normality due to heteroscedastic residual variances, and non-normality due to a skewed speed factor. In a simulation study, we establish parameter recovery and the power to separate both effects. In addition, we apply the model to a real data set. © 2017 The Authors. British Journal of Mathematical and Statistical Psychology published by John Wiley & Sons Ltd on behalf of British Psychological Society.

  10. Abrogation by human menopausal gonadotropin on testicular ...

    African Journals Online (AJOL)

    Cisplatin is one of the most effective chemotherapeutic agents used in the treatment of cancer cells including testicular cancer. Human Menopausal Gonadotropin (HMG) is a natural hormone necessary for human reproduction. This hormone is a leading modality of treatment for infertility as it contains equal amount of ...

  11. Induction of Gonadotropins for Reproductive Control

    Directory of Open Access Journals (Sweden)

    Elza Ibrahim Auerkari

    2015-10-01

    Full Text Available Much of the recent research on gonadotropin – related control processes of reproduction and reproductive maturation has concentrated on the neuronal and molecular biology of gonadotropin release. The reproductive development of healthy mammals requires appropriate fetal develompment and migration of the neural network controlling and including the gonadotropin releasing hormone (GnRH – producing neurons that are needed to regulate GnRH and luteinizing hormone (LH release. GnRH is also necessary for the development of the gonadotropin – producing pituitary gland. The fetal gonads respon to GnRH – induced LH production by producing the gonadal steroids required for further reproductive differentiation. Pubertal maturation is characterised by increases in LH levels, representing the corresponding pulsatile release of GnRH. This GnRH pulse generator appears to be an intrinsic property of the arcuate nucleus at the medial basal hypothalamus. The generator activity can be mediated by the neurotransmitter aspartate which activates neurons of the hypothalamus, inducing acuate releases of GnRH and hence initiates puberty. A major factor in human reproductive maturation is the decrease in the age of puberty, caused by improvement of nutritional conditions due to the socio – economic development. This implies that the pubertal activation of GnRH secretion depends on metabolic conditions. Of the substances that mediate the metabolic condition to the neuronal network regulating GnRH secretion, the role of the neuropeptide Y (NPY appears instrumental : for healthy mammals less food means more NPY, and accumulated NPY makes food to become sex. NPY does this by regulating the appropriate hypothalamic functions including the neuroendocrine control of gonadotropin release.

  12. Analysis of a Dynamic Viscoelastic Contact Problem with Normal Compliance, Normal Damped Response, and Nonmonotone Slip Rate Dependent Friction

    Directory of Open Access Journals (Sweden)

    Mikaël Barboteu

    2016-01-01

    Full Text Available We consider a mathematical model which describes the dynamic evolution of a viscoelastic body in frictional contact with an obstacle. The contact is modelled with a combination of a normal compliance and a normal damped response law associated with a slip rate-dependent version of Coulomb’s law of dry friction. We derive a variational formulation and an existence and uniqueness result of the weak solution of the problem is presented. Next, we introduce a fully discrete approximation of the variational problem based on a finite element method and on an implicit time integration scheme. We study this fully discrete approximation schemes and bound the errors of the approximate solutions. Under regularity assumptions imposed on the exact solution, optimal order error estimates are derived for the fully discrete solution. Finally, after recalling the solution of the frictional contact problem, some numerical simulations are provided in order to illustrate both the behavior of the solution related to the frictional contact conditions and the theoretical error estimate result.

  13. Frictional response of simulated faults to normal stresses perturbations probed with ultrasonic waves

    Science.gov (United States)

    Shreedharan, S.; Riviere, J.; Marone, C.

    2017-12-01

    We report on a suite of laboratory friction experiments conducted on saw-cut Westerly Granite surfaces to probe frictional response to step changes in normal stress and loading rate. The experiments are conducted to illuminate the fundamental processes that yield friction rate and state dependence. We quantify the microphysical frictional response of the simulated fault surfaces to normal stress steps, in the range of 1% - 600% step increases and decreases from a nominal baseline normal stress. We measure directly the fault slip rate and account for changes in slip rate with changes in normal stress and complement mechanical data acquisition by continuously probing the faults with ultrasonic pulses. We conduct the experiments at room temperature and humidity conditions in a servo controlled biaxial testing apparatus in the double direct shear configuration. The samples are sheared over a range of velocities, from 0.02 - 100 μm/s. We report observations of a transient shear stress and friction evolution with step increases and decreases in normal stress. Specifically, we show that, at low shear velocities and small increases in normal stress ( 5% increases), the shear stress evolves immediately with normal stress. We show that the excursions in slip rate resulting from the changes in normal stress must be accounted for in order to predict fault strength evolution. Ultrasonic wave amplitudes which first increase immediately in response to normal stress steps, then decrease approximately linearly to a new steady state value, in part due to changes in fault slip rate. Previous descriptions of frictional state evolution during normal stress perturbations have not adequately accounted for the effect of large slip velocity excursions. Here, we attempt to do so by using the measured ultrasonic amplitudes as a proxy for frictional state during transient shear stress evolution. Our work aims to improve understanding of induced and triggered seismicity with focus on

  14. Tumor and normal tissue responses to fractioned non-uniform dose delivery

    Energy Technology Data Exchange (ETDEWEB)

    Kaellman, P; Aegren, A; Brahme, A [Karolinska Inst., Stockholm (Sweden). Dept. of Radiation Physics

    1996-08-01

    The volume dependence of the radiation response of a tumor is straight forward to quantify because it depends primarily on the eradication of all its clonogenic cells. A tumor therefore has a parallel organization as any surviving clonogen in principle can repopulate the tumor. The difficulty with the response of the tumor is instead to know the density and sensitivity distribution of the most resistant clonogenic cells. The increase in the 50% tumor control dose and the decrease in the maximum normalized slope of the dose response relation, {gamma}, in presence of small compartments of resistant tumor cells have therefore been quantified to describe their influence on the dose response relation. Injury to normal tissue is a much more complex and gradual process. It depends on earlier effects induced long before depletion of the differentiated and clonogenic cells that in addition may have a complex structural and functional organization. The volume dependence of the dose response relation of normal tissues is therefore described here by the relative seriality, s, of the infrastructure of the organ. The model can also be generalized to describe the response of heterogeneous tissues to non uniform dose distributions. The new model is compared with clinical and experimental data on normal tissue response, and shows good agreement both with regard to the shape of dose response relation and the volume dependence of the isoeffect dose. The response of tumors and normal tissues are quantified for arbitrary dose fractionations using the linear quadratic cell survival parameters {alpha} and {beta}. The parameters of the dose response relation are derived both for a constant dose per fraction and a constant number of dose fractions, thus in the latter case accounting also for non uniform dose delivery. (author). 26 refs, 4 figs.

  15. Responses of vibrissa-sensitive cortical neurons in normal and prenatally x-irradiated rat

    International Nuclear Information System (INIS)

    Ito, M.; Kawabata, M.; Shoji, R.

    1979-01-01

    Rats were irradiated by 200 R of x ray on day 17 of gestation through the body wall of the mother. When they underwent the following electrophysiological tests at the age of 3 to 4 month, the somatosensory cortex showed a lack of layers II, III, IV, and Va. Spike responses to quick whisker deflections were recorded from single cells in the somatosenory cortex of normal and prenatally x-irradiated rats. For the irradiated rats the response latency was prolonged when compared to the normal controls. Cortical laminar analysis of field potentials revealed that there was no difference in the latency of these potentials between the two groups, suggesting that vibrissal sensory signals reach the cortical level normally even in the irradiated rats. The prolonged latency of the irradiated cortical neuronal response could thus be ascribed to an abnormal intracortical delay, which was most likely associated with the failure of development of layer IV stellate cells in these preparations

  16. Development of a radioimmunoassay for circulating levels of gonadotropin releasing hormone

    International Nuclear Information System (INIS)

    Moodbidri, S.B.; Joshi, L.R.; Sheth, A.R.; Rao, S.S.

    1976-01-01

    A specific and sensitive radioimmunoassay system has been developed for measuring gonadotropin releasing hormone (GnRH) in unextracted human serum. Circulating levels of GnRH, LH and FSH were determined in 37 serum samples obtained from twenty normal healthy women on different days of the menstrual cycle. GnRH and LH but not FSH exhibited similar patterns during the menstrual cycle. 125 I-labelled GnRH was used in the RIA system. (author)

  17. Dosimetric precision requirements and quantities for characterizing the response of tumors and normal tissues

    Energy Technology Data Exchange (ETDEWEB)

    Brahme, A [Karolinska Inst., Stockholm (Sweden). Dept. of Radiation Physics

    1996-08-01

    Based on simple radiobiological models the effect of the distribution of absorbed dose in therapy beams on the radiation response of tumor and normal tissue volumes are investigated. Under the assumption that the dose variation in the treated volume is small it is shown that the response of the tissue to radiation is determined mainly by the mean dose to the tumor or normal tissue volume in question. Quantitative expressions are also given for the increased probability of normal tissue complications and the decreased probability of tumor control as a function of increasing dose variations around the mean dose level to these tissues. When the dose variations are large the minimum tumor dose (to cm{sup 3} size volumes) will generally be better related to tumor control and the highest dose to significant portions of normal tissue correlates best to complications. In order not to lose more than one out of 20 curable patients (95% of highest possible treatment outcome) the required accuracy in the dose distribution delivered to the target volume should be 2.5% (1{sigma}) for a mean dose response gradient {gamma} in the range 2 - 3. For more steeply responding tumors and normal tissues even stricter requirements may be desirable. (author). 15 refs, 6 figs.

  18. The influence of dose fractionation and dose rate on normal tissue responses

    International Nuclear Information System (INIS)

    Barendsen, G.W.

    1982-01-01

    An analysis of responses of a variety of normal tissues in animals to fractionated irradiations has been made with the aim of developing a formalism for the prediction of tolerance doses as a function of the dose per fraction and the overall treatment time. An important feature of the formalism is that it is directly based on radiological insights and therefore provides a logical concept to account for the diversity of tissue responses. (Auth.)

  19. A survey of Sertoli cell differentiation in men after gonadotropin suppression and in testicular cancer

    DEFF Research Database (Denmark)

    Tarulli, Gerard A; Stanton, Peter G; Loveland, Kate L

    2013-01-01

    It is widely held that the somatic cell population that is responsible for sperm development and output (Sertoli cells) is terminally differentiated and unmodifiable in adults. It is postulated, with little evidence, that Sertoli cells are not terminally differentiated in some phenotypes of infer...... tubules with CIS and the emergence of strong JAM-A reactivity in seminoma. These findings indicate that adult human Sertoli cells exhibit characteristics of an undifferentiated state in oligospermic men and patients with CIS and seminoma in the presence of germ cell neoplasia....... of infertility and testicular cancer. This study sought to compare markers of Sertoli cell differentiation in normospermic men, oligospermic men (undergoing gonadotropin suppression) and testicular carcinoma in situ (CIS) and seminoma samples. Confocal microscopy was used to assess the expression of markers...... of proliferation (PCNA and Ki67) and functional differentiation (androgen receptor). As additional markers of differentiation, the organization of Sertoli cell tight junction and associated proteins were assessed in specimens with carcinoma in situ. In normal men, Sertoli cells exhibited a differentiated phenotype...

  20. Accident and Off-Normal Response and Recovery from Multi-Canister Overpack (MCO) Processing Events

    International Nuclear Information System (INIS)

    ALDERMAN, C.A.

    2000-01-01

    In the process of removing spent nuclear fuel (SNF) from the K Basins through its subsequent packaging, drymg, transportation and storage steps, the SNF Project must be able to respond to all anticipated or foreseeable off-normal and accident events that may occur. Response procedures and recovery plans need to be in place, personnel training established and implemented to ensure the project will be capable of appropriate actions. To establish suitable project planning, these events must first be identified and analyzed for their expected impact to the project. This document assesses all off-normal and accident events for their potential cross-facility or Multi-Canister Overpack (MCO) process reversal impact. Table 1 provides the methodology for establishing the event planning level and these events are provided in Table 2 along with the general response and recovery planning. Accidents and off-normal events of the SNF Project have been evaluated and are identified in the appropriate facility Safety Analysis Report (SAR) or in the transportation Safety Analysis Report for Packaging (SARP). Hazards and accidents are summarized from these safety analyses and listed in separate tables for each facility and the transportation system in Appendix A, along with identified off-normal events. The tables identify the general response time required to ensure a stable state after the event, governing response documents, and the events with potential cross-facility or SNF process reversal impacts. The event closure is predicated on stable state response time, impact to operations and the mitigated annual occurrence frequency of the event as developed in the hazard analysis process

  1. [Spermatogenesis of pulsatile gonadotropin-releasing hormone infusion versus gonadotropin therapy in male idiopathic hypogonadotropic hypogonadism].

    Science.gov (United States)

    Huang, Bingkun; Mao, Jiangfeng; Xu, Hongli; Wang, Xi; Liu, Zhaoxiang; Nie, Min; Wu, Xueyan

    2015-05-26

    To compare the efficacies of pulsatile gonadotropin-releasing hormone (GnRH) versus human chorionic gonadotropin/human menopausal gonadotropin (HCG/HMG) for spermatogenesis in male idiopathic hypogonadotropic hypogonadism (IHH). For this retrospective study, a total of 92 male IHH outpatients from May 2010 to October 2014 were recruited and categorized into GnRH (n = 40) and HCG/HMG (n = 52) groups. Each subject selected one specific therapy voluntarily. The gonadotropin levels were measured in the first week and monthly post-treatment in GnRH group. And serum total testosterone (TT), testicular volume (TV) and rate of spermatogenesis were observed monthly post-treatment in two groups. Spermatogenesis, TT and TV were compared between two groups. All IHH patients were treated for over 3 months. The median follow-up periods in GnRH and HCG/HMG groups was 8.2 (3.0-18.4) and 9.2 (3.0-18.6) months respectively (P = 0.413). In GnRH group, LH ((0.5 ± 0.6) vs (3.4 ± 2.4) U/L, P treatment. In GnRH group, at the end of follow-up, TT ((1.0 ± 1.0) vs (7.4 ± 5.2) nmol/L, P treatment time for initial sperm appearance than HCG/HMG group ((6.5 ± 3.1) vs (10.8 ± 3.7) months, P = 0.001). Pulsatile GnRH requires a shorter time for initiation of spermatogenesis than gonadotropin therapy in IHH male patients.

  2. Ejection fraction response to exercise in patients with chest pain and normal coronary arteriograms

    International Nuclear Information System (INIS)

    Gibbons, R.L.; Lee, K.L.; Cobb, F.; Jones, R.H.

    1981-01-01

    In this study we describe the ejection fraction response to upright exercise using first-pass radionuclide angiocardiography in a group of 60 patients with chest pain, normal coronary ateriograms and normal resting ventricular function. A wide range of resting function (heart rate and ejection fraction) and exercise function (heart rate, ejection fraction, peak work load and estimated peak oxygen uptake) were measured. The ejection fraction response to exercise demonstrated wide variation, ranging from a decrease of 23% to an increase of 24%. Six of 22 clinical and radionuclide angiocardiographic variables (resting ejection fraction, peak work load, age, sex, body surface area and the change in end-diastolic volume index with exercise) were significant univariate predictors of the ejection fraction response to exercise. Multivariable analysis identified resting ejection fraction, the change in end-diastolic volume index with exercise and either sex or peak work load as variables that provided significant independent predictive information. These observations indicate that the ejection fraction response to exercise is a complex response that is influenced by multiple physiologic variables. The wide variation in this population suggests that the ejection fraction response to exercise is not a reliable test for the diagnosis of coronary artery disease because of its low specificity

  3. Quantitative radiation dose-response relationships for normal tissues in man - I. Gustatory tissues response during photon and neutron radiotherapy

    International Nuclear Information System (INIS)

    Mossman, K.L.

    1982-01-01

    Quantitative radiation dose-response curves for normal gustatory tissue in man were studied. Taste function, expressed as taste loss, was evaluated in 84 patients who were given either photon or neutron radiotherapy for tumors in the head and neck region. Patients were treated to average tumor doses of 6600 cGy (photon) or 2200 cGy intervals for photon patients and 320-cGy intervals for neutron patients during radiotherapy. The dose-response curves for photons and neutrons were analyzed by fitting a four-parameter logistic equation to the data. Photon and neutron curves differed principally in their relative position along the dose axis. Comparison of the dose-response curves were made by determination of RBE. At 320 cGy, the lowest neutron dose at which taste measurements were made, RBE = 5.7. If this RBE is correct, then the therapeutic gain factor may be equal to or less than 1, indicating no biological advantage in using neutrons over photons for this normal tissue. These studies suggest measurements of taste function and evaluation of dose-response relationships may also be useful in quantitatively evaluating the efficacy of chemical modifiers of radiation response such as hypoxic cell radiosensitizers and radioprotectors

  4. Plasma Catecholamines, Sweat Electrolytes and Physiological Responses of Exercised Normal, Partial Anhidrotic and Anhidrotic Horses

    OpenAIRE

    A. Bashir; A. Rasedee

    2009-01-01

    Problem statement: Malaysia imports horses from temperate countries to develop equine sports in the country. Several of these horses developed partial and complete anhidrosis. Approach: Normal, partial anhidrotic and anhidrotic horses were exercised to determine their sweating and physiological responses to exercise. The heart and respiratory rates, rectal temperature and blood samples were obtained before the horses were lunged at 10 km h-­1 for 1 h and at again at 15, 30, 45, 60 min and 24 ...

  5. Responses of some normal tissues to low doses of γ-radiation

    International Nuclear Information System (INIS)

    Withers, H.R.

    1975-01-01

    The response of four normal tissues to low doses of γ-radiation was measured in mice using three indirect methods. The survival curves for cells of the tissues studied (colon, jejunum, testis and haemoleucopoietic system) may be exponential over an uncertain dose range (from zero to between 100 to 230 rad), the slope being about one third of that in the high-dose region. Some of the uncertainties in the data probably reflect variations in age-density distribution. (author)

  6. A radioactive waste transportation package monitoring system for normal transport and accident emergency response conditions

    International Nuclear Information System (INIS)

    Brown, G.S.; Cashwell, J.W.; Apple, M.L.

    1993-01-01

    This paper addresses spent fuel and high level waste transportation history and prospects, discusses accident histories of radioactive material transport, discusses emergency responder needs and provides a general description of the Transportation Intelligent Monitoring System (TRANSIMS) design. The key objectives of the monitoring system are twofold: (1) to facilitate effective emergency response to accidents involving a radioactive waste transportation package, while minimizing risk to the public and emergency first-response personnel, and (2) to allow remote monitoring of transportation vehicle and payload conditions to enable research into radioactive material transportation for normal and accident conditions. (J.P.N.)

  7. Nystagmus responses in a group of normal humans during earth-horizontal axis rotation

    Science.gov (United States)

    Wall, Conrad, III; Furman, Joseph M. R.

    1989-01-01

    Horizontal eye movement responses to earth-horizontal yaw axis rotation were evaluated in 50 normal human subjects who were uniformly distributed in age (20-69 years) and each age group was then divided by gender. Subjects were rotated with eyes open in the dark, using clockwise and counter-clockwise 60 deg velocity trapezoids. The nystagmus slow component velocity is analyzed. It is shown that, despite large intersubject variability, parameters which describe earth-horizontal yaw axis responses are loosely interrelated, and some of them vary significantly with gender and age.

  8. Comparison of clinical outcome and costs with CC + gonadotropins and gnrha + gonadotropins during Ivf/ICSI cycles.

    Science.gov (United States)

    Kovacs, Peter; Matyas, Szabolcs; Bernard, l Artur; Kaali, Steven G

    2004-06-01

    To compare clinical outcome and costs of CC + gonadotropins with GnRHa + gonadotropins during IVF/ICSI cycles. Clinical outcome and expenses of 382 CC + gonadotropin and 964 GnRHa + gonadotropin cycles were compared. Medication costs were calculated on the basis of the mean number of ampoules and the proportion of various gonadotropins. Costs per clinical pregnancy were calculated on the basis of expenses and clinical pregnancy rates. Women in the CC + gonadotropin group were younger, and had fewer follicles, oocytes, embryos, and embryos transferred. Clinical pregnancy rates were higher in the GnRHa group (35.9 % vs 26.2%, p costs per cycle were higher in the GnRHa group (US dollars 357 vs 248). Expenses per pregnancy however were lower in the GnRHa group (USdollars 4197 vs 5335 with IVF; USdollars 5590 vs 7244 with ICSI). When different age subgroups with similar baseline characteristics and stimulation parameters were compared, pregnancy rates were significantly higher in the GnRHa groups. Medication cost per cycle was higher in the GnRHa subgroups, and the expense per pregnancy was lower with GnRHa protocol. Cost per cycle is higher with GnRHa + gonadotropin. However, because of the better performance of the GnRHa + gonadotropin stimulation, the cumulative costs are reduced by the time a clinical pregnancy is achieved.

  9. Total renin after gonadotropin stimulation in polycystic ovarian disease.

    Science.gov (United States)

    Matinlauri, I; Anttila, L; Jaatinen, T A; Koskinen, P; Aalto, M; Irjala, K; Nikkanen, V

    1995-02-01

    To examine the influence of polycystic ovarian disease (PCOD) on the levels of total renin in plasma and follicular fluid (FF) after stimulation with hMG. Comparative study of the plasma and FF concentrations of total renin in women with and without PCOD after stimulation with hMG. In vitro fertilization-embryo transfer program at the Department of Obstetrics and Gynecology, the University Central Hospital of Turku, Finland. Thirty-six women undergoing IVF-ET for infertility with (n = 10) or without (n = 26) ultrasonographically diagnosed PCOD. Of the latter group, 15 women had tubal infertility, and the rest suffered from an anovulatory infertility and reacted with PCO-like ovarian response to stimulation. The concentrations of total renin in plasma and FF, serum E2, and protein in FF. The concentrations of plasma total renin after the gonadotropin stimulation were significantly higher in the PCOD and PCO-like groups when compared with the tubal group. The concentration of total renin in FF and the ratio of total renin per protein in FF were higher in the PCOD and PCO-like groups than in the tubal group, but the differences did not reach statistical significance. Positive correlations were found between the plasma total renin and serum E2 concentrations in the PCO-like and in the tubal group and between plasma total renin concentrations and the number of mature follicles in all groups. Follicular fluid total renin did not correlate with FF protein in any group. All findings were independent of the total hMG dosage used and the body mass index of the patients. In the present study the concentrations of total renin in plasma were enhanced markedly after gonadotropin stimulation in women with PCOD compared with women having tubal infertility. The pattern of the hormonal secretions revealed a group of infertile patients reacting biochemically like women with PCOD.

  10. The follicle-stimulating hormone (FSH) and luteinizing hormone (LH) response to a gonadotropin-releasing hormone analogue test in healthy prepubertal girls aged 10 months to 6 years

    DEFF Research Database (Denmark)

    Vestergaard, Esben T; Schjørring, Mia Elbek; Kamperis, Konstantinos

    2017-01-01

    and bone age were determined in all participants. Forty-eight healthy normal-weight girls aged 3.5 ± 0.2 years (range: 0.8-5.9 years) were included. Serum concentrations of LH and FSH were measured before and 30 min after the gonadorelin injection. RESULTS: The 30-min LH responses (mean ± 2 s.d.) were 5.......2 ± 4.0 and 2.9 ± 2.5 IU/L and the FSH responses were 23.3 ± 16.2 and 14.5 ± 10.3 IU/L in girls aged 0.8-3.0 years and 3.0-5.9 years respectively. This corresponds to upper cut-off limits for LH of 9.2 IU/L (3 years) and 5.3 IU/L (3-6 years). The stimulated LH/FSH ratio was 0.23 ± 0.19 (range 0.......06-0.43) and did not correlate with age. CONCLUSIONS: We found that LH increases up to 9.2 IU/L during GnRH test in healthy normal-weight girls below 3 years of age and that the stimulated LH/FSH ratio did not exceed 0.43. Our findings have important implications for appropriate diagnosis of central precocious...

  11. Genomic instability: potential contributions to tumour and normal tissue response, and second tumours, after radiotherapy

    International Nuclear Information System (INIS)

    Hendry, Jolyon H.

    2001-01-01

    Purpose: Induced genomic instability generally refers to a type of damage which is transmissible down cell generations, and which results in a persistently enhanced frequency of de novo mutations, chromosomal abnormalities or lethality in a significant fraction of the descendant cell population. The potential contribution of induced genomic instability to tumour and normal tissue response, and second tumours, after radiotherapy, is explored. Results: The phenomenon of spontaneous genomic instability is well known in some rare genetic diseases (e.g. Gorlin's syndrome), and there is evidence in such cases that it can lead to a greater propensity for carcinogenesis (with shortened latency) which is enhanced after irradiation. It is unclear what role induced genomic instability plays in the response of normal individuals, but persistent chromosomal instability has been detected in vivo in lymphocytes and keratinocytes from irradiated normal individuals. Such induced genomic instability might play some role in tumour response in a subset of tumours with specific defects in damage response genes, but again its contribution to radiocurability in the majority of cancer patients is unclear. In normal tissues, genomic instability induced in wild-type cells leading to delayed cell death might contribute to more severe or prolonged early reactions as a consequence of increased cell loss, a longer time required for recovery, and greater residual injury. In tumours, induced genomic instability reflected in delayed reductions in clonogenic capacity might contribute to the radiosensitivity of primary tumours, and also to a lower incidence, longer latency and slower growth rate of recurrences and metastases. Conclusions: The evidence which is reviewed shows that there is little information at present to support these propositions, but what exists is consistent with their expectations. Also, it is not yet clear to what extent mutations associated with genomic instability

  12. Physical-chemical and biological characterization of different preparations of equine chorionic gonadotropin

    OpenAIRE

    Alvarez, Rafael Herrera; Natal, Fabio Luis Nogueira; Ribela, Maria Teresa Carvalho Pinto; de Almeida, Beatriz Elane; de Oliveira, Jo?o Ezequiel; Bartolini, Paolo

    2016-01-01

    Ovarian stimulation with commercial preparations of equine chorionic gonadotropin (eCG) produces extremely variable responses in domestic animals, ranging from excessive stimulation to practically no stimulation, when applied on the basis of their declared unitage. This study was conducted to analyze four commercial preparations from different manufacturers via reversed-phase HPLC (RP-HPLC) in comparison with a reference preparation and an official International Standard from the World Health...

  13. Responsiveness of cardiodynamics to exercise loading in normal subjects and in patients with idiopathic cardiomyopathy

    International Nuclear Information System (INIS)

    Fukuoka, Yukie; Matsuda, Takeshi

    1996-01-01

    In the present study, we examined the responses of the left ventricular systolic function and diastolic function to exertion by cardiac blood pool scintigraphy using 99mTc in reference to changes with aging and changes in the cases of idiopathic cardiomyopathy. In order to study the functional response with aging to exertion, 38 normal subjects were divided by age. Subsequently, 28 hypertrophic cardiomyopathy cases (Group H), 13 dilated cardiomyopathy cases (Group D) and 14 normal cases (Group N) were studied. Ejection Fraction (EF) and Peak Ejection Rate (PER) were used as the indicators for the systolic function. Peak Filling Rate (PER), 1/3 Filling Rate (1/3FR) and Time to Peak Filling (TPF) were used as the indicators for the diastolic function. When comparison was made among the normal subjects by age, the systolic function and diastolic function at rest, varied as they were, showed no significant change with aging. The %delta EF and %delta PER tended to decrease linearly with aging (Y=-4E-X+28, p<0.0001; Y=-X+57, p<0.0001). As to the %delta PFR, %delta 1/3FR and %delta TPF, however, correlation with aging was not found. In comparing hypertrophic cardiomyopathy and dilated cardiomyopathy, Group D showed significantly lower values before exertion and after maximum exertion than the other two groups. A difference in the response of the systolic function and diastolic function to exertion was noted in both the comparative study on aging of the normal subjects and the study of cases of cardiomyopathy. The presence of the compensatory mechanism due to elevation of the left atrial pressure and an increase in the left atrial contractile power may be mentioned as a reservoir of blood and also as a booster pump. Particularly, the effect of the latter compensates for the decline in the left ventricular compliance, which may lead to the maintenance of the diastolic function. (K.H.)

  14. Radiobiological predictors of tumor and acute normal tissue response in radiotherapy for head and neck cancers

    International Nuclear Information System (INIS)

    Maciejewski, B.; Skladowski, K.; Zajusz, A.

    1991-01-01

    The importance of measurements of the potential doubling time (T pot. ) and of the survival fraction at 2.0 Gy (SF 2 ), and a method modifying acute radiation response of normal oral mucosa are discussed. Tumor clonogen repopulation accelerates around day 28 of the treatment, and the rate of repopulation is not constant but continuously increases from about 0.3 Gy/day to 1.0-1.3 Gy/day between day 28 and 65 of the treatment. This may suggest that T pot. values decrease correspondingly. The relevance of prior-to-treatment T pot. measurements to clinical situations is discussed. The SF 2 value reflects the intrinsic radiosensitivity of human tumors. The SF 2 values are expected to be valuable as predictors for tumor response to irradiation. Variations in the SF 2 values depending on tumor characteristics and assay methods are discussed in relation to the dose response and tumor cure probability. The effect of modifying the repopulation rate in the oral mucosa by stimulation with a 2% silver nitrate solution is discussed. Although these prognosticators are different in their nature, they might provide a rational basis for selecting patients into optimal irradiation treatment and might allow to modify the radiation response of dose-limiting normal tissues. (author). 5 figs., 1 tab., 28 refs

  15. Proprietary tomato extract improves metabolic response to high-fat meal in healthy normal weight subjects

    Directory of Open Access Journals (Sweden)

    Xavier Deplanque

    2016-10-01

    Full Text Available Background: Low-density lipoprotein (LDL oxidation is a risk factor for atherosclerosis. Lycopene and tomato-based products have been described as potent inhibitors of LDL oxidation. Objectives: To evaluate the effect of a 2-week supplementation with a carotenoid-rich tomato extract (CRTE standardized for a 1:1 ratio of lycopene and phytosterols, on post-prandial LDL oxidation after a high-fat meal. Design: In a randomized, double-blind, parallel-groups, placebo-controlled study, 146 healthy normal weight individuals were randomly assigned to a daily dose of CRTE standardized for tomato phytonutrients or placebo during 2 weeks. Oxidized LDL (OxLDL, glucose, insulin, and triglyceride (TG responses were measured for 8 h after ingestion of a high-fat meal before and at the end of intervention. Results: Plasma lycopene, phytofluene, and phytoene were increased throughout the study period in the CRTE group compared to placebo. CRTE ingestion significantly improved changes in OxLDL response to high-fat meal compared to placebo after 2 weeks (p<0.0001. Changes observed in glucose, insulin, and TG responses were not statistically significant after 2 weeks of supplementation, although together they may suggest a trend of favorable effect on metabolic outcomes after a high-fat meal. Conclusions: Two-week supplementation with CRTE increased carotenoids levels in plasma and improved oxidized LDL response to a high-fat meal in healthy normal weight individuals.

  16. Influence of ventilation and hypocapnia on sympathetic nerve responses to hypoxia in normal humans.

    Science.gov (United States)

    Somers, V K; Mark, A L; Zavala, D C; Abboud, F M

    1989-11-01

    The sympathetic response to hypoxia depends on the interaction between chemoreceptor stimulation (CRS) and the associated hyperventilation. We studied this interaction by measuring sympathetic nerve activity (SNA) to muscle in 13 normal subjects, while breathing room air, 14% O2, 10% O2, and 10% O2 with added CO2 to maintain isocapnia. Minute ventilation (VE) and blood pressure (BP) increased significantly more during isocapnic hypoxia (IHO) than hypocapnic hypoxia (HHO). In contrast, SNA increased more during HHO [40 +/- 10% (SE)] than during IHO (25 +/- 19%, P less than 0.05). To determine the reason for the lesser increase in SNA with IHO, 11 subjects underwent voluntary apnea during HHO and IHO. Apnea potentiated the SNA responses to IHO more than to HHO. SNA responses to IHO were 17 +/- 7% during breathing and 173 +/- 47% during apnea whereas SNA responses to HHO were 35 +/- 8% during breathing and 126 +/- 28% during apnea. During ventilation, the sympathoexcitation of IHO (compared with HHO) is suppressed, possibly for two reasons: 1) because of the inhibitory influence of activation of pulmonary afferents as a result of a greater increase in VE, and 2) because of the inhibitory influence of baroreceptor activation due to a greater rise in BP. Thus in humans, the ventilatory response to chemoreceptor stimulation predominates and restrains the sympathetic response. The SNA response to chemoreceptor stimulation represents the net effect of the excitatory influence of the chemoreflex and the inhibitory influence of pulmonary afferents and baroreceptor afferents.

  17. Estimating Non-Normal Latent Trait Distributions within Item Response Theory Using True and Estimated Item Parameters

    Science.gov (United States)

    Sass, D. A.; Schmitt, T. A.; Walker, C. M.

    2008-01-01

    Item response theory (IRT) procedures have been used extensively to study normal latent trait distributions and have been shown to perform well; however, less is known concerning the performance of IRT with non-normal latent trait distributions. This study investigated the degree of latent trait estimation error under normal and non-normal…

  18. Effect of short-term fasting on lipolytic responsiveness in normal and obese human subjects

    International Nuclear Information System (INIS)

    Wolfe, R.R.; Peters, E.J.; Klein, S.; Holland, O.B.; Rosenblatt, J.; Gary, H. Jr.

    1987-01-01

    In this study the rate of lipolysis (fatty acid and glycerol release into blood) has been quantified in both normal weight and obese volunteers after both 15 and 87 h of fasting. In each study, the basal rate and subsequent response to epinephrine infusion were determined. The rate of appearance (R/sub a/) of free fatty acids (FFA) and glycerol were quantified by infusion of [1- 13 C]palmitate and D-5-glycerol, respectively. Substrate flux rates per unit of body fat mass and lean body mass were calculated from total body water measurements using H 2 18 O dilution. In normal volunteers, the basal R/sub a/ FFA and R/sub a/ glycerol rose markedly with 87 h of fasting, whereas the increases were more modest in the obese subjects. However, the rate of mobilization of fat, in relation to the lean body mass, was higher in the obese subjects than in the normal subjects after 15 h of fasting, and the values were similar in both groups after 87 h of fasting. There was an increased lipolytic response to epinephrine after fasting in both groups. This increased sensitivity may have resulted from the enhancement of fatty acid-triglyceride substrate cycling that occurred after fasting

  19. On- and off-response ERGs elicited by sawtooth stimuli in normal subjects and glaucoma patients.

    Science.gov (United States)

    Pangeni, Gobinda; Lämmer, Robert; Tornow, Ralf P; Horn, Folkert K; Kremers, Jan

    2012-06-01

    The aim of this study is to measure the on- and off-responses and their response asymmetries elicited by sawtooth stimuli in normal subjects and glaucoma patients. Furthermore, the correlation between the ERGs and other functional and structural parameters are investigated. Full-field stimuli were produced using a Ganzfeld bowl with Light Emitting Diodes (LEDs) as light sources. On- and off-response ERGs were recorded from 17 healthy subjects, 12 pre-perimetric and 15 perimetric glaucoma patients using 4-Hz luminance rapid-on and rapid-off sawtooth stimuli (white light; mean luminance 55 cd/m(2)) at 100% contrast. The on- and off-responses were added to study response asymmetries. In addition, flash ERGs were elicited by red stimuli (200 cd/m(2)) on a blue background (10 cd/m(2)). The mean deviations (MD) of the visual field defects were obtained by standard automated perimetry. The retinal nerve fibre layer thickness (RNFLT) was measured with Spectral Domain Optical Coherence Tomography (SOCT). We studied the correlation between ERG response amplitudes, visual field mean deviation (MDs) and RNFLT values. The on-responses showed an initial negative (N-on) followed by a positive (P-on), a late positive (LP-on) and a late negative responses (LN-on). The off-responses showed an initial positive (P-off) a late positive (LP-off) and a late negative response (LN-off). The addition of on- and off-responses revealed an initial positive (P-add) and a late negative response (LN-add). The on-response components (N-on, P-on and LN-on) in the glaucoma patients were relatively similar to those of the control subjects. However, the LP-on was significantly elevated (p = 0.03) in perimetric patients. The LP-off was significantly elevated (p < 0.001), and the amplitude of LN-off was significantly reduced in perimetric patients (p = 0.02). The LN-add amplitude was significantly reduced (p < 0.001) and delayed (p = 0.03) in perimetric patients. The amplitudes of the LN-off and LN

  20. Why a disaster is not just normal business ramped up: Disaster response among ED nurses.

    Science.gov (United States)

    Hammad, Karen S; Arbon, Paul; Gebbie, Kristine; Hutton, Alison

    2017-11-15

    The emergency department (ED) is a familiar place for the emergency nurse who spends their working days inside it. A disaster threatens that familiarity and creates changes that make working in the ED during a disaster response different from the everyday experience of working in the ED. This research reports on an aspect of the findings from a larger study about the experience of working as a nurse in the ED during a disaster response. Thirteen nurses from 8 different countries were interviewed about their experience. The findings from this research demonstrate that a disaster event leads to a chain reaction of changes in process, space and practice. Nurses' respond to the news of a disaster event with shock and disbelief. The ED may change as a result of the event requiring nurses to work in an altered environment or a completely different setting. These changes provoke nurses to alter their behaviour and practice and reflect on the experience after the response. Emergency nurses have a high likelihood of participating in disaster response and as such should be adequately prepared. This highlights how disaster response is different and leads to recommendations to enhance training for emergency nurses which will better prepare them Disasterresponse is not normal business ramped up. There are a number of challenges and changes that should be considered when preparing emergency nurses for the realities of disaster response. Copyright © 2017 College of Emergency Nursing Australasia. All rights reserved.

  1. Over-the-road tests of nuclear materials package response to normal environments

    International Nuclear Information System (INIS)

    Gwinn, K.W.; Glass, R.E.; Edwards, K.R.

    1991-12-01

    In support of the development of American National Standards Institute standards for the transport of radioactive materials, Sandia has a program to characterize the normal transport environment. This program includes both analytical modeling of package and trailer responses, and over-the-road tests to measure those responses. This paper presents the results of a series of over-the-road tests performed using Chem-Nuclear equipment in the Barnwell, SC, area. The test events included a variety of road types such as rough concrete, shock events such as railroad grade crossings, and driver responses such as sharp turns. The response of the package and trailer to these events was measured with accelerometers at various locations to determine the inertial loads. Either load cells or strain gages were used to measure tiedown response. These accelerations and loads were measured on systems with flexible and ''rigid'' tiedowns. The results indicated that while significant accelerations occur on the trailer bed, these do not translate into equivalent loads in either the package or the tiedown system. This indicates that trailer-bed response should not be used in determining the load factor for fatigue calculations of the package components or in determining design loads for tiedowns

  2. Neuroendocrine regulation of gonadotropin secretion in seasonally breeding birds

    Directory of Open Access Journals (Sweden)

    Takayoshi eUbuka

    2013-03-01

    Full Text Available Seasonally breeding birds detect environmental signals, such as light, temperature, food availability and presence of mates to time reproduction. Hypothalamic neurons integrate external and internal signals, and regulate reproduction by releasing neurohormones to the pituitary gland. The pituitary gland synthesizes and releases gonadotropins which in turn act on the gonads to stimulate gametogenesis and sex steroid secretion. Accordingly, how gonadotropin secretion is controlled by the hypothalamus is key to our understanding of the mechanisms of seasonal reproduction. A hypothalamic neuropeptide, gonadotropin-releasing hormone (GnRH, activates reproduction by stimulating gonadotropin synthesis and release. Another hypothalamic neuropeptide, gonadotropin-inhibitory hormone (GnIH, inhibits gonadotropin synthesis and release directly by acting on the pituitary gland or indirectly by decreasing the activity of GnRH neurons. Therefore, the next step to understand seasonal reproduction is to investigate how the activities of GnRH and GnIH neurons in the hypothalamus and their receptors in the pituitary gland are regulated by external and internal signals. It is possible that locally-produced triiodothyronine resulting from the action of type 2 iodothyronine deiodinase on thyroxine stimulates the release of gonadotropins, perhaps by action on GnRH neurons. The function of GnRH neurons is also regulated by transcription of the GnRH gene. Melatonin, a nocturnal hormone, stimulates the synthesis and release of GnIH and GnIH may therefore regulate a daily rhythm of gonadotropin secretion. GnIH may also temporally suppress gonadotropin secretion when environmental conditions are unfavorable. Environmental and social milieus fluctuate seasonally in the wild. Accordingly, complex interactions of various neuronal and hormonal systems need to be considered if we are to understand the mechanisms underlying seasonal reproduction.

  3. Active immunization against gonadotropin-releasing hormone : an effective tool to block the fertility axis in mammals

    NARCIS (Netherlands)

    Turkstra, Jouwert Anne

    2005-01-01

    Gonadotropin releasing hormone (GnRH) plays a pivotal role in fertility and reproduction in mammals. It induces the release of luteinising hormone (LH) en follicle stimulating hormone (FSH) from the pituitary. These hormones are responsible for gonadal steroid production and indirectly for

  4. Sex-related differences in the normal cardiac response to upright exercise

    International Nuclear Information System (INIS)

    Higginbotham, M.B.; Morris, K.G.; Coleman, R.E.; Cobb, F.R.

    1984-01-01

    In previous studies from this laboratory, it was found that approximately 30% of women with chest pain and normal coronary arteries demonstrated either a decrease in or a failure to increase radionuclide ejection fraction during exercise. To examine the hypothesis that this apparent abnormality in left ventricular function represents a physiologic difference between men and women, a prospective study was made of central and peripheral cardiovascular responses to exercise in 31 age-matched healthy volunteers (16 women and 15 men). A combination of quantitative radionuclide (technetium) angiography and expired-gas analysis was used to measure ejection fraction and relative changes in end-diastolic counts, stroke counts, count output, and arteriovenous oxygen difference during symptom-limited upright bicycle exercise. Normal male and female volunteers demonstrated comparable baseline left ventricular function and similar aerobic capacity, as determined by weight-adjusted peak oxygen consumption. However, their cardiac responses to exercise were significantly different. The ejection fraction increased by 5 points or more in 14 of 15 men, but in only seven of the 16 women. End-diastolic counts increased by 30% in women, but was unchanged in men. Because decreases in ejection fraction were matched by increases in end-diastolic counts, relative increases in stroke counts and count output were the same for men and women. These data demonstrate a basic difference between men and women with respect to the mechanism by which they achieve a normal response of stroke volume to exercise; these differences must be taken into account when measurements of cardiac function during exercise stress are used for diagnostic purposes

  5. Normalize the response of EPID in pursuit of linear accelerator dosimetry standardization.

    Science.gov (United States)

    Cai, Bin; Goddu, S Murty; Yaddanapudi, Sridhar; Caruthers, Douglas; Wen, Jie; Noel, Camille; Mutic, Sasa; Sun, Baozhou

    2018-01-01

    Normalize the response of electronic portal imaging device (EPID) is the first step toward an EPID-based standardization of Linear Accelerator (linac) dosimetry quality assurance. In this study, we described an approach to generate two-dimensional (2D) pixel sensitivity maps (PSM) for EPIDs response normalization utilizing an alternative beam and dark-field (ABDF) image acquisition technique and large overlapping field irradiations. The automated image acquisition was performed by XML-controlled machine operation and the PSM was generated based on a recursive calculation algorithm for Varian linacs equipped with aS1000 and aS1200 imager panels. Cross-comparisons of normalized beam profiles and 1.5%/1.5 mm 1D Gamma analysis was adopted to quantify the improvement of beam profile matching before and after PSM corrections. PSMs were derived for both photon (6, 10, 15 MV) and electron (6, 20 MeV) beams via proposed method. The PSM-corrected images reproduced a horn-shaped profile for photon beams and a relative uniform profiles for electrons. For dosimetrically matched linacs equipped with aS1000 panels, PSM-corrected images showed increased 1D-Gamma passing rates for all energies, with an average 10.5% improvement for crossline and 37% for inline beam profiles. Similar improvements in the phantom study were observed with a maximum improvement of 32% for 15 MV and 22% for 20 MeV. The PSM value showed no significant change for all energies over a 3-month period. In conclusion, the proposed approach correct EPID response for both aS1000 and aS1200 panels. This strategy enables the possibility to standardize linac dosimetry QA and to benchmark linac performance utilizing EPID as the common detector. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

  6. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, W.A.; Wike, J.; Tucker, S.L.

    1995-01-01

    To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

  7. A dynamic elastic-visco-plastic unilateral contact problem with normal damped response and Coulomb friction

    Czech Academy of Sciences Publication Activity Database

    Eck, Ch.; Jarušek, Jiří; Sofonea, M.

    2010-01-01

    Roč. 21, č. 3 (2010), s. 229-251 ISSN 0956-7925 R&D Projects: GA AV ČR IAA100750802 Institutional research plan: CEZ:AV0Z10190503 Keywords : elastic-vosco plastic material * dynamic contact problem * normal damped response * unilateral constraint * Coulomb friction * weak solution * penalitazion * smoothing Subject RIV: BA - General Mathematics Impact factor: 1.480, year: 2010 http://journals.cambridge.org/action/displayAbstract?fromPage=online&aid=7675484&fileId=S0956792510000045

  8. Central leptin action on euglycemia restoration in type 1 diabetes: Restraining responses normally induced by fasting?

    Science.gov (United States)

    Xu, Yuanzhong; Tong, Qingchun

    2017-07-01

    Leptin monotherapy is sufficient to restore euglycemia in insulinopenic type 1 diabetes (T1D), yet the underlying mechanism remains poorly understood. Accumulating evidence demonstrates that the brain mediates the leptin action on euglycemia restoration. Here, we first review evidence supporting that symptoms in T1D resemble an uncontrolled response to fasting. Then, we discuss recent research progress on brain neurons and their neurotransmitters that potentially mediate the leptin action. Finally, peripheral effective pathways, which are normally involved in fasting responses and associated with leptin action on euglycemia restoration in T1D, will also be discussed. This summary complements several previous excellent reviews on this topic (Meek and Morton, 2016; Perry et al., 2016; Fujikawa and Coppari, 2015). A deep understanding of neurocircuitry and the peripheral effective pathways that mediate the leptin action on euglycemia restoration will likely lead to novel targets for an insulin-independent therapeutics against T1D. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. The medical reshaping of disabled bodies as a response to stigma and a route to normality.

    Science.gov (United States)

    McLaughlin, Janice

    2017-12-01

    Disabled people are said to experience stigma because their embodied presence in the world does not fit with how others interact and use their bodies to be social participants. In response they can turn to medical procedures, such as surgery or physiotherapy, in order to reshape their bodies to more closely approximate norms of social interaction and embodiment. This paper explores how medicine plays a role in attempts to be recognised by others as normal and acceptable by minimising disability. It will do so via a focus on disabled young people, in order to explore how their emerging identities and aspirations for the future influence how they think about their bodies, what normality means and their participation in multiple activities that work on their bodies. The paper draws from an Economic and Social Research Council (ESRC) project that used a range of qualitative research methods with a group of disabled young people. The project explored ways in which participants actively worked on their bodies to be more normal and examined the disciplinary and agency dynamics involved in this work. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  10. Biological responses of progestogen metabolites in normal and cancerous human breast.

    Science.gov (United States)

    Pasqualini, Jorge R; Chetrite, Gérard S

    2010-12-01

    At present, more than 200 progestogen molecules are available, but their biological response is a function of various factors: affinity to progesterone or other receptors, their structure, the target tissues considered, biological response, experimental conditions, dose, method of administration and metabolic transformations. Metabolic transformation is of huge importance because in various biological processes the metabolic product(s) not only control the activity of the maternal hormone but also have an important activity of its own. In this regard, it was observed that the 20-dihydro derivative of the progestogen dydrogesterone (Duphaston®) is significantly more active than the parent compound in inhibiting sulfatase and 17β-hydroxysteroid dehydrogenase in human breast cancer cells. Estrone sulfatase activity is also inhibited by norelgestromin, a norgestimate metabolite. Interesting information was obtained with a similar progestogen, tibolone, which is rapidly metabolized into the active 3α/3β-hydroxy and 4-ene metabolites. All these metabolites can inhibit sulfatase and 17β-hydroxysteroid dehydrogenase and stimulate sulfotransferase in human breast cancer cells. Another attractive aspect is the metabolic transformation of progesterone itself in human breast tissues. In the normal breast progesterone is mainly converted to 4-ene derivatives, whereas in the tumor tissue it is converted mostly to 5α-pregnane derivatives. 20α-Dihydroprogesterone is found mainly in normal breast tissue and possesses antiproliferative properties as well as the ability to act as an anti-aromatase agent. Consequently, this progesterone metabolite could be involved in the control of estradiol production in the normal breast and therefore implicated in one of the multifactorial mechanisms of the breast carcinogenesis process. In conclusion, a better understanding of both natural and synthetic hormone metabolic transformations and their control could potentially provide

  11. Gonadotropins studies in female egyptian subjects under different physiological conditions

    International Nuclear Information System (INIS)

    El-Nabarawy, F.S.; Megahed, Y.M.; Ibrahim, M.

    2002-01-01

    This study is concerned with the role of the hypothalamic hypophyseal regulatory hormonal mechanisms in the control of gonadal secretions in a selected normal egyptian female subjects with varying ages under different physiological conditions. The study allowed precise definition of the modulator influence of a number of key factors triggering appropriate alteration in circulating serum levels of FSH and LH determined by IRMA technique in pre-pubertal female children (9-11), post-pubertal adolescents females (13-16). Adult married females (27-33) and post-menopausal (58-63). The levels of FSH and LH were increased markedly with age but children less than 11 years old had only nocturnal increase in levels of FSH (p.O.I) and LH(P< 0.001). post-pubertal aged girls had significant nocturnal elevation only of LH levels (P< 0.001), adult married females did not exhibit significant difference in gonadotropin concentrations. whereas significant elevation in FSH and LH levels (P<0.001) in post-menopausal females were observed

  12. Postprandial glucose response to selected tropical fruits in normal glucose-tolerant Nigerians.

    Science.gov (United States)

    Edo, A; Eregie, A; Adediran, O; Ohwovoriole, A; Ebengho, S

    2011-01-01

    The glycemic response to commonly eaten fruits in Nigeria has not been reported. Therefore, this study assessed the plasma glucose response to selected fruits in Nigeria. Ten normal glucose-tolerant subjects randomly consumed 50 g carbohydrate portions of three fruits: banana (Musa paradisiaca), pineapple (Ananus comosus), and pawpaw (Carica papaya), and a 50-g glucose load at 1-week intervals. Blood samples were collected in the fasting state and half-hourly over a 2-h period post-ingestion of the fruits or glucose. The samples were analyzed for plasma glucose concentrations. Plasma glucose responses were assessed by the peak plasma glucose concentration, maximum increase in plasma glucose, 2-h postprandial plasma glucose level, and incremental area under the glucose curve and glycemic index (GI). The results showed that the blood glucose response to these three fruits was similar in terms of their incremental areas under the glucose curve, maximum increase in plasma glucose, and glycemic indices (GIs). The 2-h postprandial plasma glucose level of banana was significantly higher than that of pineapple, P < 0.025. The mean ± SEM GI values were as follows: pawpaw; 86 ± 26.8%; banana, 75.1 ± 21.8%; pineapple, 64.5 ± 11.3%. The GI of glucose is taken as 100. The GI of pineapple was significantly lower than that of glucose (P < 0.05). Banana, pawpaw, and pineapple produced a similar postprandial glucose response. Measured portions of these fruits may be used as fruit exchanges with pineapple having the most favorable glycemic response.

  13. DESCRIPTION OF BRAINSTEM AUDITORY EVOKED RESPONSES (AIR AND BONE CONDUCTION IN CHILDREN WITH NORMAL HEARING

    Directory of Open Access Journals (Sweden)

    A. V. Pashkov

    2014-01-01

    Full Text Available Diagnosis of hearing level in small children with conductive hearing loss associated with congenital craniofacial abnormalities, particularly with agenesis of external ear and external auditory meatus is a pressing issue. Conventional methods of assessing hearing in the first years of life, i. e. registration of brainstem auditory evoked responses to acoustic stimuli in the event of air conduction, does not give an indication of the auditory analyzer’s condition due to potential conductive hearing loss in these patients. This study was aimed at assessing potential of diagnosing the auditory analyzer’s function with registering brainstem auditory evoked responses (BAERs to acoustic stimuli transmitted by means of a bone vibrator. The study involved 17 children aged 3–10 years with normal hearing. We compared parameters of registering brainstem auditory evoked responses (peak V depending on the type of stimulus transmission (air/bone in children with normal hearing. The data on thresholds of the BAERs registered to acoustic stimuli in the event of air and bone conduction obtained in this study are comparable; hearing thresholds in the event of acoustic stimulation by means of a bone vibrator correlates with the results of the BAERs registered to the stimuli transmitted by means of air conduction earphones (r = 0.9. High correlation of thresholds of BAERs to the stimuli transmitted by means of a bone vibrator with thresholds of BAERs registered when air conduction earphones were used helps to assess auditory analyzer’s condition in patients with any form of conductive hearing loss.  

  14. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  15. Abnormal Auditory Brainstem Response (ABR Findings in a Near-Normal Hearing Child with Noonan Syndrome

    Directory of Open Access Journals (Sweden)

    Bahram Jalaei

    2017-01-01

    Full Text Available Introduction: Noonan syndrome (NS is a heterogeneous genetic disease that affects many parts of the body. It was named after Dr. Jacqueline Anne Noonan, a paediatric cardiologist.Case Report: We report audiological tests and auditory brainstem response (ABR findings in a 5-year old Malay boy with NS. Despite showing the marked signs of NS, the child could only produce a few meaningful words. Audiological tests found him to have bilateral mild conductive hearing loss at low frequencies. In ABR testing, despite having good waveform morphology, the results were atypical. Absolute latency of wave V was normal but interpeak latencies of wave’s I-V, I-II, II-III were prolonged. Interestingly, interpeak latency of waves III-V was abnormally shorter.Conclusion:Abnormal ABR results are possibly due to abnormal anatomical condition of brainstem and might contribute to speech delay.

  16. CT in normal pressure hydrocephalus. Correlation between CT and clinical response to shunting

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, K.; Nogaki, H.; Noda, M.; Kusunoki, T.; Tamaki, N. (Kobe Univ. (Japan). School of Medicine)

    1981-02-01

    CT scans were obtained on 33 patients (age 73y. to 31y.) with the diagnosis of normal pressure hydrocephalus. In each case, the diagnosis was made on the basis of the symptoms, CT and cisternographic findings. Underlying diseases of normal pressure hydrocephalus are ruptured aneurysms (21 cases), arteriovenous malformations (2 cases), head trauma (1 case), cerebrovascular accidents (1 case) and idiopathie (8 cases). Sixteen of 33 patients showed marked improvement, five, moderate or minimal improvement, and twelve, no change. The results were compared with CT findings and clinical response to shunting. CT findings were classified into five types, bases on the degree of periventricular hypodensity (P.V.H.), the extent of brain damage by underlying diseases, and the degree of cortical atrophy. In 17 cases of type (I), CT shows the presence of P.V.H. with or without minimal frontal lobe damage and no cortical atrophy. The good surgical improvements were achieved in all cases of type (I) by shunting. In 4 cases of type (II), CT shows the presence of P.V.H. and severe brain damage without cortical atrophy. The fair clinical improvements were achieved in 2 cases (50%) by shunting. In one case of type (III), CT shows the absence of P.V.H. without brain damage nor cortical atrophy. No clinical improvement was obtained by shunting in this type. In 9 cases of type (IV) with mild cortical atrophy, the fair clinical improvement was achieved in two cases (22%) and no improvement in 7 cases. In 2 cases of type (V) with moderate or marked cortical atrophy, no clinical improvement was obtained by shunting. In conclusion, it appeared from the present study that there was a good correlation between the result of shunting and the type of CT, and clinical response to shunting operation might be predicted by classification of CT findings.

  17. Electroretinogram responses of the normal thoroughbred horse sedated with detomidine hydrochloride.

    Science.gov (United States)

    Church, Melanie L; Norman, Joanna C

    2012-09-01

    The main objective was to record electroretinogram (ERG) parameters of normal thoroughbred mares using the HMsERG, a mini-Ganzfeld electroretinographic unit, and a contact lens electrode. The second objective was to determine whether IV detomidine hydrochloride at 0.015 mg/kg is consistently an effective choice for sedation of horses undergoing this ERG protocol. The study population consisted of 30 normal thoroughbred mares. ERG data were harvested using a protocol that included three different light intensities (10, 3000, and 10,000 mcd s/m(2)) and a 30-Hz flicker at 3000 mcd s/m(2). Mean, median, standard deviation, and estimated normal ranges using the 5-95% of the data for a- and b-wave implicit times (IT), amplitudes (AMP), and b/a ratios were reported. Scotopic results at low intensity (10 mcd s/m(2)) had estimated ranges for b-wave IT of 41.8-72.9 ms and AMP of 19.8-173.3 μV. Middle intensity (3000 mcd s/m(2)) a-wave IT was 13.2-14.7 ms with a-wave AMP of 68.4-144 μV; the b-wave IT was 28.7-41.5 ms with b-wave AMP of 105.7-271.5 μV; and the b/a ratio was 0.95-2.71. The high-intensity (10,000 mcd s/m(2)) average recordings showed an a-wave IT of 13-14.9 ms, a-wave AMP of 85.7-186.8 μV; b-wave IT of 26.6-45.4 ms, b-wave AMP of 104.7-250.6 μV; and a b/a wave ratio of 0.7-2.0. The 30-Hz cone flicker showed an IT of 22.8-28.9 ms and AMP of 44.1-117.1 μV. Results of normal thoroughbred ERG responses are reported. The protocol proved to be simple and safe and provided consistent results. © 2012 American College of Veterinary Ophthalmologists.

  18. Ultradian rhythmicity of plasma cortisol is necessary for normal emotional and cognitive responses in man.

    Science.gov (United States)

    Kalafatakis, K; Russell, G M; Harmer, C J; Munafo, M R; Marchant, N; Wilson, A; Brooks, J C; Durant, C; Thakrar, J; Murphy, P; Thai, N J; Lightman, S L

    2018-04-24

    Glucocorticoids (GCs) are secreted in an ultradian, pulsatile pattern that emerges from delays in the feedforward-feedback interaction between the anterior pituitary and adrenal glands. Dynamic oscillations of GCs are critical for normal cognitive and metabolic function in the rat and have been shown to modulate the pattern of GC-sensitive gene expression, modify synaptic activity, and maintain stress responsiveness. In man, current cortisol replacement therapy does not reproduce physiological hormone pulses and is associated with psychopathological symptoms, especially apathy and attenuated motivation in engaging with daily activities. In this work, we tested the hypothesis that the pattern of GC dynamics in the brain is of crucial importance for regulating cognitive and behavioral processes. We provide evidence that exactly the same dose of cortisol administered in different patterns alters the neural processing underlying the response to emotional stimulation, the accuracy in recognition and attentional bias toward/away from emotional faces, the quality of sleep, and the working memory performance of healthy male volunteers. These data indicate that the pattern of the GC rhythm differentially impacts human cognition and behavior under physiological, nonstressful conditions and has major implications for the improvement of cortisol replacement therapy.

  19. DNA damage and the bystander response in tumor and normal cells exposed to X-rays.

    Science.gov (United States)

    Subhashree, M; Venkateswarlu, R; Karthik, K; Shangamithra, V; Venkatachalam, P

    2017-09-01

    Monolayer and suspension cultures of tumor (BMG-1, CCRF-CEM), normal (AG1522, HADF, lymphocytes) and ATM-mutant (GM4405) human cells were exposed to X-rays at doses used in radiotherapy (high dose and high dose-rate) or radiological imaging (low dose and low dose-rate). Radiation-induced DNA damage, its persistence, and possible bystander effects were evaluated, based on DNA damage markers (γ-H2AX, p53 ser15 ) and cell-cycle-specific cyclins (cyclin B1 and cyclin D1). Dose-dependent DNA damage and a dose-independent bystander response were seen after exposure to high dose and high dose-rate radiation. The level of induced damage (expression of p53 ser15 , γ-H2AX) depended on ATM status. However, low dose and dose-rate exposures neither increased expression of marker proteins nor induced a bystander response, except in the CCRF-CEM cells. Bystander effects after high-dose irradiation may contribute to stochastic and deterministic effects. Precautions to protect unexposed regions or to inhibit transmission of DNA damage signaling might reduce radiation risks. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Proteinase-activated receptors - mediators of early and delayed normal tissue radiation responses

    International Nuclear Information System (INIS)

    Hauer-Jensen, M.

    2003-01-01

    Proteinase-activated receptors (PARs) are G-protein coupled receptors that are activated by proteolytic exposure of a receptor-tethered ligand. The discovery of this receptor family represents one of the most intriguing recent developments in signal transduction. PARs are involved in the regulation of many normal and pathophysiological processes, notably inflammatory and fibroproliferative responses to injury. Preclinical studies performed in our laboratory suggest that proteinase-activated receptor-1 (PAR-1) plays a critical role in the mechanism of chronicity of radiation fibrosis, while proteinase-activated receptor-2 (PAR-2) may mediate important fibroproliferative responses in irradiated intestine. Specifically, activation of PAR-1 by thrombin, and PAR-2 by pancreatic trypsin and mast cell proteinases, appears to be involved in acute radiation-induced inflammation, as well as in subsequent extracellular matrix deposition, leading to the development of intestinal wall fibrosis and clinical complications. Pharmacological modulators of PAR-1 or PAR-2 expression or activation would be potentially useful as preventive or therapeutic agents in patients who receive radiation therapy, especially if blockade could be targeted to specific tissues or cellular compartments

  1. Chorionic gonadotropin and uterine dialogue in the primate

    Directory of Open Access Journals (Sweden)

    Strakova Zuzana

    2004-07-01

    Full Text Available Abstract Implantation is a complex spatio-temporal interaction between the growing embryo and the mother, where both players need to be highly synchronized to be able to establish an effective communication to ensure a successful pregnancy. Using our in vivo baboon model we have shown that Chorionic Gonadotropin (CG, as the major trophoblast derived signal, not only rescues the corpus luteum but also modulates the uterine environment in preparation for implantation. This response is characterized by an alteration in both the morphological and biochemical activity in the three major cell types: luminal and glandular epithelium and stromal fibroblasts. Furthermore, CG and factors from the ovary have a synergistic effect on the receptive endometrium. Novel local effects of CG which influence the immune system to permit the survival of the fetal allograft and prevent endometrial cell death are also discussed in this review. An alternate extracellular signal-regulated kinase (ERK activation pathway observed in epithelial endometrial cells and the possibility of differential expression of the CG/LH-R isoforms during gestation, open many questions regarding the mechanism of action of CG and its signal transduction pathway within the primate endometrium.

  2. Function of gonadotropin-releasing hormone in olfaction.

    Science.gov (United States)

    Wirsig-Wiechmann, C R

    2001-06-01

    Gonadotropin-releasing hormone (GnRH) is present within neurons of the nervus terminalis, the zeroeth cranial nerve. In all vertebrate species, except in sharks where it is a separate nerve, the nervus terminalis consists of a chain of neurons embedded within olfactory or vomeronasal nerves in the nasal cavity. The function of the GnRH component of the nervus terminalis is thought to be neuromodulatory. Our research on GnRH effects on olfaction confirms this hypothesis. The processes of GnRH neural cell bodies located within chemosensory nerves project centrally into the ventral forebrain and peripherally into the lamina propria of the nasal chemosensory mucosa. GnRH receptors are expressed by chemosensory neurons as shown by RT-PCR/Southern blotting and GnRH agonist binding studies. Patch-clamp studies have shown that GnRH alters the responses of isolated chemosensory neurons to natural or electrophysiological stimulation through the modulation of voltage-gated and receptor-gated channels. Behavioral experiments demonstrate that interfering with the nasal GnRH system leads to deficits in mating behavior. These studies suggest that the function of the intranasal GnRH system is to modify olfactory information, perhaps at reproductively auspicious times. We speculate that the purpose of this altered olfactory sense is to make pheromones more detectable and salient.

  3. Gonadotropin releasing hormone agonists: Expanding vistas

    Directory of Open Access Journals (Sweden)

    Navneet Magon

    2011-01-01

    Full Text Available Gonadotropin-releasing hormone (GnRH agonists are derived from native GnRH by amino acid substitution which yields the agonist resistant to degradation and increases its half-life. The hypogonadotropic hypogonadal state produced by GnRH agonists has been often dubbed as "pseudomenopause" or "medical oophorectomy," which are both misnomers. GnRH analogues (GnRH-a work by temporarily "switching off" the ovaries. Ovaries can be "switched off" for the therapy and therapeutic trial of many conditions which include but are not limited to subfertility, endometriosis, adenomyosis, uterine leiomyomas, precocious puberty, premenstrual dysphoric disorder, chronic pelvic pain, or the prevention of menstrual bleeding in special clinical situations. Rapidly expanding vistas of usage of GnRH agonists encompass use in sex reassignment of male to female transsexuals, management of final height in cases of congenital adrenal hyperplasia, and preserving ovarian function in women undergoing cytotoxic chemotherapy. Hypogonadic side effects caused by the use of GnRH agonists can be tackled with use of "add-back" therapy. Goserelin, leuprolide, and nafarelin are commonly used in clinical practice. GnRH-a have provided us a powerful therapeutic approach to the treatment of numerous conditions in reproductive medicine. Recent synthesis of GnRH antagonists with a better tolerability profile may open new avenues for both research and clinical applications. All stakeholders who are partners in women′s healthcare need to join hands to spread awareness so that these drugs can be used to realize their full potential.

