Morphology and epidermal thickness of normal skin imaged by optical coherence tomography
DEFF Research Database (Denmark)
Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars
2008-01-01
colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults......Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...
Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin
DEFF Research Database (Denmark)
Kamstrup, M.; Faurschou, A.; Gniadecki, R.
2008-01-01
In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...
Evolution of dinosaur epidermal structures.
Barrett, Paul M; Evans, David C; Campione, Nicolás E
2015-06-01
Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Radiosensitivity of normal human epidermal cells in culture
International Nuclear Information System (INIS)
Dover, R.; Potten, C.S.
1983-01-01
Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)
Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.
Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J
2014-01-01
Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.
Insulin binding properties of normal and transformed human epidermal cultured keratinocytes
International Nuclear Information System (INIS)
Verrando, P.; Ortonne, J.P.
1985-01-01
Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders
International Nuclear Information System (INIS)
Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo
2011-01-01
Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.
Biochemistry of epidermal stem cells.
Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace
2013-02-01
The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Biochemistry of epidermal stem cells☆
Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace
2014-01-01
Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019
Long-term organ culture of rabbit skin: Effect of EGF on epidermal structure in vitro
International Nuclear Information System (INIS)
Kondo, S.; Hozumi, Y.; Aso, K.
1990-01-01
A method is described for maintaining the epidermal structure of normal rabbit ear skin explants in organ culture for up to 12 weeks. Split-thickness skin specimens were put in diffusion chambers made of either millipore filters or bovine collagen membranes, and then submitted to a roller tube culture at 15 rpm and 36 degrees C. The culture medium was Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% fetal calf serum (FCS) + 0.4 micrograms/ml hydrocortisone. The gas used in the culture tube was air + 5% CO2. Autoradiography revealed the incorporation of [3H]-glycine into the 68-kD keratin band of explants for up to 12 weeks, indicating that normal keratinization was maintained throughout the entire culture period. The turnover time of the epidermis from basal layer to granular layer was around 7 d in both the early and late stages of culture. The addition of epidermal growth factor (EGF) to the culture caused the epidermis to become acanthotic with orthokeratosis, but with high concentrations of EGF (greater than or equal to 10 ng/ml) parakeratosis and increased proliferation of the epidermis occurred. Dexamethasone (DMS) strongly inhibited the EGF effect
DEFF Research Database (Denmark)
Mi, Li-Zhi; Grey, Michael J; Nishida, Noritaka
2008-01-01
Cellular signaling mediated by the epidermal growth factor receptor (EGFR or ErbB) family of receptor tyrosine kinases plays an important role in regulating normal and oncogenic cellular physiology. While structures of isolated EGFR extracellular domains and intracellular protein tyrosine kinase...... differential functional stability in Triton X-100 versus dodecyl maltoside. Furthermore, the kinase activity can be significantly stabilized by reconstituting purified EGF-bound EGFR dimers in phospholipid nanodiscs or vesicles, suggesting that the environment around the hydrophobic transmembrane...
Directory of Open Access Journals (Sweden)
Kyounghwan Lee
2015-04-01
Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.
Hornberg, J.J.; Dekker, H.; Peters, P.H.J.; Langerak, P.; Westerhoff, H.V.; Lankelma, J.; Zoelen, E.J.J.
2006-01-01
Density-dependent growth inhibition secures tissue homeostasis. Dysfunction of the mechanisms, which regulate this type of growth control is a major cause of neoplasia. In confluent normal rat kidney (NRK) fibroblasts, epidermal growth factor (EGF) receptor levels decline, ultimately rendering these
Directory of Open Access Journals (Sweden)
Magdalena Boer
2016-02-01
Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.
Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren
2017-10-23
The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report for the first time that cyclin-dependent kinase 5 (Cdk5) is an essential regulator of MITF and PAX3. Cdk5 knockdown in mice causes a lightened coat color, a polarized distribution of melanin and hyperproliferation of basal keratinocytes. Reduced expression of Keratin 10 (K10) resulting from Cdk5 knockdown may be responsible for an abnormal epidermal structure. In contrast, overexpression of Cdk5 in sheep (Ovis aries) only produces brown patches on a white background, with no other observable abnormalities. Collectively, our findings show that Cdk5 has an important functional role in the regulation of melanin production and transportation and in normal development of the integumentary system.
Fatty acids are required for epidermal permeability barrier function.
Mao-Qiang, M; Elias, P M; Feingold, K R
1993-08-01
The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.
Bragulla, Hermann; Hirschberg, Ruth M
2003-08-15
Accessory organs of the integument are locally modified parts of the potentially feather-bearing skin in birds (e.g., the rhamphotheca, claws, or scales), and of the potentially hairy skin in mammals (e.g., the rhinarium, nails, claws, or hooves). These special parts of the integument are characterised by a modified structure of their epidermal, dermal and subcutaneous layers. The developmental processes of these various integumentary structures in birds and mammals show both similarities and differences. For example, the development of the specialised epidermal structures of both feathers and the hoof capsule is influenced by the local three-dimensional configuration of the dermis. However, in feathers, in contrast to hooves, the arrangement of the corneous cells is only partially a direct result of the particular arrangement and shape of the dermal surface of the papillary body. Whereas the diameter of the feather papilla, as well as the number, length, and width of dermal ridges on the surface of the feather papilla influence the three-dimensional architecture of the feather rami, there is no apparent direct correlation between the dermo-epidermal interface and the development of the highly ordered architecture of the radii and hamuli in the feather vane. In order to elucidate this morphogenic problem and the problem of locally different processes of keratinisation and cornification, the structure and development of feathers in birds are compared to those of the hoof capsule in horses. The equine hoof is the most complex mammalian integumentary structure, which is determined directly by the dermal surface of the papillary body. Perspectives for further research on the development of modified integumentary structures, such as the role of the dermal microangioarchitecture and the selective adhesion and various differentiation pathways of epidermal cells, are discussed. Copyright 2003 Wiley-Liss, Inc.
Herbal medicines that benefit epidermal permeability barrier function
Directory of Open Access Journals (Sweden)
Lizhi Hu
2015-06-01
Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.
The Effect of Epidermal Structures on Leaf Spectral Signatures of Ice Plants (Aizoaceae
Directory of Open Access Journals (Sweden)
René Hans-Jürgen Heim
2015-12-01
Full Text Available Epidermal structures (ES of leaves are known to affect the functional properties and spectral responses. Spectral studies focused mostly on the effect of hairs or wax layers only. We studied a wider range of different ES and their impact on spectral properties. Additionally, we identified spectral regions that allow distinguishing different ES. We used a field spectrometer to measure ex situ leaf spectral responses from 350 nm–2500 nm. A spectral library for 25 species of the succulent family Aizoaceae was assembled. Five functional types were defined based on ES: flat epidermal cell surface, convex to papillary epidermal cell surface, bladder cells, hairs and wax cover. We tested the separability of ES using partial least squares discriminant analysis (PLS-DA based on the spectral data. Subsequently, variable importance (VIP was calculated to identify spectral regions relevant for discriminating our functional types (classes. Classification performance was high, with a kappa value of 0.9 indicating well-separable spectral classes. VIP calculations identified six spectral regions of increased importance for the classification. We confirmed and extended previous findings regarding the visible-near-infrared spectral region. Our experiments also confirmed that epidermal leaf traits can be classified due to clearly distinguishable spectral signatures across species and genera within the Aizoaceae.
DEFF Research Database (Denmark)
Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole
2009-01-01
To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...
Epidermal stem cells: location, potential and contribution to cancer.
Ambler, C A; Määttä, A
2009-01-01
Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.
DEFF Research Database (Denmark)
Fismen, S; Hedberg, A; Fenton, K A
2009-01-01
Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...
DEFF Research Database (Denmark)
Celis, J E; Madsen, Peder; Rasmussen, H H
1991-01-01
A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...
Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean
2012-01-01
Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868
Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.
1988-01-01
In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure
Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis
International Nuclear Information System (INIS)
Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam
2008-01-01
The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.
Foliar Epidermal Studies of Plants in Euphorbiaceae
Directory of Open Access Journals (Sweden)
H. A. Thakur
2014-03-01
Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.
Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.
Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina
2018-03-27
Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.
Gu, Yang; Zhang, Gang; Lin, Mei
2008-02-01
To examine the change of epidermal growth factor (EGF) concentration in saliva of recurrent aphthous ulcer (RAU) patients during the ulcerous and interval period and epidermal growth factor receptor (EGFR) in ulcer biopsy samples. ECF data of the samples, which were 27 saliva samples from RAU gained not only in the ulcerous period but also in interval period and 33 ones from normal persons, were acquired through enzyme linked immunosorhent assay (ELISA) and EGF standard curve. ECFR-RNA date of RAU biopsies, which were 31 biopsy samples from RAU got during the ulcerous period and 35 ones from normal persons, were surveyed by QF-RT-PCR. All RAU samples were obtained under the same level, which were the whole patients were minor aphthous ulcers and their ulcers occurred not over the first four days. All patients and normal persons were selected seriously under the rule of physical situations without any other diseases and histories of using medicines. The EGF concentration of saliva in RAU group at ulcer occurrence was higher than that in the interval period and the normal control with a significant test (F = 3.24, P ulcer occurrence was higher than the normal control with a significant test (t = 3.15, P ulcer occasion of RAU patients could be related with the decreasing of EGF in saliva during interval period, and that the ulcer sell-cure of RAU patients would be contributed to
TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.
Directory of Open Access Journals (Sweden)
Aurélie Hayez
Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.
The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.
Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina
2004-12-03
The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.
Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun
2016-02-01
Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.
Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.
Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De
2016-10-01
In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Kuntsche, Judith; Herre, Angela; Fahr, Alfred
2013-01-01
barrier similar to that of human stratum corneum is, however, a prerequisite. In this study, the stratum corneum lipid organization in an epidermal cell culture model based on rat epidermal keratinocytes (REK organotypic culture, ROC) was investigated by small-angle X-ray scattering (SAXS) in dependence......Cell cultured skin equivalents present an alternative for dermatological in vitro evaluations of drugs and excipients as they provide the advantage of availability, lower variability and higher assay robustness compared to native skin. For penetration/permeation studies, an adequate stratum corneum...... and SC lipid organization. Cultivation for 21days resulted in further minor changes in the structural organization of ROC SC. The SAXS patterns of ROC SC had overall large similarities with that of human SC and point to the presence of a long periodicity phase with a repeat distance of about 122Å, e...
Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing
Directory of Open Access Journals (Sweden)
Sabita N. Saldanha
2015-12-01
Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.
Roles of p63 in epidermal development and tumorigenesis
Directory of Open Access Journals (Sweden)
Jeng-Yuan Yao
2012-12-01
Full Text Available pidermis is composed mainly of keratinocytes and is the major barrier of human body. The development and maintenance of normal epithelial structures and functions require the transcription factor p63. The p63 gene encodes proteins with structures similar to that of p53, including an N-terminal transactivation (TA domain, a DNA-binding domain and a carboxy-oligomerization domain. TAp63 and ΔNp63 (p63 isoforms without TA domain regulate a wide range of target genes that are important for embryonal development and epithelial integrity. Mutations of p63 gene cause epidermal abnormalities characterized by ectodermal dysplasia. Recent reports have indicated that p63 plays important role in tumorigenesis as well. However, the relative importance of TAp63 and ΔNp63 in epidermal development and tumorigenesis remains mostly unclear and awaits further investigation. In this review, we summarize the current knowledge on the structure and function of p63 and its isoforms.
[Progress in epidermal stem cells].
Wang, Li-Juan; Wang, You-Liang; Yang, Xiao
2010-03-01
Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.
Directory of Open Access Journals (Sweden)
Yira Bermudez
Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.
Yang, Shaowei; Sun, Yexiao; Geng, Zhijun; Ma, Kui; Sun, Xiaoyan; Fu, Xiaobing
2016-05-01
The majority of studies on scar formation have mainly focused on the dermis and little is known of the involvement of the epidermis. Previous research has demonstrated that the scar tissue-derived keratinocytes are different from normal cells at both the genetic and cell biological levels; however, the mechanisms responsible for the fundamental abnormalities in keratinocytes during scar development remain elusive. For this purpose, in this study, we used normal, wound edge and hypertrophic scar tissue to examine the morphological changes which occur during epidermal regeneration as part of the wound healing process and found that the histological structure of hypertrophic scar tissues differed from that of normal skin, with a significant increase in epidermal thickness. Notably, staining of the basement membrane (BM) appeared to be absent in the scar tissues. Moreover, immunofluorescence staining for cytokeratin (CK)10, CK14, CK5, CK19 and integrin-β1 indicated the differential expression of cell markers in the epidermal keratinocytes among the normal, wound edge and hypertrophic scar tissues, which corresponded with the altered BM structures. By using a panel of proteins associated with BM components, we validated our hypothesis that the BM plays a significant role in regulating the cell fate decision of epidermal keratinocytes during skin wound healing. Alterations in the structure of the BM promote basal keratinocytes to adopt a proliferative phenotype both in vivo and in vitro.
Steroid hormone and epidermal growth factor receptors in meningiomas.
Horsfall, D J; Goldsmith, K G; Ricciardelli, C; Skinner, J M; Tilley, W D; Marshall, V R
1989-11-01
A prospective study of steroid hormone and epidermal growth factor receptor expression in 57 meningiomas is presented. Scatchard analysis of radioligand binding identified 20% of meningiomas as expressing classical oestrogen receptors (ER) at levels below that normally accepted for positivity, the remainder being negative. ER could not be visualized in any meningioma using immunocytochemistry. Alternatively, 74% of meningiomas demonstrated the presence of progesterone receptors (PR) by Scatchard analysis, the specificity of which could not be attributed to glucocorticoid or androgen receptors. Confirmation of classical PR presence was determined by immunocytochemical staining. The presence of epidermal growth factor receptor (EGFR) was demonstrated in 100% of meningiomas using immunocytochemical staining. These data are reviewed in the context of previously reported results and are discussed in relation to the potential for medical therapy as an adjunct to surgery.
Directory of Open Access Journals (Sweden)
Christian eFalter
2015-03-01
Full Text Available The outwardly directed cell wall and associated plasma membrane of epidermal cells represent the first layers of plant defense against intruding pathogens. Cell wall modifications and the formation of defense structures at sites of attempted pathogen penetration are decisive for plant defense. A precise isolation of these stress-induced structures would allow a specific analysis of regulatory mechanism and cell wall adaption. However, methods for large-scale epidermal tissue preparation from the model plant Arabidopsis thaliana, which would allow proteome and cell wall analysis of complete, laser-microdissected epidermal defense structures, have not been provided. We developed the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation from A. thaliana, which is also applicable on grass leaves. This method is compatible with subsequent staining techniques to visualize stress-related cell wall structures, which were precisely isolated from the epidermal tissue layer by laser microdissection coupled to laser pressure catapulting. We successfully demonstrated that these specific epidermal tissue samples could be used for quantitative downstream proteome and cell wall analysis. The development of the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation and the compatibility to laser microdissection and downstream quantitative analysis opens new possibilities in the precise examination of stress- and pathogen-related cell wall structures in epidermal cells. Because the developed tissue processing is also applicable on A. thaliana, well-established, model pathosystems that include the interaction with powdery mildews can be studied to determine principal regulatory mechanisms in plant-microbe interaction with their potential outreach into crop breeding.
Enomoto, Yukinori; Orihara, Kanami; Takamasu, Tetsuya; Matsuda, Akio; Gon, Yasuhiro; Saito, Hirohisa; Ra, Chisei; Okayama, Yoshimichi
2009-11-01
Epidermal growth factor receptor ligands, such as epidermal growth factor (EGF) and amphiregulin, may play key roles in tissue remodeling in asthma. However, the kinetics of EGF and amphiregulin secretion in the airway after an acute asthma attack and the effect of prolonged airway exposure to these ligands on airway remodeling are unknown. To measure the EGF and amphiregulin concentrations in sputa obtained from patients with asthma under various conditions, and to examine the effects of EGF and amphiregulin on the proliferation or differentiation of airway structural cells. Epidermal growth factor and amphiregulin levels were measured by ELISA in sputum specimens collected from 14 hospitalized children with asthma during an acute asthma attack, 13 stable outpatients with asthma, 8 healthy control children, and 7 children with respiratory tract infections. The effects of EGF and amphiregulin on the proliferation and/or differentiation of normal human bronchial epithelial cells (NHBE), bronchial smooth muscle cells (BSMC), and normal human lung fibroblasts (NHLF) were examined. The sputum levels of EGF were significantly higher for about a week after an acute asthma attack compared with the levels in stable subjects with asthma and control subjects. In contrast, upregulation of amphiregulin in the sputa of patients with asthma was observed only during the acute attack. EGF caused proliferation of NHBE, BSMC, and NHLF, whereas amphiregulin induced proliferation of only NHBE. Prolonged exposure of NHBE to EGF and amphiregulin induced mucous cell metaplasia in an IL-13-independent manner. Acute asthma attacks are associated with hypersecretion of EGF and amphiregulin in the airway. Recurrent acute attacks may aggravate airway remodeling.
Altered [125I]epidermal growth factor binding and receptor distribution in psoriasis
International Nuclear Information System (INIS)
Nanney, L.B.; Stoscheck, C.M.; Magid, M.; King, L.E. Jr.
1986-01-01
Stimulation of growth and differentiation of human epidermis by epidermal growth factor (EGF) is mediated by its binding to specific receptors. Whether EGF receptors primarily mediate cell division or differentiation in hyperproliferative disease such as psoriasis vulgaris is unclear. To study the pathogenesis of psoriasis, 4-mm2 punch biopsy specimens of normal, uninvolved, and involved psoriatic skin were assayed for EGF receptors by autoradiographic, immunohistochemical, and biochemical methods. Using autoradiographic and immunohistochemical methods, basal keratinocytes were found to contain the greatest number of EGF binding sites and immunoreactive receptors as compared to the upper layers of the epidermis in both normal epidermis and psoriatic skin. No EGF receptor differences between normal and psoriatic epidermis were observed in this layer. In the upper layers of the epidermis, a 2-fold increase in EGF binding capacity was observed in psoriatic skin as compared with normal thin or thick skin. Biochemical methods indicated that [ 125 I]EGF binding was increased in psoriatic epidermis as compared with similar thickness normal epidermis when measured on a protein basis. Epidermal growth factor was shown to increase phosphorylation of the EGF receptor in skin. EGF receptors retained in the nonmitotic stratum spinosum and parakeratotic stratum corneum may reflect the incomplete, abnormal differentiation that occurs in active psoriatic lesions. Alternatively, retained EGF receptors may play a direct role in inhibiting cellular differentiation in the suprabasal layers
Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors
International Nuclear Information System (INIS)
Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili
2013-01-01
High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors
Epidermal electronics with advanced capabilities in near-field communication.
Kim, Jeonghyun; Banks, Anthony; Cheng, Huanyu; Xie, Zhaoqian; Xu, Sheng; Jang, Kyung-In; Lee, Jung Woo; Liu, Zhuangjian; Gutruf, Philipp; Huang, Xian; Wei, Pinghung; Liu, Fei; Li, Kan; Dalal, Mitul; Ghaffari, Roozbeh; Feng, Xue; Huang, Yonggang; Gupta, Sanjay; Paik, Ungyu; Rogers, John A
2015-02-25
Epidermal electronics with advanced capabilities in near field communications (NFC) are presented. The systems include stretchable coils and thinned NFC chips on thin, low modulus stretchable adhesives, to allow seamless, conformal contact with the skin and simultaneous capabilities for wireless interfaces to any standard, NFC-enabled smartphone, even under extreme deformation and after/during normal daily activities. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Quantum transport in graphene normal-metal superconductor- normal-metal structures
Directory of Open Access Journals (Sweden)
H. Mohammadpour
2008-06-01
Full Text Available We study the transport of electrons in a graphene NSN structure in which two normal regions are connected by a superconducting strip of thickness d. Within Dirac-Bogoliubov-de Gennes equations we describe the transmission through the contact in terms of different scattering processes consisting of quasiparticle cotunneling, local and crossed Andreev reflections. Compared to a fully normal structure we show that the angular dependence of the transmission probability is significantly modified by the presence of superconducting correlations. This modifation can be explained in terms of the interplay between Andreev reflection and Klein tunneling of chiral quasiparticles. We further analyze the energy dependence of the resulting differential conductance of the structure. The subgap differential conductance shows features of Andreev reflection and cotunelling processes, which tends to the values of an NS structure for large ds. Above the gap, the differential conductance shows an oscillatory behavior with energy even at very large ds.
Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori
2017-08-01
To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.
Epidermal growth in the bottlenose dolphin, Tursiops truncatus
International Nuclear Information System (INIS)
Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.
1985-01-01
Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed
Epidermal growth in the bottlenose dolphin, Tursiops truncatus
Energy Technology Data Exchange (ETDEWEB)
Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.
1985-07-01
Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.
Epidermal Inclusion Cysts of The Breast
Directory of Open Access Journals (Sweden)
Amir R. Motabar
2009-02-01
Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.
DEFF Research Database (Denmark)
Bor, M V; Sørensen, B S; Vinter-Jensen, L
2000-01-01
BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...
The organization of human epidermis: functional epidermal units and phi proportionality.
Hoath, Steven B; Leahy, D G
2003-12-01
The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.
Epidermal cell death in frogs with chytridiomycosis
Directory of Open Access Journals (Sweden)
Laura A. Brannelly
2017-02-01
Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.
Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming
2015-09-01
Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.
International Nuclear Information System (INIS)
Olsen, W.M.; Elgjo, K.
1990-01-01
A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system
Growth of melanocytes in human epidermal cell cultures
International Nuclear Information System (INIS)
Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.
1990-01-01
Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient
In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells
DEFF Research Database (Denmark)
Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K
2003-01-01
a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...
Directory of Open Access Journals (Sweden)
Daniela GUZMÁN-URIBE
Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.
International Nuclear Information System (INIS)
Ananthaswamy, H.N.; Kripke, M.L.
1981-01-01
Primary epidermal cultures from neonatal BALB/c mice were used to study the carcinogenic effects of ultraviolet radiation in vitro. These cultures were irradiated once through a Falcon plastic dish cover with an FS40 sunlamp [ultraviolet B, lambda approximately 290 to 400 nm] for various lengths of time and maintained for 8 to 12 weeks without subculturing. During this period, most of the cells in the untreated control showed signs of morphological differentiation and eventually died. The cultures irradiated with ultraviolet B radiation also behaved in the same manner except that, in some dishes, small populations of surviving cells began to proliferate and developed into morphologically distinct foci. Seven long-term cell lines were derived from these ultraviolet-irradiated primary epidermal cell cultures. Six of these cell lines produced tumors when injected s.c. into normal and/or immunosuppressed syngeneic recipients. These tumorigenic cell lines lacked definitive characteristics of differentiated epidermal cells, but the cells possessed intermediate junctions, suggesting that they were of epithelial origin. Some of these in vitro-transformed cell lines appeared to be highly antigenic inasmuch as they grew preferentially in immunosuppressed BALB/c mice as compared to their growth in normal syngeneic recipients
Epidermal growth factor receptor in primary human lung cancer
International Nuclear Information System (INIS)
Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun
1996-01-01
Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion
Comparisons of stomatal parameters between normal and abnormal ...
African Journals Online (AJOL)
ED), guard cell length (GCL) and guard cell width (GCW) of normal and abnormal leaf of Bougainvillea spectabilis Willd were studied. This can be useful for further research of physical mechanism of abnormal leaf. Epidermal cells were ...
Sex steroids and epidermal glands in two species of gekkonine lizards.
Chiu, K W; Maderson, P F; Alexander, S A; Wong, K L
1975-09-01
In vivo and in vitro experiments on the endocrine relationships of epidermal glands in the tokay Gekko gecko, and the common house gecko Hemidactylus bowringii are reported. The results show that certain aspects of beta-gland differentiation involve a synergistic action between androgens and those hormones responsible for controlling the normal shedding cycle, while other aspects are solely under androgenic control. Pre-anal organ activity appears to be solely under androgenic control.
International Nuclear Information System (INIS)
Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.
2005-01-01
The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides
International Nuclear Information System (INIS)
Choowongkomon, Kiattawee; Carlin, Cathleen; Sonnichsen, Frank D.
2005-10-01
The epidermal growth factor receptor (EGFR) is a member of the receptor tyrosine kinase family involved in the regulation of cellular proliferation and differentiation. Its juxta membrane domain (JX), the region located between the transmembrane and kinase domains, plays important roles in receptor trafficking since both basolateral sorting in polarized epithelial cells and lysosomal sorting signals are identified in this region. In order to understand the regulation of these signals, we characterized the structural properties of recombinant JX domain in dodecyl phosphocholine detergent (DPC) by nuclear magnetic resonance (NMR) spectroscopy. In DPC micelles, structures derived from NMR data showed three amphipathic, helical segments. Two equivalent average structural models on the surface of micelles were obtained that differ only in the relative orientation between the first and second helices. Our data suggests that the activity of sorting signals may be regulated by their membrane association and restricted accessibility in the intact receptor
Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes.
Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise; Bille-Hansen, Vivi
2005-02-25
Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S. chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654 and S. hyicus strain 1289D-88 showed differences in seven base pairs of the DNA sequences and in two amino acid residues in the deduced amino acid sequences. Pigs were experimentally inoculated with S. chromogenes strain VA654. By clinical observations and histopathological evaluation of the skin alterations, all pigs revealed development of generalized exudative epidermitis. No toxin producing S. hyicus was isolated from the pigs and all ExhB-positive bacterial isolates were identified as S. chromogenes. This confirmed that the disease-causing agent was the inoculated S. chromogenes strain VA654. The results of this study show that S. chromogenes may cause exudative epidermitis in pigs.
A homolog of Drosophila grainy head is essential for epidermal integrity in mice.
Ting, Stephen B; Caddy, Jacinta; Hislop, Nikki; Wilanowski, Tomasz; Auden, Alana; Zhao, Lin-Lin; Ellis, Sarah; Kaur, Pritinder; Uchida, Yoshikazu; Holleran, Walter M; Elias, Peter M; Cunningham, John M; Jane, Stephen M
2005-04-15
The Drosophila cuticle is essential for maintaining the surface barrier defenses of the fly. Integral to cuticle resilience is the transcription factor grainy head, which regulates production of the enzyme required for covalent cross-linking of the cuticular structural components. We report that formation and maintenance of the epidermal barrier in mice are dependent on a mammalian homolog of grainy head, Grainy head-like 3. Mice lacking this factor display defective skin barrier function and deficient wound repair, accompanied by reduced expression of transglutaminase 1, the key enzyme involved in cross-linking the structural components of the superficial epidermis. These findings suggest that the functional mechanisms involving protein cross-linking that maintain the epidermal barrier and induce tissue repair are conserved across 700 million years of evolution.
Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.
Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo
2018-05-01
The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.
Energy Technology Data Exchange (ETDEWEB)
Gillett, N A; Haley, P J; Hahn, F F
1988-12-01
Increased levels of epidermal growth factor receptor have been reported in a variety of tumors, including pulmonary squamous cell carcinomas in man. The purpose of this study was to determine if increased levels of epidermal growth factor (EGFR) were present in lung tumors from Beagle dogs that had been exposed to {sup 239}PuO{sub 2}- Using immunohistochemical techniques, sections from 17 lung tumors were examined for the presence of EGFR. Seven of the tumors were strongly positive for EGFR; the remainder of the tumors and the normal lung sections were negative. The positive immunostaining could not be correlated with the histologic phenotype of the tumors. Work is in progress to determine the level of EGFR in preneoplastic, proliferative epithelial foci in the Iung. (author)
Toxic epidermal necrolysis successfully treated with etanercept.
Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio
2009-03-01
Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.
Spatiotemporal Expression of p63 in Mouse Epidermal Commitment
Directory of Open Access Journals (Sweden)
Qian Zhao
2015-12-01
Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.
Normal central retinal function and structure preserved in retinitis pigmentosa.
Jacobson, Samuel G; Roman, Alejandro J; Aleman, Tomas S; Sumaroka, Alexander; Herrera, Waldo; Windsor, Elizabeth A M; Atkinson, Lori A; Schwartz, Sharon B; Steinberg, Janet D; Cideciyan, Artur V
2010-02-01
To determine whether normal function and structure, as recently found in forms of Usher syndrome, also occur in a population of patients with nonsyndromic retinitis pigmentosa (RP). Patients with simplex, multiplex, or autosomal recessive RP (n = 238; ages 9-82 years) were studied with static chromatic perimetry. A subset was evaluated with optical coherence tomography (OCT). Co-localized visual sensitivity and photoreceptor nuclear layer thickness were measured across the central retina to establish the relationship of function and structure. Comparisons were made to patients with Usher syndrome (n = 83, ages 10-69 years). Cross-sectional psychophysical data identified patients with RP who had normal rod- and cone-mediated function in the central retina. There were two other patterns with greater dysfunction, and longitudinal data confirmed that progression can occur from normal rod and cone function to cone-only central islands. The retinal extent of normal laminar architecture by OCT corresponded to the extent of normal visual function in patients with RP. Central retinal preservation of normal function and structure did not show a relationship with age or retained peripheral function. Usher syndrome results were like those in nonsyndromic RP. Regional disease variation is a well-known finding in RP. Unexpected was the observation that patients with presumed recessive RP can have regions with functionally and structurally normal retina. Such patients will require special consideration in future clinical trials of either focal or systemic treatment. Whether there is a common molecular mechanism shared by forms of RP with normal regions of retina warrants further study.
Schneider, Marlon R; Dahlhoff, Maik; Andrukhova, Olena; Grill, Jessica; Glösmann, Martin; Schüler, Christiane; Weber, Karin; Wolf, Eckhard; Erben, Reinhold G
2012-01-01
Although the bone anabolic properties of intermittent parathyroid hormone (PTH) have long been employed in the treatment of osteoporosis, the molecular mechanisms behind this action remain largely unknown. Previous studies showed that PTH increases the expression and the activity of epidermal growth factor receptor (EGFR) in osteoblasts, and activation of ERK1/2 by PTH in osteoblasts was demonstrated to induce the proteolytical release of EGFR ligands and EGFR transactivation. However, conclusive evidence for an important role of the EGFR system in mediating the anabolic actions of intermittent PTH on bone in vivo is lacking. Here, we evaluated the effects of intermittent PTH on bone in Waved-5 (Wa5) mice which carry an antimorphic Egfr allele whose product acts as a dominant negative receptor. Heterozygous Wa5 females and control littermates received a subcutaneous injection of PTH (80 μg/kg) or buffer on 5 days per week for 4 weeks. Wa5 mice had slightly lower total bone mineral density (BMD), but normal cancellous bone volume and turnover in the distal femoral metaphysis. The presence of the antimorphic Egfr allele neither influenced the PTH-induced increase in serum osteocalcin nor the increases in distal femoral BMD, cortical thickness, cancellous bone volume, and cancellous bone formation rate. Similarly, the PTH-induced rise in lumbar vertebral BMD was unchanged in Wa5 relative to wild-type mice. Wa5-derived osteoblasts showed considerably lower basal extracellular signal-regulated kinase 1/2 (ERK1/2) activation as compared to control osteoblasts. Whereas activation of ERK1/2 by the EGFR ligand amphiregulin was largely blocked in Wa5 osteoblasts, treatment with PTH induced ERK1/2 activation comparable to that observed in control osteoblasts, relative to baseline levels. Our data indicate that impairment of EGFR signaling does not affect the anabolic action of intermittent PTH on cancellous and cortical bone. Copyright © 2011. Published by Elsevier Inc.
Tight junction regulates epidermal calcium ion gradient and differentiation
International Nuclear Information System (INIS)
Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki
2011-01-01
Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.
Directory of Open Access Journals (Sweden)
Jian-Wei Zhang
2018-04-01
Full Text Available The taxonomical position of species of the genus Tamarix (Tamaricaceae has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves, and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to the studies, the leaf epidermal features, together with the character of the flower, are taxonomically clearly distinct. The establishment of Tamarix albiflonum is consolidated. Tamarix korolkowi and Tamarix ramosissima have minimal differences in epidermal characters, and the former is suggested to be a junior synonym. Tamarix ramosissima, Tamarix tarimensis, Tamarix arceuthoides and Tamarix hohenackeri are most similar with respect to their leaf epidermis; considering the common morphological features, habit, distribution and especially the hybridization, it is suggested that these four species are closely genetically related and that the variations among them are probably intraspecific. The new taxonomical evidence indicates the occurrence of 13 species and four variants in China. Presently, Tamarix is a typical plant of arid and semi-arid regions, but its Eocene ancestors lived in warm and humid climates in the coastal areas of the ancient Mediterranean Sea. Thus, the papillae or epidermal hairs, which are outgrowths of the outer epidermal cells facilitating the leaf to respond to water stress and commonly seen in the plants growing in arid or semi-arid areas rather than the plants in warm and humid climates, are of relatively recent origin in Tamarix. The primitive species lack papillae or epidermal hairs, while in evolved species these structures are abundant. Based on the ecological adaptations of the epidermal features, the palaeogeographic
Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics
International Nuclear Information System (INIS)
Ayyagari, R.R.; Khan-Dawood, F.S.