  4. 25-Hydroxycholecalciferol response to single oral cholecalciferol loading in the normal weight, overweight, and obese.

    Science.gov (United States)

    Camozzi, V; Frigo, A C; Zaninotto, M; Sanguin, F; Plebani, M; Boscaro, M; Schiavon, L; Luisetto, G

    2016-08-01

    After a single cholecalciferol load, peak serum 25-hydroxycholecalciferol (25OHD) is lower in individuals with a higher body mass index (BMI), probably due to it being distributed in a greater volume. Its subsequent disappearance from the serum is slower the higher the individual's BMI, probably due to the combination of a larger body volume and a slower release into the circulation of vitamin D stored in adipose tissue. The aim of the study is to examine 25-hydroxycholecalciferol (25OHD) response to a single oral load of cholecalciferol in the normal weight, overweight, and obese. We considered 55 healthy women aged from 25 to 67 years (mean ± SD, 50.8 ± 9.5) with a BMI ranging from 18.7 to 42 kg/m(2) (mean ± SD, 27.1 ± 6.0). The sample was divided into three groups by BMI: 20 were normal weight (BMI ≤ 25 kg/m(2)), 21 overweight (25.1 ≤ BMI ≤ 29.9 kg/ m(2)), and 14 obese (BMI ≥ 30 kg/m(2)). Each subject was given 300,000 IU of cholecalciferol orally during lunch. A fasting blood test was obtained before cholecalciferol loading and then 7, 30, and 90 days afterwards to measure serum 25OHD, 1,25 dihydroxyvitamin D [1,25 (OH)2D], parathyroid hormone (PTH), calcium (Ca), and phosphorus (P). Participants' absolute fat mass was measured using dual energy X-ray absorptiometry (DEXA). The fat mass of the normal weight subjects was significantly lower than that of the overweight, which in turn was lower than that of the obese participants. Serum 25OHD levels increased significantly in all groups, peaking 1 week after the cholecalciferol load. Peak serum 25OHD levels were lower the higher the individuals' BMI. After peaking, the 25OHD levels gradually decreased, following a significantly different trend in the three groups. The slope was similar for the overweight and obese, declining significantly more slowly than in the normal weight group. In the sample as a whole, there was a weakly significant negative correlation

  5. Normal postural responses preceding shoulder flexion: co-activation or asymmetric activation of transverse abdominis?

    Science.gov (United States)

    Davarian, Sanaz; Maroufi, Nader; Ebrahimi, Esmaeil; Parnianpour, Mohammad; Farahmand, Farzam

    2014-01-01

    It is suggested that activation of the transverse abdominis muscle has a stabilizing effect on the lumbar spine by raising intra-abdominal pressure without added disc compression. However, its feedforward activity has remained a controversial issue. In addition, research regarding bilateral activation of trunk muscles during a unilateral arm movement is limited. The aim of this study was to evaluate bilateral anticipatory activity of trunk muscles during unilateral arm flexion. Eighteen healthy subjects (aged 25 ± 3.96 years) participated in this study and performed 10 trials of rapid arm flexion in response to a visual stimulus. The electromyographic activity of the right anterior deltoid (AD) and bilateral trunk muscles including the transverse abdominis/internal oblique (TA/IO), superficial lumbar multifidus (SLM) and lumbar erector spine (LES) was recorded. The onset latency and anticipatory activity of the recorded trunk muscles were calculated. The first muscle activated in anticipation of the right arm flexion was the left TA/IO. The right TA/IO activated significantly later than all other trunk muscles (P 0.05). Healthy subjects showed no bilateral anticipatory co-activation of TA/IO in unilateral arm elevation. Further investigations are required to delineate normal muscle activation pattern in healthy subjects prior to prescribing bilateral activation training of transverse abdominis for subjects with chronic low back pain.

  6. Microvascular resistance in response to iodinated contrast media in normal and functionally impaired kidneys.

    Science.gov (United States)

    Kurihara, Osamu; Takano, Masamichi; Uchiyama, Saori; Fukuizumi, Isamu; Shimura, Tetsuro; Matsushita, Masato; Komiyama, Hidenori; Inami, Toru; Murakami, Daisuke; Munakata, Ryo; Ohba, Takayoshi; Hata, Noritake; Seino, Yoshihiko; Shimizu, Wataru

    2015-12-01

    Contrast-induced nephropathy (CIN) is considered to result from intrarenal vasoconstriction, and occurs more frequently in impaired than in normal kidneys. It was hypothesized that iodinated contrast media would markedly change renal blood flow and vascular resistance in functionally impaired kidneys. Thirty-six patients were enrolled (32 men; mean age, 75.3 ± 7.6 years) undergoing diagnostic coronary angiography and were divided into two groups based on the presence of chronic kidney disease (CKD), defined as an estimated glomerular filtration rate (eGFR) of contrast media. The APV and the RI were positively and inversely correlated with the eGFR at baseline, respectively (APV, R = 0.545, P = 0.001; RI, R = -0.627, P contrast media administration in the non-CKD group, but not in the CKD group (APV, P = 0.258; RI, P = 0.707). Although renal arterial resistance was higher in patients with CKD, it was not affected by contrast media administration, suggesting that patients with CKD could have an attenuated response to contrast media. © 2015 The Authors. Clinical and Experimental Pharmacology and Physiology Published by Wiley Publishing Asia Pty Ltd.

  7. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  8. A MALE CASE OF KALLMANN'S SYNDROME : FERTILITY INDUCED BY GONADOTROPIN (hCG/hMG) THERAPY

    OpenAIRE

    Okamoto, Shingo; Mayumi Mimura, Mayumi; Moch, Tadao; Sakamoto, Takemi; Izumi, Yukiko; Matzui, Yuhji; Hosokawa, Akiko; Kuriyama, Shigeki; Fukui, Hiroshi

    1998-01-01

    A 24-year-old male patient with Kallmann's syndrome who fathered two children after gonadotropin therapy is reported here. He was diagnosed with Kallmann's syndrome because of hypothalamic hypogonadism associated with anosmia. The gonadotropin therapy was initiated which involved treatment with human chorionic gonadotropin (hCG) and human menopausal gonadotropin (hMG). After 3 years of treatment, his secondary sexual characteristics developed to near the adult level and sperm were detected in...

  9. Neural responses to silent lipreading in normal hearing male and female subjects

    NARCIS (Netherlands)

    Ruytjens, Liesbet; Albers, Frans; van Dijk, Pim; Wit, Hero; Willemsen, Antoon

    In the past, researchers investigated silent lipreading in normal hearing subjects with functional neuroimaging tools and showed how the brain processes visual stimuli that are normally accompanied by an auditory counterpart. Previously, we showed activation differences between males and females in

  10. Fanconi Anemia a Is a Nucleocytoplasmic Shuttling Molecule Required for Gonadotropin-Releasing Hormone (GnRH) Transduction of the GnRH Receptor

    OpenAIRE

    Larder, Rachel; Karali, Dimitra; Nelson, Nancy; Brown, Pamela

    2006-01-01

    GnRH binds its cognate G protein-coupled GnRH receptor (GnRHR) located on pituitary gonadotropes and drives expression of gonadotropin hormones. There are two gonadotropin hormones, comprised of a common α- and hormone-specific β-subunit, which are required for gonadal function. Recently we identified that Fanconi anemia a (Fanca), a DNA damage repair gene, is differentially expressed within the LβT2 gonadotrope cell line in response to stimulation with GnRH. FANCA is mutated in more than 60%...

  11. Normal mitogen-induced suppression of the interleukin-6 (IL-6) response and its deficiency in systemic lupus erythematosus

    International Nuclear Information System (INIS)

    Warrington, R.J.; Rutherford, W.J.

    1990-01-01

    A low-frequency suppressor-cell population in normal peripheral blood inhibits the B-cell CESS response to IL-6, following pokeweed mitogen stimulation. The suppression of IL-6 responsiveness is radiation sensitive, directed against CESS targets and not mediated by inhibition of IL-6 production, and associated with nonspecific cytotoxic activity against CESS targets. The generation of these cytolytic cells is also radiation sensitive. A correlation was found between PWM-induced cytotoxicity against CESS and the suppression of IL-6-dependent IgG production. But cytotoxicity toward CESS targets is not responsible for this suppression because IL-2 induces equivalent or greater nonspecific cytotoxicity against CESS in the total absence of suppression of CESS-derived IgG production and suppression is also induced by mitogen-activated PBL separated from CESS targets by a cell-impermeable membrane. This suppression was not mediated by TNF alpha/beta or IFN-gamma. In systemic lupus erythematosus, suppression of IL-6-dependent IgG production is impaired in patients with active disease (29.2 +/- 13.7%) compared to patients with inactive disease (70 +/- 19.5%) or normal controls (82.8 +/- 9.2%). There is also a defect in mitogen-induced nonspecific cytotoxicity in active SLE (specific lysis 15.1 +/- 3.5%, compared to 34 +/- 4% in normals). Pokeweed mitogen-activated PBL can therefore normally induce suppression of B-cell IL-6 responses and this response is deficient in lupus

  12. Influence of Human Chorionic Gonadotropin on the Fertility Rate in ...

    African Journals Online (AJOL)

    An experiment was carried out on the influence of human chorionic gonadotropin hormone (hCG) on the fertility rate of rabbit does under artificial insemination. The rabbit does (7-8 months old) were used for the trial. The hCG was administered to the rabbit does at varying doses: 0, 50, 100 and 150 I.U representing ...

  13. Ventral frontal satiation-mediated responses to food aromas in obese and normal-weight women123

    Science.gov (United States)

    Eiler, William JA; Dzemidzic, Mario; Case, K Rose; Armstrong, Cheryl LH; Mattes, Richard D; Cyders, Melissa A; Considine, Robert V; Kareken, David A

    2014-01-01

    Background: Sensory properties of foods promote and guide consumption in hunger states, whereas satiation should dampen the sensory activation of ingestive behaviors. Such activation may be disordered in obese individuals. Objective: Using functional magnetic resonance imaging (fMRI), we studied regional brain responses to food odor stimulation in the sated state in obese and normal-weight individuals targeting ventral frontal regions known to be involved in coding for stimulus reward value. Design: Forty-eight women (25 normal weight; 23 obese) participated in a 2-day (fed compared with fasting) fMRI study while smelling odors of 2 foods and an inedible, nonfood object. Analyses were conducted to permit an examination of both general and sensory-specific satiation (satiation effects specific to a given food). Results: Normal-weight subjects showed significant blood oxygen level–dependent responses in the ventromedial prefrontal cortex (vmPFC) to food aromas compared with responses induced by the odor of an inedible object. Normal-weight subjects also showed general (but not sensory-specific) satiation effects in both the vmPFC and orbitofrontal cortex. Obese subjects showed no differential response to the aromas of food and the inedible object when fasting. Within- and between-group differences in satiation were driven largely by changes in the response to the odor of the inedible stimulus. Responses to food aromas in the obese correlated with trait negative urgency, the tendency toward negative affect-provoked impulsivity. Conclusions: Ventral frontal signaling of reward value may be disordered in obesity, with negative urgency heightening responses to food aromas. The observed nature of responses to food and nonfood stimuli suggests that future research should independently quantify each to fully understand brain reward signaling in obesity. This trial was registered at clinicaltrials.gov as NCT02041039. PMID:24695888

  14. A comparison of cytokine responses during prolonged cycling in normal and hot environmental conditions

    Directory of Open Access Journals (Sweden)

    Ludmila M Cosio-Lima

    2011-01-01

    Full Text Available Ludmila M Cosio-Lima, Bhargav V Desai, Petra B Schuler, Lesley Keck, Logan ScheelerDepartment of Health, Leisure, and Exercise Science, University of West Florida, Pensacola, FL, USAPurpose: Components of immune function are affected by physical activity in an adverse environment. The purpose of this study was to compare plasma differences in inflammatory cytokines including tumor necrosis factor α (TNF-α and interleukin 6 (IL-6, in addition to the stress hormone cortisol, during prolonged cycling under normal and hot environmental conditions in elite cyclists.Methods and design: Six trained elite male cyclists (27 ± 8 years; 75.5 ± 4 kg; maximum oxygen uptake [VO2max] = 66 ± 6 mL/kg/min, mean ± SD. The cyclists biked for 2.5 h at their prescribed 60% maximum exercise workload (Wmax or 75% VO2max either in an environmental chamber set at 15°C and 40% relative humidity (NEUTRAL or at 35°C and 40% relative humidity (HOT. The cyclists were given 4 mL of water/kg body weight every 15 min under both conditions.Results: Total cortisol concentrations were elevated (P < 0.05 immediately postexercise and 12 h postexercise in both the NEUTRAL and HOT conditions. TNF-α concentrations were only significantly (P = 0.045 elevated postexercise in HOT conditions. During the HOT conditions, a significant (P = 0.006 and 0.007, respectively difference in IL-6 was seen immediately after and 12 h postexercise. During the NEUTRAL condition, IL-6 was only significantly elevated postexercise (P < 0.05.Conclusions: Heat exposure during a long bout of exercise is sufficient to elicit stress response in elite cyclists. However, the degree of release of anti-inflammatory and proinflammatory cytokines might be related to several factors that include the athlete’s fitness level, hydration status, exercise intensity, and length of exposure to hot environments.Keywords: cytokines, inflammation, heat, exercise, performance 

  15. De novo frameshift mutation in fibroblast growth factor 8 in a male patient with gonadotropin deficiency.

    Science.gov (United States)

    Suzuki, Erina; Yatsuga, Shuichi; Igarashi, Maki; Miyado, Mami; Nakabayashi, Kazuhiko; Hayashi, Keiko; Hata, Kenichirou; Umezawa, Akihiro; Yamada, Gen; Ogata, Tsutomu; Fukami, Maki

    2014-01-01

    Missense, nonsense, and splice mutations in the Fibroblast Growth Factor 8(FGF8) have recently been identified in patients with hypothalamo-pituitary dysfunction and craniofacial anomalies. Here, we report a male patient with a frameshift mutation in FGF8. The patient exhibited micropenis, craniofacial anomalies, and ventricular septal defect at birth. Clinical evaluation at 16 years and 8 months of age revealed delayed puberty, hyposmia, borderline mental retardation, and mild hearing difficulty. Endocrine findings included gonadotropin deficiency and primary hypothyroidism. Molecular analysis identified a de novo heterozygous p.S192fsX204 mutation in the last exon of FGF8. RT-PCR analysis of normal human tissues detected FGF8 expression in the genital skin, and whole-mount in situ hybridization analysis of mouse embryos revealed Fgf8 expression in the anlage of the penis. The results indicate that frameshift mutations in FGF8 account for a part of the etiology of hypothalamo-pituitary dysfunction. Micropenis in patients with FGF8 abnormalities appears to be caused by gonadotropin deficiency and defective outgrowth of the anlage of the penis.

  16. Thresholds of Tone Burst Auditory Brainstem Responses for Infants and Young Children with Normal Hearing in Taiwan

    Directory of Open Access Journals (Sweden)

    Chung-Yi Lee

    2007-10-01

    Conclusion: Based on the published research and our study, we suggest setting the normal criterion levels for infants and young children in Taiwan of the tone burst auditory brainstem response to air-conducted tones as 30 dB nHL for 500 and 1000 Hz, and 25 dB nHL for 2000 and 4000 Hz.

  17. Peek-a-What? Infants' Response to the Still-Face Task after Normal and Interrupted Peek-a-Boo

    Science.gov (United States)

    Bigelow, Ann E.; Best, Caitlin

    2013-01-01

    Infants' sensitivity to the vitality or tension envelope within dyadic social exchanges was investigated by examining their responses following normal and interrupted games of peek-a-boo embedded in a Still-Face Task. Infants 5-6 months old engaged in two modified Still-Face Tasks with their mothers. In one task, the initial interaction ended with…

  18. Artichoke compound cynarin differentially affects the survival, growth and stress response of normal, immortalized and cancerous human cells

    DEFF Research Database (Denmark)

    Gezer, Ceren; Yücecan, Sevinç; Rattan, Suresh Inder Singh

    2015-01-01

    of CYN on the proliferative potential, survival, morphology, and stress response (SR) markers haemoxygenase-1 (HO-1) and heat shock protein-70 (HSP70) in normal human skin fibroblasts (FSF-1), telomerase-immortalized mesenchymal stem cells (hTERT-MSC) and cervical cancer cells, HeLa. Effects of CYN...

  19. Angiogenesis for tumor vascular normalization of Endostar on hepatoma 22 tumor-bearing mice is involved in the immune response.

    Science.gov (United States)

    Xu, Qingyu; Gu, Junfei; Lv, You; Yuan, Jiarui; Yang, Nan; Chen, Juan; Wang, Chunfei; Hou, Xuefeng; Jia, Xiaobin; Feng, Liang; Yin, Guowen

    2018-03-01

    Tumor vascular normalization involved in immune response is beneficial to the chemotherapy of tumors. Recombinant human endostatin (Endostar), an angiogenesis inhibitor, has been demonstrated to be effective in hepatocellular cancer (HCC). However, its vascular normalization in HCC and the role of the immune response in angiogenesis were unclear. In the present study, effects of Endostar on tumor vascular normalization were evaluated in hepatoma 22 (H22) tumor-bearing mice. Endostar was able to inhibit the proliferation and infiltration of tumor cells and improve α-fetoprotein, tumor necrosis factor-α and cyclic adenosine 5'-phosphate levels in the serum of H22-bearing mice, as well as the protein expression levels of the immune factors interferon-γ and cluster of differentiation (CD)86 in liver tissue. Endostar also exhibited more marked downregulation of the levels of vascular endothelial growth factor, CD31, matrix metalloproteinase (MMP)-2, MMP-9 and interleukin-17 during day 3-9 treatment, resulting in short-term normalization of tumor blood vessels. The period of vascular normalization was 3-9 days. The results of the present study demonstrated that Endostar was able to induce the period of vascular normalization, contributing to a more efficacious means of HCC treatment combined with other chemotherapy, and this effect was associated with the immune response. It may be concluded that Endostar inhibited immunity-associated angiogenesis behaviors of vascular endothelial cells in response to HCC. The results of the present study provided more reasonable possibility for the combination therapy of Endostar for the treatment of HCC.

  20. Gonadotropin Regulation of Retinoic Acid Activity in the Testis

    Directory of Open Access Journals (Sweden)

    Seyedmehdi Nourashrafeddin

    2018-02-01

    Full Text Available Initiation of spermatogenesis in primates is triggered at puberty by an increase in gonadotropins; i.e., follicle-stimulating hormone (FSH and luteinizing hormone (LH. Prior to puberty, testis of the monkey contains only undifferentiated germ cells. However, sermatogonial differentiation and spermatogenesis may be initiated prior to puberty after stimulation with exogenous LH and FSH. Retinoic acid (RA signaling is considered to be a major component that drives spermatogonial differentiation. We were interested in evaluating the relative role of LH and FSH, either alone or in combination, in regulating the retinoic acid signaling in monkey testis. Sixteen juvenile male rhesus monkeys (Macaca mulatta were infused with intermittent recombinant single chain human LH (schLH or recombinant human FSH (rhFSH or a combination of both for 11 days. We then analyzed the expression of the several putative RA signaling pathway related genes; i.e. RDH10, RDH11, ALDH1A1, ALDH1A2, CYP26B1, CRABP1, CRABP2, STRA6, STRA8 in the testis after 11 days of stimulation with vehicle, LH, FSH and combination LH/FSH using quantitative real-time PCR (qPCR. The qPCR results analysis showed that administration of gonadotropins affected a significant change in expression of some RA signaling related genes in the monkey testis. The gonadotropins, either alone or in combination dramatically increased expression of CRABP2 (p≤0.001, whereas there was a decrease in ALDH1A2 expression (p≤0.001. Moreover, combined gonadotropin treatment led to the significant decrease in CRABP1 expression (p≤0.05. These findings are the first evidence that the activity of retinoic acid signaling in the monkey testis is regulated through gonadotropins (LH/FSH levels.

  1. Response of cultured normal human mammary epithelial cells to X rays

    International Nuclear Information System (INIS)

    Yang, T.C.; Stampfer, M.R.; Smith, H.S.

    1983-01-01

    The effect of X rays on the reproductive death of cultured normal human mammary epithelial cells was examined. Techniques were developed for isolating and culturing normal human mammary epithelial cells which provide sufficient cells at second passage for radiation studies, and an efficient clonogenic assay suitable for measuring radiation survival curves. It was found that the survival curves for epithelial cells from normal breast tissue were exponential and had D 0 values of about 109-148 rad for 225 kVp X rays. No consistent change in cell radiosensitivity with the age of donor was observed, and no sublethal damage repair in these cells could be detected with the split-dose technique

  2. Absence of diurnal variation in visceromotor response to colorectal distention in normal Long Evans rats [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Sara Botschuijver

    2016-01-01

    Full Text Available Background: Enhanced colorectal sensitivity (i.e. visceral hypersensitivity is thought to be a pathophysiological mechanism in irritable bowel syndrome (IBS. In healthy men a circadian variation in rectal perception to colonic distention was described. Disturbed day and night rhythms, which occur in shift work and trans meridian flights, are associated with the prevalence of IBS. This raises the question whether disruptions of circadian control are responsible for the observed pathology in IBS. Prior to investigating altered rhythmicity in relation to visceral hypersensitivity in a rat model for IBS, it is relevant to establish whether normal rats display circadian variation similar to healthy men.  Methodology and findings: In rodents colorectal distension leads to reproducible contractions of abdominal musculature. We used quantification of this so called visceromotor response (VMR by electromyography (EMG to assess visceral sensitivity in rats. We assessed the VMR in normal male Long Evans rats at different time points of the light/dark cycle. Although a control experiment with male maternal separated rats confirmed that intentionally inflicted (i.e. stress induced changes in VMR can be detected, normal male Long Evans rats showed no variation in VMR along the light/dark cycle in response to colorectal distension. Conclusions: In the absence of a daily rhythm of colorectal sensitivity in normal control rats it is not possible to investigate possible aberrancies in our rat model for IBS.

  3. Effect of stage of development and sex on gonadotropin-releasing hormone secretion in in vitro hypothalamic perifusion.

    Science.gov (United States)

    Lacau-Mengido, I M; González Iglesias, A; Díaz-Torga, G; Thyssen-Cano, S; Libertun, C; Becú-Villalobos, D

    1998-04-01

    Marked sexual and ontogenic differences have been described in gonadotropin regulation in the rat. These could arise from events occurring both at the hypothalamic or hypophyseal levels. The present experiments were designed to evaluate the capacity of the hypothalamus in releasing GnRH in vitro, basally and in response to depolarization with KCl, during ontogeny in the rat. To that end we chose two well-defined developmental ages that differ markedly in sexual and ontogenic characteristics of gonadotropin regulation, 15 and 30 days. We compared GnRH release from hypothalami of females, neonatal androgenized females and males. Mediobasal hypothalami were perifused in vitro, and GnRH measured in the effluent. Basal secretion of the decapeptide increased with age in the three groups with no sexual differences encountered. When studying GnRH release induced by membrane depolarization, no differences within sex or age were encountered. On the other hand FSH serum levels decreased with age in females and increased in males, and in neonatal androgenized females followed a similar pattern to that of females. LH levels were higher in infantile females than in age-matched males or androgenized females. Such patterns of gonadotropin release were therefore not correlated to either basal or K+-induced GnRH release from the hypothalamus. We conclude that sexual and ontogenic differences in gonadotropin secretion in the developing rat are not dependent on the intrinsic capability of the hypothalamus to release GnRH in response to membrane depolarization. The hormonal differences observed during development and between sexes are probably related to differences in the sensitivity of the GnRH neuron to specific secretagogue and neurotransmitter regulation, and/or to differences in hypophyseal GnRH receptors and gonadotrope sensitivity.

  4. Using an APOS Framework to Understand Teachers' Responses to Questions on the Normal Distribution

    Science.gov (United States)

    Bansilal, Sarah

    2014-01-01

    This study is an exploration of teachers' engagement with concepts embedded in the normal distribution. The participants were a group of 290 in-service teachers enrolled in a teacher development program. The research instrument was an assessment task that can be described as an "unknown percentage" problem, which required the application…

  5. Differences in response to conventional vitamin D therapy among obese and normal weight children and adolescents in Qazvin, Iran

    Directory of Open Access Journals (Sweden)

    Fatemeh Saffari

    2017-09-01

    Full Text Available Background: Vitamin D (Vit D deficiency is one of the major nutritional deficiencies in children. Obesity has inverse association with vitamin D levels. The aim of this study was to determine the differences in response to conventional treatment for Vit D deficiency and insufficiency in obese and normal weight children and adolescents.Methods: This nested case control study was conducted in 69 obese children and 133 normal weight matched control suffering from Vit D insufficiency or deficiency. Vit D deficiency was defined as serum 25(OH D

  6. Gonadotropin-Releasing Hormone Stimulate Aldosterone Production in a Subset of Aldosterone-Producing Adenoma

    Science.gov (United States)

    Kishimoto, Rui; Oki, Kenji; Yoneda, Masayasu; Gomez-Sanchez, Celso E.; Ohno, Haruya; Kobuke, Kazuhiro; Itcho, Kiyotaka; Kohno, Nobuoki

    2016-01-01

    Abstract We aimed to detect novel genes associated with G protein-coupled receptors (GPCRs) in aldosterone-producing adenoma (APA) and elucidate the mechanisms underlying aldosterone production. Microarray analysis targeting GPCR-associated genes was conducted using APA without known mutations (APA-WT) samples (n = 3) and APA with the KCNJ5 mutation (APA-KCNJ5; n = 3). Since gonadotropin-releasing hormone receptor (GNRHR) was the highest expression in APA-WT by microarray analysis, we investigated the effect of gonadotropin-releasing hormone (GnRH) stimulation on aldosterone production. The quantitative polymerase chain reaction assay results revealed higher GNRHR expression levels in APA-WT samples those in APA-KCNJ5 samples (P APA-WT samples, and there was a significant and positive correlation between GNRHR and LHCGR expression in all APA samples (r = 0.476, P APA-WT (n = 9), which showed higher GNRHR and LHCGR levels, had significantly higher GnRH-stimulated aldosterone response than those with APA-KCNJ5 (n = 13) (P APA-WT, and the molecular analysis including the receptor expression associated with clinical findings of GnRH stimulation. PMID:27196470

  7. Quantitative radiation dose-response relationships for normal tissues in man. II. Response of the salivary glands during radiotherapy

    International Nuclear Information System (INIS)

    Mossman, K.L.

    1983-01-01

    A quantitative dose-response curve for salivary gland function in patients during radiotherapy is presented. Salivary-function data used in this study were obtained from four previously published reports. All patients were treated with 60 Co teletherapy to the head and neck using conventional treatment techniques. Salivary dysfunction was determined at specific dose levels by comparing salivary flow rates before therapy with flow rates at specific dose intervals during radiotherapy up to a total dose of 6000 cGy. Fifty percent salivary dysfunction occurred after 1000 cGy and eighty percent dysfunction was observed by the end of the therapy course (6000 cGy). The salivary-function curve was also compared to the previously published dose-response curve for taste function. Comparisons of the two curves indicate that salivary dysfunction precedes taste loss and that the shapes of the dose-response curves are different. A new term, tissue tolerance ratio, defined as the ratio of responses of two tissues given the same radiation dose, was used to make the comparisons between gustatory and salivary gland tissue effects. Measurements of salivary gland function and analysis of dose-response curves may be useful in evaluating chemical modifiers of radiation response

  8. Comparisons of amino acids, body constituents and antioxidative response between long-time HD and normal HD.

    Science.gov (United States)

    Torigoe, Akira; Sato, Emiko; Mori, Takefumi; Ieiri, Norio; Takahashi, Chika; Ishida, Yoko; Hotta, Osamu; Ito, Sadayoshi

    2016-10-01

    Introduction Oxidative stress is one of the main mediators of progression of chronic kidney diseases (CKD). Nuclear factor E2-related factor 2 (Nrf2) is the transcription factor of antioxidant and detoxifying enzymes and related proteins which play an important role in cellular defense. Long-time hemodialysis (HD) therapy (8 hours) has been considered to be more beneficial compared to normal HD therapy (4 hours). We investigated oxidative response related to Nrf2 in peripheral blood mononuclear cells (PBMCs) of long-time HD and normal HD patients. Methods Eight adult long-time HD therapy patients (44.5 ± 3.0 years) and 10 normal HD therapy patients (68.1 ± 2.7 years) were enrolled. PBMCs were isolated and processed for expression of Nrf2 and its related genes by qRT-PCR. Plasma indoxyl sulfate, amino acids, and body constituents were measured. Findings Plasma indoxyl sulfate was significantly low after long-time HD therapy compare to that of normal HD therapy. Although, skeletal muscle mass, lean body mass, mineral and protein were significantly decreased 2 months in normal HD patients, those in long-time HD patients were significantly increased after 2 months. Almost of amino acids were significantly decreased after HD therapy in both HD therapies. Plasma amino acids were significantly low in long-time HD patients compared to normal HD patients. In PBMCs, the expression of Nrf2 was significantly decreased and hemooxygenase-1 expression was significantly increased in long-time HD compared to normal HD. Conclusion These observations indicate the beneficial effects of in long-time HD in improving oxidative stress in patients. © 2016 International Society for Hemodialysis.

  9. Effects of pelvic telecobalt irradiation on gonadotropin secretin

    International Nuclear Information System (INIS)

    Pfenninger, R.

    1978-01-01

    The pitnitary reaction in women operated according to Wertheim who had menstruated regularly was investigated during telecobalt irradiation. The pitnitary reaction was observed with the aid of the gonadotropin releasing factor. A dose of 25 mcg RH-LH was applied. Releasing factor examinations were carried out before exposure with functioning ovaries, after a dose of 2000 R (i.e., after 10 exposures), and after 6000 R. In the meantime, separate gonadotropin examinations were carried out continuously. A FSH reaction was observed already after 14 days, and the values were raised to almost menopause values. After this, the FSH increased further, while the LH reaction was not observed until much later. The investigation suggests an interrelation between follicle apparatus and FSH, oestrogens and LH. (orig./AJ) [de

  10. "Good" Students and "Involved" Mothers: Latin@ Responses to Normalization Pressures in Schools

    Science.gov (United States)

    Cuero, Kimberley Kennedy; Valdez, Veronica E.

    2012-01-01

    Drawing from two in-depth qualitative studies, we used a sociocultural lens for a cross-case analysis examining how Latin@s' participation in schools is affected by ideological messages that subordinately position them in terms of their ethnicity, class, and immigrant status. We identified a range of dynamic responses to the school's normalization…

  11. Effect of retinol on the hyperthermal response of normal tissue in vivo

    International Nuclear Information System (INIS)

    Rogers, M.A.; Marigold, J.C.L.; Hume, S.P.

    1983-01-01

    The effect of prior administration of retinol, a membrane labilizer, on the in vivo hyperthermal response of lysosomes was investigated in the mouse spleen using a quantitative histochemical assay for the lysosomal enzyme acid phosphatase. A dose of retinol which had no effect when given alone enhanced the thermal response of the lysosome, causing an increase in lysosomal membrane permeability. In contrast, the same dose of retinol had no effect on the gross hyperthermal response of mouse intestine; a tissue which is relatively susceptible to hyperthermia. Thermal damage to intestine was assayed directly by crypt loss 1 day after treatment or assessed as thermal enhancement of x-ray damage by counting crypt microcolonies 4 days after a combined heat and x-ray treatment. Thus, although the hyperthermal response of the lysosome could be enhanced by the administration of retinol, thermal damage at a gross tissue level appeared to be unaffected, suggesting that lysosomal membrane injury is unlikely to be a primary event in hyperthermal cell killing

  12. Photodynamic therapy in prostate cancer: optical dosimetry and response of normal tissue

    Science.gov (United States)

    Chen, Qun; Shetty, Sugandh D.; Heads, Larry; Bolin, Frank; Wilson, Brian C.; Patterson, Michael S.; Sirls, Larry T., II; Schultz, Daniel; Cerny, Joseph C.; Hetzel, Fred W.

    1993-06-01

    The present study explores the possibility of utilizing photodynamic therapy (PDT) in treating localized prostate carcinoma. Optical properties of ex vivo human prostatectomy specimens, and in vivo and ex vivo dog prostate glands were studied. The size of the PDT induced lesion in dog prostate was pathologically evaluated as a biological endpoint. The data indicate that the human normal and carcinoma prostate tissues have similar optical properties. The average effective attenuation depth is less in vivo than that of ex vivo. The PDT treatment generated a lesion size of up to 16 mm in diameter. The data suggest that PDT is a promising modality in prostate cancer treatment. Multiple fiber system may be required for clinical treatment.

  13. Pros and cons of rotating ground motion records to fault-normal/parallel directions for response history analysis of buildings

    Science.gov (United States)

    Kalkan, Erol; Kwong, Neal S.

    2014-01-01

    According to the regulatory building codes in the United States (e.g., 2010 California Building Code), at least two horizontal ground motion components are required for three-dimensional (3D) response history analysis (RHA) of building structures. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHAs should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here, for the first time, using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak values of engineering demand parameters (EDPs) were computed for rotation angles ranging from 0 through 180° to quantify the difference between peak values of EDPs over all rotation angles and those due to FN/FP direction rotated motions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

  14. Factors influencing the vaccinia-specific cytotoxic response of thymocytes from normal and chimeric mice

    International Nuclear Information System (INIS)

    Doherty, P.C.; Schwartz, D.H.; Bennink, J.R.; Korngold, R.

    1981-01-01

    Following adoptive transfer into irradiated recipients, thymocytes can be induced to respond strongly to vaccinia virus. High levels of cytotoxic T-lymphocyte (CTL) activity may be generated from thymus, but not from spleen, of 3-day-old mice. The capacity of thymocytes to differentiate into effector CTL tends to be lost with age. Some of this loss may reflect positive suppression: a single, low dose of cyclophosphamide allows the reemergence of responsiveness in at least one mouse strain. Thymocytes from [A leads to (A x B)F1] and [(A x B)F1 leads to A] chimeras show the response patterns that would by predicted from previous studies of lymph node and spleen cells. However, thymic function seems to be rapidly lost in the [A leads to (A x B)F1] Chimeras

  15. Cardiovascular autonomic responses to head-up tilt in gestational hypertension and normal pregnancy.

    Science.gov (United States)

    Heiskanen, Nonna; Saarelainen, Heli; Kärkkäinen, Henna; Valtonen, Pirjo; Lyyra-Laitinen, Tiina; Laitinen, Tomi; Vanninen, Esko; Heinonen, Seppo

    2011-04-01

    The aim of the present study was to evaluate the influence of gestational hypertension on hemodynamics and cardiovascular autonomic regulation at rest and their responses to head-up tilt (HUT). We prospectively studied 56 pregnant women (28 with gestational hypertension and 28 healthy pregnant women) during the third trimester of pregnancy and 3 months after pregnancy. In women with pregnancy-induced hypertension, compared with control women, there were significant differences in hemodynamics and in markers of cardiovascular regulation (p Postural change from the supine to the upright position was associated with significant changes in hemodynamic responses in both groups during pregnancy (from p pregnancies (p changes in autonomic nervous function in hypertensive women appeared to be a feature of gestational-induced hypertension.

  16. Normal spectrum of pulmonary parametric response map to differentiate lung collapsibility: distribution of densitometric classifications in healthy adult volunteers

    International Nuclear Information System (INIS)

    Silva, Mario; Nemec, Stefan F.; Dufresne, Valerie; Occhipinti, Mariaelena; Heidinger, Benedikt H.; Bankier, Alexander A.; Chamberlain, Ryan

    2016-01-01

    Pulmonary parametric response map (PRM) was proposed for quantitative densitometric phenotypization of chronic obstructive pulmonary disease. However, little is known about this technique in healthy subjects. The purpose of this study was to describe the normal spectrum of densitometric classification of pulmonary PRM in a group of healthy adults. 15 healthy volunteers underwent spirometrically monitored chest CT at total lung capacity (TLC) and functional residual capacity (FRC). The paired CT scans were analyzed by PRM for voxel-by-voxel characterization of lung parenchyma according to 4 densitometric classifications: normal lung (TLC ≥ -950 HU, FRC ≥ -856 HU); expiratory low attenuation area (LAA) (TLC ≥ -950 HU, FRC < -856 HU); dual LAA (TLC<-950 HU, FRC < -856 HU); uncharacterized (TLC < -950 HU, FRC ≥ -856 HU). PRM spectrum was 78 % ± 10 % normal lung, 20 % ± 8 % expiratory LAA, and 1 % ± 1 % dual LAA. PRM was similar between genders, there was moderate correlation between dual LAA and spirometrically assessed TLC (R = 0.531; p = 0.042), and between expiratory LAA and Vol Exp/Insp ratio (R = -0.572; p = 0.026). PRM reflects the predominance of normal lung parenchyma in a group of healthy volunteers. However, PRM also confirms the presence of physiological expiratory LAA seemingly related to air trapping and a minimal amount of dual LAA likely reflecting emphysema. (orig.)

  17. Estimation of low-dose radiation-responsive proteins in the absence of genomic instability in normal human fibroblast cells.

    Science.gov (United States)

    Yim, Ji-Hye; Yun, Jung Mi; Kim, Ji Young; Nam, Seon Young; Kim, Cha Soon

    2017-11-01

    Low-dose radiation has various biological effects such as adaptive responses, low-dose hypersensitivity, as well as beneficial effects. However, little is known about the particular proteins involved in these effects. Here, we sought to identify low-dose radiation-responsive phosphoproteins in normal fibroblast cells. We assessed genomic instability and proliferation of fibroblast cells after γ-irradiation by γ-H2AX foci and micronucleus formation analyses and BrdU incorporation assay, respectively. We screened fibroblast cells 8 h after low-dose (0.05 Gy) γ-irradiation using Phospho Explorer Antibody Microarray and validated two differentially expressed phosphoproteins using Western blotting. Cell proliferation proceeded normally in the absence of genomic instability after low-dose γ-irradiation. Phospho antibody microarray analysis and Western blotting revealed increased expression of two phosphoproteins, phospho-NFκB (Ser536) and phospho-P70S6K (Ser418), 8 h after low-dose radiation. Our findings suggest that low-dose radiation of normal fibroblast cells activates the expression of phospho-NFκB (Ser536) and phospho-P70S6K (Ser418) in the absence of genomic instability. Therefore, these proteins may be involved in DNA damage repair processes.

  18. Estrogen Responsiveness of the TFIID Subunit TAF4B in the Normal Mouse Ovary and in Ovarian Tumors1

    Science.gov (United States)

    Wardell, Jennifer R.; Hodgkinson, Kendra M.; Binder, April K.; Seymour, Kimberly A.; Korach, Kenneth S.; Vanderhyden, Barbara C.; Freiman, Richard N.

    2013-01-01

    ABSTRACT Estrogen signaling in the ovary is a fundamental component of normal ovarian function, and evidence also indicates that excessive estrogen is a risk factor for ovarian cancer. We have previously demonstrated that the gonadally enriched TFIID subunit TAF4B, a paralog of the general transcription factor TAF4A, is required for fertility in mice and for the proliferation of ovarian granulosa cells following hormonal stimulation. However, the relationship between TAF4B and estrogen signaling in the normal ovary or during ovarian tumor initiation and progression has yet to be defined. Herein, we show that Taf4b mRNA and TAF4B protein, but not Taf4a mRNA or TAF4A protein, are increased in whole ovaries and granulosa cells of the ovary after exposure to 17beta-estradiol or the synthetic estrogen diethylstilbestrol and that this response occurs within hours after stimulation. Furthermore, this increase occurs via nuclear estrogen receptors both in vivo and in a mouse granulosa cancer cell line, NT-1. We observe a significant increase in Taf4b mRNA in estrogen-supplemented mouse ovarian tumors, which correlates with diminished survival of these mice. These data highlight the novel response of the general transcription factor TAF4B to estrogen in the normal ovary and during ovarian tumor progression in the mouse, suggesting its potential role in regulating actions downstream of estrogen stimulation. PMID:24068106

  19. Estrogen responsiveness of the TFIID subunit TAF4B in the normal mouse ovary and in ovarian tumors.

    Science.gov (United States)

    Wardell, Jennifer R; Hodgkinson, Kendra M; Binder, April K; Seymour, Kimberly A; Korach, Kenneth S; Vanderhyden, Barbara C; Freiman, Richard N

    2013-11-01

    Estrogen signaling in the ovary is a fundamental component of normal ovarian function, and evidence also indicates that excessive estrogen is a risk factor for ovarian cancer. We have previously demonstrated that the gonadally enriched TFIID subunit TAF4B, a paralog of the general transcription factor TAF4A, is required for fertility in mice and for the proliferation of ovarian granulosa cells following hormonal stimulation. However, the relationship between TAF4B and estrogen signaling in the normal ovary or during ovarian tumor initiation and progression has yet to be defined. Herein, we show that Taf4b mRNA and TAF4B protein, but not Taf4a mRNA or TAF4A protein, are increased in whole ovaries and granulosa cells of the ovary after exposure to 17beta-estradiol or the synthetic estrogen diethylstilbestrol and that this response occurs within hours after stimulation. Furthermore, this increase occurs via nuclear estrogen receptors both in vivo and in a mouse granulosa cancer cell line, NT-1. We observe a significant increase in Taf4b mRNA in estrogen-supplemented mouse ovarian tumors, which correlates with diminished survival of these mice. These data highlight the novel response of the general transcription factor TAF4B to estrogen in the normal ovary and during ovarian tumor progression in the mouse, suggesting its potential role in regulating actions downstream of estrogen stimulation.

  20. Enhancing the radiation response of tumors but not early or late responding normal tissues using a vascular disrupting agent

    DEFF Research Database (Denmark)

    Horsman, Michael R

    2017-01-01

    INTRODUCTION: Vascular disrupting agents (VDAs) damage tumor vasculature and enhance tumor radiation response. In this pre-clinical study, we combined radiation with the leading VDA in clinical development, combretastatin A-4 phosphate (CA4P), and compared the effects seen in tumors and relevant...... normal tissues. MATERIAL AND METHODS: Radiation was applied locally to tissues in CDF1 mice to produce full radiation dose-response curves. CA4P (250 mg/kg) was intraperitoneally (i.p.) injected within 30 minutes after irradiating. Response of 200 mm3 foot implanted C3H mammary carcinomas was assessed......% increase in ventilation rate measured by plethysmography within 9 months). A Chi-squared test was used for statistical comparisons (significance level of p 4P. The radiation...

  1. Comparison between pulsatile GnRH therapy and gonadotropins for ovulation induction in women with both functional hypothalamic amenorrhea and polycystic ovarian morphology.

    Science.gov (United States)

    Dumont, Agathe; Dewailly, Didier; Plouvier, Pauline; Catteau-Jonard, Sophie; Robin, Geoffroy

    2016-12-01

    Ovulation induction in patients having both functional hypothalamic amenorrhea (FHA) and polycystic ovarian morphology (PCOM) has been less studied in the literature. As results remain contradictory, no recommendations have yet been established. To compare pulsatile GnRH therapy versus gonadotropins for ovulation induction in "FHA-PCOM" patients and to determine if one treatment strikes as superior to the other. A 12-year retrospective study, comparing 55 "FHA-PCOM" patients, treated either with GnRH therapy (38 patients, 93 cycles) or with gonadotropins (17 patients, 53 cycles). Both groups were similar, defined by low serum LH and E2 levels, low BMI, excessive follicle number per ovary and/or high serum AMH level. Ovulation rates were significantly lower with gonadotropins (56.6% versus 78.6%, p = 0.005), with more cancellation and ovarian hyper-responses (14% versus 34% per initiated cycle, p < 0.005). Pregnancy rates were significantly higher with GnRH therapy, whether per initiated cycle (26.9% versus 7.6%, p = 0.005) or per patient (65.8% versus 23.5%, p = 0.007). In our study, GnRH therapy was more successful and safer than gonadotropins, for ovulation induction in "FHA-PCOM" patients. If results were confirmed by prospective studies, it could become a first-line treatment for this population, just as it is for FHA women without PCOM.

  2. Temporally distinct response of irradiated normal human fibroblasts and their bystander cells to energetic heavy ions

    International Nuclear Information System (INIS)

    Hamada, Nobuyuki; Ni, Meinan; Funayama, Tomoo; Sakashita, Tetsuya; Kobayashi, Yasuhiko

    2008-01-01

    Ionizing radiation-induced bystander effects have been documented for a multitude of endpoints such as mutations, chromosome aberrations and cell death, which arise in nonirradiated bystander cells having received signals from directly irradiated cells; however, energetic heavy ion-induced bystander response is incompletely characterized. To address this, we employed precise microbeams of carbon and neon ions for targeting only a very small fraction of cells in confluent fibroblast cultures. Conventional broadfield irradiation was conducted in parallel to see the effects in irradiated cells. Exposure of 0.00026% of cells led to nearly 10% reductions in the clonogenic survival and twofold rises in the apoptotic incidence regardless of ion species. Whilst apoptotic frequency increased with time up to 72 h postirradiation in irradiated cells, its frequency escalated up to 24 h postirradiation but declined at 48 h postirradiation in bystander cells, indicating that bystander cells exhibit transient commitment to apoptosis. Carbon- and neon-ion microbeam irradiation similarly caused almost twofold increments in the levels of serine 15-phosphorylated p53 proteins, irrespective of whether 0.00026, 0.0013 or 0.0066% of cells were targeted. Whereas the levels of phosphorylated p53 were elevated and remained unchanged at 2 h and 6 h postirradiation in irradiated cells, its levels rose at 6 h postirradiation but not at 2 h postirradiation in bystander cells, suggesting that bystander cells manifest delayed p53 phosphorylation. Collectively, our results indicate that heavy ions inactivate clonogenic potential of bystander cells, and that the time course of the response to heavy ions differs between irradiated and bystander cells. These induced bystander responses could be a defensive mechanism that minimizes further expansion of aberrant cells

  3. Pituitary response to a dopamine antagonist at different times of the day in normal women.

    Science.gov (United States)

    Pérez-López, F R; González-Moreno, C M; Abós, M D; Andonegui, J A; Corvo, R H

    1982-08-01

    In order to determine whether or not pituitary responsiveness to the dopaminergic antagonist clebopride changes during the nyctohemeral cycle, 10 healthy women with regular cycles were given 1 mg of clebopride orally at 09.00 h and 24.00 h with at least a 5 day interval between each test. In addition, 5 of the women were given a placebo instead of clebopride at midnight to evaluate the spontaneous hormonal changes. During the 24.00 h test the women had significantly higher (P less than 0.05) mean TSH basal levels. Serum prolactin (Prl) increased significantly (P less than 0.001) after clebopride administration while these changes did not occur when placebo was used instead of clebopride at midnight. The Prl response to clebopride was qualitatively similar at 09.00 h and at 24.00 h. Clebopride given at midnight induced a significant increase (P less than 0.05) in serum TSH while this change did not occur when the drug was given at 09.00 h or when placebo was given at midnight. The administration of clebopride resulted in no discernible alternations in serum LH, FSH or GH in either the 09.00 h or the 24.00 h tests. Thus, Prl responses to clebopride were similar in the morning and at midnight, TSH significantly increased after clebopride at midnight whereas this did not occur when the drug was given in the morning, and no significant changes were induced in LH, FSH or GH at the times studied.

  4. Standardization of the radioimmunoassay of 17β-estradiol (E2) plasmatic and his application to the study of secretion of E2 in normal women, during the menstrual cycle and after the infusion of the gonadotropin (LH/FSH/RH) release factor

    International Nuclear Information System (INIS)

    Kiyan, Takeko Shimizu

    1979-01-01

    A radioimmunoassay method for measurement of plasma E 2 was standardized utilizing a highly specific antisera against E 2 [-6 (-0-carboxymethyl)-oxime] BSA without the need of previous chromatographic purification. The anti-E 2 serum was highly specific, showing high affinity with affinity constants: K 1 =1 .62x10 12 M -1 and K 2 = 2.94x10 11 M -1 , calculated by Scatchard plot. The standard curve sensitivity was 2 pico grams. The method was specific and accurate, showing an intra-assay precision with a mean C.V. of 2.9%, with the inter-assay evaluation showing a mean C.V. of 5.0%. This method was employed to evaluate E 2 secretion during the menstrual cycle in 6 normal females, as indicated below: Days: -14 to -10 (early follicular phase..64.68 pg/ml±12.14; - 9 to - 1(late follicular phase).122.39 pg/ml ±33,54; Peak day 281.28 pg/ml ±66 ,59; + 1 to + 7(early luteal phase) 127.47 pg/ml ±24.88; + 8 to +14 (late luteal phase) 87.57 pg/ml±37,56. The effect of the acute and prolonged infusion of LH/FSH-RH(synthetic hypothalamic LH and FSH releasing hormone) was evaluated in the follicular and luteal phase in some of the normal females. (author)

  5. The chondrogenic response to exercise in the proximal femur of normal and mdx mice

    Directory of Open Access Journals (Sweden)

    Nye David J

    2010-09-01

    Full Text Available Abstract Background Submaximal exercise is used in the management of muscular dystrophy. The effects of mechanical stimulation on skeletal development are well understood, although its effects on cartilage growth have yet to be investigated in the dystrophic condition. The objective of this study was to investigate the chondrogenic response to voluntary exercise in dystrophin-deficient mice. Methods Control and dystrophin-deficient (mdx mice were divided into sedentary and exercise-treated groups and tested for chondral histomorphometric differences at the proximal femur. Results Control mice ran 7 km/week further than mdx mice on average, but this difference was not statistically significant (P > 0.05. However, exercised control mice exhibited significantly enlarged femur head diameter, articular cartilage thickness, articular cartilage tissue area, and area of calcified cartilage relative to sedentary controls and exercised mdx mice (P Conclusions Mdx mice exhibit a reduced chondrogenic response to increased mechanical stimulation relative to controls. However, no significant reduction in articular dimensions was found, indicating loss of chondral tissue may not be a clinical concern with dystrophinopathy.

  6. EEG responses to low-level chemicals in normals and cacosmics.

    Science.gov (United States)

    Schwartz, G E; Bell, I R; Dikman, Z V; Fernandez, M; Kline, J P; Peterson, J M; Wright, K P

    1994-01-01

    Recent studies from the University of Arizona indicate that normal subjects, both college students and the elderly, can register the presence of low-intensity odors in the electroencephalogram (EEG) in the absence of conscious awareness of the odors. The experimental paradigm involves subjects sniffing pairs of bottles, one containing an odorant (e.g. isoamyl acetate) dissolved in an odorless solvent (water or liquid silicone), the other containing just the solvent, while 19 channels of EEG are continuously recorded. For the low-intensity odor conditions, concentrations are adjusted downward (decreased) until subjects correctly identify the odor bottle at chance (50%). The order of odorants, concentrations, and hand holding the control bottle, are counterbalanced within and across subjects. Three previous experiments found that alpha activity (8-12 hz) decreased in midline and posterior regions when subjects sniffed the low-intensity odors. The most recent study suggests that decreased theta activity (4-8 hz) may reflect sensory registration and decreased alpha activity may reflect perceptual registration. In a just completed experiment involving college students who were selected based on combinations of high and low scores on a scale measuring cacosmia (chemical odor intolerance) and high and low scores on a scale measuring depression, cacosmic subjects (independent of depression) showed greater decreases in low-frequency alpha (8-10 hz) and greater increases in low-frequency beta (12-16 hz) to the solvent propylene glycol compared to an empty bottle. Topographic EEG mapping to low-intensity odorants may provide a useful tool for investigating possible increased sensitivity to specific chemicals in chemically sensitive individuals.

  7. Quantifying response to intracranial pressure normalization in idiopathic intracranial hypertension via dynamic neuroimaging.

    Science.gov (United States)

    Lublinsky, Svetlana; Kesler, Anat; Friedman, Alon; Horev, Anat; Shelef, Ilan

    2018-04-01

    Idiopathic intracranial hypertension (IIH) is characterized by elevated intracranial pressure without a clear cause. To investigate dynamic imaging findings in IIH and their relation to mechanisms underlying intracranial pressure normalization. Prospective. Eighteen IIH patients and 30 healthy controls. T 1 -weighted, venography, fluid attenuation inversion recovery, and apparent diffusion coefficients were acquired on 1.5T scanner. The dural sinus was measured before and after lumbar puncture (LP). The degree of sinus occlusion was evaluated, based on 95% confidence intervals of controls. We studied a number of neuroimaging biomarkers associated with IIH (sinus occlusion; optic nerve; distribution of cerebrospinal fluid into the subarachnoid space, sulci and lateral ventricles (LVs); Meckel's caves; arachnoid granulation; pituitary and choroid plexus), before and after LP, using a set of specially developed quantification techniques. Relationships among various biomarkers were investigated (Pearson correlation coefficient) and linked to long-term disease outcomes (logistic regression). The t-test and the Wilcoxon rank test were used to compare between controls and before and after LP data. As a result of LP, the following were found to be in good accordance with the opening pressure: relative compression of cerebrospinal fluid (R = -0.857, P < 0.001) and brain volumes (R = -0.576, P = 0.012), LV expansion (R = 0.772, P < 0.001) and venous volume (R = 0.696, P = 0.001), enlargement of the pituitary (R = 0.640, P = 0.023), and shrinkage of subarachnoid space (R = -0.887, P < 0.001). The only parameter that had an impact on long-term prognosis was cross-sectional size of supplemental drainage veins after LP (sensitivity of 92%, specificity of 20%, and area under the curve of 0.845, P < 0.001). We present an approach for quantitative characterization of the intracranial venous system and its implementation as a diagnostic assistance

  8. Dynamics of oligodendrocyte responses to anterograde axonal (Wallerian) and terminal degeneration in normal and TNF-transgenic mice

    DEFF Research Database (Denmark)

    Drøjdahl, Nina; Fenger, Christina; Nielsen, Helle H

    2004-01-01

    degeneration and lesion-induced axonal sprouting in the hippocampal dentate gyrus in TNF-transgenic mice with the response in genetically normal mice. Transectioning of the entorhino-dentate perforant path axonal projection increased hippocampal TNF mRNA expression in both types of mice, but to significantly...... larger levels in the TNF-transgenics. At 5 days after axonal transection, numbers of oligodendrocytes and myelin basic protein (MBP) mRNA expression in the denervated dentate gyrus in TNF-transgenic mice had increased to the same extent as in nontransgenic littermates. At this time, transgenics showed...

  9. Beta-human chorionic gonadotropin concentrations in cervicovaginal secretions in preterm delivery

    Directory of Open Access Journals (Sweden)

    Talip Gül

    2010-05-01

    Full Text Available Objectives: To investigate beta-human corionic gonadotropin (β-hCG levels in cervicovaginal secretions as an early marker for preterm delivery.Methods: The study included 55 patients at 25-36 of gestational weeks with preterm delivery risk factors including a history of preterm labor in a previous pregnancy or history of second trimester abortion. Beta-human chorionic gonadotropin (β-hCG levels of cervicovaginal secretions were measured in all patients by the radioimmunoassay method using a commercial kit.Results: Preterm delivery was observed in 25 patients and 30 patients gave term delivery. No significant differences were found between preterm and term delivery groups in age, gravidity and parity (P>0.05. APGAR scores and anthropometric measurements of newborns were significantly lower in preterm delivery group (P<0.001. Preterm delivery group had significantly higher cervicovaginal β-hCG levels compared with normal controls (94.7±37.7 vs. 35.5±14.8 mIU/ml, respectively, P<0.001. When 75 mIU/ml value of β-hCG level was taken as cut-off value; the sensitivity of the test was found as 76%, specifity 91.6%, positive predictive value 95.0% and negative predictive value as 79.9%.Conclusion: Concentrations of β-hCG in cervicovaginal secretions may be a useful early biochemical marker to detect preterm. Based on β-hCG levels in cervicovaginal secretions a closer follow-up may decrease some complications of preterm delivery. J Clin Exp Invest 2010; 1(1: 16-20

  10. Response of normal stem cells to ionizing radiation: A balance between homeostasis and genomic stability

    International Nuclear Information System (INIS)

    Harfouche, G.; Martin, M.T.

    2010-01-01

    Stem cells have been described in most adult tissues, where they play a key role in maintaining tissue homeostasis. As they self-renew throughout life, accumulating genetic anomalies can compromise their genomic integrity and potentially give rise to cancer. Stem cells (SCs) may thus be a major target of radiation carcinogenesis. In addition, unrepaired genotoxic damage may cause cell death and stem cell pool depletion, impairing lineage functionality and accelerating aging. Developments in SC biology enabled the characterization of the responses of stem cells to genotoxic stress and their role in tissue damage. We here examine how these cells react to ionizing radiation (IR), and more specifically their radiosensitivity, stress signaling and DNA repair. We first review embryonic SCs, as a paradigm of primitive pluri-potent cells, then three adult tissues, bone marrow, skin and intestine, capable of long-term regeneration and at high risk for acute radiation syndromes and long-term carcinogenesis. We discuss IR disruption of the fine balance between maintenance of tissue homeostasis and genomic stability. We show that stem cell radiosensitivity does not follow a unique model, but differs notably according to the turnover rates of the tissues. (authors)

  11. Dynamic response characteristics of high temperature superconducting maglev systems: Comparison between Halbach-type and normal permanent magnet guideways

    Science.gov (United States)

    Wang, B.; Zheng, J.; Che, T.; Zheng, B. T.; Si, S. S.; Deng, Z. G.

    2015-12-01

    The permanent magnet guideway (PMG) is very important for the performance of the high temperature superconducting (HTS) system in terms of electromagnetic force and operational stability. The dynamic response characteristics of a HTS maglev model levitating on two types of PMG, which are the normal PMG with iron flux concentration and Halbach-type PMG, were investigated by experiments. The dynamic signals for different field-cooling heights (FCHs) and loading/unloading processes were acquired and analyzed by a vibration analyzer and laser displacement sensors. The resonant frequency, stiffness and levitation height of the model were discussed. It was found that the maglev model on the Halbach-type PMG has higher resonant frequency and higher vertical stiffness compared with the normal PMG. However, the low lateral stiffness of the model on the Halbach-type PMG indicates poor lateral stability. Besides, the Halbach-type PMG has better loading capacity than the normal PMG. These results are helpful to design a suitable PMG for the HTS system in practical applications.

  12. Dynamic response characteristics of high temperature superconducting maglev systems: Comparison between Halbach-type and normal permanent magnet guideways

    International Nuclear Information System (INIS)

    Wang, B.; Zheng, J.; Che, T.; Zheng, B.T.; Si, S.S.; Deng, Z.G.

    2015-01-01

    Highlights: • The loading weight affects the RF tremendously. • Reducing the FCH can improve the stability of the maglev vehicle. • The Halbach-type PMG has better loading capacity than the conventional PMG. • Pre-load is an effective way to enhance the dynamic characteristic of the HTS maglev vehicle. - Abstract: The permanent magnet guideway (PMG) is very important for the performance of the high temperature superconducting (HTS) system in terms of electromagnetic force and operational stability. The dynamic response characteristics of a HTS maglev model levitating on two types of PMG, which are the normal PMG with iron flux concentration and Halbach-type PMG, were investigated by experiments. The dynamic signals for different field-cooling heights (FCHs) and loading/unloading processes were acquired and analyzed by a vibration analyzer and laser displacement sensors. The resonant frequency, stiffness and levitation height of the model were discussed. It was found that the maglev model on the Halbach-type PMG has higher resonant frequency and higher vertical stiffness compared with the normal PMG. However, the low lateral stiffness of the model on the Halbach-type PMG indicates poor lateral stability. Besides, the Halbach-type PMG has better loading capacity than the normal PMG. These results are helpful to design a suitable PMG for the HTS system in practical applications.

  13. Dynamic response characteristics of high temperature superconducting maglev systems: Comparison between Halbach-type and normal permanent magnet guideways

    Energy Technology Data Exchange (ETDEWEB)

    Wang, B. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Zheng, J., E-mail: jzheng@swjtu.cn [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Che, T. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Zheng, B.T.; Si, S.S. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); School of Electrical Engineering, Southwest Jiaotong University, Chengdu 610031, P R China (China); Deng, Z.G., E-mail: deng@swjtu.cn [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China)

    2015-12-15

    Highlights: • The loading weight affects the RF tremendously. • Reducing the FCH can improve the stability of the maglev vehicle. • The Halbach-type PMG has better loading capacity than the conventional PMG. • Pre-load is an effective way to enhance the dynamic characteristic of the HTS maglev vehicle. - Abstract: The permanent magnet guideway (PMG) is very important for the performance of the high temperature superconducting (HTS) system in terms of electromagnetic force and operational stability. The dynamic response characteristics of a HTS maglev model levitating on two types of PMG, which are the normal PMG with iron flux concentration and Halbach-type PMG, were investigated by experiments. The dynamic signals for different field-cooling heights (FCHs) and loading/unloading processes were acquired and analyzed by a vibration analyzer and laser displacement sensors. The resonant frequency, stiffness and levitation height of the model were discussed. It was found that the maglev model on the Halbach-type PMG has higher resonant frequency and higher vertical stiffness compared with the normal PMG. However, the low lateral stiffness of the model on the Halbach-type PMG indicates poor lateral stability. Besides, the Halbach-type PMG has better loading capacity than the normal PMG. These results are helpful to design a suitable PMG for the HTS system in practical applications.

  14. Brainstem auditory evoked response characteristics in normal-hearing subjects with chronic tinnitus and in non-tinnitus group

    Directory of Open Access Journals (Sweden)

    Shadman Nemati

    2014-06-01

    Full Text Available Background and Aim: While most of the people with tinnitus have some degrees of hearing impairment, a small percent of patients admitted to ear, nose and throat clinics or hearing evaluation centers are those who complain of tinnitus despite having normal hearing thresholds. This study was performed to better understanding of the reasons of probable causes of tinnitus and to investigate possible changes in the auditory brainstem function in normal-hearing patients with chronic tinnitus.Methods: In this comparative cross-sectional, descriptive and analytic study, 52 ears (26 with and 26 without tinnitus were examined. Components of the auditory brainstem response (ABR including wave latencies and wave amplitudes were determined in the two groups and analyzed using appropriate statistical methods.Results: The mean differences between the absolute latencies of waves I, III and V was less than 0.1 ms between the two groups that was not statistically significant. Also, the interpeak latency values of waves I-III, III-V and I-V in both groups had no significant difference. Only, the V/I amplitude ratio in the tinnitus group was significantly higher (p=0.04.Conclusion: The changes observed in amplitude of waves, especially in the latter ones, can be considered as an indication of plastic changes in neuronal activity and its possible role in generation of tinnitus in normal-hearing patients.

  15. Clomiphene citrate versus high doses of gonadotropins for in vitro fertilisation in women with compromised ovarian reserve: a randomised controlled non-inferiority trial

    Directory of Open Access Journals (Sweden)

    Ragni Guido

    2012-12-01

    Full Text Available Abstract Background The aim of the present randomised controlled non-inferiority trial is to test whether in women with compromised ovarian reserve requiring in vitro fertilisation, a protocol of ovarian stimulation using exclusively clomiphene citrate performs similarly to a regimen with high doses of gonadotropins. Methods Women with day 3 serum FSH > 12 IU/ml on at least two occasions or previous poor response to hyper-stimulation were recruited at four Italian infertility units. Selected women were allocated to clomiphene citrate 150 mg/day from day 3 to day 7 of the cycle (n=145 or to a short protocol with GnRH agonist 0.1 mg and recombinant FSH 450 IU daily (n=146. They were randomised by means of a computer-generated list into two groups. The study was not blinded. The main outcome of the study was the delivery rate per started cycle. Results The study was interrupted after the scheduled two years of recruitment before reaching the sample size. 148 women were allocated to clomiphene citrate and 156 to the short protocol with high doses of gonadotropins; 124 and 125 participants were analysed in the groups, respectively. Women allocated to high doses of gonadotropins retrieved more oocytes and had a higher probability to perform embryo-transfer. However, the chances of success were similar. The delivery rate per started cycle in women receiving clomiphene citrate and high-dose gonadotropins was 3% (n=5 and 5% (n=7, respectively (p=0.77. The mean estimated cost per delivery in the two groups was 81,294 and 113,107 Euros, respectively. No side-effects or adverse events were observed. Conclusions In women with compromised ovarian reserve selected for in vitro fertilisation, ovarian stimulation with clomiphene citrate or high-dose gonadotropins led to similar chances of pregnancy but the former is less expensive. Trial registration Trial registered on http://www.clinicaltrials.gov (NCT01389713

  16. Benazepril, an angiotensin converting enzyme inhibitor: drug interaction with salbutamol and bronchial response to histamine in normal subjects

    Science.gov (United States)

    Bauer, K. G.; Brunel, P.; Nell, G.; Quinn, G.; Kaik, G. A.

    1997-01-01

    Aims To investigate the effect of the angiotensin converting enzyme inhibitor, benazepril, on pulmonary function. Methods We investigated the influence of benazepril, on lung function and the interaction with inhaled salbutamol (0.1 to 6.6 mg) and histamine (0.03 to 30.69 g l−1 ) in normal subjects. Benazepril 20 mg, salbutamol 8 mg, propranolol 160 mg, and placebo were given orally once daily over 10 days. Results On day 8, there was no difference in the area under the salbutamol dose-response curves between benazepril, placebo and oral salbutamol (P >0.05), propranolol shifted the curves to the right (Pbenazepril 1.04 (0.99–1.08), salbutamol 1.19 (1.13–1.25), propranolol 0.57 (0.50–0.65). Conclusions Benazepril had no influence on baseline lung function, caused no interaction with inhaled salbutamol and the bronchial response to histamine was similar to placebo. However, our findings in normal subjects cannot be extrapolated automatically to asthmatics. PMID:9431834

  17. Autonomous parvoviruses neither stimulate nor are inhibited by the type I interferon response in human normal or cancer cells.