1987-01-01
Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function
International Nuclear Information System (INIS)
Ross, J.A.; Howie, S.E.; Norval, M.; Maingay, J.P.
1987-01-01
Urocanic acid (UCA), the putative photoreceptor for ultraviolet radiation (UV)-induced suppression, undergoes a UV-dependent trans to cis isomerisation. Epidermal cells from mice painted with UCA, containing a known proportion of the cis-isomer, generate suppression of the delayed type hypersensitivity response to herpes simplex virus type 1 (HSV-1) when transferred to naive syngeneic recipients at the same time and site as infection with HSV-1. One T suppressor cell subset, of phenotype (Thy1+, L3T4+, Ly2-), is induced by the cis-UCA modified epidermal cell transfer. Flow cytometric analysis of the epidermal cells from skin treated with UV or cis-UCA indicates an overall reduction from normal in the number of cells expressing MHC Class II antigens, but no alteration in the number expressing I-J antigens
Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats
DEFF Research Database (Denmark)
Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.
2013-01-01
The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...
Epidermal growth factor in alkali-burned corneal epithelial wound healing.
Singh, G; Foster, C S
1987-06-15
We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.
International Nuclear Information System (INIS)
Creixell, Mar; Herrera, Adriana P.; Ayala, Vanessa; Latorre-Esteves, Magda; Perez-Torres, Marianela; Torres-Lugo, Madeline; Rinaldi, Carlos
2010-01-01
Epidermal growth factor (EGF) was conjugated with carboxymethyldextran (CMDx) coated iron oxide magnetic nanoparticles using carbodiimide chemistry to obtain magnetic nanoparticles that target the epidermal growth factor receptor (EGFR). Epidermal growth factor modified magnetic nanoparticles were colloidally stable when suspended in biological buffers such as PBS and cell culture media. Both targeted and non-targeted nanoparticles were incubated with CaCo-2 cancer cells, known to overexpress EGFR. Nanoparticle localization within the cell was visualized by confocal laser scanning microscopy and light microscopy using Prussian blue stain. Results showed that targeted magnetic nanoparticles were rapidly accumulated in both flask-shaped small vesicles and large circular endocytic structures. Internalization patterns suggest that both clathrin-dependent and clathrin-independent receptors mediated endocytosis mechanisms are responsible for nanoparticle internalization.
Zubor, Pavol; Hatok, Jozef; Moricova, Petra; Kapustova, Ivana; Kajo, Karol; Mendelova, Andrea; Sivonova, Monika Kmetova; Danko, Jan
2015-02-01
Gene expression profile‑based taxonomy of breast cancer (BC) has been described as a significant breakthrough in comprehending the differences in the origin and behavior of cancer to allow individually tailored therapeutic approaches. In line with this, we hypothesized that the gene expression profile of histologically normal epithelium (HNEpi) could harbor certain genetic abnormalities predisposing breast tissue cells to develop human epidermal growth factor receptor 2 (HER2)‑positive BC. Thus, the aim of the present study was to assess gene expression in normal and BC tissue (BCTis) from patients with BC in order to establish its value as a potential diagnostic marker for cancer development. An array study evaluating a panel of 84 pathway‑ and disease‑specific genes in HER2‑positive BC and tumor‑adjacent HNEpi was performed using quantitative polymerase chain reaction in 12 patients using microdissected samples from frozen tissue. Common prognostic and predictive parameters of BC were assessed by immunohistochemistry and in situ hybridization. In the BCTis and HNEpi samples of 12 HER2‑positive subjects with BC, the expression of 2,016 genes was assessed. A total of 39.3% of genes were deregulated at a minimal two‑fold deregulation rate and 10.7% at a five‑fold deregulation rate in samples of HNEpi or BCTis. Significant differences in gene expression between BCTis and HNEpi samples were revealed for BCL2L2, CD44, CTSD, EGFR, ERBB2, ITGA6, NGFB, RPL27, SCBG2A1 and SCGB1D2 genes (Pbreast tissue revealed gene expression abnormalities that may represent potential markers of increased risk for HER2‑positive malignant transformation of breast tissue, and may be able to be employed as predictors of prognosis.
Epidermal growth factor in the rat prostate
DEFF Research Database (Denmark)
Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier
1998-01-01
Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....
ErbB2 resembles an autoinhibited invertebrate epidermal growth factor receptor
Energy Technology Data Exchange (ETDEWEB)
Alvarado, Diego; Klein, Daryl E.; Lemmon, Mark A.; (UPENN-MED)
2009-09-25
The orphan receptor tyrosine kinase ErbB2 (also known as HER2 or Neu) transforms cells when overexpressed, and it is an important therapeutic target in human cancer. Structural studies have suggested that the oncogenic (and ligand-independent) signalling properties of ErbB2 result from the absence of a key intramolecular 'tether' in the extracellular region that autoinhibits other human ErbB receptors, including the epidermal growth factor (EGF) receptor. Although ErbB2 is unique among the four human ErbB receptors, here we show that it is the closest structural relative of the single EGF receptor family member in Drosophila melanogaster (dEGFR). Genetic and biochemical data show that dEGFR is tightly regulated by growth factor ligands, yet a crystal structure shows that it, too, lacks the intramolecular tether seen in human EGFR, ErbB3 and ErbB4. Instead, a distinct set of autoinhibitory interdomain interactions hold unliganded dEGFR in an inactive state. All of these interactions are maintained (and even extended) in ErbB2, arguing against the suggestion that ErbB2 lacks autoinhibition. We therefore suggest that normal and pathogenic ErbB2 signalling may be regulated by ligands in the same way as dEGFR. Our findings have important implications for ErbB2 regulation in human cancer, and for developing therapeutic approaches that target novel aspects of this orphan receptor.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Identification and comparative analysis of the epidermal differentiation complex in snakes
Brigit Holthaus, Karin; Mlitz, Veronika; Strasser, Bettina; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold
2017-01-01
The epidermis of snakes efficiently protects against dehydration and mechanical stress. However, only few proteins of the epidermal barrier to the environment have so far been identified in snakes. Here, we determined the organization of the Epidermal Differentiation Complex (EDC), a cluster of genes encoding protein constituents of cornified epidermal structures, in snakes and compared it to the EDCs of other squamates and non-squamate reptiles. The EDC of snakes displays shared synteny with that of the green anole lizard, including the presence of a cluster of corneous beta-protein (CBP)/beta-keratin genes. We found that a unique CBP comprising 4 putative beta-sheets and multiple cysteine-rich EDC proteins are conserved in all snakes and other squamates investigated. Comparative genomics of squamates suggests that the evolution of snakes was associated with a gene duplication generating two isoforms of the S100 fused-type protein, scaffoldin, the origin of distinct snake-specific EDC genes, and the loss of other genes that were present in the EDC of the last common ancestor of snakes and lizards. Taken together, our results provide new insights into the evolution of the skin in squamates and a basis for the characterization of the molecular composition of the epidermis in snakes. PMID:28345630
Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina
2005-01-01
The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.
Genetic analysis of Ras genes in epidermal development and tumorigenesis
Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano
2013-01-01
Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175
Furrer, Daniela; Lemieux, Julie; Côté, Marc-André; Provencher, Louise; Laflamme, Christian; Barabé, Frédéric; Jacob, Simon; Michaud, Annick; Diorio, Caroline
2016-12-01
Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with worse prognosis and decreased overall survival in breast cancer patients. The HER2 gene contains several polymorphisms; two of the best-characterized HER2 polymorphisms are Ile655Val and Ala1170Pro. The aim of this study was to evaluate the association between these two HER2 polymorphisms in normal breast and breast cancer tissues and known breast cancer prognostic factors in a retrospective cohort study of 73 women with non-metastatic HER2-positive breast cancer. HER2 polymorphisms were assessed in breast cancer tissue and normal breast tissue using TaqMan assay. Ala1170Pro polymorphism in normal breast tissue was associated with age at diagnosis (p = 0.007), tumor size (p = 0.004) and lymphovascular invasion (p = 0.06). Similar significant associations in cancer tissues were observed. No association between the Ile655Val polymorphism and prognostic factors were observed. However, we found significant differences in the distribution of Ile655Val (p = 0.03) and Ala1170Pro (p = 0.01) genotypes between normal breast and breast tumor tissues. This study demonstrates that only the Ala1170Pro polymorphism is associated with prognostic factors in HER2-positive breast cancer patients. Moreover, our results suggest that both HER2 polymorphisms could play a significant role in carcinogenesis in non-metastatic HER2-positive breast cancer women. Copyright © 2016 Elsevier Ltd. All rights reserved.
Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report
International Nuclear Information System (INIS)
Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub
2006-01-01
Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess
Epidermal hydrogen peroxide is not increased in lesional and non-lesional skin of vitiligo.
Zailaie, Mohammad Z
2017-01-01
It is widely believed that the loss of the epidermal melanocytes in vitiligo is basically due to excessive oxidative stress. Previous research work described abnormal elevation of the absolute concentration of the epidermal hydrogen peroxide (H 2 O 2 ) in lesional and non-lesional skin of vitiligo. Based on this finding, our primary research objective was to use this feature as a screening marker in individuals at a great risk of developing vitiligo. Ninety-six patients of non-segmental vitiligo (NSV) of varying durations, skin phototypes, and treatment modalities (psoralen UVA-, narrow band UVB-treated) were recruited for this study. Raman spectroscopic measurements, using an external probehead, of the lesional and non-lesional skin were obtained, and the resulting spectra were analyzed using the Opus software package of the MultiRam spectrometer and the intensity of the peak at 875 cm -1 that represents the absolute concentration of H 2 O 2 was calculated. Contrary to previous reports, in patients of skin phototype IV, the absolute concentrations of H 2 O 2 in non-lesional and lesional NSV of all groups were non-significantly decreased compared to normal control. In patients of NSV of skin phototype V, the decrease in the absolute concentrations of H 2 O 2 was not significant in the untreated group, and a slight non-significant increase in the NBUVB-treated group was noted. However, in the PUVA-treated group, the non-lesional skin demonstrated significant increase in the absolute concentration of H 2 O 2 , whereas the lesional skin showed only a slight non-significant increase compared to normal control. In NSV patients of skin phototype VI who were previously treated with PUVA, the non-lesional skin showed a slight non-significant increase in the absolute concentration of H 2 O 2 ; however, the lesional skin showed a marked significant decrease compared to normal control and the non-lesional skin. Thereof, one can conclude that the epidermal H 2 O 2 is not
Ho, Ernest; Dagnino, Lina
2012-01-01
Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front–rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front–rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front–rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front–rear polarity and forward movement. PMID:22160594
Ho, Ernest; Dagnino, Lina
2012-02-01
Epidermal growth factor (EGF) is a potent chemotactic and mitogenic factor for epidermal keratinocytes, and these properties are central for normal epidermal regeneration after injury. The involvement of mitogen-activated protein kinases as mediators of the proliferative effects of EGF is well established. However, the molecular mechanisms that mediate motogenic responses to this growth factor are not clearly understood. An obligatory step for forward cell migration is the development of front-rear polarity and formation of lamellipodia at the leading edge. We show that stimulation of epidermal keratinocytes with EGF, but not with other growth factors, induces development of front-rear polarity and directional migration through a pathway that requires integrin-linked kinase (ILK), Engulfment and Cell Motility-2 (ELMO2), integrin β1, and Rac1. Furthermore, EGF induction of front-rear polarity and chemotaxis require the tyrosine kinase activity of the EGF receptor and are mediated by complexes containing active RhoG, ELMO2, and ILK. Our findings reveal a novel link between EGF receptor stimulation, ILK-containing complexes, and activation of small Rho GTPases necessary for acquisition of front-rear polarity and forward movement.
Immune sensitization against epidermal antigens in polymorphous light eruption
International Nuclear Information System (INIS)
Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.
1991-01-01
To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption
International Nuclear Information System (INIS)
Han, S.R.
1988-01-01
The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon
Infective endocarditis involving an apparently structurally normal valve: new epidemiological trend?
Song, Jae-Kwan
2015-07-01
Infective endocarditis (IE) has been increasingly diagnosed in patients without previously detected predisposing heart disease, but its clinical features have yet to be fully determined. A recent single-center study including echocardiographic images and surgical findings investigated the incidence of undiagnosed, clinically silent valvular or congenital heart diseases and healthcare-associated infective endocarditis (HAIE). The study confirmed that a large proportion of patients with IE have no previous history of heart disease. Analysis of underlying disease in these patients showed that undetected mitral valve prolapse was the most common disease, followed by an apparently structurally normal valve. The patients who developed IE of apparently structurally normal valves had different clinical characteristics and worse outcomes. IE involving a structurally normal valve was associated with both nosocomial and non-nosocomial HAIE, whereas community-acquired IE was more frequent than HAIE. The pathophysiologic mechanism involving the development of non-HAIE or community-acquired IE due to predominantly staphylococcal infection in an apparently structurally normal valve is not yet clearly understood. Structurally normal valves are not necessarily free of regurgitation or abnormal turbulence and, given the dynamic nature and fluctuating hemodynamic effects of conditions such as poorly controlled hypertension, end-stage renal disease, and sleep apnea, further investigation is necessary to evaluate the potential role of these diseases in the development of IE. An apparently normal-looking valve is associated with IE development in patients without previously recognized predisposing heart disease, warranting repartition of at-risk groups to achieve better clinical outcomes.
Delineating the structure of normal and abnormal personality: an integrative hierarchical approach.
Markon, Kristian E; Krueger, Robert F; Watson, David
2005-01-01
Increasing evidence indicates that normal and abnormal personality can be treated within a single structural framework. However, identification of a single integrated structure of normal and abnormal personality has remained elusive. Here, a constructive replication approach was used to delineate an integrative hierarchical account of the structure of normal and abnormal personality. This hierarchical structure, which integrates many Big Trait models proposed in the literature, replicated across a meta-analysis as well as an empirical study, and across samples of participants as well as measures. The proposed structure resembles previously suggested accounts of personality hierarchy and provides insight into the nature of personality hierarchy more generally. Potential directions for future research on personality and psychopathology are discussed.
Delineating the Structure of Normal and Abnormal Personality: An Integrative Hierarchical Approach
Markon, Kristian E.; Krueger, Robert F.; Watson, David
2008-01-01
Increasing evidence indicates that normal and abnormal personality can be treated within a single structural framework. However, identification of a single integrated structure of normal and abnormal personality has remained elusive. Here, a constructive replication approach was used to delineate an integrative hierarchical account of the structure of normal and abnormal personality. This hierarchical structure, which integrates many Big Trait models proposed in the literature, replicated across a meta-analysis as well as an empirical study, and across samples of participants as well as measures. The proposed structure resembles previously suggested accounts of personality hierarchy and provides insight into the nature of personality hierarchy more generally. Potential directions for future research on personality and psychopathology are discussed. PMID:15631580
Post-female-circumcision clitoral epidermal inclusion cyst: a case ...
African Journals Online (AJOL)
Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.
Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei
2017-05-01
Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.
Proximity effect in normal metal-multiband superconductor hybrid structures
Brinkman, Alexander; Golubov, Alexandre Avraamovitch; Kupriyanov, M. Yu
2004-01-01
A theory of the proximity effect in normal metal¿multiband superconductor hybrid structures is formulated within the quasiclassical Green's function formalism. The quasiclassical boundary conditions for multiband hybrid structures are derived in the dirty limit. It is shown that the existence of
"Cut-and-paste" manufacture of multiparametric epidermal electronic systems
Lu, Nanshu; Yang, Shixuan; Wang, Pulin
2016-05-01
Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.
Springer, Jessica Collins; Harrysson, Ola L A; Marcellin-Little, Denis J; Bernacki, Susan H
2014-10-01
Transdermal osseointegrated prostheses (TOPs) are emerging as an alternative to socket prostheses. Electron beam melting (EBM) is a promising additive manufacturing technology for manufacture of custom, freeform titanium alloy (Ti6Al4V) implants. Skin ongrowth for infection resistance and mechanical stability are critically important to the success of TOP, which can be influenced by material composition and surface characteristics. We assessed viability and proliferation of normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF) on several Ti6Al4V surfaces: solid polished commercial, solid polished EBM, solid unpolished EBM and porous unpolished EBM. Cell proliferation was evaluated at days 2 and 7 using alamarBlue(®) and cell viability was analyzed with a fluorescence-based live-dead assay after 1 week. NHDF and NHEK were viable and proliferated on all Ti6Al4V surfaces. NHDF proliferation was highest on commercial and EBM polished surfaces. NHEK was highest on commercial polished surfaces. All EBM Ti6Al4V discs exhibited an acceptable biocompatibility profile compared to solid Ti6Al4V discs from a commercial source for dermal and epidermal cells. EBM may be considered as an option for fabrication of custom transdermal implants. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.
Foveal shape and structure in a normal population.
Tick, Sarah; Rossant, Florence; Ghorbel, Itebeddine; Gaudric, Alain; Sahel, José-Alain; Chaumet-Riffaud, Philippe; Paques, Michel
2011-07-29
The shape of the human fovea presents important but still poorly characterized variations. In this study, the variability of the shape and structure of normal foveae were examined. In a group of 110 eyes of 57 healthy adults, the shape and structure of the fovea were analyzed by automated segmentation of retinal layer on high-resolution optical coherence tomography scans. In an additional group of 10 normal eyes of 10 patients undergoing fluorescein angiography, the size of the foveal avascular zone (FAZ) was correlated to foveal shape. From the thickest to the thinnest fovea, there was a structural continuum ranging from a shallow pit with continuity of the inner nuclear layer (INL) over the center (seven eyes; 6.7%), to a complete separation of inner layers overlying a flat and thinner central outer nuclear layer (ONL; eight eyes; 7.3%). Central foveal thickness correlated inversely to the degree of inner layer separation and to the surface of the FAZ. Foveal structure strongly correlates with its neurovascular organization. The findings support a developmental model in which the size of the FAZ determines the extent of centrifugal migration of inner retinal layers, which counteracts in some way the centripetal packing of cone photoreceptors.
Directory of Open Access Journals (Sweden)
Nitin Nitin
2009-06-01
Full Text Available Background: The development of noninvasive molecular imaging approaches has the potential to improve management of cancer. Methods: In this study, we demonstrate the potential of noninvasive topical delivery of an epidermal growth factor-Alexa 647 (EGF-Alexa 647 conjugate to image changes in epidermal growth factor receptor expression associated with oral neoplasia. We report a series of preclinical analyses to evaluate the optical contrast achieved after topical delivery of EGF-Alexa 647 in a variety of model systems, including cells, three-dimensional tissue cultures, and intact human tissue specimens using wide-field and high-resolution fluorescence imaging. Data were collected from 17 different oral cancer patients: eight pairs of normal and abnormal biopsies and nine resected tumors were examined. Results: The EGF-dye conjugate can be uniformly delivered throughout the oral epithelium with a penetration depth exceeding 500 µm and incubation time of less than 30 minutes. After EGF-Alexa 647 incubation, the presence of oral neoplasia is associated with a 1.5- to 6.9-fold increase in fluorescence contrast compared with grossly normal mucosa from the same patient with both wide-field and high-resolution fluorescence imaging. Conclusions: Results illustrate the potential of EGF-targeted fluorescent agents for in vivo molecular imaging, a technique that may aid in the diagnosis and characterization of oral neoplasia and allow real-time detection of tumor margins.
Epidermal Growth Factor Receptor in Pancreatic Cancer
International Nuclear Information System (INIS)
Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.
2011-01-01
Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer
Directory of Open Access Journals (Sweden)
V Chandana Epa
Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.
Homologous radioimmunoassay for human epidermal growth factor (urogastrone)
International Nuclear Information System (INIS)
Dailey, G.E.; Kraus, J.W.; Orth, D.N.
1978-01-01
Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion
Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes
International Nuclear Information System (INIS)
Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira
1997-01-01
Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding
Impact of age and sex on normal left heart structure and function.
Hagström, Linn; Henein, Michael Y; Karp, Kjell; Waldenström, Anders; Lindqvist, Per
2017-11-01
Accurate age- and sex-related normal reference values of ventricular structure and function are important to determine the level of dysfunction in patients. The aim of this study therefore was to document normal age range sex-related measurements of LV structural and functional measurements to serve such purpose. We evaluated left ventricular structure and function in 293 healthy subjects between 20 and 90 years with equally distributed gender. Doppler echocardiography was used including measure of both systolic and diastolic functions. Due to systolic LV function, only long axis function correlated with age (r = 0·55, P<0·01) and the correlation was stronger in females. Concerning diastolic function, there was a strong age correlation in all parameters used (r = 0·40-0·74, P<0·001). Due to LV structural changes over age, females showed a larger reduction in end-diastolic volumes, but no or trivial difference in wall thickness after the age of 60 years. Age is associated with significant normal changes in left ventricular structure and function, which should be considered when deciding on normality. These changes are related to systemic arterial changes as well as body stature, thus reflecting overall body ageing process. Furthermore, normal cardiac ageing in females might partly explain the higher prevalence of heart failure with preserved ejection in females. © 2016 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd.
Epidermal growth factor and its receptors in human pancreatic carcinoma
International Nuclear Information System (INIS)
Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.
1990-01-01
The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells
Current correlations in superconductor - normal metal mesoscopic structures
International Nuclear Information System (INIS)
Bignon, Guillaume
2005-01-01
Thanks to the experimental progress in miniaturization and cryogenics over the last twenty years, it is now possible to build sufficiently small electric circuits where the wave like nature of electron becomes significant. In such electric circuit transport properties like current and noise are modified. It corresponds to the mesoscopic scale. Moreover, connecting a mesoscopic circuit to a superconductor enhances the effects due to interference between electrons since a superconductor is a macroscopic source of coherent electrons pairs: the Cooper pairs. In this thesis, we study current correlations in mesoscopic normal metal - superconductor structures. First, the energy dependence of current noise in a normal metal - superconductor tunnel junction is analysed taking into account weak disorder and interactions. We show that if the normal metal is out of equilibrium, current and noise become independent. Next, we consider the case of a superconductor connected to two normal metals by tunnel junctions. We show that it is possible to change the sign of current crossed correlation by tuning the voltages and that it can be used to probe the size of the Cooper pairs. Lastly, using Usadel's quasi-classic theory, we study the energy dependence of noise in a normal metal - normal metal - superconductor double junction. We show that barrier's transparencies modifies significantly both current and noise. (author) [fr
RF Breakdown in Normal Conducting Single-cell Structures
Dolgashev, Valery A; Higo, Toshiyasu; Nantista, Christopher D; Tantawi, Sami G
2005-01-01
Operating accelerating gradient in normal conducting accelerating structures is often limited by rf breakdown. The limit depends on multiple parameters, including input rf power, rf circuit, cavity shape and material. Experimental and theoretical study of the effects of these parameters on the breakdown limit in full scale structures is difficult and costly. We use 11.4 GHz single-cell traveling wave and standing wave accelerating structures for experiments and modeling of rf breakdown behavior. These test structures are designed so that the electromagnetic fields in one cell mimic the fields in prototype multicell structures for the X-band linear collider. Fields elsewhere in the test structures are significantly lower than that of the single cell. The setup uses matched mode converters that launch the circular TM01 mode into short test structures. The test structures are connected to the mode launchers with vacuum rf flanges. This setup allows economic testing of different cell geometries, cell materials an...
Dong, Changsheng; Yang, Shanshan; Fan, Ruiwen; Ji, Kaiyuan; Zhang, Junzhen; Liu, Xuexian; Hu, Shuaipeng; Xie, Jianshan; Liu, Yu; Gao, Wenjun; Wang, Haidong; Yao, Jianbo; Smith, George W; Herrid, Muren
2017-01-01
The mammalian integumentary system plays important roles in body homeostasis, and dysfunction of melanogenesis or epidermal development may lead to a variety of skin diseases, including melanoma. Skin pigmentation in humans and coat color in fleece-producing animals are regulated by many genes. Among them, microphthalmia-associated transcription factor (MITF) and paired-box 3 (PAX3) are at the top of the cascade and regulate activities of many important melanogenic enzymes. Here, we report fo...
Holthaus, Karin Brigit; Strasser, Bettina; Sipos, Wolfgang; Schmidt, Heiko A; Mlitz, Veronika; Sukseree, Supawadee; Weissenbacher, Anton; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold
2016-03-01
The evolution of reptiles, birds, and mammals was associated with the origin of unique integumentary structures. Studies on lizards, chicken, and humans have suggested that the evolution of major structural proteins of the outermost, cornified layers of the epidermis was driven by the diversification of a gene cluster called Epidermal Differentiation Complex (EDC). Turtles have evolved unique defense mechanisms that depend on mechanically resilient modifications of the epidermis. To investigate whether the evolution of the integument in these reptiles was associated with specific adaptations of the sequences and expression patterns of EDC-related genes, we utilized newly available genome sequences to determine the epidermal differentiation gene complement of turtles. The EDC of the western painted turtle (Chrysemys picta bellii) comprises more than 100 genes, including at least 48 genes that encode proteins referred to as beta-keratins or corneous beta-proteins. Several EDC proteins have evolved cysteine/proline contents beyond 50% of total amino acid residues. Comparative genomics suggests that distinct subfamilies of EDC genes have been expanded and partly translocated to loci outside of the EDC in turtles. Gene expression analysis in the European pond turtle (Emys orbicularis) showed that EDC genes are differentially expressed in the skin of the various body sites and that a subset of beta-keratin genes within the EDC as well as those located outside of the EDC are expressed predominantly in the shell. Our findings give strong support to the hypothesis that the evolutionary innovation of the turtle shell involved specific molecular adaptations of epidermal differentiation. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Delacruz, Jomer; Weissman, Jesse; Gossage, Kirk
2010-02-01
Optical Coherence Tomography (OCT) is a non-invasive imaging modality that acquires cross sectional images of tissue in-vivo. It accelerates skin diagnosis by eliminating invasive biopsy and laborious histology in the process. Dermatologists have widely used it for looking at morphology of skin diseases such as psoriasis, dermatitis, basal cell carcinoma etc. Skin scientists have also successfully used it for looking at differences in epidermal thickness and its underlying structure with respect to age, body sites, ethnicity, gender, and other related factors. Similar to other in-vivo imaging systems, OCT images suffer from a high degree of speckle and noise content, which hinders examination of tissue structures. Most of the previous work in OCT segmentation of skin was done manually. This compromised the quality of the results by limiting the analyses to a few frames per area. In this paper, we discuss a region growing method for automatic identification of the upper and lower boundaries of the epidermis in living human skin tissue. This image analysis method utilizes images obtained from a frequency-domain OCT. This system is high-resolution and high-speed, and thus capable of capturing volumetric images of the skin in short time. The three-dimensional (3D) data provides additional information that is used in the segmentation process to help compensate for the inherent noise in the images. This method not only provides a better estimation of the epidermal thickness, but also generates a 3D surface map of the epidermal-dermal junction, from which underlying topography can be visualized and further quantified.
Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.
Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui
2018-01-01
Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.
Penile epidermal inclusion cyst: a late complication of penile girth enhancement surgery.
Park, Hyun Jun; Park, Nam Cheol; Park, Sung Woo; Jern, Tae Kyung; Choi, Kyung-Un
2008-09-01
Epidermal inclusion cysts are benign lesions that can develop in any part of the body. However, the finding of an epidermal inclusion cyst in the penis is rare. The aim of this article was to present the management of a case of a penile epidermal inclusion cyst that occurred because of late complications of a penile girth enhancement surgery. A 52-year-old man presented with a painless, slowly growing mass in the penis, which was first noted after a penile girth enhancement surgery 20 years ago. A cystic mobile mass about 2 cm in depth was found surrounding the coronal sulcus. Excision of the mass was performed for diagnosis and treatment. There was no communication with the urethra. The pathological diagnosis was an epidermal inclusion cyst of the penis. A penile epidermal inclusion cyst in adult men is rare. It can develop after an inadequate procedure for penile girth enhancement, and should be treated by complete resection.
Epidermal stem cells response to radiative genotoxic stress
International Nuclear Information System (INIS)
Marie, Melanie
2013-01-01
Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global
RF Breakdown in Normal Conducting Single-Cell Structures
International Nuclear Information System (INIS)
Dolgashev, V.A.; Nantista, C.D.; Tantawi, S.G.; Higashi, Y.; Higo, T.
2006-01-01
Operating accelerating gradient in normal conducting accelerating structures is often limited by rf breakdown. The limit depends on multiple parameters, including input rf power, rf circuit, cavity shape and material. Experimental and theoretical study of the effects of these parameters on the breakdown limit in full scale structures is difficult and costly. We use 11.4 GHz single-cell traveling wave and standing wave accelerating structures for experiments and modeling of rf breakdown behavior. These test structures are designed so that the electromagnetic fields in one cell mimic the fields in prototype multicell structures for the X-band linear collider. Fields elsewhere in the test structures are significantly lower than that of the single cell. The setup uses matched mode converters that launch the circular TM 01 mode into short test structures. The test structures are connected to the mode launchers with vacuum rf flanges. This setup allows economic testing of different cell geometries, cell materials and preparation techniques with short turn-around time. Simple 2D geometry of the test structures simplifies modeling of the breakdown currents and their thermal effects
International Nuclear Information System (INIS)
Hirata, Y.; Orth, D.N.
1981-01-01
Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)
Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis
Directory of Open Access Journals (Sweden)
Kazuhiko Arima
2015-01-01
Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.
An Epidermal Biosensor for Carcinoembryonic Antigen
National Research Council Canada - National Science Library
Schwartz, Pauline
2001-01-01
...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...
Turnover of pigment granules: cyclic catabolism and anabolism of ommochromes within epidermal cells.
Insausti, T C; Casas, J
2009-12-01
Ommochromes are end products of the tryptophan metabolism in arthropods. While the anabolism of ommochromes has been well studied, the catabolism is totally unknown. In order to study it, we used the crab-spider Misumena vatia, which is able to change color reversibly in a few days, from yellow to white and back. Ommochromes is the only pigment class responsible for the body coloration in this animal. The aim of this study was to analyze the fine structure of the epidermal cells in bleaching spiders, in an attempt to correlate morphological changes with the fate of the pigment granules. Central to the process of bleaching is the lysis of the ommochrome granules. In the same cell, intact granules and granules in different degradation stages are found. The degradation begins with granule autolysis. Some components are extruded in the extracellular space and others are recycled via autophagy. Abundant glycogen appears associated to granulolysis. In a later stage of bleaching, ommochrome progranules, typical of white spiders, appear in the distal zone of the same epidermal cell. Catabolism and anabolism of pigment granules thus take place simultaneously in spider epidermal cells. A cyclic pathway of pigment granules formation and degradation, throughout a complete cycle of color change is proposed, together with an explanation for this turnover, involving photoprotection against UV by ommochromes metabolites. The presence of this turnover for melanins is discussed.
International Nuclear Information System (INIS)
Popov, D.V.; Kalistratova, E.N.; Kaluzhina, A.V.
1982-01-01
Dynamics of physiological reactions of epidermal melanophors of larvae Rana temporaria L.. adapted to white and black backgrounds and irradiated with a dose of 700 R has been investigated. Ouring the first day after irradiation no day changes of melanophor index characteristic of intact tadpoles were discovered in whitebackground animals; melanophors preserve the aggregation state. Comparison of black background irradiated and control larvae didn't show confident differences in changes of their melanophor indices. Irradiation affects differently epidermal melanophors in the state of pigment dispersion and aggregation. It is suggested that pigment dispersion and aggregation in melanophor is realized at the expense of different cellular structures. It is shown that by the end of the experiment (21-st day) the amount of epidermal melanophor per surface unit is two times larger in black-ground larvae. General biological signaficance of revealed facts from the point of view of ontogenesis evolution is discussed
Energy Technology Data Exchange (ETDEWEB)
Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)
2016-07-08
Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.
Kharbikar, Bhushan N.; Kumar S., Harish; Kr., Sindhu; Srivastava, Rohit
2015-12-01
Chemotherapy Induced Nausea and Vomiting (CINV) is a serious health concern in the treatment of cancer patients. Conventional routes for administering anti-emetics (i.e. oral and parenteral) have several drawbacks such as painful injections, poor patient compliance, dependence on skilled personnel, non-affordability to majority of population (parenteral), lack of programmability and suboptimal bioavailability (oral). Hence, we have developed a trans-epidermal antiemetic drug delivery patch using out-of-plane hollow silicon microneedle array. Microneedles are pointed micron-scale structures that pierce the epidermal layer of skin to reach dermal blood vessels and can directly release the drug in their vicinity. They are painless by virtue of avoiding significant contact with dermal sensory nerve endings. This alternate approach gives same pharmacodynamic effects as par- enteral route at a sparse drug-dose requirement, hence negligible side-effects and improved patient compliance. Microneedle design attributes were derived by systematic study of human skin anatomy, natural micron-size structures like wasp-sting and cactus-spine and multi-physics simulations. We used deep reactive ion etching with Bosch process and optimized recipe of gases to fabricate high-aspect-ratio hollow silicon microneedle array. Finally, microneedle array and polydimethylsiloxane drug reservoir were assembled to make finished anti-emetic patch. We assessed microneedles mechanical stability, physico-chemical properties and performed in-vitro, ex- vivo and in-vivo studies. These studies established functional efficacy of the device in trans-epidermal delivery of anti-emetics, its programmability, ease of use and biosafety. Thus, out-of-plane hollow silicon microneedle array trans-epidermal antiemetic patch is a promising strategy for painless and effective management of CINV at low cost in mainstream healthcare.