    Science.gov (United States)

    Paglino, Justin C; Andres, Wells; van den Pol, Anthony N

    2014-05-01

    Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients. The cancer

  18. 77 FR 4227 - Implantation or Injectable Dosage Form New Animal Drugs; Gonadotropin Releasing Factor Analog...

    Science.gov (United States)

    2012-01-27

    ... Factor Analog-Diphtheria Toxoid Conjugate AGENCY: Food and Drug Administration, HHS. ACTION: Final rule... extends the slaughter interval for intact male swine injected with gonadotropin releasing factor analog...-322 for IMPROVEST (gonadotropin releasing factor analog-diphtheria toxoid conjugate) Sterile Solution...

  19. 76 FR 27888 - Implantation or Injectable Dosage Form New Animal Drugs; Gonadotropin Releasing Factor-Diphtheria...

    Science.gov (United States)

    2011-05-13

    ... Factor-Diphtheria Toxoid Conjugate AGENCY: Food and Drug Administration, HHS. ACTION: Final rule. [[Page... veterinary prescription use of gonadotropin releasing factor-diphtheria toxoid conjugate by subcutaneous... provides for the veterinary prescription use of IMPROVEST (gonadotropin releasing factor-diphtheria toxoid...

  20. Gonadotropin-releasing hormone agonist versus HCG for oocyte triggering in antagonist assisted reproductive technology cycles

    NARCIS (Netherlands)

    Youssef, Mohamed A. F. M.; van der Veen, Fulco; Al-Inany, Hesham G.; Griesinger, Georg; Mochtar, Monique H.; Aboulfoutouh, Ismail; Khattab, Sherif M.; van Wely, Madelon

    2011-01-01

    Background Gonadotropin-releasing hormone (GnRH) antagonist protocols for pituitary down regulation in in vitro fertilisation (IVF) and intracytoplasmic sperm injection (ICSI) allow the use of GnRH agonists for triggering final oocyte maturation. Currently, human chorionic gonadotropin (HCG) is

  1. Expression and role of gonadotropin-releasing hormone 2 and its receptor in mammals

    Science.gov (United States)

    Gonadotropin-releasing hormone (GnRH1) and its receptor (GnRHR1) drive mammalian reproduction via regulation of the gonadotropins. Yet, a second form of GnRH (GnRH2) and its receptor (GnRHR2) also exist in some mammals. GnRH2 has been completely conserved throughout 500 million years of evolution, s...

  2. Functional brain response to food images in successful adolescent weight losers compared with normal-weight and overweight controls.

    Science.gov (United States)

    Jensen, Chad D; Kirwan, C Brock

    2015-03-01

    Research conducted with adults suggests that successful weight losers demonstrate greater activation in brain regions associated with executive control in response to viewing high-energy foods. No previous studies have examined these associations in adolescents. Functional neuroimaging was used to assess brain response to food images among groups of overweight (OW), normal-weight (NW), and successful weight-losing (SWL) adolescents. Eleven SWL, 12 NW, and 11 OW participants underwent functional magnetic resonance imaging while viewing images of high- and low-energy foods. When viewing high-energy food images, SWLs demonstrated greater activation in the dorsolateral prefrontal cortex (DLPFC) compared with OW and NW controls. Compared with NW and SWL groups, OW individuals demonstrated greater activation in the ventral striatum and anterior cingulate in response to food images. Adolescent SWLs demonstrated greater neural activation in the DLPFC compared with OW/NW controls when viewing high-energy food stimuli, which may indicate enhanced executive control. OW individuals' brain responses to food stimuli may indicate greater reward incentive processes than either SWL or NW groups. © 2015 The Obesity Society.

  3. 99mTc-sestamibi muscle scintigraphy to assess the response to neuromuscular electrical stimulation of normal quadriceps femoris muscle

    International Nuclear Information System (INIS)

    Pekindil, Y.; Sarikaya, A.; Birtane, M.; Pekindil, G.; Salan, A.

    2001-01-01

    Neuromuscular electrical stimulation (NMES) is widely used for improving muscle strength by simultaneous contraction in the prevention of muscle atrophy. Although there exist many clinical methods for evaluating the therapeutic response of muscles, 99m Tc-sestamibi which is a skeletal muscle perfusion and metabolism agent has not previously been used for this purpose. The aim of our work was to ascertain whether 99m Tc-sestamibi muscle scintigraphy is useful in the monitoring of therapeutic response to NMES in healthy women. The study included 16 women aged between 21 and 45, with a mean age of 32.7±6.4. Both quadriceps femoris muscles (QFM) of each patient were studied. After randomization to remove the effect of the dominant side, one QFM of each patient was subjected to the NMES procedure for a period of 20 days. NMES was performed with an alternating biphasic rectangular current, from a computed electrical stimulator daily for 23 minutes. After measurement of skinfold thickness over the thigh, pre- and post-NMES girth measurements were assessed in centimeters. Sixty minutes after injections of 555 MBq 99m Tc-sestamibi, static images of the thigh were obtained for 5 minutes. The thigh-to-knee uptake ratio was calculated by semiquantitative analysis and normalized to body surface area (NUR=normalized uptake ratio). The difference between the pre and post NMES NUR values was significant (1.76±0.31 versus 2.25±0.38, p=0.0000). The percentage (%) increase in NUR values also well correlated with the % increase in thigh girth measurements (r=0.89, p=0.0000). These results indicated that 99m Tc-sestamibi muscle scintigraphy as a new tool may be useful in evaluating therapeutic response to NMES. (author)

  4. Three-dimensional analysis of tarsal bone response to axial loading in patients with hallux valgus and normal feet.

    Science.gov (United States)

    Watanabe, Kota; Ikeda, Yasutoshi; Suzuki, Daisuke; Teramoto, Atsushi; Kobayashi, Takuma; Suzuki, Tomoyuki; Yamashita, Toshihiko

    2017-02-01

    Patients with hallux valgus present a variety of symptoms that may be related to the type of deformity. Weightbearing affects the deformities, and the evaluation of the load response of tarsal bones has been mainly performed using two-dimensional plane radiography. The purpose of this study was to investigate and compare structural changes in the medial foot arch between patients with hallux valgus and normal controls using a computer image analysis technique and weightbearing computed tomography data. Eleven patients with hallux valgus and eleven normal controls were included. Computed tomograms were obtained with and without simulated weightbearing using a compression device. Computed tomography data were transferred into a personal computer, and a three-dimensional bone model was created using image analysis software. The load responses of each tarsal bone in the medial foot arch were measured three-dimensionally and statistically compared between the two groups. Displacement of each tarsal bone under two weightbearing conditions was visually observed by creating three-dimensional bone models. At the first metatarsophalangeal joint, the proximal phalanges of the hallux valgus group showed significantly different displacements in multiple directions. Moreover, opposite responses to axial loading were also observed in both translation and rotation between the two groups. Weightbearing caused deterioration of the hallux valgus deformity three-dimensionally at the first metatarsophalangeal joint. Information from the computer image analysis was useful for understanding details of the pathology of foot disorders related to the deformities or instability and may contribute to the development of effective conservative and surgical treatments. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Human chorionic gonadotropin, angiogenic factors, and preeclampsia risk: a nested case-control study.

    Science.gov (United States)

    Asvold, Bjørn O; Eskild, Anne; Vatten, Lars J

    2014-05-01

    To study whether human chorionic gonadotropin concentrations during pregnancy or combinations of human chorionic gonadotropin and other angiogenic factors, soluble fms-like tyrosine kinase 1 and placental growth factor (PlGF), are associated with preeclampsia risk. Nested case-control study. Population cohort of pregnant women. A total of 121 cases of preterm (cases of term preeclampsia (≥37 weeks of gestation) and 356 women without preeclampsia (controls). Women with preeclampsia were identified by linkage to the Medical Birth Registry of Norway. Concentrations of human chorionic gonadotropin, soluble fms-like tyrosine kinase 1 and PlGF were measured in maternal serum samples collected in each trimester of pregnancy. Odds ratios of preterm and term preeclampsia. High human chorionic gonadotropin concentrations (highest quartile) in the first trimester were associated with reduced risk for preterm preeclampsia (OR 0.3, 95% CI 0.1-0.9), compared with low human chorionic gonadotropin (lowest quartile), whereas high human chorionic gonadotropin concentrations in the second trimester were associated with increased risk for preterm preeclampsia (OR 4.0, 95% CI 1.8-8.9). High human chorionic gonadotropin concentrations in the third trimester were associated with increased risk for term preeclampsia (OR 4.8, 95% CI 1.8-13.3). Concentrations of human chorionic gonadotropin above the median value combined with PlGF below the median in the second trimester were associated with very high risk for preterm preeclampsia (OR 36.9, 95% CI 8.2-165.8). The results suggest an important role of human chorionic gonadotropin in the pathophysiological processes that lead to preeclampsia. The combined association of human chorionic gonadotropin and PlGF indicates a possible synergism between underlying biological pathways. © 2014 Nordic Federation of Societies of Obstetrics and Gynecology.

  6. A Journey through the Gonadotropin-Inhibitory Hormone System of Fish

    Directory of Open Access Journals (Sweden)

    José A. Muñoz-Cueto

    2017-10-01

    Full Text Available Gonadotropin-inhibitory hormone (GnIH is a hypothalamic neuropeptide that belongs to the RFamide peptide family and was first identified in the quail brain. From the discovery of avian GnIH, orthologous GnIH peptides have been reported in a variety of vertebrates, including mammals, amphibians, teleosts and agnathans, but also in protochordates. It has been clearly established that GnIH suppresses reproduction in avian and mammalian species through its inhibitory actions on brain GnRH and pituitary gonadotropins. In addition, GnIH also appears to be involved in the regulation of feeding, growth, stress response, heart function and social behavior. These actions are mediated via G protein-coupled GnIH receptors (GnIH-Rs, of which two different subtypes, GPR147 and GPR74, have been described to date. With around 30,000 species, fish represent more than one-half of the total number of recognized living vertebrate species. In addition to this impressive biological diversity, fish are relevant because they include model species with scientific and clinical interest as well as many exploited species with economic importance. In spite of this, the study of GnIH and its physiological effects on reproduction and other physiological processes has only been approached in a few fish species, and results obtained are in some cases conflicting. In this review, we summarize the information available in the literature on GnIH sequences identified in fish, the distribution of GnIH and GnIH-Rs in central and peripheral tissues, the physiological actions of GnIH on the reproductive brain-pituitary-gonadal axis, as well as other reported effects of this neuropeptide, and existing knowledge on the regulatory mechanisms of GnIH in fish.

  7. Revisiting the slow force response: the role of the PKG signaling pathway in the normal and the ischemic heart.

    Science.gov (United States)

    Castro-Ferreira, Ricardo; Neves, João Sérgio; Ladeiras-Lopes, Ricardo; Leite-Moreira, André M; Neiva-Sousa, Manuel; Almeida-Coelho, João; Ferreira-Martins, João; F Leite-Moreira, Adelino

    2014-09-01

    The myocardial response to acute stretch consists of a two-phase increase in contractility: an acute increase by the Frank-Starling mechanism and a gradual and time-dependent increase in force generated known as the slow force response (SFR). The SFR is actively modulated by different signaling pathways, but the role of protein kinase G (PKG) signaling is unknown. In this study we aim to characterize the role of the PKG signaling pathway in the SFR under normal and ischemic conditions. Rabbit papillary muscles were stretched from 92 to 100% of maximum length (Lmax) under basal conditions, in the absence (1) or presence of: a PKG agonist (2) and a PKG inhibitor (3); under ischemic conditions in the absence (4) or presence of: a PKG agonist (5); a nitric oxide (NO) donor (6) and a phosphodiesterase 5 (PDE5) inhibitor (7). Under normoxia, the SFR was significantly attenuated by inhibition of PKG and remained unaltered with PKG activation. Ischemia induced a progressive decrease in myocardial contractility after stretch. Neither the PKG agonist nor the NO donor altered the myocardial response to stretch under ischemic conditions. However, the use of a PDE5 inhibitor in ischemia partially reversed the progressive deterioration in contractility. PKG activity is essential for the SFR. During ischemia, a progressive decline in the force is observed in response to acute myocardial stretch. This dysfunctional response can be partially reversed by the use of PDE5 inhibitors. Copyright © 2013 Sociedade Portuguesa de Cardiologia. Published by Elsevier España. All rights reserved.

  8. Expression of an engineered heterologous antimicrobial peptide in potato alters plant development and mitigates normal abiotic and biotic responses.

    Directory of Open Access Journals (Sweden)

    Ravinder K Goyal

    Full Text Available Antimicrobial cationic peptides (AMPs are ubiquitous small proteins used by living cells to defend against a wide spectrum of pathogens. Their amphipathic property helps their interaction with negatively charged cellular membrane of the pathogen causing cell lysis and death. AMPs also modulate signaling pathway(s and cellular processes in animal models; however, little is known of cellular processes other than the pathogen-lysis phenomenon modulated by AMPs in plants. An engineered heterologous AMP, msrA3, expressed in potato was previously shown to cause resistance of the transgenic plants against selected fungal and bacterial pathogens. These lines together with the wild type were studied for growth habits, and for inducible defense responses during challenge with biotic (necrotroph Fusarium solani and abiotic stressors (dark-induced senescence, wounding and temperature stress. msrA3-expression not only conferred protection against F. solani but also delayed development of floral buds and prolonged vegetative phase. Analysis of select gene transcript profiles showed that the transgenic potato plants were suppressed in the hypersensitive (HR and reactive oxygen species (ROS responses to both biotic and abiotic stressors. Also, the transgenic leaves accumulated lesser amounts of the defense hormone jasmonic acid upon wounding with only a slight change in salicylic acid as compared to the wild type. Thus, normal host defense responses to the pathogen and abiotic stressors were mitigated by msrA3 expression suggesting MSRA3 regulates a common step(s of these response pathways. The stemming of the pathogen growth and mitigating stress response pathways likely contributes to resource reallocation for higher tuber yield.

  9. A Dose-Response Strategy Reveals Differences between Normal-Weight and Obese Men in Their Metabolic and Inflammatory Responses to a High-Fat Meal123

    Science.gov (United States)

    Schwander, Flurina; Kopf-Bolanz, Katrin A.; Buri, Caroline; Portmann, Reto; Egger, Lotti; Chollet, Magali; McTernan, Philip G.; Piya, Milan K.; Gijs, Martin A. M.; Vionnet, Nathalie; Pralong, François; Laederach, Kurt; Vergères, Guy

    2014-01-01

    A dose-response strategy may not only allow investigation of the impact of foods and nutrients on human health but may also reveal differences in the response of individuals to food ingestion based on their metabolic health status. In a randomized crossover study, we challenged 19 normal-weight (BMI: 20–25 kg/m2) and 18 obese (BMI: >30 kg/m2) men with 500, 1000, and 1500 kcal of a high-fat (HF) meal (60.5% energy from fat). Blood was taken at baseline and up to 6 h postprandially and analyzed for a range of metabolic, inflammatory, and hormonal variables, including plasma glucose, lipids, and C-reactive protein and serum insulin, glucagon-like peptide-1, interleukin-6 (IL-6), and endotoxin. Insulin was the only variable that could differentiate the postprandial response of normal-weight and obese participants at each of the 3 caloric doses. A significant response of the inflammatory marker IL-6 was only observed in the obese group after ingestion of the HF meal containing 1500 kcal [net incremental AUC (iAUC) = 22.9 ± 6.8 pg/mL × 6 h, P = 0.002]. Furthermore, the net iAUC for triglycerides significantly increased from the 1000 to the 1500 kcal meal in the obese group (5.0 ± 0.5 mmol/L × 6 h vs. 6.0 ± 0.5 mmol/L × 6 h; P = 0.015) but not in the normal-weight group (4.3 ± 0.5 mmol/L × 6 h vs. 4.8 ± 0.5 mmol/L × 6 h; P = 0.31). We propose that caloric dose-response studies may contribute to a better understanding of the metabolic impact of food on the human organism. This study was registered at clinicaltrials.gov as NCT01446068. PMID:24812072

  10. A dose-response strategy reveals differences between normal-weight and obese men in their metabolic and inflammatory responses to a high-fat meal.

    Science.gov (United States)

    Schwander, Flurina; Kopf-Bolanz, Katrin A; Buri, Caroline; Portmann, Reto; Egger, Lotti; Chollet, Magali; McTernan, Philip G; Piya, Milan K; Gijs, Martin A M; Vionnet, Nathalie; Pralong, François; Laederach, Kurt; Vergères, Guy

    2014-10-01

    A dose-response strategy may not only allow investigation of the impact of foods and nutrients on human health but may also reveal differences in the response of individuals to food ingestion based on their metabolic health status. In a randomized crossover study, we challenged 19 normal-weight (BMI: 20-25 kg/m(2)) and 18 obese (BMI: >30 kg/m(2)) men with 500, 1000, and 1500 kcal of a high-fat (HF) meal (60.5% energy from fat). Blood was taken at baseline and up to 6 h postprandially and analyzed for a range of metabolic, inflammatory, and hormonal variables, including plasma glucose, lipids, and C-reactive protein and serum insulin, glucagon-like peptide-1, interleukin-6 (IL-6), and endotoxin. Insulin was the only variable that could differentiate the postprandial response of normal-weight and obese participants at each of the 3 caloric doses. A significant response of the inflammatory marker IL-6 was only observed in the obese group after ingestion of the HF meal containing 1500 kcal [net incremental AUC (iAUC) = 22.9 ± 6.8 pg/mL × 6 h, P = 0.002]. Furthermore, the net iAUC for triglycerides significantly increased from the 1000 to the 1500 kcal meal in the obese group (5.0 ± 0.5 mmol/L × 6 h vs. 6.0 ± 0.5 mmol/L × 6 h; P = 0.015) but not in the normal-weight group (4.3 ± 0.5 mmol/L × 6 h vs. 4.8 ± 0.5 mmol/L × 6 h; P = 0.31). We propose that caloric dose-response studies may contribute to a better understanding of the metabolic impact of food on the human organism. This study was registered at clinicaltrials.gov as NCT01446068. © 2014 American Society for Nutrition.

  11. Numerical Study on Dynamic Response of a Horizontal Layered-Structure Rock Slope under a Normally Incident Sv Wave

    Directory of Open Access Journals (Sweden)

    Zhifa Zhan

    2017-07-01

    Full Text Available Several post-earthquake investigations have indicated that the slope structure plays a leading role in the stability of rock slopes under dynamic loads. In this paper, the dynamic response of a horizontal layered-structure rock slope under harmonic Sv wave is studied by making use of the Fast Lagrangian Analysis of Continua method (FLAC. The suitability of FLAC for studying wave transmission across rock joints is validated through comparison with analytical solutions. After parametric studies on Sv wave transmission across the horizontal layered-structure rock slope, it is found that the acceleration amplification coefficient η, which is defined as the ratio of the acceleration at the monitoring point to the value at the toe, wavily increases with an increase of the height along the slope surface. Meanwhile, the fluctuation weakens with normalized joint stiffness K increasing and enhances with normalized joint spacing ξ increasing. The acceleration amplification coefficient of the slope crest ηcrest does not monotonously increase with the increase of ξ, but decreases with the increase of K. Additionally, ηcrest is more sensitive to ξ compared to K. From the contour figures, it can also be found that the contour figures of η take on rhythm, and the effects of ξ on the acceleration amplification coefficient are more obvious compared to the effects on K.

  12. Fertility Rates of Ewes Treated with Medroxyprogesterone and Injected with Equine Chorionic Gonadotropin plus Human Chorionic Gonadotropin in Anoestrous Season

    Directory of Open Access Journals (Sweden)

    I. W. Santos

    2010-01-01

    Full Text Available The aim of the present paper was to investigate the efficiency of the equine chorionic gonadotropin (eCG plus human chorionic gonadotropin (hCG associated with medroxyprogesterone acetate (MAP to estrous ewes synchronization. Ninety Texel ewes were investigated during seasonal anoestrous. The ewes received intravaginal sponges containing MAP (60 mg for nine days. At the time of sponges' withdrawal, the ewes were divided into three groups (G: (1 receiving 2 mL of saline i.m. (n=30, (2 receiving eCG 400 IU i.m. (n=30, and (3 receiving eCG 400 IU plus hCG 200 IU i.m. (n=30. Twelve h after sponges' removal, teaser rams were used to estrus check and remained with the ewes for 96 h. The artificial insemination was made with fresh semen 10 h after estrus detection. The effect of the treatment was not significant for the estrous rates among the groups: 73%, 90%, and 86%, respectively. The main effect was observed in the pregnancy and lambing rates among the groups: 70%, 86%, 56%, and 80%, 120%, 56%, respectively. Based on these results from our study, the use of the MAP—eCG is the best choice to improve the fertility rate on ewes.

  13. Development of New Gonadotropin-Releasing Hormone-Modified Dendrimer Platforms with Direct Antiproliferative and Gonadotropin Releasing Activity.

    Science.gov (United States)

    Varamini, Pegah; Rafiee, Amirreza; Giddam, Ashwini Kumar; Mansfeld, Friederike M; Steyn, Frederik; Toth, Istvan

    2017-10-26

    Gonadotropin-releasing hormone (GnRH) agonists (e.g., triptorelin) are used for androgen suppression therapy. They possess improved stability as compared to the natural GnRH, yet they suffer from a poor pharmacokinetic profile. To address this, we used a GnRH peptide-modified dendrimer platform with and without lipidation strategy. Dendrimers were synthesized on a polylysine core and bore either native GnRH (1, 2, and 5) or lipid-modified GnRH (3 and 4). Compound 3, which bore a lipidic moiety in a branched tetramer structure, showed approximately 10-fold higher permeability and metabolic stability and 39 times higher antitumor activity against hormone-resistant prostate cancer cells (DU145) relative to triptorelin. In gonadotropin-release experiments, dendrimer 3 was shown to be the most potent construct. Dendrimer 3 showed similar luteinizing hormone (LH)-release activity to triptorelin in mice. Our findings indicate that dendrimer 3 is a promising analog with higher potency for the treatment of hormone-resistant prostate cancer than the currently available GnRH agonists.

  14. Changes in phosphatidylcholine fatty acid composition are associated with altered skeletal muscle insulin responsiveness in normal man.

    Science.gov (United States)

    Clore, J N; Harris, P A; Li, J; Azzam, A; Gill, R; Zuelzer, W; Rizzo, W B; Blackard, W G

    2000-02-01

    The fatty acid composition of skeletal muscle cell membrane phospholipids (PLs) is known to influence insulin responsiveness in man. We have recently shown that the fatty acid composition of phosphatidylcholine (PC), and not phosphatidylethanolamine (PE), from skeletal muscle membranes is of particular importance in this relationship. Efforts to alter the PL fatty acid composition in animal models have demonstrated induction of insulin resistance. However, it has been more difficult to determine if changes in insulin sensitivity are associated with changes in the skeletal muscle membrane fatty acid composition of PL in man. Using nicotinic acid (NA), an agent known to induce insulin resistance in man, 9 normal subjects were studied before and after treatment for 1 month. Skeletal muscle membrane fatty acid composition of PC and PE from biopsies of vastus lateralis was correlated with insulin responsiveness using a 3-step hyperinsulinemic-euglycemic clamp. Treatment with NA was associated with a 25% increase in the half-maximal insulin concentration ([ED50] 52.0 +/- 7.5 to 64.6 +/- 9.0 microU/mL, P insulin sensitivity. Significant changes in the fatty acid composition of PC, but not PE, were also observed after NA administration. An increase in the percentage of 16:0 (21% +/- 0.3% to 21.7% +/- 0.4%, P insulin resistance with NA is associated with changes in the fatty acid composition of PC in man.

  15. Gonadotropin-Releasing Hormone Regulates Expression of the DNA Damage Repair Gene, Fanconi anemia A, in Pituitary Gonadotroph Cells1

    Science.gov (United States)

    Larder, Rachel; Chang, Lynda; Clinton, Michael; Brown, Pamela

    2007-01-01

    Gonadal function is critically dependant on regulated secretion of the gonadotropin hormones from anterior pituitary gonadotroph cells. Gonadotropin biosynthesis and release is triggered by the binding of hypothalamic GnRH to GnRH receptor expressed on the gonadotroph cell surface. The repertoire of regulatory molecules involved in this process are still being defined. We used the mouse LβT2 gonadotroph cell line, which expresses both gonadotropin hormones, as a model to investigate GnRH regulation of gene expression and differential display reverse transcription-polymerase chain reaction (RT-PCR) to identify and isolate hormonally induced changes. This approach identified Fanconi anemia a (Fanca), a gene implicated in DNA damage repair, as a differentially expressed transcript. Mutations in Fanca account for the majority of cases of Fanconi anemia (FA), a recessively inherited disease identified by congenital defects, bone marrow failure, infertility, and cancer susceptibility. We confirmed expression and hormonal regulation of Fanca mRNA by quantitative RT-PCR, which showed that GnRH induced a rapid, transient increase in Fanca mRNA. Fanca protein was also acutely upregulated after GnRH treatment of LβT2 cells. In addition, Fanca gene expression was confined to mature pituitary gonadotrophs and adult mouse pituitary and was not expressed in the immature αT3-1 gonadotroph cell line. Thus, this study extends the expression profile of Fanca into a highly specialized endocrine cell and demonstrates hormonal regulation of expression of the Fanca locus. We suggest that this regulatory mechanism may have a crucial role in the GnRH-response mechanism of mature gonadotrophs and perhaps the etiology of FA. PMID:15128600

  16. Gonadotropin-releasing hormone regulates expression of the DNA damage repair gene, Fanconi anemia A, in pituitary gonadotroph cells.

    Science.gov (United States)

    Larder, Rachel; Chang, Lynda; Clinton, Michael; Brown, Pamela

    2004-09-01

    Gonadal function is critically dependant on regulated secretion of the gonadotropin hormones from anterior pituitary gonadotroph cells. Gonadotropin biosynthesis and release is triggered by the binding of hypothalamic GnRH to GnRH receptor expressed on the gonadotroph cell surface. The repertoire of regulatory molecules involved in this process are still being defined. We used the mouse L beta T2 gonadotroph cell line, which expresses both gonadotropin hormones, as a model to investigate GnRH regulation of gene expression and differential display reverse transcription-polymerase chain reaction (RT-PCR) to identify and isolate hormonally induced changes. This approach identified Fanconi anemia a (Fanca), a gene implicated in DNA damage repair, as a differentially expressed transcript. Mutations in Fanca account for the majority of cases of Fanconi anemia (FA), a recessively inherited disease identified by congenital defects, bone marrow failure, infertility, and cancer susceptibility. We confirmed expression and hormonal regulation of Fanca mRNA by quantitative RT-PCR, which showed that GnRH induced a rapid, transient increase in Fanca mRNA. Fanca protein was also acutely upregulated after GnRH treatment of L beta T2 cells. In addition, Fanca gene expression was confined to mature pituitary gonadotrophs and adult mouse pituitary and was not expressed in the immature alpha T3-1 gonadotroph cell line. Thus, this study extends the expression profile of Fanca into a highly specialized endocrine cell and demonstrates hormonal regulation of expression of the Fanca locus. We suggest that this regulatory mechanism may have a crucial role in the GnRH-response mechanism of mature gonadotrophs and perhaps the etiology of FA.

  17. Development of a radioreceptor assay for human chorion gonadotropin: Application in normal and pathological pregnancies

    International Nuclear Information System (INIS)

    Koch, R.

    1978-01-01

    Rats testes were homogenised, and the binding capacity of several dilutions of these were tested with iodine 125 -labelled human choriongonadotropin. Investigations about binding over a period of 36 hrs. with 3 different temperatures, inhibition tests and cross reaction analyses for determining the specificity were carried out. 2 assay systems could be developed. The highly sensitive assay was applied at early pregnancy, at suspected disturbed or ectopic gravidity and allowed to measure the hCG-serum concentration above the physiological basal secretion of hLH. The less sensitive assay was used for measuring hCG in later stages of pregnancy, chorionepitheliomas and other hCG producing tumours. With the highly sensitive and specific assay, hCG was determinable 8 to 10 days post conceptionem. (orig.) [de

  18. Prolactin-sensitive neurons express estrogen receptor-α and depend on sex hormones for normal responsiveness to prolactin.

    Science.gov (United States)

    Furigo, Isadora C; Kim, Ki Woo; Nagaishi, Vanessa S; Ramos-Lobo, Angela M; de Alencar, Amanda; Pedroso, João A B; Metzger, Martin; Donato, Jose

    2014-05-30

    Estrogens and prolactin share important target tissues, including the gonads, brain, liver, kidneys and some types of cancer cells. Herein, we sought anatomical and functional evidence of possible crosstalk between prolactin and estrogens in the mouse brain. First, we determined the distribution of prolactin-responsive neurons that express the estrogen receptor α (ERα). A large number of prolactin-induced pSTAT5-immunoreactive neurons expressing ERα mRNA were observed in several brain areas, including the anteroventral periventricular nucleus, medial preoptic nucleus, arcuate nucleus of the hypothalamus, ventrolateral subdivision of the ventromedial nucleus of the hypothalamus (VMH), medial nucleus of the amygdala and nucleus of the solitary tract. However, although the medial preoptic area, periventricular nucleus of the hypothalamus, paraventricular nucleus of the hypothalamus, retrochiasmatic area, dorsomedial subdivision of the VMH, lateral hypothalamic area, dorsomedial nucleus of the hypothalamus and ventral premammillary nucleus contained significant numbers of prolactin-responsive neurons, these areas showed very few pSTAT5-immunoreactive cells expressing ERα mRNA. Second, we evaluated prolactin sensitivity in ovariectomized mice and observed that sex hormones are required for a normal responsiveness to prolactin as ovariectomized mice showed a lower number of prolactin-induced pSTAT5 immunoreactive neurons in all analyzed brain nuclei compared to gonad-intact females. In addition, we performed hypothalamic gene expression analyses to determine possible post-ovariectomy changes in components of prolactin signaling. We observed no significant changes in the mRNA expression of prolactin receptor, STAT5a or STAT5b. In summary, sex hormones exert a permissive role in maintaining the brain's prolactin sensitivity, most likely through post-transcriptional mechanisms. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. The quest for predicting sustained shunt response in normal pressure hydrocephalus: an analysis of the callosal angle's utility.

    Science.gov (United States)

    Grahnke, Kurt; Jusue-Torres, Ignacio; Szujewski, Caroline; Joyce, Cara; Schneck, Michael; Prabhu, Vikram; Anderson, Douglas

    2018-04-30

    Diagnosing normal pressure hydrocephalus (NPH) and selecting patients who will experience a sustained benefit from fluid diversion surgery remains challenging. This study seeks to evaluate the association between the callosal angle (CA) and the long-term post-operative response to ventriculoperitoneal shunt (VPS) surgery in a different subgroup population than previously studied to assess its generalizability. We studied 73 patients with idiopathic NPH who underwent VPS surgery and had at least 18 months of follow-up between 2000-2016. We recorded their pre and postoperative symptoms according to the NPH Eide scale and their comorbidities with the Kiefer index. Their CA, as well as Evan's Index, ventricular height, and transependymal signal were measured. Multivariable statistical models were used to determine which factors were associated with postoperative improvement, while controlling for the presence of the NPH triad. Fifty-nine patients (82%) demonstrated a successful response to surgery at their first postoperative follow-up. However, this declined to 54 patients (75%) at one year and 45 (62.5%) patients at their last follow-up. When controlling for the presence of the triad of symptoms, the CA significantly predicted a good, sustained response to surgery; for every degree decrease in the CA, a patient is 4% more likely to experience benefit from surgery. The CA is a useful preoperative prognostic tool for predicting which patients will experience a sustained benefit from surgery. Further studies are required to clarify this disease in the context of old age, comorbidity, and possible concomitant neurodegenerative diseases. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Gonadotropin suppression in men leads to a reduction in claudin-11 at the Sertoli cell tight junction.

    Science.gov (United States)

    McCabe, M J; Tarulli, G A; Laven-Law, G; Matthiesson, K L; Meachem, S J; McLachlan, R I; Dinger, M E; Stanton, P G

    2016-04-01

    /post-meiotic germ cell suppression; claudin-11 staining was (i) punctate (i.e. 'spotty' appearance) at the basal aspect of tubules when the average numbers of adluminal germ cells were 40% of control. Changes in localization of connexin-43 and vinculin were also observed (smaller effects than for claudin-11) but ZO-1, β-catenin and β-actin did not differ, compared with control. Claudin-11 was the only Sertoli cell TJ protein investigated, but it is considered to be the most pivotal of constituent proteins given its known implication in infertility and BTB function. We were limited to testis samples which had been gonadotropin-suppressed for 8 weeks, shorter than the 74-day spermatogenic wave, which may account for the heterogeneity in claudin-11 and germ cell response observed among the men. Longer suppression (12-24 weeks) is known to suppress germ cells further and claudin-11 disruption may be more uniform, although we could not access such samples. These findings are important for our understanding of the sites of action of male hormonal contraception, because they suggest that BTB function could be ablated following long-term hormone suppression treatment. National Health and Medical Research Council (Australia) Program Grants 241000 and 494802; Research Fellowship 1022327 (to R.I.M.) and the Victorian Government's Operational Infrastructure Support Program. None of the authors have any conflicts to disclose. Not applicable. © The Author 2016. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Mathematical modeling of gonadotropin-releasing hormone signaling.

    Science.gov (United States)

    Pratap, Amitesh; Garner, Kathryn L; Voliotis, Margaritis; Tsaneva-Atanasova, Krasimira; McArdle, Craig A

    2017-07-05

    Gonadotropin-releasing hormone (GnRH) acts via G-protein coupled receptors on pituitary gonadotropes to control reproduction. These are G q -coupled receptors that mediate acute effects of GnRH on the exocytotic secretion of luteinizing hormone (LH) and follicle-stimulating hormone (FSH), as well as the chronic regulation of their synthesis. GnRH is secreted in short pulses and GnRH effects on its target cells are dependent upon the dynamics of these pulses. Here we overview GnRH receptors and their signaling network, placing emphasis on pulsatile signaling, and how mechanistic mathematical models and an information theoretic approach have helped further this field. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Human Chorionic Gonadotropin: The Pregnancy Hormone and More

    Directory of Open Access Journals (Sweden)

    Charalampos Theofanakis

    2017-05-01

    Full Text Available To thoroughly review the uses of human chorionic gonadotropin (hCG related to the process of reproduction and also assess new, non-traditional theories. Review of the international literature and research studies. hCG and its receptor, LH/CGR, are expressed in numerous sites of the reproductive tract, both in gonadal and extra-goanadal tissues, promoting oocyte maturation, fertilization, implantation and early embryo development. Moreover, hCG seems to have a potential role as an anti-rejection agent in solid organ transplantation. Future research needs to focus extensively on the functions of hCG and its receptor LH/CGR, in an effort to reveal known, as well as unknown clinical potentials.

  3. Regulation of gonadotropin-releasing hormone neurons by glucose

    Science.gov (United States)

    Roland, Alison V.; Moenter, Suzanne M.

    2011-01-01

    Reproduction is influenced by energy balance, but the physiological pathways mediating their relationship have not been fully elucidated. As the central regulators of fertility, gonadotropin-releasing hormone (GnRH) neurons integrate numerous physiological signals, including metabolic cues. Circulating glucose levels regulate GnRH release and may in part mediate the effects of negative energy balance on fertility. Existing evidence suggests that neural pathways originating in the hindbrain, as well as in the hypothalamic feeding nuclei, transmit information concerning glucose availability to GnRH neurons. Here we review recent evidence suggesting that GnRH neurons may directly sense changes in glucose availability by a mechanism involving adenosine monophosphate-activated protein kinase (AMPK). These findings expand our understanding of how metabolic signaling in the brain regulates reproduction. PMID:21855365

  4. Localization of gonadotropin binding sites in human ovarian neoplasms

    International Nuclear Information System (INIS)

    Nakano, R.; Kitayama, S.; Yamoto, M.; Shima, K.; Ooshima, A.

    1989-01-01

    The binding of human luteinizing hormone and human follicle-stimulating hormone to ovarian tumor biopsy specimens from 29 patients was analyzed. The binding sites for human luteinizing hormone were demonstrated in one tumor of epithelial origin (mucinous cystadenoma) and in one of sex cord-stromal origin (theca cell tumor). The binding sites for human follicle-stimulating hormone were found in three tumors of epithelial origin (serous cystadenoma and mucinous cystadenoma) and in two of sex cord-stromal origin (theca cell tumor and theca-granulosa cell tumor). The surface-binding autoradiographic study revealed that the binding sites for gonadotropins were localized in the stromal tissue. The results suggest that gonadotropic hormones may play a role in the growth and differentiation of a certain type of human ovarian neoplasms

  5. The dynamics of connexin expression, degradation and localisation are regulated by gonadotropins during the early stages of in vitro maturation of swine oocytes.

    Directory of Open Access Journals (Sweden)

    Nicolas Santiquet

    Full Text Available Gap junctional communication (GJC plays a primordial role in oocyte maturation and meiotic resumption in mammals by directing the transfer of numerous molecules between cumulus cells and the oocyte. Gap junctions are made of connexins (Cx, proteins that regulate GJC in numerous ways. Understanding the dynamic regulation of connexin arrangements during in vitro maturation (IVM could provide a powerful tool for controlling meiotic resumption and consequently in vitro development of fully competent oocytes. However, physiological events happening during the early hours of IVM may still be elucidated. The present study reports the dynamic regulation of connexin expression, degradation and localization during this stage. Cx43, Cx45 and Cx60 were identified as the main connexins expressed in swine COC. Cx43 and Cx45 transcripts were judged too static to be a regulator of GJC, while Cx43 protein expression was highly responsive to gonadotropins, suggesting that it might be the principal regulator of GJC. In addition, the degradation of Cx43 expressed after 4.5 h of IVM in response to equine chorionic gonadotropin appeared to involve the proteasomal complex. Cx43 localisation appeared to be associated with GJC. Taken together, these results show for the first time that gonadotropins regulate Cx43 protein expression, degradation and localisation in porcine COC during the first several hours of IVM. Regulation of Cx43 may in turn, via GJC, participate in the development of fully competent oocytes.

  6. Implementing a finite-state off-normal and fault response system for disruption avoidance in tokamaks

    Science.gov (United States)

    Eidietis, N. W.; Choi, W.; Hahn, S. H.; Humphreys, D. A.; Sammuli, B. S.; Walker, M. L.

    2018-05-01

    A finite-state off-normal and fault response (ONFR) system is presented that provides the supervisory logic for comprehensive disruption avoidance and machine protection in tokamaks. Robust event handling is critical for ITER and future large tokamaks, where plasma parameters will necessarily approach stability limits and many systems will operate near their engineering limits. Events can be classified as off-normal plasmas events, e.g. neoclassical tearing modes or vertical displacements events, or faults, e.g. coil power supply failures. The ONFR system presented provides four critical features of a robust event handling system: sequential responses to cascading events, event recovery, simultaneous handling of multiple events and actuator prioritization. The finite-state logic is implemented in Matlab®/Stateflow® to allow rapid development and testing in an easily understood graphical format before automated export to the real-time plasma control system code. Experimental demonstrations of the ONFR algorithm on the DIII-D and KSTAR tokamaks are presented. In the most complex demonstration, the ONFR algorithm asynchronously applies ‘catch and subdue’ electron cyclotron current drive (ECCD) injection scheme to suppress a virulent 2/1 neoclassical tearing mode, subsequently shuts down ECCD for machine protection when the plasma becomes over-dense, and enables rotating 3D field entrainment of the ensuing locked mode to allow a safe rampdown, all in the same discharge without user intervention. When multiple ONFR states are active simultaneously and requesting the same actuator (e.g. neutral beam injection or gyrotrons), actuator prioritization is accomplished by sorting the pre-assigned priority values of each active ONFR state and giving complete control of the actuator to the state with highest priority. This early experience makes evident that additional research is required to develop an improved actuator sharing protocol, as well as a methodology to

  7. Attenuation of the pressor response to exogenous angiotensin by angiotensin receptor blockers and benazepril hydrochloride in clinically normal cats.

    Science.gov (United States)

    Jenkins, Tiffany L; Coleman, Amanda E; Schmiedt, Chad W; Brown, Scott A

    2015-09-01

    To compare the attenuation of the angiotensin I-induced blood pressure response by once-daily oral administration of various doses of angiotensin receptor blockers (irbesartan, telmisartan, and losartan), benazepril hydrochloride, or lactose monohydrate (placebo) for 8 days in clinically normal cats. 6 healthy cats (approx 17 months old) with surgically implanted arterial telemetric blood pressure-measuring catheters. Cats were administered orally the placebo or each of the drug treatments (benazepril [2.5 mg/cat], irbesartan [6 and 10 mg/kg], telmisartan [0.5, 1, and 3 mg/kg], and losartan [2.5 mg/kg]) once daily for 8 days in a crossover study. Approximately 90 minutes after capsule administration on day 8, each cat was anesthetized and arterial blood pressure measurements were recorded before and after IV administration of each of 4 boluses of angiotensin I (20, 100, 500, and 1,000 ng/kg). This protocol was repeated 24 hours after benazepril treatment and telmisartan (3 mg/kg) treatment. Differences in the angiotensin I-induced change in systolic arterial blood pressure (ΔSBP) among treatments were determined. At 90 minutes after capsule administration, only losartan did not significantly reduce ΔSBP in response to the 3 higher angiotensin doses, compared with placebo. Among drug treatments, telmisartan (3 mg/kg dosage) attenuated ΔSBP to a significantly greater degree than benazepril and all other treatments. At 24 hours, telmisartan was more effective than benazepril (mean ± SEM ΔSBP, 15.7 ± 1.9 mm Hg vs 55.9 ± 12.42 mm Hg, respectively). Results indicated that telmisartan administration may have advantages over benazepril administration for cats with renal or cardiovascular disease.

  8. Ventromedial hypothalamic expression of Bdnf is required to establish normal patterns of afferent GABAergic connectivity and responses to hypoglycemia

    Directory of Open Access Journals (Sweden)

    Anna Kamitakahara

    2016-02-01

    Full Text Available Objective: The ventromedial nucleus of the hypothalamus (VMH controls energy and glucose homeostasis through direct connections to a distributed network of nuclei in the hypothalamus, midbrain, and hindbrain. Structural changes in VMH circuit morphology have the potential to alter VMH function throughout life, however, molecular signals responsible for specifying its neural connections are not fully defined. The VMH contains a high density of neurons that express brain-derived neurotrophic factor (BDNF, a potent neurodevelopmental effector known to regulate neuronal survival, growth, differentiation, and connectivity in a number of neural systems. In the current study, we examined whether BDNF impacts the afferent and efferent connections of the VMH, as well as energy homeostatic function. Methods: To determine if BDNF is required for VMH circuit formation, a transgenic mouse model was used to conditionally delete Bdnf from steroidogenic factor 1 (SF1 expressing neurons of the VMH prior to the onset of establishing neural connections with other regions. Projections of SF1 expressing neurons were visualized with a genetically targeted fluorescent label and immunofluorescence was used to measure the density of afferents to SF1 neurons in the absence of BDNF. Physiological changes in body weight and circulating blood glucose were also evaluated in the mutant mice. Results: Our findings suggest that BDNF is required to establish normal densities of GABAergic afferents onto SF1 neurons located in the ventrolateral part of the VMH. Furthermore, loss of BDNF from VMH SF1 neurons results in impaired physiological responses to insulin-induced hypoglycemia. Conclusion: The results of this study indicate that BDNF is required for formation and/or maintenance of inhibitory inputs to SF1 neurons, with enduring effects on glycemic control. Author Video: Author Video Watch what authors say about their articles Keywords: Ventromedial nucleus of the hypothalamus

  9. The effect of palm oil, lard, and puff-pastry margarine on postprandial lipid and hormone responses in normal-weight and obese young women.

    Science.gov (United States)

    Jensen, J; Bysted, A; Dawids, S; Hermansen, K; Hølmer, G

    1999-12-01

    Only a few studies have been published on the postprandial effects of different fatty acids in obese subjects. Therefore, the present study investigated the effects of three test meals containing palm oil (PO), lard (LD), or puff-pastry margarine (PPM), all normal dietary ingredients, on postprandial lipid and hormone responses in normal-weight and obese young women. The study was performed as a randomized, crossover design. The fats differed in the content of palmitic acid, stearic acid, and trans monounsaturated fatty acids allowing a dietary comparison of different 'solid' fatty acids. The obese women had significantly higher fasting concentrations and postprandial responses of plasma total triacylglycerol (TAG), chylomicron-TAG, and insulin compared with the normal-weight women but there was no significant difference in the postprandial responses between the three test meals. The obese women had fasting concentrations of leptin four times greater than the normal-weight women. There were no postprandial changes in the concentrations of leptin. The fasting concentrations of HDL-cholesterol were significantly lower in the obese women than in the normal-weight women, whereas there was no significant difference between the two groups in the concentrations of total cholesterol or LDL-cholesterol. These results provide evidence that obese women have exaggerated lipid and hormone responses compared with normal-weight women but the different contents of saturated and trans monounsaturated fatty acids provided by PO, LD, and PPM have no effect in either group.

  10. Pentobarbital anesthesia and the response of tumor and normal tissue in the C3Hf/SED mouse to radiation

    International Nuclear Information System (INIS)

    Suit, H.D.; Sedlacek, R.S.; Silver, G.; Dosoretz, D.

    1985-01-01

    Experiments have been performed to assess the effect of sodium pentobarbital (NaPb) on the response of MCaIV, FSaII, and SCCVII using TCD50 and acute reaction of normal skin as end points. The TCD50 was lower or unchanged in the anesthetized than in the conscious mouse. There was no effect of NaPb on the acute reaction of skin. The ERs for NaPb on the TCD50 (ν = 1) for air breathing condition was essentially 1.0 for all three tumors. For the FSaII and SCCVII pentobarbital enhancement ratios were 1.29 and 1.34 for O/sub 2/3ATA conditions. For two dose (ν=2) irradiations ERs for the O/sub 2/3ATA were 1.46, 1.72 and 2.21 for MCaIV, FSaII and SCCVII respectively. For ν = 15, temperature 35 0 C ERs for O/sub 2/3ATA were 1.08 and 1.09 for MCaIV and FSaII but 1.22 for SCCVII

  11. Gonadotropins, their receptors, and the regulation of testicular functions in fish

    NARCIS (Netherlands)

    Schulz, Rüdiger W; Vischer, H F; Cavaco, J E; Dos Santos Rocha, M.E.; Tyler, R.C.; Goos, H.J.; Bogerd, J.

    The pituitary gonadotropins luteinizing hormone (LH) and follicle-stimulating hormone (FSH) regulate steroidogenesis and spermatogenesis by activating receptors expressed by Leydig cells (LH receptor) and Sertoli cells (FSH receptor), respectively. This concept is also valid in fish, although the

  12. Effect of human chorionic gonadotropin (hCG) on in vitro oocyte ...

    African Journals Online (AJOL)

    use

    2011-11-23

    Nov 23, 2011 ... In vitro exposure of Barilius vagra ovarian follicles to human chorionic gonadotropin (hCG) .... breakdown (GVBD) by treating them with egg clearing solution ..... trihydroxy-5Я-pregnen-20-one, in female plaice (Pleuronectes.

  13. GONAD REMATURATION ON Pangasionodon hypophthalmus FEMALE THROUGH INJECTION OF PREGNANT MARE SERUM GONADOTROPIN AND HUMAN CHORIONIC GONADOTROPIN

    Directory of Open Access Journals (Sweden)

    Evi Tahapari

    2014-06-01

    Full Text Available The success of spawning is influenced by internal and external factors. One of the factors that affect the var iabi li ty of Pangasianodon hypophthalmus female reproductive is the change of seasons that cause disrupted continuity of the seed availability, especially in the dry season. In the present study, combination of PMSG (pregnant mare serum gonadotropin + HCG (hormone chorionic gonadotropin hormone injections was done to induce gonad development. The treatments in this study were without hormone injections as control (A, injection of PMSG 10 IU/kg + HCG 10 IU/kg (B, and injection of PMSG 20 IU/kg HCG + 10 IU/kg (C. Injections were conducted at intervals of two weeks as many as six times. The results showed that gonad maturation generally occurs 2-4 weeks after estradiol-17 peak. PMSG + HCG hormone injections gave a significant effect on increasing the quantity and quality of eggs production. The fecundity in the A, B, C treatments, were 233,700±220,676; 300,305±24,581 and 488,433±142,228; respectively. Number of larvae produced from the A, B, C treatments, were 156,979±170,838; 229,997±18,081 and 362,713±101,850; respectively. Combination of PMSG 20 IU/kg + HCG 10 IU/kg hormone injection gave the best result on fecundity and the number of larvae production.

  14. Obesity, serum steroid levels, and pulsatile gonadotropin secretion in polycystic ovarian disease.

    Science.gov (United States)

    Laatikainen, T; Tulenheimo, A; Andersson, B; Kärkkäinen, J

    1983-04-01

    Serum binding capacity of sex-hormone binding globulin (SHBG-BC), steroid concentrations, and secretion patterns of LH and FSH were compared between groups of seven nonobese and seven obese patients with polycystic ovarian disease (PCOD). Obese patients with PCOD differed from those with normal weight in having very low SHBG-BC and elevated serum levels of free and albumin bound testosterone. Compared to healthy women in the follicular phase, both nonobese and obese patients with PCOD showed equally elevated serum levels of androstenedione, estrone, and albumin-bound and free estradiol. Pattern of gonadotropin secretion was studied from blood samples taken at 15 min intervals for 6 h. In 6 patients of both groups low pulses of FSH were found coincidently with pulses of LH. Serum level of LH showed a clear pulsatile pattern in all patients with PCOD, varying from 4.5 to 7.5 pulses per 6 h. The mean pulse rate in the groups of nonobese and obese patients with PCOD was similar, 5.9 pulses per 6 h. In the obese patients the mean LH levels were, however, less elevated and the pulse amplitudes were smaller than those in the nonobese patients. We suggest that this difference is due to high levels of biologically active testosterone in obese patients with PCOD.

  15. Use of a radioreceptorassay of human chorionic gonadotropin for the diagnosis and management of ectopic pregnancy

    International Nuclear Information System (INIS)

    Saxena, B.B.; Landesman, R.

    1975-01-01

    The radioreceptorassay of human chorionic gonadotropin (hCG), with a sensitivity of 50 pg or 3 mIU/ml of plasma, has provided almost 100 percent reliability in detecting pregnancy after the first missed cycle. This test may be performed within 1 hour and is ideally suited to the clinical detection of ectopic pregnancy, especially in patients who require immediate surgical intervention. Thirteen patients with suspected ectopic pregnancy were evaluated by the radioreceptorassay, one of whom was followed with four separate determinations. The results of the assay were subsequently compared with those of hemagglutination pregnancy tests, clinical symptoms, and pathologic findings. All of the patients were diagnosed accurately by the radioreceptorassay, even when hemagglutination tests yielded a false indication of pregnancy. By this assay, the hCG levels during ectopic pregnancies are generally lower than those found during a normal intrauterine pregnancy; in addition, pregnancy may be detected much earlier (prior to the rupture) than is possible by hemagglutination tests. Furthermore, the diagnosis of ectopic pregnancy may be excluded for patients admitted to the hospital with acute abdominal emergencies

  16. Human chorionic gonadotropin (HCG) and alphafeto protein (AFP) in sudanese pregnant women using immunoradiometric assay

    International Nuclear Information System (INIS)

    Abdalla, O. M.; Khalid, M. M.; Hassan, A.; Ali, N. I.; Khalid, A. SH.; Abdelhadi, H. A.; Khair, L. A. M.; Almahi, W. A.; Gaafar, A.; Abdalla, H.; Basheer, H.

    2004-12-01

    In this study 672 pregnant Sudanese women were involved in order to determine the reference values of human chorionic gonadotropin (HCG) and alpha feto protein (AFP). Blood samples were collected from different maternity centers in Khartoum and Omdurman maternity. Sensitive immunoradiometric assay (IRMA), method was used for measuring HCG and AFP in maternal serum. The data collected reveals that, the behavior of both AFP and HCG resemble that of the international one, where the peak concentrations of HCG are reached at 7-9 weeks of pregnancy then decrease, then staying relatively constant during the second trimester and increasing slightly towards term. The maternal serum concentration of AFP increases during pregnancy, reaching its peak during the last trimester. The concentration of AFP and HCG in maternal serum with relative couples was also compared to that of ir relative couples. Relative couples showed significant increase in maternal AFP level in the first and third trimesters (p=0.001and 0.000) respectively. The HCG concentration in both groups was not significantly different throughout the pregnancy (p>0.15). It is recommended that each laboratory establishes its own normal values. Since sudanese obstetrician depends previously on values from abroad, this study may help them to handle their patients depending on our own reference values.(Author)

  17. Human chorionic gonadotropin (HCG) and alphafeto protein (AFP) in Sudanese pregnant women using immunoradiometric assay

    International Nuclear Information System (INIS)

    Abdalla, O. M.; Khalid, M. M.; Hassan, A.; Ali, N. I.; Khalid, A. SH.; Abdelhadi, H. A.; Khair, L. A. M.; Almahi, W. A.; Gaafar, A.; Abdalla, H.; Basheer, H.

    2004-01-01

    In this study 672 pregnant Sudanese women were involved in order to determine the reference values of Human Chorionic Gonadotropin (HCG) and alpha feto protein (AFP). Blood samples were collected from different maternity centers in Khartoum and Omdurman maternity. Sensitive immunoradiometric assay (IRMA), method was used for measuring HCG and AFP in maternal serum. The data collected reveals that, the behavior of both AFP and HCG resemble that of the international one, where the peak concentrations of HCG are reached at 7-9 weeks of pregnancy then decrease, then staying relatively constant during the second trimester and increasing slightly towards term. The maternal serum concentration of AFP increases during pregnancy, reaching its peak during the last trimester. The concentration of AFP and HCG in maternal serum with relative couples was also compared to that of ir relative couples. Relative couples showed significant increase in maternal AFP level in the first and third trimesters (p= 0.001and 0.000) respectively. The HCG concentration in both groups was not significantly different throughout the pregnancy (p> 0.15). It is recommended that each laboratory establishes its own normal values. Since Sudanese obstetrician depends previously on values from abroad, this study may help them to handle their patients depending on our own reference values. (Authors)

  18. Practice guideline: Idiopathic normal pressure hydrocephalus: Response to shunting and predictors of response: Report of the Guideline Development, Dissemination, and Implementation Subcommittee of the American Academy of Neurology.

    Science.gov (United States)

    Halperin, John J; Kurlan, Roger; Schwalb, Jason M; Cusimano, Michael D; Gronseth, Gary; Gloss, David

    2015-12-08

    We evaluated evidence for utility of shunting in idiopathic normal pressure hydrocephalus (iNPH) and for predictors of shunting effectiveness. We identified and classified relevant published studies according to 2004 and 2011 American Academy of Neurology methodology. Of 21 articles, we identified 3 Class I articles. Shunting is possibly effective in iNPH (96% chance subjective improvement, 83% chance improvement on timed walk test at 6 months) (3 Class III). Serious adverse event risk was 11% (1 Class III). Predictors of success included elevated Ro (1 Class I, multiple Class II), impaired cerebral blood flow reactivity to acetazolamide (by SPECT) (1 Class I), and positive response to either external lumbar drainage (1 Class III) or repeated lumbar punctures. Age may not be a prognostic factor (1 Class II). Data are insufficient to judge efficacy of radionuclide cisternography or aqueductal flow measurement by MRI. Clinicians may choose to offer shunting for subjective iNPH symptoms and gait (Level C). Because of significant adverse event risk, risks and benefits should be carefully weighed (Level B). Clinicians should inform patients with iNPH with elevated Ro and their families that they have an increased chance of responding to shunting compared with those without such elevation (Level B). Clinicians may counsel patients with iNPH and their families that (1) positive response to external lumbar drainage or to repeated lumbar punctures increases the chance of response to shunting, and (2) increasing age does not decrease the chance of shunting being successful (both Level C). © 2015 American Academy of Neurology.

  19. Developmental programming: impact of prenatal testosterone excess on pre- and postnatal gonadotropin regulation in sheep.

    Science.gov (United States)

    Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha

    2008-04-01

    The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.

  20. [Responses of normalized difference vegetation index (NDVI) to precipitation changes on the grassland of Tibetan Plateau from 2000 to 2015.

    Science.gov (United States)

    Wang, Zhi Peng; Zhang, Xian Zhou; He, Yong Tao; Li, Meng; Shi, Pei Li; Zu, Jia Xing; Niu, Ben

    2018-01-01

    Precipitation change is an important factor in the inter-annual variation of grassland growth on the Tibetan Plateau. The total amount, distribution pattern and concentration time are three basic characteristics of precipitation change. The temporal and spatial characteristics of precipitation change were analyzed based on climate data of 145 meteorological stations on the Tibetan Plateau and nearby areas from 2000 to 2015. The total precipitation amount was characterized by annual precipitation, distribution pattern of precipitation during the year was characterized by improved precipitation concentration index (PCI), and precipitation centroid (PC) was defined to indicate the change in precipitation concentrated time. To better illustrate the response of grassland to precipitation change, vegetation growth status was characterized by the maximum value of normalized difference vegetation index (NDVI max ). Results indicated that the annual precipitation and PCI had an apparent gradient across the whole plateau and the latest PC occurred in the southern plateau. NDVI max of alpine shrub grassland was significantly correlated with the change of PCI,increased with even distribution of precipitation during growth period, and limited by the total annual precipitation. Alpine meadow did not show significantly correlations with these three indices. The inter-annual variability of NDVI max of steppe was controlled by both PCI and PC. NDVI max of alpine desert grassland was mainly controlled by annual precipitation. In addition to annual total amount of precipitation, the distribution characteristics of precipitation should be further considered when the influence of precipitation change on different types of vegetation on the Qinghai Tibet Plateau was studied.

  1. First trimester pregnancy-associated plasma protein A and human chorionic gonadotropin-beta in early and late pre-eclampsia

    DEFF Research Database (Denmark)

    Karahasanovic, Azra; Sørensen, Steen; Nilas, Lisbeth

    2014-01-01

    Abstract Background: The aim of this study was to compare pregnancy-associated plasma protein A (PAPP-A) and the β-subunit of human chorionic gonadotropin (hCGβ) measured in maternal plasma at the first trimester screening, in women who later developed early or late pre-eclampsia (PE) to women...... with normal pregnancies. Methods: In the study were included 161 cases with PE and 88 controls with uncomplicated pregnancies. Plasma PAPP-A and hCGβ were measured between gestational age (GA) 8+2 and 14+0, and cases with early and late onset PE were compared with controls. Results: Median of hCGβ (Mo...

  2. Effects of short-term glucocorticoid deprivation on growth hormone (GH) response to GH-releasing peptide-6: Studies in normal men and in patients with adrenal insufficiency

    OpenAIRE

    Pinto, Ana Claudia de Assis Rocha [UNIFESP; Dias-da-Silva, Magnus Régios [UNIFESP; Martins, Manoel R. [UNIFESP; Brunner, Elisa [UNIFESP; Lengyel, Ana Maria Judith [UNIFESP

    2000-01-01

    There are no data in the literature about the effects of glucocorticoid deprivation on GH-releasing peptide-g (GHRP-6)-induced GH release. the aims of this study were to evaluate GH responsiveness to GHRP-6 1) after metyrapone administration in normal men, and 2) in patients with chronic hypocortisolism after glucocorticoid withdrawal for 72 h. in normal subjects, metyrapone ingestion did not alter significantly GH responsiveness to GHRP-6 [n = 8; peak, 39.3 +/- 7.1 mu g/L; area under the cur...

  3. Gonadotropin-Releasing Hormone Regulates Expression of the DNA Damage Repair Gene, Fanconi anemia A, in Pituitary Gonadotroph Cells1

    OpenAIRE

    Larder, Rachel; Chang, Lynda; Clinton, Michael; Brown, Pamela

    2004-01-01

    Gonadal function is critically dependant on regulated secretion of the gonadotropin hormones from anterior pituitary gonadotroph cells. Gonadotropin biosynthesis and release is triggered by the binding of hypothalamic GnRH to GnRH receptor expressed on the gonadotroph cell surface. The repertoire of regulatory molecules involved in this process are still being defined. We used the mouse LβT2 gonadotroph cell line, which expresses both gonadotropin hormones, as a model to investigate GnRH regu...

  4. Comparison of incidences of normal tissue complications with tumor response in a phase III trial comparing heat plus radiation to radiation alone

    International Nuclear Information System (INIS)

    Dewhirst, M.W.; Sim, D.A.; Grochowski, K.J.

    1984-01-01

    The success of hyperthermia (/sup Δ/) as an adjuvant to radiation (XRT) will depend on whether the increase in tumor control is greater than that for normal tissue reactions. One hundred and thirty dogs and cats were stratified by histology and randomized to receive XRT (460 rads per fraction, two fractions per week, for eight fractions) or /sup Δ/ + XRT (30 min. at 44 +-2 0 C; one fraction per week, four fractions; immediately prior to XRT). Heat induced changes in tumor and normal tissue responses were made by comparing ratios of incidence for /sup Δ/ + XRT and XRT alone (TRR; Thermal Relative Risk). Change in tumor response duration was calculated from statistical analysis of response duration curves (RRR; Relative Relapse Rate). Heat increased early normal tissue reactions (moist desquamation and mucositis by a factor of 1.08. Tumor complete response, by comparison, was significantly improved (TRR = 2.12, p < .001). Late skin fibrosis was also increased (TRR = 1.51), but the prolongation in tumor response was greater (RRR 1.85). The degree of thermal enhancement for all tissues was dependent on the minimum temperature achieved on the first treatment, but the values for tumor were consistently greater than those achieved for normal tissues

  5. Targeting Gonadotropins: An Alternative Option for Alzheimer Disease Treatment

    Directory of Open Access Journals (Sweden)

    Gemma Casadesus

    2006-01-01

    Full Text Available Recent evidence indicates that, alongside oxidative stress, dysregulation of the cell cycle in neurons susceptible to degeneration in Alzheimer disease may play a crucial role in the initiation of the disease. As such, the role of reproductive hormones, which are closely associated with the cell cycle both during development and after birth, may be of key import. While estrogen has been the primary focus, the protective effects of hormone replacement therapy on cognition and dementia only during a “crucial period” led us to expand the study of hormonal influences to other members of the hypothalamic pituitary axis. Specifically, in this review, we focus on luteinizing hormone, which is not only increased in the sera of patients with Alzheimer disease but, like estrogen, is modulated by hormone replacement therapy and also influences cognitive behavior and pathogenic processing in animal models of the disease. Targeting gonadotropins may be a useful treatment strategy for disease targeting multiple pleiotropic downstream consequences.

  6. Serum LH and FSH Responses to Synthetic LH-RH in Normal Infants, Children and Patients With Turner's Syndrome

    Science.gov (United States)

    Suwa, Seizo; And Others

    1974-01-01

    Effects of luteinizing hormone-releasing hormone (LH-RH) on LH and follicle-stimulating hormone (FSH) release were studied in 26 normal children and six patients (from 1-to 14-years-old) with Turner's syndrome. (Author)

  7. Biological and biochemical properties of human chorionic gonadotropin from urine of patients with hydatidiform mole and its radioimmunoassay

    International Nuclear Information System (INIS)

    Nishimura, Ryuichiro; Hamamoto, Tamotsu; Tanabe, Keizo; Takemori, Masayuki; Ashitaka, Yoshihiko

    1981-01-01

    Human chorionic gonadotropin (hCG) was extracted and purified from the urine of four patients with hydatidiform mole. The immunological activities of the hCG-hydatidiform mole by hCG radioimmunoassay (RIA) ranged from 9,380 to 9,700 IU/mg, and the biological activities measured by the immature rat ovarian weight method ranged from 7,250 to 7,780 IU/mg. The results of the amino acid compositions of all the hCG-hydatidiform moles were practically identical with those of hCG-normal pregnancies. The carbohydrate moiety of the hCG-hydatidiform mole was also suspected to be almost similar to that of hCG-normal pregnancies by the results of their in vitro and in vivo biological activities. It was demonstrated that hCG-hydatidiform mole was composed of α and β subunits (similar to a hCG-normal pregnancy) when hCG-hydatidiform mole was separated into subunits by SDS disc electrophoresis after treatment with mercaptoethanol. The RIA system of hCG-hydatidiform mole can be established. The concentrations of hCG in sera of normal pregnant women and patients with trophoblastic diseases assayed by hCG-hydatidiform mole RIA were equivalent to those obtained by a standard hCG RIA. Hence, a standard hCG-immunoassay method used in the management of trophoblastic diseases is considered reasonable so far as the immunoantigenecity of hCG is concerned. (author)

  8. The response of normal and ataxia-telangiectasia human fibroblasts to the lethal effects of far, mid and near ultraviolet radiations

    International Nuclear Information System (INIS)

    Keyse, S.M.; McAleer, M.A.; Davies, D.J.G.; Moss, S.H.