Optimal allocation of leaf epidermal area for gas exchange
de Boer, Hugo J.; Price, Charles A.; Wagner-Cremer, Friederike; Dekker, Stefan C.; Franks, Peter J.; Veneklaas, Erik J.
2016-01-01
Summary A long?standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of ...
An Epidermal Biosensor for Carcinoembryonic Antigen
National Research Council Canada - National Science Library
Schwartz, Pauline
2003-01-01
...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...
Majdzadeh, Ali; Lee, Anthony M D; Wang, Hequn; Lui, Harvey; McLean, David I; Crawford, Richard I; Zloty, David; Zeng, Haishan
2015-05-01
Recent advances in biomedical optics have enabled dermal and epidermal components to be visualized at subcellular resolution and assessed noninvasively. Multiphoton microscopy (MPM) and reflectance confocal microscopy (RCM) are noninvasive imaging modalities that have demonstrated promising results in imaging skin micromorphology, and which provide complementary information regarding skin components. This study assesses whether combined MPM/RCM can visualize intracellular and extracellular melanin granules in the epidermis and dermis of normal human skin. We perform MPM and RCM imaging of in vivo and ex vivo skin in the infrared domain. The inherent three-dimensional optical sectioning capability of MPM/RCM is used to image high-contrast granular features across skin depths ranging from 50 to 90 μm. The optical images thus obtained were correlated with conventional histologic examination including melanin-specific staining of ex vivo specimens. MPM revealed highly fluorescent granular structures below the dermal-epidermal junction (DEJ) region. Histochemical staining also demonstrated melanin-containing granules that correlate well in size and location with the granular fluorescent structures observed in MPM. Furthermore, the MPM fluorescence excitation wavelength and RCM reflectance of cell culture-derived melanin were equivalent to those of the granules. This study suggests that MPM can noninvasively visualize and quantify subepidermal melanin in situ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong
2016-12-01
: Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.
Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.
Papiorek, Sarah; Junker, Robert R; Lunau, Klaus
2014-01-01
Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.
Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.
Directory of Open Access Journals (Sweden)
Sarah Papiorek
Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of
Li, Z; Hu, L; Elias, PM; Man, M-Q
2018-01-01
Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...
Directory of Open Access Journals (Sweden)
Shelly Abad Cruz
Full Text Available Cortisol is the major endogenous glucocorticoid (GC both in human and fish, mediated by corticosteroid receptors. Due to the absence of aldosterone production in teleost fish, cortisol is also traditionally accepted to function as mineralocorticoid (MC; but whether it acts through the glucocorticoid receptor (GR or the mineralocorticoid receptor (MR remains a subject of debate. Here, we used loss-of-function and rescue assays to determine whether cortisol affects zebrafish epidermal ionocyte development and function via the GR and/or the MR. GR knockdown morphants displayed a significant decrease in the major ionocytes, namely Na(+-K(+-ATPase-rich cells (NaRCs and H(+-ATPase-rich cells (HRCs, as well as other cells, including epidermal stem cells (ESCs, keratinocytes, and mucus cells; conversely, cell numbers were unaffected in MR knockdown morphants. In agreement, GR morphants, but not MR morphants, exhibited decreased NaRC-mediated Ca(2+ uptake and HRC-mediated H(+ secretion. Rescue via GR capped mRNA injection or exogenous cortisol incubation normalized the number of epidermal ionocytes in GR morphants. We also provide evidence for GR localization in epidermal cells. At the transcript level, GR mRNA is ubiquitously expressed in gill sections and present in both NaRCs and HRCs, supporting the knockdown and functional assay results in embryo. Altogether, we have provided solid molecular evidence that GR is indeed present on ionocytes, where it mediates the effects of cortisol on ionocyte development and function. Hence, cortisol-GR axis performs the roles of both GC and MC in zebrafish skin and gills.
Possible role of epidermal keratinocytes in the construction of acupuncture meridians.
Denda, Mitsuhiro; Tsutsumi, Moe
2014-04-01
Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.
Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells
International Nuclear Information System (INIS)
Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui
2008-01-01
Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis
DEFF Research Database (Denmark)
Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar
2014-01-01
The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...
Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M
1992-07-01
Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.
Epidermal Growth Factor and Intestinal Barrier Function
Directory of Open Access Journals (Sweden)
Xiaopeng Tang
2016-01-01
Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.
Perforator Flaps after Excision of Large Epidermal Cysts in the Buttocks
Directory of Open Access Journals (Sweden)
Sang Wha Kim
2014-03-01
Full Text Available Background Epidermal cysts are commonly occurring masses usually less than 5 cm in diameter, but in predisposed patients, epidermal cysts can grow relatively large due to chronic infection. Methods From June 2002 to July 2010, 17 patients received 19 regional perforator-based island flaps to cover defects due to the excision of large epidermal cysts (diameter >5 cm in the buttocks. Eight patients had diabetes, and seven had rheumatoid arthritis. The pedicles were not fully isolated to prevent spasms or twisting. Results All the flaps survived completely, except for one case with partial necrosis of the flap, which necessitated another perforator-based island flap for coverage. There were two cases of wound dehiscence, which were re-closed after meticulous debridement. There were no recurrences of the masses during follow-up periods of 8.1 months (range, 6-12 months. Conclusions In patients with large epidermal cysts and underlying medical disorders, regional perforator-based island flaps can be the solution to coverage of the defects after excision.
Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.
Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M
2016-09-01
Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.
Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age
Directory of Open Access Journals (Sweden)
Zobiri O
2012-02-01
Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test
Breslow, L; Cowan, P A
1984-02-01
This study describes a strategy for examining cognitive functioning in psychotic and normal children without the usual confounding effects of marked differences in cognitive structure that occur when children of the same age are compared. Participants were 14 psychotic children, 12 males and 2 females, mean age 9-2, matched with normal children at preoperational and concrete operational stage levels on a set of Piagetian classification tasks. The mean age of the normal children was 6-4, replicating the usually found developmental delay in psychotic samples. Participants were then compared on both structural level and functional abilities on a set of tasks involving seriation of sticks; the higher-level children were also administered a seriation drawing task. Analysis of children's processes of seriating and seriation drawings indicated that over and above the structural retardation, psychotic children at all levels showed functional deficits, especially in the use of anticipatory imagery. The implications for general developmental theory are that progress in structural development is not sufficient for imaginal development, and that structural development of logical concepts is relatively independent of the development of imagery. It was suggested that "thought disorder" may not be a disordered structure of thinking or a retardation in psychotic populations but rather a mismatch between higher-level logical structures and lower-level functions.
Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes
DEFF Research Database (Denmark)
Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise
2005-01-01
Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S....... chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had...... an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654...
Inhibition of epidermal cell proliferation by borderline rays
Energy Technology Data Exchange (ETDEWEB)
Born, W [Freiburg Univ.; Daikeler, G
1976-08-01
Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.
Zhao, Heling; Yang, Hongsheng; Zhao, Huan; Liu, Shilin; Wang, Tianming
2012-01-01
Albino Apostichopus japonicus occur both in the wild and in captivity. The offspring of albino A. japonicus also suffer from albinism. The formation of melanin in the melanocytes is dependant on microphthalmia-associated transcription factor (MITF). To investigate the role of MITF in controlling albinism, we cloned the full-length MITF cDNA from A. japonicus and compared MITF mRNA expression in albino and normal A. japonicus. In addition, we used light and electron microscopy to compare histological samples of normal and albino A. japonicus. The body wall of albino adults was characterized by significantly lower levels of MITF expression and lower numbers of epidermal melanocytes, which also contained less melanin. In albino juvenile offspring, MITF expression levels were significantly lower 32 d after fertilization and there were fewer, and less developed, epidermal melanocytes. Thus, we conclude that albino A. japonicus have fewer melanocytes and a reduced ability to synthesize melanin, likely because of lower expression of MITF.
Dharma, Fitra
2006-01-01
The research aims to reveal an empirical evidence whether structural assurance belief and situational normality belief have positive effect to trust in e-commerce system. Data for the study are collected from 100 Internet's user. It used multiple regression to analyze the data. The results indicate that perception of structural assurance has significant effect on trust in e-commerce site. However we failed to find out empirical evidence that situational normality belief has significant effect...
Giant epidermal inclusion cyst in the male breast: A case report
Energy Technology Data Exchange (ETDEWEB)
KIm, Hyun Jin; Park, Woon Ju; KIm, Sang Wook; Paik, So Ya [Daejin Medical Center Bundang Jesaeng General Hospital, Seongnam (Korea, Republic of)
2017-03-15
Giant epidermal inclusion cyst is a rare disease entity, and the occurrence of this cyst in the male breast is extremely rare. We report a case of giant epidermal inclusion cyst in the breast, which presented as a palpable and painful right breast mass in a 63-year-old man. The sonographic and computed tomography (CT) features are described in-depth. Physical examination revealed a firm, well-defined mass in the upper central portion of the right breast. Ultrasonography showed a 5.2 cm sized, oval, circumscribed, and complex cystic and solid mass with posterior acoustic enhancement, and CT showed a well-defined homogeneous low density mass without enhancement in the right breast. Surgical excision was performed, and pathological examination revealed a giant epidermal inclusion cyst.
MRI of normal pituitary glands and their surrounding structures
International Nuclear Information System (INIS)
Sato, Yoshiyuki
1991-01-01
Normal MRI appearances of the pituitary glands and their surrounding structures were evaluated in 332 patients without sellar and parasellar diseases. The height of the pituitary gland was maximum at 10-19 years of age reflecting hormonal activity. The width of the pituitary gland decreased, while that of the cavernous sinus increased with aging. This is probably due to atherosclerotic change of the internal carotid artery. Females younger than 30 years of age tended to show a convex upper surface of the pituitary gland and the displacement of the pituitary stalk was common after 50 years of age. Almost all of the anterior lobe of the pituitary gland showed isointensity relative to the pons or cerebral cortex and the majority (85.1%) of the posterior lobe showed hyperintensity. However, the anterior lobe in 2 newborns showed hyperintensity similar to the normal posterior lobe in adults. The posterior lobe was located off the midline in 19.1% of the subjects. One case of pars intermedia cyst was discovered among 14 subjects who were administered Gd-DTPA. The dural membrane between the pituitary gland and cavernous sinus was recognizable only in 8.6% on the right side and 7.5% on the left side. Primary empty sella was identified in 4.5%. Knowledge of the above normal ranges and variations of the pituitary gland and its surrounding structures is important in diagnosing sellar and parasellar lesions. (author) 52 refs
EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...
African Journals Online (AJOL)
Administrator
stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...
Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.
2013-01-01
Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445
Epidermal CYP2 family cytochromes P450
International Nuclear Information System (INIS)
Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.
2004-01-01
Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier
Cointegration as a data normalization tool for structural health monitoring applications
Harvey, Dustin Y.; Todd, Michael D.
2012-04-01
The structural health monitoring literature has shown an abundance of features sensitive to various types of damage in laboratory tests. However, robust feature extraction in the presence of varying operational and environmental conditions has proven to be one of the largest obstacles in the development of practical structural health monitoring systems. Cointegration, a technique adapted from the field of econometrics, has recently been introduced to the SHM field as one solution to the data normalization problem. Response measurements and feature histories often show long-run nonstationarity due to fluctuating temperature, load conditions, or other factors that leads to the occurrence of false positives. Cointegration theory allows nonstationary trends common to two or more time series to be modeled and subsequently removed. Thus, the residual retains sensitivity to damage with dependence on operational and environmental variability removed. This study further explores the use of cointegration as a data normalization tool for structural health monitoring applications.
Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G
1989-10-15
The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.
The epidermis in Passerina/ (Thymelaeaceae: structure, function and taxonomic significance
Directory of Open Access Journals (Sweden)
C. L. Bredenkamp
2000-02-01
Full Text Available Epidermal features were studied in all 17 species of Passerina, a genus endemic to southern Africa. Leaves in Passerina are inversely ericoid, the adaxial surface concave and the abaxial surface convex. Leaves are inversely dorsiventral and epistomatic. The adaxial epidermis is villous, with unicellular, uniseriate trichomes and relatively small thin-walled cells, promoting flexibility of leaf margins owing to turgor changes. In common with many other Thymelaeaceae, abaxial epidermal cells are large and tanniniferous with mucilaginous cell walls. The cuticle is adaxially thin, but abaxially well developed, probably enabling the leaf to restrict water loss and to tolerate high light intensity and UV-B radiation. Epicuticular waxes, present in all species, comprise both soft and plate waxes. Epidermal structure proves to be taxonomically important at family, genus and species levels. Interspecific differences include arrangement of stomata and presence or absence of abaxial epidermal hair. Other diagnostic characters of the abaxial epidermal cells are arrangement,size and shape, cutic- ular ornamentation and presence or absence of wax platelets. Two groups of species on the basis of abaxial epidermal cell orientation are recognised. Many leaf epidermal features in Passerina are interpreted as structural adaptations to the Mediterranean climate of the Cape.
Tc-99m-MDP scintigraphy in the evaluation of epidermal nevus syndrome
International Nuclear Information System (INIS)
Barbosa, M.N.S.; Cunha, M.O.; Severiche, A.F.A.; Ramos, C.D.; Etchebehere, E.C.S.C.; Belangero, W.; Camargo, E.E.
1997-01-01
Full text: Epidermal nevus syndrome has been described as a congenital neurocutaneous disorder in which epidermal nevi are associated with malformations of other organs, commonly the skeleton and central nervous system. Ocular, cardiac, and genitourinary system abnormalities, as well as other skin lesions, may also be seen. A 19 year old patient with epidermal nevus syndrome, presenting congenital facial epidermal nevi and bone deformity of the lower limbs (shortening of the left leg, left thigh varum, bilateral genu valgum, and multiple pathological fractures), as referred to the nuclear medicine laboratory to evaluate involvement of other sites of the skeleton. Whole body bone scintigraphy performed with MDP-Tc-99m showed multiple small focal areas of increased uptake in the skeleton, mainly in the upper and lower limbs, posterior ribs, right acetabulum, right sacroiliac joint, and right greater trochanter, interpreted as pathological fractures at different stages of remodeling. The range of skeletal findings in this condition is quite diverse. Many of these findings can be attributed to local tissue overgrowth with deformities and advanced bone age, associate with pathological fractures
Geburek, Florian; Ohnesorge, Bernhard; Deegen, Eckehard; Doeleke, Renate; Hewicker-Trautwein, Marion
2005-12-01
We report the historical, clinical and histopathological characteristics of skin lesions in biopsies from 37 heavy draught horses with chronic pastern dermatitis. The skin lesions were divided into four macroscopic groups: scaling (group I, n=5), hyperkeratotic and hyperplastic plaque-like lesions (group II, n=14), nodular skin masses (group III, n=16) and verrucous skin lesions (group IV, n=2). The principal histological findings were hyperkeratosis and epidermal hyperplasia. There was a gradual increase in epidermal hyperplasia from groups I to IV, suggesting that the lesions represent different stages of disease. In all cases, there was perivascular dermatitis dominated by T lymphocytes with an increase in MHC class II-positive dendritic-like cells. Immunohistochemical labelling for cytokeratins CK5/6(4), CK10 and CK14 indicated a change in their expression pattern. This correlated with the degree of epidermal hyperplasia, indicating abnormal differentiation of keratinocytes. There was a statistically significant correlation between the severity of skin lesions and several other factors including increasing age, increasing cannon circumference, prominence of anatomical structures such as fetlock tufts of hairs, ergots and chestnuts, and bulges in the fetlock region.
Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases
Energy Technology Data Exchange (ETDEWEB)
Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran [Uijongbu St. Mary' s Hospital, Catholic University College of Medicine, Seoul (Korea, Republic of)
2007-08-15
We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation.
Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases
International Nuclear Information System (INIS)
Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran
2007-01-01
We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation
Epidermal growth factor in mammary glands and milk from rats
DEFF Research Database (Denmark)
Thulesen, J; Raaberg, Lasse; Nexø, Ebba
1993-01-01
Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF-immunoreact......Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF...
Toxic epidermal necrolysis and Stevens-Johnson syndrome
Directory of Open Access Journals (Sweden)
French Lars E
2010-12-01
Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis
Blaak, J; Dähnhardt, D; Dähnhardt-Pfeiffer, S; Bielfeldt, S; Wilhelm, K-P; Wohlfart, R; Staib, P
2017-06-01
Xerosis is a serious problem among the very old. It is a dermatological challenge caused by significant alterations in stratum corneum (SC) function and structure. Two negative changes in aged skin are (i) the enhanced skin surface pH and (ii) the altered SC lipid content, composition and ordering. Therefore, we investigated the way in which an acidic skin care product with different plant oils affects SC function, structure and lipid profile in older subjects with dry skin. Before and after a 3-week application period, different biophysical measurements were performed: transepidermal water loss, SC hydration and skin surface pH. In addition, the SC lipid matrix was evaluated by analysis of the intercellular lipid lamellae and the SC lipid profile. After treatment, a significant increase in lipid lamellae in the intercellular space of the SC was observed in the area treated with the test product compared to the untreated area. Furthermore, the ceramide level was found to be increased, although ceramides were not provided by the acidic test formulation. In summary, topical application of a pH 4.0 product containing plant oils improves epidermal barrier formation and SC lipid ordering and ratio in aged dry skin. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
A review of toxic epidermal necrolysis management in Japan
Directory of Open Access Journals (Sweden)
Yuri Kinoshita
2017-01-01
Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.
Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...
African Journals Online (AJOL)
REVIEW. Introduction. Stevens-Johnson syndrome (SJS) and toxic epidermal ... that affect the skin and mucous membranes. ... Open Access article distributed under the terms of the .... pathogenic components are removed from plasma. The.
Epidermal growth factor enemas for induction of remission in left-sided ulcerative colitis
Directory of Open Access Journals (Sweden)
Hugo Nodarse-Cuní
2013-03-01
Full Text Available Introduction: ulcerative colitis is a little known chronic inflammatory disease in colonic mucosa. The positive effect of epidermal growth factor was shown in a previous report, with enema use for treatment of mild to moderate left-sided manifestation of the disease. This evidence provided the basis for evaluating the efficacy and safety profile of a viscous solution of this product. Methods: thirty-one patients were randomized to three groups for daily medications during 14 days. Twelve received one 10 mg enema of epidermal growth factor dissolved in 100 mL of viscous solution whereas nine were treated with placebo enema; both groups also received 1.2 g of oral mesalamine per day. The other group included ten patients with 3 g / 100 mL of mesalamine enema. Primary end point was clinical responses after two weeks of treatment, defined as a decreased of, at least three points from baseline, the Disease Activity Index and endoscopic or histological evidences of improvement. Results: remission of disease was observed in all patients in the epidermal growth factor group, and six in both, mesalamine enema and placebo group. All the comparisons between groups showed statistically significant superiority for epidermal growth factor, the only product with significant reduction in disease activity index as well as the presence and intensity of digestive symptoms in patients after treatment. None adverse event was reported. Conclusions: the results agree with previous molecular and clinical evidences, indicating that the epidermal growth factor is effective to reduce disease activity and to induce remission. A new study involving more patients should be conducted to confirm the efficacy of the epidermal growth factor enemas.
Epidermal growth factor pathway substrate 15, Eps15
DEFF Research Database (Denmark)
Salcini, A E; Chen, H; Iannolo, G
1999-01-01
Eps15 was originally identified as a substrate for the kinase activity of the epidermal growth factor receptor (EGFR). Eps15 has a tripartite structure comprising a NH2-terminal portion, which contains three EH domains, a central putative coiled-coil region, and a COOH-terminal domain containing...... multiple copies of the amino acid triplet Aspartate-Proline-Phenylalanine. A pool of Eps15 is localized at clathrin coated pits where it interacts with the clathrin assembly complex AP-2 and a novel AP-2 binding protein, Epsin. Perturbation of Eps15 and Epsin function inhibits receptor-mediated endocytosis...... of EGF and transferrin, demonstrating that both proteins are components of the endocytic machinery. Since the family of EH-containing proteins is implicated in various aspects of intracellular sorting, biomolecular strategies aimed at interfering with these processes can now be envisioned...
International Nuclear Information System (INIS)
Han Lihong; Gong Shoujun; Li Guangming; Li Yebing; Xu Bin
2001-01-01
The author observed the serum levels of carboxy terminal peptide of type I procollagen (PICP) and epidermal growth factor (EGF) in the patients with viral hepatitis and cirrhosis. The serum PICP and EGF were detected in 164 cases by RIA. The results indicated that two indexes increased significantly in patients with severe chronic hepatitis, chronic persistent hepatitis and post hepatitis cirrhosis compared with normal control (P 0.05). The results showed that detection of serum PICP and EGF may be valuable diagnostic markers to assess the degree of liver inflammation and fibrosis in viral liver diseases
Staiano-Coico, L; Steinberg, M; Higgins, P J
1990-10-15
Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.
FOLIAR EPIDERMAL AND PHYTOCHEMICAL STUDIES OF THE ...
African Journals Online (AJOL)
Administrator
alkaloid, saponin, inulin, cellulose, tannin and lignin; Eragrostis tremula tested negative for lignin and positive for cellulose, saponin and alkaloids while Axonopus compressus tested negative for lignin, but positive for alkaloid, saponin, inulin, cellulose and tannin respectively. Leaf epidermal studies help to determine ...
Stevens Johnsons syndrom og toksisk epidermal nekrolyse
DEFF Research Database (Denmark)
Kaur-Knudsen, Diljit; Zachariae, Claus; Thomsen, Simon Francis
2013-01-01
Stevens-Johnson syndrome and toxic epidermal necrolysis are acute mucocutaneous diseases primarily due to drug intake. The diseases are characterised by the separation of epidermis from dermis which can be life-threatening. Mortality is often caused by sepsis and multiple organ failure. The most...
On possible structures of normal ionizing shock waves in electromagnetic shock tubes
International Nuclear Information System (INIS)
Liberman, M.A.; Synakh, V.S.; Zakajdakhov, V.V.; Velikovich, A.L.
1982-01-01
The problem of possible structures of normal ionizing shock waves is studied. On the basis of the general theory of ionizing shock waves in magnetic fields, a similarity solution of the piston problem for an impenetrable piston and a magnetic piston is described and a numerical solution of the non-stationary piston problem is obtained. It is shown that precursor photo-ionization of the neutral gas by the radiation of the shock-heated gas is the dominant factor in shaping normal ionizing shock structures. In particular, it is shown that the strong overheating of atoms and ions in shock fronts is due to the tensor form of Ohm's law in the precursor region. (author)
Directory of Open Access Journals (Sweden)
Lasse Henriksen
Full Text Available The epidermal growth factor receptor (EGFR regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF and transforming growth factor-α (TGF-α. For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF or betacellulin (BTC was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown.
Henriksen, Lasse; Grandal, Michael Vibo; Knudsen, Stine Louise Jeppe; van Deurs, Bo; Grøvdal, Lene Melsæther
2013-01-01
The epidermal growth factor receptor (EGFR) regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF) and transforming growth factor-α (TGF-α). For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF) or betacellulin (BTC) was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown. PMID:23472148
Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique
2014-10-01
While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment
Protective Effect of HemoHIM on Epidermal Melanocytes in Ultraviolet-B irradiated Mice
Energy Technology Data Exchange (ETDEWEB)
Lee, Hae June [Korea Institute of Radiological and Medical Science, Seoul (Korea, Republic of); Kim, Jong Choon; Moon, Chang Jong; Kim, Sung Ho [Chonnam National University, Gwangju (Korea, Republic of); Jung, U Hee; Park, Hae Ran; Jo, Sung Kee [Jeongeup Campus of Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Jang, Jong Sik; Kim, Tae Hwan [Kyungpook National University, Daegu (Korea, Republic of)
2011-06-15
We induced the activation of melanocytes in the epidermis of C57BL/6 mice by ultraviolet-B (UV-B) irradiation, and observed the effect of an herbal preparation (HemoHIM, HH) on the formation, and decrease of UV-B-induced epidermal melanocytes. C57BL/6 mice were irradiated by UV-B 80 mJ:cm{sup -2} (0.5 mW:sec{sup -1}) daily for 7 days, and HH was intraperitoneally, orally or topically applied pre- or post-irradiation. For the estimation of change of epidermal melanocytes, light microscopic observation with dihydroxyphenylalanine (DOPA) stain was performed. Split epidermal sheets prepared from the ear of untreated mice exhibited 13∼15 melanocytes:mm{sup -2}, and one week after UV irradiation, the applied areas showed an increased number of strongly DOPA-positive melanocytes with stout dendrites. But intraperitoneal, oral or topical treatment with HH before each irradiation interrupted UV-B-induced pigmentation and resulted in a marked reduction in the number of epidermal melanocytes as compared to the number found in UV-B-irradiated, untreated control skin. The number and size of DOPA-positive epidermal melanocytes were also significantly decreased in intraperitoneally injected or topically applicated group after irradiation with HH at 3rd and 6th weeks after irradiation. The present study suggests the HH as inhibitor of UV-B-induced pigmentation, and depigmenting agent.
Directory of Open Access Journals (Sweden)
David Judah
Full Text Available Integrin-linked kinase (ILK is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.
Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina
2012-01-01
Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.
Standardized method to obtain dermo-epidermal junction samples from bovine hoof
Directory of Open Access Journals (Sweden)
H.M.F. Mendes
2015-04-01
Full Text Available As afecções podais em bovinos causam importante impacto econômico negativo na bovinocultura. Pesquisas têm sido realizadas com o objetivo de avançar no entendimento dos processos ocorridos na junção derme-epiderme do casco de bovinos com laminite e nos demais tecidos moles durante as lesões infecciosas. Apesar disso, não foram encontrados na literatura consultada estudos que descrevessem um método padronizado para a obtenção de amostras do tecido laminar do casco. Nesse contexto, foi necessário criar e estabelecer um método viável para a colheita de amostras da junção derme-epiderme, de modo a viabilizar o estudo de pós-graduação que originou esta comunicação. O objetivo é relatar um método padronizado, testado e bem-sucedido para obtenção de amostras da junção derme-epiderme do casco de bovinos em suas regiões solear, axial e dorsal. Foram obtidos fragmentos transversais das unhas de vacas abatidas em frigorífico. A espessura desses fragmentos foi de 1,5cm, aproximadamente, e contemplava as regiões solear, axial e dorsal do casco. De forma sistematizada, amostras da junção derme-epiderme de cada uma dessas regiões foram removidas, fixadas em formol, processadas e incluídas em parafina. A análise usando microscopia de luz demonstrou cortes histológicos íntegros e sem artefatos, que permitiram ampla avaliação das estruturas tanto da derme quanto da epiderme. Concluiu-se que o método proposto viabiliza a obtenção de amostras de padrão e qualidade adequados ao estudo do tecido laminar do casco bovino.
Improvement of arbutin trans-epidermal delivery using ...
African Journals Online (AJOL)
Purpose: To assess the ability of radiofrequency (RF) microporation to promote trans-epidermal delivery of arbutin. Methods: To investigate the enhancing effect of RF microchannels on skin permeation of arbutin, in vitro skin permeability studies were performed with RF microporation-treated Hartley albino guinea pig skin ...
A Bloch mode expansion approach for analyzing quasi-normal modes in open nanophotonic structures
DEFF Research Database (Denmark)
de Lasson, Jakob Rosenkrantz; Kristensen, Philip Trøst; Mørk, Jesper
2014-01-01
We present a new method for determining quasi-normal modes in open nanophotonic structures using a modal ex- pansion technique. The outgoing wave boundary condition of the quasi-normal modes is satisfied automatically without absorbing boundaries, representing a significant advantage compared...
Hybrid Enhanced Epidermal SpaceSuit Design Approaches
Jessup, Joseph M.
A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.
Grhl3 and Lmo4 play coordinate roles in epidermal migration.
Hislop, Nikki R; Caddy, Jacinta; Ting, Stephen B; Auden, Alana; Vasudevan, Sumitha; King, Sarah L; Lindeman, Geoffrey J; Visvader, Jane E; Cunningham, John M; Jane, Stephen M
2008-09-01
In addition to its role in formation of the epidermal barrier, the mammalian transcription factor Grainy head-like 3 (Grhl3) is also essential for neural tube closure and wound repair, processes that are dependent in part on epidermal migration. Here, we demonstrate that the LIM-only domain protein, LMO4 serves as a functional partner of GRHL3 in its established roles, and define a new cooperative role for these factors in another developmental epidermal migration event, eyelid fusion. GRHL3 and LMO4 interact biochemically and genetically, with mutant mice exhibiting fully penetrant exencephaly, thoraco-lumbo-sacral spina bifida, defective skin barrier formation, and a co-incident eyes-open-at-birth (EOB) phenotype, which is not observed in the original individual null lines. The two genes are co-expressed in the surface ectoderm of the migrating eyelid root, and electron microscopy of Grhl3/Lmo4-null eyes reveals a failure in epithelial extension and a lack of peridermal clump formation at the eyelid margins. Accumulation of actin fibers is also absent in the circumference of these eyelids, and ERK1/2 phosphorylation is lost in the epidermis and eyelids of Grhl3(-/-)/Lmo4(-/-) embryos. Keratinocytes from mutant mice fail to "heal" in in vitro scratch assays, consistent with a general epidermal migratory defect that is dependent on ERK activation and actin cable formation.
Avoiding vacuum arcs in high gradient normal conducting RF structures
Sjøbæk, Kyrre Ness; Adli, Erik; Grudiev, Alexej; Wuensch, Walter
In order to build the Compact LInear Collider (CLIC), accelerating structures reaching extremely high accelerating gradients are needed. Such structures have been built and tested using normal-conducting copper, powered by X-band RF power and reaching gradients of 100 MV/m and above. One phenomenon that must be avoided in order to reliably reach such gradients, is vacuum arcs or “breakdowns”. This can be accomplished by carefully designing the structure geometry such that high surface fields and large local power flows are avoided. The research presented in this thesis presents a method for optimizing the geometry of accelerating structures so that these breakdowns are made less likely, allowing the structure to operate reliably at high gradients. This was done primarily based on a phenomenological scaling model, which predicted the maximum gradient as a function of the break down rate, pulse length, and field distribution in the structure. The model is written in such a way that it allows direct comparis...
Wilson, P D; Nathrath, W B; Trejdosiewicz, L K
1982-01-01
Immunoelectron microscope cytochemistry was carried out on 2% paraformaldehyde fixed, 50 mu sections of normal urothelium and bladder carcinoma cells in culture using antisera raised in rabbits to human 40-63 000 MW epidermal "broad spectrum" keratin and calf urothelial "luminal epithelial antigen" (aLEA) Both the unconjugated and indirect immunoperoxidase-DAB techniques were used before routine embedding. The localisation of both keratin and luminal epithelial antigen (LEA) was similar in normal and neoplastic cells and reaction product was associated not only with tonofilaments but also lining membrane vesicles and on fine filaments in the cytoplasmic ground substance.
Holtrop, Jodi Summers; Potworowski, Georges; Fitzpatrick, Laurie; Kowalk, Amy; Green, Lee A
2016-08-15
Care management in primary care can be effective in helping patients with chronic disease improve their health status, however, primary care practices are often challenged with implementation. Further, there are different ways to structure care management that may make implementation more or less successful. Normalization process theory (NPT) provides a means of understanding how a new complex intervention can become routine (normalized) in practice. In this study, we used NPT to understand how care management structure affected how well care management became routine in practice. Data collection involved semi-structured interviews and observations conducted at 25 practices in five physician organizations in Michigan, USA. Practices were selected to reflect variation in physician organizations, type of care management program, and degree of normalization. Data were transcribed, qualitatively coded and analyzed, initially using an editing approach and then a template approach with NPT as a guiding framework. Seventy interviews and 25 observations were completed. Two key structures for care management organization emerged: practice-based care management where the care managers were embedded in the practice as part of the practice team; and centralized care management where the care managers worked independently of the practice work flow and was located outside the practice. There were differences in normalization of care management across practices. Practice-based care management was generally better normalized as compared to centralized care management. Differences in normalization were well explained by the NPT, and in particular the collective action construct. When care managers had multiple and flexible opportunities for communication (interactional workability), had the requisite knowledge, skills, and personal characteristics (skill set workability), and the organizational support and resources (contextual integration), a trusting professional relationship
International Nuclear Information System (INIS)
Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.
1975-01-01
Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin
Patterns of brain structural connectivity differentiate normal weight from overweight subjects.
Gupta, Arpana; Mayer, Emeran A; Sanmiguel, Claudia P; Van Horn, John D; Woodworth, Davis; Ellingson, Benjamin M; Fling, Connor; Love, Aubrey; Tillisch, Kirsten; Labus, Jennifer S
2015-01-01
Alterations in the hedonic component of ingestive behaviors have been implicated as a possible risk factor in the pathophysiology of overweight and obese individuals. Neuroimaging evidence from individuals with increasing body mass index suggests structural, functional, and neurochemical alterations in the extended reward network and associated networks. To apply a multivariate pattern analysis to distinguish normal weight and overweight subjects based on gray and white-matter measurements. Structural images (N = 120, overweight N = 63) and diffusion tensor images (DTI) (N = 60, overweight N = 30) were obtained from healthy control subjects. For the total sample the mean age for the overweight group (females = 32, males = 31) was 28.77 years (SD = 9.76) and for the normal weight group (females = 32, males = 25) was 27.13 years (SD = 9.62). Regional segmentation and parcellation of the brain images was performed using Freesurfer. Deterministic tractography was performed to measure the normalized fiber density between regions. A multivariate pattern analysis approach was used to examine whether brain measures can distinguish overweight from normal weight individuals. 1. White-matter classification: The classification algorithm, based on 2 signatures with 17 regional connections, achieved 97% accuracy in discriminating overweight individuals from normal weight individuals. For both brain signatures, greater connectivity as indexed by increased fiber density was observed in overweight compared to normal weight between the reward network regions and regions of the executive control, emotional arousal, and somatosensory networks. In contrast, the opposite pattern (decreased fiber density) was found between ventromedial prefrontal cortex and the anterior insula, and between thalamus and executive control network regions. 2. Gray-matter classification: The classification algorithm, based on 2 signatures with 42 morphological features, achieved 69
Patterns of brain structural connectivity differentiate normal weight from overweight subjects
Gupta, Arpana; Mayer, Emeran A.; Sanmiguel, Claudia P.; Van Horn, John D.; Woodworth, Davis; Ellingson, Benjamin M.; Fling, Connor; Love, Aubrey; Tillisch, Kirsten; Labus, Jennifer S.
2015-01-01
Background Alterations in the hedonic component of ingestive behaviors have been implicated as a possible risk factor in the pathophysiology of overweight and obese individuals. Neuroimaging evidence from individuals with increasing body mass index suggests structural, functional, and neurochemical alterations in the extended reward network and associated networks. Aim To apply a multivariate pattern analysis to distinguish normal weight and overweight subjects based on gray and white-matter measurements. Methods Structural images (N = 120, overweight N = 63) and diffusion tensor images (DTI) (N = 60, overweight N = 30) were obtained from healthy control subjects. For the total sample the mean age for the overweight group (females = 32, males = 31) was 28.77 years (SD = 9.76) and for the normal weight group (females = 32, males = 25) was 27.13 years (SD = 9.62). Regional segmentation and parcellation of the brain images was performed using Freesurfer. Deterministic tractography was performed to measure the normalized fiber density between regions. A multivariate pattern analysis approach was used to examine whether brain measures can distinguish overweight from normal weight individuals. Results 1. White-matter classification: The classification algorithm, based on 2 signatures with 17 regional connections, achieved 97% accuracy in discriminating overweight individuals from normal weight individuals. For both brain signatures, greater connectivity as indexed by increased fiber density was observed in overweight compared to normal weight between the reward network regions and regions of the executive control, emotional arousal, and somatosensory networks. In contrast, the opposite pattern (decreased fiber density) was found between ventromedial prefrontal cortex and the anterior insula, and between thalamus and executive control network regions. 2. Gray-matter classification: The classification algorithm, based on 2 signatures with 42
Genre, Andrea; Chabaud, Mireille; Timmers, Ton; Bonfante, Paola; Barker, David G.
2005-01-01
The penetration of arbuscular mycorrhizal (AM) fungi through the outermost root tissues of the host plant is a critical step in root colonization, ultimately leading to the establishment of this ecologically important endosymbiotic association. To evaluate the role played by the host plant during AM infection, we have studied in vivo cellular dynamics within Medicago truncatula root epidermal cells using green fluorescent protein labeling of both the plant cytoskeleton and the endoplasmic reticulum. Targeting roots with Gigaspora hyphae has revealed that, before infection, the epidermal cell assembles a transient intracellular structure with a novel cytoskeletal organization. Real-time monitoring suggests that this structure, designated the prepenetration apparatus (PPA), plays a central role in the elaboration of the apoplastic interface compartment through which the fungus grows when it penetrates the cell lumen. The importance of the PPA is underlined by the fact that M. truncatula dmi (for doesn't make infections) mutants fail to assemble this structure. Furthermore, PPA formation in the epidermis can be correlated with DMI-dependent transcriptional activation of the Medicago early nodulin gene ENOD11. These findings demonstrate how the host plant prepares and organizes AM infection of the root, and both the plant–fungal signaling mechanisms involved and the mechanistic parallels with Rhizobium infection in legume root hairs are discussed. PMID:16284314
Estimating structural equation models with non-normal variables by using transformations
Montfort, van K.; Mooijaart, A.; Meijerink, F.
2009-01-01
We discuss structural equation models for non-normal variables. In this situation the maximum likelihood and the generalized least-squares estimates of the model parameters can give incorrect estimates of the standard errors and the associated goodness-of-fit chi-squared statistics. If the sample
Stevens–Johnson syndrome/toxic epidermal necrolysis caused by cefadroxil in a cat
Directory of Open Access Journals (Sweden)
Roberta Sartori
2016-06-01
Full Text Available Case summary A 5-year-old, spayed female, indoor-only domestic shorthair cat was referred with an acute history of multifocal cutaneous and mucocutaneous erosive-ulcerative lesions and skin detachment. The lesions occurred on the seventh day of therapy with cefadroxil. Erosive-ulcerative and occasionally crusted lesions were apparent on the medial and lateral canthus of both eyes, ventral neck, abdomen, perivulvar region, periungual skin and medial aspect of the front and hindlimbs. Diffuse and severe exfoliation was present on the dorsum and tail base and in both external ear canals. The cat was also dehydrated, tachycardic and febrile. Histopathological examination revealed extensive epidermal ulceration, interface dermatitis with vacuolar degeneration, apoptosis at multiple epidermal levels and basal, suprabasal and spinous dermoepidermal detachment. The histopathological diagnosis was consistent with Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN. The recently reported Algorithm of Drug Causality in Epidermal Necrolysis (ALDEN, currently used in human medicine, was applied and a score of +6 was calculated; this supported the view that SJS/TEN in this cat was very likely to be associated with cefadroxil administration. Relevance and novel information This clinical communication reports cefadroxil as a very probable cause of SJS/TEN in a cat; the ALDEN was applied in this case and supported diagnosis.
Jian-Wei Zhang; Ashalata D'Rozario; Shi-Min Duan; Xi-Yong Wang; Xiao-Qing Liang; Bo-Rong Pan
2018-01-01
The taxonomical position of species of the genus Tamarix (Tamaricaceae) has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves), and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to ...
Optimization of hardening/softening behavior of plane frame structures using nonlinear normal modes
DEFF Research Database (Denmark)
Dou, Suguang; Jensen, Jakob Søndergaard
2016-01-01
Devices that exploit essential nonlinear behavior such as hardening/softening and inter-modal coupling effects are increasingly used in engineering and fundamental studies. Based on nonlinear normal modes, we present a gradient-based structural optimization method for tailoring the hardening...... involving plane frame structures where the hardening/softening behavior is qualitatively and quantitatively tuned by simple changes in the geometry of the structures....
International Nuclear Information System (INIS)
An Zhu; Shaeffer, James; Leslie, Susan; Kolm, Paul; El-Mahdi, Anas M.
1996-01-01
Purpose: To determine whether the expression of epidermal growth factor receptor (EGFR) protein was predictive of patient survival independently of other prognostic factors in astrocytic tumors. Methods and Materials: Epidermal growth factor receptor protein expression was investigated immunohistochemically in formalin-fixed, paraffin-embedded surgical specimens of 55 glioblastoma multiforme, 14 anaplastic astrocytoma, and 2 astrocytomas given definitive irradiation. We evaluated the relationship of EGFR protein expression and tumor grade, histologic features, age at diagnosis, sex, patient survival, and recurrence-free survival. Results: The percentage of tumor cells which were EGFR positive related to reduced survival by Cox regression analysis in both univariate (p = 0.0424) and multivariate analysis (p = 0.0016). Epidermal growth factor receptor positivity was the only 1 of 11 clinical and histological variables associated with decreased recurrence-free survival by either univariate (p = 0.0353) or multivariate (p = 0.0182) analysis. Epidermal growth factor receptor protein expression was not related to patient age, sex, or histologic features. Conclusion: Epidermal growth factor receptor positivity was a significant and independent prognostic indicator for overall survival and recurrence-free survival for irradiated patients with astrocytic gliomas
DEFF Research Database (Denmark)
Kriegbaum, Mette Camilla; Jacobsen, Benedikte; Füchtbauer, Annette
2016-01-01
of C4.4A in normal physiology and cancer progression. The unchallenged C4.4A-deficient mice were viable, fertile, born in a normal Mendelian distribution and, surprisingly, displayed normal development of squamous epithelia. The C4.4A-deficient mice were, nonetheless, significantly lighter than...
AUTOMATED ASSESSMENT OF EPIDERMAL THICKNESS AND VASCULAR DENSITY OF PORT WINE STAINS OCT IMAGE
Directory of Open Access Journals (Sweden)
CHENGMING WANG
2014-01-01
Full Text Available Optical coherence tomography (OCT enables in vivo imaging of port wine stains (PWS lesions. The knowledge of vascular structure and epidermal thickness (ET of PWS may aid the objective diagnosis and optimal treatment. To obtain the structural parameters more rapidly and avoid user intervention, an automated algorithm of energy map is introduced based on intensity and edge information to extract the skin surface using dynamic programming method. Subsequently, an averaged A-scan analysis is performed to obtain the mean ET and the relative intensity of dermis indicating the corresponding vascular density. This approach is currently successfully applied in clinical diagnosis and shows promising guidance and assessment of PDT treatment.
Do brain image databanks support understanding of normal ageing brain structure? A systematic review
International Nuclear Information System (INIS)
Dickie, David Alexander; Job, Dominic E.; Wardlaw, Joanna M.; Poole, Ian; Ahearn, Trevor S.; Staff, Roger T.; Murray, Alison D.
2012-01-01
To document accessible magnetic resonance (MR) brain images, metadata and statistical results from normal older subjects that may be used to improve diagnoses of dementia. We systematically reviewed published brain image databanks (print literature and Internet) concerned with normal ageing brain structure. From nine eligible databanks, there appeared to be 944 normal subjects aged ≥60 years. However, many subjects were in more than one databank and not all were fully representative of normal ageing clinical characteristics. Therefore, there were approximately 343 subjects aged ≥60 years with metadata representative of normal ageing, but only 98 subjects were openly accessible. No databank had the range of MR image sequences, e.g. T2*, fluid-attenuated inversion recovery (FLAIR), required to effectively characterise the features of brain ageing. No databank supported random subject retrieval; therefore, manual selection bias and errors may occur in studies that use these subjects as controls. Finally, no databank stored results from statistical analyses of its brain image and metadata that may be validated with analyses of further data. Brain image databanks require open access, more subjects, metadata, MR image sequences, searchability and statistical results to improve understanding of normal ageing brain structure and diagnoses of dementia. (orig.)
Directory of Open Access Journals (Sweden)
Hassan Riad
2013-10-01
Full Text Available A malignant transformation is known to occur in many nevi such as a sebaceous nevus or a basal cell nevus, but a verrucous epidermal nevus has only rarely been associated with neoplastic changes. Keratoacanthoma, multifocal papillary apocrine adenoma, multiple malignant eccrine poroma, basal cell carcinoma and cutaneous squamous cell carcinoma (CSCC have all been reported to develop from a verrucous epidermal nevus. CSCC has also been reported to arise from other nevoid lesions like a nevus comedonicus, porokeratosis, a sebaceous nevus, an oral sponge nevus and an ichthyosiform nevus with CHILD syndrome. Here we report a case of progressive poorly differentiated CSCC arising from a localized verrucous epidermal nevus, which caused both spinal cord and brain metastasis.
Extracorporeal Cardiopulmonary Resuscitation Among Patients with Structurally Normal Hearts.
Conrad, Stephanie J; Bridges, Brian C; Kalra, Yuvraj; Pietsch, John B; Smith, Andrew H
Extracorporeal cardiopulmonary resuscitation (eCPR) has been well described as a rescue therapy in refractory cardiac arrest among patients with congenital heart disease. The purpose of this retrospective analysis of data from the Extracorporeal Life Support Organization was to evaluate outcomes of eCPR in patients with structurally normal hearts and to identify risk factors that may contribute to mortality. During the study period, 1,431 patients met inclusion criteria. Median age was 16 years. Overall survival to hospital discharge was 32%. Conditional logistic regression demonstrated an independent survival benefit among smaller patients, patients with a lower partial pressure of carbon dioxide (PaCO2) on cannulation, and those with a shorter duration from intubation to eCPR cannulation. A diagnosis of sepsis was independently associated with a nearly threefold increase in odds of mortality, whereas the diagnosis of myocarditis portended a more favorable outcome. Neurologic complications, pulmonary hemorrhage, disseminated intravascular coagulation, CPR, pH less than 7.20, and hyperbilirubinemia after eCPR cannulation were independently associated with an increase in odds of mortality. When utilizing eCPR in patients with structurally normal hearts, a diagnosis of sepsis is independently associated with mortality, whereas a diagnosis of myocarditis is protective. Neurologic complications and pulmonary hemorrhage while on extracorporeal membrane oxygenation (ECMO) are independently associated with mortality.
Culture technique of rabbit primary epidermal keratinocytes
Directory of Open Access Journals (Sweden)
Marini M
2012-10-01
Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.
Optimal allocation of leaf epidermal area for gas exchange.
de Boer, Hugo J; Price, Charles A; Wagner-Cremer, Friederike; Dekker, Stefan C; Franks, Peter J; Veneklaas, Erik J
2016-06-01
A long-standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of diffusion and geometry based on the hypothesis that selection for higher anatomical maximum stomatal conductance (gsmax ) involves a trade-off to minimize the fraction of the epidermis that is allocated to stomata. Predicted allometric relationships between stomatal traits were tested with a comprehensive compilation of published and unpublished data on 1057 species from all major clades. In support of our theoretical framework, stomatal traits of this phylogenetically diverse sample reflect spatially optimal allometry that minimizes investment in the allocation of epidermal area when plants evolve towards higher gsmax . Our results specifically highlight that the stomatal morphology of angiosperms evolved along spatially optimal allometric relationships. We propose that the resulting wide range of viable stomatal trait combinations equips angiosperms with developmental and evolutionary flexibility in leaf gas exchange unrivalled by gymnosperms and pteridophytes. © 2016 The Authors New Phytologist © 2016 New Phytologist Trust.
Endoscopic mode for three-dimensional CT display of normal and pathologic laryngeal structures
International Nuclear Information System (INIS)
Sanuki, Tetsuji; Hyodo, Masamitsu; Yumoto, Eiji; Yasuhara, Yoshifumi; Ochi, Takashi
1997-01-01
The recent development of helical (spiral) computed tomography allows collection of volumetric data to obtain high quality three-dimensional (3D) reconstructed images. The authors applied the 3D CT endoscopic imaging technique to asses normal and pathologic laryngeal structures. The latter included trauma, vocal fold atrophy, cancer of the larynx and recurrent nerve palsy. This technique was able to show normal laryngeal structures and characteristic findings of each pathology. The 3D CT endoscopic images can be rotated around any axis, allowing optimal depiction of pathologic lesion. The use of 3D CT endoscopic technique provides the display of the location and extent of pathology and affords accurate therapeutic planning. (author)
Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang
2018-02-01
Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Inflammatory linear verrucous epidermal naevus: Report of three ...
African Journals Online (AJOL)
Background: Epidermal naevi are congenital harmatomas that arise from embryonal ectodermal cells. The inflammatory linear verrucous variant is rare and presents with disturbing symptoms. In blacks the classical erythema is not common but pruritus and discharge are the commonest features. Methods and results: We ...
Directory of Open Access Journals (Sweden)
Fernanda Bastos Segatto
2004-10-01
Full Text Available Embora a batata (Solanum tuberosum seja uma espécie de grande valor econômico, são poucas as informações disponíveis sobre a anatomia foliar, principalmente de características estruturais da epiderme. O estudo da anatomia foliar assume grande importância básica, para a ecologia e fisiologia, e aplicada para a fitopatologia e o melhoramento genético. Este trabalho teve por objetivo identificar uma técnica histológica que permite a confecção de lâminas semipermanentes para avaliar a epiderme foliar, em vista frontal, de um grande número de plantas de batata em um curto período de tempo. O corte paradérmico a mão livre, o método de Jeffrey e as técnicas de hidróxido de potássio e de impressão da epiderme foram avaliados. Lâminas semipermanentes foram confeccionadas da secção frontal da epiderme de folíolos principais do terço médio de plantas de batata. A impressão da epiderme em lâmina foi a única técnica que possibilitou a avaliação adequada de todos os clones de batata utilizados. A impressão da epiderme é uma técnica muito rápida, de baixo custo e de fácil execução, que atende os requisitos necessários para a identificação e seleção de características anatômicas de um grande número de plantas em um programa de melhoramento genético de batata.Even though potato (Solanum tuberosum is an economically important crop, information about leaf characteristics of anatomical structure has not been well studied. Studies of leaf epidermis have significance for basic fields as ecology and physiology and for applied fields as plant pathology and breeding. The objective of this research was to identify a fast and easy technique to prepare semi-permanent slides for studying the anatomy of potato leaf epidermis. Para dermal free hand cut, Jeffrey method, potassium hydroxide and epidermal fingerprint on glass slide techniques were evaluated. Semi-permanent slides were prepared from the longitudinal section of
Etanercept therapy for toxic epidermal necrolysis.
Paradisi, Andrea; Abeni, Damiano; Bergamo, Fabio; Ricci, Francesco; Didona, Dario; Didona, Biagio
2014-08-01
Toxic epidermal necrolysis (TEN) is a severe and potentially lethal drug reaction for which no standard treatment is available. To describe a case series of patients with TEN treated with a single dose of etanercept. We observed 10 consecutive patients with TEN. For each patient, we recorded the presence of comorbidities and all the drugs recently started (ie, in the last month). In all cases, 50 mg of etanercept was administered in a single subcutaneous injection. The clinical severity of disease was computed using the SCORe of Toxic Epidermal Necrosis (SCORTEN) scale. Using the probabilities of death linked to each level of SCORTEN score, we calculated the expected probability of death in our patients. Healing was defined as complete reepithelialization, and a time to healing curve was then obtained using the Kaplan-Meier method. All patients promptly responded to treatment, reaching complete reepithelialization without complications or side effects. The median time to healing was 8.5 days. This is a small, uncontrolled case series. These preliminary results suggest the possibility that tumor necrosis factor-alfa may be an effective target for control of TEN, a dangerous skin condition for which no effective cure has yet been found. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.
Assessment of the Developmental Toxicity of Epidermal Growth ...
African Journals Online (AJOL)
Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...
Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine
2018-01-01
The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
The epidermal biosynthesis of cholecalciferol (vitamin D3)
International Nuclear Information System (INIS)
Beadle, P.C.
1977-01-01
An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)
Genetics Home Reference: Stevens-Johnson syndrome/toxic epidermal necrolysis
... Hung SI. Recent advances in the genetics and immunology of Stevens-Johnson syndrome and toxic epidermal necrosis. ... 2012 May 29. Citation on PubMed or Free article on PubMed Central More from Genetics Home Reference ...
Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo
2014-10-15
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. Copyright © 2014 Elsevier Inc. All rights reserved.
Hussain, Amara Noor; Zafar, Muhammad; Ahmad, Mushtaq; Khan, Raees; Yaseen, Ghulam; Khan, Muhammad Saleem; Nazir, Abdul; Khan, Amir Muhammad; Shaheen, Shabnum
2018-05-01
Palynological features as well as comparative foliar epidermal using light and scanning electron microscope (SEM) of 17 species (10genera) of Amaranthaceae have been studied for its taxonomic significance. Different foliar and palynological micro-morphological characters were examined to explain their value in resolving the difficulty in identification. All species were amphistomatic but stomata on abaxial surface were more abundant. Taxonomically significant epidermal character including stomata type, trichomes (unicellular, multicellular, and capitate) and epidermal cells shapes (polygonal and irregular) were also observed. Pollens of this family are Polypantoporate, pores large, spheroidal, mesoporous region is sparsely to scabrate, densely psilate, and spinulose. All these characters can be active at species level for identification purpose. This study indicates that at different taxonomic levels, LM and SEM pollen and epidermal morphology is explanatory and significant to identify species and genera. © 2018 Wiley Periodicals, Inc.
Lindahl, Erik; Azuara, Cyril; Koehl, Patrice; Delarue, Marc
2006-07-01
Normal mode analysis (NMA) is an efficient way to study collective motions in biomolecules that bypasses the computational costs and many limitations associated with full dynamics simulations. The NOMAD-Ref web server presented here provides tools for online calculation of the normal modes of large molecules (up to 100,000 atoms) maintaining a full all-atom representation of their structures, as well as access to a number of programs that utilize these collective motions for deformation and refinement of biomolecular structures. Applications include the generation of sets of decoys with correct stereochemistry but arbitrary large amplitude movements, the quantification of the overlap between alternative conformations of a molecule, refinement of structures against experimental data, such as X-ray diffraction structure factors or Cryo-EM maps and optimization of docked complexes by modeling receptor/ligand flexibility through normal mode motions. The server can be accessed at the URL http://lorentz.immstr.pasteur.fr/nomad-ref.php.
HLA-B Sequencing in Patients with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis
2017-03-03
Stevens -Johnson Syndrome and Toxic Epidermal Necrolysis Brittany L. Lenz, MD, Andrew T. Patterson, MD, Amanda J . Laska, MD, Patrick J . Brown, MD, and...59 MDW/SGVU SUBJECT: Professional Presentation Approval 8 DEC 2016 1. Your paper, entitled HLA-B Sequencing in Patients with Stevens -Johnson...PATIENTS WITH STEVENS -JOHNSON SYNDROME AND TOXIC EPIDERMAL NECROL YSIS 2. FUNDING RECEIVED FOR THIS STUDY? DYES rgj NO FUNDING SOURCE: I I 3. IS THIS
Clinical Studies on conformal radiotherapy combined with epidermal ...
African Journals Online (AJOL)
Purpose: To study the effect of conformal radiotherapy combined with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in the second-line treatment of non-small cell lung cancer (NSCLC). Methods: A total of 316 patients attending Shanghai Pulmonary Hospital affiliated to Tongji University, were divided ...
Matsukuma, Shoichi; Yoshihara, Mitsuyo; Kasai, Fumio; Kato, Akinori; Yoshida, Akira; Akaike, Makoto; Kobayashi, Osamu; Nakayama, Haruhiko; Sakuma, Yuji; Yoshida, Tsutomu; Kameda, Yoichi; Tsuchiya, Eiju; Miyagi, Yohei
2006-01-01
A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. PMID:16931592
Percoco, Giuseppe; Merle, Chloé; Jaouen, Thomas; Ramdani, Yasmina; Bénard, Magalie; Hillion, Mélanie; Mijouin, Lily; Lati, Elian; Feuilloley, Marc; Lefeuvre, Luc; Driouich, Azeddine; Follet-Gueye, Marie-Laure
2013-12-01
The skin is a natural barrier between the body and the environment and is colonised by a large number of microorganisms. Here, we report a complete analysis of the response of human skin explants to microbial stimuli. Using this ex vivo model, we analysed at both the gene and protein level the response of epidermal cells to Staphylococcus epidermidis (S. epidermidis) and Pseudomonas fluorescens (P. fluorescens), which are present in the cutaneous microbiota. We showed that both bacterial species affect the structure of skin explants without penetrating the living epidermis. We showed by real-time quantitative polymerase chain reaction (qPCR) that S. epidermidis and P. fluorescens increased the levels of transcripts that encode antimicrobial peptides (AMPs), including human β defensin (hBD)2 and hBD3, and the pro-inflammatory cytokines interleukin (IL)-1α and (IL)-1-β, as well as IL-6. In addition, we analysed the effects of bacterial stimuli on the expression profiles of genes related to innate immunity and the inflammatory response across the epidermal layers, using laser capture microdissection (LCM) coupled to qPCR. We showed that AMP transcripts were principally upregulated in suprabasal keratinocytes. Conversely, the expression of pro-inflammatory cytokines was upregulated in the lower epidermis. These findings were confirmed by protein localisation using specific antibodies coupled to optical or electron microscopy. This work underscores the potential value of further studies that use LCM on human skin explants model to study the roles and effects of the epidermal microbiota on human skin physiology. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Epidermal growth factor receptor expression in urinary bladder cancer
Directory of Open Access Journals (Sweden)
Dayalu S.L. Naik
2011-01-01
Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.
Predicting human epidermal melanin concentrations for different skin tones
CSIR Research Space (South Africa)
Smit, Jacoba E
2011-07-01
Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...
Epidermal Nevus Syndrome Associated with Brain Malformations and Medulloblastoma
Directory of Open Access Journals (Sweden)
J Gordon Millichap
2013-01-01
Full Text Available Researchers at Juntendo University and Tokyo Women’s Medical University, Japan; and University of California, San Francisco, Ca, report a male infant with epidermal nevus syndrome associated with brainstem and cerebellar malformations and neonatal medulloblastoma.
Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.
Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K
2011-10-01
Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.
Taylor, Eric S; Pol-Fachin, Laercio; Lins, Roberto D; Lower, Steven K
2017-04-01
The epidermal growth factor receptor (EGFR) is an important transmembrane glycoprotein kinase involved the initiation or perpetuation of signal transduction cascades within cells. These processes occur after EGFR binds to a ligand [epidermal growth factor (EGF)], thus inducing its dimerization and tyrosine autophosphorylation. Previous publications have highlighted the importance of glycosylation and dimerization for promoting proper function of the receptor and conformation in membranes; however, the effects of these associations on the protein conformational stability have not yet been described. Molecular dynamics simulations were performed to characterize the conformational preferences of the monomeric and dimeric forms of the EGFR extracellular domain upon binding to EGF in the presence and absence of N-glycan moieties. Structural stability analyses revealed that EGF provides the most conformational stability to EGFR, followed by glycosylation and dimerization, respectively. The findings also support that EGF-EGFR binding takes place through a large-scale induced-fitting mechanism. Proteins 2017; 85:561-570. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Mahernia, Shabnam; Hassanzadeh, Malihe; Sharifi, Niusha; Mehravi, Bita; Paytam, Fariba; Adib, Mehdi; Amanlou, Massoud
2018-02-01
Cancer cells are described with features of uncontrolled growth, invasion and metastasis. The epidermal growth factor receptor subfamily of tyrosine kinases (EGFR-TK) plays a crucial regulatory role in the control of cellular proliferation and progression of various cancers. Therefore, its inhibition might lead to the discovery of a new generation of anticancer drugs. In the present study, structure-based pharmacophore modeling, molecular docking and molecular dynamics simulations were applied to identify potential hits, which exhibited good inhibition on the proliferation of MCF-7 breast cancer cell line and favorable binding interactions on EGFR-TK. Selected compounds were examined for their anticancer activity against the Michigan Cancer Foundation-7 (MCF-7) breast cancer cell line which overexpresses EGFR using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) tetrazolium reduction assay. Compounds 1 and 2, with an isoindoline-1-one core, induced significant inhibition of breast cancer cells proliferation with IC[Formula: see text] values 327 and 370 nM, respectively.
Retrospective Study of Epidermal Parasitic Skin Diseases amongst ...
African Journals Online (AJOL)
ADOWIE PERE
ABSTRACT: A ten year retrospective study (1997-2006) was undertaken to determine the prevalence of. Epidermal Parasitic Skin Diseases (EPSD) among out-patients from the skin diseases hospital in Maiduguri, Borno state. Out of 10,000 out-patients examined during the study period, 3527(35.27%) where infected with ...
TGM5 mutations impact epidermal differentiation in acral peeling skin syndrome.
Pigors, Manuela; Kiritsi, Dimitra; Cobzaru, Cristina; Schwieger-Briel, Agnes; Suárez, Jose; Faletra, Flavio; Aho, Heikki; Mäkelä, Leeni; Kern, Johannes S; Bruckner-Tuderman, Leena; Has, Cristina
2012-10-01
Acral peeling skin syndrome (APSS) is an autosomal recessive skin disorder characterized by acral blistering and peeling of the outermost layers of the epidermis. It is caused by mutations in the gene for transglutaminase 5, TGM5. Here, we report on clinical and molecular findings in 11 patients and extend the TGM5 mutation database by four, to our knowledge, previously unreported mutations: p.M1T, p.L41P, p.L214CfsX15, and p.S604IfsX9. The recurrent mutation p.G113C was found in 9 patients, but also in 3 of 100 control individuals in a heterozygous state, indicating that APSS might be more widespread than hitherto expected. Using quantitative real-time PCR, immunoblotting, and immunofluorescence analysis, we demonstrate that expression and distribution of several epidermal differentiation markers and corneodesmosin (CDSN) is altered in APSS keratinocytes and skin. Although the expression of transglutaminases 1 and 3 was not changed, we found an upregulation of keratin 1, keratin 10, involucrin, loricrin, and CDSN, probably as compensatory mechanisms for stabilization of the epidermal barrier. Our results give insights into the consequences of TGM5 mutations on terminal epidermal differentiation.
Epidermal growth factor and lung development in the offspring of the diabetic rat
DEFF Research Database (Denmark)
Thulesen, J; Poulsen, Steen Seier; Nexø, Ebba
2000-01-01
Fetuses of diabetic mothers who were exposed to excessive glucose show delayed maturation. Under these conditions, altered growth factor expression or signaling may have important regulatory influences. We examined the role of epidermal growth factor (EGF) in lung development and maternal diabetes...... in the rat. In order to evaluate the possible role of glucose for the expression of EGF and the growth of lung tissue, we performed in vitro studies with organotypic cultures of fetal alveolar cells obtained from control rats. Compared to pups of normal rats, the newborn rats of untreated diabetic rats had...... and was associated with a reduced intensity of surfactant protein A-IR. The only difference observed between pups of treated diabetic rats and controls was a decrease in the lung weight:body weight ratio. In organotypic cultures, the presence of 13 mmol/L glucose in the cell media increased immunoreactive staining...
Autodegradation of 125I-labeled human epidermal cell surface proteins
International Nuclear Information System (INIS)
Hashimoto, K.; Singer, K.H.; Lazarus, G.S.
1982-01-01
Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)
DEFF Research Database (Denmark)
Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure
2003-01-01
alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...
Bhardwaj, Supriya; Rani, Seema; Srivastava, Niharika; Kumar, Ravinder; Parsad, Davinder
2017-03-01
Non-segmental vitiligo (NSV) results from autoimmune destruction of melanocytes. The altered levels of various cytokines have been proposed in the pathogenesis of vitiligo. However, the exact immune mechanisms have not yet been fully elucidated. To investigate the role of epidermal and systemic cytokines in active and stable NSV patients. Serum levels of inflammatory cytokines were checked in 42 active and 30 stable NSV patients with 30 controls. The lesional, perilesional and normal skin sections were subjected to H&E staining. The mRNA expression of inflammatory cytokines and their respective receptors were assessed by quantitative PCR in lesional skin of both active and stable NSV skin. The MITF and IL-17A were immunolocalized in lesional, perilesional and normal skin tissue. Significant increase in the expression of inflammatory cytokines, IL-17A, IL-1β and TGF-β was observed in active patients, whereas no change was observed in stable patients. A marked reduction in epidermal thickness was observed in lesional skin sections. Significant increase in IL-17A and significant decrease in microphthalmia associated transcription factor (MITF) expression was observed in lesional and perilesional skin sections. Moreover, qPCR analysis showed significant alterations in the mRNA levels of IL-17A, IL-1β, IFN-γ, TGF-β and their respective receptors in active and stable vitiligo patient samples. Increased levels of IL-17A and IL-1β cytokines and decreased expression of MITF suggested a possible role of these cytokines in dysregulation of melanocytic activity in the lesional skin and hence might be responsible for the progression of active vitiligo. Copyright © 2016 Elsevier Ltd. All rights reserved.
Jayalakshmy, P S; Subitha, K; Priya, P V; Johnson, Gerald
2012-05-01
Epidermal cyst is a very common benign cystic lesion of the skin. It is usual to find ulceration of the lining epithelium, rupture of the cyst wall with chronic inflammation and foreign body giant cell reaction. But, it is very rare to see an epidermal cyst with marked accumulation of melanin pigment. Only a few cases of pigmented epidermal cyst with dense collection of melanin pigment have been published in the literature. Here, we are reporting a case of ruptured epidermal cyst with keratin granuloma formation and showing dense collection of melanin pigment.