    1985-01-01

    The responses of two ataxia-telangiectasia (A-T) cell strains to the lethal effects of monochromatic far, mid and near ultraviolet radiations have been determined and compared with the responses of three normal human cell strains. The authors results confirm a previous observation that the A-T cell strain AT4BI is abnormally sensitive to the lethal effects of mid u.v. (313 nm) radiation. After far u.v. (254 nm) radiation the strain AT4BI exhibits a small but statistically significant increase in sensitivity compared to the normal strains. Of most interest, in terms of a mechanistic interpretation of the sensitivity of A-T strains, the survival responses of neither A-T strain tested to near u.v. (365 nm) radiation differed significantly from the mean response of the normal strains, although it is of interest that one normal strain (48BR) was found to be significantly more resistant to near u.v. radiation than any of the other strains tested. The results are discussed in terms of the possible induction of radiogenic lesions in DNA by ultraviolet radiations and the possible mechanisms of radiation sensitivity in ataxia-telangiectasia. (author)

  9. SU-E-J-212: MR Diffusion Tensor Imaging for Assessment of Tumor and Normal Brain Tissue Responses of Juvenile Pilocytic Astrocytoma Treated by Proton Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hou, P; Park, P; Li, H; Zhu, X; Mahajan, A; Grosshans, D [M.D. Anderson Cancer Center, Houston, TX (United States)

    2015-06-15

    Purpose: Diffusion tensor imaging (DTI) can measure molecular mobility at the cellular level, quantified by the apparent diffusion coefficient (ADC). DTI may also reveal axonal fiber directional information in the white matter, quantified by the fractional anisotropy (FA). Juvenile pilocytic astrocytoma (JPA) is a rare brain tumor that occurs in children and young adults. Proton therapy (PT) is increasingly used in the treatment of pediatric brain tumors including JPA. However, the response of both tumors and normal tissues to PT is currently under investigation. We report tumor and normal brain tissue responses for a pediatric case of JPA treated with PT assessed using DTI. Methods: A ten year old male with JPA of the left thalamus received passive scattered PT to a dose of 50.4 Gy (RBE) in 28 fractions. Post PT, the patient has been followed up in seven years. At each follow up, MRI imaging including DTI was performed to assess response. MR images were registered to the treatment planning CT and the GTV mapped onto each MRI. The GTV contour was then mirrored to the right side of brain through the patient’s middle line to represent normal brain tissue. ADC and FA were measured within the ROIs. Results: Proton therapy can completely spare contra lateral brain while the target volume received full prescribed dose. From a series of MRI ADC images before and after PT at different follow ups, the enhancement corresponding to GTV had nearly disappeared more than 2 years after PT. Both ADC and FA demonstrate that contralateral normal brain tissue were not affect by PT and the tumor volume reverted to normal ADC and FA values. Conclusion: DTI allowed quantitative evaluation of tumor and normal brain tissue responses to PT. Further study in a larger cohort is warranted.

  10. SU-E-J-212: MR Diffusion Tensor Imaging for Assessment of Tumor and Normal Brain Tissue Responses of Juvenile Pilocytic Astrocytoma Treated by Proton Therapy

    International Nuclear Information System (INIS)

    Hou, P; Park, P; Li, H; Zhu, X; Mahajan, A; Grosshans, D

    2015-01-01

    Purpose: Diffusion tensor imaging (DTI) can measure molecular mobility at the cellular level, quantified by the apparent diffusion coefficient (ADC). DTI may also reveal axonal fiber directional information in the white matter, quantified by the fractional anisotropy (FA). Juvenile pilocytic astrocytoma (JPA) is a rare brain tumor that occurs in children and young adults. Proton therapy (PT) is increasingly used in the treatment of pediatric brain tumors including JPA. However, the response of both tumors and normal tissues to PT is currently under investigation. We report tumor and normal brain tissue responses for a pediatric case of JPA treated with PT assessed using DTI. Methods: A ten year old male with JPA of the left thalamus received passive scattered PT to a dose of 50.4 Gy (RBE) in 28 fractions. Post PT, the patient has been followed up in seven years. At each follow up, MRI imaging including DTI was performed to assess response. MR images were registered to the treatment planning CT and the GTV mapped onto each MRI. The GTV contour was then mirrored to the right side of brain through the patient’s middle line to represent normal brain tissue. ADC and FA were measured within the ROIs. Results: Proton therapy can completely spare contra lateral brain while the target volume received full prescribed dose. From a series of MRI ADC images before and after PT at different follow ups, the enhancement corresponding to GTV had nearly disappeared more than 2 years after PT. Both ADC and FA demonstrate that contralateral normal brain tissue were not affect by PT and the tumor volume reverted to normal ADC and FA values. Conclusion: DTI allowed quantitative evaluation of tumor and normal brain tissue responses to PT. Further study in a larger cohort is warranted

  11. Environmental impacts on the gonadotropic system in female Atlantic salmon (Salmo salar) during vitellogenesis: Photothermal effects on pituitary gonadotropins, ovarian gonadotropin receptor expression, plasma sex steroids and oocyte growth.

    Science.gov (United States)

    Taranger, Geir Lasse; Muncaster, Simon; Norberg, Birgitta; Thorsen, Anders; Andersson, Eva

    2015-09-15

    The gonadotropic system and ovarian growth and development were studied during vitellogenesis in female Atlantic salmon subjected to either simulated natural photoperiod and ambient water temperature (NL-amb), or an accelerating photoperiod (short day of LD8:16 from May 10) combined with either warmed (ca 2°C above ambient; 8L-warm) or cooled water (ca 2°C below ambient; 8L-cold) from May to September. Monthly samples were collected from 10 females/group for determination of transcript levels of pituitary gonadotropin subunits (fshb and lhb) and ovarian gonadotropin receptors (fshr and lhr), plasma sex steroids (testosterone: T and estradiol-17β: E2), gonadosomatic index (GSI) and oocyte size. Short day in combination with either warmed or cooled water induced an earlier increase in pituitary fshb and lhb levels compared with NL-amb controls, and advanced ovarian growth and the seasonal profiles of T, E2. By contrast only minor effects were seen of the photothermal treatments on ovarian fshr and lhr. The 8L-cold had earlier increase in fshb, lhb and E2, but similar oocyte and gonadal growth as 8L-warm, suggesting that the 8L-cold group tried to compensate for the lower water temperature during the period of rapid gonadal growth by increasing fshb and E2 production. Both the 8L-warm and 8L-cold groups showed incomplete ovulation in a proportion of the females, possibly due to the photoperiod advancement resulting in earlier readiness of spawning occurring at a higher ambient temperature, or due to some reproductive dysfunction caused by photothermal interference with normal neuroendocrine regulation of oocyte development and maturation. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Pulsatile gonadotropin-releasing hormone therapy is associated with earlier spermatogenesis compared to combined gonadotropin therapy in patients with congenital hypogonadotropic hypogonadism

    Directory of Open Access Journals (Sweden)

    Jiang-Feng Mao

    2017-01-01

    Full Text Available Both pulsatile gonadotropin-releasing hormone (GnRH infusion and combined gonadotropin therapy (human chorionic gonadotropin and human menopausal gonadotropin [HCG/HMG] are effective to induce spermatogenesis in male patients with congenital hypogonadotropic hypogonadism (CHH. However, evidence is lacking as to which treatment strategy is better. This retrospective cohort study included 202 patients with CHH: twenty had received pulsatile GnRH and 182 had received HCG/HMG. Patients had received therapy for at least 12 months. The total follow-up time was 15.6 ± 5.0 months (range: 12-27 months for the GnRH group and 28.7 ± 13.0 months (range: 12-66 months for the HCG/HMG group. The median time to first sperm appearance was 6 months (95% confidence interval [CI]: 1.6-10.4 in the GnRH group versus 18 months (95% CI: 16.4-20.0 in the HCG/HMG group (P 1 × 10 6 ml−1 was 43.7% ± 20.4% (16 samples in the GnRH group versus 43.2% ± 18.1% (153 samples in the HCG/HMG group (P = 0.921. Notably, during follow-up, the GnRH group had lower serum testosterone levels than the HCG/HMG group (8.3 ± 4.6 vs 16.2 ± 8.2 nmol l−1 , P < 0.001. Our study found that pulsatile GnRH therapy was associated with earlier spermatogenesis and larger testicular size compared to combined gonadotropin therapy. Additional prospective randomized studies would be required to confirm these findings.

  13. Effect of luminance contrast on BOLD-fMRI response in deaf and normal occipital visual cortex

    International Nuclear Information System (INIS)

    Xue Yanping; Zhai Renyou; Jiang Tao; Cui Yong; Zhou Tiangang; Rao Hengyi; Zhuo Yan

    2002-01-01

    Objective: To examine the effect of luminance contrast stimulus by using blood oxygenation level dependent functional magnetic resonance imaging (BOLD-fMRI) within deaf occipital visual cortex, and to compare the distribution, extent, and intensity of activated areas between deaf subjects and normal hearing subjects. Methods: Twelve deaf subjects (average age 16.5) and 15 normal hearing subjects (average age 23.7) were stimulated by 4 kinds of luminance contrast (0.7, 2.2, 50.0, 180.0 lm). The fMRI data were collected on GE 1.5 T Signa Horizon LX MRI system and analyzed by AFNI to generate the activation map. Results: Responding to all 4 kinds of stimulus luminance contrast, all deaf and normal subjects showed significant activations in occipital visual cortex. For both deaf and normal subjects, the number of activated pixels increased significantly with increasing luminance contrast (F normal = 4.27, P deaf = 6.41, P 0.05). The local mean activation level for all activated pixels remained constant with increasing luminance contrast. However, there was an increase in the mean activation level for those activated pixels common to all trials as the stimulus luminance contrast was increased, but no significant difference was found within them (F normal = 0.79, P > 0.05; F deaf = 1.6, P > 0.05). Conclusion: The effect of luminance contrast on occipital visual cortex of deaf is similar to but somewhat higher than that of normal hearing subjects. In addition, it also proved that fMRI is a feasible method in the study of the deaf visual cortex

  14. Freeze-all cycle for all normal responders?

    Science.gov (United States)

    Roque, Matheus; Valle, Marcello; Guimarães, Fernando; Sampaio, Marcos; Geber, Selmo

    2017-02-01

    The purpose of this study is to evaluate the freeze-all strategy in subgroups of normal responders, to assess whether this strategy is beneficial regardless of ovarian response, and to evaluate the possibility of implementing an individualized embryo transfer (iET) based on ovarian response. This was an observational, cohort study performed in a private IVF center. A total of 938 IVF cycles were included in this study. The patients were submitted to controlled ovarian stimulation (COS) with a gonadotropin-releasing hormone (GnRH) antagonist protocol and a cleavage-stage day 3 embryo transfer. We performed a comparison of outcomes between the fresh embryo transfer (n = 523) and the freeze-all cycles (n = 415). The analysis was performed in two subgroups of patients based on the number of retrieved oocytes: Group 1 (4-9 oocytes) and Group 2 (10-15 oocytes). In Group 1 (4-9 retrieved oocytes), the implantation rates (IR) were 17.9 and 20.5% (P = 0.259) in the fresh and freeze-all group, respectively; the ongoing pregnancy rates (OPR) were 31 and 33% (P = 0.577) in the fresh and freeze-all group, respectively. In Group 2 (10-15 oocytes), the IR were 22.1 and 30.1% (P = 0.028) and the OPR were 34 and 47% (P = 0.021) in the fresh and freeze-all groups, respectively. Although the freeze-all policy may be related to better in vitro fertilization (IVF) outcomes in normal responders, these potential advantages decrease with worsening ovarian response. Patients with poorer ovarian response do not benefit from the freeze-all strategy.

  15. Increased Progesterone/Estradiol Ratio on the Day of hCG Administration Adversely Affects Success of In Vitro Fertilization–Embryo Transfer in Patients Stimulated with Gonadotropin-releasing Hormone Agonist and Recombinant Follicle-stimulating Hormone

    Directory of Open Access Journals (Sweden)

    Yu-Che Ou

    2008-06-01

    Conclusion: Premature luteinization, defined as late follicular P/E2 ratio of > 1 in long GnRHa cycles with rFSH stimulation, adversely affected ovarian responses and clinical outcomes. It seems unrelated to preovulatory luteinizing hormone (LH elevation and LH/hCG content of gonadotropins and could be associated with poor ovarian response and the presence of dysmature follicles. [Taiwan J Obstet Cynecol 2008;47(2:1 68-1 74

  16. The use of biological isodoses ''IsobioGy 2'' for evaluation of tumour and normal tissues response for fractionated irradiation

    International Nuclear Information System (INIS)

    Maciejewski, B.; Skolyszewski, J.; Majewski, S.; Lobodziec, W.; Jedynak, T.; Slosarek, K.

    1988-01-01

    Divergences between physical and biological dose distributions were analysed using linear quadratic model. It was found that small variations in physical dose distribution and differences in normal tissue sensitivity for change in dose per fraction, expressed by a α/β value, can cause a high difference between physical and biological doses. This difference significantly increases when one field instead of two fields is daily treated. If there is no enough separation between treated fields, the biological dose may dramatically increase. The use of biological ''isobioGy 2'' isodoses, instead of physical isodoses, can provide an important information on biological effect in tumour or normal tissue and may diminish the risk of giving too high dose to normal tissue and too low dose to the tumour. 6 figs., 13 refs. (author)

  17. In vitro radiation response studies on bone marrow fibroblasts (CFU-F) obtained from normal and chronically irradiated dogs

    International Nuclear Information System (INIS)

    Klein, A.K.; Stitzel, K.A.; Greenberg, B.; Woo, L.

    1984-01-01

    The radiation resistance of bone marrow fibroblasts as measured by their proliferative potential was evaluated in chronically irradiated dogs. Bone marrows were obtained from eight dogs that had been chronically irradiated beginning at 21 days of gestation or after birth and eight age-matched controls. Of these irradiated dogs, four were either preleukemic or exhibited frank acute nonlymphocytic leukemia. The other four were clinically normal but demonstrated abnormalities in their marrow that could be attributed to radiation effects and/or other pathologic changes. Fibroblasts from six of the irradiated dogs were significantly more radioresistant than those of their controls. Five of these six dogs subsequently succumbed to hematopathologic disease, while the two irradiated dogs with normal fibroblasts remained clinically normal, suggesting that this observed radioresistance may be linked to the disease process. (author)

  18. DNA strand breaking and rejoining in response to ultraviolet light in normal human and xeroderma pigmentosum cells

    International Nuclear Information System (INIS)

    Dingman, C.W.; Kakunaga, T.

    1976-01-01

    A description is given of a reproducible technique for measuring DNA strand breaking and rejoining in cells after treatment with U.V.-light. Results obtained with normal human cells, xeroderma pigmentosum cells (XP, complementation group A) and XP variant cells suggested that all three of these cell-types can carry out single-strand incision with equal rapidity. However, the breaks so induced appeared to be only slowly rejoined in the XP variant cells and rejoined not at all in XP complementation group A cells. Furthermore, parental strand rejoining was inhibited by caffeine in XP variant cells but not in normal cells. (author)

  19. Differential gene expression in human granulosa cells from recombinant FSH versus human menopausal gonadotropin ovarian stimulation protocols

    Directory of Open Access Journals (Sweden)

    Bietz Mandi G

    2010-03-01

    Full Text Available Abstract Background The study was designed to test the hypothesis that granulosa cell (GC gene expression response differs between recombinant FSH and human menopausal gonadotropin (hMG stimulation regimens. Methods Females Results After exclusions, 1736 genes exhibited differential expression between groups. Over 400 were categorized as signal transduction genes, ~180 as transcriptional regulators, and ~175 as enzymes/metabolic genes. Expression of selected genes was confirmed by RT-PCR. Differentially expressed genes included A kinase anchor protein 11 (AKAP11, bone morphogenetic protein receptor II (BMPR2, epidermal growth factor (EGF, insulin-like growth factor binding protein (IGFBP-4, IGFBP-5, and hypoxia-inducible factor (HIF-1 alpha. Conclusions Results suggest that major differences exist in the mechanism by which pure FSH alone versus FSH/LH regulate gene expression in preovulatory GC that could impact oocyte maturity and developmental competence.

  20. Hyperglycosylated human chorionic gonadotropin does not increase progesterone production by luteinized granulosa cells.

    Science.gov (United States)

    Crochet, John R; Shah, Anish A; Schomberg, David W; Price, Thomas M

    2012-09-01

    Trophoblast-derived human chorionic gonadotropin (hCG) promotes corpus luteum progesterone (P4) production, and wide ranges of serum P4 levels are noted in various pregnancy outcomes, despite similar hCG concentrations. There are five unique biologically active hCG variants in human pregnancy urine, and previous studies of P4 production in response to hCG have used only preparations containing all isoforms. Understanding exactly which hCG variant is primarily responsible for stimulating corpus luteum steroidogenesis may have great clinical and diagnostic implications, including in the setting of ectopic pregnancy. Our objective was to delineate the role of the standard and hyperglycosylated (H)-hCG isoforms in stimulating P4 production by luteinized granulosa cells. Cell culture, ELISA, and fluorometric-based protein assays were done at Duke University Medical Center. Patients were anonymous oocyte donors. Cultured luteinized granulosa cells were treated with 0.25, 0.5, and 1.0 ng/ml total hCG, which contains all isoforms, purified standard hCG (37.1 kDa), and purified H-hCG (42.8 kDa). P4 produced per total cellular protein (nanograms per microgram) was measured via ELISA and fluorometric protein determination kits. Both total hCG (P = 0.0003) and purified standard hCG (P production. Purified H-hCG did not change the P4 produced per total cellular protein response (P value not significant). Standard hCG stimulated P4 production by cultured granulosa cells and likely supports corpus luteum function via interactions with the LH/hCG receptor. In contrast, H-hCG did not increase P4 production, which indicates a nonsteroidogenic role for this protein during early gestation.

  1. Gonadotropins in Infertile Men with Idiopathic Hypogonadotropic Hypogonadism

    Directory of Open Access Journals (Sweden)

    Homayoun Abbasi

    2009-01-01

    Full Text Available Background: Stimulatory therapy with gonadotrpins is an effective treatment to inducespermatogenesis in men with idiopathic hypogonadotroptic hypogonadism (IHH. The aim ofthis study was to assess the effectiveness of human chorionic gonadotropin / human menopausalgonadotropin on hypogonadotropic infertile men.Materials and Methods: This study included fifty-six azoospermic infertile men with IHH treatedwith hCG / hMG. All patients received hCG (5000 IU, IM3 times /week for three months. Afterthat, treatment was continued combined with hMG (75 IU, IM 3 times/week. Semen analysis wasperformed every 3 months. After 15 months, fine needle aspiration was performed if the patientswere azoospermic. Treatment continued if mature spermatozoa were present in FNA, otherwisetreatment was discontinued. In the former cases, semen analysis was requested 24months afterthebeginning of treatment.Results: In this study, spermatozoa were present in the ejaculate in 50 out of 56 patients (89.2%after combined treatment. Average time of sperm appearance was 9.2 months. Mean spermconcentration was 9.12 x 106/ml. FNA carried out after 15 months of treatment in 23(41% ofpatients with persistent azoospermia, 91.3% of these latter patients had mature spermatozoa on fineneedle aspiration. Pregnancy occurred in 23 (41% cases.The mean sperm concentration in patients whose spouses became pregnant was 15.56x 10.6Conclusion: hCG/ hMG combination therapy is effective treatment for fertility in patients withIHH. FNA can be used as a safe and suitable tool to evaluate patients that remains azoospermicafter 15 month of treatment.

  2. Response of growth hormone (GH), FFA, blood sugar and insulin to exercise in obese patients and normal subjects

    NARCIS (Netherlands)

    Schwarz, F.; Haar, D.J. ter; Riet, H.G. van; Thijssen, J.H.H.

    1969-01-01

    Ergometer tests with a constant workload of 600 Kg./min. during 30 minutes were done on eight normal subjects, eight severely obese patients, and two women who had formerly been obese. Arterial blood was sampled three times before, four times during and three times after exercise. The incidence and

  3. SIMBIOS Normalized Water-Leaving Radiance Calibration and Validation: Sensor Response, Atmospheric Corrections, Stray Light and Sun Glint. Chapter 14

    Science.gov (United States)

    Mueller, James L.

    2001-01-01

    This Sensor Intercomparison and Merger for Biological and Interdisciplinary Oceanic Studies (SIMBIOS) contract supports acquisition of match up radiometric and bio-optical data for validation of Sea-Viewing Wide Field-of-view Sensor (SeaWiFS) and other ocean color satellites, and evaluation of uncertainty budgets and protocols for in situ measurements of normalized water leaving radiances.

  4. The effect of palm oil, lard, and puff-pastry margarine on postprandial lipid and hormone responses in normal-weight and obese young women

    DEFF Research Database (Denmark)

    Jensen, Janne J. Dyrsborg; Bysted, Anette; Dawids, Steen

    1999-01-01

    , on postprandial lipid and hormone responses in normal-weight and obese young women. The study was performed as a randomized, crossover design. The fats differed in the content of palmitic acid, stearic acid, and traits monounsaturated fatty acids allowing a dietary comparison of different 'solid' fatty acids......Only a few studies have been published on the postprandial effects of different fatty acids in obese subjects. Therefore, the present study investigated the effects of three test meals containing palm oil (PO), lard (LD), or puff-pastry margarine (PPM), all normal dietary ingredients...... acids provided by PO, LD, and PPM have no effect in either group....

  5. Gonadotropin-releasing hormone 2 suppresses food intake in the zebrafish, Danio rerio

    Directory of Open Access Journals (Sweden)

    Ryo eNishiguchi

    2012-10-01

    Full Text Available Gonadotropin-releasing hormone (GnRH is an evolutionarily conserved neuropeptide with 10 amino acid residues, of which several structural variants exist. A molecular form known as GnRH2 ([His5 Trp7 Tyr8]GnRH, also known as chicken GnRH II is widely distributed in vertebrates except for rodents, and has recently been implicated in the regulation of feeding behavior in goldfish. However, the influence of GnRH2 on feeding behavior in other fish has not yet been studied. In the present study, therefore, we investigated the role of GnRH2 in the regulation of feeding behavior in a zebrafish model, and examined its involvement in food intake after intracerebroventricular (ICV administration. ICV injection of GnRH2 at 0.1 and 1 pmol/g body weight (BW induced a marked decrease of food consumption in a dose-dependent manner during 30 min after feeding. Cumulative food intake was significantly decreased by ICV injection of GnRH2 at 1 pmol/g BW during the 30-min post-treatment observation period. The anorexigenic action of GnRH2 was completely blocked by treatment with the GnRH type I receptor antagonist Antide at 50 pmol/g BW. We also examined the effect of feeding condition on the expression level of the GnRH2 transcript in the hypothalamus. Levels of GnRH2 mRNA obtained from fish that had been provided excess food for 7 days were higher than those in fish that had been fed normally. These results suggest that, in zebrafish, GnRH2 acts as an anorexigenic factor, as is the case in goldfish.

  6. Commercial radioimmunoassay for beta subunit of human chorionic gonadotropin: falsely positive determinations due to elevated serum luteinizing hormone

    International Nuclear Information System (INIS)

    Fowler, J.E. Jr.; Platoff, G.E.; Kubrock, C.A.; Stuzman, R.E.

    1982-01-01

    Among 17 men who had received seemingly curative treatment for unilateral non-seminomatous germ cell tumors for the testis and who had consistently normal serum human chorionic gonadotropin (HCG) levels at a reference laboratory, 7 (41%) had at least one falsely positive commercial serum HCG determination. To investigate the cause of these falsely positive determinations the authors measured the cross reactivity of luteinizing hormone (LH) and follicle stimulating hormone (FSH) standards in the commercial HCG assay, and studied the relationships between commercial HCG levels and serum LH levels, serum FSH levels and gonadal status in men with and without normal gonadal function. The falsely positive HCG determinations appeared to be due to elevated serum LH levels and cross reactivity of LH in the commercial HCG assay because: 1) there was substantial cross reactivity of the LH standards in the commercial assay, 2) the serum LH was elevated in four of six men with solitary testes, 3) there was a striking correlation between elevated serum LH levels and falsely elevated commercial HCG levels in ten men with solitary or absent testes, and 4) there were no falsely positive HCG determinations in 13 normal men but there were falsely positive HCG determinations in seven of ten anorchid men

  7. A review of luteinising hormone and human chorionic gonadotropin when used in assisted reproductive technology

    DEFF Research Database (Denmark)

    Ezcurra, Diego; Humaidan, Peter

    2014-01-01

    to the purification process, thus hCG, mimicking LH action, is added to standardise the product. However, unlike LH, hCG plays a very minor role during the natural human menstrual cycle. It is secreted by the embryo and placenta, and its main role is to support implantation and pregnancy. More recently, recombinant......Gonadotropins extracted from the urine of post-menopausal women have traditionally been used to stimulate folliculogenesis in the treatment of infertility and in assisted reproductive technology (ART). Products, such as human menopausal gonadotropin (hMG), consist not only of a mixture...... of the hormones, follicle-stimulating hormone (FSH), luteinising hormone (LH) and human chorionic gonadotropin (hCG), but also other biologically active contaminants, such as growth factors, binding proteins and prions. The actual amount of molecular LH in hMG preparations varies considerably due...

  8. Isolation and characterization of gonadotropin isohormones from the pituitary gland of pike eel (Muraenesox cinereus)

    International Nuclear Information System (INIS)

    Huang, F.-L.; Huang, C.-J.; Lin, S.-H.; Lo, T.-B.; Papkoff, H.

    1981-01-01

    Pike eel gonadotropins were isolated from pituitary glands by 40% alcohol-6% ammonium acetate, pH 5.1 extraction and were purified by DEAE-cellulose chromatography and electrophoresis into four electrophoretically homogeneous forms. These four isohormones were biologically identified as gonadotropins by the stimulation of 32 P-uptake in 1-day-old chick testes, by the induction of ovulation in catfish, and by the in vitro production of testosterone from isolated rat Leydig cells and of androgen from carp testes. The amino acid composition of the isohormones were similar to other known piscine gonadotropins (carp and salmon) and were composed of two non-identical subunits with Tyr and Ser as N-terminal amino acid residues. The molecular weights of two subunits were 15000 and 10500, respectively, as estimated by SDS-gel disc electrophoresis. (author)

  9. Seasonal relationship between gonadotropin, growth hormone, and estrogen receptor mRNA expression in the pituitary gland of largemouth bass.

    Science.gov (United States)

    Martyniuk, Christopher J; Kroll, Kevin J; Porak, Wesley F; Steward, Cheree; Grier, Harry J; Denslow, Nancy D

    2009-09-15

    The objectives of this study were to investigate the seasonal changes in pituitary gonadotropins, growth hormone (GH), and estrogen receptor (ER) isoform mRNA in wild female and male largemouth bass (LMB) (Micropterus salmoides) from an unpolluted habitat to better understand reproductive physiology in this ecologically important species. Female pituitary luteinizing hormone (LH) beta subunit and follicle stimulating hormone (FSH) beta subunit mRNA showed significant seasonal variation with levels peaking from January to April and were lowest from May to August. Male LMB showed more variation in gonadotropin subunit expression from month to month. Females had approximately 2-3 times higher gonadotropin mRNA levels in the pituitary when compared to males. All three gonadotropin mRNAs in females were positively correlated to gonadosomatic index (GSI), but only LHbeta mRNA was correlated to GSI in males. Gonadotropin mRNA expression also increased with increasing oocyte and sperm maturation. Gonadotropin beta subunit mRNA expression was positively correlated to GH mRNA in both sexes. The expression of all three ER isoforms was significantly correlated to each other in both sexes. The concurrent increase in all three ER mRNA isoforms with increasing gonadotropin mRNA in females and males suggests a prominent role for E2 feedback on pituitary gonadotropin synthesis in both sexes and that each of the three ER isoforms are likely to play a role in the pituitary during teleost reproduction.

  10. Separation of metabolic supply and demand: aerobic glycolysis as a normal physiological response to fluctuating energetic demands in the membrane.

    Science.gov (United States)

    Epstein, Tamir; Xu, Liping; Gillies, Robert J; Gatenby, Robert A

    2014-01-01

    Cancer cells, and a variety of normal cells, exhibit aerobic glycolysis, high rates of glucose fermentation in the presence of normal oxygen concentrations, also known as the Warburg effect. This metabolism is considered abnormal because it violates the standard model of cellular energy production that assumes glucose metabolism is predominantly governed by oxygen concentrations and, therefore, fermentative glycolysis is an emergency back-up for periods of hypoxia. Though several hypotheses have been proposed for the origin of aerobic glycolysis, its biological basis in cancer and normal cells is still not well understood. We examined changes in glucose metabolism following perturbations in membrane activity in different normal and tumor cell lines and found that inhibition or activation of pumps on the cell membrane led to reduction or increase in glycolysis, respectively, while oxidative phosphorylation remained unchanged. Computational simulations demonstrated that these findings are consistent with a new model of normal physiological cellular metabolism in which efficient mitochondrial oxidative phosphorylation supplies chronic energy demand primarily for macromolecule synthesis and glycolysis is necessary to supply rapid energy demands primarily to support membrane pumps. A specific model prediction was that the spatial distribution of ATP-producing enzymes in the glycolytic pathway must be primarily localized adjacent to the cell membrane, while mitochondria should be predominantly peri-nuclear. The predictions were confirmed experimentally. Our results show that glycolytic metabolism serves a critical physiological function under normoxic conditions by responding to rapid energetic demand, mainly from membrane transport activities, even in the presence of oxygen. This supports a new model for glucose metabolism in which glycolysis and oxidative phosphorylation supply different types of energy demand. Cells use efficient but slow-responding aerobic metabolism

  11. Efficacy and Outcome Predictors of Gonadotropin Treatment for Male Congenital Hypogonadotropic Hypogonadism

    Science.gov (United States)

    Liu, Zhaoxiang; Mao, Jangfeng; Wu, Xueyan; Xu, Hongli; Wang, Xi; Huang, Bingkun; Zheng, Junjie; Nie, Min; Zhang, Hongbing

    2016-01-01

    Abstract Gonadotropin induces masculinization and spermatogenesis in men with congenital hypogonadotropic hypogonadism (CHH). However, large cohort studies for the efficacy and reliable predictors of this therapy need to be conducted. The aim of this study was to investigate the efficacy of gonadotropin treatment in a large cohort of male CHH patients and analyze putative predictors for successful spermatogenesis. This retrospective study included 223 CHH azoospermic patients without puberty development treated between 2005 and 2014. All patients received combined human chorionic gonadotropin (HCG) and human menopausal gonadotropin (HMG) and were followed up for >6 months (5109 person-months). Serum total testosterone level, testicular size, spermatogenesis, and pregnancy outcome were recorded at each visit. After gonadotropin therapy, testicular size was enlarged from 2.1 ± 1.6 to 8.1 ± 4.6 mL (P 0/mL) occurred at a median period of 15 months (95% confidence interval 13.5–16.5). Larger basal testicular volume (P = 0.012) and noncryptorchidism history (P = 0.028) are independent predictors for earlier sperm appearance. Sixty four percent (143/223) of patients succeeded in producing sperms and the average time for initial sperm detection was 14 ± 8 months. However, their sperm concentrations (11.7 [2.1, 24.4] million/mL) and sperm progressive motility (A + B 36.9% ± 20.2%) are significantly lower than World Health Organization standards. Of the 34 patients who desired for fathering children, 19 patients impregnanted their partners during the treatment. Gonadotropin therapy induces spermatogenesis in male CHH patients. A larger basal testicular size and noncryptorchidism history are favorable indicators for earlier spermatogenesis. PMID:26945370

  12. Vesicles mimicking normal and cancer cell membranes exhibit differential responses to the cell-penetrating peptide Pep-1.

    Science.gov (United States)

    Almarwani, Bashiyar; Phambu, Esther Nzuzi; Alexander, Christopher; Nguyen, Ha Aimee T; Phambu, Nsoki; Sunda-Meya, Anderson

    2018-06-01

    The cell-penetrating peptide (CPP) Pep-1 presents a great potential in drug delivery due to its intrinsic property to cross plasma membrane. However, its mechanism of entry into the cell remains unresolved. In this study, we compare the selectivity of Pep-1 towards vesicles mimicking normal and cancer cell membranes. The interaction was performed in a wide range of peptide-to-lipid molar ratios using infrared (IR), fluorescence, scanning electron microscopy (SEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC) techniques. At low peptide concentration, fluorescence experiments show that lipid-phosphatidylserine (PS) seems to enable Pep-1 translocation into cancer cell membrane as evidenced by the blue shift of its maximal emission wavelength. DSC data show that Pep-1 induces segregation of lipids. At high peptide concentration, IR data indicate that the interaction of Pep-1 is relatively stronger with normal cell membrane than with cancer cell membrane through the phosphate groups, while the interaction is weaker with normal cell membrane than with cancer cell membrane through the carbonyl groups. TGA and DSC data reveal that vesicles of normal cell membrane are thermally more stable than vesicles of cancer cell membrane. This suggests that the additional lipid PS included in cancer cell membrane has a destabilizing effect on the membrane structure. SEM images reveal that Pep-1 form superstructures including spherical particles and fibrils in the presence of both model membranes. PS seems to enhance peptide transport across cellular membranes. The biophysical techniques in this study provide valuable insights into the properties of CPPs in drug delivery systems. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Effect of endotoxin preparations (LPS) with irradiation decreased toxicity on the immune response of normal and irradiated rats

    Energy Technology Data Exchange (ETDEWEB)

    Elekes, E; Bertok, L [Orszagos Frederic Joliot-Curie Sugarbiologiai es Sugaregeszsegugyi Kutato Intezet, Budapest (Hungary)

    1979-03-01

    A comparison of the immunostimulating effect of parent and radiodetoxified with 50, 100, 150 and 200 kGy (5, 10, 15 and 20 Mrad) /sup 60/Co ..gamma..-rays endotoxin preparations in normal and irradiated rats is given. By increasing the dose of irradiation the immunostimulating effect decreased. The preparations detoxified even with the highest (200 kGy) dose is characterized by a pronounced adjuvant effect in irradiated animals.

  14. Radioiodinated nondegradable gonadotropin-releasing hormone analogs: new probes for the investigation of pituitary gonadotropin-releasing hormone receptors.

    Science.gov (United States)

    Clayton, R N; Shakespear, R A; Duncan, J A; Marshall, J C; Munson, P J; Rodbard, D

    1979-12-01

    Studies of pituitary plasma membrane gonadotropin-releasing hormone (GnRH) receptors using [125I]-iodo-GnRH suffer major disadvantages. Only a small (less than 25%) proportion of specific tracer binding is to high affinity sites, with more than 70% bound to low affinity sites (Ka = 1 x 10(6) M-1). [125I]Iodo-GnRH is also inactivated during incubation with pituitary plasma membrane preparations. Two superactive analongs of GnRH, substituted in positions 6 and 10, were used as the labeled ligand to overcome these problems. Both analogs bound to the same high affinity sites as GnRH on bovine pituitary plasma membranes, though the affinity of the analogs was higher than that of the natural decapeptide (Ka = 2.0 x 10(9), 6.0 x 10(9), and 3.0 x 10(8) M-1 for [D-Ser(TBu)6]des-Gly10-GnRH ethylamide, [D-Ala6]des-Gly10-GnRH ethylamide, and GnRH, respectively. The labeled analogs bound to a single class of high affinity sites with less than 15% of the specific binding being to low affinity sites (Ka approximately equal to 1 x 10(6) M-1). The labeled analogs were not inactivated during incubation with the pituitary membrane preparations. Using the analogs as tracer, a single class of high affinity sites (K1 = 4.0 x 10(9) M-1) was also demonstrated on crude 10,800 x g rat pituitary membrane preparations. Use of these analogs as both the labeled and unlabeled ligand offers substantial advantages over GnRH for investigation of GnRH receptors, allowing accurate determination of changes in their numbers and affinities under various physiological conditions.

  15. Comparison of Nocturia Response to Desmopressin Treatment between Patients with Normal and High Nocturnal Bladder Capacity Index

    Directory of Open Access Journals (Sweden)

    Tine Hajdinjak

    2013-01-01

    Full Text Available Objective. To compare efficacy of desmopressin for treatment of nocturia between patients with normal and high nocturnal bladder capacity index (NBCi. Methods. Retrospective analysis of adult patients treated with desmopressin for nocturia. Patients were analyzed according to high or normal NBCi value before treatment. Results. 55 patients were identified, aged 49–84, 47 males, 8 females, who started desmopressin 0.2 mg nocte between 2009 and 2011. Two groups (N: normal and H: high NBCi were similar regarding number, gender, age, 24 h urine volume, and nocturnal urine volume. On treatment, nocturnal volume decreased by mean of 364 mL. Number of nightly voids decreased in N group from 3.11 to 1.50, in H from 3.96 to 1.44. Nocturnal polyuria and nocturia indices also decreased significantly. NBCi remained the same in N group (0.56 on therapy and in H group decreased to mean 0.63. All on-treatment values were statistically similar in N and H groups. Pretreatment differences were abolished with treatment. NBCi was significantly correlated to nocturia reduction—larger reduction was observed in patients with higher NBCi. In 8/55 patients, hyponatremia was detected, but without clinical consequences. Conclusions. The results indicate that the effectiveness of desmopressin on nocturia is not dependent upon the patient's pretreatment NBCi.

  16. Low dosing of gonadotropins in in vitro fertilization cycles for women with poor ovarian reserve: systematic review and meta-analysis

    NARCIS (Netherlands)

    Youssef, Mohamed Abdel-Fattah; van Wely, Madelon; Mochtar, Monique; Fouda, Usama Mohamed; Eldaly, Ashraf; El Abidin, Eman Zein; Elhalwagy, Ahmed; Mageed Abdallah, Ahmed Abdel; Zaki, Sherif Sameh; Abdel Ghafar, Mohamed Sayed; Mohesen, Mohamed Nagi; van der Veen, Fulco

    2018-01-01

    Objective: To evaluate the effectiveness of low doses of gonadotropins and gonadotropins combined with oral compounds compared with high doses of gonadotropins in ovarian stimulation regimens in terms of ongoing pregnancy per fresh IVF attempt in women with poor ovarian reserve undergoing

  17. "Normality of Residuals Is a Continuous Variable, and Does Seem to Influence the Trustworthiness of Confidence Intervals: A Response to, and Appreciation of, Williams, Grajales, and Kurkiewicz (2013"

    Directory of Open Access Journals (Sweden)

    Jason W. Osborne

    2013-09-01

    Full Text Available Osborne and Waters (2002 focused on checking some of the assumptions of multiple linear.regression. In a critique of that paper, Williams, Grajales, and Kurkiewicz correctly clarify that.regression models estimated using ordinary least squares require the assumption of normally.distributed errors, but not the assumption of normally distributed response or predictor variables..They go on to discuss estimate bias and provide a helpful summary of the assumptions of multiple.regression when using ordinary least squares. While we were not as precise as we could have been.when discussing assumptions of normality, the critical issue of the 2002 paper remains -' researchers.often do not check on or report on the assumptions of their statistical methods. This response.expands on the points made by Williams, advocates a thorough examination of data prior to.reporting results, and provides an example of how incremental improvements in meeting the.assumption of normality of residuals incrementally improves the accuracy of confidence intervals.

  18. Radiotherapy. Non-standard fractionated regimens improving cancer treatment. Part II. Response of normal tissues to fractionated irradiation

    International Nuclear Information System (INIS)

    Villar, A.; Hernandez, M.; Pera, J.; Cambray, M.; Villa, S.; Arnaiz, M.D.

    1988-01-01

    The phenomena participating in the response of tissues to fractionated irradiation are analyzed with special emphasis on the most relevant points influencing the design of non-standard fractionated regimens. (Author)

  19. Response Pattern Based on the Amplitude of Ear Canal Recorded Cochlear Microphonic Waveforms across Acoustic Frequencies in Normal Hearing Subjects

    OpenAIRE

    Zhang, Ming

    2012-01-01

    Low-frequency otoacoustic emissions (OAEs) are often concealed by acoustic background noise such as those from a patient’s breathing and from the environment during recording in clinics. When using electrocochleaography (ECochG or ECoG), such as cochlear microphonics (CMs), acoustic background noise do not contaminate the recordings. Our objective is to study the response pattern of CM waveforms (CMWs) to explore an alternative approach in assessing cochlear functions. In response to a 14-mse...

  20. The Spatial Musical Association of Response Codes does not depend on a normal visual experience: A study with early blind individuals.

    Science.gov (United States)

    Cattaneo, Zaira; Lega, Carlotta; Rinaldi, Luca; Fantino, Micaela; Ferrari, Chiara; Merabet, Lotfi B; Vecchi, Tomaso

    2018-02-26

    Converging evidence suggests that the perception of auditory pitch exhibits a characteristic spatial organization. This pitch-space association can be demonstrated experimentally by the Spatial Musical Association of Response Codes (SMARC) effect. This is characterized by faster response times when a low-positioned key is pressed in response to a low-pitched tone, and a high-positioned key is pressed in response to a high-pitched tone. To investigate whether the development of this pitch-space association is mediated by normal visual experience, we tested a group of early blind individuals on a task that required them to discriminate the timbre of different instrument sounds with varying pitch. Results revealed a comparable pattern in the SMARC effect in both blind participants and sighted controls, suggesting that the lack of prior visual experience does not prevent the development of an association between pitch height and vertical space.

  1. Near-infrared spectroscopy can detect differences in vascular responsiveness to a hyperglycaemic challenge in individuals with obesity compared to normal-weight individuals.

    Science.gov (United States)

    Soares, Rogério Nogueira; Reimer, Raylene A; Alenezi, Zaid; Doyle-Baker, Patricia K; Murias, Juan Manuel

    2018-01-01

    To examine whether the near-infrared spectroscopy combined with vascular occlusion test technique could detect differences in vascular responsiveness during hyperglycaemia between normal-weight individuals and individuals with obesity. A total of 16 normal-weight individuals (body mass index, 21.3 ± 1.7 kg/m 2 ) and 13 individuals with obesity (body mass index, 34.4 ± 2.0 kg/m 2 ) were submitted to five vascular occlusion tests (Pre, 30, 60, 90 and 120 min after glucose challenge). Vascular responsiveness was determined by the Slope 2 (Slope 2 StO 2 ) and the area under the curve (StO 2AUC ) of oxygen saturation derived from near-infrared spectroscopy-vascular occlusion test. The Slope 2 StO 2 increased from 1.07 ± 0.16%/s (Pre) to 1.53 ± 0.21%/s at 90 min ( p obese it increased from 0.71 ± 0.09%/s (Pre) to 0.92 ± 0.14%/s at 60 min ( p obesity. Near-infrared spectroscopy-vascular occlusion test technique was capable of detecting differences in vascular responsiveness during hyperglycaemia between normal-weight individuals and individuals with obesity.

  2. GnRH-induced Ca2+ signaling patterns and gonadotropin secretion in pituitary gonadotrophs. Functional adaptations to both ordinary and extraordinary physiological demands

    Directory of Open Access Journals (Sweden)

    María Luisa eDurán-Pastén

    2013-09-01

    Full Text Available Pituitary gonadotrophs are a small fraction of the anterior pituitary population, yet they synthesize gonadotropins: luteinizing (LH and follicle stimulating (FSH, essential for gametogenesis and steroidogenesis. LH is secreted via a regulated pathway while FSH release is mostly constitutive and controlled by synthesis. Although gonadotrophs fire action potentials spontaneously, the intracellular Ca2+ rises produced do not influence secretion, which is mainly driven by Gonadotropin Releasing Hormone (GnRH, a decapeptide synthesized in the hypothalamus and released in a pulsatile manner into the hypophyseal portal circulation. GnRH binding to G protein coupled receptors triggers Ca2+ mobilization from InsP3-sensitive intracellular pools, generating the global Ca2+ elevations necessary for secretion. Ca2+ signaling responses to increasing [GnRH] vary in stereotyped fashion from subthreshold to baseline spiking (oscillatory, to biphasic (spike-oscillatory or spike-plateau. This progression varies somewhat in gonadotrophs from different species and biological preparations. Both baseline spiking and biphasic GnRH-induced Ca2+ signals control LH/FSH synthesis and exocytosis. Estradiol and testosterone regulate gonadotropin secretion through feedback mechanisms, while FSH synthesis and release are influenced by activin, inhibin and follistatin. Adaptation to physiological events like the estrous cycle, involves changes in GnRH sensitivity and LH/FSH synthesis: in proestrus, estradiol feedback regulation abruptly changes from negative to positive, causing the pre-ovulatory LH surge. Similarly, when testosterone levels drop after orquiectomy the lack of negative feedback on pituitary and hypothalamus boosts both GnRH and LH secretion, gonadotrophs GnRH sensitivity increases and Ca2+ signaling patterns change. In addition, gonadotrophs proliferate and grow. These plastic changes denote a more vigorous functional adaptation in response to an extraordinary

  3. Qualitative dose response of the normal canine head to epithermal neutron irradiation with and without boron capture

    International Nuclear Information System (INIS)

    DeHaan, C.E.; Gavin, P.R.; Kraft, S.L.; Wheeler, F.J.; Atkinson, C.A.

    1992-01-01

    Boron Neutron Capture Therapy is being re-evaluated for the treatment of intracranial tumors. Prior to human clinical trials, determination of normal tissue tolerance is critical. Dogs were chosen as a large animal model for the following reasons. Dogs can be evaluated with advanced imaging, diagnostic and therapeutic modalities. Dogs are amenable to detailed neurologic examination and subtle behavioral changes are easily detected. Specifically, Labrador retrievers were chosen for their large body and head size. The dogs received varying doses of epithermal neutron irradiation and boron neutron capture irradiation using an epithermal neutron source. The dogs were closely monitored for up to one year post irradiation

  4. Auditory brainstem response latency in forward masking, a marker of sensory deficits in listeners with normal hearing thresholds

    DEFF Research Database (Denmark)

    Mehraei, Golbarg; Paredes Gallardo, Andreu; Shinn-Cunningham, Barbara G.

    2017-01-01

    -spontaneous rate fibers results in a faster recovery of wave-V latency as the slow contribution of these fibers is reduced. Results showed that in young audiometrically normal listeners, a larger change in wave-V latency with increasing masker-to-probe interval was related to a greater effect of a preceding masker......-V latency changes with increasing masker-to-probe intervals. In the same listeners, behavioral forward masking detection thresholds were measured. We hypothesized that 1) auditory nerve fiber deafferentation increases forward masking thresholds and increases wave-V latency and 2) a preferential loss of low...

  5. The olfactory gonadotropin-releasing hormone immunoreactive system in mouse.

    Science.gov (United States)

    Jennes, L

    1986-10-29

    The olfactory gonadotropin-releasing hormone (GnRH) system in mice was studied with immunofluorescence in combination with lesions of the olfactory bulb and retrograde transport of horseradish peroxidase (HRP) which was administered intravascularly, intranasally or into the subarachnoid space. GnRH-positive neurons were located in the two major branches forming the septal roots of the nervus terminalis, in the ganglion terminale, within the fascicles of the nervus terminalis throughout its extent, in a conspicuous band which connects the ventral neck of the caudal olfactory bulb with the accessory olfactory bulb and in the nasal mucosa. GnRH-positive fibers were seen in all areas in which neurons were found, i.e. in the rostral septum, the ganglion and nervus terminalis and in the nasal subepithelium. In addition, a broad bundle of fibers was observed to surround the entire caudal olfactory bulb, connecting the rostral sulcus rhinalis with the ventrocaudal olfactory bulb. Fibers were seen in close association with the main and accessory olfactory bulb, with the fila olfactoria and with the nasal mucosa. Throughout the olfactory bulb and the nasal epithelium, an association of GnRH fibers with blood vessels was apparent. Intravascular and intranasal injection of HRP resulted in labeling of certain GnRH neurons in the septal roots of the nervus terminalis, the ganglion terminale, the nervus terminalis, the caudal ventrodorsal connection and in the accessory olfactory bulb. After placement of HRP into the subarachnoid space dorsal to the accessory olfactory bulb, about 50% of the GnRH neurons in the accessory olfactory bulb and in the ventrodorsal connection were labeled with HRP. Also, a few GnRH neurons in the rostral septum, the ganglion terminale and in the fascicles of the nervus terminalis had taken up the enzyme. Lesions of the nervus terminalis caudal to the ganglion terminale resulted in sprouting of GnRH fibers at both sites of the knife cut. Lesions rostral

  6. The omega-3 fatty acid eicosapentaenoic acid is required for normal alcohol response behaviors in C. elegans.

    Directory of Open Access Journals (Sweden)

    Richard C Raabe

    Full Text Available Alcohol addiction is a widespread societal problem, for which there are few treatments. There are significant genetic and environmental influences on abuse liability, and understanding these factors will be important for the identification of susceptible individuals and the development of effective pharmacotherapies. In humans, the level of response to alcohol is strongly predictive of subsequent alcohol abuse. Level of response is a combination of counteracting responses to alcohol, the level of sensitivity to the drug and the degree to which tolerance develops during the drug exposure, called acute functional tolerance. We use the simple and well-characterized nervous system of Caenorhabditis elegans to model the acute behavioral effects of ethanol to identify genetic and environmental factors that influence level of response to ethanol. Given the strong molecular conservation between the neurobiological machinery of worms and humans, cellular-level effects of ethanol are likely to be conserved. Increasingly, variation in long-chain polyunsaturated fatty acid levels has been implicated in complex neurobiological phenotypes in humans, and we recently found that fatty acid levels modify ethanol responses in worms. Here, we report that 1 eicosapentaenoic acid, an omega-3 polyunsaturated fatty acid, is required for the development of acute functional tolerance, 2 dietary supplementation of eicosapentaenoic acid is sufficient for acute tolerance, and 3 dietary eicosapentaenoic acid can alter the wild-type response to ethanol. These results suggest that genetic variation influencing long-chain polyunsaturated fatty acid levels may be important abuse liability loci, and that dietary polyunsaturated fatty acids may be an important environmental modulator of the behavioral response to ethanol.

  7. Evaluation of fault-normal/fault-parallel directions rotated ground motions for response history analysis of an instrumented six-story building

    Science.gov (United States)

    Kalkan, Erol; Kwong, Neal S.

    2012-01-01

    According to regulatory building codes in United States (for example, 2010 California Building Code), at least two horizontal ground-motion components are required for three-dimensional (3D) response history analysis (RHA) of buildings. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHA analyses should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak responses of engineering demand parameters (EDPs) were obtained for rotation angles ranging from 0° through 180° for evaluating the FN/FP directions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

  8. Apoptosis in chronic myeloid leukaemia: normal responses by progenitor cells to growth factor deprivation, X-irradiation and glucocorticoids

    Energy Technology Data Exchange (ETDEWEB)

    Amos, T.A.S.; Lewis, J.L.; Grand, F.H.; Gooding, R.P.; Goldman, J.M.; Gordon, M.Y. [Royal Postgraduate Medical School, London (United Kingdom)

    1995-10-01

    Inhibition of apoptosis (genetically programmed active cell death) by p210 BCR-ABL expression is a mechanism that might contribute to clonal expansion in chronic myeloid leukaemia (CML). Since cell death following exposure to ionizing radiation and many chemotherapeutic agents can occur by the apoptotic pathway, inhibition of apoptosis would be expected to confer a relative resistance to these treatments. Similarly, cells deprived of growth factors in vitro die by apoptosis, and inhibition of apoptosis would therefore be expected to allow cells to survive better in growth factor-deprived conditions. We found that the survival of normal and CML myeloid progenitors was the same after in vitro incubation in deprived conditions and after treatment with X-irradiation or glucocorticoids. We also found that mature cells in colonies produced by CML progenitors (CFU-GM) did not survive better than those produced by normal progenitor cells. Flow cytometric analysis of propidium iodide-stained cells provided a direct indication that the degree of apoptosis may correspond to the degree of deprivation. These results suggest that inhibition of apoptosis may not be the primary mechanism whereby BCR-ABL influences the expansion of the malignant clone in CML. (Author).

  9. The radiobiology of laser-driven particle beams: focus on sub-lethal responses of normal human cells

    International Nuclear Information System (INIS)

    Manti, L.; Perozziello, F.M.; Romagnani, L.; Borghesi, M.; Doria, D.; Candiano, G.; Cirrone, G.A.P.; Leanza, R.; Romano, F.; Scuderi, V.; Tramontana, A.; Chaudhary, P.; Gwynne, D.; Prise, K. M.

    2017-01-01

    Accelerated proton beams have become increasingly common for treating cancer. The need for cost and size reduction of particle accelerating machines has led to the pioneering investigation of optical ion acceleration techniques based on laser-plasma interactions as a possible alternative. Laser-matter interaction can produce extremely pulsed particle bursts of ultra-high dose rates (≥ 10 9 Gy/s), largely exceeding those currently used in conventional proton therapy. Since biological effects of ionizing radiation are strongly affected by the spatio-temporal distribution of DNA-damaging events, the unprecedented physical features of such beams may modify cellular and tissue radiosensitivity to unexplored extents. Hence, clinical applications of laser-generated particles need thorough assessment of their radiobiological effectiveness. To date, the majority of studies have either used rodent cell lines or have focussed on cancer cell killing being local tumour control the main objective of radiotherapy. Conversely, very little data exist on sub-lethal cellular effects, of relevance to normal tissue integrity and secondary cancers, such as premature cellular senescence. Here, we discuss ultra-high dose rate radiobiology and present preliminary data obtained in normal human cells following irradiation by laser-accelerated protons at the LULI PICO2000 facility at Laser Lab Europe, France.

  10. Apoptosis in chronic myeloid leukaemia: normal responses by progenitor cells to growth factor deprivation, X-irradiation and glucocorticoids

    International Nuclear Information System (INIS)

    Amos, T.A.S.; Lewis, J.L.; Grand, F.H.; Gooding, R.P.; Goldman, J.M.; Gordon, M.Y.

    1995-01-01

    Inhibition of apoptosis (genetically programmed active cell death) by p210 BCR-ABL expression is a mechanism that might contribute to clonal expansion in chronic myeloid leukaemia (CML). Since cell death following exposure to ionizing radiation and many chemotherapeutic agents can occur by the apoptotic pathway, inhibition of apoptosis would be expected to confer a relative resistance to these treatments. Similarly, cells deprived of growth factors in vitro die by apoptosis, and inhibition of apoptosis would therefore be expected to allow cells to survive better in growth factor-deprived conditions. We found that the survival of normal and CML myeloid progenitors was the same after in vitro incubation in deprived conditions and after treatment with X-irradiation or glucocorticoids. We also found that mature cells in colonies produced by CML progenitors (CFU-GM) did not survive better than those produced by normal progenitor cells. Flow cytometric analysis of propidium iodide-stained cells provided a direct indication that the degree of apoptosis may correspond to the degree of deprivation. These results suggest that inhibition of apoptosis may not be the primary mechanism whereby BCR-ABL influences the expansion of the malignant clone in CML. (Author)

  11. The use of equine chorionic gonadotropin in the treatment of anestrous dairy cows in gonadotropin-releasing hormone/progesterone protocols of 6 or 7 days.

    Science.gov (United States)

    Bryan, M A; Bó, G; Mapletoft, R J; Emslie, F R

    2013-01-01

    In seasonally calving, pasture-based dairy farm systems, the interval from calving to first estrus is a critical factor affecting reproductive efficiency. This study evaluated the effects of equine chorionic gonadotropin (eCG) on the reproductive response of lactating, seasonally calving dairy cows diagnosed with anovulatory anestrus by rectal palpation. Cows on 15 commercial dairy farms were selected for initial inclusion based on nonobserved estrus by 7 d before the planned start of mating. All cows were palpated rectally and evaluated for body condition score and ovary score, and were included for treatment according to the trial protocol if diagnosed with anovulatory anestrus. All cows received a standard anestrous treatment protocol consisting of insertion of a progesterone device, injection of 100 µg of GnRH at the time of device insertion, and injection of PGF(2α) at device removal (GPG/P4). Cows were randomly assigned to 1 of 2 groups (6 d or 7 d) for duration of progesterone device insertion. Within each of these groups, cows were further randomly assigned to receive either 400 IU of eCG at device removal or to remain untreated as controls, resulting in a 2×2 arrangement of treatment groups: (1) 6-d device and no eCG (n=484); (2) 6-d device and eCG (n=462); (3) 7-d device and no eCG (n=546); and (4) 7-d device and eCG (n=499). Cows were detected for estrus from the time of progesterone device removal and were inseminated; those not detected in estrus within 60 h after progesterone device removal received 100 µg of GnRH and were inseminated at 72 h. The primary outcomes considered were proportion of cows conceiving within 7 d of the beginning of breeding (7-d conception rate; 7-d CR), proportion pregnant within 28 d (28-d in calf rate; 28-d ICR), and days to conception (DTC). We found no significant differences between the 6- and 7-d insertion periods and found no 6- or 7-d insertion period × eCG treatment interactions. Inclusion of eCG into either

  12. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  13. Response of normal children to influenza A/New Jersey/76 virus vaccine administered by jet injector.

    Science.gov (United States)

    McIntosh, K; Orr, I; Andersen, M; Arthur, J H; Blakeman, G J

    1977-12-01

    Ninety-seven children six to 10 years old received monovalent influenza A/New Jersey/76 virus vaccine by jet injector. Comparison with groups receiving vaccine intramuscularly revealed that local reactions (tenderness and erythema) were more frequent and more severe in the group vaccinated by jet injector. Antibody response, however, was similar for all groups.

  14. Normal and sublethally irradiated stem and granulocyte progenitor cell regeneration in an in vivo culture system. The cellular response to humoral factors released through the action of cyclophosphamide

    International Nuclear Information System (INIS)

    MacVittie, T.

    1977-01-01

    The in vivo diffusion chamber (DC) method of marrow culture was used to determine if the injection of host mice with cyclophosphamide (CY) caused, through its cytoxic action, the release of a humoral factor(s) capable of initiating stem cell (CFU-s) and granulocyte-macrophage progenitor cell (CFU-c) proliferation. Host mice were injected with CY 1-4 days prior to 800 rad of 60 Co WBI and implantation of DCs containing normal or 400 rad sublethally irradiated (SLI) marrow cells. The greatest proliferative response within CFU-s and CFU-c populations occurred in those mice injected with CY 3 days prior to implant. The marked CFU-s and CFU-c regeneration was initiated during the initial 24 hr of culture in both normal and SLI marrow cells. Thereafter growth rates were approximately the same. SLI marrow, however, showed a greater response to the humoral effects of CY injection than did normal marrow. These data provided evidence that CY induced the release of a diffusible factor(s) capable of accelerating regeneration of normal and sublethally irradiated CFU-s and CFU-c, the magnitude of which was dependent upon the time elapsed between CY injected and implantation of DCs. The marked proliferative response of the SLI stem and progenitor cells to the humoral stimulation may be indicative of the heterogeneity of both CFU-s and CFU-c populations surviving sublethal radiation exposure. The target cells may have possessed a differential sensitivity to the factor(s) initiating cell proliferation

  15. Blood leukocyte responses to extracorporeal circulation. 3. Long term extracorporeal circulation without and with irradiation in normal and splenectomized dogs

    Energy Technology Data Exchange (ETDEWEB)

    Szemere, P.; Fliedner, T.M. (Ulm Univ. (Germany, F.R.). Abt. Klinische Physiologie)

    1983-01-01

    Long term (12-48 h) extracorporeal circulation without and with irradiation of the blood was performed in normal and splenectomized dogs in order to observe the effect of these procedures on blood leukocyte counts including CFU-C. A transient granulocytopenia and a decrease of lymphocyte count were observed. The blood CFU-C level diminished to a very low level and remained low for the whole time of the experiments. There was no significant difference between the results of procedures with or without irradiation. The similar effect of a shortened tubing system on the blood leukocyte count is also reported. Heparin infusion alone did not decrease the peripheral CFU-C concentration. The possible explanations for the observed phenomena are discussed.

  16. Effects of preventing O-glycosylation on the secretion of human chorionic gonadotropin in Chinese hamster ovary cells

    International Nuclear Information System (INIS)

    Matzuk, M.M.; Krieger, M.; Corless, C.L.; Boime, I.

    1987-01-01

    Human chorionic gonadotropin (hCG) is a member of a family of heterodimeric glycoprotein hormones that have a common α subunit but differ in their hormone-specific β-subunits. The β subunit of hCG (hCGβ) is unique among the β subunits in that it contains four mucin-like O-linked oligosaccharides attached to a carboxyl-terminal extension. To study the effects of O-glycosylation on the secretion and assembly of hCG, expression vectors containing either hCGβ gene alone or together with the hCGα gene were transfected into a mutant Chinese hamster ovary cell line, 1d1D, which exhibits a reversible defect in O-glycosylation. The results reveal that hCGβ can be secreted normally in the absence of its O-linked oligosaccharides. hCGβ devoid of O-linked carbohydrate can also combine efficiently with hCGα and be secreted as an intact dimer. The authors conclude that in Chinese hamster ovary cells, the hCGβ O-linked chains play no role in the assembly and secretion of hCG. The normal and O-linked oligosaccharide-deficient forms of hCG secreted by these cells should prove useful in examining the role of O-linked chains on the biological function of hCG

  17. Toward developing recombinant gonadotropin-based hormone therapies for increasing fertility in the flatfish Senegalese sole.

    Directory of Open Access Journals (Sweden)

    François Chauvigné

    Full Text Available Captive flatfishes, such as the Senegalese sole, typically produce very low volumes of sperm. This situation is particularly prevalent in the first generation (F1 of reared sole males, which limits the development of artificial fertilization methods and the implementation of selective breeding programs. In this study, we investigated whether combined treatments with homologous recombinant follicle-stimulating (rFsh and luteinizing (rLh hormones, produced in a mammalian host system, could stimulate spermatogenesis and enhance sperm production in Senegalese sole F1 males. In an initial autumn/winter experiment, weekly intramuscular injections with increasing doses of rFsh over 9 weeks resulted in the stimulation of gonad weight, androgen release, germ cell proliferation and entry into meiosis, and the expression of different spermatogenesis-related genes, whereas a subsequent single rLh injection potentiated spermatozoa differentiation. In a second late winter/spring trial corresponding to the sole's natural prespawning and spawning periods, we tested the effect of repeated rLh injections on the amount and quality of sperm produced by males previously treated with rFsh for 4, 6, 8 or 10 weeks. These latter results showed that the combination of rFsh and rLh treatments could increase sperm production up to 7 times, and slightly improve the motility of the spermatozoa, although a high variability in the response was found. However, sustained administration of rFsh during spawning markedly diminished Leydig cell survival and the steroidogenic potential of the testis. These data suggest that in vivo application of rFsh and rLh is effective at stimulating spermatogenesis and sperm production in Senegalese sole F1 males, setting the basis for the future establishment of recombinant gonadotropin-based hormone therapies to ameliorate reproductive dysfunctions of this species.

  18. A comparison of spent fuel shipping cask response to 10 CFR 71 normal conditions and realistic hot day extremes

    International Nuclear Information System (INIS)

    Manson, S.J.; Gianoulakis, S.E.

    1994-04-01

    An examination of the effect of a realistic (though conservative) hot day environment on the thermal transient behavior of spent fuel shipping casks is made. These results are compared to those that develop under the prescribed normal thermal condition of 10 CFR 71. Of specific concern are the characteristics of propagating thermal waves, which are set up by diurnal variations of temperature and insolation in the outdoor environment. In order to arrive at a realistic approximation of these variations on a conservative hot day, actual temperature and insolation measurements have been obtained from the National Climatic Data Center (NCDC) for representatively hot and high heat flux days. Thus, the use of authentic meteorological data ensures the realistic approach sought. Further supporting the desired realism of the modeling effort is the use of realistic cask configurations in which multiple laminations of structural, shielding, and other materials are expected to attenuate the propagating thermal waves. The completed analysis revealed that the majority of wall temperatures, for a wide variety of spent fuel shipping cask configurations, fall well below those predicted by enforcement of the regulatory environmental conditions of 10 CFR 71. It was found that maximum temperatures at the cask surface occasionally lie above temperatures predicted under the prescribed regulatory conditions. However, the temperature differences are small enough that the normal conservative assumptions that are made in the course of typical cask evaluations should correct for any potential violations. The analysis demonstrates that diurnal temperature variations that penetrate the cask wall all have maxima substantially less than the corresponding regulatory solutions. Therefore it is certain that vital cask components and the spent fuel itself will not exceed the temperatures calculated by use of the conditions of 10 CFR 71

  19. Gut microbiota and glucometabolic alterations in response to recurrent partial sleep deprivation in normal-weight young individuals.

    Science.gov (United States)

    Benedict, Christian; Vogel, Heike; Jonas, Wenke; Woting, Anni; Blaut, Michael; Schürmann, Annette; Cedernaes, Jonathan

    2016-12-01

    Changes to the microbial community in the human gut have been proposed to promote metabolic disturbances that also occur after short periods of sleep loss (including insulin resistance). However, whether sleep loss affects the gut microbiota remains unknown. In a randomized within-subject crossover study utilizing a standardized in-lab protocol (with fixed meal times and exercise schedules), we studied nine normal-weight men at two occasions: after two nights of partial sleep deprivation (PSD; sleep opportunity 02:45-07:00 h), and after two nights of normal sleep (NS; sleep opportunity 22:30-07:00 h). Fecal samples were collected within 24 h before, and after two in-lab nights, of either NS or PSD. In addition, participants underwent an oral glucose tolerance test following each sleep intervention. Microbiota composition analysis (V4 16S rRNA gene sequencing) revealed that after two days of PSD vs. after two days of NS, individuals exhibited an increased Firmicutes:Bacteroidetes ratio, higher abundances of the families Coriobacteriaceae and Erysipelotrichaceae, and lower abundance of Tenericutes (all P < 0.05) - previously all associated with metabolic perturbations in animal or human models. However, no PSD vs. NS effect on beta diversity or on fecal short-chain fatty acid concentrations was found. Fasting and postprandial insulin sensitivity decreased after PSD vs. NS (all P < 0.05). Our findings demonstrate that short-term sleep loss induces subtle effects on human microbiota. To what extent the observed changes to the microbial community contribute to metabolic consequences of sleep loss warrants further investigations in larger and more prolonged sleep studies, to also assess how sleep loss impacts the microbiota in individuals who already are metabolically compromised.