Tsai, Chang-Ru; Anderson, Aimee E; Burra, Sirisha; Jo, Juyeon; Galko, Michael J
2017-07-01
Yorkie (Yki), the transcriptional co-activator of the Hippo signaling pathway, has well-characterized roles in balancing apoptosis and cell division during organ growth control. Yki is also required in diverse tissue regenerative contexts. In most cases this requirement reflects its well-characterized roles in balancing apoptosis and cell division. Whether Yki has repair functions outside of the control of cell proliferation, death, and growth is not clear. Here we show that Yki and Scalloped (Sd) are required for epidermal wound closure in the Drosophila larval epidermis. Using a GFP-tagged Yki transgene we show that Yki transiently translocates to some epidermal nuclei upon wounding. Genetic analysis strongly suggests that Yki interacts with the known wound healing pathway, Jun N-terminal kinase (JNK), but not with Platelet Derived Growth Factor/Vascular-Endothelial Growth Factor receptor (Pvr). Yki likely acts downstream of or parallel to JNK signaling and does not appear to regulate either proliferation or apoptosis in the larval epidermis during wound repair. Analysis of actin structures after wounding suggests that Yki and Sd promote wound closure through actin regulation. In sum, we found that Yki regulates an epithelial tissue repair process independently of its previously documented roles in balancing proliferation and apoptosis. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Wakshull, E.; Kraemer, P.M.; Wharton, W.
1985-01-01
Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells
Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.
Crawford, Melissa; Dagnino, Lina
2017-10-02
The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.
High-gradient normal-conducting RF structures for muon cooling channels
International Nuclear Information System (INIS)
Corlett, J.N.; Green, M.A.; Hartman, N.; Ladran, A.; Li, D.; MacGill, R.; Rimmer, R.; Moretti, A.; Jurgens, T.; Holtkamp, N.; Black, E.; Summers, D.; Booke, M.
2001-01-01
We present a status report on the research and development of high-gradient normal-conducting RF structures for the ionization cooling of muons in a neutrino factory or muon collider. High-gradient RF structures are required in regions enclosed in strong focusing solenoidal magnets, precluding the application of superconducting RF technology [1]. We propose using linear accelerating structures, with individual cells electromagnetically isolated, to achieve the required gradients of over 15 MV/m at 201 MHz and 30 MV/m at 805 MHz. Each cell will be powered independently, and cell length and drive phase adjusted to optimize shunt impedance of the assembled structure. This efficient design allows for relatively small field enhancement on the structure walls, and an accelerating field approximately 1.7 times greater than the peak surface field. The electromagnetic boundary of each cell may be provided by a thin Be sheet, or an assembly of thin-walled metal tubes. Use of thin, low-Z materials will allow passage of the muon beams without significant deterioration in beam quality due to scattering. R and D in design and analysis of robust structures that will operate under large electric and magnetic fields and RF current heating are discussed, including the experimental program based in a high-power test laboratory developed for this purpose
The under-appreciated promiscuity of the epidermal growth factor receptor family.
Directory of Open Access Journals (Sweden)
Sean P Kennedy
2016-08-01
Full Text Available Each member of the epidermal growth factor receptor (EGFR family plays a key role in normal development, homeostasis and a variety of pathophysiological conditions, most notably in cancer. According to the prevailing dogma, these four receptor tyrosine kinases (RTKs; EGFR, ERBB2, ERBB3 and ERBB4 function exclusively through the formation of homodimers and heterodimers within the EGFR family. These combinatorial receptor interactions are known to generate increased interactome diversity and therefore influence signalling output, subcellular localization and function of the heterodimer. This molecular plasticity is also thought to play a role in the development of resistance towards targeted cancer therapies aimed at these known oncogenes. Interestingly, many studies now challenge this dogma and suggest that the potential for EGFR family receptors to interact with more distantly related RTKs is much greater than currently appreciated. Here we discuss how the promiscuity of these oncogenic receptors may lead to the formation of many unexpected receptor pairings and the significant implications for the efficiency of many targeted cancer therapies.
Radiologic Findings of Epidermal Cysts in the Trunk
International Nuclear Information System (INIS)
Kim, Myung Hyun; Chung, Jae Joon; Park, Kyoung Seuk; Park, Su Mi
2005-01-01
To evaluate the ultrasonographic (US) or computer tomography (CT) findings of surgically proven epidermal cysts in the trunk, and to compare the echogenicity of cysts with internal contents. Forty-five patients were retrospectively evaluated. US and CT findings of epidermal cysts were assessed in regard to location, size, shape, number, echogenicity, posterior sound enhancement, internal density, septa, mural nodule and calcification, perilesional infiltration, contrast enhancement, and internal contents. All 45 patients (M:F=29:16; US in 26, CT in 19) had only one cyst, and they were located in the buttocks (n=19), back (n=13), inguinal (n=4), posterior neck (n=3), perineum (n=2), abdominal wall (n=2), presternal (n=1), and axilla (n=1). Of 26 patients who underwent US, there were 8 cases of homogeneously hypoechoic mass (30.8%), 8 of inhomogeneously hypoechoic mass (30.8%), 7 of homogeneously hypoechoic mass with internal hypoechoic lines and echogenic spots (26.9%) and 3 of homogeneously hypoechoic mass with internal echogenic spots (11.5%). Posterior sound enhancement was noted in 21 patients (80.8%). Of 19 patients who underwent CT, there were 14 cases of simple cyst (73.7%) and 5 of abscess-like lesion (26.3%). Overlying skin thickening (n=13), contrast enhancement of cystic wall (n=11), perilesional infiltration (n=7), and internal septa (n=6) were demonstrated. The internal contents of the cysts were keratinous (n=27, 60.0%) or greasy (n=15, 33.3%) material. There was no statistical significance between the echogenicity of the cysts and the internal contents (p > 0.2). Epidermal cysts showed homogeneous or inhomogeneous hypoechoic mass with posterior sound enhancement on US. There was no relationship between the echogenicity of the cysts and the internal contents. In the case of ruptured cyst, an abscess-like lesion with wall enhancement and perilesional infiltration was noted on CT scan
Identification of grazed grasses using epidermal characters | R ...
African Journals Online (AJOL)
The use of anatomical features of the abaxial epidermis of grasses is discussed for the identification of fragments of epidermis present in samples of rumen. The reliability of this technique, and the variation of the epidermal characters in two widely distributed species of grass, is given. A "Key" to identity certain genera of ...
Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus
Directory of Open Access Journals (Sweden)
Naser Tayyebi Meibodi
2011-01-01
Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.
Irradiation of protoporphyric mice induces down-regulation of epidermal eicosanoid metabolism
International Nuclear Information System (INIS)
He, D.; Lim, H.W.
1991-01-01
This study investigated the effect of radiation on clinical and histologic changes, and on cutaneous eicosanoid metabolism, in Skh:HR-1 hairless albino mice rendered protoporphyric by the administration of collidine. At 0.1-18 h after exposure to 12 kJ/m2 of 396-406 nm irradiation, thicknesses of back skin and ears were measured, and histologic changes were evaluated by using hematoxylin and eosin (H-E) and Giemsa's stains. Activities of eicosanoid-metabolizing enzymes in epidermal and dermal homogenates were assessed by incubating the tissue homogenates with 3H-AA, followed by quantitation of the eicosanoids generated by radio-TLC. In irradiated protoporphyric mice, an increase of back-skin thickness was noted at 0.1 h, reaching a peak at 18 h, whereas maximal increase in ear thickness was observed at 12 h. Histologic changes included dermal edema, increased mast cell degranulation, and mononuclear cells in the dermis. In these irradiated protoporphyric animals, generations of 6 keto-PGF1a, PGF2a, PGE2, PGD2, and HETE by epidermal eicosanoid-metabolizing enzymes were markedly suppressed at all the timepoints studied. Dermal eicosanoid-metabolizing enzymes of irradiated protoporphyric mice generated increased amounts of PGE2 and HETE at 18 h, probably reflecting the presence of dermal cellular infiltrates. The suppression of the activities of epidermal eicosanoid-metabolizing enzymes was prevented by intraperitoneal injection of WR-2721, a sulfhydryl group generator, prior to irradiation, suggesting that the suppression was secondary to photo-oxidative damage of the enzymes during the in vivo phototoxic response. These results suggest that the effect of protoporphyrin and radiation on cutaneous eicosanoid metabolism in this animal model in vivo is that of a down regulation of the activities of epidermal eicosanoid-metabolizing enzymes
Chaudhuri, R K; Bojanowski, K
2017-10-01
The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Directory of Open Access Journals (Sweden)
Christley Scott
2010-08-01
Full Text Available Abstract Background Simulation of sophisticated biological models requires considerable computational power. These models typically integrate together numerous biological phenomena such as spatially-explicit heterogeneous cells, cell-cell interactions, cell-environment interactions and intracellular gene networks. The recent advent of programming for graphical processing units (GPU opens up the possibility of developing more integrative, detailed and predictive biological models while at the same time decreasing the computational cost to simulate those models. Results We construct a 3D model of epidermal development and provide a set of GPU algorithms that executes significantly faster than sequential central processing unit (CPU code. We provide a parallel implementation of the subcellular element method for individual cells residing in a lattice-free spatial environment. Each cell in our epidermal model includes an internal gene network, which integrates cellular interaction of Notch signaling together with environmental interaction of basement membrane adhesion, to specify cellular state and behaviors such as growth and division. We take a pedagogical approach to describing how modeling methods are efficiently implemented on the GPU including memory layout of data structures and functional decomposition. We discuss various programmatic issues and provide a set of design guidelines for GPU programming that are instructive to avoid common pitfalls as well as to extract performance from the GPU architecture. Conclusions We demonstrate that GPU algorithms represent a significant technological advance for the simulation of complex biological models. We further demonstrate with our epidermal model that the integration of multiple complex modeling methods for heterogeneous multicellular biological processes is both feasible and computationally tractable using this new technology. We hope that the provided algorithms and source code will be a
Pérez-Gutiérrez, J F; Argüelles, J C; Iglesias-Núñez, M; Oliveira, K S; De La Muela, M Sánchez
2011-07-01
To perform a histological and immunohistochemical study of epidermal growth factor, transforming growth factor-alpha and their receptor, as well as the apoptotic signal active caspase-3 in the levator ani muscle of dogs with and without perineal hernia. Biopsy specimens of the levator ani muscle were obtained from 25 dogs with perineal hernia and 4 non-affected dogs and were processed for Masson and immunohistochemical staining. The affected dogs exhibited myopathological features, internalised nuclei, destruction and abnormal size of muscle fibres, which were replaced by collagen. The immunohistochemical study revealed active caspase-3, epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor in the levator ani. Compared to the healthy muscle, transforming growth factor-alpha staining intensity was lower in the affected muscle, whereas epidermal growth factor receptor and active caspase-3 staining were higher. Pelvic diaphragm muscle weakening is the leading cause of perineal hernia in the dog. Survival and death signals expressed in these muscles may contribute to the pathogenesis of this disease. This study reports epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor immunohistochemical expression in the skeletal muscle and suggests that perineal hernia in the dog is accompanied by levator ani muscle atrophy, increased expression of epidermal growth factor receptor, caspase-3 activation, and decreased expression of transforming growth factor-alpha. © 2011 British Small Animal Veterinary Association.
Morphometric analysis of epidermal differentiation in primary roots of Zea mays
Moore, R.; Smith, H. S.
1990-01-01
Epidermal differentiation in primary roots of Zea mays was divided into six cell types based on cellular shape and cytoplasmic appearance. These six cell types are: 1) apical protoderm, located at the tip of the root pole and characterized by periclinally flattened cells; 2) cuboidal protoderm, located approximately 230 microns from the root pole and characterized by cuboidal cells; 3) tabular epidermis, located approximately 450 microns from the root pole and characterized by anticlinally flattened cells; 4) cuboidal epidermis, located approximately 900 microns from the root pole and characterized by cuboidal cells having numerous small vacuoles; 5) vacuolate cuboidal epidermis, located approximately 1,500 microns from the root pole and characterized by cuboidal cells containing several large vacuoles; and 6) columnar epidermis, located approximately 2,200 microns from the root pole (i.e., at the beginning of the zone of elongation) and characterized by elongated cells. We also used stereology to quantify the cellular changes associated with epidermal differentiation. The quiescent center and the apical protoderm have significantly different ultrastructures. The relative volume of dictyosomes increases dramatically during the early stages of epidermal differentiation. This increase correlates inversely with the amount of coverage provided by the root cap and mucilage.
Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.
Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C
2017-05-01
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.
Normal CT measurement of sellar and juxtasellar structures
International Nuclear Information System (INIS)
Kim, Bo Hyun; Chung, Jin Wook; Han, Moon Hee; Chang, Kee Hyun
1988-01-01
The thorough knowledge of precise anatomy of the sellar, parasellar and suprasellar regions and of normal computed tomographic (CT) features in those areas are very important because there are many tiny but essential structures in which pathology makes only minute changes and so meticulous investigations are required. We performed direct coronal thin section CT scan of sellar and juxtasellar regions in 58 cases in order to evaluate normal CT features such as CT densities, shapes and sizes of normal sellar and juxtasellar structures. The results obtained are as follows: 1.The CT densities of pituitary glands were 87 ± 23 in anterior lobe and 69 ± 22 in posterior lobe. The latter was significantly less dense than the former. Posterior lobes could be identified as oval low density area in sagittal reconstruction in 18/58 (31%). Mean pituitary height was 6.5 ± 1.5mm. In young females of childbearing age, mean height was 7.0 ± 1.7mm. Upper margins of pituitary glands were flat in 29 cases (50%), upward convex in 16 cases (28%), and upward concave in 13 cases (22%). Upper margins of pituitary glands were upward convex in 8/15 (53%) of young female of childbearing age. Pituitary densities were homogeneous in 36 cases (77%) and heterogeneous in 7 cases (15%), and 4 cases (7%) show focal pituitary low density that is greater than 3mm in diameter. 2.Moderate to severe degree of cisternal herniation was found in 10 cases (17%): only 1 case before the age of 30, and 9 cases after the age of 30. 3.The lateral margins of cavernous sinus were bilaterally flat in 42 cases (72%), bilaterally convex in 3 cases (5%), unilaterally convex in 12 cases (21%), and unilaterally concave only in 1 case (2%). The third cranial nerves were found as symmetric filling defects in superolateral aspect of anterior cavernous sinus in most of the cases, the maximal size of which was 2.7 ± 0.9mm in diameter and did not exceed 3.5mm. The other cranial nerves were less frequently identified as
Directory of Open Access Journals (Sweden)
H Ishida
2009-12-01
Full Text Available The degree of DNA-instability as revealed by immunohistochemical staining with anti-cytidine antibody after acid hydrolysis (DNA-instability test has been recently used as a marker of malignancy. This technique was applied to examine 17 skin tissue samples of Bowen’s disease, 47 of actinic keratosis, 15 of squamous cell carcinoma, 5 of seborrheic keratosis, and 10 of normal skin. All benign neoplastic cells of seborrheic keratosis and normal epidermal cells were negative. On the other hand, all cancer cells were positive with the DNA-instability test, indicating their malignancy, but all basal cells in Bowen’s disease were completely negative. Compatible with this result, the basal cells in Bowen’s disease were characteristically normal as evident in other histochemical examinations. Thus, they were negative with p53 immunohistochemistry, with normal signals of chromosome 17 in situ hybridisation and argyrophilic nucleolar organiser region, and showed slightly enhanced proliferative activity as revealed by proliferating cell nuclear antigen immunohistochemistry. Immunohistochemical staining with 34 ß E12 (monoclonal antibody against cytokeratins 1, 5, 10, and 14, which stains all normal epidermal keratinocytes including basal cells, showed that only the basal cells of Bowen’s disease stained strongly and homogeneously, while all cancer cells in the upper layers of Bowen’s disease and all layers of actinic keratosis were only sporadically or weakly stained. Staining with 34 ß B4 (monoclonal antibody against cytokeratin 1, which recognises the whole epidermis except for the basal layer in the normal epidermis, showed that the basal cells in the Bowen’s disease were completely negative, and lower layer cells in the actinic keratosis and upper layer cells in Bowen’s disease were only sporadically stained positive, although the superficial layer cells in actinic keratosis stained strongly and homogeneously. Our findings clearly
Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst
2013-02-01
Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.
Pattern of hormone receptors and human epidermal growth factor ...
African Journals Online (AJOL)
Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...
Enhancement of intestinal growth in neonatal rats by epidermal growth factor in milk
International Nuclear Information System (INIS)
Berseth, C.L.
1987-01-01
Breast milk has been shown to enhance neonatal intestinal growth. Because epidermal growth factor (EGF) is present in the milk of various mammalian species, the hypothesis was tested that EGF in rodent milk mediates, in part, the breast milk-enhanced intestinal growth in neonatal rat. Fifty-eight rat pups fed artificial formal that contained 1.2, 3.0, and 6.0 μg/ml EGF for 39 h had greater incorporation of [ 3 H]thymidine into DNA and DNA content of intestine than 29 pups fed unsupplemented formula. Pups fed EGF for 5 days had significantly greater body weight, intestinal weight, length, and DNA content than control pups. Conversely, pups fed pooled rat milk containing rabbit-derived antibody to EGF for 39 h had intestines of lower weight that contained less DNA than animals fed rat milk containing normal rabbit serum. EGF appears to mediate, in part, breast milk-enhanced neonatal intestinal growth
International Nuclear Information System (INIS)
Nelson, Gail M.; Ahlborn, Gene J.; Delker, Don A.; Kitchin, Kirk T.; O'Brien, Thomas G.; Chen Yan; Kohan, Michael J.; Roop, Barbara C.; Ward, William O.; Allen, James W.
2007-01-01
Chronic arsenic exposure in humans is associated with cancers of the skin, lung, bladder and other tissues. There is evidence that folate deficiency may increase susceptibility to arsenic effects, including skin lesions. K6/ODC mice develop skin tumors when exposed to 10 ppm sodium arsenite for 5 months. In the current study, K6/ODC mice maintained on either a folate deficient or folate sufficient diet were exposed to 0, 1, or 10 ppm sodium arsenite in the drinking water for 30 days. Total RNA was isolated from skin samples and gene expression analyzed using Affymetrix Mouse 430 2.0 GeneChips. Data from 24 samples, with 4 mice in each of the 6 treatment groups, were RMA normalized and analyzed by two-way ANOVA using GeneSpring TM . Top gene ontology (GO) categories for genes responding significantly to both arsenic treatment and folate deficiency include nucleotide metabolism and cell organization and biogenesis. For many of these genes, folate deficiency magnifies the response to arsenic treatment. In particular, expression of markers of epidermal differentiation, e.g., loricrin, small proline rich proteins and involucrin, was significantly reduced by arsenic in the folate sufficient animals, and reduced further or at a lower arsenic dose in the folate deficient animals. In addition, expression of a number of epidermal cell growth/proliferation genes and cellular movement genes was altered. These results indicate that arsenic disrupts the normal balance of cell proliferation and differentiation, and that folate deficiency exacerbates these effects, consistent with the view that folate deficiency is a nutritional susceptibility factor for arsenic-induced skin tumorigenesis
Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors
Cai, Yichen
2017-06-16
Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.
Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors
Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen
2017-01-01
Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.
Genética Molecular das Epidermólises Bolhosas Molecular Genetics of Epidermolysis Bullosa
Directory of Open Access Journals (Sweden)
Hiram Larangeira de Almeida Jr
2002-10-01
Full Text Available O estudo das alterações moleculares das epidermólises bolhosas tem contribuído para que se compreenda melhor essas enfermidades. Na epidermólise bolhosa simples a maioria dos casos está associada com alteração nas citoqueratinas basais 5 (gen KRT5 e 14 (gen KRT14, o que modifica o citoesqueleto na camada basal da epiderme, levando à degeneração dessa camada, formando bolha intra-epidérmica. Mutações na plectina (gen PLEC1, componente da placa interna do hemidesmossoma, levam também à clivagem intra-epidérmica. Na epidermólise bolhosa juncional vários gens estão envolvidos, em decorrência da complexidade da zona da membrana basal, todos levando ao descolamento dos queratinócitos basais na lâmina lúcida, pela disfunção da aderência entre esses e a lâmina densa. Alterações na laminina 5 (gens LAMA3, LAMB3 e LAMC2, integrina alfa6beta4 (gens ITGA6 e ITGB4 e colágeno XVII (gen COL17A1 foram descritas. Por fim, na epidermólise bolhosa distrófica apenas um gen está mutado, alterando o colágeno VII (gen COL7A1, principal componente das fibrilas ancorantes, produzindo clivagem abaixo da lâmina densa, variando fenotipicamente de acordo com a conseqüência da mutação. Outra aplicação importante dessas informações refere-se ao diagnóstico pré-natal, com a perspectiva no futuro da terapia gênica.New data regarding the molecular aspects of the heterogeneous group of epidermolysis bullosa has brought some important information about its pathogenesis. In epidermolysis bullosa simplex the majority of mutations are localized in the genes of the basal cytokeratin 5 (gene KRT5 and 14 (gene KRT14, cytolysis at this layer with intraepidermal blister is seen under light microscopy. Mutations of plectin (gene PLEC1, a protein found in the inner hemidesmosomal plaque, leads also to intraepidermal blisters. In junctional epidermolysis bullosa many proteins from the basal membrane zone are involved, such as laminin 5 (genes
Correlation of human epidermal growth factor receptor protein expression and colorectal cancer.
Yang, Wen-Juan; Shen, Xing-Jie; Ma, Xiao-Xia; Tan, Zhi-Gang; Song, Yan; Guo, Yi-Tong; Yuan, Mei
2015-07-28
To investigate the correlation between human epidermal growth factor receptor (HER-2) protein expression and colorectal cancer (CRC) using a case-control study and meta-analysis. Tumor tissue specimens from 162 CRC patients were selected for the case group. Fifty cases were randomly selected, and normal CRC tissue at least 10 cm away from the tumor margins of these cases was used to generate the control group. The expression of the HER-2 protein in the 162 CRC tissue samples and the 50 adjacent normal mucosa tissue samples was detected via immunohistochemistry. The experimental data were analyzed using SPSS 18.0 software, and R software version 3.1.0 was utilized for further verification. The expression of HER-2 protein in the 162 CRC tissue samples was significantly higher than in the normal tissue specimens. The data showed that the expression of HER-2 in CRC was related to the Dukes' stage, the depth of invasion and lymph node metastasis. The HER-2-positive patients had lower 3- and 5-year OS rates than the HER-2-negative patients, but there was no significant difference. However, there was a statistically significant difference in the 3- and 5-year disease-free survival (DFS) rates of HER-2-positive and HER-2-negative patients. The results of the meta-analysis showed that the expression of HER-2 in CRC patients was statistically significantly increased over that of healthy people. The 3-year DFS rate in HER-2-positive patients was markedly lower than that in HER-2-negative patients. Down-regulation of HER-2 expression might be a dependable strategy for CRC therapy.
In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells
DEFF Research Database (Denmark)
Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K
2003-01-01
In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...
Inferring network structure in non-normal and mixed discrete-continuous genomic data.
Bhadra, Anindya; Rao, Arvind; Baladandayuthapani, Veerabhadran
2018-03-01
Inferring dependence structure through undirected graphs is crucial for uncovering the major modes of multivariate interaction among high-dimensional genomic markers that are potentially associated with cancer. Traditionally, conditional independence has been studied using sparse Gaussian graphical models for continuous data and sparse Ising models for discrete data. However, there are two clear situations when these approaches are inadequate. The first occurs when the data are continuous but display non-normal marginal behavior such as heavy tails or skewness, rendering an assumption of normality inappropriate. The second occurs when a part of the data is ordinal or discrete (e.g., presence or absence of a mutation) and the other part is continuous (e.g., expression levels of genes or proteins). In this case, the existing Bayesian approaches typically employ a latent variable framework for the discrete part that precludes inferring conditional independence among the data that are actually observed. The current article overcomes these two challenges in a unified framework using Gaussian scale mixtures. Our framework is able to handle continuous data that are not normal and data that are of mixed continuous and discrete nature, while still being able to infer a sparse conditional sign independence structure among the observed data. Extensive performance comparison in simulations with alternative techniques and an analysis of a real cancer genomics data set demonstrate the effectiveness of the proposed approach. © 2017, The International Biometric Society.
Bruckert, G; Vivien, D; Docagne, F; Roussel, B D
2016-04-01
Reverse transcription quantitative-polymerase chain reaction (RT-qPCR) has become a routine method in many laboratories. Normalization of data from experimental conditions is critical for data processing and is usually achieved by the use of a single reference gene. Nevertheless, as pointed by the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines, several reference genes should be used for reliable normalization. Ageing is a physiological process that results in a decline of many expressed genes. Reliable normalization of RT-qPCR data becomes crucial when studying ageing. Here, we propose a RT-qPCR study from four mouse brain regions (cortex, hippocampus, striatum and cerebellum) at different ages (from 8 weeks to 22 months) in which we studied the expression of nine commonly used reference genes. With the use of two different algorithms, we found that all brain structures need at least two genes for a good normalization step. We propose specific pairs of gene for efficient data normalization in the four brain regions studied. These results underline the importance of reliable reference genes for specific brain regions in ageing.
International Nuclear Information System (INIS)
Jin, Sun Hee; Choi, Dalwoong; Chun, Young-Jin; Noh, Minsoo
2014-01-01
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to
Energy Technology Data Exchange (ETDEWEB)
Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)
2014-10-15
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to
Integrating normal and abnormal personality structure: a proposal for DSM-V.
Widiger, Thomas A
2011-06-01
The personality disorders section of the American Psychiatric Association's fifth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-V) is currently being developed. The purpose of the current paper is to encourage the authors of DSM-V to integrate normal and abnormal personality structure within a common, integrative model, and to suggest that the optimal choice for such an integration would be the five-factor model (FFM) of general personality structure. A proposal for the classification of personality disorder from the perspective of the FFM is provided. Discussed as well are implications and issues associated with an FFM of personality disorder, including validity, coverage, feasibility, clinical utility, and treatment implications.
Growth of normal or irradiated vaginal epithelium in in vivo cultures
International Nuclear Information System (INIS)
Tileva, M.
1975-01-01
Growth of normal or irradiated vaginal epithelium was studied by the method of F.M.Lazarenko (1959). Pieces of vaginal mucosa from immature albino rats, normal or exposed to 1000 or 2000 R, were embedded in celloidin and implanted into the abdominal wall of female immature rats. Implants were recovered for histological examinations from day 1 to day 10 after surgery. At day 1 post implantation, vaginal epithelium was found to have dedifferentiated. Cells showed a high mitotic index (MI = 16.2%). Cell proliferation progressed further to attain a peak rate at 3 days (MI = 32.7%). At 5 days, newly formed structures began to differentiate, and concurrently manifested a gradual decrease in cell proliferative activity (at 10 days, MI = 15.6%). Following exposure to 1000 R, vaginal epithelium displayed a similar pattern of growth and differentiation, the only difference from non-irradiated epithelium being that there was a transient mitotic delay over the first 3 days; mitotic rates reached a peak at 5 days (MI = 47.0%), were still high at 7 days (MI = 31.3%), and fell to 19% at 10 days. With this longer proliferation period, newly formed structures appeared ''luxuriant''. After a dose of 2000 R, vaginal epithelium failed to show any signs of growth at all investigated time intervals. These data are in agreement with evidence obtained by K.M.Svetikova (1961) and L.I.Chekulaeva (1969, 1974) for a good restitutional ability of epithelia of epidermal origin following exposure to 1200 R X-rays. By Warren' rule (1944), i.e., that cells should be considered radiosensitive if severely damaged by less than 2500 R, vaginal epithelium cells may be designated as relatively susceptible to radiation. (author)
Normal variation in early parental sensitivity predicts child structural brain development.
Kok, Rianne; Thijssen, Sandra; Bakermans-Kranenburg, Marian J; Jaddoe, Vincent W V; Verhulst, Frank C; White, Tonya; van IJzendoorn, Marinus H; Tiemeier, Henning
2015-10-01
Early caregiving can have an impact on brain structure and function in children. The influence of extreme caregiving experiences has been demonstrated, but studies on the influence of normal variation in parenting quality are scarce. Moreover, no studies to date have included the role of both maternal and paternal sensitivity in child brain maturation. This study examined the prospective relation between mothers' and fathers' sensitive caregiving in early childhood and brain structure later in childhood. Participants were enrolled in a population-based prenatal cohort. For 191 families, maternal and paternal sensitivity was repeatedly observed when the child was between 1 year and 4 years of age. Head circumference was assessed at 6 weeks, and brain structure was assessed using magnetic resonance imaging (MRI) measurements at 8 years of age. Higher levels of parental sensitivity in early childhood were associated with larger total brain volume (adjusted β = 0.15, p = .01) and gray matter volume (adjusted β = 0.16, p = .01) at 8 years, controlling for infant head size. Higher levels of maternal sensitivity in early childhood were associated with a larger gray matter volume (adjusted β = 0.13, p = .04) at 8 years, independent of infant head circumference. Associations with maternal versus paternal sensitivity were not significantly different. Normal variation in caregiving quality is related to markers of more optimal brain development in children. The results illustrate the important role of both mothers and fathers in child brain development. Copyright © 2015 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.
Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan
2010-01-01
This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed
Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung
2013-01-01
Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...
Epidermal response of rainbow trout to Ichthyobodo necator
DEFF Research Database (Denmark)
Chettri, Jiwan Kumar; Kuhn, Jesper Andreas; Mohammad, Rezkar Jaafar
2014-01-01
Infections with the parasitic flagellate Ichthyobodo necator (Henneguy, 1883) cause severe skin and gill disease in rainbow trout Oncorhynchus mykiss (Walbaum, 1792) juveniles. The epidermal disturbances including hyperplasia and mucous cell exhaustion caused by parasitization are known, but no d...
Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion
DEFF Research Database (Denmark)
Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore
2009-01-01
BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...
Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C
2013-06-01
In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Directory of Open Access Journals (Sweden)
Yen-Hsi Liu
2010-09-01
Conclusions: Both aerobic and anaerobic microorganisms were present in the inflamed epidermal cysts, although the anaerobic bacteria, specifically, Propionibacterium spp and Peptostreptococcus spp, were isolated slightly more frequently. Antibiotics directed against anaerobes may be considered in the treatment regimen for inflamed epidermal cysts.
Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel
2006-08-01
Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer
Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells
Directory of Open Access Journals (Sweden)
Raj Victor
2011-08-01
Full Text Available Abstract Cyprinid herpesvirus 3 (CyHV-3 is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry.
Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells
2011-01-01
Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry. PMID:21816061
Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.
Bolívar-Flores, Y J; Kuri-Harcuch, W
1999-08-01
Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.
Retinoic acid modulation of ultraviolet light-induced epidermal ornithine decarboxylase activity
International Nuclear Information System (INIS)
Lowe, N.J.; Breeding, J.
1982-01-01
Irradiation of skin with ultraviolet light of sunburn range (UVB) leads to a large and rapid induction of the polyamine biosynthetic enzyme ornithine decarboxylase in the epidermis. Induction of epidermal ornithine decarboxylase also occurs following application of the tumor promoting agent 12-0-tetradecanoylphorbol-13 acetate and topical retinoic acid is able to block both this ornithine decarboxylase induction and skin tumor promotion. In the studies described below, topical application of retinoic acid to hairless mouse skin leads to a significant inhibition of UVB-induced epidermal ornithine decarboxylase activity. The degree of this inhibition was dependent on the dose, timing, and frequency of the application of retinoic acid. To show significant inhibition of UVB-induced ornithine decarboxylase the retinoic acid had to be applied within 5 hr of UVB irradiation. If retinoic acid treatment was delayed beyond 7 hr following UVB, then no inhibition of UVB-induced ornithine decarboxylase was observed. The quantities of retinoic acid used (1.7 nmol and 3.4 nmol) have been shown effective at inhibiting 12-0-tetradecanoyl phorbol-13 acetate induced ornithine decarboxylase. The results show that these concentrations of topical retinoic acid applied either before or immediately following UVB irradiation reduces the UVB induction of epidermal ornithine decarboxylase. The effect of retinoic acid in these regimens on UVB-induced skin carcinogenesis is currently under study
Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques
2015-06-01
Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.
Grafting of human epidermal cells, presence and perspectives
Czech Academy of Sciences Publication Activity Database
Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.