  20. Responses of human normal osteoblast cells and osteoblast-like cell line, MG-63 cells, to pulse electromagnetic field (PEMF

    Directory of Open Access Journals (Sweden)

    Suttatip Kamolmatyakul

    2008-01-01

    Full Text Available The objective of this in vitro study is to investigate the effect of pulsed electromagnetic field (PEMF on cellular proliferation and osteocalcin production of osteoblast-like cell line, MG-63 cells, and human normal osteoblast cells (NHOC obtained from surgical bone specimens. The cells were placed in 24-well culture plates in the amount of 3x104 cell/wells with 2 ml αMEM media supplemented with 10% FBS. The experimental plates were placed between a pair of Helmoltz coils powered by a pulse generator (PEMF, 50 Hz, 1.5 mV/cm in the upper compartment of a dual incubator (Forma. The control plates were placed in the lower compartment of the incubator without Helmotz coils. After three days, the cell proliferation was measured by the method modified from Mossman (J. Immunol Methods 1983; 65: 55-63. Other sets of plates were used for osteocalcin production assessment. Media from these sets were collected after 6 days and assessed for osteocalcin production using ELISA kits. The data were analyzed using a one-way analysis of variance (ANOVA. The results showed that MG-63 cells from the experimental group proliferated significantly more than those from the control group (20% increase, p<0.05. No significant difference in osteocalcin production was detected between the two groups. On the other hand, NHOC from the experimental group produced larger amount of osteocalcin (25% increase, p<0.05 and proliferated significantly more than those from the control group (100% increase, p<0.05. In conclusion, PEMF effect on osteoblasts might depend on their cell type of origin. For osteoblast-like cell line, MG-63 cells, PEMF increased proliferation rate but not osteocalcin production of the cells. However, PEMF stimulation effect on human normal osteoblast cells was most likely associated with enhancement of both osteocalcin production and cell proliferation.

  1. Prospective, randomized comparison between pulsatile GnRH therapy and combined gonadotropin (FSH+LH) treatment for ovulation induction in women with hypothalamic amenorrhea and underlying polycystic ovary syndrome.

    Science.gov (United States)

    Dubourdieu, Sophie; Fréour, Thomas; Dessolle, Lionel; Barrière, Paul

    2013-05-01

    To compare the efficacy of pulsatile GnRH therapy versus combined gonadotropins for ovulation induction in women with both hypothalamic amenorrhoea and polycystic ovarian syndrome (HA/PCOS) according to their current hypothalamic status. This single-centre, prospective, randomized study was conducted in the Nantes University Hospital, France. Thirty consecutive patients were treated for ovulation induction with either pulsatile GnRH therapy or combined gonadotropins (rFSH+rLH). Frequency of adequate ovarian response (mono- or bi-follicular) and clinical pregnancy rate were then compared between both groups. Ovarian response was similar in both groups with comparable frequency of adequate ovarian response (73% vs 60%), but the clinical pregnancy rate was significantly higher in the pulsatile GnRH therapy group than in the combined gonadotropin group (46% vs 0%). HA/PCOS is a specific subgroup of infertile women. Pulsatile GnRH therapy is an effective and safe method of ovulation induction that can be used successfully in these patients. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  2. Association Between Progesterone Elevation on the Day of Human Chronic Gonadotropin Trigger and Pregnancy Outcomes After Fresh Embryo Transfer in In Vitro Fertilization/Intracytoplasmic Sperm Injection Cycles.

    Science.gov (United States)

    Esteves, Sandro C; Khastgir, Gautam; Shah, Jatin; Murdia, Kshitiz; Gupta, Shweta Mittal; Rao, Durga G; Dash, Soumyaroop; Ingale, Kundan; Patil, Milind; Moideen, Kunji; Thakor, Priti; Dewda, Pavitra

    2018-01-01

    Progesterone elevation (PE) during the late follicular phase of controlled ovarian stimulation in fresh embryo transfer in vitro fertilization (IVF)/intracytoplasmic sperm injection cycles has been claimed to be associated with decreased pregnancy rates. However, the evidence is not unequivocal, and clinicians still have questions about the clinical validity of measuring P levels during the follicular phase of stimulated cycles. We reviewed the existing literature aimed at answering four relevant clinical questions, namely (i) Is gonadotropin type associated with PE during the follicular phase of stimulated cycles? (ii) Is PE on the day of human chorionic gonadotropin (hCG) associated with negative fresh embryo transfer IVF/intracytoplasmic sperm injection (ICSI) cycles outcomes in all patient subgroups? (iii) Which P thresholds are best to identify patients at risk of implantation failure due to PE in a fresh embryo transfer? and (iv) Should a freeze all policy be adopted in all the cycles with PE on the day of hCG? The existing evidence indicates that late follicular phase progesterone rise in gonadotropin releasing analog cycles is mainly caused by the supraphysiological stimulation of granulosa cells with exogenous follicle-stimulating hormone. Yet, the type of gonadotropin used for stimulation seems to play no significant role on progesterone levels at the end of stimulation. Furthermore, PE is not a universal phenomenon with evidence indicating that its detrimental consequences on pregnancy outcomes do not affect all patient populations equally. Patients with high ovarian response to control ovarian stimulation are more prone to exhibit PE at the late follicular phase. However, in studies showing an overall detrimental effect of PE on pregnancy rates, the adverse effect of PE on endometrial receptivity seems to be offset, at least in part, by the availability of good quality embryo for transfer in women with a high ovarian response. Given the limitations of

  3. Association Between Progesterone Elevation on the Day of Human Chronic Gonadotropin Trigger and Pregnancy Outcomes After Fresh Embryo Transfer in In Vitro Fertilization/Intracytoplasmic Sperm Injection Cycles

    Directory of Open Access Journals (Sweden)

    Sandro C. Esteves

    2018-04-01

    Full Text Available Progesterone elevation (PE during the late follicular phase of controlled ovarian stimulation in fresh embryo transfer in vitro fertilization (IVF/intracytoplasmic sperm injection cycles has been claimed to be associated with decreased pregnancy rates. However, the evidence is not unequivocal, and clinicians still have questions about the clinical validity of measuring P levels during the follicular phase of stimulated cycles. We reviewed the existing literature aimed at answering four relevant clinical questions, namely (i Is gonadotropin type associated with PE during the follicular phase of stimulated cycles? (ii Is PE on the day of human chorionic gonadotropin (hCG associated with negative fresh embryo transfer IVF/intracytoplasmic sperm injection (ICSI cycles outcomes in all patient subgroups? (iii Which P thresholds are best to identify patients at risk of implantation failure due to PE in a fresh embryo transfer? and (iv Should a freeze all policy be adopted in all the cycles with PE on the day of hCG? The existing evidence indicates that late follicular phase progesterone rise in gonadotropin releasing analog cycles is mainly caused by the supraphysiological stimulation of granulosa cells with exogenous follicle-stimulating hormone. Yet, the type of gonadotropin used for stimulation seems to play no significant role on progesterone levels at the end of stimulation. Furthermore, PE is not a universal phenomenon with evidence indicating that its detrimental consequences on pregnancy outcomes do not affect all patient populations equally. Patients with high ovarian response to control ovarian stimulation are more prone to exhibit PE at the late follicular phase. However, in studies showing an overall detrimental effect of PE on pregnancy rates, the adverse effect of PE on endometrial receptivity seems to be offset, at least in part, by the availability of good quality embryo for transfer in women with a high ovarian response. Given the

  4. Association Between Progesterone Elevation on the Day of Human Chronic Gonadotropin Trigger and Pregnancy Outcomes After Fresh Embryo Transfer in In Vitro Fertilization/Intracytoplasmic Sperm Injection Cycles

    Science.gov (United States)

    Esteves, Sandro C.; Khastgir, Gautam; Shah, Jatin; Murdia, Kshitiz; Gupta, Shweta Mittal; Rao, Durga G.; Dash, Soumyaroop; Ingale, Kundan; Patil, Milind; Moideen, Kunji; Thakor, Priti; Dewda, Pavitra

    2018-01-01

    Progesterone elevation (PE) during the late follicular phase of controlled ovarian stimulation in fresh embryo transfer in vitro fertilization (IVF)/intracytoplasmic sperm injection cycles has been claimed to be associated with decreased pregnancy rates. However, the evidence is not unequivocal, and clinicians still have questions about the clinical validity of measuring P levels during the follicular phase of stimulated cycles. We reviewed the existing literature aimed at answering four relevant clinical questions, namely (i) Is gonadotropin type associated with PE during the follicular phase of stimulated cycles? (ii) Is PE on the day of human chorionic gonadotropin (hCG) associated with negative fresh embryo transfer IVF/intracytoplasmic sperm injection (ICSI) cycles outcomes in all patient subgroups? (iii) Which P thresholds are best to identify patients at risk of implantation failure due to PE in a fresh embryo transfer? and (iv) Should a freeze all policy be adopted in all the cycles with PE on the day of hCG? The existing evidence indicates that late follicular phase progesterone rise in gonadotropin releasing analog cycles is mainly caused by the supraphysiological stimulation of granulosa cells with exogenous follicle-stimulating hormone. Yet, the type of gonadotropin used for stimulation seems to play no significant role on progesterone levels at the end of stimulation. Furthermore, PE is not a universal phenomenon with evidence indicating that its detrimental consequences on pregnancy outcomes do not affect all patient populations equally. Patients with high ovarian response to control ovarian stimulation are more prone to exhibit PE at the late follicular phase. However, in studies showing an overall detrimental effect of PE on pregnancy rates, the adverse effect of PE on endometrial receptivity seems to be offset, at least in part, by the availability of good quality embryo for transfer in women with a high ovarian response. Given the limitations of

  5. Possession of ATM Sequence Variants as Predictor for Late Normal Tissue Responses in Breast Cancer Patients Treated With Radiotherapy

    International Nuclear Information System (INIS)

    Ho, Alice Y.; Fan, Grace; Atencio, David P.; Green, Sheryl; Formenti, Silvia C.; Haffty, Bruce G.; Iyengar, Preetha B.A.; Bernstein, Jonine L.; Stock, Richard G.; Cesaretti, Jamie A.; Rosenstein, Barry S.

    2007-01-01

    Purpose: The ATM gene product is a central component of cell cycle regulation and genomic surveillance. We hypothesized that DNA sequence alterations in ATM predict for adverse effects after external beam radiotherapy for early breast cancer. Methods and Materials: A total of 131 patients with a minimum of 2 years follow-up who had undergone breast-conserving surgery and adjuvant radiotherapy were screened for sequence alterations in ATM using DNA from blood lymphocytes. Genetic variants were identified using denaturing high performance liquid chromatography. The Radiation Therapy Oncology Group late morbidity scoring schemes for skin and subcutaneous tissues were applied to quantify the radiation-induced effects. Results: Of the 131 patients, 51 possessed ATM sequence alterations located within exons or in short intron regions flanking each exon that encompass putative splice site regions. Of these 51 patients, 21 (41%) exhibited a minimum of a Grade 2 late radiation response. In contrast, of the 80 patients without an ATM sequence variation, only 18 (23%) had radiation-induced adverse responses, for an odds ratio of 2.4 (95% confidence interval, 1.1-5.2). Fifteen patients were heterozygous for the G→A polymorphism at nucleotide 5557, which causes substitution of asparagine for aspartic acid at position 1853 of the ATM protein. Of these 15 patients, 8 (53%) exhibited a Grade 2-4 late response compared with 31 (27%) of the 116 patients without this alteration, for an odds ratio of 3.1 (95% confidence interval, 1.1-9.4). Conclusion: Sequence variants located in the ATM gene, in particular the 5557 G→A polymorphism, may predict for late adverse radiation responses in breast cancer patients

  6. Follicular fluid lipid fingerprinting from women with PCOS and hyper response during IVF treatment.

    Science.gov (United States)

    Cordeiro, Fernanda Bertuccez; Cataldi, Thaís Regiani; do Vale Teixeira da Costa, Lívia; de Lima, Camila Bruna; Stevanato, Juliana; Zylbersztejn, Daniel Suslik; Ferreira, Christina Ramires; Eberlin, Marcos Nogueira; Cedenho, Agnaldo Pereira; Turco, Edson Guimarães Lo

    2015-01-01

    Polycystic ovary syndrome (PCOS) is an endocrine-metabolic disorder that leads to lower natural reproductive potential and presents a challenge for assisted reproductive medicine because patients may exhibit immature oocyte retrieval and a higher risk of ovarian hyper stimulation syndrome during in vitro fertilization (IVF) treatment. This study aimed to identify potential lipid biomarkers for women with PCOS and a hyper response to controlled ovarian stimulation. Follicular fluid samples were collected from patients who underwent IVF, including normal responder women who became pregnant (control group, n = 11), women with PCOS and a hyper response to gonadotropins (PCOS group, n = 7) and women with only hyper response to gonadotropins (HR group, n = 7). A lipidomic analysis was performed by electrospray ionization mass spectrometry, and candidate biomarkers were analyzed by tandem mass spectrometry experiment. The lipid profiles indicated particularities related to differences in phosphatidylcholine (PCOS and HR), phosphatidylserine, phosphatydilinositol and phosphatidylglycerol (control), sphingolipids (PCOS) and phosphatidylethanolamine (control and HR). These findings contribute to the understanding of the molecular mechanisms associated with lipid metabolism in the PCOS-related hyper response, and strongly suggest that these lipids may be useful as biomarkers, leading to the development of more individualized treatment for pregnancy outcome.

  7. Gut microbiota and glucometabolic alterations in response to recurrent partial sleep deprivation in normal-weight young individuals

    Directory of Open Access Journals (Sweden)

    Christian Benedict

    2016-12-01

    Full Text Available Objective: Changes to the microbial community in the human gut have been proposed to promote metabolic disturbances that also occur after short periods of sleep loss (including insulin resistance. However, whether sleep loss affects the gut microbiota remains unknown. Methods: In a randomized within-subject crossover study utilizing a standardized in-lab protocol (with fixed meal times and exercise schedules, we studied nine normal-weight men at two occasions: after two nights of partial sleep deprivation (PSD; sleep opportunity 02:45–07:00 h, and after two nights of normal sleep (NS; sleep opportunity 22:30–07:00 h. Fecal samples were collected within 24 h before, and after two in-lab nights, of either NS or PSD. In addition, participants underwent an oral glucose tolerance test following each sleep intervention. Results: Microbiota composition analysis (V4 16S rRNA gene sequencing revealed that after two days of PSD vs. after two days of NS, individuals exhibited an increased Firmicutes:Bacteroidetes ratio, higher abundances of the families Coriobacteriaceae and Erysipelotrichaceae, and lower abundance of Tenericutes (all P < 0.05 – previously all associated with metabolic perturbations in animal or human models. However, no PSD vs. NS effect on beta diversity or on fecal short-chain fatty acid concentrations was found. Fasting and postprandial insulin sensitivity decreased after PSD vs. NS (all P < 0.05. Discussion: Our findings demonstrate that short-term sleep loss induces subtle effects on human microbiota. To what extent the observed changes to the microbial community contribute to metabolic consequences of sleep loss warrants further investigations in larger and more prolonged sleep studies, to also assess how sleep loss impacts the microbiota in individuals who already are metabolically compromised. Author Video: Author Video Watch what authors say about their articles Keywords: Bacteroidetes, Firmicutes, Insulin resistance

  8. Ovarian hyperstimulation syndrome in gonadotropin-treated laboratory South African clawed frogs (Xenopus laevis).

    Science.gov (United States)

    Green, Sherril L; Parker, John; Davis, Corrine; Bouley, Donna M

    2007-05-01

    Ovarian hyperstimulation syndrome (OHS) is a rare but sometimes fatal iatrogenic complication of ovarian stimulation associated with the administration of exogenous gonadotropins to women undergoing treatment for infertility. Laboratory Xenopus spp are commonly treated with human chorionic gonadotropin (hCG) to stimulate ovulation and optimize the number of oocytes harvested for use in biomedical research. Here we report cases of OHS in 2 gonadotropin-treated laboratory Xenopus laevis. After receiving hCG, the frogs developed severe subcutaneous accumulation of fluid, coelomic distention, and whole-body edema and were unable to dive, although they continued to eat and swim. At postmortem examination, extensive subcutaneous edema was present; ascites and massive numbers of free-floating eggs were found in the coelomic cavity and in aberrant locations: around the heart-sac and adhered to the liver capsule. Whole-body edema, gross enlargement of the ovaries, ascites, and abdominal distention are findings comparable to those observed in women with OHS. The pathophysiology of OHS is thought to be related to hormonally induced disturbances of vasoactive mediators, one of which may be vascular endothelial growth factor secreted by theca and granulosa cells. We know of no other report describing OHSlike symptoms in gonadotropin-treated frogs, and the cases described here are 2 of the 3 we have observed at our respective institutions over the last 6 y. According to these results, OHS appears to be rare in gonadotropin-treated laboratory Xenopus. However, the condition should be included in the differential diagnosis for the bloated frog.

  9. Associations between postprandial insulin and blood glucose responses, appetite sensations and energy intake in normal weight and overweight individuals: a meta-analysis of test meal studies

    DEFF Research Database (Denmark)

    Flint, Anne; Gregersen, Nikolaj T.; Gluud, Lise L.

    2007-01-01

    is unclear whether postprandial blood glucose or insulin exerts a regulatory function in short-term appetite regulation in humans. The aim of this study was to investigate, by use of meta-analysis, the role of blood glucose and insulin in short-term appetite sensation and energy intake (EI......) in normal weight and overweight participants. Data from seven test meal studies were used, including 136 healthy participants (ALL) (92 normal weight (NW) and 44 overweight or obese (OW)). All meals were served as breakfasts after an overnight fast, and appetite sensations and blood samples were obtained...... frequently in the postprandial period. Finally, an ad libitum lunch was served. Data were analysed by fixed effects study level (SL) meta-regression analysis and individual participant data (IPD) regression analysis, using STATA software. In SL analysis, postprandial insulin response was associated...

  10. Comparison of Dose Response Models for Predicting Normal Tissue Complications from Cancer Radiotherapy: Application in Rat Spinal Cord

    Energy Technology Data Exchange (ETDEWEB)

    Adamus-Górka, Magdalena; Mavroidis, Panayiotis, E-mail: panayiotis.mavroidis@ki.se; Lind, Bengt K.; Brahme, Anders [Department of Medical Radiation Physics, Karolinska Institutet and Stockholm University, Stockholm S-17176 (Sweden)

    2011-05-18

    Seven different radiobiological dose-response models have been compared with regard to their ability to describe experimental data. The first four models, namely the critical volume, the relative seriality, the inverse tumor and the critical element models are mainly based on cell survival biology. The other three models: the Lyman (Gaussian distribution), the parallel architecture and the Weibull distribution models are semi-empirical and rather based on statistical distributions. The maximum likelihood estimation was used to fit the models to experimental data and the χ{sup 2}-distribution, AIC criterion and F-test were applied to compare the goodness-of-fit of the models. The comparison was performed using experimental data for rat spinal cord injury. Both the shape of the dose-response curve and the ability of handling the volume dependence were separately compared for each model. All the models were found to be acceptable in describing the present experimental dataset (p > 0.05). For the white matter necrosis dataset, the Weibull and Lyman models were clearly superior to the other models, whereas for the vascular damage case, the Relative Seriality model seems to have the best performance although the Critical volume, Inverse tumor, Critical element and Parallel architecture models gave similar results. Although the differences between many of the investigated models are rather small, they still may be of importance in indicating the advantages and limitations of each particular model. It appears that most of the models have favorable properties for describing dose-response data, which indicates that they may be suitable to be used in biologically optimized intensity modulated radiation therapy planning, provided a proper estimation of their radiobiological parameters had been performed for every tissue and clinical endpoint.

  11. Comparison of Dose Response Models for Predicting Normal Tissue Complications from Cancer Radiotherapy: Application in Rat Spinal Cord

    International Nuclear Information System (INIS)

    Adamus-Górka, Magdalena; Mavroidis, Panayiotis; Lind, Bengt K.; Brahme, Anders

    2011-01-01

    Seven different radiobiological dose-response models have been compared with regard to their ability to describe experimental data. The first four models, namely the critical volume, the relative seriality, the inverse tumor and the critical element models are mainly based on cell survival biology. The other three models: the Lyman (Gaussian distribution), the parallel architecture and the Weibull distribution models are semi-empirical and rather based on statistical distributions. The maximum likelihood estimation was used to fit the models to experimental data and the χ 2 -distribution, AIC criterion and F-test were applied to compare the goodness-of-fit of the models. The comparison was performed using experimental data for rat spinal cord injury. Both the shape of the dose-response curve and the ability of handling the volume dependence were separately compared for each model. All the models were found to be acceptable in describing the present experimental dataset (p > 0.05). For the white matter necrosis dataset, the Weibull and Lyman models were clearly superior to the other models, whereas for the vascular damage case, the Relative Seriality model seems to have the best performance although the Critical volume, Inverse tumor, Critical element and Parallel architecture models gave similar results. Although the differences between many of the investigated models are rather small, they still may be of importance in indicating the advantages and limitations of each particular model. It appears that most of the models have favorable properties for describing dose-response data, which indicates that they may be suitable to be used in biologically optimized intensity modulated radiation therapy planning, provided a proper estimation of their radiobiological parameters had been performed for every tissue and clinical endpoint

  12. Nitric oxide is involved in light-specific responses of tomato during germination under normal and osmotic stress conditions.

    Science.gov (United States)

    Piterková, Jana; Luhová, Lenka; Hofman, Jakub; Turecková, Veronika; Novák, Ondrej; Petrivalsky, Marek; Fellner, Martin

    2012-09-01

    Nitric oxide (NO) is involved in the signalling and regulation of plant growth and development and responses to biotic and abiotic stresses. The photoperiod-sensitive mutant 7B-1 in tomato (Solanum lycopersicum) showing abscisic acid (ABA) overproduction and blue light (BL)-specific tolerance to osmotic stress represents a valuable model to study the interaction between light, hormones and stress signalling. The role of NO as a regulator of seed germination and ABA-dependent responses to osmotic stress was explored in wild-type and 7B-1 tomato under white light (WL) and BL. Germination data were obtained from the incubation of seeds on germinating media of different composition. Histochemical analysis of NO production in germinating seeds was performed by fluorescence microscopy using a cell-permeable NO probe, and endogenous ABA was analysed by mass spectrometry. The NO donor S-nitrosoglutathione stimulated seed germination, whereas the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (PTIO) had an inhibitory effect. Under WL in both genotypes, PTIO strongly suppressed germination stimulated by fluridone, an ABA inhibitor. The stimulatory effect of the NO donor was also observed under osmotic stress for 7B-1 seeds under WL and BL. Seed germination inhibited by osmotic stress was restored by fluridone under WL, but less so under BL, in both genotypes. This effect of fluridone was further modulated by the NO donor and NO scavenger, but only to a minor extent. Fluorescence microscopy using the cell-permeable NO probe DAF-FM DA (4-amino-5-methylamino-2',7'-difluorofluorescein diacetate) revealed a higher level of NO in stressed 7B-1 compared with wild-type seeds. As well as defective BL signalling, the differential NO-dependent responses of the 7B-1 mutant are probably associated with its high endogenous ABA concentration and related impact on hormonal cross-talk in germinating seeds. These data confirm that light-controlled seed germination and

  13. Radiation dose response of normal lung assessed by Cone Beam CT - A potential tool for biologically adaptive radiation therapy

    International Nuclear Information System (INIS)

    Bertelsen, Anders; Schytte, Tine; Bentzen, Soren M.; Hansen, Olfred; Nielsen, Morten; Brink, Carsten

    2011-01-01

    Background: Density changes of healthy lung tissue during radiotherapy as observed by Cone Beam CT (CBCT) might be an early indicator of patient specific lung toxicity. This study investigates the time course of CBCT density changes and tests for a possible correlation with locally delivered dose. Methods: A total of 665 CBCTs in 65 lung cancer patients treated with IMRT/VMAT to 60 or 66 Gy in 2 Gy fractions were analyzed. For each patient, CBCT lung density changes during the treatment course were related to the locally delivered dose. Results: A dose response is observed for the patient population at the end of the treatment course. However, the observed dose response is highly variable among patients. Density changes at 10th and 20th fraction are clearly correlated to those observed at the end of the treatment course. Conclusions: CBCT density changes in healthy lung tissue during radiotherapy correlate with the locally delivered dose and can be detected relatively early during the treatment. If these density changes are correlated to subsequent clinical toxicity this assay could form the basis for biological adaptive radiotherapy.

  14. Immunoregulatory activities of human immunodeficiency virus (HIV) proteins: Effect of HIV recombinant and synthetic peptides on immunoglobulin synthesis and proliferative responses by normal lymphocytes

    International Nuclear Information System (INIS)

    Nair, M.P.N.; Pottathil, R.; Heimer, E.P.; Schwartz, S.A.

    1988-01-01

    Recombinant and synthetic peptides corresponding to envelope proteins of the human immunodeficiency virus (HIV) were examined for their effects on the activities of lymphocytes from normal donors in vitro. Although lymphocytes cultured with env-gag peptides produced significant amounts of IgG, addition of env-gag peptides to a pokeweed mitogen-induced B-cell activation system resulted in suppression of immunoglobulin synthesis by normal lymphocytes. Recombinant antigens, env-gag and env-80 dihydrofolate reductase (DHFR), produced a substantial proliferative response by peripheral blood mononuclear cells (PBMC) as determined by [ 3 H]thymidine incorporation. PBMC precultured with HIV synthetic peptide env 578-608 also manifested significant proliferative responses as compared to control cultures. CD3 + lymphocytes precultured with recombinant HIV antigens, env-gag and env-80 DHFR, and synthetic HIV peptide, env 487-511, showed moderate but significant proliferative responses. Both recombinant antigens and synthetic peptides also produced a dose-dependent stimulatory effect on proliferation by CD3 - lymphocytes. These studies demonstrate that recombinant and synthetic peptides of the HIV genome express immunoregulatory T- and B-cell epitopes. Identification of unique HIV epitopes with immunogenic and immunoregulatory activities is necessary for the development of an effective vaccine against HIV infection

  15. Estimation of Extreme Response and Failure Probability of Wind Turbines under Normal Operation using Probability Density Evolution Method

    DEFF Research Database (Denmark)

    Sichani, Mahdi Teimouri; Nielsen, Søren R.K.; Liu, W. F.

    2013-01-01

    Estimation of extreme response and failure probability of structures subjected to ultimate design loads is essential for structural design of wind turbines according to the new standard IEC61400-1. This task is focused on in the present paper in virtue of probability density evolution method (PDEM......), which underlies the schemes of random vibration analysis and structural reliability assessment. The short-term rare failure probability of 5-mega-watt wind turbines, for illustrative purposes, in case of given mean wind speeds and turbulence levels is investigated through the scheme of extreme value...... distribution instead of any other approximate schemes of fitted distribution currently used in statistical extrapolation techniques. Besides, the comparative studies against the classical fitted distributions and the standard Monte Carlo techniques are carried out. Numerical results indicate that PDEM exhibits...

  16. Auditory brainstem response latency in forward masking, a marker of sensory deficits in listeners with normal hearing thresholds

    DEFF Research Database (Denmark)

    Mehraei, Golbarg; Paredes Gallardo, Andreu; Shinn-Cunningham, Barbara G.

    2017-01-01

    In rodent models, acoustic exposure too modest to elevate hearing thresholds can nonetheless cause auditory nerve fiber deafferentation, interfering with the coding of supra-threshold sound. Low-spontaneous rate nerve fibers, important for encoding acoustic information at supra-threshold levels...... and in noise, are more susceptible to degeneration than high-spontaneous rate fibers. The change in auditory brainstem response (ABR) wave-V latency with noise level has been shown to be associated with auditory nerve deafferentation. Here, we measured ABR in a forward masking paradigm and evaluated wave......-V latency changes with increasing masker-to-probe intervals. In the same listeners, behavioral forward masking detection thresholds were measured. We hypothesized that 1) auditory nerve fiber deafferentation increases forward masking thresholds and increases wave-V latency and 2) a preferential loss of low...

  17. Vascular response to ischemia in the feet of falanga torture victims and normal controls--color and spectral Doppler findings

    DEFF Research Database (Denmark)

    Torp-Pedersen, Søren; Amris, Kirstine; Holm, Christian Cato

    2009-01-01

    to controls. On color Doppler this would be seen as less color after ischemia and on spectral Doppler as elevated resistive index (RI). METHODS: Ten male torture victims from the Middle East and nine age, sex and ethnically matched controls underwent Doppler examination of the abductor hallucis and flexor...... digitorum brevis muscles before and after two minutes ischemia induced with a pressure cuff over the malleoli. The color Doppler findings were quantified with the color fraction (CF) before and after ischemia. On spectral Doppler the resistive index was measured once before and three consecutive times after....... However, the trend in RI still supports the hypothesis. The negative findings may be due to inadequate design where the CF and RI were measured in one setting, perhaps resulting in both methods being applied imperfectly. The response to ischemia seems short-lived and we suggest that the Doppler methods...

  18. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  19. Cigarette smoke induces endoplasmic reticulum stress and the unfolded protein response in normal and malignant human lung cells

    Directory of Open Access Journals (Sweden)

    Yang Jin

    2008-08-01

    Full Text Available Abstract Background Although lung cancer is among the few malignancies for which we know the primary etiological agent (i.e., cigarette smoke, a precise understanding of the temporal sequence of events that drive tumor progression remains elusive. In addition to finding that cigarette smoke (CS impacts the functioning of key pathways with significant roles in redox homeostasis, xenobiotic detoxification, cell cycle control, and endoplasmic reticulum (ER functioning, our data highlighted a defensive role for the unfolded protein response (UPR program. The UPR promotes cell survival by reducing the accumulation of aberrantly folded proteins through translation arrest, production of chaperone proteins, and increased degradation. Importance of the UPR in maintaining tissue health is evidenced by the fact that a chronic increase in defective protein structures plays a pathogenic role in diabetes, cardiovascular disease, Alzheimer's and Parkinson's syndromes, and cancer. Methods Gene and protein expression changes in CS exposed human cell cultures were monitored by high-density microarrays and Western blot analysis. Tissue arrays containing samples from 110 lung cancers were probed with antibodies to proteins of interest using immunohistochemistry. Results We show that: 1 CS induces ER stress and activates components of the UPR; 2 reactive species in CS that promote oxidative stress are primarily responsible for UPR activation; 3 CS exposure results in increased expression of several genes with significant roles in attenuating oxidative stress; and 4 several major UPR regulators are increased either in expression (i.e., BiP and eIF2α or phosphorylation (i.e., phospho-eIF2α in a majority of human lung cancers. Conclusion These data indicate that chronic ER stress and recruitment of one or more UPR effector arms upon exposure to CS may play a pivotal role in the etiology or progression of lung cancers, and that phospho-eIF2α and BiP may have

  20. Spermine modulation of the glutamateNMDA receptors is differentially responsive to conantokins in normal and alzheimer disease human cortex

    International Nuclear Information System (INIS)

    Ragnarsson, L.; Dodd, P.R.; Lewis, R.; University of Queensland, QLD

    1998-01-01

    Full text: The pharmacological characteristics of human N-methyl-D-aspartate (NMDA) receptors were examined in 12 control and 6 pathologically confirmed Alzheimer disease (AD) cases in six different brain areas, by studying their responses to MK-801, glutamate, spermine, and the NMDA receptor antagonists Ala(7)-conantokinG and Lys(7)-conantokinG. [ 3 H]MK801 binding assays performed by standard protocols on well-washed synoptic plasma membranes showed little variation in k D in all six brain areas, including comparisons between control and matched AD cases. b MAX values showed regional differences within control and AD cases, but there was no significant difference between groups in any of the brain regions. Maximal glutamate-enhanced [ 3 H]MK801 binding did not vary much between the brain regions or between control and AD cases, whereas maximal spermine-enhanced [ 3 H]MK-801 binding differed significantly between certain brain regions and between control and AD cases. In absolute terms in the control cases, the activation values were much lower in the spared regions, occipital and motor cortex, than in other areas; further, areas which are susceptible to damage showed reduced spermine activation in AD cases. These regional differences in the efficacy of spermine activation might be the result of local variations in the subunit composition of the NMDA receptor. Ala(7)-conantokinG and Lys(7)-conantokinG showed slight differences in potency, with the Ala(7) compound as the more potent. Both peptides produced 100% inhibition of spermine-enhanced [ 3 H]MK-801 binding in all brain areas, ana both gave lower IC 50 values in AD cases than in control cases. The significant differences in the inhibition of spermine-enhanced [ 3 H]MK-801 binding by the peptides between control and AD cases suggest that AD cases have a particular receptor subunit composition that is responsive to polyamines and which might make them more susceptible to excitotoxic damage. The spermine site

  1. Standardization of androstenedione and estrone radioimmunoassay and profile of sex steroids, gonadotropins and prolactin - in patients with chronic anovulation due to inappropriate feedback (polycystic ovarian syndrome)

    International Nuclear Information System (INIS)

    Vilanova, Maria do Socorro Veras

    1992-01-01

    Full text. In order to evaluate the profile of the sex steroids gonadotropin and prolactin in polycystic ovarian syndrome (POS), 24 patients with POS were studied and compared with 20 normal women during the early follicular phase of the menstrual cycle. Radioimmunoassay techniques for androstenedione (A) and estrone (E 1 ) were standardized for the purpose of the study. Androstenedione and estrone were extracted from plasma with ethyl ether. The assays were maintained in equilibrium and the labelled hormone-antibody complex was then separated from the free hormone using dextran charcoal. The sensitivity of the method was 6.8 pg/tube for A and 3.7 pg/tube for E 1 . Nonspecific binding ws 3.4 for A and 3.3 for E 1 . The interessay error at the D50 level was 15.6 for A and 8.6 for E 1 . Patients with POS had significantly higher basal levels of LH, A, T E 1 and PRL and similar FSH and DHEA-S levels when compared with normal women. The LH/FSH ratio was significantly elevated and the A/T ratio was significantly decreased. The A/E 1 and T/E 2 ratios were elevated and the E 1 /E 2 was decreased, although the differences were not statistically significant. A positive correlation between A and E 1 was observed in patients with POS. In view of the above data, it was concluded that: the quality control parameters of the radioimmunoassay for A and E 1 standardized in the present study are considered satisfactory, and the assay could be used for diagnosis and research; the patients with POS have a different sex steroid and gonadotropin profile when compared normal women during the early follicular phase of the menstrual cycle

  2. Oxygen-Sensitive K+ Channels Modulate Human Chorionic Gonadotropin Secretion from Human Placental Trophoblast

    Science.gov (United States)

    Díaz, Paula; Sibley, Colin P.; Greenwood, Susan L.

    2016-01-01

    Human chorionic gonadotropin (hCG) is a key autocrine/paracrine regulator of placental syncytiotrophoblast, the transport epithelium of the human placenta. Syncytiotrophoblast hCG secretion is modulated by the partial pressure of oxygen (pO2), reactive oxygen species (ROS) and potassium (K+) channels. Here we test the hypothesis that K+ channels mediate the effects of pO2 and ROS on hCG secretion. Placental villous explants from normal term pregnancies were cultured for 6 days at 6% (normoxia), 21% (hyperoxia) or 1% (hypoxia) pO2. On days 3–5, explants were treated with 5mM 4-aminopyridine (4-AP) or tetraethylammonium (TEA), blockers of pO2-sensitive voltage-gated K+ (KV) channels, or ROS (10–1000μM H2O2). hCG secretion and lactate dehydrogenase (LDH) release, a marker of necrosis, were determined daily. At day 6, hCG and LDH were measured in tissue lysate and 86Rb (K+) efflux assessed to estimate syncytiotrophoblast K+ permeability. hCG secretion and 86Rb efflux were significantly greater in explants maintained in 21% pO2 than normoxia. 4-AP/TEA inhibited hCG secretion to a greater extent at 21% than 6% and 1% pO2, and reduced 86Rb efflux at 21% but not 6% pO2. LDH release and tissue LDH/hCG were similar in 6%, 21% and 1% pO2 and unaffected by 4-AP/TEA. H2O2 stimulated 86Rb efflux and hCG secretion at normoxia but decreased 86Rb efflux, without affecting hCG secretion, at 21% pO2. 4-AP/TEA-sensitive K+ channels participate in pO2-sensitive hCG secretion from syncytiotrophoblast. ROS effects on both hCG secretion and 86Rb efflux are pO2-dependent but causal links between the two remain to be established. PMID:26863525

  3. Single Cell Chemical Cytometry of Akt Activity in Rheumatoid Arthritis and Normal Fibroblast-like Synoviocytes in Response to Tumor Necrosis Factor α.

    Science.gov (United States)

    Mainz, Emilie R; Serafin, D Stephen; Nguyen, Tuong T; Tarrant, Teresa K; Sims, Christopher E; Allbritton, Nancy L

    2016-08-02

    The etiology of rheumatoid arthritis (RA) is poorly understood, and 30% of patients are unresponsive to established treatments targeting tumor necrosis factor α (TNFα). Akt kinase is implicated in TNFα signaling and may act as a barometer of patient responses to biologic therapies. Fluorescent peptide sensors and chemical cytometry were employed to directly measure Akt activity as well as proteolytic activity in individual fibroblast-like synoviocytes (FLS) from RA and normal subjects. The specificity of the peptide reporter was evaluated and shown to be a valid measure of Akt activity in single cells. The effect of TNFα treatment on Akt activity was highly heterogeneous between normal and RA subjects, which was not observable in bulk analyses. In 2 RA subjects, a bimodal distribution of Akt activity was observed, primarily due to a subpopulation (21.7%: RA Subject 5; 23.8%: RA Subject 6) of cells in which >60% of the reporter was phosphorylated. These subjects also possessed statistically elevated proteolytic cleavage of the reporter relative to normal subjects, suggesting heterogeneity in Akt and protease activity that may play a role in the RA-affected joint. We expect that chemical cytometry studies pairing peptide reporters with capillary electrophoresis will provide valuable data regarding aberrant kinase activity from small samples of clinical interest.

  4. Low dosing of gonadotropins in in vitro fertilization cycles for women with poor ovarian reserve: systematic review and meta-analysis.

    Science.gov (United States)

    Youssef, Mohamed Abdel-Fattah; van Wely, Madelon; Mochtar, Monique; Fouda, Usama Mohamed; Eldaly, Ashraf; El Abidin, Eman Zein; Elhalwagy, Ahmed; Mageed Abdallah, Ahmed Abdel; Zaki, Sherif Sameh; Abdel Ghafar, Mohamed Sayed; Mohesen, Mohamed Nagi; van der Veen, Fulco

    2018-02-01

    To evaluate the effectiveness of low doses of gonadotropins and gonadotropins combined with oral compounds compared with high doses of gonadotropins in ovarian stimulation regimens in terms of ongoing pregnancy per fresh IVF attempt in women with poor ovarian reserve undergoing IVF/intracytoplasmic sperm injection (ICSI) treatment. A systematic review and meta-analysis of randomized controlled studies that evaluate the effectiveness of low dosing of gonadotropins alone or combined with oral compounds compared with high doses of gonadotropins in women with poor ovarian reserve undergoing IVF/ICSI treatment. Not applicable. Subfertile women with poor ovarian reserve undergoing IVF/ICSI treatment. We searched the PubMed, EMBASE, Web of Science, the Cochrane Library, and the Clinical Trials Registry using medical subject headings and free text terms up to June 2016, without language or year restrictions. We included randomized controlled studies (RCTs) enrolling subfertile women with poor ovarian reserve undergoing IVF/ICSI treatment and comparing low doses of gonadotropins and gonadotropins combined with oral compounds versus high doses of gonadotropins. We assessed the risk of bias using the criteria recommended by the Cochrane Collaboration. We pooled the results by meta-analysis using the fixed and random effects model. The primary outcome was ongoing pregnancy rate (PR) per woman randomized. We retrieved 787 records. Fourteen RCTs (N = 2,104 women) were included in the analysis. Five studies (N = 717 women) compared low doses of gonadotropins versus high doses of gonadotropins. There was no evidence of a difference in ongoing PR (2 RCTs: risk rate 0.98, 95% confidence interval 0.62-1.57, I 2 = 0). Nine studies (N = 1,387 women) compared ovarian stimulation using gonadotropins combined with the oral compounds letrozole (n = 6) or clomiphene citrate (CC) (n = 3) versus high doses of gonadotropins. There was no evidence of a difference in ongoing PR (3 RCTs: risk

  5. Strontium-Doped Calcium Phosphate and Hydroxyapatite Granules Promote Different Inflammatory and Bone Remodelling Responses in Normal and Ovariectomised Rats

    Science.gov (United States)

    Xia, Wei; Emanuelsson, Lena; Norlindh, Birgitta; Omar, Omar; Thomsen, Peter

    2013-01-01

    The healing of bone defects may be hindered by systemic conditions such as osteoporosis. Calcium phosphates, with or without ion substitutions, may provide advantages for bone augmentation. However, the mechanism of bone formation with these materials is unclear. The aim of this study was to evaluate the healing process in bone defects implanted with hydroxyapatite (HA) or strontium-doped calcium phosphate (SCP) granules, in non-ovariectomised (non-OVX) and ovariectomised (OVX) rats. After 0 (baseline), six and 28d, bone samples were harvested for gene expression analysis, histology and histomorphometry. Tumour necrosis factor-α (TNF-α), at six days, was higher in the HA, in non-OVX and OVX, whereas interleukin-6 (IL-6), at six and 28d, was higher in SCP, but only in non-OVX. Both materials produced a similar expression of the receptor activator of nuclear factor kappa-B ligand (RANKL). Higher expression of osteoclastic markers, calcitonin receptor (CR) and cathepsin K (CatK), were detected in the HA group, irrespective of non-OVX or OVX. The overall bone formation was comparable between HA and SCP, but with topological differences. The bone area was higher in the defect centre of the HA group, mainly in the OVX, and in the defect periphery of the SCP group, in both non-OVX and OVX. It is concluded that HA and SCP granules result in comparable bone formation in trabecular bone defects. As judged by gene expression and histological analyses, the two materials induced different inflammatory and bone remodelling responses. The modulatory effects are associated with differences in the spatial distribution of the newly formed bone. PMID:24376855

  6. A lower dose threshold for the in vivo protective adaptive response to radiation. Tumorigenesis in chronically exposed normal and Trp53 heterozygous C57BL/6 mice

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.; Burchart, P.; Wyatt, H.

    2008-01-01

    Low doses of ionizing radiation to cells and animals may induce adaptive responses that reduce the risk of cancer. However, there are upper dose thresholds above which these protective adaptive responses do not occur. We have now tested the hypothesis that there are similar lower dose thresholds that must be exceeded in order to induce protective effects in vivo. We examined the effects of low dose/low dose rate fractionated exposures on cancer formation in Trp53 normal or cancer-prone Trp53 heterozygous female C57BL/6 mice. Beginning at 6 weeks of age, mice were exposed 5 days/week to single daily doses (0.33 mGy, 0.7 mGy/h) totaling 48, 97 or 146 mGy over 30, 60 or 90 weeks. The exposures for shorter times (up to 60 weeks) appeared to be below the level necessary to induce overall protective adaptive responses in Trp53 normal mice, and detrimental effects (shortened lifespan, increased frequency) evident for only specific tumor types (B- and T-cell lymphomas), were produced. Only when the exposures were continued for 90 weeks did the dose become sufficient to induce protective adaptive responses, balancing the detrimental effects for these specific cancers, and reducing the risk level back to that of the unexposed animals. Detrimental effects were not seen for other tumor types, and a protective effect was seen for sarcomas after 60 weeks of exposure, which was then lost when the exposure continued for 90 weeks. As previously shown for the upper dose threshold for protection by low doses, the lower dose boundary between protection and harm was influenced by Trp53 functionality. Neither protection nor harm was observed in exposed Trp53 heterozygous mice, indicating that reduced Trp53 function raises the lower dose/dose rate threshold for both detrimental and protective tumorigenic effects. (author)

  7. Specificity of tumor necrosis factor toxicity for human mammary carcinomas relative to normal mammary epithelium and correlation with response to doxorubicin

    International Nuclear Information System (INIS)

    Dollbaum, C.; Creasey, A.A.; Dairkee, S.H.; Hiller, A.J.; Rudolph, A.R.; Lin, L.; Vitt, C.; Smith, H.S.

    1988-01-01

    By using a unique short-term culture system capable of growing both normal and malignant breast epithelial tissue, human recombinant tumor necrosis factor (TNF) showed preferential cytotoxicity to malignant cells as compared to the corresponding nonmalignant cells. Most of the malignant specimens were sensitive to TNF with 13 of 18 specimens showing 90% inhibition of clonal growth (ID 90 ). In contrast, all 13 nonmalignant specimens tested clustered at the resistant end of the TNF response spectrum. This differential sensitivity to TNF was seen in three cases in which malignant and nonmalignant breast epithelial tissues from the same patient were studied. To investigate the mechanism of resistance to TNF by normal cells, the presence of receptors for TNF was determined. Five of six cultures showed specific binding of 125 I-labeled TNF and there was no relationship between the degree of resistance and the degree of specific binding. Simultaneous comparison of tumor responsiveness to doxorubicin and TNF revealed a positive correlation in ID 90 values; these results may have important implications for the clinical use of TNF in cancer patients heavily pretreated with doxorubicin

  8. Oral contraceptive therapy for polycystic ovary disease after chronic gonadotropin-releasing agonist administration. Predictors of continued ovarian suppression.

    Science.gov (United States)

    Elkind-Hirsch, K E; Anania, C; Malinak, R

    1996-09-01

    To study the beneficial effects of oral contraceptive (OC) therapy following gonadotropin-releasing hormone agonist (GnRH-a) administration in women with polycystic ovary disease (PCOD). Twenty-three hyperandrogenic women (aged 15-39) were randomized into two groups; GnRH-a (depot every 28 days) for six months or combination therapy (GnRH-a plus OC "addback") for six months. Following six months of treatment with either therapy, all patients received OC therapy for at least six months. The hormonal state was evaluated at three-month intervals. Hormone levels of luteinizing hormone (LH), testosterone (T) and free T remained suppressed within the normal range in 11 of 17 patients (65%) during the six months of OC only therapy, while the other six patients showed "escape" from suppression, with the LH, T and free T concentrations rising to pre-GnRH-a treatment levels. Use of OC addback therapy did not potentiate the long-acting therapeutic effect of GnRH-a pretreatment; three of six patients in the escape group were pretreated with combination therapy and three with GnRH-a only. In the majority of women with PCOD, OC therapy following GnRH-a administration was effective in maintaining ovarian androgen suppression. Failure to maintain ovarian suppression in this patient population was associated with higher elevations of baseline free T concentrations.

  9. Effects of a gonadotropin-releasing hormone vaccine on ovarian cyclicity and uterine morphology of an Asian elephant (Elephas maximus).

    Science.gov (United States)

    Boedeker, Nancy C; Hayek, Lee-Ann C; Murray, Suzan; de Avila, David M; Brown, Janine L

    2012-09-01

    This report describes the successful use of a gonadotropin-releasing hormone (GnRH) vaccine to suppress ovarian steroidogenic activity and to treat hemorrhage and anemia associated with reproductive tract pathology in a 59-year-old Asian elephant (Elephas maximus). The Repro-BLOC GnRH vaccine was administered subcutaneously as a series of 4 boosters of increasing dose from 3 to 30 mg of recombinant ovalbumin-GnRH fusion protein given at variable intervals after initial vaccination with 3 mg protein. Efficacy was confirmed over a year after initial vaccination based on complete ovarian cycle suppression determined by serum progestagen analyses. Estrous cycle suppression was associated with a significant increase in GnRH antibody binding and subsequent decrease in serum luteinizing hormone and follicle-stimulating hormone concentrations. Ultrasonographic examinations of the reproductive tract documented a reduction in uterine size and vascularity after immunization. The hematocrit level normalized soon after the initial intrauterine hemorrhage, and no recurrence of anemia has been detected. No substantive adverse effects were associated with GnRH vaccination. The results indicate that GnRH vaccination in elephants shows potential for contraception and management of uterine pathology in older elephants.

  10. Efficacy of extended clomifene citrate regimen in comparison with gonadotropins in clomifene citrate-resistant women with polycystic ovary syndrome

    OpenAIRE

    Mahmoud Fathy Hassan

    2014-01-01

    Background: Gonadotropins are successful treatment for women with clomifene citrate (CC)-resistant polycystic ovary syndrome (PCOS). The aim of this study was to test the hypothesis that extended CC treatment may be an alternative to gonadotropins in the management of CC-resistant women with PCOS. Methods: A randomized controlled trial comprised 200 women with CC-resistant PCOS were allocated to two equal treatment groups. Patients in the CC group were given 100 mg of CC daily starting fr...

  11. Responsiveness to a Physiological Regimen of GnRH Therapy and Relation to Genotype in Women With Isolated Hypogonadotropic Hypogonadism

    Science.gov (United States)

    Abel, Brent S.; Shaw, Natalie D.; Brown, Jenifer M.; Adams, Judith M.; Alati, Teresa; Martin, Kathryn A.; Pitteloud, Nelly; Seminara, Stephanie B.; Plummer, Lacey; Pignatelli, Duarte; Crowley, William F.; Welt, Corrine K.

    2013-01-01

    Context: Isolated hypogonadotropic hypogonadism (IHH) is caused by defective GnRH secretion or action resulting in absent or incomplete pubertal development and infertility. Most women with IHH ovulate with physiological GnRH replacement, implicating GnRH deficiency as the etiology. However, a subset does not respond normally, suggesting the presence of defects at the pituitary or ovary. Objectives: The objective of the study was to unmask pituitary or ovarian defects in IHH women using a physiological regimen of GnRH replacement, relating these responses to genes known to cause IHH. Design, Setting, and Subjects: This study is a retrospective analysis of 37 IHH women treated with iv pulsatile GnRH (75 ng/kg per bolus). Main Outcome Measures: Serum gonadotropin and sex steroid levels were measured, and 14 genes implicated in IHH were sequenced. Results: During their first cycle of GnRH replacement, normal cycles were recreated in 60% (22 of 37) of IHH women. Thirty percent of women (12 of 37) demonstrated an attenuated gonadotropin response, indicating pituitary resistance, and 10% (3 of 37) exhibited an exaggerated FSH response, consistent with ovarian resistance. Mutations in CHD7, FGFR1, KAL1, TAC3, and TACR3 were documented in IHH women with normal cycles, whereas mutations were identified in GNRHR, PROKR2, and FGFR1 in those with pituitary resistance. Women with ovarian resistance were mutation negative. Conclusions: Although physiological replacement with GnRH recreates normal menstrual cycle dynamics in most IHH women, hypogonadotropic responses in the first week of treatment identify a subset of women with pituitary dysfunction, only some of whom have mutations in GNRHR. IHH women with hypergonadotropic responses to GnRH replacement, consistent with an additional ovarian defect, did not have mutations in genes known to cause IHH, similar to our findings in a subset of IHH men with evidence of an additional testicular defect. PMID:23341491

  12. {sup 99m}Tc-sestamibi muscle scintigraphy to assess the response to neuromuscular electrical stimulation of normal quadriceps femoris muscle

    Energy Technology Data Exchange (ETDEWEB)

    Pekindil, Y.; Sarikaya, A.; Birtane, M.; Pekindil, G.; Salan, A. [Trakya Univ., Edirne (Turkey). Hospital

    2001-08-01

    Neuromuscular electrical stimulation (NMES) is widely used for improving muscle strength by simultaneous contraction in the prevention of muscle atrophy. Although there exist many clinical methods for evaluating the therapeutic response of muscles, {sup 99m}Tc-sestamibi which is a skeletal muscle perfusion and metabolism agent has not previously been used for this purpose. The aim of our work was to ascertain whether {sup 99m}Tc-sestamibi muscle scintigraphy is useful in the monitoring of therapeutic response to NMES in healthy women. The study included 16 women aged between 21 and 45, with a mean age of 32.7{+-}6.4. Both quadriceps femoris muscles (QFM) of each patient were studied. After randomization to remove the effect of the dominant side, one QFM of each patient was subjected to the NMES procedure for a period of 20 days. NMES was performed with an alternating biphasic rectangular current, from a computed electrical stimulator daily for 23 minutes. After measurement of skinfold thickness over the thigh, pre- and post-NMES girth measurements were assessed in centimeters. Sixty minutes after injections of 555 MBq {sup 99m}Tc-sestamibi, static images of the thigh were obtained for 5 minutes. The thigh-to-knee uptake ratio was calculated by semiquantitative analysis and normalized to body surface area (NUR=normalized uptake ratio). The difference between the pre and post NMES NUR values was significant (1.76{+-}0.31 versus 2.25{+-}0.38, p=0.0000). The percentage (%) increase in NUR values also well correlated with the % increase in thigh girth measurements (r=0.89, p=0.0000). These results indicated that {sup 99m}Tc-sestamibi muscle scintigraphy as a new tool may be useful in evaluating therapeutic response to NMES. (author)

  13. Ontogenic studies of the neural control of adenohypophyseal hormones in the rat: gonadotropins.

    Science.gov (United States)

    Becú-Villalobos, D; Lacau-Mengido, I M; Libertun, C

    1990-12-01

    1. Serotonergic, dopaminergic, and opioid systems controlling luteinizing hormone (LH) and follicle stimulating hormone (FSH) secretion develop with particular characteristics in the male and female prepubertal rats. 2. Serotonergic pathways evoke a maximal release of LH and FSH in female rats from day 12 to day 20 of age, but not in males of the same age. 3. Antidopaminergic drugs increase LH and FSH levels only in the female infantile rats. This effect is absent at birth and disappears after 20 days of age. 4. Naloxone markedly increases gonadotropins in 12-day-old females. 5. On the other hand, in 12-day-old male rats some neurotropic drugs such as diazepam could enhance LH levels, the effect being absent at other ages or in female littermates. 6. A period of high sensitivity of gonadotropins to neurotropic drugs is present during the second and third weeks of life of the rat and it is related to the sexual differentiation of the brain.

  14. Evaluation of puberty by verifying spontaneous and stimulated gonadotropin values in girls.

    Science.gov (United States)

    Chin, Vivian L; Cai, Ziyong; Lam, Leslie; Shah, Bina; Zhou, Ping

    2015-03-01

    Changes in pharmacological agents and advancements in laboratory assays have changed the gonadotropin-releasing hormone analog stimulation test. To determine the best predictive model for detecting puberty in girls. Thirty-five girls, aged 2 years 7 months to 9 years 3 months, with central precocious puberty (CPP) (n=20) or premature thelarche/premature adrenarche (n=15). Diagnoses were based on clinical information, baseline hormones, bone age, and pelvic sonogram. Gonadotropins and E2 were analyzed using immunochemiluminometric assay. Logistic regression for CPP was performed. The best predictor of CPP is the E2-change model based on 3- to 24-h values, providing 80% sensitivity and 87% specificity. Three-hour luteinizing hormone (LH) provided 75% sensitivity and 87% specificity. Basal LH lowered sensitivity to 65% and specificity to 53%. The E2-change model provided the best predictive power; however, 3-h LH was more practical and convenient when evaluating puberty in girls.

  15. Consensus statement on the use of gonadotropin-releasing hormone analogs in children

    DEFF Research Database (Denmark)

    Carel, Jean-Claude; Eugster, Erica A; Rogol, Alan

    2009-01-01

    , an equal male/female ratio, and a balanced spectrum of professional seniority and expertise. EVIDENCE: Preference was given to articles written in English with long-term outcome data. The US Public Health grading system was used to grade evidence and rate the strength of conclusions. When evidence......OBJECTIVE: Gonadotropin-releasing hormone analogs revolutionized the treatment of central precocious puberty. However, questions remain regarding their optimal use in central precocious puberty and other conditions. The Lawson Wilkins Pediatric Endocrine Society and the European Society...... for Pediatric Endocrinology convened a consensus conference to review the clinical use of gonadotropin-releasing hormone analogs in children and adolescents. PARTICIPANTS: When selecting the 30 participants, consideration was given to equal representation from North America (United States and Canada) and Europe...

  16. Response of right ventricular size, function, and pressure to supine exercise: a comparison of patients with chronic obstructive lung disease and normal subjects

    Energy Technology Data Exchange (ETDEWEB)

    Slutsky, R; Hooper, W; Ackerman, W; Moser, K

    1982-12-01

    The response of right ventricular ejection fraction (RVEF) and right ventricular end-diastolic volume (RVEDV) to exercise was studied in 11 patients with severe (FEV/sub 25/sub(%)sub(-)/sub 75/sub(%)=0.32+-0.13, mean+-SD) chronic obstructive pulmonary disease (COPD). Using gated radionuclide cardiac blood pool imaging techniques, the response of the patients with COPD was compared with that of 15 control subjects. Arterial blood gases, pulmonary arterial pressures, wedge pressure, and right ventricular pressures also were monitored in patients with COPD. The resting RVEF was lower and the resting RVEDV was higher in patients with COPD than in normals (both, P<0.01). Two of the 11 COPD patients had a RVEF during rest that was below lower limits, while 10 of 11 patients had RV dilation. Right ventricular end-diastolic pressure, measured during rest in patients with COPD, was normal (6.1+-2.1 mm Hg) and cardiac index was within normal limits (3.55+-0.82 l/min/m/sup 2/). With exercise this cardiac index rose to 5.52+-1.7/min/m/sup 2/(P<0.01) due to the increase in heart rate (83+-18 to 125+-25 beats/min; P<0.01) while stroke volume did not significantly change. During exercise, normal subjects showed an increase in RVEF while RVEDV did not change; in patients with COPD, the RVEF fell and the RVEDV increased. In the patients with COPD, mild resting arterial hypoxemia and hypercapnia were both exaggerated during exercise; and mild resting pulmonary arterial hypertension (PAm=24.3+-7.65 mm Hg) also worsened with exercise (PAm=41+-19 mm Hg, P<0.01). Correlation between change in RVEF and PAm was -0.58, and between change in RVEDV and PAm was 0.63. We conclude that patients with severe COPD often have right ventricular dilation at rest and commonly respond to supine exercise with a fall in FV ejection fraction and further dilation of the right ventricle.

  17. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  18. Comparative Gene Expression Profiling in Human Cumulus Cells according to Ovarian Gonadotropin Treatments

    Directory of Open Access Journals (Sweden)

    Said Assou

    2013-01-01

    Full Text Available In in vitro fertilization cycles, both HP-hMG and rFSH gonadotropin treatments are widely used to control human follicle development. The objectives of this study are (i to characterize and compare gene expression profiles in cumulus cells (CCs of periovulatory follicles obtained from patients stimulated with HP-hMG or rFSH in a GnRH antagonist cycle and (ii to examine their relationship with in vitro embryo development, using Human Genome U133 Plus 2.0 microarrays. Genes that were upregulated in HP-hMG-treated CCs are involved in lipid metabolism (GM2A and cell-to-cell interactions (GJA5. Conversely, genes upregulated in rFSH-treated CCs are implicated in cell assembly and organization (COL1A1 and COL3A1. Interestingly, some genes specific to each gonadotropin treatment (NPY1R and GM2A for HP-hMG; GREM1 and OSBPL6 for rFSH were associated with day 3 embryo quality and blastocyst grade at day 5, while others (STC2 and PTX3 were related to in vitro embryo quality in both gonadotropin treatments. These genes may prove valuable as biomarkers of in vitro embryo quality.

  19. Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

    Energy Technology Data Exchange (ETDEWEB)

    Shima, K.; Kitayama, S.; Nakano, R.

    1987-05-01

    Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3 beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.

  20. Hypogonadotropic hypogonadism: new identification of testicular blood flow and varicocele after treatment with gonadotropins.

    Science.gov (United States)

    ur Rehman, Khaleeq; Shahid, Khubaib; Humayun, Hina

    2014-09-01

    To investigate testicular changes in patients with hypogonadotropic hypogonadism (HH) after treatment with gonadotropins. Patients with HH were investigated and followed before and after treatment. Urology and andrology clinic of a teaching hospital. Consecutive male patients with diagnosed HH. All patients were treated with gonadotropins during the study period and later. The hormonal status and scrotal color Doppler ultrasound (CDUS) of patients was recorded before and after treatment. Twenty-six patients with HH (ages 18-43 years) were followed for 8-29 months. After treatment, serum T and secondary sex characters improved in all and spermatogenesis developed in 61.5% of patients. Before treatment, testicular (intraparenchymal blood flow) was undetectable in all and barely detectable in three patients. This improved significantly to 4.53±5.44 and 4.27±4.97 cm/second, respectively, after treatment. Subcapsular arterial flow and testicular size also improved significantly. Similarly, after treatment, transverse epididymal diameter (TED) increased significantly. At baseline, no patient had detectable varicocele on CDUS. After treatment, varicocele was demonstrable in 23% of patients. This finding was further evaluated retrospectively from our 76 HH patient files. None of them had varicocele before treatment, but after treatment 19.73% were found to have varicocele. Patients with HH responded to gonadotropins by improvement in testicular blood flow and increase in TED. In some patients, varicocele was found to develop after treatment. Copyright © 2014 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  1. Effects of equine chorionic gonadotropin (eCG) administration and ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-17

    Sep 17, 2008 ... inappropriate BCS nursing their kids, were unable give a proper response to ... in diet causes negative balance of energy for physiolo- gical activities like ..... trations of hormones and glucose in plasma and follicular fluid.

  2. Neural circuits of eye movements during performance of the visual exploration task, which is similar to the responsive search score task, in schizophrenia patients and normal subjects

    International Nuclear Information System (INIS)

    Nemoto, Yasundo; Matsuda, Tetsuya; Matsuura, Masato

    2004-01-01

    Abnormal exploratory eye movements have been studied as a biological marker for schizophrenia. Using functional MRI (fMRI), we investigated brain activations of 12 healthy and 8 schizophrenic subjects during performance of a visual exploration task that is similar to the responsive search score task to clarify the neural basis of the abnormal exploratory eye movement. Performance data, such as the number of eye movements, the reaction time, and the percentage of correct answers showed no significant differences between the two groups. Only the normal subjects showed activations at the bilateral thalamus and the left anterior medial frontal cortex during the visual exploration tasks. In contrast, only the schizophrenic subjects showed activations at the right anterior cingulate gyms during the same tasks. The activation at the different locations between the two groups, the left anterior medial frontal cortex in normal subjects and the right anterior cingulate gyrus in schizophrenia subjects, was explained by the feature of the visual tasks. Hypoactivation at the bilateral thalamus supports a dysfunctional filtering theory of schizophrenia. (author)

  3. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  4. Microdose gonadotropin-releasing hormone agonist flare-up protocol versus multiple dose gonadotropin-releasing hormone antagonist protocol in poor responders undergoing intracytoplasmic sperm injection-embryo transfer cycle.

    Science.gov (United States)

    Kahraman, Korhan; Berker, Bulent; Atabekoglu, Cem Somer; Sonmezer, Murat; Cetinkaya, Esra; Aytac, Rusen; Satiroglu, Hakan

    2009-06-01

    To compare the efficacy of microdose GnRH agonist (GnRH-a) flare-up and multiple dose GnRH antagonist protocols in patients who have a poor response to a long luteal GnRH-a protocol. Prospective, randomized, clinical study. University hospital. Forty-two poor responder patients undergoing intracytoplasmic sperm injection (ICSI)-embryo transfer cycle. Twenty-one patients received microdose leuprolide acetate (LA) (50 microg twice daily) starting on the second day of withdrawal bleeding. The other 21 patients received 0.25 mg of cetrorelix daily when the leading follicle reached 14 mm in diameter. Serum E(2) levels, number of growing follicles and mature oocytes, embryo quality, dose of gonadotropin used, cancellation, fertilization, implantation rate and pregnancy rate (PR). The mean serum E(2) concentration on the day of hCG administration was significantly higher in the microdose GnRH-a group than in the GnRH antagonist group (1,904 vs. 1,362 pg/mL). The clinical PRs per started cycle of microdose GnRH-a and GnRH antagonist groups were 14.2% and 9.5%, respectively. There were no statistically significant differences in the other ovulation induction characteristics, fertilization and implantation rates. Microdose GnRH-a flare-up protocol and multiple dose GnRH antagonist protocol seem to have similar efficacy in improving treatment outcomes of poor responder patients.

  5. Regulation of P450 oxidoreductase by gonadotropins in rat ovary and its effect on estrogen production

    Directory of Open Access Journals (Sweden)

    Uesaka Miki

    2008-12-01

    Full Text Available Abstract Background P450 oxidoreductase (POR catalyzes electron transfer to microsomal P450 enzymes. Its deficiency causes Antley-Bixler syndrome (ABS, and about half the patients with ABS have ambiguous genitalia and/or impaired steroidogenesis. POR mRNA expression is up-regulated when mesenchymal stem cells (MSCs differentiate into steroidogenic cells, suggesting that the regulation of POR gene expression is important for steroidogenesis. In this context we examined the regulation of POR expression in ovarian granulosa cells by gonadotropins, and its possible role in steroidogenesis. Methods Changes in gene expression in MSCs during differentiation into steroidogenic cells were examined by DNA microarray analysis. Changes in mRNA and protein expression of POR in the rat ovary or in granulosa cells induced by gonadotropin treatment were examined by reverse transcription-polymerase chain reaction and western blotting. Effects of transient expression of wild-type or mutant (R457H or V492E POR proteins on the production of estrone in COS-7 cells were examined in vitro. Effects of POR knockdown were also examined in estrogen producing cell-line, KGN cells. Results POR mRNA was induced in MSCs following transduction with the SF-1 retrovirus, and was further increased by cAMP treatment. Expression of POR mRNA, as well as Cyp19 mRNA, in the rat ovary were induced by equine chorionic gonadotropin and human chorionic gonadotropin. POR mRNA and protein were also induced by follicle stimulating hormone in primary cultured rat granulosa cells, and the induction pattern was similar to that for aromatase. Transient expression of POR in COS-7 cells, which expressed a constant amount of aromatase protein, greatly increased the rate of conversion of androstenedione to estrone, in a dose-dependent manner. The expression of mutant POR proteins (R457H or V492E, such as those found in ABS patients, had much less effect on aromatase activity than expression of wild

  6. Pituitary Gonadotropins, Prolactin and Growth Hormone Differentially Regulate AQP1 Expression in the Porcine Ovarian Follicular Cells

    Directory of Open Access Journals (Sweden)

    Mariusz T. Skowronski

    2017-12-01

    Full Text Available The present in vitro study analyzed whether the hormones that affect the ovarian follicular steroidogenesis process also participate in the regulation of AQP1 mRNA and protein expression. Granulosa (Gc and theca cells (Tc of medium and large porcine ovarian follicles were exposed to follicle-stimulating hormone (FSH, luteinizing hormone (LH, prolactin (PRL and growth hormone (GH for 24 h in separated cells and co-cultures of these cells. Real-time PCR, Western blotting, immunofluorescence and volumetric analysis were then performed. Gonadotropins, PRL and GH had a stimulatory impact on AQP1 mRNA and protein expression in Gc and Tc of medium and large ovarian cells. Moreover, swelling assays, in response to a hypotonic environment, demonstrated the functional presence of AQPs in porcine Gc and Tc. Immunofluorescence analysis showed that AQP1 protein was mainly localized in the perinuclear region of the cytoplasm, endosomes and cell membranes of Gc and Tc from medium and large follicles. It seems possible that AQP1 present in Gc and Tc cells may be implicated not only in the regulation of water homeostasis required for follicle development but also in cell proliferation and migration.

  7. Malware Normalization

    OpenAIRE

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  8. Exercise training normalizes renal blood flow responses to acute hypoxia in experimental heart failure: role of the α1-adrenergic receptor.

    Science.gov (United States)

    Pügge, Carolin; Mediratta, Jai; Marcus, Noah J; Schultz, Harold D; Schiller, Alicia M; Zucker, Irving H

    2016-02-01

    Recent data suggest that exercise training (ExT) is beneficial in chronic heart failure (CHF) because it improves autonomic and peripheral vascular function. In this study, we hypothesized that ExT in the CHF state ameliorates the renal vasoconstrictor responses to hypoxia and that this beneficial effect is mediated by changes in α1-adrenergic receptor activation. CHF was induced in rabbits. Renal blood flow (RBF) and renal vascular conductance (RVC) responses to 6 min of 5% isocapnic hypoxia were assessed in the conscious state in sedentary (SED) and ExT rabbits with CHF with and without α1-adrenergic blockade. α1-adrenergic receptor expression in the kidney cortex was also evaluated. A significant decline in baseline RBF and RVC and an exaggerated renal vasoconstriction during acute hypoxia occurred in CHF-SED rabbits compared with the prepaced state (P renal denervation (DnX) blocked the hypoxia-induced renal vasoconstriction in CHF-SED rabbits. α1-adrenergic protein in the renal cortex of animals with CHF was increased in SED animals and normalized after ExT. These data provide evidence that the acute decline in RBF during hypoxia is caused entirely by the renal nerves but is only partially mediated by α1-adrenergic receptors. Nonetheless, α1-adrenergic receptors play an important role in the beneficial effects of ExT in the kidney. Copyright © 2016 the American Physiological Society.

  9. HPA axis response to social stress is attenuated in schizophrenia but normal in depression: evidence from a meta-analysis of existing studies.

    Science.gov (United States)

    Ciufolini, Simone; Dazzan, Paola; Kempton, Matthew J; Pariante, Carmine; Mondelli, Valeria

    2014-11-01

    We conducted a meta-analysis to investigate the HPA axis response to social stress in studies that used the Trier Social Stress Test (TSST), or comparable distressing paradigms, in individuals with either depression or schizophrenia. Sample size-adjusted effect sizes (Hedge's g statistic) were calculated to estimate the HPA axis stress response to social stress. We used a meta-regression model to take into account the moderating effect of the baseline cortisol level. Participants with depression show an activation pattern to social stress similar to that of healthy controls. Despite a normal cortisol production rate, individuals with schizophrenia have lower cortisol levels than controls both in anticipation and after exposure to social stress. Participants with depression and higher cortisol levels before the task have an increased cortisol production and reached higher cortisol levels during the task. This may be explained by the presence of an impaired negative feedback. The activation pattern present in schizophrenia may explain the reduced ability to appropriately contextualize past experiences shown by individuals with psychosis in social stressful situation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Use of Sine Shaped High-Frequency Rhythmic Visual Stimuli Patterns for SSVEP Response Analysis and Fatigue Rate Evaluation in Normal Subjects

    Directory of Open Access Journals (Sweden)

    Ahmadreza Keihani

    2018-05-01

    Full Text Available Background: Recent EEG-SSVEP signal based BCI studies have used high frequency square pulse visual stimuli to reduce subjective fatigue. However, the effect of total harmonic distortion (THD has not been considered. Compared to CRT and LCD monitors, LED screen displays high-frequency wave with better refresh rate. In this study, we present high frequency sine wave simple and rhythmic patterns with low THD rate by LED to analyze SSVEP responses and evaluate subjective fatigue in normal subjects.Materials and Methods: We used patterns of 3-sequence high-frequency sine waves (25, 30, and 35 Hz to design our visual stimuli. Nine stimuli patterns, 3 simple (repetition of each of above 3 frequencies e.g., P25-25-25 and 6 rhythmic (all of the frequencies in 6 different sequences e.g., P25-30-35 were chosen. A hardware setup with low THD rate (<0.1% was designed to present these patterns on LED. Twenty two normal subjects (aged 23–30 (25 ± 2.1 yrs were enrolled. Visual analog scale (VAS was used for subjective fatigue evaluation after presentation of each stimulus pattern. PSD, CCA, and LASSO methods were employed to analyze SSVEP responses. The data including SSVEP features and fatigue rate for different visual stimuli patterns were statistically evaluated.Results: All 9 visual stimuli patterns elicited SSVEP responses. Overall, obtained accuracy rates were 88.35% for PSD and > 90% for CCA and LASSO (for TWs > 1 s. High frequency rhythmic patterns group with low THD rate showed higher accuracy rate (99.24% than simple patterns group (98.48%. Repeated measure ANOVA showed significant difference between rhythmic pattern features (P < 0.0005. Overall, there was no significant difference between the VAS of rhythmic [3.85 ± 2.13] compared to the simple patterns group [3.96 ± 2.21], (P = 0.63. Rhythmic group had lower within group VAS variation (min = P25-30-35 [2.90 ± 2.45], max = P35-25-30 [4.81 ± 2.65] as well as least individual pattern VAS (P25

  11. Different serotonin receptor types participate in 5-hydroxytryptophan-induced gonadotropins and prolactin release in the female infantile rat.

    Science.gov (United States)

    Lacau-Mengido, I M; Libertun, C; Becú-Villalobos, D

    1996-05-01

    Serotonin (5-HT) receptors can be classified into at least three, possibly up to seven, classes of receptors. They comprise the 5-HT1, 5-HT2, and 5-HT3 classes, the "uncloned' 5-HT4 receptor and the recombinant receptors 5-ht5, 5-ht6 and 5-ht7. We investigated the role of different serotonin receptor types in a neuroendocrine response to the activation of the serotonergic system. Female immature rats were chosen as an experimental model as it has been shown that during the 3rd week of life, and not at later developmental stages, 5-hydroxytryptophan (5-HTP, a serotonin precursor) induces gonadotropin release in females and not in males. Besides, at this age, serotonin releases prolactin in both sexes. 5-HTP (50 mg/kg) released prolactin, luteinizing hormone (LH) and follicle-stimulating hormone (FSH) as expected. Ketanserin (5-HT2A antagonist) and methysergide (5-HT2C antagonist) blocked 5-HTP-induced prolactin release, but did not block the LH or FSH responses. Ondansetron (5-HT3 receptor antagonist) did not modify prolactin response to 5-HTP, whereas it blocked 5-HTP-induced LH and FSH release. Propranolol (5-HT1 and beta-adrenergic antagonist) blocked prolactin, LH and FSH release induced by 5-HTP. The 5-HT2C agonist 1-(3-chlorophenyl)piperazine dihydrochloride released prolactin, without modifying LH or FSH release. Methyl-quipazine and phenylbiguanide (5-HT3 agonists) increased both LH and FSH levels, without altering prolactin secretion. The present experiments indicate that serotonin acting at the 5-HT3 receptor mediates LH and FSH release in infantile female rats, whereas 5-HT2C or 2A receptor types participate in the release of prolactin at this age. 5-HT1 receptor type may be involved in the release of the three hormones, though a beta-adrenergic component of the response cannot be discarded.

  12. Gonadotropin Releasing Hormone (GnRH) Neuron Migration: Initiation, Maintenance and Cessation as Critical Steps to Ensure Normal Reproductive Function

    OpenAIRE

    Wierman, Margaret E.; Kiseljak-Vassiliades, Katja; Tobet, Stuart

    2010-01-01

    GnRH neurons follow a carefully orchestrated journey from their birth in the olfactory placode area. Initially, they migrate along with the vomeronasal nerve into the brain at the cribriform plate, then progress caudally to sites within the hypothalamus where they halt and send projections to the median eminence to activate pituitary gonadotropes. Many factors controlling this precise journey have been elucidated by the silencing or over expression of candidate genes in mouse models. Importan...

  13. Differences in Normal Tissue Response in the Esophagus Between Proton and Photon Radiation Therapy for Non-Small Cell Lung Cancer Using In Vivo Imaging Biomarkers.

    Science.gov (United States)

    Niedzielski, Joshua S; Yang, Jinzhong; Mohan, Radhe; Titt, Uwe; Mirkovic, Dragan; Stingo, Francesco; Liao, Zhongxing; Gomez, Daniel R; Martel, Mary K; Briere, Tina M; Court, Laurence E

    2017-11-15

    To determine whether there exists any significant difference in normal tissue toxicity between intensity modulated radiation therapy (IMRT) or proton therapy for the treatment of non-small cell lung cancer. A total of 134 study patients (n=49 treated with proton therapy, n=85 with IMRT) treated in a randomized trial had a previously validated esophageal toxicity imaging biomarker, esophageal expansion, quantified during radiation therapy, as well as esophagitis grade (Common Terminology Criteria for Adverse Events version 3.0), on a weekly basis during treatment. Differences between the 2 modalities were statically analyzed using the imaging biomarker metric value (Kruskal-Wallis analysis of variance), as well as the incidence and severity of esophagitis grade (χ 2 and Fisher exact tests, respectively). The dose-response of the imaging biomarker was also compared between modalities using esophageal equivalent uniform dose, as well as delivered dose to an isotropic esophageal subvolume. No statistically significant difference in the distribution of esophagitis grade, the incidence of grade ≥3 esophagitis (15 and 11 patients treated with IMRT and proton therapy, respectively), or the esophageal expansion imaging biomarker between cohorts (P>.05) was found. The distribution of imaging biomarker metric values had similar distributions between treatment arms, despite a slightly higher dose volume in the proton arm (P>.05). Imaging biomarker dose-response was similar between modalities for dose quantified as esophageal equivalent uniform dose and delivered esophageal subvolume dose. Regardless of treatment modality, there was high variability in imaging biomarker response, as well as esophagitis grade, for similar esophageal doses between patients. There was no significant difference in esophageal toxicity from either proton- or photon-based radiation therapy as quantified by esophagitis grade or the esophageal expansion imaging biomarker. Copyright © 2017 Elsevier

  14. Dynamical response of the Galileo Galilei on the ground rotor to test the equivalence principle: Theory, simulation, and experiment. I. The normal modes

    International Nuclear Information System (INIS)

    Comandi, G.L.; Chiofalo, M.L.; Toncelli, R.; Bramanti, D.; Polacco, E.; Nobili, A.M.

    2006-01-01

    Recent theoretical work suggests that violation of the equivalence principle might be revealed in a measurement of the fractional differential acceleration η between two test bodies-of different compositions, falling in the gravitational field of a source mass--if the measurement is made to the level of η≅10 -13 or better. This being within the reach of ground based experiments gives them a new impetus. However, while slowly rotating torsion balances in ground laboratories are close to reaching this level, only an experiment performed in a low orbit around the Earth is likely to provide a much better accuracy. We report on the progress made with the 'Galileo Galilei on the ground' (GGG) experiment, which aims to compete with torsion balances using an instrument design also capable of being converted into a much higher sensitivity space test. In the present and following articles (Part I and Part II), we demonstrate that the dynamical response of the GGG differential accelerometer set into supercritical rotation-in particular, its normal modes (Part I) and rejection of common mode effects (Part II)-can be predicted by means of a simple but effective model that embodies all the relevant physics. Analytical solutions are obtained under special limits, which provide the theoretical understanding. A simulation environment is set up, obtaining a quantitative agreement with the available experimental data on the frequencies of the normal modes and on the whirling behavior. This is a needed and reliable tool for controlling and separating perturbative effects from the expected signal, as well as for planning the optimization of the apparatus

  15. Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight

    Science.gov (United States)

    Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu

    2017-08-01

    Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p trafficking, promote early response, mediating C-myc related proliferation, promote antiapoptotic activity and protects

  16. Normal accidents

    International Nuclear Information System (INIS)

    Perrow, C.

    1989-01-01

    The author has chosen numerous concrete examples to illustrate the hazardousness inherent in high-risk technologies. Starting with the TMI reactor accident in 1979, he shows that it is not only the nuclear energy sector that bears the risk of 'normal accidents', but also quite a number of other technologies and industrial sectors, or research fields. The author refers to the petrochemical industry, shipping, air traffic, large dams, mining activities, and genetic engineering, showing that due to the complexity of the systems and their manifold, rapidly interacting processes, accidents happen that cannot be thoroughly calculated, and hence are unavoidable. (orig./HP) [de

  17. Evaluation of the association of vitamin D deficiency with gonadotropins and sex hormone in obese and non-obese women with polycystic ovary syndrome.

    Science.gov (United States)

    Velija-Ašimi, Zelija

    2014-02-01

    To evaluate the association of vitamin D (VD) deficiency with gonadotropins and sex hormone in obese and non-obese women with polycystic ovary syndrome (PCOS). Of the total of 140 women, thirty obese and thirty nonobese, aged 20-40 years, were included in the study. Inclusion criteria were the women with normal level of thyroid-stimulating hormone (TSH), prolactin (PRL), parathyroid hormone (PTH), and calcium, and those who had not received any medication or VD supplementation within the last 6 months. Serum 25- hydroxyvitamin D (25(OH)D), C-reactive protein (CRP), lipid profile, fasting serum glucose, basal insulin, homeostasis model analysis of insulin resistance (HOMA-IR) index, follicle-stimulating hormone (FSH), luteinizing hormone (LH), oestrogen, total testosterone, dehidroepiandrostendion-sulphat (DHEA-S), androstendione, and sex hormone binding globulin (SHBG) were determined at follicular phase. Body mass index (BMI), weight, waist, lipids, and CRP were significantly higher in obese than in non-obese PCOS women (p=0.000). Meanwhile, insulin and HOMA-IR were also higher in the obese PCOS (p less than 0.000), and so was the fasting glucose (p=0.004). Furthermore, obese PCOS showed significantly higher level of LH (p=0.012), but lower level of progesterone (p=0.001) and androstendione (p=0.006) than in non-obese PCOS. In total 68% of PCOS women had VD deficiency but without significant difference among groups according to BMI. There was no association of VD deficiency with gonadotropins and sex hormones except SHBG. Insulin resistance was a better independent risk factor for the presence of vitamin D deficiency than SHBG. The insulin resistance and vitamin D deficiency significantly predicted the obesity risk in PCOS women.

  18. alpha-difluoromethylornithine modifies gonadotropin-releasing hormone release and follicle-stimulating hormone secretion in the immature female rat.

    Science.gov (United States)

    Thyssen, S M; Becú-Villalobos, D; Lacau-Mengido, I M; Libertun, C

    1997-06-01

    Polyamines play an essential role in tissue growth and differentiation, in body weight increment, in brain organization, and in the molecular mechanisms of hormonal action, intracellular signaling, and cell-to-cell communication. In a previous study, inhibition of their synthesis by alpha-difluoromethylornithine (DFMO), a specific and irreversible inhibitor of ornithine decarboxylase, during development in female rats, was followed by prolonged high follicle-stimulating hormone (FSH) serum level and a delayed puberty onset. Those changes were relatively independent of body mass and did not impair posterior fertility. The present work studies the mechanisms and site of action of polyamine participation in FSH secretion during development. DFMO was injected in female rats between Days 1 and 9 on alternate days. At 10 days of age, hypothalami from control and DFMO rats were perifused in vitro, and basal and potassium-induced gonadotropin-releasing hormone (GnRH) release were measured. The response to membrane depolarization was altered in DFMO hypothalami. Increased GnRH release in response to a low K+ concentration was evidenced. Adenohypophyses of the same treated prepubertal rats were perifused in vitro and the response to GnRH pulses was checked. In DFMO-treated rats, higher FSH release was observed, with no changes in LH or PRL secretion. Finally, pituitary GnRH receptor number in adenohypophyseal membranes from treated and control groups was quantified. A significant reduction in specific binding was evident in hypophyses from DFMO-treated rats when compared with binding in the control group. In summary, DFMO treatment in a critical developmental period in the female rat impacts the immature GnRH neuronal network and immature gonadotropes. A delay in maturation is evidenced by a higher sensitivity to secretagogs in both pituitary glands and hypothalamic explants. These events could explain the prolonged high FSH serum levels and delayed puberty onset seen in

  19. Peritoneal Adhesion and Angiogenesis in Ovarian Carcinoma Are Inversely Regulated by Hyaluronan: The Role of Gonadotropins

    Directory of Open Access Journals (Sweden)

    Yael Chagit Tzuman

    2010-01-01

    Full Text Available Ovarian carcinoma is the leading cause of death among gynecologic cancers. Although transformation of the outer ovarian epithelium was linked with ovulation, the disease is significantly more prevalent and severe in postmenopausal women. We postulated that menopause could augment ovarian cancer progression through the effects of gonadotropins on multifocal seeding to the mesothelial layer lining the peritoneum. This seeding is mediated by integrins as well as by CD44 interaction with hyaluronan (HA. Here, we report the effect of gonadotropins on HA synthesis and degradation and on peritoneal adhesion. A significant concentration- and time-dependent induction in expression levels of HA synthases (HASs and hyaluronidases (Hyals was observed in vitro on stimulation of human epithelial ovarian carcinoma cells by gonadotropins. Hormonal regulation of HA-mediated adhesion was manifested in vivo as well, by fluorescence microscopy of stained MLS multicellular tumor spheroids. The number of spheroids adhered to the mesothelium of ovariectomized CD-1 nude mice 9.5 hours after intraperitoneal insertion was significantly higher than in nonovariectomized mice. Inhibition of HA synthesis by 6-diazo-5-oxo-1-norleucine (DON both in spheroids and ovariectomized mice significantly reduced the number of adhered spheroids. Thus, the change in the hormonal environment during menopause assists in HA-dependent adherence of ovarian cancer spheroids onto the peritoneum. However, HA is antiangiogenic and it can significantly suppress tumor progression. Accordingly, angiogenesis of the adhered spheroids was significantly elevated in DON-treated tumors. These results can explain the selective pressure that can lead to simultaneously increased tumor expression of both HASs and Hyals.

  20. Negative feedback governs gonadotrope frequency-decoding of gonadotropin releasing hormone pulse-frequency.

    Directory of Open Access Journals (Sweden)

    Stefan Lim

    Full Text Available The synthesis of the gonadotropin subunits is directed by pulsatile gonadotropin-releasing hormone (GnRH from the hypothalamus, with the frequency of GnRH pulses governing the differential expression of the common alpha-subunit, luteinizing hormone beta-subunit (LHbeta and follicle-stimulating hormone beta-subunit (FSHbeta. Three mitogen-activated protein kinases, (MAPKs, ERK1/2, JNK and p38, contribute uniquely and combinatorially to the expression of each of these subunit genes. In this study, using both experimental and computational methods, we found that dual specificity phosphatase regulation of the activity of the three MAPKs through negative feedback is required, and forms the basis for decoding the frequency of pulsatile GnRH. A fourth MAPK, ERK5, was shown also to be activated by GnRH. ERK5 was found to stimulate FSHbeta promoter activity and to increase FSHbeta mRNA levels, as well as enhancing its preference for low GnRH pulse frequencies. The latter is achieved through boosting the ultrasensitive behavior of FSHbeta gene expression by increasing the number of MAPK dependencies, and through modulating the feedforward effects of JNK activation on the GnRH receptor (GnRH-R. Our findings contribute to understanding the role of changing GnRH pulse-frequency in controlling transcription of the pituitary gonadotropins, which comprises a crucial aspect in regulating reproduction. Pulsatile stimuli and oscillating signals are integral to many biological processes, and elucidation of the mechanisms through which the pulsatility is decoded explains how the same stimulant can lead to various outcomes in a single cell.

  1. Pancreatic beta-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes.

    Science.gov (United States)

    Asmar, Meena; Højberg, Patricia V; Deacon, Carolyn F; Hare, Kristine; Holst, Jens J; Madsbad, Sten

    2010-02-25

    This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both days, while AUC proinsulin/C-peptide ratio was higher with GLP-1 (P=0.02). In the patients, amylin, C-peptide and proinsulin AUCs were unaltered by near-normoglycaemia per se. Proinsulin responses to GLP-1 were unchanged, but amylin and C-peptide AUCs increased (PAUC amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks of near-normoglycaemia, whereas GLP-1 increased amylin and C-peptide secretion and amylin/C-peptide ratio. Near-normoglycaemia reduced proinsulin/C-peptide ratio during stimulation with GLP-1, suggesting that strict glycaemic control might ameliorate some of the disturbances in beta-cell function characterizing T2DM. Copyright 2010 Elsevier B.V. All rights reserved.

  2. Reconstructing Normality

    DEFF Research Database (Denmark)

    Gildberg, Frederik Alkier; Bradley, Stephen K.; Fristed, Peter Billeskov

    2012-01-01

    Forensic psychiatry is an area of priority for the Danish Government. As the field expands, this calls for increased knowledge about mental health nursing practice, as this is part of the forensic psychiatry treatment offered. However, only sparse research exists in this area. The aim of this study...... was to investigate the characteristics of forensic mental health nursing staff interaction with forensic mental health inpatients and to explore how staff give meaning to these interactions. The project included 32 forensic mental health staff members, with over 307 hours of participant observations, 48 informal....... The intention is to establish a trusting relationship to form behaviour and perceptual-corrective care, which is characterized by staff's endeavours to change, halt, or support the patient's behaviour or perception in relation to staff's perception of normality. The intention is to support and teach the patient...

  3. Pursuing Normality

    DEFF Research Database (Denmark)

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease......BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... was to understand the reflections on cancer survivorship care of lymphoma survivors to aid the future planning of cancer survivorship care and overcome barriers to participation. METHODS: Data were generated in a hematological ward during 4 months of ethnographic fieldwork, including participant observation and 46...

  4. A facile and sensitive peptide-modulating graphene oxide nanoribbon catalytic nanoplasmon analytical platform for human chorionic gonadotropin

    Directory of Open Access Journals (Sweden)

    Liang A

    2017-12-01

    Full Text Available Aihui Liang,1,2,* Chongning Li,1,2,* Dan Li,1,2,* Yanghe Luo,1–3 Guiqing Wen,1,2 Zhiliang Jiang1,2 1Key Laboratory of Ecology of Rare and Endangered Species and Environmental Protection, Guangxi Normal University, Ministry of Education, 2Guangxi Key Laboratory of Environmental Pollution Control Theory and Technology, Guilin University of Technology, Guilin, 3School of Food and Bioengineering, Hezhou University, Hezhou, China *These authors contributed equally to this work Abstract: The nanogold reaction between HAuCl4 and citrate is very slow, and the catalyst graphene oxide nanoribbon (GONR enhanced the nanoreaction greatly to produce gold nanoparticles (AuNPs that exhibited strong surface plasmon resonance (SPR absorption (Abs at 550 nm and resonance Rayleigh scattering (RRS at 550 nm. Upon addition of the peptide of human chorionic gonadotropin (hCG, the peptide could adsorb on the GONR surface, which inhibited the catalysis. When hCG was added, peptides were separated from the GONR surface due to the formation of stable peptide–hCG complex, which led to the activation of GONR catalytic effect. With the increase in hCG concentration, the RRS and Abs signal enhanced linearly. The enhanced RRS value showed a good linear relationship with hCG concentration in the range of 0.2–20 ng/mL, with a detection limit of 70 pg/mL. Accordingly, two new GONR catalytic RRS/Abs methods were established for detecting hCG in serum samples. Keywords: nanocatalysis, graphene oxide nanoribbon, peptide regulation, hCG, RRS

  5. Prospective assessment of early fetal loss using an immunoenzymometric screening assay for detection of urinary human chorionic gonadotropin.

    Science.gov (United States)

    Taylor, C A; Overstreet, J W; Samuels, S J; Boyers, S P; Canfield, R E; O'Connor, J F; Hanson, F W; Lasley, B L

    1992-06-01

    To develop an economical, nonradiometric immunoenzymometric assay (IEMA) for the detection of urinary human chorionic gonadotropin (hCG) in studies of early fetal loss. To be effective, the IEMA must have a sensitivity equal to the standard immunoradiometric assay (IRMA) and sufficient specificity to eliminate the need for screening most nonconceptive cycles with the expensive and labor-intensive IRMA. Two different assays were used to measure hCG in daily early morning urine samples from potential conceptive cycles. Women undergoing donor artificial insemination (AI) were evaluated in a prospective study. Ninety-two women volunteers were selected on the basis of apparent normal reproductive health. Artificial insemination with nonfrozen donor semen was performed by cervical cup twice each menstrual cycle at 48-hour intervals, and daily urine samples were self-collected throughout the menstrual cycle. An IEMA was developed to detect urinary hCG using the same antibodies as in the standard IRMA; a study was designed to determine whether this nonradiometric assay could successfully detect the early fetal loss that was detected by the IRMA. Of 224 menstrual cycles analyzed by both assays, a total of six early fetal losses were detected by the IRMA. When the tentative screening rule was set to allow all six of these losses and 95% of future losses to be detected by the IEMA, an additional 34 false-positive results were detected by the IEMA. The specificity of the IEMA with this rule was calculated to be 84%. An IEMA based on the same antibodies used for the standard IRMA can serve as an efficient screening assay for the detection of early fetal loss. When the IEMA is used in this manner, nearly 80% of screened menstrual cycles can be eliminated without further testing by the IRMA.

  6. Effects of peripubertal gonadotropin-releasing hormone agonist on brain development in sheep--a magnetic resonance imaging study.

    Science.gov (United States)

    Nuruddin, Syed; Bruchhage, Muriel; Ropstad, Erik; Krogenæs, Anette; Evans, Neil P; Robinson, Jane E; Endestad, Tor; Westlye, Lars T; Madison, Cindee; Haraldsen, Ira Ronit Hebold

    2013-10-01

    In many species sexual dimorphisms in brain structures and functions have been documented. In ovine model, we have previously demonstrated that peri-pubertal pharmacological blockade of gonadotropin releasing hormone (GnRH) action increased sex-differences of executive emotional behavior. The structural substrate of this behavioral alteration however is unknown. In this magnetic resonance image (MRI) study on the same animals, we investigated the effects of GnRH agonist (GnRHa) treatment on the volume of total brain, hippocampus and amygdala. In total 41 brains (17 treated; 10 females and 7 males, and 24 controls; 11 females and 13 males) were included in the MRI study. Image acquisition was performed with 3-T MRI scanner. Segmentation of the amygdala and the hippocampus was done by manual tracing and total gray and white matter volumes were estimated by means of automated brain volume segmentation of the individual T2-weighted MRI volumes. Statistical comparisons were performed with general linear models. Highly significant GnRHa treatment effects were found on the volume of left and right amygdala, indicating larger amygdalae in treated animals. Significant sex differences were found for total gray matter and right amygdala, indicating larger volumes in male compared to female animals. Additionally, we observed a significant interaction between sex and treatment on left amygdala volume, indicating stronger effects of treatment in female compared to male animals. The effects of GnRHa treatment on amygdala volumes indicate that increasing GnRH concentration during puberty may have an important impact on normal brain development in mammals. These novel findings substantiate the need for further studies investigating potential neurobiological side effects of GnRHa treatment on the brains of young animals and humans. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Pancreatic beta-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Asmar, Meena; Højberg, Patricia V; Deacon, Carolyn F

    2010-01-01

    glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both......This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood...... amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks...

  8. Pancreatic ß-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Asmar, Meena; Højberg, Patricia; Deacon, Carolyn F.

    2010-01-01

    glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both......This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood...... amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks...

  9. Plasma ceramide levels are altered in low and normal birth weight men in response to short-term high-fat overfeeding

    DEFF Research Database (Denmark)

    Ribel-Madsen, Amalie; Ribel-Madsen, Rasmus; Nielsen, Kristian Fog

    2018-01-01

    Low birth weight (LBW) individuals have an increased risk of developing insulin resistance and type 2 diabetes compared with normal birth weight (NBW) individuals. We hypothesised that LBW individuals exhibit an increased fatty acid flux into lipogenesis in non-adipose tissue with a resulting...... accumulation of lipotoxic lipids, including ceramides, in the blood. Therefore, we measured fasting plasma levels of 27 ceramides in 18 young, healthy, LBW men and 25 NBW controls after an isocaloric control diet and a 5-day high-fat, high-calorie diet by HPLC-HRMS. LBW men did not show elevated plasma......:0–18:1/d18:1–18:0 and d18:1–24:2/d18:2–24:1 levels and increased the d18:0–24:1a level in response to overfeeding. Plasma d18:0–24:1a and total ceramide levels were positively associated with the fasting blood glucose level and endogenous glucose production after the control diet, and the total ceramide...

  10. In vitro fertilization (IVF) versus gonadotropins followed by IVF as treatment for primary infertility: a cost-based decision analysis.

    Science.gov (United States)

    Kansal-Kalra, Suleena; Milad, Magdy P; Grobman, William A

    2005-09-01

    To compare the economic consequences of proceeding directly to IVF to those of proceeding with gonadotropins followed by IVF in patients cost and success of each infertility regimen as well as the pregnancy-associated costs of singleton or multiple gestations and the risk and cost of cerebral palsy. Cost per live birth. Both treatment arms resulted in a >80% chance of birth. The gonadotropin arm was over four times more likely to result in a high-order multiple pregnancy (HOMP). Despite this, when the base case estimates were utilized, immediate IVF emerged as more costly per live birth. In sensitivity analysis, immediate IVF became less costly per live birth when IVF was more likely to achieve birth (55.1%) or cheaper (11,432 dollars) than our base case assumptions. After considering the risk and cost of HOMP, immediate IVF is more costly per live birth than a trial of gonadotropins prior to IVF.

  11. Expression and Role of Gonadotropin-Releasing Hormone 2 and Its Receptor in Mammals

    Directory of Open Access Journals (Sweden)

    Amy T. Desaulniers

    2017-12-01

    Full Text Available Gonadotropin-releasing hormone 1 (GnRH1 and its receptor (GnRHR1 drive mammalian reproduction via regulation of the gonadotropins. Yet, a second form of GnRH (GnRH2 and its receptor (GnRHR2 also exist in mammals. GnRH2 has been completely conserved throughout 500 million years of evolution, signifying high selection pressure and a critical biological role. However, the GnRH2 gene is absent (e.g., rat or inactivated (e.g., cow and sheep in some species but retained in others (e.g., human, horse, and pig. Likewise, many species (e.g., human, chimpanzee, cow, and sheep retain the GnRHR2 gene but lack the appropriate coding sequence to produce a full-length protein due to gene coding errors; although production of GnRHR2 in humans remains controversial. Certain mammals lack the GnRHR2 gene (e.g., mouse or most exons entirely (e.g., rat. In contrast, old world monkeys, musk shrews, and pigs maintain the coding sequence required to produce a functional GnRHR2. Like GnRHR1, GnRHR2 is a 7-transmembrane, G protein-coupled receptor that interacts with Gαq/11 to mediate cell signaling. However, GnRHR2 retains a cytoplasmic tail and is only 40% homologous to GnRHR1. A role for GnRH2 and its receptor in mammals has been elusive, likely because common laboratory models lack both the ligand and receptor. Uniquely, both GnRH2 and GnRHR2 are ubiquitously expressed; transcript levels are abundant in peripheral tissues and scarcely found in regions of the brain associated with gonadotropin secretion, suggesting a divergent role from GnRH1/GnRHR1. Indeed, GnRH2 and its receptor are not physiological modulators of gonadotropin secretion in mammals. Instead, GnRH2 and GnRHR2 coordinate the interaction between nutritional status and sexual behavior in the female brain. Within peripheral tissues, GnRH2 and its receptor are novel regulators of reproductive organs. GnRH2 and GnRHR2 directly stimulate steroidogenesis within the porcine testis. In the female, GnRH2 and

  12. Effects of X-irradiation on gonadotropin secretion in rat anterior pituitary cells

    International Nuclear Information System (INIS)

    Li Xinmin; Liu Shuzheng

    1988-01-01

    The dispersed rat anterior pituitary cells cultured in 3 days was exposed to single doses of X-irradiation in the range of 0.5-8.0 Gy. LH and FSH contents in both the supernatant and the cells were measured. The LH secretion was significantly increased at the doses greater than 0.5 Gy and FSH secretion was also significantly enhanced at the dose of 4.0 Gy. The cellular contents of both LH and FSH remained near the control levels. It is concluded that gonadotropin secretion can be stimulated by single doses of X-rays in the range of 0.5-8.0 Gy

  13. Monoclonal antibodies to human chorionic gonadotropin and their application to two-site sandwich radioimmunoassay

    International Nuclear Information System (INIS)

    Mizuchi, A.; Iio, M.; Miyachi, Y.

    1984-01-01

    Monoclonal antibodies were prepared against human chorionic gonadotropin (HCG). One monoclonal antibody recognized a conformational determinant expressed only on native HCG molecule and another monoclonal antibody had the specificity for the epitopes located on the β-subunit of HCG. Monoclonal antibodies reacting with different antigenic determinants on the HCG molecule were used to develop a simplified 2-site sandwich radioimmunoassay in which one monoclonal antibody was immobilized and another labeled with 125 iodine. This assay was highly specific for HCG and there was no cross-reactivity with α,β-subunit of HCG, luteinizing hormone and follicle stimulating hormone. (Auth.)

  14. The gonadotropin-releasing hormone antagonist protocol--the protocol of choice for the polycystic ovary syndrome patient undergoing controlled ovarian stimulation

    DEFF Research Database (Denmark)

    Kol, Shahar; Homburg, Roy; Alsbjerg, Birgit

    2012-01-01

    Polycystic ovary syndrome (PCOS) patients are prone to develop ovarian hyperstimulation syndrome (OHSS), a condition which can be minimized or completely eliminated by the use of a gonadotropin-releasing hormone agonist (GnRHa) trigger. In this commentary paper, we maintain that the gonadotropin-...... ongoing pregnancy rates in the subsequent frozen-thawed transfer cycles....

  15. Efficacy and Outcome Predictors of Gonadotropin Treatment for Male Congenital Hypogonadotropic Hypogonadism: A Retrospective Study of 223 Patients.

    Science.gov (United States)

    Liu, Zhaoxiang; Mao, Jangfeng; Wu, Xueyan; Xu, Hongli; Wang, Xi; Huang, Bingkun; Zheng, Junjie; Nie, Min; Zhang, Hongbing

    2016-03-01

    Gonadotropin induces masculinization and spermatogenesis in men with congenital hypogonadotropic hypogonadism (CHH). However, large cohort studies for the efficacy and reliable predictors of this therapy need to be conducted. The aim of this study was to investigate the efficacy of gonadotropin treatment in a large cohort of male CHH patients and analyze putative predictors for successful spermatogenesis. This retrospective study included 223 CHH azoospermic patients without puberty development treated between 2005 and 2014. All patients received combined human chorionic gonadotropin (HCG) and human menopausal gonadotropin (HMG) and were followed up for >6 months (5109 person-months). Serum total testosterone level, testicular size, spermatogenesis, and pregnancy outcome were recorded at each visit. After gonadotropin therapy, testicular size was enlarged from 2.1 ± 1.6 to 8.1 ± 4.6 mL (P 0/mL) occurred at a median period of 15 months (95% confidence interval 13.5-16.5). Larger basal testicular volume (P = 0.012) and noncryptorchidism history (P = 0.028) are independent predictors for earlier sperm appearance. Sixty four percent (143/223) of patients succeeded in producing sperms and the average time for initial sperm detection was 14 ± 8 months. However, their sperm concentrations (11.7 [2.1, 24.4] million/mL) and sperm progressive motility (A + B 36.9% ± 20.2%) are significantly lower than World Health Organization standards. Of the 34 patients who desired for fathering children, 19 patients impregnanted their partners during the treatment. Gonadotropin therapy induces spermatogenesis in male CHH patients. A larger basal testicular size and noncryptorchidism history are favorable indicators for earlier spermatogenesis.

  16. Low-dose gonadotropin induction of ovulation in anovulatory women - still needed in the age of IVF.

    Science.gov (United States)

    White, Davinia; Hardy, Kate; Lovelock, Suzannah; Franks, Stephen

    2018-02-19

    Low-dose, step-up gonadotropin is the treatment of choice for women with PCOS who have not conceived after anti-estrogen treatment, and as an effective alternative to pulsatile GnRH in women with hypogonadotropic hypogonadism (HH). There has been, however, no large-scale, comparative study between the two groups using low-dose gonadotropins. Here we performed a retrospective, comparative analysis, in a single clinic database, of efficacy and safety of induction of ovulation using low-dose gonadotropins in 364 Women with PCOS and 80 women with HH. The rate of ovulation was high in both PCOS (83%) and HH (84%) but mono-follicular, ovulatory cycles were more prevalent in PCOS than in HH (77% vs 53%, p<0.0001) and the proportion of cycles that were abandoned was higher in HH than in PCOS (25% vs 15%, p<0.0001). The median threshold dose of gonadotropin required to induce ovulation was 75iu/day in PCOS and 113iu/day in HH (p<0.001) and the range of doses was greater in HH women. Forty-nine percent of women with PCOS and 65% of those with HH conceived (more than 90% within 6 cycles of treatment) and had a least one pregnancy. Multiple pregnancies (all twins) occurred in only 4% of women with PCOS and 5% of those with HH. These findings emphasise the efficacy and safety of low-dose gonadotropin treatment for both clomiphene-resistant women with PCOS and those with HH. These results highlight the importance of choosing the more physiological approach of gonadotropin induction of ovulation in both groups as the most appropriate treatment, in preference to IVF.

  17. Ameliorative effects of exogenous gonadotropins on reproductive profiles of replacement gilts with delayed puberty in a farm in Thailand

    OpenAIRE

    Am-In, Nutthee; Roongsitthichai, Atthaporn

    2017-01-01

    This study was to investigate the effect of gonadotropins on reproductive profiles of replacement gilts with delayed puberty. Totally, 136 Landrace × Yorkshire crossbred gilts, were categorized into control (n = 58) and treatment (n = 78) groups. Gonadotropins (400 U eCG plus 200 IU hCG) were administered in treatment group only. The results revealed that gilts in treatment group had higher number of gilts with estrus (92.3 vs 25.9%, P < 0.001), shorter onset to estrus (4.7 ± 0.3 vs 9.0 ± 0.8...

  18. Role of Stroma-Derived Extracellular Matrix in Regulation of Growth and Hormonal Responsiveness of Normal and Cancerous Human Breast Epithelium

    National Research Council Canada - National Science Library

    Woodward, Terry

    1997-01-01

    Specific extracellular matrix (ECM) proteins and their cellular receptors (integrins) are required for normal mammary gland morphogenesis and differentiation, while their expression is dramatically altered during tumorigenesis...

  19. Effect of cortisol on gonadotropin inhibitory hormone (GnIH) in the cinnamon clownfish, Amphiprion melanopus.

    Science.gov (United States)

    Choi, Young Jae; Habibi, Hamid R; Kil, Gyung-Suk; Jung, Min-Min; Choi, Cheol Young

    2017-04-01

    Hypothalamic peptides, gonadotropin-releasing hormone (GnRH) and gonadotropin inhibitory hormone (GnIH), play pivotal roles in the control of reproduction and gonadal maturation in fish. In the present study we tested the possibility that stress-mediated reproductive dysfunction in teleost may involve changes in GnRH and GnIH activity. We studied expression of brain GnIH, GnIH-R, seabream GnRH (sbGnRH), as well as circulating levels of follicle stimulating hormone (FSH), and luteinizing hormone (LH) in the cinnamon clownfish, Amphiprion melanopus. Treatment with cortisol increased GnIH mRNA level, but reduced sbGnRH mRNA and circulating levels of LH and FSH in cinnamon clownfish. Using double immunofluorescence staining, we found expression of both GnIH and GnRH in the diencephalon region of cinnamon clownfish brain. These findings support the hypothesis that cortisol, an indicator of stress, affects reproduction, in part, by increasing GnIH in cinnamon clownfish which contributes to hypothalamic suppression of reproductive function in A. melanopus, a protandrous hermaphroditic fish. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Possible role of serum testosterone, gonadotropins and prolactin in patients with premature ejaculation.

    Science.gov (United States)

    Abu El-Hamd, M; Farah, A

    2018-02-01

    Premature ejaculation (PE) is the most common male sexual dysfunction. This study aimed to investigate the role of serum testosterone, gonadotropins and prolactin in patients with PE. In a prospective a case-controlled study, it was conducted on 90 male patients with PE and 90 male healthy participants as controls. Patients were evaluated by Premature Ejaculation Diagnostic Tool (PEDT) and intravaginal ejaculatory latency time (IELT). Patients with mean IELT values ≤60 s and PEDT total scores ≥11 were considered to have PE. Serum levels of total testosterone (TT), free testosterone (FT), follicle-stimulating hormone (FSH), luteinising hormone (LH) and prolactin (PL) were investigated in patients with PE and controls. There was no statistically significant difference between patients with PE and controls regarding the serum levels of TT, FT, FSH, LH and PL (p value ˃.05). There was no significant correlation between the sex hormones levels (TT, FT, FSH, LH and PL) and (age, body mass index (BMI), IELTS and total PEDT scores of the patients; p value ˃.05). This study concluded that there was no disturbance in serum levels of testosterone, gonadotropins and prolactin in patients with PE and controls. These hormones could not relate to pathogenesis of PE. © 2017 Blackwell Verlag GmbH.

  1. Gonadotropin stimulates oocyte translation by increasing magnesium activity through intracellular potassium-magnesium exchange

    International Nuclear Information System (INIS)

    Horowitz, S.B.; Tluczek, L.J.

    1989-01-01

    We previously showed that gonadotropin increases the K + activity in Xenopus oocytes and that this is a signal for increased translation. However, K + need not act to control synthesis directly but may act through an unidentified downstream effector. Using microinjection to vary the salt content of oocytes and concomitantly measuring [ 3 H]leucine incorporation, we found that small changes in Mg 2+ greatly affect translation rates. (Ca 2+ had little influence.) By measuring intracellular ion activities, we found that oocyte cations existed in a buffer-like (ion-exchange) equilibrium in which K + and Mg 2+ are the preponderant monovalent and divalent cations. Hence, increasing cellular K + activity might increase translation by causing Mg 2+ activity to rise. If so, the increased translation rates produced by hormone treatment or K + injection would be prevented by EDTA, a Mg 2+ chelating agent. This prediction was tested and confirmed. We conclude that, when gonadotropin increases K + activity, the cell's internal ion-exchange equilibrium is altered thereby increasing Mg 2+ activity and this up-regulates translation

  2. Neurokinin B and serum albumin limit copper binding to mammalian gonadotropin releasing hormone.

    Science.gov (United States)

    Gul, Ahmad Samir; Tran, Kevin K; Jones, Christopher E

    2018-02-26

    Gonadotropin releasing hormone (GnRH) triggers secretion of luteinizing hormone and follicle stimulating hormone from gonadotropic cells in the anterior pituitary gland. GnRH is able to bind copper, and both in vitro and in vivo studies have suggested that the copper-GnRH complex is more potent at triggering gonadotropin release than GnRH alone. However, it remains unclear whether copper-GnRH is the active species in vivo. To explore this we have estimated the GnRH-copper affinity and have examined whether GnRH remains copper-bound in the presence of serum albumin and the neuropeptide neurokinin B, both copper-binding proteins that GnRH will encounter in vivo. We show that GnRH has a copper dissociation constant of ∼0.9 × 10 -9  M, however serum albumin and neurokinin B can extract metal from the copper-GnRH complex. It is therefore unlikely that a copper-GnRH complex will survive transit through the pituitary portal circulation and that any effect of copper must occur outside the bloodstream in the absence of neurokinin B. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. South Asian women with polycystic ovary syndrome exhibit greater sensitivity to gonadotropin stimulation with reduced fertilization and ongoing pregnancy rates than their Caucasian counterparts.

    Science.gov (United States)

    Palep-Singh, M; Picton, H M; Vrotsou, K; Maruthini, D; Balen, A H

    2007-10-01

    Polycystic ovary syndrome (PCOS) is a heterogeneous syndrome. In vitro fertilization (IVF)/intracytoplasmic sperm injection (ICSI) is required for PCOS cases that are refractory to standard ovulation induction or have co-existing infertility factors in women with PCOS and Tubal factor subfertility. Assess ethnic variations in response to IVF/ICSI treatment. Observational Comparative study in a University hospital fertility clinic in women with PCOS and Tubal factor subfertility. Women with PCOS (Asians: AP=104; Caucasians: CP=220) and those with tubal factor infertility seeking fertility treatment were assessed (Asians: AC=84; Caucasians: CC=200). Six hundred and eight fresh IVF or ICSI cycles using long protocol of GnRHa suppression and resulting in a fresh embryo transfer were compared. The primary endpoint was to assess the dose of gonadotropins used in the cycles. The secondary outcomes were: total number of oocytes retrieved, fertilization and ongoing clinical pregnancy rates. We found that the South Asian women presented at a younger age for the management of sub-fertility. An extended stimulation phase and Caucasian ethnicity showed an inverse correlation with the number of oocytes retrieved in the PCOS subgroup. Caucasian ethnicity was associated with a higher fertilization rate however increase in body mass index (BMI) and the laboratory technique of IVF appeared to have a negative impact on fertilization rates in the PCOS subgroup. Commencing down regulation on day 1 of the cycles was negatively associated with fertilization rates in the tubal group. In terms of clinical pregnancy rates, the Caucasian PCOS had a 2.5 times (95% CI: 1.25-5) higher chance of an ongoing clinical pregnancy as compared with their Asian counterpart. Also, a unit increase in the basal FSH concentration reduced the odds of pregnancy by 18.6% (95% CI: 1.8-32.6%) in the PCOS group. The Asian PCOS have a greater sensitivity to gonadotropin stimulation with lower fertilization and

  4. Fanconi anemia A is a nucleocytoplasmic shuttling molecule required for gonadotropin-releasing hormone (GnRH) transduction of the GnRH receptor.

    Science.gov (United States)

    Larder, Rachel; Karali, Dimitra; Nelson, Nancy; Brown, Pamela

    2006-12-01

    GnRH binds its cognate G protein-coupled GnRH receptor (GnRHR) located on pituitary gonadotropes and drives expression of gonadotropin hormones. There are two gonadotropin hormones, comprised of a common alpha- and hormone-specific beta-subunit, which are required for gonadal function. Recently we identified that Fanconi anemia a (Fanca), a DNA damage repair gene, is differentially expressed within the LbetaT2 gonadotrope cell line in response to stimulation with GnRH. FANCA is mutated in more than 60% of cases of Fanconi anemia (FA), a rare genetically heterogeneous autosomal recessive disorder characterized by bone marrow failure, endocrine tissue cancer susceptibility, and infertility. Here we show that induction of FANCA protein is mediated by the GnRHR and that the protein constitutively adopts a nucleocytoplasmic intracellular distribution pattern. Using inhibitors to block nuclear import and export and a GnRHR antagonist, we demonstrated that GnRH induces nuclear accumulation of FANCA and green fluorescent protein (GFP)-FANCA before exporting back to the cytoplasm using the nuclear export receptor CRM1. Using FANCA point mutations that locate GFP-FANCA to the cytoplasm (H1110P) or functionally uncouple GFP-FANCA (Q1128E) from the wild-type nucleocytoplasmic distribution pattern, we demonstrated that wild-type FANCA was required for GnRH-induced activation of gonadotrope cell markers. Cotransfection of H1110P and Q1128E blocked GnRH activation of the alphaGsu and GnRHR but not the beta-subunit gene promoters. We conclude that nucleocytoplasmic shuttling of FANCA is required for GnRH transduction of the alphaGSU and GnRHR gene promoters and propose that FANCA functions as a GnRH-induced signal transducer.

  5. Use of Sine Shaped High-Frequency Rhythmic Visual Stimuli Patterns for SSVEP Response Analysis and Fatigue Rate Evaluation in Normal Subjects.

    Science.gov (United States)

    Keihani, Ahmadreza; Shirzhiyan, Zahra; Farahi, Morteza; Shamsi, Elham; Mahnam, Amin; Makkiabadi, Bahador; Haidari, Mohsen R; Jafari, Amir H

    2018-01-01

    Background: Recent EEG-SSVEP signal based BCI studies have used high frequency square pulse visual stimuli to reduce subjective fatigue. However, the effect of total harmonic distortion (THD) has not been considered. Compared to CRT and LCD monitors, LED screen displays high-frequency wave with better refresh rate. In this study, we present high frequency sine wave simple and rhythmic patterns with low THD rate by LED to analyze SSVEP responses and evaluate subjective fatigue in normal subjects. Materials and Methods: We used patterns of 3-sequence high-frequency sine waves (25, 30, and 35 Hz) to design our visual stimuli. Nine stimuli patterns, 3 simple (repetition of each of above 3 frequencies e.g., P25-25-25) and 6 rhythmic (all of the frequencies in 6 different sequences e.g., P25-30-35) were chosen. A hardware setup with low THD rate ( 90% for CCA and LASSO (for TWs > 1 s). High frequency rhythmic patterns group with low THD rate showed higher accuracy rate (99.24%) than simple patterns group (98.48%). Repeated measure ANOVA showed significant difference between rhythmic pattern features ( P rhythmic [3.85 ± 2.13] compared to the simple patterns group [3.96 ± 2.21], ( P = 0.63). Rhythmic group had lower within group VAS variation (min = P25-30-35 [2.90 ± 2.45], max = P35-25-30 [4.81 ± 2.65]) as well as least individual pattern VAS (P25-30-35). Discussion and Conclusion: Overall, rhythmic and simple pattern groups had higher and similar accuracy rates. Rhythmic stimuli patterns showed insignificantly lower fatigue rate than simple patterns. We conclude that both rhythmic and simple visual high frequency sine wave stimuli require further research for human subject SSVEP-BCI studies.

  6. Neural responses to visual food stimuli after a normal vs. higher protein breakfast in breakfast-skipping teens: a pilot fMRI study.

    Science.gov (United States)

    Leidy, Heather J; Lepping, Rebecca J; Savage, Cary R; Harris, Corey T

    2011-10-01

    This functional magnetic resonance imaging (fMRI) pilot study identified whether breakfast consumption would alter the neural activity in brain regions associated with food motivation and reward in overweight "breakfast skipping" (BS) adolescent girls and examined whether increased protein at breakfast would lead to additional alterations. Ten girls (Age: 15 ± 1 years; BMI percentile 93 ± 1%; BS 5 ± 1×/week) completed 3 testing days. Following the BS day, the participants were provided with, in randomized order, normal protein (NP; 18 ± 1 g protein) or higher protein (HP; 50 ± 1 g protein) breakfast meals to consume at home for 6 days. On day 7 of each pattern, the participants came to the laboratory to consume their respective breakfast followed by appetite questionnaires and an fMRI brain scan to identify brain activation responses to viewing food vs. nonfood images prior to lunch. Breakfast consumption led to enduring (i.e., 3-h post breakfast) reductions in neural activation in the hippocampus, amygdala, cingulate, and parahippocampus vs. BS. HP led to enduring reductions in insula and middle prefrontal cortex activation vs. NP. Hippocampal, amygdala, cingulate, and insular activations were correlated with appetite and inversely correlated with satiety. In summary, the addition of breakfast led to alterations in brain activation in regions previously associated with food motivation and reward with additional alterations following the higher-protein breakfast. These data suggest that increased dietary protein at breakfast might be a beneficial strategy to reduce reward-driven eating behavior in overweight teen girls. Due to the small sample size, caution is warranted when interpreting these preliminary findings.

  7. Changes in gonadotropin-releasing hormone and gonadotropin-releasing hormone receptor gene expression after an increase in carbon monoxide concentration in the cavernous sinus of male wild boar and pig crossbread.

    Science.gov (United States)

    Romerowicz-Misielak, M; Tabecka-Lonczynska, A; Koziol, K; Gilun, P; Stefanczyk-Krzymowska, S; Och, W; Koziorowski, M

    2016-06-01

    Previous studies indicate that there are at least a few regulatory systems involved in photoperiodic synchronisation of reproductive activity, which starts with the retina and ends at the gonadotropin-releasing hormone (GnRH) pulse generator. Recently we have shown indicated that the amount of carbon monoxide (CO) released from the eye into the ophthalmic venous blood depends on the intensity of sunlight. The aim of this study was to test whether changes in the concentration of carbon monoxide in the ophthalmic venous blood may modulate reproductive activity, as measured by changes in GnRH and GnRH receptor gene expression. The animal model used was mature male swine crossbred from wild boars and domestic sows (n = 48). We conducted in vivo experiments to determine the effect of increased CO concentrations in the cavernous sinus of the mammalian perihypophyseal vascular complex on gene expression of GnRH and GnRH receptors as well as serum luteinizing hormone (LH) levels. The experiments were performed during long photoperiod days near the summer solstice (second half of June) and short photoperiod days near the winter solstice (second half of December). These crossbred swine demonstrated a seasonally-dependent marked variation in GnRH and GnRH receptor gene expression and systemic LH levels in response to changes in CO concentration in ophthalmic venous blood. These results seem to confirm the hypothesis of humoral phototransduction as a mechanism for some of bright light's effects in animal chronobiology and the effect of CO on GnRH and GnRH receptor gene expression.

  8. Predicting the effect of gonadotropin-releasing hormone (GnRH) analogue treatment on uterine leiomyomas based on MR imaging

    Energy Technology Data Exchange (ETDEWEB)

    Matsuno, Y.; Yamashita, Y.; Takahashi, M. [Dept. of Radiology, Kumamoto Univ. School of Medicine, Kumamoto (Japan); Katabuchi, H.; Okamura, H. [Dept. of Gynecology and Obstetrics, Kumamoto Univ. School of Medicine, Kumamoto (Japan); Kitano, Y.; Shimamura, T. [Dept. of Gynecology and Obstetrics, Amakusa Chuou General Hospital, Hondo (Japan)

    1999-11-01

    Purpose: To test the hypothesis that the simple assessment of signal intensity on T2-weighted MR images is predictive of the effect of hormonal treatment with gonadotropin-releasing hormone (GnRH) analogue. Material and methods: The correlation between T2-weighted MR imaging of uterine leiomyomas and histologic findings was evaluated using 85 leiomyomas from 62 females who underwent myomectomy or hysterectomy. We also correlated the pretreatment MR images features obtained in 110 women with 143 leiomyomas with the effect of GnRH analogue treatment. The size (length x width x depth) of the leiomyoma was evaluated before and at 6 months after treatment by ultrasound. Results: The proportion of leiomyoma cell fascicles and that of extracellular matrix affected signal intensities of uterine leiomyomas on T2-weighted MR images. The amount of extracellular matrix was predominant in hypointense leiomyomas on T2-weighted images, while diffuse intermediate signal leiomyomas were predominantly composed of leiomyoma cell fascicles. Marked degenerative changes were noted in leiomyomas with heterogenous hyperintensity. The homogeneously intermediate signal intensity leiomyomas showed significant size reduction after treatment (size ratio; posttreatment volume/pretreatment volume 0.29{+-}0.11). The size ratio for the hypointense tumors was 0.82{+-}0.14, and 0.82{+-}0.18 for the heterogeneously hyperintense tumors. There was a significant difference in the response to treatment between the homogeneously intermediate signal intensity leiomyomas and the hypointense or heterogeneously hyperintense leiomyomas (both p<0.01). Conclusion: Signal intensity on T2-weighted MR images depends on the amount of leiomyoma cell fascicles and extracellular matrix. Simple assessment of the MR signal intensity is useful in predicting the effect of GnRH analogue on uterine leiomyomas. (orig.)

  9. Molecular and functional characterization of a novel gonadotropin-releasing-hormone receptor isolated from the common octopus (Octopus vulgaris).

    Science.gov (United States)

    Kanda, Atsuhiro; Takahashi, Toshio; Satake, Honoo; Minakata, Hiroyuki

    2006-04-01

    GnRH (gonadotropin-releasing hormone) plays a pivotal role in the regulation of reproduction in vertebrates through interaction with a specific receptor. Previously, we isolated a GnRH homologue, oct-GnRH, from the common octopus (Octopus vulgaris). In the present study, we have identified a GnRH receptor (oct-GnRHR) specific for oct-GnRH from Octopus brain. Oct-GnRHR includes domains and motifs typical of vertebrate GnRH receptors. The intron-inserted positions are conserved between oct-GnRHR and the chordate GnRHR genes. The oct-GnRHR expressed in Xenopus (South African clawed frog) oocytes was responsive to oct-GnRH, but not to any other HPLC fractions of the Octopus brain extract. These results show that oct-GnRHR is an authentic receptor for oct-GnRH. Southern blotting of reverse-transcription PCR products revealed that the oct-GnRHR mRNA was widely distributed in the central and peripheral nervous systems and in several peripheral tissues. In situ hybridization showed that oct-GnRHR mRNA was expressed in some regions involved in autonomic functions, feeding, memory and movement. Oct-GnRH was shown to induce steroidogenesis of testosterone, progesterone and 17beta-oestradiol in Octopus ovary and testis, where oct-GnRHR was abundantly expressed. These results suggest that oct-GnRH, like its vertebrate counterparts, acts as a multifunctional neurotransmitter, neuromodulator and hormone-like factor, both in Octopus central nervous system and peripheral tissues, and that both structure and functions of the GnRH family are, at least partially, evolutionarily conserved between octopuses and chordates.

  10. Molecular and functional characterization of a novel gonadotropin-releasing-hormone receptor isolated from the common octopus (Octopus vulgaris)

    Science.gov (United States)

    Kanda, Atsuhiro; Takahashi, Toshio; Satake, Honoo; Minakata, Hiroyuki

    2005-01-01

    GnRH (gonadotropin-releasing hormone) plays a pivotal role in the regulation of reproduction in vertebrates through interaction with a specific receptor. Previously, we isolated a GnRH homo-logue, oct-GnRH, from the common octopus (Octopus vulgaris). In the present study, we have identified a GnRH receptor (oct-GnRHR) specific for oct-GnRH from Octopus brain. Oct-GnRHR includes domains and motifs typical of vertebrate GnRH receptors. The intron-inserted positions are conserved between oct-GnRHR and the chordate GnRHR genes. The oct-GnRHR expressed in Xenopus (South African clawed frog) oocytes was responsive to oct-GnRH, but not to any other HPLC fractions of the Octopus brain extract. These results show that oct-GnRHR is an authentic receptor for oct-GnRH. Southern blotting of reverse-transcription PCR products revealed that the oct-GnRHR mRNA was widely distributed in the central and peripheral nervous systems and in several peripheral tissues. In situ hybridiz-ation showed that oct-GnRHR mRNA was expressed in some regions involved in autonomic functions, feeding, memory and movement. Oct-GnRH was shown to induce steroidogenesis of testosterone, progesterone and 17β-oestradiol in Octopus ovary and testis, where oct-GnRHR was abundantly expressed. These results suggest that oct-GnRH, like its vertebrate counterparts, acts as a multifunctional neurotransmitter, neuromodulator and hormone-like factor, both in Octopus central nervous system and peripheral tissues, and that both structure and functions of the GnRH family are, at least partially, evolutionarily conserved between octopuses and chordates. PMID:16367741

  11. Predicting the effect of gonadotropin-releasing hormone (GnRH) analogue treatment on uterine leiomyomas based on MR imaging

    International Nuclear Information System (INIS)

    Matsuno, Y.; Yamashita, Y.; Takahashi, M.; Katabuchi, H.; Okamura, H.; Kitano, Y.; Shimamura, T.

    1999-01-01

    Purpose: To test the hypothesis that the simple assessment of signal intensity on T2-weighted MR images is predictive of the effect of hormonal treatment with gonadotropin-releasing hormone (GnRH) analogue. Material and methods: The correlation between T2-weighted MR imaging of uterine leiomyomas and histologic findings was evaluated using 85 leiomyomas from 62 females who underwent myomectomy or hysterectomy. We also correlated the pretreatment MR images features obtained in 110 women with 143 leiomyomas with the effect of GnRH analogue treatment. The size (length x width x depth) of the leiomyoma was evaluated before and at 6 months after treatment by ultrasound. Results: The proportion of leiomyoma cell fascicles and that of extracellular matrix affected signal intensities of uterine leiomyomas on T2-weighted MR images. The amount of extracellular matrix was predominant in hypointense leiomyomas on T2-weighted images, while diffuse intermediate signal leiomyomas were predominantly composed of leiomyoma cell fascicles. Marked degenerative changes were noted in leiomyomas with heterogenous hyperintensity. The homogeneously intermediate signal intensity leiomyomas showed significant size reduction after treatment (size ratio; posttreatment volume/pretreatment volume 0.29±0.11). The size ratio for the hypointense tumors was 0.82±0.14, and 0.82±0.18 for the heterogeneously hyperintense tumors. There was a significant difference in the response to treatment between the homogeneously intermediate signal intensity leiomyomas and the hypointense or heterogeneously hyperintense leiomyomas (both p<0.01). Conclusion: Signal intensity on T2-weighted MR images depends on the amount of leiomyoma cell fascicles and extracellular matrix. Simple assessment of the MR signal intensity is useful in predicting the effect of GnRH analogue on uterine leiomyomas. (orig.)

  12. The estrogen myth: potential use of gonadotropin-releasing hormone agonists for the treatment of Alzheimer's disease.

    Science.gov (United States)

    Casadesus, Gemma; Garrett, Matthew R; Webber, Kate M; Hartzler, Anthony W; Atwood, Craig S; Perry, George; Bowen, Richard L; Smith, Mark A

    2006-01-01

    Estrogen and other sex hormones have received a great deal of attention for their speculative role in Alzheimer's disease (AD), but at present a direct connection between estrogen and the pathogenesis of AD remains elusive and somewhat contradictory. For example, on one hand there is a large body of evidence suggesting that estrogen is neuroprotective and improves cognition, and that hormone replacement therapy (HRT) at the onset of menopause reduces the risk of developing AD decades later. However, on the other hand, studies such as the Women's Health Initiative demonstrate that HRT initiated in elderly women increases the risk of dementia. While estrogen continues to be investigated, the disparity of findings involving HRT has led many researchers to examine other hormones of the hypothalamic-pituitary-gonadal axis such as luteinising hormone (LH) and follicle-stimulating hormone. In this review, we propose that LH, rather than estrogen, is the paramount player in the pathogenesis of AD. Notably, both men and women experience a 3- to 4-fold increase in LH with aging, and LH receptors are found throughout the brain following a regional pattern remarkably similar to those neuron populations affected in AD. With respect to disease, serum LH level is increased in women with AD relative to non-diseased controls, and levels of LH in the brain are also elevated in AD. Mechanistically, we propose that elevated levels of LH may be a fundamental instigator responsible for the aberrant reactivation of the cell cycle that is seen in AD. Based on these aforementioned aspects, clinical trials underway with leuprolide acetate, a gonadotropin-releasing hormone agonist that ablates serum LH levels, hold great promise as a ready means of treatment in individuals afflicted with AD.

  13. OVULATION INDUCTION IN PREMATURE OVARIAN FAILURE - A PLACEBO-CONTROLLED RANDOMIZED TRIAL COMBINING PITUITARY SUPPRESSION WITH GONADOTROPIN STIMULATION

    NARCIS (Netherlands)

    VANKASTEREN, YM; HOEK, A; SCHOEMAKER, J

    Objectives: To determine the effect of pituitary suppression with a GnRH agonist (GnRH-a) on the success of ovulation induction with exogenous gonadotropins in patients with premature ovarian failure (POF). Design: Placebo-controlled, randomized, double-blind study. The data were analyzed with a

  14. River profile response to normal fault growth and linkage: an example from the Hellenic forearc of south-central Crete, Greece

    Science.gov (United States)

    Gallen, Sean F.; Wegmann, Karl W.