2001-01-01
Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry
Davydyan, Garri
2015-12-01
The evolution of biologic systems (BS) includes functional mechanisms that in some conditions may lead to the development of cancer. Using mathematical group theory and matrix analysis, previously, it was shown that normally functioning BS are steady functional structures regulated by three basis regulatory components: reciprocal links (RL), negative feedback (NFB) and positive feedback (PFB). Together, they form an integrative unit maintaining system's autonomy and functional stability. It is proposed that phylogenetic development of different species is implemented by the splitting of "rudimentary" characters into two relatively independent functional parts that become encoded in chromosomes. The functional correlate of splitting mechanisms is RL. Inversion of phylogenetic mechanisms during ontogenetic development leads cell differentiation until cells reach mature states. Deterioration of reciprocal structure in the genome during ontogenesis gives rise of pathological conditions characterized by unsteadiness of the system. Uncontrollable cell proliferation and invasive cell growth are the leading features of the functional outcomes of malfunctioning systems. The regulatory element responsible for these changes is RL. In matrix language, pathological regulation is represented by matrices having positive values of diagonal elements ( TrA > 0) and also positive values of matrix determinant ( detA > 0). Regulatory structures of that kind can be obtained if the negative entry of the matrix corresponding to RL is replaced with the positive one. To describe not only normal but also pathological states of BS, a unit matrix should be added to the basis matrices representing RL, NFB and PFB. A mathematical structure corresponding to the set of these four basis functional patterns (matrices) is a split quaternion (coquaternion). The structure and specific role of basis elements comprising four-dimensional linear space of split quaternions help to understand what
Topical Application of Glycolipids from Isochrysis galbana Prevents Epidermal Hyperplasia in Mice
Directory of Open Access Journals (Sweden)
Azahara Rodríguez-Luna
2017-12-01
Full Text Available Chronic inflammatory skin diseases such as psoriasis have a significant impact on society. Currently, the major topical treatments have many side effects, making their continued use in patients difficult. Microalgae have emerged as a source of bio-active molecules such as glycolipids with potent anti-inflammatory properties. We aimed to investigate the effects of a glycolipid (MGMG-A and a glycolipid fraction (MGDG obtained from the microalga Isochrysis galbana on a TPA-induced epidermal hyperplasia murine model. In a first set of experiments, we examined the preventive effects of MGMG-A and MGDG dissolved in acetone on TPA-induced hyperplasia model in mice. In a second step, we performed an in vivo permeability study by using rhodamine-containing cream, ointment, or gel to determinate the formulation that preserves the skin architecture and reaches deeper. The selected formulation was assayed to ensure the stability and enhanced permeation properties of the samples in an ex vivo experiment. Finally, MGDG-containing cream was assessed in the hyperplasia murine model. The results showed that pre-treatment with acetone-dissolved glycolipids reduced skin edema, epidermal thickness, and pro-inflammatory cytokine production (TNF-α, IL-1β, IL-6, IL-17 in epidermal tissue. The in vivo and ex vivo permeation studies showed that the cream formulation had the best permeability profile. In the same way, MGDG-cream formulation showed better permeation than acetone-dissolved preparation. MGDG-cream application attenuated TPA-induced skin edema, improved histopathological features, and showed a reduction of the inflammatory cell infiltrate. In addition, this formulation inhibited epidermal expression of COX-2 in a similar way to dexamethasone. Our results suggest that an MGDG-containing cream could be an emerging therapeutic strategy for the treatment of inflammatory skin pathologies such as psoriasis.
International Nuclear Information System (INIS)
Chen, Xiaorui; Lu, Mingyang; Poon, Billy K.; Wang, Qinghua; Ma, Jianpeng
2009-01-01
The structural model of the unliganded and fully glycosylated simian immunodeficiency virus gp120 core determined to 4.0 Å resolution was substantially improved using a recently developed normal-mode-based anisotropic B-factor refinement method. The envelope protein gp120/gp41 of simian and human immunodeficiency viruses plays a critical role in viral entry into host cells. However, the extraordinarily high structural flexibility and heavy glycosylation of the protein have presented enormous difficulties in the pursuit of high-resolution structural investigation of some of its conformational states. An unliganded and fully glycosylated gp120 core structure was recently determined to 4.0 Å resolution. The rather low data-to-parameter ratio limited refinement efforts in the original structure determination. In this work, refinement of this gp120 core structure was carried out using a normal-mode-based refinement method that has been shown in previous studies to be effective in improving models of a supramolecular complex at 3.42 Å resolution and of a membrane protein at 3.2 Å resolution. By using only the first four nonzero lowest-frequency normal modes to construct the anisotropic thermal parameters, combined with manual adjustments and standard positional refinement using REFMAC5, the structural model of the gp120 core was significantly improved in many aspects, including substantial decreases in R factors, better fitting of several flexible regions in electron-density maps, the addition of five new sugar rings at four glycan chains and an excellent correlation of the B-factor distribution with known structural flexibility. These results further underscore the effectiveness of this normal-mode-based method in improving models of protein and nonprotein components in low-resolution X-ray structures
Tumores dermóides e epidermóides intra-espinhas
Directory of Open Access Journals (Sweden)
Oscar Fontenelle Filho
1971-03-01
Full Text Available São relatados dois casos de tumores epidermóides e um de tumor dermóide, todos intrarraquianos. Este último era de localização epidural ao nível da coluna torácica (caso 3; os dois tumores epidermóides situavam-se na coluna tóraco-lombar (caso 1 e lombar (caso 2, respectivamente, sendo o primeiro intramedular e o segundo intradural. Em dois casos (casos 2 e 3 os tumores associavam-se a fístula dérmica congênita. Um paciente (caso 3 foi operado aos dois meses de idade; a descoberta do tumor deveu-se à realização da raquimanometria que revelou bloqueio, apesar do paciente não apresentar qualquer sinal neurológico de compressão medular. Os autores são de opinião que, em presença de fístula dérmica congênita ao nível da coluna vertebral, principalmente quando localizada acima do segmento lombosacro, deve-se sempre suspeitar da possibilidade do tumor epidermóide ou dermóide intrarraquiano, mesmo na ausência de sinais neurológicos. A combinação de sintomas neurológicos de longa duração, a evidência radiológica de erosão e alargamento do canal raquiano e a história de fístula dérmica congênita proporcionaram o diagnóstico pré-operatório correto no caso 2.
Role of submandibular saliva and epidermal growth factor in gastric cytoprotection
DEFF Research Database (Denmark)
Poulsen, Steen Seier
1984-01-01
without submandibular glands. Exogenous EGF and saliva with a high but still physiological concentration of EGF significantly reduced the median area in the stomach displaying ulcers and ulcerations, whereas saliva without EGF had no effect. Although EGF is a known inhibitor of gastric acid secretion......The role of submandibular epidermal growth factor in protection of the gastric mucosa was investigated in rats. Removal of the submandibular glands and thereby submandibular epidermal growth factor (EGF) caused rats to develop gastric lesions (ulcerations and ulcers) after administration......, the dose used in the present study had no effect on gastric acid secretion in chronic gastric fistula rats; removal of the submandibular glands also did not have any such effect. We conclude that exocrine secretion of submandibular EGF has a cytoprotective function in the stomach, an effect that may...
Lakshmanan, J; Landel, C P
1986-07-01
We examined long-term effects of neonatal hyperthyroidism on salivary secretions of nerve growth factor and epidermal growth factor in male and female mice at the age of 31 days. Hyperthyroidism was induced by thyroxine (T4) injections (0.4 microgram/g body weight/day) during days 0-6. Littermate control mice were treated with vehicle. T4 treatment did not alter the amounts of protein secreted into saliva but hormone administration induced alteration in the types of protein secreted. T4 treatment decreased the contents of both nerve growth factor and epidermal growth factor secreted into the saliva. A Sephadex G-200 column chromatographic profile revealed the presence of two distinct nerve growth factor immunoreactive peaks, while epidermal growth factor immunoreactivity predominantly eluted as a single low molecular weight form. T4 treatment did not alter the molecular nature of their secretion, but the treatment decreased their contents. These results indicate an impairment in salivary secretion of nerve growth factor and epidermal growth factor long after T4 treatment has been discontinued.
Epidermal hydration levels in rosacea patients improve after minocycline therapy.
LENUS (Irish Health Repository)
Ní Raghallaigh, S
2013-12-06
Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.
Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour
International Nuclear Information System (INIS)
Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.
1996-01-01
Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)
Energy Technology Data Exchange (ETDEWEB)
Nickoloff, B.J.; Griffiths, E.M.; Baadsgaard, O.; Voorhees, J.J.; Hanson, C.A.; Cooper, K.D. (Univ. of Michigan Medical Center, Ann Arbor (USA))
1989-04-21
In mucosis fungoides the malignant T cells express lymphocyte function-associated antigen-1, which allows them to bind to epidermal keratinocytes expressing the gamma interferon-inducible intercellular adhesion molecule-1. In this report, a patient with leukemic-stage mucosis fungoides (Sezary syndrome) had widespread erythematous dermal infiltrates containing malignant T cells, but without any epidermotropism. The authors discovered that the T cells expressed normal amounts of functional lymphocyte function-associated antigen-1, but the keratinocytes did not express significant levels of intercellular adhesion molecule-1, which was probably due to the inability of the malignant T cells to produce gamma interferon. These results support the concept that the inability of malignant T cells to enter the epidermis may contribute to emergence of more clinically aggressive T-cell clones that are no longer confined to the skin, but infiltrate the blood, lymph nodes, and viscera, as is seen in Sezary syndrome.
Carbon isotope ratios of epidermal and mesophyll tissues from leaves of C3 and CAM plants
International Nuclear Information System (INIS)
Nishida, K.; Roksandic, Z.; Osmond, B.
1981-01-01
The δ 13 C values for epidermal and mesophyll tissues of two C 3 plants, Commelina communis and Tulipa gesneriana, and a CAM plant, Kalanchoē daigremontiana, were measured. The values for the tissues of both C 3 plants were similar. In young leaves of Kalanchoē, the epidermis and the mesophyll showed S 13 C values which were nearly identical, and similar to those found in C 3 plants. However, markedly more negative values for epidermal compared to mesophyll tissue, were obtained in the mature Kalanchoē leaf. This is consistent with the facts that the epidermis in a CAM leaf is formed when leaves engage in C 3 photosynthesis and that subsequent dark CO 2 fixation in guard cells or mesophyll cells makes only a small contribution to total epidermal carbon
Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji
2016-01-01
To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.
Comparing of Normal Stress Distribution in Static and Dynamic Soil-Structure Interaction Analyses
International Nuclear Information System (INIS)
Kholdebarin, Alireza; Massumi, Ali; Davoodi, Mohammad; Tabatabaiefar, Hamid Reza
2008-01-01
It is important to consider the vertical component of earthquake loading and inertia force in soil-structure interaction analyses. In most circumstances, design engineers are primarily concerned about the analysis of behavior of foundations subjected to earthquake-induced forces transmitted from the bedrock. In this research, a single rigid foundation with designated geometrical parameters located on sandy-clay soil has been modeled in FLAC software with Finite Different Method and subjected to three different vertical components of earthquake records. In these cases, it is important to evaluate effect of footing on underlying soil and to consider normal stress in soil with and without footing. The distribution of normal stress under the footing in static and dynamic states has been studied and compared. This Comparison indicated that, increasing in normal stress under the footing caused by vertical component of ground excitations, has decreased dynamic vertical settlement in comparison with static state
Tunnell, J W; Nelson, J S; Torres, J H; Anvari, B
2000-01-01
Higher laser fluences than currently used in therapy (5-10 J/cm(2)) are expected to result in more effective treatment of port wine stain (PWS) birthmarks. However, higher incident fluences increase the risk of epidermal damage caused by absorption of light by melanin. Cryogen spray cooling offers an effective method to reduce epidermal injury during laser irradiation. The objective of this study was to determine whether high laser incident fluences (15-30 J/cm(2)) could be used while still protecting the epidermis in ex vivo human skin samples. Non-PWS skin from a human cadaver was irradiated with a Candela ScleroPlus Laser (lambda = 585 nm; pulse duration = 1.5 msec) by using various incident fluences (8-30 J/cm(2)) without and with cryogen spray cooling (refrigerant R-134a; spurt durations: 40-250 msec). Assessment of epidermal damage was based on histologic analysis. Relatively short spurt durations (40-100 msec) protected the epidermis for laser incident fluences comparable to current therapeutic levels (8-10 J/cm(2)). However, longer spurt durations (100-250 msec) increased the fluence threshold for epidermal damage by a factor of three (up to 30 J/cm(2)) in these ex vivo samples. Results of this ex vivo study show that epidermal protection from high laser incident fluences can be achieved by increasing the cryogen spurt duration immediately before pulsed laser exposure. Copyright 2000 Wiley-Liss, Inc.
Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation
M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)
1997-01-01
textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were
Metabolic epidermal necrosis in two dogs with different underlying diseases.
Bond, R; McNeil, P E; Evans, H; Srebernik, N
1995-05-06
Two dogs with metabolic epidermal necrosis had hyperkeratosis of the footpads accompanied by erythematous, erosive and crusting lesions affecting the muzzle, external genitalia, perineum and periocular regions. Histopathological examination of skin biopsies revealed a superficial hydropic dermatitis with marked parakeratosis. Both dogs had high plasma activities of alkaline phosphatase and alanine aminotransferase and high concentrations of glucose, and also a marked hypoaminoacidaemia. Despite these similarities, the cutaneous eruptions were associated with different underlying diseases. One dog had a pancreatic carcinoma which had metastasised widely; the primary tumour and the metastases showed glucagon immunoreactivity on immunocytochemical staining, and the dog's plasma glucagon concentration was markedly greater than that of control dogs. The other dog had diffuse hepatic disease; its plasma glucagon concentration was similar to that of control samples and cirrhosis was identified post mortem. Metabolic epidermal necrosis in dogs is a distinct cutaneous reaction pattern which may be associated with different underlying systemic diseases; however, the pathogenesis of the skin lesions remains unclear.
The immigration delay disease: adermatoglyphia-inherited absence of epidermal ridges.
Burger, Bettina; Fuchs, Dana; Sprecher, Eli; Itin, Peter
2011-05-01
In the digital age, personal identification by fingerprints (epidermal ridges) has become more frequent and is often required for biometric passports. The more fingerprints are analyzed, the more variants in their formation are documented. Individuals completely missing fingerprints as an isolated finding are extremely rare. Only 4 kindreds have been described to date, with additional clinical features in most cases. We describe a female patient with missing epidermal ridges on the fingers, palms, toes, and soles as an isolated feature. Absent fingerprints, or adermatoglyphia, were inherited over 4 generations of her family in an autosomal dominant fashion. We present the clinical features of the index patient, and compare the case with previous reports in the literature. Because of problems in personal identification, this embryologic malformation caused the patient significant difficulties when traveling to other countries, which is why we name it the immigration delay disease. Copyright © 2009 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.
Immunohistochemical localization of epidermal growth factor in rat and man
DEFF Research Database (Denmark)
Poulsen, Steen Seier; Nexø, Ebba
1986-01-01
Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...
Wang, Xuelin; Zhang, Yuxin; Guo, Rui; Wang, Hongzhang; Yuan, Bo; Liu, Jing
2018-03-01
Conformable epidermal printed electronics enabled from gallium-based liquid metals (LMs), highly conductive and low-melting-point alloys, are proposed as the core to achieving immediate contact between skin surface and electrodes, which can avoid the skin deformation often caused by conventional rigid electrodes. When measuring signals, LMs can eliminate resonance problems with shorter time to reach steady state than Pt and gelled Pt electrodes. By comparing the contact resistance under different working conditions, it is demonstrated that both ex vivo and in vivo LM electrode-skin models have the virtues of direct and immediate contact with skin surface without the deformation encountered with conventional rigid electrodes. In addition, electrocardio electrodes composed of conformable LM printed epidermal electronics are adopted as smart devices to monitor electrocardiogram signals of rabbits. Furthermore, simulation treatment for smart defibrillation offers a feasible way to demonstrate the effect of liquid metal electrodes (LMEs) on the human body with less energy loss. The remarkable features of soft epidermal LMEs such as high conformability, good conductivity, better signal stability, and fine biocompatibility represent a critical step towards accurate medical monitoring and future smart treatments.
Seo, Min-Duk; Kang, Tae Jin; Lee, Chang Hoon; Lee, Ai-Young; Noh, Minsoo
2012-01-01
HaCaT cells are the immortalized human keratinocytes and have been extensively used to study the epidermal homeostasis and its pathophysiology. T helper cells play a role in various chronic dermatological conditions and they can affect skin barrier homeostasis. To evaluate whether HaCaT cells can be used as a model cell system to study abnormal skin barrier development in various dermatologic diseases, we analyzed the gene expression profile of epidermal differentiation markers of HaCaT cells in response to major T helper (Th) cell cytokines, such as IFNγ, IL-4, IL-17A and IL-22. The gene transcriptional profile of cornified envelope-associated proteins, such as filaggrin, loricrin, involucrin and keratin 10 (KRT10), in HaCaT cells was generally different from that in normal human keratinocytes (NHKs). This suggests that HaCaT cells have a limitation as a model system to study the pathophysiological mechanism associated with the Th cell cytokine-dependent changes in cornified envelope-associated proteins which are essential for normal skin barrier development. In contrast, the gene transcription profile change of human β2-defensin (HBD2) in response to IFNγ, IL-4 or IL-17A in HaCaT cells was consistent with the expression pattern of NHKs. IFNγ also up-regulated transglutaminase 2 (TGM2) gene transcription in both HaCaT cells and NHKs. As an alternative cell culture system for NHKs, HaCaT cells can be used to study molecular mechanisms associated with abnormal HBD2 and TGM2 expression in response to IFNγ, IL-4 or IL-17A. PMID:24116291
Directory of Open Access Journals (Sweden)
Jung-Hwan Lee
Full Text Available The aim of this study is to investigate the effects of cold atmospheric pressure plasma (CAP-induced radicals on the epidermal growth factor receptor (EGFR, which is overexpressed by oral squamous cell carcinoma, to determine the underlying mechanism of selective killing. CAP-induced highly reactive radicals were observed in both plasma plume and cell culture media. The selective killing effect was observed in oral squamous cell carcinoma compared with normal human gingival fibroblast. Degradation and dysfunction of EGFRs were observed only in the EGFR-overexpressing oral squamous cell carcinoma and not in the normal cell. Nitric oxide scavenger pretreatment in cell culture media before CAP treatment rescued above degradation and dysfunction of the EGFR as well as the killing effect in oral squamous cell carcinoma. CAP may be a promising cancer treatment method by inducing EGFR dysfunction in EGFR-overexpressing oral squamous cell carcinoma via nitric oxide radicals.
Lee, Jung-Hwan; Om, Ji-Yeon; Kim, Yong-Hee; Kim, Kwang-Mahn; Choi, Eun-Ha; Kim, Kyoung-Nam
2016-01-01
The aim of this study is to investigate the effects of cold atmospheric pressure plasma (CAP)-induced radicals on the epidermal growth factor receptor (EGFR), which is overexpressed by oral squamous cell carcinoma, to determine the underlying mechanism of selective killing. CAP-induced highly reactive radicals were observed in both plasma plume and cell culture media. The selective killing effect was observed in oral squamous cell carcinoma compared with normal human gingival fibroblast. Degradation and dysfunction of EGFRs were observed only in the EGFR-overexpressing oral squamous cell carcinoma and not in the normal cell. Nitric oxide scavenger pretreatment in cell culture media before CAP treatment rescued above degradation and dysfunction of the EGFR as well as the killing effect in oral squamous cell carcinoma. CAP may be a promising cancer treatment method by inducing EGFR dysfunction in EGFR-overexpressing oral squamous cell carcinoma via nitric oxide radicals.
Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)
International Nuclear Information System (INIS)
Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.
1997-01-01
This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist
Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes
Laporta, Robert F.; Taichman, Lorne B.
1982-06-01
Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.
International Nuclear Information System (INIS)
Plevova, P.
2002-01-01
Background. Ionising radiation and cytostatic agents used in cancer therapy exert damaging effects on normal tissues and induce a complex response at the cellular and molecular levels. Cytokines and adhesion molecules are involved in this response. Methods. Published data on the given topic have been reviewed. Results and conclusions. Various cytokines and adhesion molecules, including tumor necrosis factor α, interleukins- 1,-2,-4, and -6, interferon γ, granulocyte macrophage- and macrophage- colony stimulating factors, transforming growth factor β, platelet-derived growth factor, insulin-like growth factor I, fibroblast and epidermal growth factors, platelet-activating factor, intercellular adhesion molecule-1, vascular cell adhesion molecule-1, E- and P-selectins are involved in the response of normal tissues to ionizing radiation- and chemotherapy- induced normal tissues damage and are co-responsible for some side effects of these treatment modalities, including fever, anorexia and fatigue, suppression of hematopoiesis, both acute and late local tissue response. (author)
DEFF Research Database (Denmark)
Mellergaard, Stig; Nielsen, Else
1997-01-01
and the disease prevalence in the present case, the disease pattern showed evident similarities with formerly described oxygen deficiency-induced outbreaks of lymphocystis and epidermal papilloma in dab in the Kattegat. In 1988, the prevalence of lymphocystis and epidermal papilloma increased significantly...
Precaval retropancreatic space: Normal anatomy
Energy Technology Data Exchange (ETDEWEB)
Lee, Yeon Hee; Kim, Ki Whang; Kim, Myung Jin; Yoo, Hyung Sik; Lee, Jong Tae [Yonsei University College of Medicine, Seoul (Korea, Republic of)
1992-07-15
The authors defined precaval retropancreatic space as the space between pancreatic head with portal vein and IVC and analyzed the CT findings of this space to know the normal structures and size in this space. We evaluated 100 cases of normal abdominal CT scan to find out normal anatomic structures of precaval retropancreatic space retrospectively. We also measured the distance between these structures and calculated the minimum, maximum and mean values. At the splenoportal confluence level, normal structures between portal vein and IVC were vessel (21%), lymph node (19%), and caudate lobe of liver (2%) in order of frequency. The maximum AP diameter of portocaval lymph node was 4 mm. Common bile duct (CBD) was seen in 44% and the diameter was mean 3 mm and maximum 11 mm. CBD was located in extrapancreatic (75%) and lateral (60.6%) to pancreatic head. At IVC-left renal vein level, the maximum distance between CBD and IVC was 5 mm and the structure between posterior pancreatic surface and IVC was only fat tissue. Knowledge of these normal structures and measurement will be helpful in differentiating pancreatic mass with retropancreatic mass such as lymphadenopathy.
Directory of Open Access Journals (Sweden)
Suvash Chandra Paul
2018-05-01
Full Text Available This study compares the properties of normal and recycled brick aggregates to produce a medium range (25–30 MPa compressive strength of structural grade concrete. Up to date, brick aggregates are commonly used in structural concrete in some South Asian and African countries. Many concrete structures which were built in the last century are made from brick aggregates and some of them are already in a position of ending of their service life. At the same time, population and economic growth is forcing the demolition of many old structures. Therefore, there is a huge flow of construction and demolition waste and thereby it is necessary to recycle the waste to overcome the problem of occupying the landfill sites. For this study, recycled brick aggregates were collected from the various demolished building sites and their physical and mechanical performance were then compared with the concrete made from normal brick aggregates. It is found that the mechanical properties of recycled brick concrete are comparable to that of normal brick aggregate at medium strength level. The production cost of recycled brick concrete is also found to be 10–12% lower than normal brick aggregates.
Epidermal nevus syndrome associated with unusual neurological, ocular, and skeletal features
Directory of Open Access Journals (Sweden)
Reena Sharma
2012-01-01
Full Text Available Epidermal nevus syndrome (ENS is a rare disease, the pathogenesis of which is largely elusive. We, hereby, report an exclusive case of a 20-year-old man with verrucous ENS presented with dark colored papules and plaques along the Blaschko′s lines present over the head and neck area along with fleshy growth in both eyes since birth. Limb length discrepancy and kyphoscoliosis were remarkable. Skin biopsy was compatible with verrucous epidermal nevus while the biopsy of the ocular lesion confirmed complex choristoma. MRI brain revealed calcification in the right temporal lobe. Bilateral arachnoid cyst in the middle cranial fossa, scleral osteoma in the posterior part of the right eyeball, and deformed calvarium were evident on CECT skull and orbit. The present illustration emphasizes the importance of a punctilious work up of the case.
99m Tc-anti-epidermal growth factor receptor nanobody for tumor imaging.
Piramoon, Majid; Hosseinimehr, Seyed Jalal; Omidfar, Kobra; Noaparast, Zohreh; Abedi, Seyed Mohammad
2017-04-01
Nanobodies are important biomolecules for tumor targeting. In this study, we synthesized and labeled anti-epidermal growth factor receptor (EGFR) nanobody OA-cb6 with 99m Tc(CO) 3 + and evaluated its characteristics for targeting the EGFR in the A431 human epidermal carcinoma cell line. Nanobody radiolabeling was achieved with high yield and radiochemical purity, and the radioconjugate was stable. Biodistribution results in nude mice exhibited a favorable tumor-to-muscle ratio at 4-hr postinjection, and tumor location was visualized at 4 hr after injection of radiolabeled nanobody. Our result showed that the OA-cb6- 99m Tc-tricarbonyl radiolabeled nanobody is a promising radiolabeled biomolecule for tumor imaging in cancers with high EGFR overexpression. © 2016 John Wiley & Sons A/S.
An immunologic approach to induction of epidermal growth factor deficiency
DEFF Research Database (Denmark)
Raaberg, Lasse; Nexø, Ebba; Poulsen, Steen Seier
1995-01-01
Epidermal growth factor (EGF) in pharmacologic doses is able to induce growth and development in the fetus and the newborn. To investigate the opposite situation, the effects of insufficient amounts of EGF during development, we wanted to establish an in vivo model with a state of EGF deficiency....
Antibody-induced dimerization activates the epidermal growth factor receptor tyrosine kinase
Spaargaren, M.; Defize, L. H.; Boonstra, J.; de Laat, S. W.
1991-01-01
The relationship between epidermal growth factor receptor (EGF-R) protein tyrosine kinase activation and ligand-induced receptor dimerization was investigated using several bivalent anti-EGF-R antibodies directed against various receptor epitopes. In A431 membrane preparations and permeabilized
DEFF Research Database (Denmark)
Boone, Marc; Draye, Jean Pierre; Verween, Gunther
2014-01-01
While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decell......While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting...... before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo......-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found...
International Nuclear Information System (INIS)
Huang, L.H.; Cheng, H.; Sweeney, W.V.; Pardi, A.; Tam, J.P.
1991-01-01
Factor IX is a blood clotting protein that contains three regions, including a γ-carboxyglutamic acid (Gla) domain, two tandemly connected epidermal growth factor like (EGF-like) domains, and a serine protease region. The protein exhibits a high-affinity calcium binding site in the first EGF0like domain, in addition to calcium binding in the Gla domain. The first EGF-like domain, factor IX (45-87), has been synthesized. Sequence-specific resonance assignment of the peptide has been made by using 2D NMR techniques, and its secondary structure has been determined. The protein is found to have two antiparallel β-sheets, and preliminary distance geometry calculations indicate that the protein has two domains, separated by Trp 28 , with the overall structure being similar to that of EGF. An NMR investigation of the calcium-bound first EGF-like domain indicates the presence and location of a calcium binding site involving residues on both strands of one of the β-sheets as well as the N-terminal region of the peptide. These results suggest that calcium binding in the first EGF-like domain could induce long-range (possibly interdomain) conformational changes in factor IX, rather than causing structural alterations in the EGF-like domain itself
Forrester, Alison R; Elias, Martina S; Woodward, Emma L; Graham, Mark; Williams, Faith M; Reynolds, Nick J
2014-01-01
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a potent activator of the aryl hydrocarbon receptor (AhR) and causes chloracne in humans. The pathogenesis and role of AhR in chloracne remains incompletely understood. To elucidate the mechanisms contributing to the development of the chloracne-like phenotype in a human epidermal equivalent model and identify potential biomarkers. Using primary normal human epidermal keratinocytes (NHEK), we studied AhR activation by XRE-luciferase, AhR degradation and CYP1A1 induction. We treated epidermal equivalents with high affinity TCDD or two non-chloracnegens: β-naphthoflavone (β-NF) and 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE). Using Western blotting and immunochemistry for filaggrin (FLG), involucrin (INV) and transglutaminase-1 (TGM-1), we compared the effects of the ligands on keratinocyte differentiation and development of the chloracne-like phenotype by H&E. In NHEKs, activation of an XRE-luciferase and CYP1A1 protein induction correlated with ligand binding affinity: TCDD>β-NF>ITE. AhR degradation was induced by all ligands. In epidermal equivalents, TCDD induced a chloracne-like phenotype, whereas β-NF or ITE did not. All three ligands induced involucrin and TGM-1 protein expression in epidermal equivalents whereas FLG protein expression decreased following treatment with TCDD and β-NF. Inhibition of AhR by α-NF blocked TCDD-induced AhR activation in NHEKs and blocked phenotypic changes in epidermal equivalents; however, AhR knock down did not reproduce the phenotype. Ligand-induced CYP1A1 and AhR degradation did not correlate with their chloracnegenic potential, indicating that neither CYP1A1 nor AhR are suitable biomarkers. Mechanistic studies showed that the TCDD-induced chloracne-like phenotype depends on AhR activation whereas AhR knock down did not appear sufficient to induce the phenotype. Copyright © 2013 Japanese Society for Investigative Dermatology. Published by Elsevier
Yuan, Xiao-Ying; Liu, Wei; Hao, Jian-Chun; Gu, Wei-Jie; Zhao, Yan-Shuang
2012-01-01
The purpose of this study was to investigate whether grape seed proanthocyanidin extract (GSPE) can provide photoprotection against ultraviolet (UV) irradiation. Study has shown that GSPE is a natural oxidant, and is used in many fields such as ischemia-reperfusion injury, chronic pancreatitis, and even cancer. However, the effect of GSPE on UV irradiation is as yet unknown. Cutaneous areas on the backs of normal volunteers were untreated or treated with GSPE solutions or vehicles 30 min before exposure to two minimal erythema doses (MED) of solar simulated radiation. Cutaneous areas at different sites were examined histologically for the number of sunburn cells, or immunohistochemically for Langerhans cells and mutant p53 epidermal cells. On histological and immunohistochemical examination, skin treated with GSPE before UV radiation showed fewer sunburn cells and mutant p53-positive epidermal cells and more Langerhans cells compared with skin treated with 2-MED UV radiation only (p<0.001, p<0.001, and p<0.01, respectively). GSPE may be a possible preventive agent for photoprotection.
The Antiaging Properties of Andrographis paniculata by Activation Epidermal Cell Stemness
Directory of Open Access Journals (Sweden)
Jiyoung You
2015-09-01
Full Text Available Andrographis paniculata (A. paniculata, Chuanxinlian, a medicinal herb with an extremely bitter taste that is native to China and other parts of Southeast Asia, possesses immense therapeutic value; however, its therapeutic properties have rarely been applied in the field of skin care. In this study, we investigated the effect of an A. paniculata extract (APE on human epidermal stem cells (EpSCs, and confirmed its anti-aging effect through in vitro, ex vivo, and in vivo study. An MTT assay was used to determine cell proliferation. A flow cytometric analysis, with propidium iodide, was used to evaluate the cell cycle. The expression of integrin β1 (CD29, the stem cell marker, was detected with antibodies, using flow cytometry in vitro, and immunohistochemical assays in ex vivo. Type 1 collagen and VEGF (vascular endothelial growth factor were measured using an enzyme-linked immunosorbent assay (ELISA. During the clinical study, skin hydration, elasticity, wrinkling, sagging, and dermal density were evaluated before treatment and at four and eight weeks after the treatment with the test product (containing the APE on the face. The proliferation of the EpSCs, treated with the APE, increased significantly. In the cell cycle analysis, the APE increased the G2/M and S stages in a dose-dependent manner. The expression of integrin β1, which is related to epidermal progenitor cell expansion, was up-regulated in the APE-treated EpSCs and skin explants. In addition, the production of VEGF in the EpSCs increased significantly in response to the APE treatment. Consistent with these results, the VEGF and APE-treated EpSCs conditioned medium enhanced the Type 1 collagen production in normal human fibroblasts (NHFs. In the clinical study, the APE improved skin hydration, dermal density, wrinkling, and sagging significantly. Our findings revealed that the APE promotes a proliferation of EpSCs, through the up-regulation of the integrin β1 and VEGF expression
The Antiaging Properties of Andrographis paniculata by Activation Epidermal Cell Stemness.
You, Jiyoung; Roh, Kyung-Baeg; Li, Zidan; Liu, Guangrong; Tang, Jian; Shin, Seoungwoo; Park, Deokhoon; Jung, Eunsun
2015-09-22
Andrographis paniculata (A. paniculata, Chuanxinlian), a medicinal herb with an extremely bitter taste that is native to China and other parts of Southeast Asia, possesses immense therapeutic value; however, its therapeutic properties have rarely been applied in the field of skin care. In this study, we investigated the effect of an A. paniculata extract (APE) on human epidermal stem cells (EpSCs), and confirmed its anti-aging effect through in vitro, ex vivo, and in vivo study. An MTT assay was used to determine cell proliferation. A flow cytometric analysis, with propidium iodide, was used to evaluate the cell cycle. The expression of integrin β1 (CD29), the stem cell marker, was detected with antibodies, using flow cytometry in vitro, and immunohistochemical assays in ex vivo. Type 1 collagen and VEGF (vascular endothelial growth factor) were measured using an enzyme-linked immunosorbent assay (ELISA). During the clinical study, skin hydration, elasticity, wrinkling, sagging, and dermal density were evaluated before treatment and at four and eight weeks after the treatment with the test product (containing the APE) on the face. The proliferation of the EpSCs, treated with the APE, increased significantly. In the cell cycle analysis, the APE increased the G2/M and S stages in a dose-dependent manner. The expression of integrin β1, which is related to epidermal progenitor cell expansion, was up-regulated in the APE-treated EpSCs and skin explants. In addition, the production of VEGF in the EpSCs increased significantly in response to the APE treatment. Consistent with these results, the VEGF and APE-treated EpSCs conditioned medium enhanced the Type 1 collagen production in normal human fibroblasts (NHFs). In the clinical study, the APE improved skin hydration, dermal density, wrinkling, and sagging significantly. Our findings revealed that the APE promotes a proliferation of EpSCs, through the up-regulation of the integrin β1 and VEGF expression. The VEGF
Steven johnsons syndrome and toxic epidermal necrolysis: A review
Directory of Open Access Journals (Sweden)
Sri ram Anne
2014-12-01
Full Text Available Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the etiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, identification and interruption of the culprit drug, specialized supportive care ideally in an intensive care unit, and consideration of immunomodulating agents such as high-dose intravenous immunoglobulin therapy.
Energy Technology Data Exchange (ETDEWEB)
Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)
2017-02-01
Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.
Kappus, H; Reinhold, C
1994-04-01
Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.
Gastric luminal epidermal growth factor is affected by diet | Iputo ...
African Journals Online (AJOL)
Objective. Diet is an area of major interest to those investigating the causes of cancer of the oesophagus in the Transkei. This study looked at the associations between intragastric epidermal growth factor level, diet and intragastric pH. Setting and subjects. A dietary survey was co-ordinated with studies of gastric luminal ...
Spin-filter effect in normal metal/ferromagnetic insulator/normal metal/superconductor structures
International Nuclear Information System (INIS)
Li, Hong; Yang, Wei; Yang, Xinjian; Qin, Minghui; Guo, Jianqin
2007-01-01
Taking into account the thickness of the ferromagnetic insulator, the spin-filter effect in normal metal/ferromagnetic insulator/normal metal/superconductor (NM/FI/NM/SC) junctions is studied based on the Blonder-Tinkham-Klapwijk (BTK) theory. It is shown that a spin-dependent energy shift during the tunneling process induces splitting of the subgap resonance peaks. The spin polarization due to the spin-filter effect of the FI causes an imbalance of the peaks heights and can enhance the Zeeman splitting of the gap peaks caused by an applied magnetic field. The spin-filter effect has no contribution to the proximity-effect-induced superconductivity in NM interlayer
Possible physiological role of milk epidermal growth factor in neonatal eyelid opening
International Nuclear Information System (INIS)
Tsutsumi, O.; Tsutsumi, A.; Oka, T.
1987-01-01
The eyelid opening of newborn mice occurs normally on day 13.9 +/- 1.8 after birth. When newborn mice were injected with anti-epidermal growth factor (EGF) antibody every other day starting on day 1 after birth, the eyelid opening was delayed by ∼ 3 days. The effect of anti-EGF became less prominent as the treatment was started at later times: when it was give from day 7, no delay in eyelid opening was observed. On the other hand, eyelid opening was enhanced by ∼ 3 days by EGF injection given on day 3 for every other day. This effect of EGF was antagonized by simultaneous administration of anti-EGF antibody. EGF was present at a concentration of 6.6 ng/ml in the plasma of 1-wk-old pups nursed by their mother, but it was not detectable in the plasma of 3-wk-old weaned pups. EGF concentration in the submandibular glands, however, was 17 times greater in 3- than in 1-wk-old pups. EGF was measured by radioimmunoassay. These results suggest that milk EGF may play a physiological role in eyelid opening during the neonatal period
Real-time visualization of macromolecule uptake by epidermal Langerhans cells in living animals.
Frugé, Rachel E; Krout, Colleen; Lu, Ran; Matsushima, Hironori; Takashima, Akira
2012-03-01
As a skin-resident member of the dendritic cell family, Langerhans cells (LCs) are generally regarded to function as professional antigen-presenting cells. Here we report a simple method to visualize the endocytotic activity of LCs in living animals. BALB/c mice received subcutaneous injection of FITC-conjugated dextran (DX) probes into the ear skin and were then examined under confocal microscopy. Large numbers of FITC(+) epidermal cells became detectable 12-24 hours after injection as background fluorescence signals began to disappear. Most (>90%) of the FITC(+) epidermal cells expressed Langerin, and >95% of Langerin(+) epidermal cells exhibited significant FITC signals. To assess intracellular localization, Alexa Fluor 546-conjugated DX probes were locally injected into IAβ-enhanced green fluorescent protein (EGFP) knock-in mice and Langerin-EGFP-diphtheria toxin receptor mice--three dimensional rotation images showed close association of most of the internalized DX probes with major histocompatibility complex (MHC) class II molecules, but not with Langerin molecules. These observations support the current view that LCs constantly sample surrounding materials, including harmful and innocuous antigens, at the environmental interface. Our data also validate the potential utility of the newly developed imaging approach to monitor LC function in wild-type animals.
Expression and analysis of exogenous proteins in epidermal cells.
Dagnino, Lina; Ho, Ernest; Chang, Wing Y
2010-01-01
In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.
"Cut-and-Paste" Manufacture of Multiparametric Epidermal Sensor Systems.
Yang, Shixuan; Chen, Ying-Chen; Nicolini, Luke; Pasupathy, Praveenkumar; Sacks, Jacob; Su, Becky; Yang, Russell; Sanchez, Daniel; Chang, Yao-Feng; Wang, Pulin; Schnyer, David; Neikirk, Dean; Lu, Nanshu
2015-11-04
Multifunctional epidermal sensor systems (ESS) are manufactured with a highly cost and time effective, benchtop, and large-area "cut-and-paste" method. The ESS made out of thin and stretchable metal and conductive polymer ribbons can be noninvasively laminated onto the skin surface to sense electrophysiological signals, skin temperature, skin hydration, and respiratory rate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
McDonald, Mark W; Wolanski, Mark R; Simmons, Joseph W; Buchsbaum, Jeffrey C
2013-01-01
Cranial reirradiation is clinically appropriate in some cases but cumulative radiation dose to critical normal structures remains a practical concern. The authors developed a simple technique in 3D conformal proton craniospinal irradiation (CSI) to block organs at risk (OAR) while minimizing underdosing of adjacent target brain tissue. Two clinical cases illustrate the use of proton therapy to provide salvage CSI when a previously irradiated OAR required sparing from additional radiation dose. The prior radiation plan was coregistered to the treatment planning CT to create a planning organ at risk volume (PRV) around the OAR. Right and left lateral cranial whole brain proton apertures were created with a small block over the PRV. Then right and left lateral “inverse apertures” were generated, creating an aperture opening in the shape of the area previously blocked and blocking the area previously open. The inverse aperture opening was made one millimeter smaller than the original block to minimize the risk of dose overlap. The inverse apertures were used to irradiate the target volume lateral to the PRV, selecting a proton beam range to abut the 50% isodose line against either lateral edge of the PRV. Together, the 4 cranial proton fields created a region of complete dose avoidance around the OAR. Comparative photon treatment plans were generated with opposed lateral X-ray fields with custom blocks and coplanar intensity modulated radiation therapy optimized to avoid the PRV. Cumulative dose volume histograms were evaluated. Treatment plans were developed and successfully implemented to provide sparing of previously irradiated critical normal structures while treating target brain lateral to these structures. The absence of dose overlapping during irradiation through the inverse apertures was confirmed by film. Compared to the lateral X-ray and IMRT treatment plans, the proton CSI technique improved coverage of target brain tissue while providing the least
DEFF Research Database (Denmark)
Zhou, F.S.; Andersen, C.H.; Burhenne, K.
2000-01-01
We propose a model for activation of the epidermal cell hypersensitive response (HR) in the barley/powdery mildew interaction. The model suggests that the plasma membrane proton pump (H+-ATPase) of epidermal cells is activated following penetration by an avirulent powdery mildew fungus...... in the incompatible interaction; (4) race-specific proton extrusion is observed underneath epidermal tissue detached from leaves inoculated 15 h earlier; and (5) treatment of leaves with fusicoccin, an activator of the plasma membrane H+-ATPase, increases the number of HR-cells in the compatible interaction........ This will cause an acidification of the apoplast towards the mesophyll cells, thereby activating generation of H2O2 from the mesophyll, which subsequently triggers the epidermal cell to undergo HR. The model is supported by the following data: (1) the earliest HR-related H2O2 is found in the attachment zones...
Bonnet-Duquennoy, Mathilde; Dumas, Marc; Debacker, Adeline; Lazou, Kristell; Talbourdet, Sylvie; Franchi, Jocelyne; Heusèle, Catherine; André, Patrice; Schnebert, Sylvianne; Bonté, Frédéric; Kurfürst, Robin
2007-06-01
Studying photoexposed and photoprotected skin biopsies from young and aged women, it has been found that a specific zone, composed of the basal layers of the epidermis, the dermal epidermal junction, and the superficial dermis, is major target of aging and reactive oxygen species. We showed that this zone is characterized by significant variations at a transcriptional and/or protein levels. Using low-density DNA chip technology, we evaluated the effect of a natural mixture of Aframomum angustifolium seed extract containing labdane diterpenoids on these aging markers. Expression profiles of normal human fibroblasts (NHF) were studied using a customized cDNA macroarray system containing genes covering dermal structure, inflammatory responses, and oxidative stress defense mechanisms. For normal human keratinocyte (NHK) investigations, we chose OLISA technique, a sensitive and quantitative method developed by BioMérieux specifically designed to investigate cell death, proliferation, epidermal structure, differentiation, and oxidative stress defense response. We observed that this extract strongly modified gene expression profiles of treated NHK, but weakly for NHF. This extract regulated antioxidant defenses, dermal-epidermal junction components, and epidermal renewal-related genes. Using low-density DNA chip technology, we identified new potential actions of A. angustifolium seed extract on skin aging.
Vissers, W.H.P.M.; Muys, L.; Erp, P.E.J. van; Jong, E.M.G.J. de; Kerkhof, P.C.M. van de
2004-01-01
Inflammatory linear verrucous epidermal nevus (ILVEN) is a rare skin disorder with a clinical and histological resemblance to psoriasis. In the past clinical and histological criteria have been defined. However, there remains a discussion as to whether ILVEN is a disease entity distinct from linear
Amplification of epidermal growth factor receptor gene in renal cell carcinoma
DEFF Research Database (Denmark)
El-Hariry, Iman; Powles, Thomas; Lau, Mike R
2010-01-01
Expression of epidermal growth factor receptor (EGFR) may be of prognostic value in renal cell cancer (RCC). Gene amplification of EGFR was investigated in a cohort of 315 patients with advanced RCC from a previously reported randomised study. Using fluorescent in situ hybridisation, only 2...
Keratins K2 and K10 are essential for the epidermal integrity of plantar skin.
Fischer, Heinz; Langbein, Lutz; Reichelt, Julia; Buchberger, Maria; Tschachler, Erwin; Eckhart, Leopold
2016-01-01
K1 and K2 are the main type II keratins in the suprabasal epidermis where each of them heterodimerizes with the type I keratin K10 to form intermediate filaments. In regions of the ears, tail, and soles of the mouse, only K2 is co-expressed with K10, suggesting that these keratins suffice to form a mechanically resilient cytoskeleton. To determine the effects of the suppression of both main keratins, K2 and K10, in the suprabasal plantar epidermis of the mouse. Krt2(-/-) Krt10(-/-) mice were generated by crossing Krt2(-/-) and Krt10(-/-) mice. Epidermal morphology of soles of hind-paws was examined macroscopically and histologically. Immunofluorescence analysis and quantitative PCR analysis were performed to analyze the expression of keratins in sole skin of wildtype and Krt2(-/-) Krt10(-/-) mice. Highly abundant proteins of the sole stratum corneum were determined by electrophoretic and chromatographic separation and subsequent mass spectrometry. K2 and K10 are the most prominent suprabasal keratins in normal mouse soles with the exception of the footpads where K1, K9 and K10 predominate. Mice lacking both K2 and K10 were viable and developed epidermal acanthosis and hyperkeratosis in inter-footpad epidermis of the soles. The expression of keratins K1, K9 and K16 was massively increased at the RNA and protein levels in the soles of Krt2(-/-) Krt10(-/-) mice. This study demonstrates that the loss of the main cytoskeletal components of plantar epidermis, i.e. K2 and K10, can be only partly compensated by the upregulation of other keratins. The thickening of the epidermis in the soles of Krt2(-/-) Krt10(-/-) mice may serve as a model for pathomechanistic aspects of palmoplantar keratoderma. Copyright © 2015. Published by Elsevier Ireland Ltd.
Clark, Jessica A; Clark, Andrew T; Hotchkiss, Richard S; Buchman, Timothy G; Coopersmith, Craig M
2008-07-01
Epidermal growth factor (EGF) is a cytoprotective peptide that has healing effects on the intestinal mucosa. We sought to determine whether systemic administration of EGF after the onset of sepsis improved intestinal integrity and decreased mortality. FVB/N mice were subjected to either sham laparotomy or 2 x 23 cecal ligation and puncture (CLP). Septic mice were further randomized to receive injection of either 150 microg kg(-1) d(-1) (i.p.) EGF or 0.9% saline (i.p.). Circulating EGF levels were decreased after CLP compared with sham animals but were unaffected by giving exogenous EGF treatment. In contrast, intestinal EGF levels increased after CLP and were further augmented by exogenous EGF treatment. Intestinal EGF receptor was increased after CLP, whether assayed by immunohistochemistry, real-time polymerase chain reaction, or Western blot, and exogenous EGF treatment decreased intestinal EGF receptor. Villus length decreased 2-fold between sham and septic animals, and EGF treatment resulted in near total restitution of villus length. Sepsis decreased intestinal proliferation and increased intestinal apoptosis. This was accompanied by increased expression of the proapoptotic proteins Bid and Fas-associated death domain, as well as the cyclin-dependent kinase inhibitor p21 cip1/waf Epidermal growth factor treatment after the onset of sepsis restored both proliferation and apoptosis to levels seen in sham animals and normalized expression of Bid, Fas-associated death domain, and p21 cip1/waf . To determine whether improvements in gut homeostasis were associated with a decrease in sepsis-induced mortality, septic mice with or without EGF treatment after CLP were followed 7 days for survival. Mortality decreased from 60% to 30% in mice treated with EGF after the onset of sepsis (P < 0.05). Thus, EGF may be a potential therapeutic agent for the treatment of sepsis in part due to its ability to protect intestinal integrity.
Morita, Toshiyuki; Tsuchiya, Akiko; Sugimoto, Masazumi
2011-09-01
Re-epithelialization in skin wound healing is a process in which epidermal sheets grow and close the wound. Although the actin-myosin system is thought to have a pivotal role in re-epithelialization, its role is not clear. In fish skin, re-epithelialization occurs around 500 μm/h and is 50 times faster than in mammalian skin. We had previously reported that leading-edge cells of the epidermal outgrowth have both polarized large lamellipodia and "purse string"-like actin filament cables in the scale-skin culture system of medaka fish, Oryzias latipes (Cell Tissue Res, 2007). The actin purse-string (APS) is a supracellular contractile machinery in which adherens junctions (AJs) link intracellular myosin II-including actin cables between neighboring cells. In this study, we developed a modified "face-to-face" scale-skin culture system as an ex vivo model to study epidermal wound healing, and examined the role of the actin-myosin system in the rapid re-epithelialization using a myosin II ATPase inhibitor, blebbistatin. A low level of blebbistatin suppressed the formation of APS and induced the dissociation of keratocytes from the leading edge without attenuating the growth of the epidermal sheet or the migration rate of solitary keratocytes. AJs in the superficial layer showed no obvious changes elicited by blebbistatin. However, two epidermal sheets without APSs did not make a closure with each other, which was confirmed by inhibiting the connecting AJs between the superficial layers. These results suggest that myosin II activity is required for functional leading-edge cells and for epidermal closure.
Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins.
Zenz, Rainer; Eferl, Robert; Kenner, Lukas; Florin, Lore; Hummerich, Lars; Mehic, Denis; Scheuch, Harald; Angel, Peter; Tschachler, Erwin; Wagner, Erwin F
2005-09-15
Psoriasis is a frequent, inflammatory disease of skin and joints with considerable morbidity. Here we report that in psoriatic lesions, epidermal keratinocytes have decreased expression of JunB, a gene localized in the psoriasis susceptibility region PSORS6. Likewise, inducible epidermal deletion of JunB and its functional companion c-Jun in adult mice leads (within two weeks) to a phenotype resembling the histological and molecular hallmarks of psoriasis, including arthritic lesions. In contrast to the skin phenotype, the development of arthritic lesions requires T and B cells and signalling through tumour necrosis factor receptor 1 (TNFR1). Prior to the disease onset, two chemotactic proteins (S100A8 and S100A9) previously mapped to the psoriasis susceptibility region PSORS4, are strongly induced in mutant keratinocytes in vivo and in vitro. We propose that the abrogation of JunB/activator protein 1 (AP-1) in keratinocytes triggers chemokine/cytokine expression, which recruits neutrophils and macrophages to the epidermis thereby contributing to the phenotypic changes observed in psoriasis. Thus, these data support the hypothesis that epidermal alterations are sufficient to initiate both skin lesions and arthritis in psoriasis.
International Nuclear Information System (INIS)
Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.
1996-01-01
UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)
DEFF Research Database (Denmark)
Poulsen, Steen Seier
1984-01-01
The effect of VIP and somatostatin on secretion of epidermal growth factor and bicarbonate from Brunner's glands was investigated in the rat. Vasoactive intestinal polypeptide infused in doses of 10 and 100 ng/kg/h significantly increased epidermal growth factor and bicarbonate output......, but the concentrations did not change. Somatostatin infused at doses of 1, 10, 100 and 1000 ng/kg/h against a background of VIP 100 ng/kg/h inhibited in dose-dependent fashion the stimulated epidermal growth factor and bicarbonate outputs from rat Brunner's gland pouches. Also basal secretion was inhibited...... growth factor and bicarbonate from Brunner's glands, an effect which is inhibited by somatostatin. A possible role for somatostatin in the control of Brunner's gland secretion is suggested....
The Study of Anatomical Structure and Karyotype of West Sumatran Dioscorea bulbifora L
Directory of Open Access Journals (Sweden)
Sjahridal Dahlan
2007-04-01
Full Text Available Had been done from March 2005 to January 2006 in plant Structure and Development Laboratory of Biology Department, Faculty of Mathematic and Natural Science, Andalas University. In present study were used descriptives and quantitatives method by preparing semi-permanent and permanent slide. Anatomycal structures of green aerial stem were consisting of epidermal, cortex with endodermoid cells and sclerechima tissue centripetally. Vascular bundle can be rocognized in three distinct rings with amphycribal type. Transverse section of leave anatomical composed by both a layer epidermal on upper and lower leaf surface, palysade parechima, and spons parenchyma (dorsiventral type. The stomata were anomocytic type on both upper and lower surface of leaf (amphystomatic type. Idioblast of cell raphides crystals and tannin containing founded in leaf structure. In transverse section each of eight individual bundle surrounded by sclerenchyma. The root anatomical structures consist of epidermal, cortex, endodermal (U shape wall thickening, pericycle and pith (with three ring of vascular bundles centripetally. The air tuber lacking of starch grains containing of parenchyma cells. Idioblast cell expected contain of HCN distributed over all of tuber tissue. The somatic cell chromosome were diploid 2n=20 with basic chromosome number were x=10.
Directory of Open Access Journals (Sweden)
Donna Brennan
2010-01-01
Full Text Available Cell-cell adhesion mediated by desmosomes is crucial for maintaining proper epidermal structure and function, as evidenced by several severe and potentially fatal skin disorders involving impairment of desmosomal proteins. Pemphigus foliaceus (PF and staphylococcal scalded skin syndrome (SSSS are subcorneal blistering diseases resulting from loss of function of the desmosomal cadherin, desmoglein 1 (Dsg1. To further study the pathomechanism of these diseases and to assess the adhesive properties of Dsg2, we employed a recently established transgenic (Tg mouse model expressing Dsg2 in the superficial epidermis. Neonatal Tg and wild type (WT mice were injected with purified ETA or PF Ig. We showed that ectopic expression of Dsg2 reduced the extent of blister formation in response to both ETA and PF Ig. In response to PF Ig, we observed either a dramatic loss or a reorganization of Dsg1-α, Dsg1-β, and, to a lesser extent, Dsg1-γ, in WT mice. The Inv-Dsg2 Tg mice showed enhanced retention of Dsg1 at the cell-cell border. Collectively, our data support the role for Dsg2 in cell adhesion and suggest that ectopic superficial expression of Dsg2 can increase membrane preservation of Dsg1 and limit epidermal blister formation mediated by PF antibodies and exfoliative toxins.
The electronic structure of normal metal-superconductor bilayers
Energy Technology Data Exchange (ETDEWEB)
Halterman, Klaus; Elson, J Merle [Sensor and Signal Sciences Division, Naval Air Warfare Center, China Lake, CA 93355 (United States)
2003-09-03
We study the electronic properties of ballistic thin normal metal-bulk superconductor heterojunctions by solving the Bogoliubov-de Gennes equations in the quasiclassical and microscopic 'exact' regimes. In particular, the significance of the proximity effect is examined through a series of self-consistent calculations of the space-dependent pair potential {delta}(r). It is found that self-consistency cannot be neglected for normal metal layer widths smaller than the superconducting coherence length {xi}{sub 0}, revealing its importance through discernible features in the subgap density of states. Furthermore, the exact self-consistent treatment yields a proximity-induced gap in the normal metal spectrum, which vanishes monotonically when the normal metal length exceeds {xi}{sub 0}. Through a careful analysis of the excitation spectra, we find that quasiparticle trajectories with wavevectors oriented mainly along the interface play a critical role in the destruction of the energy gap.
Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes
Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...
Adding a Piece to the Leaf Epidermal Cell Shape Puzzle.
von Wangenheim, Daniel; Wells, Darren M; Bennett, Malcolm J
2017-11-06
The jigsaw puzzle-shaped pavement cells in the leaf epidermis collectively function as a load-bearing tissue that controls organ growth. In this issue of Developmental Cell, Majda et al. (2017) shed light on how the jigsaw shape can arise from localized variations in wall stiffness between adjacent epidermal cells. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
1981-03-01
The Specialists' Meeting on ''Demonstration of Structural Integrity under Normal and Faulted Conditions'' was held at Chester, United Kingdom on 3-5 June 1980. The meeting was sponsored by the International Atomic Energy Agency (IAEA) on the recommendation of the International Working Group on Past Reactors (IWGFR). Twenty-one participants from France, the Federal Republic of Germany, Italy, Japan, the Netherlands, the United Kingdom, the United States of America and two international organizations, CEC and IAEA, attended. The purpose of the meeting was to review and discuss methods for assessing the integrity of the LMFBR safety-related structures during normal and abnormal operation, especially in the presence of defects, and to recommend future development. The technical sessions were divided into four topical sessions as follows: 1. National Review Presentations on Demonstration of Structural Integrity; 2. Material Properties; 3. Structural Analysis; 4. Design Approaches and Assessment Experience. During the meeting papers were presented by the participants on behalf of their countries or organizations. Each presentation was followed by an open discussion in the subject covered by the paper and subsequently, session summaries were drafted. After the formal sessions were completed, a final discussion session was held and general conclusions and recommendations were reached by consensus. Session summaries, general conclusions and recommendations, national review papers presented during the first session as well as the agenda of the meeting and the list of participants are given
Directory of Open Access Journals (Sweden)
Kai Kretzschmar
2014-10-01
Full Text Available B-lymphocyte-induced nuclear maturation protein 1 (BLIMP1 was previously reported to define a sebaceous gland (SG progenitor population in the epidermis. However, the recent identification of multiple stem cell populations in the hair follicle junctional zone has led us to re-evaluate its function. We show, in agreement with previous studies, that BLIMP1 is expressed by postmitotic, terminally differentiated epidermal cells within the SG, interfollicular epidermis, and hair follicle. Epidermal overexpression of c-Myc results in loss of BLIMP1+ cells, an effect modulated by androgen signaling. Epidermal-specific deletion of Blimp1 causes multiple differentiation defects in the epidermis in addition to SG enlargement. In culture, BLIMP1+ sebocytes have no greater clonogenic potential than BLIMP1− sebocytes. Finally, lineage-tracing experiments reveal that, under steady-state conditions, BLIMP1-expressing cells do not divide. Thus, rather than defining a sebocyte progenitor population, BLIMP1 functions in terminally differentiated cells to maintain homeostasis in multiple epidermal compartments.
Directory of Open Access Journals (Sweden)
Simon Krabbe
2016-01-01
Full Text Available This case report describes a patient with arthritis of the large joints, bilateral sacroiliitis, and positive anti-SSA and anti-dsDNA antibody, who received sulfasalazine and shortly thereafter became critically ill. He developed toxic epidermal necrolysis, hemolytic anemia, lymphopenia, markedly elevated ferritin, and muscle wasting. A diagnosis of systemic lupus erythematosus was made, and mycophenolate mofetil and systemic glucocorticoids brought this severe disease under control. Toxic epidermal necrolysis-like lesions and hemophagocytic syndrome have been reported as manifestations of systemic lupus erythematosus. This patient possibly had spondyloarthritis or an undifferentiated connective tissue disease at presentation, and we suggest, based on the timing of events, that sulfasalazine may have acted as a trigger of the severe disease manifestations.
Toxic epidermal necrolysis due to concomitant use of lamotrigine and valproic acid
Directory of Open Access Journals (Sweden)
Sukhjot Kaur
2013-01-01
Full Text Available Anti-epileptic drugs can be associated with a wide spectrum of cutaneous adverse reactions ranging from simple maculopapular rashes to more severe and life threatening reactions like Stevens-Johnson syndrome and toxic epidermal necrolysis. These rashes are well documented with older antiepileptic drugs like phenytoin, phenobarbitone and carbamazapine. Lamotrigine is a newer, unrelated antiepileptic drug that causes skin rashes in 3-10% of new users. Higher starting dose or rapid escalation, concurrent treatment with valproic acid, and a previous history of a rash with other antiepileptic drugs are well recognized risk factors for lamotrigine related serious rashes. We report two patients with toxic epidermal necrolysis, resulting from concomitant use of lamotrigine and valproic acid. It is emphasized that clinicians adhere to the recommended dosage guidelines and adopt a slow dose titration when initiating treatment with lamotrigine.
Role of Pin1 in UVA-induced cell proliferation and malignant transformation in epidermal cells
International Nuclear Information System (INIS)
Han, Chang Yeob; Hien, Tran Thi; Lim, Sung Chul; Kang, Keon Wook
2011-01-01
Highlights: → Pin1 expression is enhanced by low energy UVA irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. → UVA irradiation increases activator protein-1 activity and cyclin D1 in a Pin1-dependent manner. → UVA potentiates EGF-inducible, anchorage-independent growth of epidermal cells, and this is suppressed by Pin1 inhibition or by anti-oxidant. -- Abstract: Ultraviolet A (UVA) radiation (λ = 320-400 nm) is considered a major cause of human skin cancer. Pin1, a peptidyl prolyl isomerase, is overexpressed in most types of cancer tissues and plays an important role in cell proliferation and transformation. Here, we demonstrated that Pin1 expression was enhanced by low energy UVA (300-900 mJ/cm 2 ) irradiation in both skin tissues of hairless mice and JB6 C141 epidermal cells. Exposure of epidermal cells to UVA radiation increased cell proliferation and cyclin D1 expression, and these changes were blocked by Pin1 inhibition. UVA irradiation also increased activator protein-1 (AP-1) minimal reporter activity and nuclear levels of c-Jun, but not c-Fos, in a Pin1-dependent manner. The increases in Pin1 expression and in AP-1 reporter activity in response to UVA were abolished by N-acetylcysteine (NAC) treatment. Finally, we found that pre-exposure of JB6 C141 cells to UVA potentiated EGF-inducible, anchorage-independent growth, and this effect was significantly suppressed by Pin1inhibition or by NAC.
Sperry, Megan M; Kartha, Sonia; Granquist, Eric J; Winkelstein, Beth A
2018-07-01
Inter-subject networks are used to model correlations between brain regions and are particularly useful for metabolic imaging techniques, like 18F-2-deoxy-2-(18F)fluoro-D-glucose (FDG) positron emission tomography (PET). Since FDG PET typically produces a single image, correlations cannot be calculated over time. Little focus has been placed on the basic properties of inter-subject networks and if they are affected by group size and image normalization. FDG PET images were acquired from rats (n = 18), normalized by whole brain, visual cortex, or cerebellar FDG uptake, and used to construct correlation matrices. Group size effects on network stability were investigated by systematically adding rats and evaluating local network connectivity (node strength and clustering coefficient). Modularity and community structure were also evaluated in the differently normalized networks to assess meso-scale network relationships. Local network properties are stable regardless of normalization region for groups of at least 10. Whole brain-normalized networks are more modular than visual cortex- or cerebellum-normalized network (p network resolutions where modularity differs most between brain and randomized networks. Hierarchical analysis reveals consistent modules at different scales and clustering of spatially-proximate brain regions. Findings suggest inter-subject FDG PET networks are stable for reasonable group sizes and exhibit multi-scale modularity.
Ghassemi, Pejhman; Wang, Quanzeng; Pfefer, T. Joshua
2016-03-01
Photoacoustic Tomography (PAT) employs high-power near-infrared (near-IR) laser pulses to generate structural and functional information on tissue chromophores up to several centimeters below the surface. Such insights may facilitate detection of breast cancer - the most common cancer in women. PAT mammography has been the subject of extensive research, including techniques based on exogenous agents for PAT contrast enhancement and molecular specificity. However, photothermal safety risks of PAT due to strong chromophores such as epidermal melanin and plasmonic nanoparticles have not been rigorously studied. We have used computational and experimental approaches to elucidate highly dynamic optical-thermal processes during PAT. A Monte Carlo model was used to simulate light propagation at 800 and 1064 nm in a multi-layer breast tissue geometry with different epidermal pigmentation levels and a tumorsimulating inclusion incorporating nanoparticles. Energy deposition results were then used in a bioheat transfer model to simulate temperature transients. Experimental measurements involved multi-layer hydrogel phantoms with inclusions incorporating gold nanoparticles. Phantom optical properties were measured using the inverse adding-doubling technique. Thermal imaging was performed as phantoms were irradiated with 5 ns near-IR pulses. Scenarios using 10 Hz laser irradiation of breast tissue containing various nanoparticle concentrations were implemented experimentally and computationally. Laser exposure levels were based on ANSI/IEC limits. Surface temperature measurements were compared to corresponding simulation data. In general, the effect of highly pigmented skin on temperature rise was significant, whereas unexpectedly small levels of temperature rise during nanoparticle irradiation were attributed to rapid photodegradation. Results provide key initial insights into light-tissue interactions impacting the safety and effectiveness of PAT.
Barkla, Bronwyn J; Vera-Estrella, Rosario
2015-01-01
One of the remarkable adaptive features of the halophyte Mesembryanthemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC) which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF) and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples identified 352 significantly differing metabolites (268 after correction for FDR). Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na(+) and Cl(-) ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggests large alterations in M. crystallinum epidermal bladder cells.
Barkla, Bronwyn J.; Vera-Estrella, Rosario
2015-01-01
One of the remarkable adaptive features of the halophyte Mesembryanthemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC) which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF) and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples identified 352 significantly differing metabolites (268 after correction for FDR). Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na+ and Cl− ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggests large alterations in M. crystallinum epidermal bladder cells. PMID:26113856
DEFF Research Database (Denmark)
Jensen, Charlotte Harken; Krogh, Thomas N; Højrup, Peter
1994-01-01
The present paper describes the primary structure, glycosylation and tissue localization of fetal antigen 1 (FA1) isolated from second-trimester human amniotic fluid. FA1 is a single-chained, heterogeneous glycoprotein of 225-262 amino acid residues. FA1 has six well conserved epidermal...... extends with minor corrections to the human adrenal-specific mRNA, pG2 as well. Immunohistochemical analysis demonstrated the presence of FA1 in 10 out of 14 lung tumors containing neuroendocrine elements, and in the placental villi where FA1 was exclusively seen in stromal cells in close contact...... to the vascular structure. In the pancreas, FA1 co-localized with insulin in the insulin secretory granules of the beta cells within the islets of Langerhans. Our findings suggest that FA1 is synthesized as a membrane anchored protein and released into the circulation after enzymic cleavage, and that circulating...