    2017-02-01

    Topography is a reflection of the tectonic and geodynamic processes that act to uplift the Earth's surface and the erosional processes that work to return it to base level. Numerous studies have shown that topography is a sensitive recorder of tectonic signals. A quasi-physical understanding of the relationship between river incision and rock uplift has made the analysis of fluvial topography a popular technique for deciphering relative, and some argue absolute, histories of rock uplift. Here we present results from a study of the fluvial topography from south-central Crete, demonstrating that river longitudinal profiles indeed record the relative history of uplift, but several other processes make it difficult to recover quantitative uplift histories. Prior research demonstrates that the south-central coastline of Crete is bound by a large ( ˜ 100 km long) E-W striking composite normal fault system. Marine terraces reveal that it is uplifting between 0.1 and 1.0 mm yr-1. These studies suggest that two normal fault systems, the offshore Ptolemy and onshore South-Central Crete faults, linked together in the recent geologic past (ca. 0.4-1 My BP). Fault mechanics predict that when adjacent faults link into a single fault the uplift rate in footwalls of the linkage zone will increase rapidly. We use this natural experiment to assess the response of river profiles to a temporal jump in uplift rate and to assess the applicability of the stream power incision model to this setting. Using river profile analysis we show that rivers in south-central Crete record the relative uplift history of fault growth and linkage as theory predicts that they should. Calibration of the commonly used stream power incision model shows that the slope exponent, n, is ˜ 0.5, contrary to most studies that find n ≥ 1. Analysis of fluvial knickpoints shows that migration distances are not proportional to upstream contributing drainage area, as predicted by the stream power incision model

  15. The anti-Müllerian hormone (AMH) acts as a gatekeeper of ovarian steroidogenesis inhibiting the granulosa cell response to both FSH and LH.

    Science.gov (United States)

    Sacchi, Sandro; D'Ippolito, Giovanni; Sena, Paola; Marsella, Tiziana; Tagliasacchi, Daniela; Maggi, Elena; Argento, Cindy; Tirelli, Alessandra; Giulini, Simone; La Marca, Antonio

    2016-01-01

    Anti Müllerian Hormone (AMH) has a negative and inhibitory role in many functions of human granulosa-lutein cells (hGCs) including notoriously the reduction of the aromatase CYP19A1 expression induced by follicle-stimulating hormone (FSH). No data have been provided on the possible role of AMH in modulating the response to luteinizing hormone (LH) (alone or combined with FSH) as well as its effect on other enzymes involved in steroidogenesis including aromatase P450scc. The aim of this study was to investigate the role of AMH as regulator of the basal and stimulated steroids production by hGCs. Primary culture of hGCs were incubated with hormones AMH, LH, and FSH, alone or in combination. The CYP19A1 and P450scc messenger RNA (mRNA) expression, normalized by housekeeping ribosomal protein S7 (RpS7) gene, was evaluated by reverse transcriptase quantitative PCR (RT-qPCR). Each reaction was repeated in triplicate. Negative controls using corresponding amount of vehicle control for each hormone treatment were performed. AMH did not modulate the basal mRNA expression of both aromatase genes at any of the concentrations tested. Meanwhile, the strong mRNA induction of CYP19A1 and P450scc generated by a 24-h gonadotropin treatment (alone and combined) was suppressed by 20 ng/ml AMH added to culture medium. These findings contribute in clarifying the relationship between hormones regulating the early phase of steroidogenesis confirming that AMH is playing a suppressive role on CYP19A1 expression stimulated by gonadotropin in hGCs. Furthermore, a similar inhibitory effect for AMH was observed on P450scc gene expression when activated by gonadotropin treatment.

  16. Progressive obesity alters the steroidogenic response to ovulatory stimulation and increases the abundance of mRNAs stored in the ovulated oocyte.

    Science.gov (United States)

    Pohlmeier, William E; Xie, Fang; Kurz, Scott G; Lu, Ningxia; Wood, Jennifer R

    2014-08-01

    Obese women who are able to attain pregnancy are at increased risk for early-pregnancy loss due, in part, to reduced oocyte quality. We and others have demonstrated that female Lethal Yellow (LY) mice and female C57BL/6 mice fed a high fat diet (B6-HFD) exhibit phenotypes consistent with human obesity. These studies also showed that zygotes collected from LY and B6-HFD females have reduced developmental competence. The current hypothesis is that LY and B6-HFD females exhibit an abnormal response to gonadotropin stimulation compared to C57BL/6 controls fed normal rodent chow (B6-ND), resulting in the ovulation of oocytes with an altered molecular phenotype which may contribute to its reduced developmental competence. To test this hypothesis, age-matched B6-ND, B6-HFD, and LY females were stimulated with exogenous gonadotropins, then circulating hormone levels and the phenotypes of ovulated oocytes were analyzed. There was no difference in ovulation rate or in the percentage of morphologically abnormal oocytes collected from the oviduct of any females. Progesterone and progesterone/estradiol ratios, however, were increased in B6-HFD and LY compared to B6-ND females 16 hr post-human chorionic gonadotropin treatment. The transcript abundance of several candidate oocyte genes was also increased in B6-HFD- and LY-derived oocytes compared to B6-ND-derived oocytes. These data suggest that increased insulin and leptin levels of obese females elevated circulating progesterone concentrations, altered transcriptional activity during oocyte growth, and/or impaired mechanisms of RNA translation and degradation during oocyte maturation. These changes in mRNA abundance likely contribute to reduced oocyte quality and the subsequent poor embryogenesis associated with obesity. © 2014 Wiley Periodicals, Inc.

  17. Use of various gonadotropin and biosimilar formulations for in vitro fertilization cycles: results of a worldwide Web-based survey.

    Science.gov (United States)

    Christianson, Mindy S; Shoham, Gon; Tobler, Kyle J; Zhao, Yulian; Monseur, Brent; Leong, Milton; Shoham, Zeev

    2017-08-01

    The purpose of this study was to identify trends in gonadotropin therapy in patients undergoing in vitro fertilization (IVF) treatment worldwide. Retrospective evaluation utilizing the results of a Web-based survey, IVF-Worldwide ( www.IVF-worldwide.com ) was performed. Three hundred fourteen centers performing a total of 218,300 annual IVF cycles were evaluated. Respondents representing 62.2% of cycles (n = 135,800) did not believe there was a difference between urinary and recombinant gonadotropins in terms of efficacy and live birth rate. Of the respondents, 67.3% (n = 146,800) reported no difference between recombinant and urinary formulations in terms of short-term safety and risk of ovarian hyperstimulation syndrome. In terms of long-term safety using human urinary gonadotropins, 50.6% (n = 110,400) of respondents believe there are potential long-term risks including prion disease. For 95.3% of units (n = 208,000), the clinician was the decision maker determining which specific gonadotropins are used for IVF. Of the units, 62.6% (n = 136,700) identified efficacy as the most important factor in deciding which gonadotropin to prescribe. While most (67.3%, n = 146,800) were aware of new biosimilar recombinant FSH products entering the market, 92% (n = 201,000) reported they would like more information. A fraction of respondents (25.6%, n = 55,900) reported having experience with these new products, and of these, 80.3% (n = 46,200) reported that they were similar in efficacy as previously used gonadotropins in a similar patient group. Respondents representing the majority of centers do not believe a difference exists between urinary and recombinant gonadotropins with respect to efficacy and live birth rates. While many are aware of new biosimilar recombinant FSH products entering the market, over 90% desire more information on these products.

  18. The laparoscopic ovarian electrocautery versus gonadotropin therapy in infertile women with clomiphene citrate-resistant polycystic ovary syndrome; a randomized controlled trial.

    Science.gov (United States)

    Mehrabian, Ferdous; Eessaei, Fatemeh

    2012-03-01

    This study aimed to compare two methods of treatment of infertility with gonadotropin with laparoscopic ovarian electrocauterization in patients with clomiphene citrate-resistant polycystic ovary syndrome (PCOS). A number of 104 nulipara patients with polycystic ovary syndrome, who were resistant to clomiphene citrate were randomly assigned to two groups. One group received gonadotropin; after the bleeding withdrawal and from the third day of the cycle, the injection of human menopausal gonadotropin (HMG) was started with 10 mg medroxy progesterone. The patients were followed with serial trans-vaginal sonographies. When the diameter of follicles reached to 18 mm, human chorionic gonadotropin (HCG) was prescribed. The other group was treated with laparoscopic ovarian electrocauterization under general anesthesia. If after 3 cycles, the anovulation was established with progesterone measurement, the clomiphene citrate was prescribed. Gonadotropin was administered, if the lack of ovulation persisted. No significant difference was documented between the two groups in terms of the obesity indexes, duration of infertility, age, sonographic and laboratory findings. In the gonadotropin group, 37 cases (71%) of pregnancy occurred. The rate of pregnancy was the same in the other group consisting of 18 cases treated by electrocautery, 9 cases with cautery + clomiphene, and 10 cases with clomiphene + cautery + gonadotropin. In the group treated with gonadotropin, there were 1 triple and 4 twins pregnancies. In the group treated with ovarian electrocautery, one twin pregnancy was observed. In the group treated with gonadotropin, 2 cases of ovarian hyperstimulation syndrome, 1 case of ectopic pregnancy and 6 cases of miscarriage occurred; the corresponding figure in the ovarian electrocautery group consisted of 5 cases of miscarriage. Our findings suggest that ovarian electrocauterization is an appropriate method with good efficacy and low complication rate for infertility

  19. Impact of different colours of artificial light at night on melatonin rhythm and gene expression of gonadotropins in European perch.

    Science.gov (United States)

    Brüning, Anika; Hölker, Franz; Franke, Steffen; Kleiner, Wibke; Kloas, Werner

    2016-02-01

    The distribution and intensity of artificial light at night, commonly referred to as light pollution, is consequently rising and progressively also ecological implications come to light. Low intensity light is known to suppress nocturnal melatonin production in several fish species. This study aims to examine the least suppressive light colour for melatonin excreted into the holding water and the influence of different light qualities and quantities in the night on gene expression of gonadotropins in fish. European perch (Perca fluviatilis) were exposed to light of different wavelengths during the night (blue, green, and red). Melatonin concentrations were measured from water samples every 3h during a 24h period. Gene expression of gonadotropins was measured in perch exposed to different light colours and was additionally examined for perch subjected to different intensities of white light (0 lx, 1 lx, 10 lx, 100 lx) during the night. All different light colours caused a significant drop of melatonin concentration; however, blue light was least suppressive. Gene expression of gonadotropins was not influenced by nocturnal light of different light colours, but in female perch gonadotropin expression was significantly reduced by white light already at the lowest level (1 lx). We conclude that artificial light with shorter wavelengths at night is less effective in disturbing biological rhythms of perch than longer wavelengths, coinciding with the light situation in freshwater habitats inhabited by perch. Different light colours in the night showed no significant effect on gonadotropin expression, but white light in the night can disturb reproductive traits already at very low light intensities. These findings indicate that light pollution has not only the potential to disturb the melatonin cycle but also the reproductive rhythm and may therefore have implications on whole species communities. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Review: Regulatory mechanisms of gonadotropin-inhibitory hormone (GnIH synthesis and release in photoperiodic animals

    Directory of Open Access Journals (Sweden)

    Kazuyoshi eTsutsui

    2013-04-01

    Full Text Available Gonadotropin-inhibitory hormone (GnIH is a novel hypothalamic neuropeptide that was discovered in quail as an inhibitory factor for gonadotropin release. GnIH inhibits gonadotropin synthesis and release in birds through actions on gonadotropin-releasing hormone (GnRH neurons and gonadotropes, mediated via the GnIH receptor (GnIH-R, GPR147. Subsequently, GnIH was identified in mammals and other vertebrates. As in birds, mammalian GnIH inhibits gonadotropin secretion, indicating a conserved role for this neuropeptide in the control of the hypothalamic-pituitary-gonadal (HPG axis across species. Identification of the regulatory mechanisms governing GnIH expression and release is important in understanding the physiological role of the GnIH system. A nocturnal hormone, melatonin, appears to act directly on GnIH neurons through its receptor to induce expression and release of GnIH in quail, a photoperiodic bird. Recently, a similar, but opposite, action of melatonin on the inhibition of expression of mammalian GnIH was shown in hamsters and sheep, photoperiodic mammals. These results in photoperiodic animals demonstrate that GnIH expression is photoperiodically modulated via a melatonin-dependent process. Recent findings indicate that GnIH may be a mediator of stress-induced reproductive disruption in birds and mammals, pointing to a broad role for this neuropeptide in assessing physiological state and modifying reproductive effort accordingly. This paper summarizes the advances made in our knowledge regarding the regulation of GnIH synthesis and release in photoperiodic birds and mammals. This paper also discusses the neuroendocrine integration of environmental signals, such as photoperiods and stress, and internal signals, such as GnIH, melatonin and glucocorticoids, to control avian and mammalian reproduction.

  1. Association of basal serum testosterone levels with ovarian response and in vitro fertilization outcome

    Directory of Open Access Journals (Sweden)

    Sun Mei

    2011-01-01

    Full Text Available Abstract Background To evaluate basal testosterone (T levels during follicular phase of the menstrual cycle as a predictor for ovarian response and in vitro fertilization (IVF outcome. Method We analyzed data retrospectively from hospital-based IVF center including one thousand two hundred and sixty Chinese Han women under their first IVF cycle reached the ovum pick-up stage, without polycystic ovary syndrome (PCOS or endometriosis undergoing long IVF protocol. Patients were divided into 2 groups. Group 1: patients with diminished ovarian reserve (basal FSH >10 IU/L (n = 187; Group 2: patients with normal ovarian reserve (basal FSH Results Basal T levels were markly different between pregnant and non-pregnant women in Group 1; whereas not in Group 2. A testosterone level of 47.85 ng/dl was shown to predict pregnancy outcome with a sensitivity of 52.8% and specificity of 65.3%; and the basal T was correlated with the numbers of large follicles (> 14 mm on HCG day in Group 1. Significantly negative correlations were observed between basal T, days of stimulation and total dose of gonadotropins after adjusting for confounding factors in both groups. Conclusion In women with diminished ovarian reserve, basal T level was a predictor for the number of large follicles on HCG day and pregnancy outcome; but could not in those with normal serum FSH. Basal T levels were associated with both days of stimulation and total dose of gonadotropins, indicating that lower level of T might relate with potential ovarian poor response.

  2. Predictive value of plasma human chorionic gonadotropin measured 14 days after Day-2 single embryo transfer

    DEFF Research Database (Denmark)

    Løssl, Kristine; Oldenburg, Anna; Toftager, Mette

    2017-01-01

    Introduction: Prediction of pregnancy outcome after in vitro fertilization is important for patients and clinicians. Early plasma human chorionic gonadotropin (p-hCG) levels are the best known predictor of pregnancy outcome, but no studies have been restricted to single embryo transfer (SET) of Day......-2 embryos. The aim of the present study was to investigate the predictive value of p-hCG measured exactly 14 days after the most commonly used Day-2 SET on pregnancy, delivery, and perinatal outcome. Material and methods: A retrospective analysis of prospectively collected data on 466 women who had...... p-hCG measured exactly 14 days after Day-2 SET during a randomized trial including 1050 unselected women (aged 18–40 years) undergoing their first in vitro fertilization/ intracytoplasmic sperm injection treatment. Results: The p-hCG predicted clinical pregnancy [area under the curve (AUC) 0.953; 95...

  3. The hormone level of both the testosterone and the gonadotropin. Chapter

    International Nuclear Information System (INIS)

    2000-01-01

    Concentration of testosterone and gonadotropin hormones in blood serum was studied at 120 examined sick persons. It is shown that the statistically reliable (P<0.5) decrease of testosterone level is exhibiting under influence of radiation doses over 0.25 Gy. During radiation doses action increasing the legible tendency to of testosterone level reduction is noted. Results of pituitary gland-gonad system study in dependence of sexual dysfunctions are presented. Data evident that sexual dysfunction does not depend from suppression of hormone activity of gonads. It is revealed, that common testosterone level in sicks suffered from low radiation action was reduced. Differences in testosterone content at sicks with sexual dysfunction and without its have not been revealed

  4. Effect of temperature on the concentration of plasma gonadotropine and spermatogenesis of the goldfish Carassius auratus

    Energy Technology Data Exchange (ETDEWEB)

    Gillet, C.; Billard, R.; Breton, B.

    1977-01-01

    Concentrations of immunoreactive plasma gonadotropin (c-GtH) were measured for goldfish kept at conditions of temperature held constant or increasing between 10 and 30/sup 0/C, between February and July. At temperatures of 17/sup 0/C or above the levels of plasma c-GtH were significantly (P < 0.005) higher during April and May than at 10/sup 0/C. In April the pituitary concentration of c-GtH was maximum for fish held at 17/sup 0/C or above and the minimum for fish held below 17/sup 0/C, but in June the situation was reversed. A study of the gonads showed that spermatogenesis is faster at 17--24/sup 0/C than at 10/sup 0/C, but at 30/sup 0/C spermatogenic activity was inhibited.

  5. Influence of Anthropometric Measurements on Abnormal Gonadotropin Secretion in Women with Polycystic Ovary Syndrome

    International Nuclear Information System (INIS)

    Haider, S.; Mannan, N.; Qureshi, M. A.; Khan, A.

    2014-01-01

    Objective: To evaluate the influence of anthropometric measurements on abnormal gonadotropin secretion in patients with polycystic ovary syndrome (PCOS). Study Design: Cross-sectional study. Place and Duration of Study: The Institute of Basic Medical Sciences (IBMS), DUHS in collaboration with Gynae/infertility clinics of the Civil Hospital and Lady Dufferin Hospital, Karachi, from October 2010 to February 2011. Methodology: One hundred and sixty three oligomenorrhic PCOS women of reproductive age (18 - 40 years) fulfilling the revised Rotterdam 2003 criteria were studied. The data recorded on a prescribed proforma included current age, age at menarche, menstrual irregularities, presence of hirsuitism, acne, infertility, familial nature, blood pressure, BMI and waisthip ratio. Blood samples for gonadotropin assay were taken randomly on day 6th to 30th of menstrual cycle, in a gel tube. Hormonal assay was performed using chemiluminescent immunoassay. Kruskul Wallis test was used to assess the influence of BMI levels on LH:FSH values. Results: The mean weight was 66.14 +- 11.02 kg and mean BMI was 27.03 +- 4.42 kg/m2. There was no significant difference in mean LH/FSH ratio (p=.575) among BMI groups. However, there was a positive correlation between BMI and LH:FSH ratio (p=0.04, r=0.155). Conclusion: There was high frequency of obesity (69%) in women with PCOS. Although no significant difference was found between mean LH:FSH ratio among different BMI groups levels but significant correlation between BMI levels and LH: FSH suggested that there was positive relation between BMI and LH: FSH. (author)

  6. Hair-Normalized Cortisol Waking Response as a Novel Biomarker of Hypothalamic-Pituitary-Adrenal Axis Activity following Acute Trauma: A Proof-of-Concept Study with Pilot Results

    Directory of Open Access Journals (Sweden)

    David M. Walton

    2013-01-01

    Full Text Available The mechanisms underlying the development of persistent posttraumatic pain and disability remain elusive. Recent evidence suggests that disordered stress-system pathway (hypothalamic-pituitary-adrenal axis activity may be responsible for the genesis and maintenance of long-term sensory and emotional problems. However, confidence in current evidence is limited by the necessarily retrospective collection of data. Hair cortisol can serve as a calendar of HPA axis activity going back several months prior to injury. The purposes of this pilot study were to determine the feasibility of using hair cortisol and hair-normalized salivary cortisol as biomarkers of distress following traumatic injuries of whiplash or distal radius fracture. Ten subjects provided complete data within 3 weeks of injury. Hair cortisol, cortisol waking response (CWR, and mean daily cortisol (MDC were captured at inception, as were self-report indicators of pain, disability, and pain catastrophizing. Pain and disability were also captured 3 months after injury. Results indicate that cortisol waking response may be a useful biomarker of current distress as measured using the pain catastrophizing scale, especially when normalized to 3-month hair cortisol (r=0.77 raw, 0.93 normalized. Hair-normalized CWR may also have predictive capacity, correlating with 3-month self-reported disability at r=0.70. While promising, the results must be viewed in light of the small sample.

  7. The relationship between the variants in the 5′-untranslated regions of equine chorionic gonadotropin genes and serum equine chorionic gonadotropin levels

    Directory of Open Access Journals (Sweden)

    ShuQin Liu

    2017-12-01

    Full Text Available Objective An experiment was conducted to study the association between the single nucleotide polymorphisms (SNPs in 5′-untranslated regions (5′-UTR of equine chorionic gonadotropin (eCG genes and the serum eCG levels. Methods SNPs in 5′-UTR of eCG genes were screened across 10 horse breeds, including 7 Chinese indigenous breeds and 3 imported breeds using iPLEX chemistry, and the association between the serum eCG levels of 174 pregnant Da’an mares and their serum eCG levels (determined with ELISA was analyzed. Results Four SNPs were identified in the 5′-UTR of the eCGα gene, and one of them was unique in the indigenous breeds. There were 2 SNPs detected at the 5′ end of the eCGβ subunit gene, and one of them was only found in the Chinese breeds. The SNP g.39948246T>C at the 5′-UTR of eCGα was associated significantly with eCG levels of 75-day pregnant mare serum (pC mutation causes appearance of the specific binding site of hepatocyte nuclear factor 3 forkhead homolog 2 (HFH-2, which is a transcriptional repressor belonging to the forkhead protein family of transcription factors. Conclusion The SNP g.39948246T>C at the 5′-UTR of eCGα is associated with eCG levels of 75-day pregnant mare serum (p<0.05.

  8. Muscle inflammatory signaling in response to 9 days of physical inactivity in young men with low compared to normal birth weight

    DEFF Research Database (Denmark)

    Friedrichsen, Martin; Ribel-Madsen, Rasmus; Mortensen, Brynjulf

    2012-01-01

    OBJECTIVE: The molecular mechanisms linking physical inactivity and muscle insulin resistance in humans has been suggested to include increased muscle inflammation, possibly associated with impaired oxidative metabolism. We employed a human bed rest study including 20 young males with normal birth...

  9. RNA-sequence data normalization through in silico prediction of reference genes: the bacterial response to DNA damage as case study.

    Science.gov (United States)

    Berghoff, Bork A; Karlsson, Torgny; Källman, Thomas; Wagner, E Gerhart H; Grabherr, Manfred G

    2017-01-01

    Measuring how gene expression changes in the course of an experiment assesses how an organism responds on a molecular level. Sequencing of RNA molecules, and their subsequent quantification, aims to assess global gene expression changes on the RNA level (transcriptome). While advances in high-throughput RNA-sequencing (RNA-seq) technologies allow for inexpensive data generation, accurate post-processing and normalization across samples is required to eliminate any systematic noise introduced by the biochemical and/or technical processes. Existing methods thus either normalize on selected known reference genes that are invariant in expression across the experiment, assume that the majority of genes are invariant, or that the effects of up- and down-regulated genes cancel each other out during the normalization. Here, we present a novel method, moose 2 , which predicts invariant genes in silico through a dynamic programming (DP) scheme and applies a quadratic normalization based on this subset. The method allows for specifying a set of known or experimentally validated invariant genes, which guides the DP. We experimentally verified the predictions of this method in the bacterium Escherichia coli , and show how moose 2 is able to (i) estimate the expression value distances between RNA-seq samples, (ii) reduce the variation of expression values across all samples, and (iii) to subsequently reveal new functional groups of genes during the late stages of DNA damage. We further applied the method to three eukaryotic data sets, on which its performance compares favourably to other methods. The software is implemented in C++ and is publicly available from http://grabherr.github.io/moose2/. The proposed RNA-seq normalization method, moose 2 , is a valuable alternative to existing methods, with two major advantages: (i) in silico prediction of invariant genes provides a list of potential reference genes for downstream analyses, and (ii) non-linear artefacts in RNA-seq data

  10. Genome Wide Evaluation of Normal Human Tissue in Response to Controlled, In vivo Low-Dose Low LET Ionizing Radiation Exposure: Pathways and Mechanisms Final Report, September 2013

    Energy Technology Data Exchange (ETDEWEB)

    Rocke, David M. [University of California Davis

    2013-09-09

    During course of this project, we have worked in several areas relevant to low-dose ionizing radiation. Using gene expression to measure biological response, we have examined the response of human skin exposed in-vivo to radation, human skin exposed ex-vivo to radiation, and a human-skin model exposed to radiation. We have learned a great deal about the biological response of human skin to low-dose ionizing radiation.

  11. Concentration of carcinoembryonic antigen alpha-fetoprotein and beta-subunit of human chorionic gonadotropin in the serum of coke oven workers

    Energy Technology Data Exchange (ETDEWEB)

    Snit, M. [Silesian Medical Academy, Zabrze (Poland)

    1993-01-01

    Increased levels of carcinoembryonic antigen and {alpha}-fetoprotein were found in blood serum of coke oven workers, and also to some extent in smokers and in residents of industrial cities. The {beta} subunit of chorionic gonadotropin was barely detectable.

  12. Immunohistochemical evidence for the involvement of gonadotropin releasing hormone in neuroleptic and cataleptic effects of haloperidol in mice.

    Science.gov (United States)

    Fegade, Harshal A; Umathe, Sudhir N

    2016-04-01

    Blockade of dopamine D2 receptor by haloperidol is attributed for neuroleptic and cataleptic effects; and also for the release of gonadotropin releasing hormone (GnRH) from the hypothalamus. GnRH agonist is reported to exhibit similar behavioural effects as that of haloperidol, and pre-treatment with GnRH antagonist is shown to attenuate the effects of haloperidol, suggesting a possibility that GnRH might mediate the effects of haloperidol. To substantiate such possibility, the influence of haloperidol on GnRH immunoreactivity (GnRH-ir) in the brain was studied in vehicle/antide pre-treated mice by peroxidase-antiperoxidase method. Initially, an earlier reported antide-haloperidol interaction in rat was confirmed in mice, wherein haloperidol (250μg/kg, i.p.) exhibited suppression of conditioned avoidance response (CAR) on two-way shuttle box, and induced catalepsy in bar test; and pre-treatment with antide (50μg/kg, s.c., GnRH antagonist) attenuated both effects of haloperidol. Immunohistochemical study was carried out to identify GnRH-ir in the brain, isolated 1h after haloperidol treatment to mice pre-treated with vehicle/antide. The morphometric analysis of microphotographs of brain sections revealed that haloperidol treatment increased integrated density units of GnRH-ir in various regions of the limbic system. Considering basal GnRH-ir in vehicle treated group as 100%, the increase in GnRH-ir after haloperidol treatment was by 100.98% in the medial septum; 54.26% in the bed nucleus of the stria terminalis; 1152.85% in the anteroventral periventricular nucleus; 120.79% in the preoptic area-organum vasculosum of the lamina terminalis and 138.82% in the arcuate nucleus. Antide did not influence basal and haloperidol induced increase in GnRH-ir in any of the regions. As significant increase in GnRH-ir after haloperidol treatment was observed in such regions of the brain which are reported to directly or indirectly communicate with the hippocampus and basal

  13. Milt-Egg Ratio in Artificial Fertilization of Pangasiid Catfish Injected by Gonadotropin Releasing Hormone-Analog (GnRH-a and Domperidone Mixture

    Directory of Open Access Journals (Sweden)

    J. Subagja

    2007-08-01

    Full Text Available Study on the level of gonadotropin hormone treatments combined with latency time to induce ovulation in Pangasius djambal was conducted in the Research Instalation of Germ Plasm, Cijeruk, Bogor. This study was carried out to investigate the effect of GnRH-a and domperidone mixture on the milt production and fertilization rates of Pangasius djambal, and to determine the optimal milt-egg ratio required for artificial fertilization. Different doses of hormone i.e: 0,3; 0,5 and 0,7 ml kg"1 body weight combined with latency time of 12, 24 and 48 h after inducing hormone were applied to increase milt-production. Milt dilution was 10"1, 10~2, 10"3, 10"4, 10"5, 10"6 and 10"7and evaluated for hatching rate and normality of larvae. The results showed that mean milt production was 4,3 ml/kg body weight, and there was interaction between hormone dose of 0,5 ml/kg of body weight and latency time 12 and 24 h that giving hatching rate of 77 to 83% ( p Key words : Fertilization, milt production, domperidone, Pangasius djambal   ABSTRAK Suatu studi penyuntikan hormon gonadotropin dengan perbedaan dosis dan waktu laten terhadap spesies Pangasius djambal telah dilakukan di Instalasi Riset Plasma Nutfah Air Tawar, Cijeruk, Bogor. Tujuan penelitian ini adalah untuk mengetahui pengaruh hormon GnRH-a dan domperidon terhadap produktivitas semen ikan jantan dan viabilitasnya pada pembuahan buatan. Tujuan lainnya untuk menentukan perbandingan optimal antara jumlah spermatozoa dengan telur dalam fertilisasi buatan. Dosis hormon perlakuan untuk peningkatan produksi semen yaitu 0,3; 0,5 dan 0,7 ml.kg"1 bobot badan yang di kombinasikan dengan waktu inkubasi jantan 12, 24 dan 24 jam setelah penyuntikan hormon. Semen diencerkan mulai dari 10"', 10"2, 10"3, 10"4, 10~5, 10'6 dan 10"7, dan dilakukan pembuahan terhadap telur. Daya tetas dan abnormalitas larva dievaluasi. Hasil analisis menunjukan produksi semen rata-rata 4,3 ml/kg bobot badan, ada interaksi antara dosis hormon 0

  14. Fetal programming: testosterone exposure of the female sheep during midgestation disrupts the dynamics of its adult gonadotropin secretion during the periovulatory period.

    Science.gov (United States)

    Savabieasfahani, Mozhgan; Lee, James S; Herkimer, Carol; Sharma, Tejinder P; Foster, Douglas L; Padmanabhan, Vasantha

    2005-01-01

    Prenatal exposure of the female sheep to excess testosterone (T) leads to hypergonadotropism, multifollicular ovaries, and progressive loss of reproductive cycles. We have determined that prenatal T treatment delays the latency of the estradiol (E2)-induced LH surge. To extend this finding into a natural physiological context, the present study was conducted to determine if the malprogrammed surge mechanism alters the reproductive cycle. Specifically, we wished to determine if prenatal T treatment 1) delays the onset of the preovulatory gonadotropin surge during the natural follicular phase rise in E2, 2) alters pulsatile LH secretion and the dynamics of the secondary FSH surge, and 3) compromises the ensuing luteal function. Females prenatally T-treated from Day 60 to Day 90 of gestation (147 days is term) and control females were studied when they were approximately 2.5 yr of age. Reproductive cycles of control and prenatally T-treated females were synchronized with PGF2alpha, and peripheral blood samples were collected every 2 h for 120 h to characterize cyclic changes in E2, LH, and FSH and then daily for 14 days to monitor changes in luteal progesterone. To assess LH pulse patterns, blood samples were also collected frequently (each 5 min for 6 h) during the follicular and luteal phases of the cycle. The results revealed that, in prenatally T-treated females, 1) the preovulatory increase in E2 was normal; 2) the latencies between the preovulatory increase in E2 and the peaks of the primary LH and FSH surges were longer, but the magnitudes similar; 3) follicular-phase LH pulse frequency was increased; 4) the interval between the primary and secondary FSH surges was reduced but there was a tendency for an increase in duration of the secondary FSH surge; but 5) luteal progesterone patterns were in general unaltered. Thus, exposure of the female to excess T before birth produces perturbances and maltiming in periovulatory gonadotropin secretory dynamics, but these

  15. Elevated mRNA-levels of gonadotropin-releasing hormone and its receptor in plaque-bearing Alzheimer's disease transgenic mice.

    Directory of Open Access Journals (Sweden)

    Syed Nuruddin

    Full Text Available Research on Alzheimer's disease (AD has indicated an association between hormones of the hypothalamic-pituitary-gonadal (HPG axis and cognitive senescence, indicating that post meno-/andropausal changes in HPG axis hormones are implicated in the neuropathology of AD. Studies of transgenic mice with AD pathologies have led to improved understanding of the pathophysiological processes underlying AD. The aims of this study were to explore whether mRNA-levels of gonadotropin-releasing hormone (Gnrh and its receptor (Gnrhr were changed in plaque-bearing Alzheimer's disease transgenic mice and to investigate whether these levels and amyloid plaque deposition were downregulated by treatment with a gonadotropin-releasing hormone analog (Gnrh-a; Leuprorelin acetate. The study was performed on mice carrying the Arctic and Swedish amyloid-β precursor protein (AβPP mutations (tgArcSwe. At 12 months of age, female tgArcSwe mice showed a twofold higher level of Gnrh mRNA and more than 1.5 higher level of Gnrhr mRNA than age matched controls. Male tgArcSwe mice showed the same pattern of changes, albeit more pronounced. In both sexes, Gnrh-a treatment caused significant down-regulation of Gnrh and Gnrhr mRNA expression. Immunohistochemistry combined with quantitative image analysis revealed no significant changes in the plaque load after Gnrh-a treatment in hippocampus and thalamus. However, plaque load in the cerebral cortex of treated females tended to be lower than in female vehicle-treated mice. The present study points to the involvement of hormonal changes in AD mice models and demonstrates that these changes can be effectively counteracted by pharmacological treatment. Although known to increase in normal aging, our study shows that Gnrh/Gnrhr mRNA expression increases much more dramatically in tgArcSwe mice. Treatment with Leuprorelin acetate successfully abolished the transgene specific effects on Gnrh/Gnrhr mRNA expression. The present experimental

  16. Change in body mass index and insulin resistance after 1-year treatment with gonadotropin-releasing hormone agonists in girls with central precocious puberty.

    Science.gov (United States)

    Park, Jina; Kim, Jae Hyun

    2017-03-01

    Gonadotropin-releasing hormone agonist (GnRHa) is used as a therapeutic agent for central precocious puberty (CPP); however, increased obesity may subsequently occur. This study compared body mass index (BMI) and insulin resistance during the first year of GnRHa treatment for CPP. Patient group included 83 girls (aged 7.0-8.9 years) with developed breasts and a peak luteinizing hormone level of ≥5 IU/L after GnRH stimulation. Control group included 48 prepubertal girls. BMI and insulin resistance-related indices (homeostasis model assessment of insulin resistance [HOMA-IR] and quantitative insulin sensitivity check index [QUICKI]) were used to compare the groups before treatment, and among the patient group before and after GnRHa treatment. No statistical difference in BMI z -score was detected between the 2 groups before treatment. Fasting insulin and HOMA-IR were increased in the patient group; fasting glucose-to-insulin ratio and QUICKI were increased in the control group (all P resistance compared to the control group. During GnRHa treatment, normal-weight individuals showed increased BMI z -scores without increased insulin resistance; the overweight group demonstrated increased insulin resistance without significantly altered BMI z -scores. Long-term follow-up of BMI and insulin resistance changes in patients with CPP is required.

  17. The GnRH receptor and the response of gonadotrope cells to GnRH pulse frequency code. A story of an atypical adaptation of cell function relying on a lack of receptor homologous desensitization.

    Directory of Open Access Journals (Sweden)

    Christian Bleux

    2010-01-01

    Full Text Available Brain control of the reproductive system is mediated through hypothalamic gonadotropin-releasing hormone (GnRH which activates specific receptors (GnRHR present at the surface of the pituitary gonadotropes to trigger secretion of the two gonadotropins LH and FSH. A unique feature of this system is the high dependence on the secretion mode of GnRH, which is basically pulsatile but undergoes considerable fluctuations in pulse frequency pattern in response to endogenous or external factors. How the physiological fluctuations of GnRH secretion that orchestrate normal reproduction are decoded by the gonadotrope cell machinery to ultimately control gonadotropin release and/or subunit gene transcription has been the subject of intensive studies during the past decades. Surprisingly, the mammalian GnRHR is unique among G protein-coupled receptor family as it lacks the carboxy-terminal tail usually involved in classical endocytotic process. Accordingly, it does not desensitize properly and internalizes very poorly. Both this atypical intrinsic property and post-receptor events may thus contribute to decode the GnRH signal. This includes the participation of a network of signaling pathways that differently respond to GnRH together with a growing amount of genes differentially sensitive to pulse frequency. Among these are two pairs of genes, the transcription factors EGR-1 and NAB, and the regulatory factors activin and follistatin, that function as intracellular autoregulatory feedback loops controlling respectively LHbeta and FSHbeta gene expression and hence, LH and FSH synthesis. Pituitary gonadotropes thus represent a unique model of cells functionally adapted to respond to a considerably fluctuating neuroendocrine stimulation, from short individual pulses to sustained GnRH as observed at the proestrus of ovarian cycle. Altogether, the data emphasize the adaptative reciprocal complementarity of hypothalamic GnRH neurones and pituitary gonadotropes to

  18. Differential post-irradiation caffeine response in normal diploid versus SV40-transformed human fibroblasts: potential role of nuclear organization and protein-composition

    International Nuclear Information System (INIS)

    Taylor, Y.C.; Parsian, A.J.; Duncan, P.G.

    1993-01-01

    To test the hypothesis that the enhancement of cell killing by post-irradiation treatment with caffeine (CAF) is mediated by alterations in chromatin structure, several nuclear parameters were examined in both caffeine-responsive and non-responsive cell lines. (author)

  19. Differential post-irradiation caffeine response in normal diploid versus SV40-transformed human fibroblasts: potential role of nuclear organization and protein-composition

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Y.C.; Parsian, A.J.; Duncan, P.G. (Washington Univ., St. Louis, MO (United States). School of Medicine)

    1993-07-01

    To test the hypothesis that the enhancement of cell killing by post-irradiation treatment with caffeine (CAF) is mediated by alterations in chromatin structure, several nuclear parameters were examined in both caffeine-responsive and non-responsive cell lines. (author).

  20. Ontogeny of thymic independent antibody responses in vitro in normal mice and mice with an x-linked B cell defect

    Energy Technology Data Exchange (ETDEWEB)

    Mosier, D.E.; Mond, J.J.; Goldings, E.A.

    1977-12-01

    The primary in vitro antibody response of neonatal spleen cells to three thymic independent antigens has been examined. The time of onset of responsiveness to TNP-Brucella abortus and TNP-lipopolysaccharide was significantly earlier than the onset of responsiveness to TNP-Ficoll. This ontologic sequence was not affected by T cell depletion or antigen presentation on adult macrophages. In neonatal mice bearing the X-linked CBA/N defect, the response to TNP-Brucella abortus and TNP-lipopolysaccharide was much delayed and no response to TNP-Ficoll developed. We conclude that different thymic independent antigens address different subpopulations of B cells, one of which appears earlier in ontogeny than the other.

  1. Ontogeny of thymic independent antibody responses in vitro in normal mice and mice with an x-linked B cell defect

    International Nuclear Information System (INIS)

    Mosier, D.E.; Mond, J.J.; Goldings, E.A.

    1977-01-01

    The primary in vitro antibody response of neonatal spleen cells to three thymic independent antigens has been examined. The time of onset of responsiveness to TNP-Brucella abortus and TNP-lipopolysaccharide was significantly earlier than the onset of responsiveness to TNP-Ficoll. This ontologic sequence was not affected by T cell depletion or antigen presentation on adult macrophages. In neonatal mice bearing the X-linked CBA/N defect, the response to TNP-Brucella abortus and TNP-lipopolysaccharide was much delayed and no response to TNP-Ficoll developed. We conclude that different thymic independent antigens address different subpopulations of B cells, one of which appears earlier in ontogeny than the other

  2. Extracting the normal lung dose–response curve from clinical DVH data: a possible role for low dose hyper-radiosensitivity, increased radioresistance

    International Nuclear Information System (INIS)

    Gordon, J J; Snyder, K; Zhong, H; Barton, K; Sun, Z; Chetty, I J; Matuszak, M; Ten Haken, R K

    2015-01-01

    In conventionally fractionated radiation therapy for lung cancer, radiation pneumonitis’ (RP) dependence on the normal lung dose-volume histogram (DVH) is not well understood. Complication models alternatively make RP a function of a summary statistic, such as mean lung dose (MLD). This work searches over damage profiles, which quantify sub-volume damage as a function of dose. Profiles that achieve best RP predictive accuracy on a clinical dataset are hypothesized to approximate DVH dependence.Step function damage rate profiles R(D) are generated, having discrete steps at several dose points. A range of profiles is sampled by varying the step heights and dose point locations. Normal lung damage is the integral of R(D) with the cumulative DVH. Each profile is used in conjunction with a damage cutoff to predict grade 2 plus (G2+) RP for DVHs from a University of Michigan clinical trial dataset consisting of 89 CFRT patients, of which 17 were diagnosed with G2+ RP.Optimal profiles achieve a modest increase in predictive accuracy—erroneous RP predictions are reduced from 11 (using MLD) to 8. A novel result is that optimal profiles have a similar distinctive shape: enhanced damage contribution from low doses (<20 Gy), a flat contribution from doses in the range ∼20–40 Gy, then a further enhanced contribution from doses above 40 Gy. These features resemble the hyper-radiosensitivity / increased radioresistance (HRS/IRR) observed in some cell survival curves, which can be modeled using Joiner’s induced repair model.A novel search strategy is employed, which has the potential to estimate RP dependence on the normal lung DVH. When applied to a clinical dataset, identified profiles share a characteristic shape, which resembles HRS/IRR. This suggests that normal lung may have enhanced sensitivity to low doses, and that this sensitivity can affect RP risk. (paper)

  3. Fresh versus frozen embryo transfer after gonadotropin-releasing hormone agonist trigger in gonadotropin-releasing hormone antagonist cycles among high responder women: A randomized, multi-center study

    Directory of Open Access Journals (Sweden)

    Abbas Aflatoonian

    2018-02-01

    Full Text Available Background: The use of embryo cryopreservation excludes the possible detrimental effects of ovarian stimulation on the endometrium, and higher reproductive outcomes following this policy have been reported. Moreover, gonadotropin-releasing hormone agonist trigger in gonadotropin-releasing hormone (GnRH antagonist cycles as a substitute for standard human chorionic gonadotropin trigger, minimizes the risk of ovarian hyperstimulation syndrome (OHSS in fresh as well as frozen embryo transfer cycles (FET. Objective: To compare the reproductive outcomes and risk of OHSS in fresh vs frozen embryo transfer in high responder patients, undergoing in vitro fertilization triggered with a bolus of GnRH agonist. Materials and Methods: In this randomized, multi-centre study, 121 women undergoing FET and 119 women undergoing fresh ET were investigated as regards clinical pregnancy as the primary outcome and the chemical pregnancy, live birth, OHSS development, and perinatal data as secondary outcomes. Results: There were no significant differences between FET and fresh groups regarding chemical (46.4% vs. 40.2%, p=0.352, clinical (35.8% vs. 38.3%, p=0.699, and ongoing (30.3% vs. 32.7%, p=0.700 pregnancy rates, also live birth (30.3% vs. 29.9%, p=0.953, perinatal outcomes, and OHSS development (35.6% vs. 42.9%, p=0.337. No woman developed severe OHSS and no one required admission to hospital. Conclusion: Our findings suggest that GnRHa trigger followed by fresh transfer with modified luteal phase support in terms of a small human chorionic gonadotropin bolus is a good strategy to secure good live birth rates and a low risk of clinically relevant OHSS development in in vitro fertilization patients at risk of OHSS.

  4. Normal Pressure Hydrocephalus (NPH)

    Science.gov (United States)

    ... local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain disorder ... Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal fluid ...

  5. Test-retest repeatability of the pupil light response to blue and red light stimuli in normal human eyes using a novel pupillometer

    DEFF Research Database (Denmark)

    Herbst, Kristina; Sander, Birgit; Milea, Dan

    2011-01-01

    In this study, we evaluated the repeatability of pupil responses to colored light stimuli in healthy subjects using a prototype chromatic pupillometer. One eye of 10 healthy subjects was tested twice in the same day using monochromatic light exposure at two selected wavelengths (660 and 470 nm......, we have developed a novel prototype of color pupillometer which demonstrates good repeatability in evoking and recording the pupillary response to a bright blue and red light stimulus....

  6. Test-retest repeatability of the pupil light response to blue and red light stimuli in normal human eyes using a novel pupillometer

    DEFF Research Database (Denmark)

    Herbst, Kristina; Sander, Birgit; Milea, Dan

    2011-01-01

    In this study, we evaluated the repeatability of pupil responses to colored light stimuli in healthy subjects using a prototype chromatic pupillometer. One eye of 10 healthy subjects was tested twice in the same day using monochromatic light exposure at two selected wavelengths (660 and 470¿nm......, we have developed a novel prototype of color pupillometer which demonstrates good repeatability in evoking and recording the pupillary response to a bright blue and red light stimulus....

  7. Dual effect of melatonin on gonadotropin-releasing-hormone-induced Ca(2+) signaling in neonatal rat gonadotropes

    Czech Academy of Sciences Publication Activity Database

    Zemková, Hana; Vaněček, Jiří

    2001-01-01

    Roč. 74, č. 4 (2001), s. 262-269 ISSN 0028-3835 R&D Projects: GA ČR GA309/99/0213; GA ČR GA309/99/0215; GA AV ČR IAA5011103; GA AV ČR IAA5011105 Institutional research plan: CEZ:AV0Z5011922 Keywords : melatonin * gonadotropin-release hormone * calcium Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 2.144, year: 2001

  8. Seasonal Relationship between Gonadotropin, Growth Hormone, and Estrogen Receptor mRNA Expression in the Pituitary Gland of Largemouth Bass

    OpenAIRE

    Martyniuk, Christopher J; Kroll, Kevin J.; Porak, Wesley F.; Steward, Cheree; Grier, Harry J.; Denslow, Nancy D.

    2009-01-01

    The objectives of this study were to investigate the seasonal changes in pituitary gonadotropins, growth hormone (GH), and estrogen receptor (ER) isoform mRNA in wild female and male largemouth bass (LMB) (Micropterus salmoides) from an unpolluted habitat to better understand reproductive physiology in this ecologically important species. Female pituitary luteinizing hormone (LH) β subunit and follicle-stimulating hormone (FSH) β subunit mRNA showed significant seasonal variation with levels ...

  9. Prenatal exposure to vinclozolin disrupts selective aspects of the gonadotropin-releasing hormone neuronal system of the rabbit

    OpenAIRE

    Wadas, B.C.; Hartshorn, C.A.; Aurand, E.R.; Palmer, J.S.; Roselli, C.E.; Noel, M.L.; Gore, A.C.; Veeramachaneni, D.N.R.; Tobet, S.A.

    2010-01-01

    Developmental exposure to the agricultural fungicide vinclozolin can impair reproductive function in male rabbits and was previously found to decrease the number of immunoreactive-gonadotropin-releasing hormone (ir-GnRH) neurons in the region of the organum vasculosum of the lamina terminalis (OVLT) and rostral preoptic area (rPOA) by postnatal week (PNW) 6. To further examine the disruption of GnRH neurons by fetal vinclozolin exposure, in the current study, pregnant rabbits were dosed orall...

  10. CHARACTERIZATION OF THE RECEPTOR FOR GONADOTROPIN-RELEASING HORMONE IN THE PITUITARY OF THE AFRICAN CATFISH, CLARIAS-GARIEPINUS

    NARCIS (Netherlands)

    de Leeuw, R.; Conn, P. M.; van't Veer, C.; Goos, H. J.; van Oordt, P. G.

    1988-01-01

    Receptors for gonadotropin-releasing hormone (GnRH) were characterized using a radioligand prepared from a superactive analog of salmon GnRH (sGnRH), D-Arg(6)-Pro(9)-sGnRH-NEt (sGnRHa). Binding of(125)I-sGnRHa to catfish pituitary membrane fractions reached equilibrium after 2 h incubation at 4°C.

  11. AKAP13 Rho-GEF and PKD-binding domain deficient mice develop normally but have an abnormal response to β-adrenergic-induced cardiac hypertrophy.

    Directory of Open Access Journals (Sweden)

    Matthew J Spindler

    Full Text Available A-kinase anchoring proteins (AKAPs are scaffolding molecules that coordinate and integrate G-protein signaling events to regulate development, physiology, and disease. One family member, AKAP13, encodes for multiple protein isoforms that contain binding sites for protein kinase A (PKA and D (PKD and an active Rho-guanine nucleotide exchange factor (Rho-GEF domain. In mice, AKAP13 is required for development as null embryos die by embryonic day 10.5 with cardiovascular phenotypes. Additionally, the AKAP13 Rho-GEF and PKD-binding domains mediate cardiomyocyte hypertrophy in cell culture. However, the requirements for the Rho-GEF and PKD-binding domains during development and cardiac hypertrophy are unknown.To determine if these AKAP13 protein domains are required for development, we used gene-trap events to create mutant mice that lacked the Rho-GEF and/or the protein kinase D-binding domains. Surprisingly, heterozygous matings produced mutant mice at Mendelian ratios that had normal viability and fertility. The adult mutant mice also had normal cardiac structure and electrocardiograms. To determine the role of these domains during β-adrenergic-induced cardiac hypertrophy, we stressed the mice with isoproterenol. We found that heart size was increased similarly in mice lacking the Rho-GEF and PKD-binding domains and wild-type controls. However, the mutant hearts had abnormal cardiac contractility as measured by fractional shortening and ejection fraction.These results indicate that the Rho-GEF and PKD-binding domains of AKAP13 are not required for mouse development, normal cardiac architecture, or β-adrenergic-induced cardiac hypertrophic remodeling. However, these domains regulate aspects of β-adrenergic-induced cardiac hypertrophy.

  12. The effect of administering equine chorionic gonadotropin (eCG) and human chorionic gonadotropin (hCG) post artificial insemination on fertility of lactating dairy cows.

    Science.gov (United States)

    Bartolome, J A; Wallace, S Perez; de la Sota, R L; Thatcher, W W

    2012-09-15

    The objective was to evaluate the effect of equine chorionic gonadotropin (eCG) and hCG post artificial insemination (AI) on fertility of lactating dairy cows. In Experiment 1, cows were either treated with eCG on Day 22 post AI (400 IU; n = 80) or left untreated (n = 84). On Day 29, pregnant cows were either treated with hCG (2500 IU; n = 32) or left untreated (n = 36). Pregnancy and progesterone were evaluated on Days 29 and 45. In Experiment 2, cows (n = 28) were either treated with eCG on Day 22 (n = 13) or left untreated (n = 15) and either treated with hCG on Day 29 (n = 14) or left untreated (n = 14). Blood sampling and ultrasonography were conducted between Days 22 and 45. In Experiment 3, cows were either treated with eCG on Day 22 post AI (n = 229) or left untreated (n = 241). Pregnancy was evaluated on Days 36 and 85. In Experiment 1, eCG on Day 22 increased (P cows on Day 29 (50.0 vs. 33.3%) and on Day 45, the increase was higher (P cows with timed AI (41.2 vs. 6.5%) than in cows AI at detected estrus (50.0 vs. 37.8%). Pregnancy losses were reduced by eCG and hCG, but increased in cows that did not receive eCG but were given hCG (P cows, but not in cows treated with eCG. In Experiment 2, hCG increased (P cows (P cows with low body condition (eCG = 45.6 and 43.5%; Control = 22.9 and 22.9%). In conclusion, eCG at 22 days post insemination increased fertility, primarily in cows with low body condition and reduced pregnancy losses when given 7 days before hCG; hCG induced accessory CLs and slightly increased progesterone, but hCG given in the absence of a prior eCG treatment reduced fertility. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. A loss-of-function mutation in the nucleoporin AtNUP160 indicates that normal auxin signalling is required for a proper ethylene response in Arabidopsis

    Science.gov (United States)

    Robles, Linda M.; Deslauriers, Stephen D.; Alvarez, Ashley A.; Larsen, Paul B.

    2012-01-01

    As part of a continuing effort to elucidate mechanisms that regulate the magnitude of ethylene signalling, an Arabidopsis mutant with an enhanced ethylene response was identified. Subsequent characterization of this loss-of-function mutant revealed severe hypocotyl shortening in the presence of saturating ethylene along with increased expression in leaves of a subset of ethylene-responsive genes. It was subsequently determined by map-based cloning that the mutant (sar1-7) represents a loss-of-function mutation in the previously described nucleoporin AtNUP160 (At1g33410, SAR1). In support of previously reported results, the sar1-7 mutant partially restored auxin responsiveness to roots of an rce1 loss-of-function mutant, indicating that AtNUP160/SAR1 is required for proper expression of factors responsible for the repression of auxin signalling. Analysis of arf7-1/sar1-7 and arf19-1/sar1-7 double mutants revealed that mutations affecting either ARF7 or ARF19 function almost fully blocked manifestation of the sar1-7-dependent ethylene hypersensitivity phenotype, suggesting that ARF7- and ARF19-mediated auxin signalling is responsible for regulating the magnitude of and/or competence for the ethylene response in Arabidopsis etiolated hypocotyls. Consistent with this, addition of auxin to ethylene-treated seedlings resulted in severe hypocotyl shortening, reminiscent of that seen for other eer (enhanced ethylene response) mutants, suggesting that auxin functions in part synergistically with ethylene to control hypocotyl elongation and other ethylene-dependent phenomena. PMID:22238449

  14. Fundulus heteroclitus gonadotropins.5: Small scale chromatographic fractionation of pituitary extracts into components with different steroidogenic activities using homologous bioassays

    Directory of Open Access Journals (Sweden)

    Petrino Teresa R

    2004-03-01

    Full Text Available Abstract Fractionation and characterization of gonadotropins (GtH from Fundulus heteroclitus pituitary extracts were carried out using a biocompatible liquid chromatographic procedure (Pharmacia FPLC system. Chromatographic fractions were monitored for gonadotropic activities (induction of oocyte maturation and steroid production using homologous follicle bioassays in vitro. Size-exclusion chromatography eluted gonadotropic activity in one major protein peak (Mr ~ 30,000. Anion-exchange and hydrophobic-interaction chromatography (HIC yielded two distinct peaks of 17beta-estradiol (E2- and 17alpha-hydroxy,20beta-dihydroprogesterone (DHP-promoting activity with associated oocyte maturation. Two-dimensional chromatography (chromatofocusing followed by HIC resolved pituitary extracts into two active fractions; both induced E2 synthesis, but one was relatively poor in eliciting DHP and testosterone production. Thus, using homologous bioassays, at least two quantitatively different gonadotropic (steroidogenic activities: an E2-promoting gonadotropin (GtH I-like and a DHP-promoting gonadotropin (GtH II-like, which has a lower isoelectric point but greater hydrophobicity than the former, can be distinguished from F. heteroclitus pituitaries by a variety of chromatographic procedures. This study complements previous biochemical and molecular data in F. heteroclitus and substantiates the duality of GtH function in a multiple-spawning teleost.

  15. Amenorative effects of exogenous gonadotropins on reproductive profiles of replacement gilts with delayed puberty in a farm in Thailand.

    Science.gov (United States)

    Am-In, Nutthee; Roongsitthichai, Atthaporn

    2017-02-01

    This study was to investigate the effect of gonadotropins on reproductive profiles of replacement gilts with delayed puberty. Totally, 136 Landrace X Yorkshire crossbred gilts, were categorized into control (n = 58) and treatment (n = 78) groups. Gonadotropins (400 U eCG plus 200 IU hCG) were administered in treatment group only. The results revealed that gilts in treatment group had higher number of gilts with estrus (92.3 vs 25.9%, P < 0.001), shorter onset to estrus (4.7 ± 0.3 vs 9.0 ± 0.8 d, P < 0.001), higher number of dominant follicles (18.0 ± 0.2 vs 13.2 ± 0.3 follicles, P < 0.001), and higher farrowing rate (87.5 vs 53.3%, P = 0.002) than those in control group. In conclusion, gonadotropins containing 400 IU eCG plus 200 IU hCG could improve reproductive profiles in replacement gilts with delayed puberty.

  16. Effect of anti-gonadotropin-releasing factor vaccine and band castration on indicators of welfare in beef cattle.

    Science.gov (United States)

    Marti, S; Devant, M; Amatayakul-Chantler, S; Jackson, J A; Lopez, E; Janzen, E D; Schwartzkopf-Genswein, K S

    2015-04-01

    Angus crossbred bulls (n = 60; 257 ± 5.4 d of age; initial BW 358.8 ± 3.78 kg) were used to study the effect of a vaccine against gonadotropin-releasing factor (GnRF) and band castration on behavioral and physiological indicators of pain. Cattle were randomly assigned to 1 of 3 treatments: bulls, band-castrated calves without pain mitigation (castrated), and immune-vaccinated animals administered an anti-GnRF vaccine (vaccinated). All animals were fitted with a radio frequency ear tag so that individual animal feed intake and feeding behavior were recorded daily over the entire trial using an electronic feed bunk monitoring system. Two doses of anti-GnRF vaccine were administrated on d -35 and 0 and band castration was performed on d 0. Animal BW was recorded weekly starting on d -36 until d 56. Visual analog scores (VAS) were measured on d -36 -35, -1, and 0, and salivary cortisol concentration was measured at -30, 0, 30, 60, 120, and 270 min on d -35 and 0 after castration. Saliva and blood were obtained on d 1, 2, 5, and 7 and weekly until d 56 for determination of cortisol and complete blood cell count. Video data were collected for pain, sexual, and aggressive behavior daily the first week and once a week until d 56. Data were analyzed with a mixed-effect model with castration, time, and their interactions as main effects. Vaccinated calves had reduced ADG and intake (P castrated calves had reduced ADG and intake (P castration. However, on d 0, castrated cattle had greater cortisol concentrations and VAS (P 0.05) between treatments on d 0, 1, and 2. At d 56, vaccinated calves had greater (P castrated calves and both had less final BW than bulls. There was no indication that vaccination caused any physiological or behavioral changes indicative of pain. In contrast, band castration resulted in elevated cortisol scores and VAS indicative of a pain response and behavior related to pain (P castration in beef cattle under North American feedlot practices.

  17. Gonadotropin-releasing hormone agonist triggering of oocyte maturation in assisted reproductive technology cycles

    Directory of Open Access Journals (Sweden)

    Engin Türkgeldi

    2015-06-01

    Full Text Available Gonadotropin-releasing hormone agonists (GnRHa have gained increasing attention in the last decade as an alternative trigger for oocyte maturation in patients at high risk for ovarian hyperstimulation syndrome (OHSS. They provide a short luteinizing hormone (LH peak that limits the production of vascular endothelial growth factor, which is the key mediator leading to increased vascular permeability, the hallmark of OHSS. Initial studies showed similar oocyte yield and embryo quality compared with conventional human chorionic gonadotropin (hCG triggering; however, lower pregnancy rates and higher miscarriage rates were alarming in GnRHa triggered groups. Therefore, two approaches have been implemented to rescue the luteal phase in fresh transfers. Intensive luteal phase support (iLPS involves administiration of high doses of progesterone and estrogen and active patient monitoring. iLPS has been shown to provide satisfactory fertilization and clinical pregnancy rates, and to be especially useful in patients with high endogenous LH levels, such as in polycystic ovary syndrome. The other method for luteal phase rescue is low-dose hCG administiration 35 hours after GnRHa trigger. Likewise, this method results in statistically similar ongoing pregnancy rates (although slightly lower than to those of hCG triggered cycles. GnRHa triggering decreased OHSS rates dramatically, however, none of the rescue methods prevent OHSS totally. Cases were reported even in patients who underwent cryopreservation and did not receive hCG. GnRH triggering induces a follicle stimulating hormone (FSH surge, similar to natural cycles. Its possible benefits have been investigated and dual triggering, GnRHa trigger accompanied by a simultaneous low-dose hCG injection, has produced promising results that urge further exploration. Last of all, GnRHa triggering is useful in fertility preservation cycles in patients with hormone sensitive tumors. In conclusion, GnRHa triggering

  18. Test-retest repeatability of the pupil light response to blue and red light stimuli in normal human eyes using a novel pupillometer

    Directory of Open Access Journals (Sweden)

    Kristina eHerbst

    2011-02-01

    Full Text Available In this study, we evaluated the repeatability of pupil responses to colored light stimuli in healthy subjects using a prototype chromatic pupillometer. One eye of 10 healthy subjects was tested twice in the same day using monochromatic light exposure at 2 selected wavelengths (660 nm and 470 nm, intensity 300 cd/m2 presented continuously for 20 seconds. Pupil responses were recorded in real time before, during and after light exposure. Maximal contraction amplitude and sustained contraction amplitude were calculated. In addition, we quantified the summed pupil response during continuous light stimulation as the total area between a reference line representing baseline pupil size and the line representing actual pupil size over 20 seconds (area under the curve. There was no significant difference in the repeated measure compared to the first test for any of the pupil response parameters. In conclusion, we have developed a novel prototype of color pupillometer which demonstrates good repeatability in evoking and recording the pupillary response to a bright blue and red light stimulus.

  19. Ethics and "normal birth".

    Science.gov (United States)

    Lyerly, Anne Drapkin

    2012-12-01

    The concept of "normal birth" has been promoted as ideal by several international organizations, although debate about its meaning is ongoing. In this article, I examine the concept of normalcy to explore its ethical implications and raise a trio of concerns. First, in its emphasis on nonuse of technology as a goal, the concept of normalcy may marginalize women for whom medical intervention is necessary or beneficial. Second, in its emphasis on birth as a socially meaningful event, the mantra of normalcy may unintentionally avert attention to meaning in medically complicated births. Third, the emphasis on birth as a normal and healthy event may be a contributor to the long-standing tolerance for the dearth of evidence guiding the treatment of illness during pregnancy and the failure to responsibly and productively engage pregnant women in health research. Given these concerns, it is worth debating not just what "normal birth" means, but whether the term as an ideal earns its keep. © 2012, Copyright the Authors Journal compilation © 2012, Wiley Periodicals, Inc.

  20. Normalization: A Preprocessing Stage

    OpenAIRE

    Patro, S. Gopal Krishna; Sahu, Kishore Kumar

    2015-01-01

    As we know that the normalization is a pre-processing stage of any type problem statement. Especially normalization takes important role in the field of soft computing, cloud computing etc. for manipulation of data like scale down or scale up the range of data before it becomes used for further stage. There are so many normalization techniques are there namely Min-Max normalization, Z-score normalization and Decimal scaling normalization. So by referring these normalization techniques we are ...

  1. NAD+ supplementation normalizes key Alzheimer’s features and DNA damage responses in a new AD mouse model with introduced DNA repair deficiency

    DEFF Research Database (Denmark)

    Hou, Yujun; Lautrup, Sofie; Cordonnier, Stephanie

    2018-01-01

    including phosphorylated Tau (pTau) pathologies, synaptic dysfunction, neuronal death, and cognitive impairment. Here we report that 3xTgAD/Polβ+/− mice have a reduced cerebral NAD+/NADH ratio indicating impaired cerebral energy metabolism, which is normalized by nicotinamide riboside (NR) treatment. NR...... function in multiple behavioral tests and restored hippocampal synaptic plasticity in 3xTgAD mice and 3xTgAD/Polβ+/− mice. In general, the deficits between genotypes and the benefits of NR were greater in 3xTgAD/Polβ+/− mice than in 3xTgAD mice. Our findings suggest a pivotal role for cellular NAD......+ depletion upstream of neuroinflammation, pTau, DNA damage, synaptic dysfunction, and neuronal degeneration in AD. Interventions that bolster neuronal NAD+ levels therefore have therapeutic potential for AD....

  2. Blood leukocyte responses to extracorporeal circulation. 2. Medium term extracorporeal circulation without and with extracorporeal irradiation in normal and splenectomized dogs

    Energy Technology Data Exchange (ETDEWEB)

    Szemere, P.; Fliedner, T.M. (Ulm Univ. (Germany, F.R.). Abt. Klinische Physiologie)

    1983-01-01

    Medium term (6-8 h) extracorporeal irradiation without and with irradiation of blood was performed in normal and splenectomized dogs to reveal the changes of blood leukocytes including CFU-C. A regular but transitory decrease of granulocytes and a longer lasting diminution of lymphocytes in the blood were observed. The CFU-C level became and mostly remained very low during the procedure. Splenectomy did not influence significantly the changes of peripheral leukocyte counts. No marked difference of leukocytes was seen in the blood samples taken from the arterial or venous side of the shunt or even from the cubital vein. Also, the irradiation did not produce any difference in the alterations of blood cell counts compared to those without irradiation. The possible explanations of these results are discussed.

  3. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  4. Group normalization for genomic data.

    Science.gov (United States)

    Ghandi, Mahmoud; Beer, Michael A

    2012-01-01

    Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN), to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

  5. Group normalization for genomic data.

    Directory of Open Access Journals (Sweden)

    Mahmoud Ghandi

    Full Text Available Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN, to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

  6. Improvement of ovarian response and oocyte quality of aged female by administration of bone morphogenetic protein-6 in a mouse model

    Directory of Open Access Journals (Sweden)

    Park Seung S

    2012-12-01

    Full Text Available Abstract Background Advancing female age remains a difficult problem in infertility treatment. Ovarian angiogenesis plays an important role in follicular development and the activation of ovarian angiogenesis has been emerged as a new strategy for the improvement of age-related decline of oocyte quality. BMP-6 affect gonadotropin signals in granulosa cells and it promotes normal fertility by enabling appropriate response to LH and normal oocyte quality. BMP-6 has a potential role in regulation of angiogenesis and regulates the expression of inhibitor of DNA-binding proteins (Ids. Ids involved in the control and timing of follicle selection and granulosa cells differentiation. Especially, Id-1 is well-characterized target of BMP-6 signaling. Therefore, this study investigated whether co-administration of BMP-6 during superovulation process improves ovarian response, oocyte quality and expression of Id-1 and vascular endothelial growth factor (VEGF in the ovary of aged female using a mouse model. Methods Aged C57BL/6 female mice (26–31 weeks old were superovulated by injection with 0.1 mL of 5 IU equine chorionic gonadotropin (eCG containing recombinant mouse BMP-6 at various doses (0, 0.01, 0.1, 1, and 10 ng, followed by injection with 5 IU human chorionic gonadotropin (hCG 48 h later. Then, the mice were immediately paired with an individual male. The aged control group was superovulated without BMP-6. Young mice of 6–9 weeks old were superovulated without BMP-6 as a positive control for superovulation and in vitro culture of embryos. Eighteen hours after hCG injection, zygotes were retrieved and cultured for 4 days. Both ovaries of each mouse were provided in the examination of ovarian expression of Id-1 and VEGF by reverse transcriptase-polymerase chain reaction, western blot, and immunohistochemistry. Results Administration of 0.1 ng BMP-6 significantly increased the number and blastocyst formation rate of oocytes ovulated and ovarian

  7. Necdin, a Prader-Willi syndrome candidate gene, regulates gonadotropin-releasing hormone neurons during development.

    Science.gov (United States)

    Miller, Nichol L G; Wevrick, Rachel; Mellon, Pamela L

    2009-01-15

    Prader-Willi syndrome (PWS) is a complex genetic disorder characterized by hyperphagia, obesity and hypogonadotrophic hypogonadism, all highly suggestive of hypothalamic dysfunction. The NDN gene, encoding the MAGE family protein, necdin, maps to the PWS chromosome region and is highly expressed in mature hypothalamic neurons. Adult mice lacking necdin have reduced numbers of gonadotropin-releasing hormone (GnRH) neurons, but the mechanism for this reduction is unknown. Herein, we show that, although necdin is not expressed in an immature, migratory GnRH neuronal cell line (GN11), high levels are present in a mature GnRH neuronal cell line (GT1-7). Furthermore, overexpression of necdin activates GnRH transcription through cis elements bound by the homeodomain repressor Msx that are located in the enhancer and promoter of the GnRH gene, and knock-down of necdin expression reduces GnRH gene expression. In fact, overexpression of Necdin relieves Msx repression of GnRH transcription through these elements and necdin co-immunoprecipitates with Msx from GnRH neuronal cells, indicating that necdin may activate GnRH gene expression by preventing repression of GnRH gene expression by Msx. Finally, necdin is necessary for generation of the full complement of GnRH neurons during mouse development and extension of GnRH axons to the median eminence. Together, these results indicate that lack of necdin during development likely contributes to the hypogonadotrophic hypogonadal phenotype in individuals with PWS.

  8. Necdin, a Prader–Willi syndrome candidate gene, regulates gonadotropin-releasing hormone neurons during development

    Science.gov (United States)

    Miller, Nichol L.G.; Wevrick, Rachel; Mellon, Pamela L.

    2009-01-01

    Prader–Willi syndrome (PWS) is a complex genetic disorder characterized by hyperphagia, obesity and hypogonadotrophic hypogonadism, all highly suggestive of hypothalamic dysfunction. The NDN gene, encoding the MAGE family protein, necdin, maps to the PWS chromosome region and is highly expressed in mature hypothalamic neurons. Adult mice lacking necdin have reduced numbers of gonadotropin-releasing hormone (GnRH) neurons, but the mechanism for this reduction is unknown. Herein, we show that, although necdin is not expressed in an immature, migratory GnRH neuronal cell line (GN11), high levels are present in a mature GnRH neuronal cell line (GT1-7). Furthermore, overexpression of necdin activates GnRH transcription through cis elements bound by the homeodomain repressor Msx that are located in the enhancer and promoter of the GnRH gene, and knock-down of necdin expression reduces GnRH gene expression. In fact, overexpression of Necdin relieves Msx repression of GnRH transcription through these elements and necdin co-immunoprecipitates with Msx from GnRH neuronal cells, indicating that necdin may activate GnRH gene expression by preventing repression of GnRH gene expression by Msx. Finally, necdin is necessary for generation of the full complement of GnRH neurons during mouse development and extension of GnRH axons to the median eminence. Together, these results indicate that lack of necdin during development likely contributes to the hypogonadotrophic hypogonadal phenotype in individuals with PWS. PMID:18930956

  9. Zebrafish adult-derived hypothalamic neurospheres generate gonadotropin-releasing hormone (GnRH neurons

    Directory of Open Access Journals (Sweden)

    Christian Cortés-Campos

    2015-09-01

    Full Text Available Gonadotropin-releasing hormone (GnRH is a hypothalamic decapeptide essential for fertility in vertebrates. Human male patients lacking GnRH and treated with hormone therapy can remain fertile after cessation of treatment suggesting that new GnRH neurons can be generated during adult life. We used zebrafish to investigate the neurogenic potential of the adult hypothalamus. Previously we have characterized the development of GnRH cells in the zebrafish linking genetic pathways to the differentiation of neuromodulatory and endocrine GnRH cells in specific regions of the brain. Here, we developed a new method to obtain neural progenitors from the adult hypothalamus in vitro. Using this system, we show that neurospheres derived from the adult hypothalamus can be maintained in culture and subsequently differentiate glia and neurons. Importantly, the adult derived progenitors differentiate into neurons containing GnRH and the number of cells is increased through exposure to either testosterone or GnRH, hormones used in therapeutic treatment in humans. Finally, we show in vivo that a neurogenic niche in the hypothalamus contains GnRH positive neurons. Thus, we demonstrated for the first time that neurospheres can be derived from the hypothalamus of the adult zebrafish and that these neural progenitors are capable of producing GnRH containing neurons.

  10. Development of Gonadotropin-Releasing Hormone-Secreting Neurons from Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Carina Lund

    2016-08-01

    Full Text Available Gonadotropin-releasing hormone (GnRH neurons regulate human puberty and reproduction. Modeling their development and function in vitro would be of interest for both basic research and clinical translation. Here, we report a three-step protocol to differentiate human pluripotent stem cells (hPSCs into GnRH-secreting neurons. Firstly, hPSCs were differentiated to FOXG1, EMX2, and PAX6 expressing anterior neural progenitor cells (NPCs by dual SMAD inhibition. Secondly, NPCs were treated for 10 days with FGF8, which is a key ligand implicated in GnRH neuron ontogeny, and finally, the cells were matured with Notch inhibitor to bipolar TUJ1-positive neurons that robustly expressed GNRH1 and secreted GnRH decapeptide into the culture medium. The protocol was reproducible both in human embryonic stem cells and induced pluripotent stem cells, and thus provides a translational tool for investigating the mechanisms of human puberty and its disorders.

  11. Does Gonadotropin Releasing Hormone Agonists plus add-back therapy bring an aurora to orthodontic treatment?

    Directory of Open Access Journals (Sweden)

    Jiang Lingyong

    2012-01-01

    Full Text Available Introduction: Obviously, long therapy time of orthodontic treatment and a number of its adverse effects, such as pain, root resorption, enamel demineralization, periodontal disease, are the main reasons of complaints from patients. It is the first thing for an orthodontist to shorten the period of treatment and decrease the complications of orthodontic treatment as much as possible. The Hypothesis: We hypothesis Gonadotropin Releasing Hormone Agonists (GnRHa and add-back therapy can create the "therapeutic window", namely, the appropriate estrogen level and assuage the adverse effects of estrogen deficiency which should be avoided as much as possible. Evaluation of the Hypothesis: It is generally acknowledged that estrogen has direct regulating role in bone metabolism by acting on osteoblasts and osteoclasts. Estrogen deficiency can increase the rate of orthodontic tooth movement and also bring about some adverse effects. The appropriate estrogen level, which we call the "therapeutic window" in orthodontic treatment, can speed up the orthodontic tooth movement and eliminate the adverse effects as far as possible. GnRHa can be the maker of estrogen deficiency; meanwhile, add-back therapy can remove the adverse effects by estrogen deficiency. So, we believe that GnRHa plus add-back therapy could be a new adjuvant method of orthodontic treatment and be good for orthodontists and patients.

  12. Effect of Adding Human Chorionic Gonadotropin to The Endometrial Preparation Protocol in Frozen Embryo Transfer Cycles

    Directory of Open Access Journals (Sweden)

    Maryam Eftekhar

    2012-01-01

    Full Text Available Background: Human chorionic gonadotropin (HCG, one of the initial embryonic signals, isprobably a major regulator of the embryo-endometrial relationship. This study aims to assess theadvantage of HCG supplementation during the secretory phase of hormonally prepared cycles forthe transfer of cryopreserved-thawed embryos.Materials and Methods: This study was a randomized clinical trial. Infertile women who werecandidates for frozen-thawed embryo transfers entered the study and were divided into two groups,HCG and control. The endometrial preparation method was similar in both groups: all women receivedestradiol valerate (6 mg po per day from the second day of the menstrual cycle and progesteronein oil (100 mg intramuscular (I.M. when the endometrial thickness reached 8 mm. Estradiol andprogesterone were continued until the tenth week of gestation. In the HCG group, patients received anHCG 5000 IU injection on the first day of progesterone administration and the day of embryo transfer.Results: In this study, 130 couples participated: 65 in the HCG group and 65 in the control group.There was no statistically significant difference between groups regarding basic characteristics.Implantation rate, chemical pregnancy, clinical pregnancy, ongoing pregnancy, and abortion rateswere similar in both groups.Conclusion: Although HCG has some advantages in assisted reproductive technology (ARTcycles, our study did not show any benefit of HCG supplementation during the secretory phase offrozen cycles (Registration Number: IRCT201107266420N4.

  13. Gonadotropin-releasing hormone immunoreactivity in the adult and fetal human olfactory system.

    Science.gov (United States)

    Kim, K H; Patel, L; Tobet, S A; King, J C; Rubin, B S; Stopa, E G

    1999-05-01

    Studies in fetal brain tissue of rodents, nonhuman primates and birds have demonstrated that cells containing gonadotropin-releasing hormone (GnRH) migrate from the olfactory placode across the nasal septum into the forebrain. The purpose of this study was to examine GnRH neurons in components of the adult and fetal human olfactory system. In the adult human brain (n=4), immunoreactive GnRH was evident within diffusely scattered cell bodies and processes in the olfactory bulb, olfactory nerve, olfactory cortex, and nervus terminalis located on the anterior surface of the gyrus rectus. GnRH-immunoreactive structures showed a similar distribution in 20-week human fetal brains (n=2), indicating that the migration of GnRH neurons is complete at this time. In 10-11-week fetal brains (n=2), more cells were noted in the nasal cavity than in the brain. Our data are consistent with observations made in other species, confirming olfactory derivation and migration of GnRH neurons into the brain from the olfactory placode. Copyright 1999 Elsevier Science B.V.

  14. [Association of human chorionic gonadotropin level in embryo culture media with early embryo development].

    Science.gov (United States)

    Wang, Haiying; Zhang, Renli; Han, Dong; Liu, Caixia; Cai, Jiajie; Bi, Yanling; Wen, Anmin; Quan, Song

    2014-06-01

    To investigate the association of human chorionic gonadotropin (HCG) level on day 3 of embryo culture with embryo development. Spent culture media were collected from individually cultured embryos on day 3 of in vitro fertilization and embryo transfer (IVF-ET) cycles. HCG concentration in the culture media was measured using an ELISA kit and its association with embryo development was assessed. In the 163 samples of embryo culture media from 60 patients, HCG was positive in 153 sample (93.8%) with a mean level of 0.85 ± 0.43 mIU/ml. The concentration of hCG in the culture media increased gradually as the number of blastomeres increased (F=2.273, P=0.03), and decreased as the morphological grade of the embryo was lowered (F=3.900, P=0.02). ELISA is capable of detecting HCG levels in spent culture media of embryos on day 3 of in vitro culture. The concentration of HCG in spent culture media is positively correlated with the status of early embryo development and implantation rate and thus serves as a useful marker for embryo selection in IVF-ET procedure.

  15. Internalization and recycling of receptor-bound gonadotropin-releasing hormone agonist in pituitary gonadotropes

    International Nuclear Information System (INIS)

    Schvartz, I.; Hazum, E.

    1987-01-01

    The fate of cell surface gonadotropin-releasing hormone (GnRH) receptors on pituitary cells was studied utilizing lysosomotropic agents and monensin. Labeling of pituitary cells with a photoreactive GnRH derivative, [azidobenzoyl-D-Lys6]GnRH, revealed a specific band of Mr = 60,000. When photoaffinity-labeled cells were exposed to trypsin immediately after completion of the binding, the radioactivity incorporated into the Mr = 60,000 band decreased, with a concomitant appearance of a proteolytic fragment (Mr = 45,000). This fragment reflects cell surface receptors. Following GnRH binding, the hormone-receptor complexes underwent internalization, partial degradation, and recycling. The process of hormone-receptor complex degradation was substantially prevented by lysosomotropic agents, such as chloroquine and methylamine, or the proton ionophore, monensin. Chloroquine and monensin, however, did not affect receptor recycling, since the tryptic fragment of Mr = 45,000 was evident after treatment with these agents. This suggests that recycling of GnRH receptors in gonadotropes occurs whether or not the internal environment is acidic. Based on these findings, we propose a model describing the intracellular pathway of GnRH receptors

  16. Glucocorticoid regulation of gonadotropin release from gonadotropes of ovine pituitary gland in vitro

    International Nuclear Information System (INIS)

    Nangalama, A.W.

    1989-01-01

    In order to understand the role of glucocorticoids in the regulation of gonadotropin release by the pituitary gland, the short-term effects of cortisol perifusion (1.5 h to 8 hrs) on GnRH-induced LH secretion were investigated. To determine the biochemical mechanism(s) by which cortisol can act to modulate GnRH-induced LH release, the interactions of cortisol and arachidonic acid in GnRH-stimulated LH release were examined. Cortisol perifusion for 1.5 hr had no effect on GnRH-induced LH release, but longer treatment periods (4 hr-8 hrs) significantly reduced GnRH-stimulated LH release (4.0 hr, p -4 M AA was administered for 20 min before a 10 min, 10 -10 M GnRH pulse. Like cortisol, chloroquine also failed to inhibit AA-induced LH release. Perifusion with 10 -6 M cortisol for 6.0 hours significantly (p 3 ]AA release 24% below the basal (100%) [ 3 H]AA secretion. Reduction of [ 3 H]AA release was accompanied by decreased GnRH-stimulated LH secretion

  17. Interaction Of Calcium Phosphate Nanoparticles With Human Chorionic Gonadotropin Modifies Secondary And Tertiary Protein Structure

    Directory of Open Access Journals (Sweden)

    Al-Hakeim Hussein K

    2015-12-01

    Full Text Available Calcium phosphate nanoparticles (CaPNP have good biocompatibility and bioactivity inside human body. In this study, the interaction between CaPNP and human chorionic gonadotropin (hCG was analyzed to determine the changes in the protein structure in the presence of CaPNP and the quantity of protein adsorbed on the CaPNP surface. The results showed a significant adsorption of hCG on the CaPNP nanoparticle surface. The optimal fit was achieved using the Sips isotherm equation with a maximum adsorption capacity of 68.23 µg/mg. The thermodynamic parameters, including ∆H° and ∆G°, of the adsorption process are positive, whereas ∆S° is negative. The circular dichroism results of the adsorption of hCG on CaPNP showed the changes in its secondary structure; such changes include the decomposition of α-helix strand and the increase in β-pleated sheet and random coil percentages. Fluorescence study indicated minimal changes in the tertiary structure near the microenvironment of the aromatic amino acids such as tyrosine and phenyl alanine caused by the interaction forces between the CaPNP and hCG protein. The desorption process showed that the quantity of the hCG desorbed significantly increases as temperature increases, which indicates the weak forces between hCG and the surface.

  18. Radioimmunological properties of antisera from carp gonadotropin (c-GTH) and its subunits

    International Nuclear Information System (INIS)

    Burzawa-Gerard, Elisabeth; Kerdelhue, B.

    1978-01-01

    Anti-sera against carp gonadotropin (c-GTH) and its subunits SU I and SU II were produced in rabbits (IS-c-GTH, IS-SU I and IS-SU II). The radioimmunological titers were determined when antiserum binding dilution was 50 p. 100 of the 125 I-labelled glycoproteins. The titers of IS-c-GTH were 1/750 000, 1/300 000 and 1/500 000, respectively with c-GTH, SU I and SU II. With SU I, the titer of IS-SU I was 1/100 000 ; this antiserum in excess bound only 25 p. 100 of the c-GTH and no SU II. With c-GTH and SU II, the titer of IS-SU II was 1/270 000; it was 1/13 000 with SU I. With these antisera no binding was observed with rat hormones (LH, FSH, TSH, PRL) but IS-c-GTH and IS-SU II weakly bound rLH [fr

  19. Nonreproductive role of gonadotropin-releasing hormone in the control of ascidian metamorphosis.

    Science.gov (United States)

    Kamiya, Chisato; Ohta, Naoyuki; Ogura, Yosuke; Yoshida, Keita; Horie, Takeo; Kusakabe, Takehiro G; Satake, Honoo; Sasakura, Yasunori

    2014-12-01

    Gonadotropin-releasing hormones (GnRHs) are neuropeptides that play central roles in the reproduction of vertebrates. In the ascidian Ciona intestinalis, GnRHs and their receptors are expressed in the nervous systems at the larval stage, when animals are not yet capable of reproduction, suggesting that the hormones have non-reproductive roles. We showed that GnRHs in Ciona are involved in the animal's metamorphosis by regulating tail absorption and adult organ growth. Absorption of the larval tail and growth of the adult organs are two major events in the metamorphosis of ascidians. When larvae were treated with GnRHs, they completed tail absorption more frequently than control larvae. cAMP was suggested to be a second messenger for the induction of tail absorption by GnRHs. tGnRH-3 and tGnRH-5 (the "t" indicates "tunicate") inhibited the growth of adult organs by arresting cell cycle progression in parallel with the promotion of tail absorption. This study provides new insights into the molecular mechanisms of ascidian metamorphosis conducted by non-reproductive GnRHs. © 2014 Wiley Periodicals, Inc.

  20. Chitosan-based DNA delivery vector targeted to gonadotropin-releasing hormone (GnRH) receptor.

    Science.gov (United States)

    Boonthum, Chatwalee; Namdee, Katawut; Boonrungsiman, Suwimon; Chatdarong, Kaywalee; Saengkrit, Nattika; Sajomsang, Warayuth; Ponglowhapan, Suppawiwat; Yata, Teerapong

    2017-02-10

    The main purpose of this study was to investigate the application of modified chitosan as a potential vector for gene delivery to gonadotropin-releasing hormone receptor (GnRHR)-expressing cells. Such design of gene carrier could be useful in particular for gene therapy for cancers related to the reproductive system, gene disorders of sexual development, and contraception and fertility control. In this study, a decapeptide GnRH was successfully conjugated to chitosan (CS) as confirmed by proton nuclear magnetic resonance spectroscopy ( 1 H NMR) and Attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR). The synthesized GnRH-conjugated chitosan (GnRH-CS) was able to condense DNA to form positively charged nanoparticles and specifically deliver plasmid DNA to targeted cells in both two-dimensional (2D) and three-dimensional (3D) cell cultures systems. Importantly, GnRH-CS exhibited higher transfection activity compared to unmodified CS. In conclusion, GnRH-conjugated chitosan can be a promising carrier for targeted DNA delivery to GnRHR-expressing cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. High gonadotropin dosage does not affect euploidy and pregnancy rates in IVF PGS cycles with single embryo transfer.

    Science.gov (United States)

    Barash, Oleksii O; Hinckley, Mary D; Rosenbluth, Evan M; Ivani, Kristen A; Weckstein, Louis N

    2017-11-01

    Does high gonadotropin dosage affect euploidy and pregnancy rates in PGS cycles with single embryo transfer? High gonadotropin dosage does NOT affect euploidy and pregnancy rates in PGS cycles with single embryo transfer. PGS has been proven to be the most effective and reliable method for embryo selection in IVF cycles. Euploidy and blastulation rates decrease significantly with advancing maternal age. In order to recruit an adequate number of follicles, the average dosage of gonadotropins administered during controlled ovarian stimulation in IVF cycles often increases significantly with advancing maternal age. A retrospective study of SNP (Single Nucleotide Polymorphism) PGS outcome data from blastocysts biopsied on day 5 or day 6 was conducted to identify differences in euploidy and clinical pregnancy rates. Seven hundred and ninety four cycles of IVF treatment with PGS between January 2013 and January 2017 followed by 651 frozen embryo transfers were included in the study (506 patients, maternal age (y.o.) - 37.2 ± 4.31). A total of 4034 embryos were analyzed (5.1 ± 3.76 per case) for euploidy status. All embryos were vitrified after biopsy, and selected embryos were subsequently thawed for a hormone replacement frozen embryo transfer cycle. All cycles were analyzed by total gonadotropin dosage (5000 IU), by number of eggs retrieved (1-5, 5-10, 10-15 and >15 eggs) and patient's age (cycles) euploidy rates ranged from 62.3% (cycle) to 67.5% (>5000 IU were used in the IVF cycle) (OR = 0.862, 95% CI 0.687-1.082, P = 0.2) and from 69.5% (1-5 eggs retrieved) to 60.0% (>15 eggs retrieved) (OR = 0.658, 95% CI 0.405-1.071, P = 0.09). Similar data were obtained in the oldest group of patients (≥41 y.o. - 189 IVF cycles): euploidy rates ranged from 30.7 to 26.4% (OR = 0.811, 95% CI 0.452-1.454, P = 0.481) when analyzed by total dosage of gonadotropins used in the IVF cycle and from 40.0 to 30.7% (OR = 0.531, 95% CI 0.204-1.384, P = 0.19), when assessed by the total

  2. The circadian variation in Anti-Müllerian hormone in patients with polycystic ovary syndrome differs significantly from normally ovulating women

    DEFF Research Database (Denmark)

    Bungum, Leif Johan; Franssohn, Florencia; Bungum, Mona Berger Håkonsen

    2013-01-01

    To improve the biologic understanding of the Polycystic Ovarian Syndrome (PCOS) condition by examining the circadian variation and relationship between Anti Müllerian Hormone (AMH), gonadotropins and ovarian steroids in PCOS patients compared to normally ovulating and menstruating women....... By comparing the pattern of co-variation between AMH and Luteinizing Hormone, two compounds closely linked to hyperandrogenism and anovulation in PCOS, the involvement of the Hypothalamic-Pituitary-Ovarian axis in PCOS pathology could be elucidated....

  3. Graded hyperthyroidism and serum human chorionic gonadotropin concentration in patients with trophoblastic disease

    International Nuclear Information System (INIS)

    Rajatanavin, R.

    1989-11-01

    Serum thyroid hormone and basal and post TRH stimulated levels of TSH were measured in 48 female subjects of mean age 29.3 ± 9.2 and mean gravida 2.9 ± 2.6 with trophoblastic disease (TD), both benign and malignant. Normal pregnant women (n=21) served as controls. Twenty-five patients showed a normal response to TRH (Group i) while the rest (Group ii) had subnormal response while thyroid hormone levels were increased. Two subgroups iiA and iiB were formed within Group ii on the basis of the free T 4 levels (measured by equilibrium dialysis) falling below or above the 25th percentile. hCG levels were higher in Group ii than in Group i and a stepwise significant increase in the mean level of this hormone was observed in Group i to iiA and iiB. Significant correlation between hCG levels and those of thyroxine, free thyroxine, and triiodothyronine were found in TD patients as a whole, but not within the different subgroups. Clinical signs were minimal, with proximal muscle weakness and fine finger tumours observed in 10 patients in Group iiB. The study shows that the incidence of biochemical hyperthyroidism is higher than was reported before sensitive methods for TSH measurement were available, and postulates that increased hCG concentrations in themselves and/or abnormal metabolic variants of hCG produced by trophoblastic tumours may act as thyroid stimulators in this condition. 64 refs, 5 figs, 4 tabs

  4. Analysis of recombinant and native human lutropin/luteotrophin and human chorionic gonadotropin by reversed-phase high performance liquid chromatography

    International Nuclear Information System (INIS)

    Almeida, Beatriz Elane de

    2009-01-01

    Specific RP-HPLC conditions for the analysis of recombinant and native hLH and hCG preparations and of their subunits were set up. Heterodimeric hLH and hCG and their alpha and beta subunits all migrated with significantly different retention times (t R ) in the following order of increasing hydrophobicity: alpha-hCG R = 38.35 +- 0.42 min; RSD = 1.1 %; n = 4 preparations), while the hCG main peak ran about 4 % faster when compared to this average value. Human LH, hFSH and hCG peaks could also be identified in the heterogeneous urinary preparations. Quantitative analysis could be validated for the seven homogeneous preparations and accuracy, precision and sensitivity were calculated on the basis of a highly linear dose-response curve (r=0.99998; p<0.0001; n=20). Quantification of the different gonadotropins in the heterogeneous urinary preparations was also carried out, though with clear accuracy limitations. (author)

  5. Microdose Flare-up Gonadotropin-releasing Hormone (GnRH) Agonist Versus GnRH Antagonist Protocols in Poor Ovarian Responders Undergoing Intracytoplasmic Sperm Injection.

    Science.gov (United States)

    Boza, Aysen; Cakar, Erbil; Boza, Barıs; Api, Murat; Kayatas, Semra; Sofuoglu, Kenan

    2016-01-01

    Microdose flare-up GnRH agonist and GnRH antagonist have become more popular in the management of poor ovarian responders (POR) in recent years; however, the optimal protocol for POR patients undergoing in vitro fertilization has still been a challenge. In this observational study design, two hundred forty four poor ovarian responders were retrospectively evaluated for their response to GnRH agonist protocol (group-1, n=135) or GnRH antagonist protocol (group-2, n=109). Clinical pregnancy rate was the primary end point and was compared between the groups. Student t-test, Mann Whitney U test and χ (2)-test were used to compare the groups. The pmicrodose flare-up protocol has favorable outcomes with respect to the number of oocytes retrieved and implantation rate; nevertheless, the clinical pregnancy rate was found to be similar in comparison to GnRH antagonist protocol in poor ovarian responders. GnRH antagonist protocol appears to be promising with significantly lower gonadotropin requirement and lower treatment cost in poor ovarian responders.

  6. Does the use of gonadotropin-releasing hormone antagonists in natural IVF cycles for poor responder patients cause more harm than benefit?

    Science.gov (United States)

    Aksoy, Senai; Yakin, Kayhan; Seyhan, Ayse; Oktem, Ozgur; Alatas, Cengiz; Ata, Baris; Urman, Bulent

    2016-06-01

    Poor ovarian response to controlled ovarian stimulation (COS) is one of the most critical factors that substantially limits the success of assisted reproduction techniques (ARTs). Natural and modified natural cycle IVF are two options that could be considered as a last resort. Blocking gonadotropin-releasing hormone (GnRH) actions in the endometrium via GnRH receptor antagonism may have a negative impact on endometrial receptivity. We analysed IVF outcomes in 142 natural (n = 30) or modified natural (n = 112) IVF cycles performed in 82 women retrospectively. A significantly lower proportion of natural cycles reached follicular aspiration compared to modified natural cycles (56.7% vs. 85.7%, p cycles ending in embryo transfer (26.7% vs. 44.6%) was not statistically significant between natural cycle and modified natural IVF cycles. Clinical pregnancy (6.7% vs. 7.1%) and live birth rates per initiated cycle (6.7% vs. 5.4%) were similar between the two groups. Notably, the implantation rate was slightly lower in modified natural cycles (16% vs. 25%, p > 0.05). There was a trend towards higher clinical pregnancy (25% vs. 16%) and live birth (25% vs. 12%) rates per embryo transfer in natural cycles compared to modified natural cycles, but the differences did not reach statistical significance.

  7. Regular activity breaks combined with physical activity improve postprandial plasma triglyceride, nonesterified fatty acid, and insulin responses in healthy, normal weight adults: A randomized crossover trial.

    Science.gov (United States)

    Homer, Ashleigh R; Fenemor, Stephen P; Perry, Tracy L; Rehrer, Nancy J; Cameron, Claire M; Skeaff, C Murray; Peddie, Meredith C

    Compared with prolonged sitting, regular activity breaks immediately lower postprandial glucose and insulin, but not triglyceride responses. Postprandial triglycerides can be lowered by physical activity but the effect is often delayed by ∼12 to 24 hours. The objective of the study was to determine whether regular activity breaks affect postprandial triglyceride response in a delayed manner similar to physical activity. In a randomized crossover trial, 36 adults (body mass index 23.9 kg/m 2 [standard deviation 3.9]) completed four 2-day interventions: (1) prolonged sitting (SIT); (2) prolonged sitting with 30 minutes of continuous walking (60% VO 2max ), at the end of Day 1 (SIT + PA D1 ); (3) Sitting with 2 minutes of walking (60% VO 2max ) every 30 minutes (RAB); (4) A combination of the continuous walking and regular activity breaks in 2 and 3 above (RAB + PA D1 ). Postprandial plasma triglyceride, nonesterified fatty acids, glucose, and insulin responses were measured in venous blood over 5 hours on Day 2. Compared with SIT, both RAB (difference: -43.61 mg/dL·5 hours; 95% confidence interval [CI] -83.66 to -2.67; P = .035) and RAB + PA D1 (-65.86 mg/dL·5 hours; 95% CI -112.14 to -19.58; P = .005) attenuated triglyceride total area under the curve (tAUC). RAB + PA D1 produced the greatest reductions in insulin tAUC (-23%; 95% CI -12% to -31%; P glucose tAUC (P = .290). Postprandial triglyceride response is attenuated by regular activity breaks, when measured ∼24 hours after breaks begin. Combining regular activity breaks with 30 minutes of continuous walking further improves insulinemic and lipidemic responses. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  8. SU-F-T-681: Does the Biophysical Modeling for Immunological Aspects in Radiotherapy Precisely Predict Tumor and Normal Tissue Responses?

    Energy Technology Data Exchange (ETDEWEB)

    Oita, M [Graduate School of Health Sciences, Okayama University, Okayama, Okayama (Japan); Nakata, K [Tokyo University of Science, Noda, Chiba (Japan); Sasaki, M [Tokushima University Hospital, Tokushima, Tokushima (Japan); Tominaga, M [Tokushima University Graduate School, Tokushima, Tokushima (Japan); Aoyama, H [Okayama University Hospital, Okayama, Okayama (Japan); Honda, H [Ehime University Hospital, Tohon, Ehime (Japan); Uto, Y [Tokushima University, Tokushima, Tokushima (Japan)

    2016-06-15

    Purpose: Recent advances in immunotherapy make possible to combine with radiotherapy. The aim of this study was to assess the TCP/NTCP model with immunological aspects including stochastic distribution as intercellular uncertainties. Methods: In the clinical treatment planning system (Eclipse ver.11.0, Varian medical systems, US), biological parameters such as α/β, D50, γ, n, m, TD50 including repair parameters (bi-exponential repair) can be set as any given values to calculate the TCP/NTCP. Using a prostate cancer patient data with VMAT commissioned as a 6-MV photon beam of Novalis-Tx (BrainLab, US) in clinical use, the fraction schedule were hypothesized as 70–78Gy/35–39fr, 72–81Gy/40–45fr, 52.5–66Gy/16–22fr, 35–40Gy/5fr of 5–7 fractions in a week. By use of stochastic biological model applying for Gaussian distribution, the effects of the TCP/NTCP variation of repair parameters of the immune system as well as the intercellular uncertainty of tumor and normal tissues have been evaluated. Results: As respect to the difference of the α/β, the changes of the TCP/NTCP were increased in hypo-fraction regimens. The difference between the values of n and m affect the variation of the NTCP with the fraction schedules, independently. The elongation of repair half-time (long) increased the TCP/NTCP twice or much higher in the case of hypo-fraction scheme. For tumor, the repopulation parameters such as Tpot and Tstart, which is immunologically working to the tumor, improved TCP. Conclusion: Compared to default fixed value, which has affected by the probability of cell death and cure, hypo-fractionation schemes seemed to have advantages for the variations of the values of m. The possibility of an increase of the α/β or TD50 and repair parameters in tumor and normal tissue by immunological aspects were highly expected. For more precise prediction, treatment planning systems should be incorporated the complicated biological optimization in clinical

  9. Spatiotemporal changes of normalized difference vegetation index (NDVI) and response to climate extremes and ecological restoration in the Loess Plateau, China

    Science.gov (United States)

    Zhao, Anzhou; Zhang, Anbing; Liu, Xianfeng; Cao, Sen

    2018-04-01

    Extreme drought, precipitation, and other extreme climatic events often have impacts on vegetation. Based on meteorological data from 52 stations in the Loess Plateau (LP) and a satellite-derived normalized difference vegetation index (NDVI) from the third-generation Global Inventory Modeling and Mapping Studies (GIMMS3g) dataset, this study investigated the relationship between vegetation change and climatic extremes from 1982 to 2013. Our results showed that the vegetation coverage increased significantly, with a linear rate of 0.025/10a ( P NDVI revealed an increasing trend from the northwest to the southeast, with about 61.79% of the LP exhibiting a significant increasing trend ( P NDVI at the yearly time scale ( P NDVI during the spring and autumn ( P NDVI and RX1day, TMAXmean, TXn, and TXx was insignificant in summer. Vegetation exhibited a significant negative relationship with precipitation extremes in winter ( P NDVI in Yan'an and Yulin during 1998-2013, r = 0.859 and 0.85, n = 16, P < 0.001.

  10. Ginsenoside Rb1 Attenuates Agonist-Induced Contractile Response via Inhibition of Store-Operated Calcium Entry in Pulmonary Arteries of Normal and Pulmonary Hypertensive Rats

    Directory of Open Access Journals (Sweden)

    Rui-Xing Wang

    2015-03-01

    Full Text Available Background: Pulmonary hypertension (PH is characterized by sustained vasoconstriction, enhanced vasoreactivity and vascular remodeling, which leads to right heart failure and death. Despite several treatments are available, many forms of PH are still incurable. Ginsenoside Rb1, a principle active ingredient of Panax ginseng, exhibits multiple pharmacological effects on cardiovascular system, and suppresses monocrotaline (MCT-induced right heart hypertrophy. However, its effect on the pulmonary vascular functions related to PH is unknown. Methods: We examined the vasorelaxing effects of ginsenoside Rb1 on endothelin-1 (ET-1 induced contraction of pulmonary arteries (PAs and store-operated Ca2+ entry (SOCE in pulmonary arterial smooth muscle cells (PASMCs from chronic hypoxia (CH and MCT-induced PH. Results: Ginsenoside Rb1 elicited concentration-dependent relaxation of ET-1-induced PA contraction. The vasorelaxing effect was unaffected by nifedipine, but abolished by the SOCE blocker Gd3+. Ginsenoside Rb1 suppressed cyclopiazonic acid (CPA-induced PA contraction, and CPA-activated cation entry and Ca2+ transient in PASMCs. ET-1 and CPA-induced contraction, and CPA-activated cation entry and Ca2+ transients were enhanced in PA and PASMCs of CH and MCT-treated rats; the enhanced responses were abolished by ginsenoside Rb1. Conclusion: Ginsenoside Rb1 attenuates ET-1-induced contractile response via inhibition of SOCE, and it can effectively antagonize the enhanced pulmonary vasoreactivity in PH.

  11. Standardization of the radioimmunoassay of 17{beta}-estradiol (E{sub 2}) plasmatic and his application to the study of secretion of E{sub 2} in normal women, during the menstrual cycle and after the infusion of the gonadotropin (LH/FSH/RH) release factor; Padronizacao do metodo de radioimunoensaio de 17{beta}-estradiol (E{sub 2}) plasmatico e sua aplicacao ao estudo da secrecao de E{sub 2} em mulheres normais, durante o ciclo menstrual e apos a infusao do fator liberador de gonadotrofinas (LH/FSH/RH)

    Energy Technology Data Exchange (ETDEWEB)

    Kiyan, Takeko Shimizu

    1979-07-01

    A radioimmunoassay method for measurement of plasma E{sub 2} was standardized utilizing a highly specific antisera against E{sub 2} [-6 (-0-carboxymethyl)-oxime] BSA without the need of previous chromatographic purification. The anti-E{sub 2} serum was highly specific, showing high affinity with affinity constants: K{sub 1}=1 .62x10{sup 12} M{sup -1} and K{sub 2} = 2.94x10{sup 11} M{sup -1}, calculated by Scatchard plot. The standard curve sensitivity was 2 pico grams. The method was specific and accurate, showing an intra-assay precision with a mean C.V. of 2.9%, with the inter-assay evaluation showing a mean C.V. of 5.0%. This method was employed to evaluate E{sub 2} secretion during the menstrual cycle in 6 normal females, as indicated below: Days: -14 to -10 (early follicular phase..64.68 pg/ml{+-}12.14; - 9 to - 1(late follicular phase).122.39 pg/ml {+-}33,54; Peak day 281.28 pg/ml {+-}66 ,59; + 1 to + 7(early luteal phase) 127.47 pg/ml {+-}24.88; + 8 to +14 (late luteal phase) 87.57 pg/ml{+-}37,56. The effect of the acute and prolonged infusion of LH/FSH-RH(synthetic hypothalamic LH and FSH releasing hormone) was evaluated in the follicular and luteal phase in some of the normal females. (author)

  12. An increased rectal maximum tolerable volume and long anal canal are associated with poor short-term response to biofeedback therapy for patients with anismus with decreased bowel frequency and normal colonic transit time.

    Science.gov (United States)

    Rhee, P L; Choi, M S; Kim, Y H; Son, H J; Kim, J J; Koh, K C; Paik, S W; Rhee, J C; Choi, K W

    2000-10-01

    Biofeedback is an effective therapy for a majority of patients with anismus. However, a significant proportion of patients still failed to respond to biofeedback, and little has been known about the factors that predict response to biofeedback. We evaluated the factors associated with poor response to biofeedback. Biofeedback therapy was offered to 45 patients with anismus with decreased bowel frequency (less than three times per week) and normal colonic transit time. Any differences in demographics, symptoms, and parameters of anorectal physiologic tests were sought between responders (in whom bowel frequency increased up to three times or more per week after biofeedback) and nonresponders (in whom bowel frequency remained less than three times per week). Thirty-one patients (68.9 percent) responded to biofeedback and 14 patients (31.1 percent) did not. Anal canal length was longer in nonresponders than in responders (4.53 +/- 0.5 vs. 4.08 +/- 0.56 cm; P = 0.02), and rectal maximum tolerable volume was larger in nonresponders than in responders. (361 +/- 87 vs. 302 +/- 69 ml; P = 0.02). Anal canal length and rectal maximum tolerable volume showed significant differences between responders and nonresponders on multivariate analysis (P = 0.027 and P = 0.034, respectively). This study showed that a long anal canal and increased rectal maximum tolerable volume are associated with poor short-term response to biofeedback for patients with anismus with decreased bowel frequency and normal colonic transit time.

  13. Different roles of ROS and Nrf2 in Cr(VI)-induced inflammatory responses in normal and Cr(VI)-transformed cells

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Ram Vinod; Pratheeshkumar, Poyil; Son, Yong-Ok; Wang, Lei [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, College of Medicine, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Hitron, John Andrew [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Divya, Sasidharan Padmaja; Zhang, Zhuo [Department of Toxicology and Cancer Biology, College of Medicine, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Shi, Xianglin, E-mail: xshi5@email.uky.edu [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States)

    2016-09-15

    Hexavalent chromium (Cr(VI)) is classified as a human carcinogen. Cr(VI) has been associated with adenocarcinomas and squamous cell carcinoma of the lung. The present study shows that acute Cr(VI) treatment in human bronchial epithelial cells (BEAS-2B) increased inflammatory responses (TNF-α, COX-2, and NF-кB/p65) and expression of Nrf2. Cr(VI)-induced generation of reactive oxygen species (ROS) are responsible for increased inflammation. Despite the fact that Nrf2 is a master regulator of response to oxidative stress, silencing of Nrf2 in the acute Cr(VI) treatment had no effect on Cr(VI)-induced inflammation. In contrast, in Cr(VI)-transformed (CrT) cells, Nrf2 is constitutively activated. Knock-down of this protein resulted in decreased inflammation, while silencing of SOD2 and CAT had no effect in the expression of these inflammatory proteins. Results obtained from the knock-down of Nrf2 in CrT cells are very different from the results obtained in the acute Cr(VI) treatment. In BEAS-2B cells, knock-down of Nrf2 had no effect in the inflammation levels, while in CrT cells a decrease in the expression of inflammation markers was observed. These results indicate that before transformation, ROS plays a critical role while Nrf2 not in Cr(VI)-induced inflammation, whereas after transformation (CrT cells), Nrf2 is constitutively activated and this protein maintains inflammation while ROS not. Constitutively high levels of Nrf2 in CrT binds to the promoter regions of COX-2 and TNF-α, leading to increased inflammation. Collectively, our results demonstrate that before cell transformation ROS are important in Cr(VI)-induced inflammation and after transformation a constitutively high level of Nrf2 is important. - Highlights: • Cr(VI)-induced ROS increased inflammation, while Nrf2 had no effect. • In the CrT cells knock-down of Nrf2 resulted in decreased inflammation. • Mechanistic differences in regulating Cr(VI)-induced inflammation.

  14. TH-E-BRF-04: Characterizing the Response of Texture-Based CT Image Features for Quantification of Radiation-Induced Normal Lung Damage

    International Nuclear Information System (INIS)

    Krafft, S; Court, L; Briere, T; Martel, M

    2014-01-01

    Purpose: Radiation induced lung damage (RILD) is an important dose-limiting toxicity for patients treated with radiation therapy. Scoring systems for RILD are subjective and limit our ability to find robust predictors of toxicity. We investigate the dose and time-related response for texture-based lung CT image features that serve as potential quantitative measures of RILD. Methods: Pre- and post-RT diagnostic imaging studies were collected for retrospective analysis of 21 patients treated with photon or proton radiotherapy for NSCLC. Total lung and selected isodose contours (0–5, 5–15, 15–25Gy, etc.) were deformably registered from the treatment planning scan to the pre-RT and available follow-up CT studies for each patient. A CT image analysis framework was utilized to extract 3698 unique texture-based features (including co-occurrence and run length matrices) for each region of interest defined by the isodose contours and the total lung volume. Linear mixed models were fit to determine the relationship between feature change (relative to pre-RT), planned dose and time post-RT. Results: Seventy-three follow-up CT scans from 21 patients (median: 3 scans/patient) were analyzed to describe CT image feature change. At the p=0.05 level, dose affected feature change in 2706 (73.1%) of the available features. Similarly, time affected feature change in 408 (11.0%) of the available features. Both dose and time were significant predictors of feature change in a total of 231 (6.2%) of the extracted image features. Conclusion: Characterizing the dose and time-related response of a large number of texture-based CT image features is the first step toward identifying objective measures of lung toxicity necessary for assessment and prediction of RILD. There is evidence that numerous features are sensitive to both the radiation dose and time after RT. Beyond characterizing feature response, further investigation is warranted to determine the utility of these features as

  15. Cadmium, cobalt and lead cause stress response, cell cycle deregulation and increased steroid as well as xenobiotic metabolism in primary normal human bronchial epithelial cells which is coordinated by at least nine transcription factors

    Energy Technology Data Exchange (ETDEWEB)

    Glahn, Felix; Wiese, Jan; Foth, Heidi [Martin-Luther-University, Halle-Wittenberg, Institute of Environmental Toxicology, Halle/Saale (Germany); Schmidt-Heck, Wolfgang; Guthke, Reinhard [Leibniz Institute for Natural Product Research and Infection Biology, Hans Knoell Institute, Jena (Germany); Zellmer, Sebastian; Gebhardt, Rolf [University of Leipzig, Institute of Biochemistry, Medical Faculty, Leipzig (Germany); Golka, Klaus; Degen, Gisela H.; Hermes, Matthias; Schormann, Wiebke; Brulport, Marc; Bauer, Alexander; Bedawy, Essam [IfADo, Leibniz Research Centre for Working Environment and Human Factors, Dortmund (Germany); Hergenroeder, Roland [ISAS, Institute for Analytical Sciences, Dortmund (Germany); Lehmann, Thomas [Translational Centre for Regenerative Medicine, Leipzig (Germany); Hengstler, Jan G. [IfADo, Leibniz Research Centre for Working Environment and Human Factors, Dortmund (Germany)

    2008-08-15

    Workers occupationally exposed to cadmium, cobalt and lead have been reported to have increased levels of DNA damage. To analyze whether in vivo relevant concentrations of heavy metals cause systematic alterations in RNA expression patterns, we performed a gene array study using primary normal human bronchial epithelial cells. Cells were incubated with 15{mu}g/l Cd(II), 25{mu}g/l Co(II) and 550{mu}g/l Pb(II) either with individual substances or in combination. Differentially expressed genes were filtered out and used to identify enriched GO categories as well as KEGG pathways and to identify transcription factors whose binding sites are enriched in a given set of promoters. Interestingly, combined exposure to Cd(II), Co(II) and Pb(II) caused a coordinated response of at least seven stress response-related transcription factors, namely Oct-1, HIC1, TGIF, CREB, ATF4, SRF and YY1. A stress response was further corroborated by up regulation of genes involved in glutathione metabolism. A second major response to heavy metal exposure was deregulation of the cell cycle as evidenced by down regulation of the transcription factors ELK-1 and the Ets transcription factor GABP, as well as deregulation of genes involved in purine and pyrimidine metabolism. A third and surprising response was up regulation of genes involved in steroid metabolism, whereby promoter analysis identified up regulation of SRY that is known to play a role in sex determination. A forth response was up regulation of xenobiotic metabolising enzymes, particularly of dihydrodiol dehydrogenases 1 and 2 (AKR1C1, AKR1C2). Incubations with individual heavy metals showed that the response of AKR1C1 and AKR1C2 was predominantly caused by lead. In conclusion, we have shown that in vivo relevant concentrations of Cd(II), Co(II) and Pb(II) cause a complex and coordinated response in normal human bronchial epithelial cells. This study gives an overview of the most responsive genes. (orig.)

  16. Short-term effects of a low glycemic index carob-containing snack on energy intake, satiety, and glycemic response in normal-weight, healthy adults: Results from two randomized trials.

    Science.gov (United States)

    Papakonstantinou, Emilia; Orfanakos, Nickolaos; Farajian, Paul; Kapetanakou, Anastasia E; Makariti, Ifigenia P; Grivokostopoulos, Nikolaos; Ha, Marie-Ann; Skandamis, Panagiotis N

    2017-10-01

    The potential positive health effects of carob-containing snacks are largely unknown. Therefore, the aims of these studies were to determine the glycemic index (GI) of a carob snack compared with chocolate cookie containing equal amounts of available carbohydrates and to compare the effects of a carob versus chocolate cookie preload consumed as snack before a meal on (a) short-term satiety response measured by subsequent ad libitum meal intake, (b) subjective satiety as assessed by visual analog scales and (c) postprandial glycemic response. Ten healthy, normal-weight volunteers participated in GI investigation. Then, 50 healthy, normal-weight individuals consumed, crossover, in random order, the preloads as snack, with 1-wk washout period. Ad libitum meal (lunch and dessert) was offered. Capillary blood glucose samples were collected at baseline, 2 h after breakfast, just before preload consumption, 2 h after preload, 3 h after preload, just before meal (lunch and dessert), 1 h after meal, and 2 h after meal consumption. The carob snack was a low GI food, whereas the chocolate cookie was a high GI food (40 versus 78, respectively, on glucose scale). Consumption of the carob preload decreased the glycemic response to a following meal and to the individual's feelings of hunger, desire to eat, preoccupation with food, and thirst between snack and meal, as assessed with the use of visual analog scales. Subsequently, participants consumed less amounts of food (g) and had lower total energy intake at mealtimes. The carob snack led to increased satiety, lower energy intake at meal, and decreased postmeal glycemic response possibly due to its low GI value. Identifying foods that promote satiety and decrease glycemic response without increasing the overall energy intake may offer advantages to body weight and glycemic control. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Normalization Strategies for Enhancing Spatio-Temporal Analysis of Social Media Responses during Extreme Events: A Case Study based on Analysis of Four Extreme Events using Socio-Environmental Data Explorer (SEDE)

    Science.gov (United States)

    Ajayakumar, J.; Shook, E.; Turner, V. K.

    2017-10-01

    With social media becoming increasingly location-based, there has been a greater push from researchers across various domains including social science, public health, and disaster management, to tap in the spatial, temporal, and textual data available from these sources to analyze public response during extreme events such as an epidemic outbreak or a natural disaster. Studies based on demographics and other socio-economic factors suggests that social media data could be highly skewed based on the variations of population density with respect to place. To capture the spatio-temporal variations in public response during extreme events we have developed the Socio-Environmental Data Explorer (SEDE). SEDE collects and integrates social media, news and environmental data to support exploration and assessment of public response to extreme events. For this study, using SEDE, we conduct spatio-temporal social media response analysis on four major extreme events in the United States including the "North American storm complex" in December 2015, the "snowstorm Jonas" in January 2016, the "West Virginia floods" in June 2016, and the "Hurricane Matthew" in October 2016. Analysis is conducted on geo-tagged social media data from Twitter and warnings from the storm events database provided by National Centers For Environmental Information (NCEI) for analysis. Results demonstrate that, to support complex social media analyses, spatial and population-based normalization and filtering is necessary. The implications of these results suggests that, while developing software solutions to support analysis of non-conventional data sources such as social media, it is quintessential to identify the inherent biases associated with the data sources, and adapt techniques and enhance capabilities to mitigate the bias. The normalization strategies that we have developed and incorporated to SEDE will be helpful in reducing the population bias associated with social media data and will be useful

  18. THE RELATIONSHIP BETWEEN THE ACADEMIC PERFORMANCE AND PRACTICE OF TOLERANCE, SOLIDARITY AND RESPONSIBILITY OF STUDENTS FROM NORMAL RURAL SCHOOL "RICARDO FLORES MAGON"

    Directory of Open Access Journals (Sweden)

    Cintya Arely Hernández-López

    2016-07-01

    Full Text Available The Rural School “Ricardo Flores Magon” is concerned about providing an education that contributes to the integral formation of its students, with the intention that they will graduate with the skills needed to enter the labor and social world, for it is required to acquire values that contribute of the significantly way to consolidate the graduate profile. The quantitative method was used in this research; It focuses on the type of non-experimental design; the sample was probabilistic, 90 students of the Bachelor's degree in Elementary Education. Among the results it highlighted that students who practice more often the values of responsibility, solidarity and tolerance obtain higher academic achievement than those of their classmates.

  19. Changes in the renin-angiotensin-aldosterone system in response to dietary salt intake in normal and hypertensive pregnancy. A randomized trial

    DEFF Research Database (Denmark)

    Nielsen, Lise Hald; Ovesen, Per; Hansen, Mie R

    2016-01-01

    It was hypothesized that primary renal sodium retention blunted the reactivity of the renin-angiotensin-aldosterone system to changes in salt intake in preeclampsia (PE). A randomized, cross-over, double-blinded, dietary intervention design was used to measure the effects of salt tablets or place...... of plasma renin and angiotensin II in response to changes in dietary salt intake compatible with a primary increase in renal sodium reabsorption in hypertensive pregnancies.......It was hypothesized that primary renal sodium retention blunted the reactivity of the renin-angiotensin-aldosterone system to changes in salt intake in preeclampsia (PE). A randomized, cross-over, double-blinded, dietary intervention design was used to measure the effects of salt tablets or placebo...

  20. Maximal lipid oxidation in patients with type 2 diabetes is normal and shows an adequate increase in response to aerobic training

    DEFF Research Database (Denmark)

    Mogensen, M; Vind, B F; Højlund, K

    2009-01-01

    AIM: Insulin resistance in subjects with type 2 diabetes (T2D) and obesity is associated with an imbalance between the availability and the oxidation of lipids. We hypothesized that maximal whole-body lipid oxidation during exercise (FATmax) is reduced and that training-induced metabolic adaptation...... in response to aerobic training in obese subjects with and without T2D. These metabolic adaptations to training seem to be unrelated to changes in insulin sensitivity and indicate that an impaired capacity for lipid oxidation is not a major cause of insulin resistance in T2D....... subjects after training (all p Insulin-stimulated glucose disappearance rate (Rd) was lower in T2D vs. control subjects both before and after training. Rd increased...

  1. Ovarian reaction and estrus manifestation in delayed puberty gilts after treatment with equine chorionic gonadotropin

    Directory of Open Access Journals (Sweden)

    Stančić Ivan B

    2012-08-01

    Full Text Available Abstract Background Prolonged pre-insemination anestrus (i.e. delayed puberty is a major contributing factor for culling up to 30% of the replacement gilts at large breeding farm units in Vojvodina. It is imperative to determine if these gilts are acyclic (prepubertal or cyclic, but just fail to exhibit behavioural estrus. Recent investigations demonstrate that treatment with equine chorionic gonadotropin (eCG can increase the diestrous phase duration in sexually mature gilts. Based on these finding, the aim of the present studies was to determine the reproductive status of delayed puberty gilts following injection with eCG. Methods Two experiments were conducted on a swine breeding farm in Vojvodina. In Exp. 1, 20 prepubertal (acyclic gilts, and 120 sexually mature (cyclic gilts were injected with a single injection of 400 IU eCG + 200 IU human chorionic gonadotropin (hCG or with 1000 IU eCG (cyclic gilts, at d5, d11 or d17 after spontaneous estrus detection, to determine their ovarian reaction and induced estrus manifestation. In Exp. 2, sixty delayed puberty gilts (estrus not detected until 8 month of age, av. 258 days were culled from breeding herd and slaughtered to determine their reproductive status based on ovarian anatomical features. The second group of gilts (n = 60 was treated with a single 1000 IU eCG injection to determine their reproductive status, based on the interval between eCG injection to estrus detection and duration. The data were analyzed by descriptive statistics, t-test, analysis of variance and Duncan’s test in the software package Statistics 10th. Results Ovulations were induced in 90% of acyclic (sexually immature and, on average, 93.3% of cyclic (sexually mature gilts after the eCG injection. On average, 4 days after the eCG injection, estrus was detected in 85% of the treated acyclic (sexually immature gilts and in 95% (19/20 of the cyclic (sexually mature gilts, treated with eCG on day 17

  2. Endothelial Ca+-activated K+ channels in normal and impaired EDHF-dilator responses--relevance to cardiovascular pathologies and drug discovery.

    Science.gov (United States)

    Grgic, Ivica; Kaistha, Brajesh P; Hoyer, Joachim; Köhler, Ralf

    2009-06-01

    The arterial endothelium critically contributes to blood pressure control by releasing vasodilating autacoids such as nitric oxide, prostacyclin and a third factor or pathway termed 'endothelium-derived hyperpolarizing factor' (EDHF). The nature of EDHF and EDHF-signalling pathways is not fully understood yet. However, endothelial hyperpolarization mediated by the Ca(2+)-activated K(+) channels (K(Ca)) has been suggested to play a critical role in initializing EDHF-dilator responses in conduit and resistance-sized arteries of many species including humans. Endothelial K(Ca) currents are mediated by the two K(Ca) subtypes, intermediate-conductance K(Ca) (KCa3.1) (also known as, a.k.a. IK(Ca)) and small-conductance K(Ca) type 3 (KCa2.3) (a.k.a. SK(Ca)). In this review, we summarize current knowledge about endothelial KCa3.1 and KCa2.3 channels, their molecular and pharmacological properties and their specific roles in endothelial function and, particularly, in the EDHF-dilator response. In addition we focus on recent experimental evidences derived from KCa3.1- and/or KCa2.3-deficient mice that exhibit severe defects in EDHF signalling and elevated blood pressures, thus highlighting the importance of the KCa3.1/KCa2.3-EDHF-dilator system for blood pressure control. Moreover, we outline differential and overlapping roles of KCa3.1 and KCa2.3 for EDHF signalling as well as for nitric oxide synthesis and discuss recent evidence for a heterogeneous (sub) cellular distribution of KCa3.1 (at endothelial projections towards the smooth muscle) and KCa2.3 (at inter-endothelial borders and caveolae), which may explain their distinct roles for endothelial function. Finally, we summarize the interrelations of altered KCa3.1/KCa2.3 and EDHF system impairments with cardiovascular disease states such as hypertension, diabetes, dyslipidemia and atherosclerosis and discuss the therapeutic potential of KCa3.1/KCa2.3 openers as novel types of blood pressure-lowering drugs.

  3. CDK1 inhibition facilitates formation of syncytiotrophoblasts and expression of human Chorionic Gonadotropin

    KAUST Repository

    Ullah, Rahim

    2018-05-17

    Aims The human placental syncytiotrophoblast (STB) cells play essential roles in embryo implantation and nutrient exchange between the mother and the fetus. STBs are polyploid which are formed by fusion of diploid cytotrophoblast (CTB) cells. Abnormality in STBs formation can result in pregnancy-related disorders. While a number of genes have been associated with CTB fusion the initial events that trigger cell fusion are not well understood. Primary objective of this study was to enhance our understanding about the molecular mechanism of placental cell fusion. Methods FACS and microscopic analysis was used to optimize Forskolin-induced fusion of BeWo cells (surrogate of CTBs) and subsequently, changes in the expression of different cell cycle regulator genes were analyzed through Western blotting and qPCR. Immunohistochemistry was performed on the first trimester placental tissue sections to validate the results in the context of placental tissue. Effect of Cyclin Dependent Kinase 1 (CDK1) inhibitor, RO3306, on BeWo cell fusion was studied by microscopy and FACS, and by monitoring the expression of human Chorionic Gonadotropin (hCG) by Western blotting and qPCR. Results The data showed that the placental cell fusion was associated with down regulation of CDK1 and its associated cyclin B, and significant decrease in DNA replication. Moreover, inhibition of CDK1 by an exogenous inhibitor induced placental cell fusion and expression of hCG. Conclusion Here, we report that the placental cell fusion can be induced by inhibiting CDK1. This study has a high therapeutic significance to manage pregnancy related abnormalities.

  4. Serum human chorionic gonadotropin is associated with angiogenesis in germ cell testicular tumors

    Directory of Open Access Journals (Sweden)

    Avilés-Salas Alejandro

    2009-08-01

    Full Text Available Abstract Background Germ cell testicular tumors have survival rate that diminishes with high tumor marker levels, such as human chorionic gonadotropin (hCG. hCG may regulate vascular neoformation through vascular endothelial growth factor (VEGF. Our purpose was to determine the relationship between hCG serum levels, angiogenesis, and VEGF expression in germ cell testicular tumors. Methods We conducted a retrospective study of 101 patients. Serum levels of hCG, alpha-fetoprotein (AFP, and lactate dehydrogenase were measured prior to surgery. Vascular density (VD and VEGF tissue expression were determined by immunohistochemistry and underwent double-blind analysis. Results Histologically, 46% were seminomas and 54%, non-seminomas. Median follow-up was 43 ± 27 months. Relapse was present in 7.5% and mortality in 11.5%. Factors associated with high VD included non-seminoma type (p = 0.016, AFP ≥ 14.7 ng/mL (p = 0.0001, and hCG ≥ 25 mIU/mL (p = 0.0001. In multivariate analysis, the only significant VD-associated factor was hCG level (p = 0.04. When hCG levels were stratified, concentrations ≥ 25 mIU/mL were related with increased neovascularization (p Conclusion This is the first study that relates increased serum hCG levels with vascularization in testicular germ cell tumors. Hence, its expression might play a role in tumor angiogenesis, independent of VEGF expression, and may explain its association with poor prognosis. hCG might represent a molecular target for therapy.

  5. Neuroanatomical organization of gonadotropin-releasing hormone neurons during the oestrus cycle in the ewe

    Science.gov (United States)

    Batailler, Martine; Caraty, Alain; Malpaux, Benoît; Tillet, Yves

    2004-01-01

    Background During the preovulatory surge of gonadotropin-releasing hormone (GnRH), a very large amount of the peptide is released in the hypothalamo-hypophyseal portal blood for 24-36H00. To study whether this release is linked to a modification of the morphological organization of the GnRH-containing neurons, i.e. morphological plasticity, we conducted experiments in intact ewes at 4 different times of the oestrous cycle (before the expected LH surge, during the LH surge, and on day 8 and day 15 of the subsequent luteal phase). The cycle stage was verified by determination of progesterone and LH concentrations in the peripheral blood samples collected prior to euthanasia. Results The distribution of GnRH-containing neurons throughout the preoptic area around the vascular organ of the lamina terminalis was studied following visualisation using immunohistochemistry. No difference was observed in the staining intensity for GnRH between the different groups. Clusters of GnRH-containing neurons (defined as 2 or more neurons being observed in close contact) were more numerous during the late follicular phase (43 ± 7) than during the luteal phase (25 ± 6), and the percentage of clusters was higher during the beginning of the follicular phase than during the luteal phase. There was no difference in the number of labelled neurons in each group. Conclusions These results indicate that the morphological organization of the GnRH-containing neurons in ewes is modified during the follicular phase. This transitory re-organization may contribute to the putative synchronization of these neurons during the surge. The molecular signal inducing this plasticity has not yet been identified, but oestradiol might play an important role, since in sheep it is the only signal which initiates the GnRH preovulatory surge. PMID:15555074

  6. Neuroanatomical organization of gonadotropin-releasing hormone neurons during the oestrus cycle in the ewe

    Directory of Open Access Journals (Sweden)

    Malpaux Benoît

    2004-11-01

    Full Text Available Abstract Background During the preovulatory surge of gonadotropin-releasing hormone (GnRH, a very large amount of the peptide is released in the hypothalamo-hypophyseal portal blood for 24-36H00. To study whether this release is linked to a modification of the morphological organization of the GnRH-containing neurons, i.e. morphological plasticity, we conducted experiments in intact ewes at 4 different times of the oestrous cycle (before the expected LH surge, during the LH surge, and on day 8 and day 15 of the subsequent luteal phase. The cycle stage was verified by determination of progesterone and LH concentrations in the peripheral blood samples collected prior to euthanasia. Results The distribution of GnRH-containing neurons throughout the preoptic area around the vascular organ of the lamina terminalis was studied following visualisation using immunohistochemistry. No difference was observed in the staining intensity for GnRH between the different groups. Clusters of GnRH-containing neurons (defined as 2 or more neurons being observed in close contact were more numerous during the late follicular phase (43 ± 7 than during the luteal phase (25 ± 6, and the percentage of clusters was higher during the beginning of the follicular phase than during the luteal phase. There was no difference in the number of labelled neurons in each group. Conclusions These results indicate that the morphological organization of the GnRH-containing neurons in ewes is modified during the follicular phase. This transitory re-organization may contribute to the putative synchronization of these neurons during the surge. The molecular signal inducing this plasticity has not yet been identified, but oestradiol might play an important role, since in sheep it is the only signal which initiates the GnRH preovulatory surge.

  7. Use of equine chorionic gonadotropin to control reproduction of the dairy cow: a review.

    Science.gov (United States)

    De Rensis, F; López-Gatius, F

    2014-04-01

    Equine chorionic gonadotropin (eCG) is a member of the glycoprotein family of hormones along with LH, FSH and thyroid-stimulating hormone. In non-equid species, eCG shows high LH- and FSH-like activities and has a high affinity for both FSH and LH receptors in the ovaries. On the granulosa and thecal cells of the follicle, eCG has long-lasting LH- and FSH-like effects that stimulate oestradiol and progesterone secretion. Thus, eCG administration in dairy cattle results in fewer atretic follicles, the recruitment of more small follicles showing an elevated growth rate, the sustained growth of medium and large follicles and improved development of the dominant and pre-ovulatory follicle. In consequence, the quality of the ensuing CL is improved, and thereby progesterone secretion increased. Based on these characteristics, eCG treatment is utilized in veterinary medicine to control the reproductive activity of the cow by i) improving reproductive performance during early post-partum stages; ii) increasing ovulation and pregnancy rates in non-cyclic cows; iii) improving the conception rate in cows showing delayed ovulation; and finally, iv) eCG is currently included in protocols for fixed-time artificial insemination since after inducing the synchrony of ovulation using a progesterone-releasing device, eCG has beneficial effects on embryo development and survival. The above effects are not always observed in cyclic animals, but they are evident in animals in which LH secretion and ovarian activity are reduced or compromised, for instance, during the early post-partum period, under seasonal heat stress, in anoestrus animals or in animals with a low body condition score. © 2014 Blackwell Verlag GmbH.

  8. The lower expression of gonadotropin-releasing hormone receptor associated with poor prognosis in gastric cancer

    Science.gov (United States)

    Lu, Mingzhu; Zhu, Jing; Ling, Yang; Shi, Wenping; Zhang, Changsong; Wu, Haorong

    2015-01-01

    Aims: Expression of gonadotropin-releasing hormone receptor (GnRHR) has been demonstrated in a number of malignancies. The aim is to investigate the expression of GnRHR and prognosis in gastric cancer. Methods and materials: GnRHR mRNA was examined in tumor and non-tumor tissues from 48 gastric cancer patients by Real-time PCR. The GnRHR protein expression was performed by immunohistochemical analysis. Results: The expression of GnRHR mRNA was higher (mean ± SD, -10.06 ± 1.28) in gastric tumor tissues than matched non-tumor tissues (mean ± SD, -12.43 ± 1.33). GnRHR mRNA expression was associated with lymph node metastasis, distant metastasis, and TNM stage. We found the decreased expression of GnRHR mRNA were significantly correlated with poor overall survival (P = 0.003). Immunocytochemical staining of GnRHR in tumor tissues showed mainly weak staining (43.48%, 10/23) and moderate staining (21.74%, 5/23) in high GnRHR mRNA patients, and mainly negative staining in low GnRHR