Directory of Open Access Journals (Sweden)
Soumya Joseph
Full Text Available LIM-domain only protein 4 (LMO4 is a widely expressed protein with important roles in embryonic development and breast cancer. It has been reported to bind many partners, including the transcription factor Deformed epidermal autoregulatory factor-1 (DEAF1, with which LMO4 shares many biological parallels. We used yeast two-hybrid assays to show that DEAF1 binds both LIM domains of LMO4 and that DEAF1 binds the same face on LMO4 as two other LMO4-binding partners, namely LIM domain binding protein 1 (LDB1 and C-terminal binding protein interacting protein (CtIP/RBBP8. Mutagenic screening analysed by the same method, indicates that the key residues in the interaction lie in LMO4LIM2 and the N-terminal half of the LMO4-binding domain in DEAF1. We generated a stable LMO4LIM2-DEAF1 complex and determined the solution structure of that complex. Although the LMO4-binding domain from DEAF1 is intrinsically disordered, it becomes structured on binding. The structure confirms that LDB1, CtIP and DEAF1 all bind to the same face on LMO4. LMO4 appears to form a hub in protein-protein interaction networks, linking numerous pathways within cells. Competitive binding for LMO4 therefore most likely provides a level of regulation between those different pathways.
Directory of Open Access Journals (Sweden)
Wataru Kobayashi
2014-01-01
Full Text Available Purpose. To assess the association between optic nerve head (ONH microcirculation, central papillomacular bundle (CPB structure, and visual function in eyes with treatment naive normal tension glaucoma (NTG. Methods. This study included 40 eyes of 40 patients with NTG and 20 eyes of 20 normal patients. We used laser speckle flowgraphy (LSFG to measure mean blur rate (MBR in all eyes and calculated the ratio of MBR in the horizontal quadrants of tissue area ONH (temporal/nasal ratio of MBR in the tissue area: T/N MT. Clinical findings also included retinal nerve fiber layer thickness (RNFLT and ganglion cell complex thickness (GCCT in the CPB and macular areas, best-corrected visual acuity (BCVA, mean deviation (MD, and refractive error. Results. T/N MT was correlated with both BCVA and MD. The OCT parameters most highly correlated with T/N MT were macular RNFLT and mid-CPB RNFLT. Furthermore, T/N MT, mid-CPB RNFLT, and macular RNFLT were higher in NTG than in normal eyes. A discrimination analysis revealed that T/N MT and refractive error were independent factors indicating NTG. Conclusions. Our results suggest that T/N MT is a candidate biomarker of NTG. Furthermore, T/N MT reflects visual function, including acuity and sensitivity, and CPB structure.
Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion.
Directory of Open Access Journals (Sweden)
Aleksandra Piwko-Czuchra
Full Text Available BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in their absence, while in vitro data have shown a fundamental role for these adhesion receptors in stem/progenitor cell expansion and differentiation. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate this discrepancy we generated hypomorphic mice expressing reduced beta1 integrin levels on keratinocytes that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis.
Mapping of Carboxypeptidase M in Normal Human Kidney and Renal Cell Carcinoma
Denis, Catherine J.; Van Acker, Nathalie; De Schepper, Stefanie; De Bie, Martine; Andries, Luc; Fransen, Erik; Hendriks, Dirk; Kockx, Mark M.
2013-01-01
Although the kidney generally has been regarded as an excellent source of carboxypeptidase M (CPM), little is known about its renal-specific expression level and distribution. This study provides a detailed localization of CPM in healthy and diseased human kidneys. The results indicate a broad distribution of CPM along the renal tubular structures in the healthy kidney. CPM was identified at the parietal epithelium beneath the Bowman’s basement membrane and in glomerular mesangial cells. Capillaries, podocytes, and most interstitial cells were CPM negative. Tumor cells of renal cell carcinoma subtypes lose CPM expression upon dedifferentiation. Tissue microarray analysis demonstrated a correlation between low CPM expression and tumor cell type. CPM staining was intense on phagocytotic tumor-associated macrophages. Immunoreactive CPM was also detected in the tumor-associated vasculature. The absence of CPM in normal renal blood vessels points toward a role for CPM in angiogenesis. Coexistence of CPM and the epidermal growth factor receptor (EGFR) was detected in papillary renal cell carcinoma. However, the different subcellular localization of CPM and EGFR argues against an interaction between these h proteins. The description of the distribution of CPM in human kidney forms the foundation for further study of the (patho)physiological activities of CPM in the kidney. PMID:23172796
Directory of Open Access Journals (Sweden)
R. Walter Heinrichs
2017-01-01
Full Text Available This study assessed whether cortical thickness across the brain and regionally in terms of the default mode, salience, and central executive networks differentiates schizophrenia patients and healthy controls with normal range or below-normal range cognitive performance. Cognitive normality was defined using the MATRICS Consensus Cognitive Battery (MCCB composite score (T=50 ± 10 and structural magnetic resonance imaging was used to generate cortical thickness data. Whole brain analysis revealed that cognitively normal range controls (n=39 had greater cortical thickness than both cognitively normal (n=17 and below-normal range (n=49 patients. Cognitively normal controls also demonstrated greater thickness than patients in regions associated with the default mode and salience, but not central executive networks. No differences on any thickness measure were found between cognitively normal range and below-normal range controls (n=24 or between cognitively normal and below-normal range patients. In addition, structural covariance between network regions was high and similar across subgroups. Positive and negative symptom severity did not correlate with thickness values. Cortical thinning across the brain and regionally in relation to the default and salience networks may index shared aspects of the psychotic psychopathology that defines schizophrenia with no relation to cognitive impairment.
Wu, Jia; Zhang, Wei; Xu, Aiqiang; Zhang, Li; Yan, Tao; Li, Zhuo; Wu, Xiaopan; Zhu, Xilin; Ma, Juan; Li, Ke; Li, Hui; Liu, Ying
2013-08-01
Hepatocellular carcinoma (HCC) is a common solid malignant tumor occurring worldwide that leads to the third largest cause of death compared to other cancers. Genetic and environmental factors are involved in the pathogenesis of HCC. Epidermal growth factor (EGF) and epidermal growth factor receptor (EGFR) can stimulate the proliferation of epidermal and epithelial cells. The EGF signal pathway has a relationship with the growth of the embryo, tissue repairing, and tumorigenesis. In this study, 416 patients with hepatitis B virus infection (HBV)-related HCC and 645 individuals who had never been infected with HBV of the Chinese Han population were enrolled. Eight single-nucleotide polymorphisms (SNPs), whose minor allele frequency >20% in the EGF and EGFR genes, were genotyped to examine their associations with hepatocarcinogenesis. Genotyping experiments were carried out using TaqMan. There were significant differences in genotype distributions (p=0.005) and allele frequencies (p=0.001, odds ratio [OR]=1.43, 95% confidence interval [CI]=1.15-1.79) of rs11569017 in the EGF gene between the HCC and control groups. After binary logistic regression to determine independent factors for susceptibility to HCC under an additive model, rs11569017 was still independently associated with the susceptibility to HCC (p=0.021, OR=1.48, 95% CI=1.06-2.07), but no significant differences in other SNPs were found. Additionally, the haplotype T-G constructed by rs11569017 and rs4444903 of the EGF gene might increase the risk of HBV-related HCC (p=0.002, OR=1.44, 95% CI=1.15-1.82). The rs11569017 T allele was associated with susceptibility to HBV-related HCC.
Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M
2007-02-01
Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.
STEVENS–JOHNSON SYNDROME — TOXIC EPIDERMAL NECTROLYSIS IN CHILDREN. PART II. SYSTEM, LOCAL TREATMENT
Directory of Open Access Journals (Sweden)
V.F. Zhernosek
2011-01-01
Full Text Available The second part of the article concerning Stevens–Johnson syndrome — toxic epidermal necrolysis (SJS–TEN is devoted to the treatment of this disease. The modern approaches to the use of systemic agents — antibacterial, antiviral, analgesics and sedatives, and anticoagulants are discussed in detail. Regulations of the drugs use depending on the patient state and the etiology of SJS–TEN are marked out. The basic principles of the fluid therapy for rehydration and dehydration prevention are shown in the article. Particular attention is paid to the local therapy — treatment of mucous membranes and skin lesions.Key words: Stevens-Johnson syndrome, toxic epidermal necrolysis, children, antibiotic therapy, topical treatment.
Directory of Open Access Journals (Sweden)
V. D. El'kin
2017-01-01
Full Text Available We present a clinical case of ichthyosis hystrix, a rare genetic ichthyosiform dermatosis. Specifics of the disease are related to the complexity of differential diagnosis and verification of the diagnosis, because clinical manifestation of ichthyosis hystrix is similar with that of verrucous epidermal nevus. Clinical particulars of both nosologies are characterized by bizarre and widespread skin lesions of spicular hyperkeratotic growth, located along Blaschko lines. The exclusive feature of the clinical case described is a long-term (20 years clinical and laboratory monitoring of the patient. The literature review provides brief information on etiology, pathogenesis, clinical features, differential diagnosis, and pathomorphology of ichthyosis hystrix and verrucous epidermal nevus.
Dynamic structure factor of the normal Fermi gas from the collisionless to the hydrodynamic regime
International Nuclear Information System (INIS)
Watabe, Shohei; Nikuni, Tetsuro
2010-01-01
The dynamic structure factor of a normal Fermi gas is investigated by using the moment method for the Boltzmann equation. We determine the spectral function at finite temperatures over the full range of crossover from the collisionless regime to the hydrodynamic regime. We find that the Brillouin peak in the dynamic structure factor exhibits a smooth crossover from zero to first sound as functions of temperature and interaction strength. The dynamic structure factor obtained using the moment method also exhibits a definite Rayleigh peak (ω∼0), which is a characteristic of the hydrodynamic regime. We compare the dynamic structure factor obtained by the moment method with that obtained from the hydrodynamic equations.
International Nuclear Information System (INIS)
Kohda, Daisuke; Sawada, Toshie; Inagaki, Fuyuhiko
1991-01-01
The pH titration shifts for all the nonlabile proton resonances in a 53-residue protein (mouse epidermal growth factor) were measured in the p 2 H range 1.5-9 with two-dimensional (2D) 1 H NMR. The 2D NMR pH titration experiment made it possible to determine the pK values for all the ionizable group which were titrated in the pH range 1.5-9 in the protein. The pK values of the nine ionizable groups (α-amino group, four Asp, two Glu, one His, and α-carboxyl group) were found to be near their normal values. The 2D titration experiment also provided a detailed description of the pH-dependent behavior of the proton chemical shifts and enabled us to characterize the pH-dependent changes of protein conformation. Analysis of the pH-dependent shifts of ca. 200 proton resonances offered evidence of conformational changes in slightly basic pH solution: The deprotonation of the N-terminal α-amino group induced a widespread conformational change over the β-sheet structure in the protein, while the effects of deprotonation of the His22 imidazole group were relatively localized. The authors found that the 2D NMR pH titration experiment is a powerful tool for investigating the structural and dynamic properties of proteins
International Nuclear Information System (INIS)
Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.
1988-01-01
Specific binding of 125 I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class A/B diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more 125 I-hEGF than did fetal membranes (P 125 I-hEGF binding to fetal membranes from the various pregnancy states (P 125 I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P 125 I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P 125 I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P 125 I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone. (author)
Directory of Open Access Journals (Sweden)
Victor Paromov
2011-01-01
Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.
Influence of epidermal hydration on the friction of human skin against textiles
Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S
2008-01-01
Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.
Directory of Open Access Journals (Sweden)
Michelle T Juarez
2011-12-01
Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating
Epidermal inclusion cyst in male breast: mammographic and ultrasonographic findings in three cases
International Nuclear Information System (INIS)
Cubells, M.; Gil de Ramales, V.; Bulto, J. A.; Morcillo, E.; Celma, J.
2000-01-01
Three cases of histologically diagnosed epidermal inclusion cysts in male breast are presented. This is a very uncommon condition that results from the inclusion of epidermal remnants beneath the skin, which form a keratin-filled cystic cavity. The clinical presentation is that of palpable breast masses showing medium-to-high density in mammography. They are well defined and do not present calcifications. Ultrasound discloses their cystic form, with moderate posterior reinforcement, although they do not appear as anechoic cysts. Characteristically, echoes are detected in the interior that correspond to the degeneration keratin. The differential diagnosis should include cysts complicated by infection or hemorrhage, fibroadenomas with low echogenicity and even tumors of neoplastic origin. Color Doppler ultrasound disclosed the absence of internal vascularisation, a circumstance that indicated the benignity of the lesion. (Author) 9 refs
Lee, Han-Seung; Ismail, Mohamed A.; Woo, Young-Je; Min, Tae-Beom; Choi, Hyun-Kook
2014-01-01
Structural lightweight concrete (SLWC) has superior properties that allow the optimization of super tall structure systems for the process of design. Because of the limited supply of lightweight aggregates in Korea, the development of structural lightweight concrete without lightweight aggregates is needed. The physical and mechanical properties of specimens that were cast using normal coarse aggregates and different mixing ratios of foaming agent to evaluate the possibility of creating structural lightweight concrete were investigated. The results show that the density of SLWC decreases as the dosage of foaming agent increases up to a dosage of 0.6%, as observed by SEM. It was also observed that the foaming agent induced well separated pores, and that the size of the pores ranged from 50 to 100 μm. Based on the porosity of concrete specimens with foaming agent, compressive strength values of structural lightweight foam concrete (SLWFC) were obtained. It was also found that the estimated values from proposed equations for compressive strength and modulus of elasticity of SLWFC, and values obtained by actual measurements were in good agreement. Thus, this study confirms that new structural lightweight concrete using normal coarse aggregates and foaming agent can be developed successfully. PMID:28788691
Heterogeneity and plasticity of epidermal stem cells
DEFF Research Database (Denmark)
Schepeler, Troels; Page, Mahalia E; Jensen, Kim Bak
2014-01-01
The epidermis is an integral part of our largest organ, the skin, and protects us against the hostile environment. It is a highly dynamic tissue that, during normal steady-state conditions, undergoes constant turnover. Multiple stem cell populations residing in autonomously maintained compartments...... facilitate this task. In this Review, we discuss stem cell behaviour during normal tissue homeostasis, regeneration and disease within the pilosebaceous unit, an integral structure of the epidermis that is responsible for hair growth and lubrication of the epithelium. We provide an up-to-date view...... of the pilosebaceous unit, encompassing the heterogeneity and plasticity of multiple discrete stem cell populations that are strongly influenced by external cues to maintain their identity and function....
Antimicrobial susceptibility of Staphylococcus hyicus Isolated from exudative epidermitis in pigs
DEFF Research Database (Denmark)
Wegener, Henrik Caspar; Watts, J.L.; Salmon, S.A.
1994-01-01
for their activities against 100 S. hyicus strains isolated from pigs with exudative epidermitis. Novobiocin was the most active compound tested, with an MIC for 90% of the strains tested (MIC(90)) of less than or equal to 0.06 mu g/ml. Enrofloxacin, ampicillin, and ceftiofur were the next most active compounds...
International Nuclear Information System (INIS)
Gerberick, G.F.; Ryan, C.A.; Von Bargen, E.C.; Stuard, S.B.; Ridder, G.M.
1991-01-01
Lymphocytes from BALB/c mice photosensitized in vivo to tetrachlorosalicylanilide (TCSA) were investigated to determine whether they could be stimulated to proliferate when cultured with Langerhans cell-enriched cultured epidermal cells (LC-EC) photohapten-modified in vitro with TCSA + UVA radiation. Cultured LC-EC were photohapten-modified in vitro by irradiation in TCSA-containing medium using a 1000-watt solar simulator equipped with filters to deliver primarily UVA radiation (320-400 nm). Lymphocytes from TCSA-photosensitized mice were incubated with LC-EC that had been treated in vitro with 0.1 mM TCSA and 2 J/cm2 UVA radiation (TCSA + UVA). Responder lymphocytes demonstrated a significant increase in their blastogenesis response compared to lymphocytes that were incubated with LC-EC irradiated with UVA prior to treatment with TCSA (UVA/TCSA) or with LC-EC that had received no treatment. Lymphocytes from naive mice or mice photosensitized with musk ambrette (MA) demonstrated a significantly lower response to LC-EC modified with TCSA + UVA, indicating the specificity of the response. Maximum blastogenesis response was achieved when LC-EC were treated with 0.1 mM TCSA and a UVA radiation dose of at least 0.5 J/cm2. Epidermal cells depleted of LC by treatment with anti-Ia antibody plus complement or by an adherence procedure were unable to stimulate this blastogenesis response. Epidermal cells treated in vitro with TCSA + UVA demonstrated enhanced fluorescence compared to control cells. The fluorescence observed was not restricted to any specific epidermal cell type; however, fluorescence microscopy studies revealed that dendritic Ia-positive cells, presumably LC, were also TCSA fluorescent
Epidermal structure of some important forest plants
Energy Technology Data Exchange (ETDEWEB)
Farooqui, P
1981-10-01
Eucalyptus species are a dominant feature of the vegetation of India, largely planted in forest areas for timber and oil. The wood is used on a large scale in the paper and pulp industries. According to one researcher, Eucalyptus is represented by 605 species in the world, of which over a hundred species are cultivated in India. As they look very similar to each other, with few exceptions, it is difficult to distinguish them when not in flower. The structure of the leaf epidermis in 8 species of Eucalyptus has been studied. It is found that such studies may be useful for demarcating the different species. A guideline to the species studied is provided. (Refs. 13).
Renal origin of rat urinary epidermal growth factor
DEFF Research Database (Denmark)
Nexø, Ebba; Poulsen, Steen Seier
1984-01-01
The origin of rat urinary epidermal growth factor (EGF) has been investigated. Unilateral nephrectomy decreased the concentration, total output of EGF and EGF/creatinine ratio by approximately 50%, while the output of creatinine was unchanged. Removal of the submandibular glands and duodenal...... Brunner's glands, organs known to produce EGF, had no influence on the output of EGF in urine. Renal clearance of EGF exceeded that of creatinine, and after bilateral nephrectomy or bilateral ligation of the ureters, the concentration of creatinine in serum increased, while the concentration of EGF...
Kremer, M; Lang, E; Berger, A C
2000-09-01
origin. These experimental results demonstrate the establishment of an effective cell cultivation process which may be suitable for scale-up production of the epidermal component as large-scale composite-skin grafts. When seeded into Integratrade mark and grafted onto the nude mouse a replacement skin with normal functioning dermal-epidermal components was developed. These results encourage the design of a clinical trial to assess the function of this composite graft in man.
Bao, Weier; Greenwold, Matthew J; Sawyer, Roger H
2017-11-01
Gene co-expression network analysis has been a research method widely used in systematically exploring gene function and interaction. Using the Weighted Gene Co-expression Network Analysis (WGCNA) approach to construct a gene co-expression network using data from a customized 44K microarray transcriptome of chicken epidermal embryogenesis, we have identified two distinct modules that are highly correlated with scale or feather development traits. Signaling pathways related to feather development were enriched in the traditional KEGG pathway analysis and functional terms relating specifically to embryonic epidermal development were also enriched in the Gene Ontology analysis. Significant enrichment annotations were discovered from customized enrichment tools such as Modular Single-Set Enrichment Test (MSET) and Medical Subject Headings (MeSH). Hub genes in both trait-correlated modules showed strong specific functional enrichment toward epidermal development. Also, regulatory elements, such as transcription factors and miRNAs, were targeted in the significant enrichment result. This work highlights the advantage of this methodology for functional prediction of genes not previously associated with scale- and feather trait-related modules.
Influence of epidermal hydration on the friction of human skin against textile
Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.
2008-01-01
Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between
Pediatric Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis Halted by Etanercept.
Gavigan, Geneviève M; Kanigsberg, Nordau D; Ramien, Michele L
2018-02-01
We report a case of an 11-year-old female with Stevens-Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN) overlap, most likely triggered by sulfamethoxazole-trimethoprim, who was treated with the combination of methylprednisolone, cyclosporine, and etanercept. Her condition stabilized and her skin involvement did not progress after the addition of etanercept. To our knowledge, this is the first report of etanercept for pediatric SJS/TEN.
Effects of epidermal growth factor on bone formation and resorption in vivo
International Nuclear Information System (INIS)
Marie, P.J.; Hott, M.; Perheentupa, J.
1990-01-01
The effects of mouse epidermal growth factor (EGF) on bone formation and resorption were examined in male mice. EGF administration (2-200 ng.g-1.day-1 ip for 7 days) induced a dose-dependent rise in plasma EGF levels that remained within physiological range. Histomorphometric analysis of caudal vertebrae showed that EGF (20 and 200 ng.g-1.day-1) reduced the endosteal matrix and mineral appositional rates after 5 days of treatment as measured by double [3H]proline labeling and double tetracycline labeling, respectively. This effect was transitory and was not observed after 7 days of EGF administration. EGF administered for 7 days induced a dose-dependent increase in the periosteal osteoblastic and tetracycline double-labeled surfaces. At high dosage (200 ng.g-1.day-1) EGF administration increased the osteoclastic surface and the number of acid phosphatase-stained osteoclasts, although plasma calcium remained normal. The results show that EGF administration at physiological doses induces distinct effects on endosteal and periosteal bone formation and that the effects are dependent on EGF dosage and duration of treatment. This study indicates that EGF at physiological dosage stimulates periosteal bone formation and increases endosteal bone resorption in the growing mouse
Protein profiling of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.
Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar
2012-09-01
Plant epidermal trichomes are as varied in morphology as they are in function. In the halophyte Mesembryanthemum crystallinum, specialized trichomes called epidermal bladder cells (EBC) line the surface of leaves and stems, and increase dramatically in size and volume upon plant salt-treatment. These cells have been proposed to have roles in plant defense and UV protection, but primarily in sodium sequestration and as water reservoirs. To gain further understanding into the roles of EBC, a cell-type-specific proteomics approach was taken in which precision single-cell sampling of cell sap from individual EBC was combined with shotgun peptide sequencing (LC-MS/MS). Identified proteins showed diverse biological functions and cellular locations, with a high representation of proteins involved in H(+)-transport, carbohydrate metabolism, and photosynthesis. The proteome of EBC provides insight into the roles of these cells in ion and water homeostasis and raises the possibility that they are photosynthetically active and functioning in Crassulacean acid metabolism. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Soulat, P.; Tavassoli, A.
1981-01-01
The following is a summary of a few selected programmes in France on the structural integrity of fast reactor components under normal and faulted conditions. The scope of the programmes selected is limited to that suggested by the specialists Meeting organisers
Linn, Kristin A; Gaonkar, Bilwaj; Satterthwaite, Theodore D; Doshi, Jimit; Davatzikos, Christos; Shinohara, Russell T
2016-05-15
Normalization of feature vector values is a common practice in machine learning. Generally, each feature value is standardized to the unit hypercube or by normalizing to zero mean and unit variance. Classification decisions based on support vector machines (SVMs) or by other methods are sensitive to the specific normalization used on the features. In the context of multivariate pattern analysis using neuroimaging data, standardization effectively up- and down-weights features based on their individual variability. Since the standard approach uses the entire data set to guide the normalization, it utilizes the total variability of these features. This total variation is inevitably dependent on the amount of marginal separation between groups. Thus, such a normalization may attenuate the separability of the data in high dimensional space. In this work we propose an alternate approach that uses an estimate of the control-group standard deviation to normalize features before training. We study our proposed approach in the context of group classification using structural MRI data. We show that control-based normalization leads to better reproducibility of estimated multivariate disease patterns and improves the classifier performance in many cases. Copyright © 2016 Elsevier Inc. All rights reserved.
An epidermal equivalent assay for identification and ranking potency of contact sensitizers
Gibbs, S.; Corsini, E.; Spiekstra, S.W.; Galbiati, V.; Fuchs, H.W.; Degeorge, G.; Troese, M.; Hayden, P.; Deng, W.; Roggen, E.
2013-01-01
The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low
Immunohistochemical localisation and developmental aspects of epidermal growth factor in the rat
DEFF Research Database (Denmark)
Raaberg, L; Nexø, E; Damsgaard Mikkelsen, J
1988-01-01
The tissue localisation and time of first appearance of Epidermal Growth Factor (EGF) in the developing rat were investigated by means of immunohistochemistry, radioimmunoassay and radioreceptor assay. In this study we were able to show, that EGF appears prenatally in the lung and the kidney from...
Does epidermal growth factor play a role in the action of sucralfate?
DEFF Research Database (Denmark)
Nexø, Ebba; Poulsen, Steen Seier
1987-01-01
Epidermal growth factor (EGF) is a mitogenic peptide synthesized in the submandibular glands and released in saliva. EGF is able to prevent the development of gastrointestinal ulcers in the rat and to accelerate their healing. The present work was undertaken to examine whether Sucralfate acts via...
Response of human epidermal keratinocytes to UV light
International Nuclear Information System (INIS)
Kartasova, A.A.
1987-01-01
This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs
Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo
2016-10-01
Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.
Epidermal wound repair is regulated by the planar cell polarity signaling pathway.
Caddy, Jacinta; Wilanowski, Tomasz; Darido, Charbel; Dworkin, Sebastian; Ting, Stephen B; Zhao, Quan; Rank, Gerhard; Auden, Alana; Srivastava, Seema; Papenfuss, Tony A; Murdoch, Jennifer N; Humbert, Patrick O; Parekh, Vishwas; Boulos, Nidal; Weber, Thomas; Zuo, Jian; Cunningham, John M; Jane, Stephen M
2010-07-20
The mammalian PCP pathway regulates diverse developmental processes requiring coordinated cellular movement, including neural tube closure and cochlear stereociliary orientation. Here, we show that epidermal wound repair is regulated by PCP signaling. Mice carrying mutant alleles of PCP genes Vangl2, Celsr1, PTK7, and Scrb1, and the transcription factor Grhl3, interact genetically, exhibiting failed wound healing, neural tube defects, and disordered cochlear polarity. Using phylogenetic analysis, ChIP, and gene expression in Grhl3(-)(/-) mice, we identified RhoGEF19, a homolog of a RhoA activator involved in PCP signaling in Xenopus, as a direct target of GRHL3. Knockdown of Grhl3 or RhoGEF19 in keratinocytes induced defects in actin polymerization, cellular polarity, and wound healing, and re-expression of RhoGEF19 rescued these defects in Grhl3-kd cells. These results define a role for Grhl3 in PCP signaling and broadly implicate this pathway in epidermal repair. (c) 2010 Elsevier Inc. All rights reserved.
Anti-epidermal growth factor receptor skin toxicity: a matter of topical hydration.
Ferrari, Daris; Codecà, Carla; Bocci, Barbara; Crepaldi, Francesca; Violati, Martina; Viale, Giulia; Careri, Carmela; Caldiera, Sarah; Bordin, Veronica; Luciani, Andrea; Zonato, Sabrina; Cassinelli, Gabriela; Foa, Paolo
2016-02-01
Skin toxicity is a frequent complication of anti-epidermal growth factor receptor therapy, which can be an obstacle in maintaining the dose intensity and may negatively impact on the clinical outcome of cancer patients. Skin lesions depend on the disruption of the keratinocyte development pathways and no treatment is clearly effective in resolving the cutaneous alterations frequently found during anti-epidermal growth factor receptor therapy. Among systemic treatments, oral tetracycline proved to be useful in preventing skin manifestations. We describe the case of a patient affected by metastatic colorectal cancer, for whom a combination of chemotherapy and cetuximab was used as second-line treatment. The patient developed a symptomatic papulopustular skin rash that disappeared completely after a twice-daily application of a hydrating and moisturizing cream, mainly consisting of a mixture of paraffin, silicone compounds, and macrogol. The marked cutaneous amelioration allowed the patient to continue cetuximab without any further symptoms and was associated with a partial radiological response.
A Theoretical Model of Jigsaw-Puzzle Pattern Formation by Plant Leaf Epidermal Cells.
Higaki, Takumi; Kutsuna, Natsumaro; Akita, Kae; Takigawa-Imamura, Hisako; Yoshimura, Kenji; Miura, Takashi
2016-04-01
Plant leaf epidermal cells exhibit a jigsaw puzzle-like pattern that is generated by interdigitation of the cell wall during leaf development. The contribution of two ROP GTPases, ROP2 and ROP6, to the cytoskeletal dynamics that regulate epidermal cell wall interdigitation has already been examined; however, how interactions between these molecules result in pattern formation remains to be elucidated. Here, we propose a simple interface equation model that incorporates both the cell wall remodeling activity of ROP GTPases and the diffusible signaling molecules by which they are regulated. This model successfully reproduces pattern formation observed in vivo, and explains the counterintuitive experimental results of decreased cellulose production and increased thickness. Our model also reproduces the dynamics of three-way cell wall junctions. Therefore, this model provides a possible mechanism for cell wall interdigitation formation in vivo.
Directory of Open Access Journals (Sweden)
Bronwyn Jane Barkla
2015-06-01
Full Text Available One of the remarkable adaptive features of the halophyte and facultative CAM plant Mesembryathemum crystallinum are the specialized modified trichomes called epidermal bladder cells (EBC which cover the leaves, stems, and peduncle of the plant. They are present from an early developmental stage but upon salt stress rapidly expand due to the accumulation of water and sodium. This particular plant feature makes it an attractive system for single cell type studies, with recent proteomics and transcriptomics studies of the EBC establishing that these cells are metabolically active and have roles other than sodium sequestration. To continue our investigation into the function of these unusual cells we carried out a comprehensive global analysis of the metabolites present in the EBC extract by gas chromatography Time-of-Flight mass spectrometry (GC-TOF and identified 194 known and 722 total molecular features. Statistical analysis of the metabolic changes between control and salt-treated samples was used to identify 352 significantly differing metabolites (268 after correction for FDR. Principal components analysis provided an unbiased evaluation of the data variance structure. Biochemical pathway enrichment analysis suggested significant perturbations in 13 biochemical pathways as defined in KEGG. More than 50% of the metabolites that show significant changes in the EBC, can be classified as compatible solutes and include sugars, sugar alcohols, protein and non-protein amino acids, and organic acids, highlighting the need to maintain osmotic homeostasis to balance the accumulation of Na and Cl ions. Overall, the comparison of metabolic changes in salt treated relative to control samples suggest large alterations in Mesembryanthemum crystallinum epidermal bladder cells.
Development and evaluation of spatial point process models for epidermal nerve fibers.
Olsbo, Viktor; Myllymäki, Mari; Waller, Lance A; Särkkä, Aila
2013-06-01
We propose two spatial point process models for the spatial structure of epidermal nerve fibers (ENFs) across human skin. The models derive from two point processes, Φb and Φe, describing the locations of the base and end points of the fibers. Each point of Φe (the end point process) is connected to a unique point in Φb (the base point process). In the first model, both Φe and Φb are Poisson processes, yielding a null model of uniform coverage of the skin by end points and general baseline results and reference values for moments of key physiologic indicators. The second model provides a mechanistic model to generate end points for each base, and we model the branching structure more directly by defining Φe as a cluster process conditioned on the realization of Φb as its parent points. In both cases, we derive distributional properties for observable quantities of direct interest to neurologists such as the number of fibers per base, and the direction and range of fibers on the skin. We contrast both models by fitting them to data from skin blister biopsy images of ENFs and provide inference regarding physiological properties of ENFs. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jehill D Parikh
Full Text Available Both aging and hypertension are significant risk factors for heart failure in the elderly. The purpose of this study was to determine how aging, with and without hypertension, affects left ventricular function.Cross-sectional study of magnetic resonance imaging and 31P spectroscopy-based measurements of left ventricular structure, global function, strains, pulse wave velocity, high energy phosphate metabolism in 48 normal subjects and 40 treated hypertensive patients (though no other cardiovascular disease or diabetes stratified into 3 age deciles from 50-79 years.Normal aging was associated with significant increases in systolic blood pressure, vascular stiffness, torsion, and impaired diastolic function (all P<0.05. Age-matched hypertension exacerbated the effects of aging on systolic pressure, and diastolic function. Hypertension alone, and not aging, was associated with increased left ventricular mass index, reduced energetic reserve, reduced longitudinal shortening and increased endocardial circumferential shortening (all P<0.05. Multiple linear regression analysis showed that these unique hypertensive features were significantly related to systolic blood pressure (P<0.05.1 Hypertension adds to the age-related changes in systolic blood pressure and diastolic function; 2 hypertension is uniquely associated with changes in several aspects of left ventricular structure, function, systolic strains, and energetics; and 3 these uniquely hypertensive-associated parameters are related to the level of systolic blood pressure and so are potentially modifiable.
Zhu, Ting; Liang, Xing; Wang, Xiang-Ming; Shen, Kang
2017-12-01
Our previous work showed that the cell adhesion molecule SAX-7 forms an elaborate pattern in Caenorhabditis elegans epidermal cells, which instructs PVD dendrite branching. However, the molecular mechanism forming the SAX-7 pattern in the epidermis is not fully understood. Here, we report that the dynein light intermediate chain DLI-1 and the fusogen EFF-1 are required in epidermal cells to pattern SAX-7. While previous reports suggest that these two molecules act cell-autonomously in the PVD, our results show that the disorganized PVD dendritic arbors in these mutants are due to the abnormal SAX-7 localization patterns in epidermal cells. Three lines of evidence support this notion. First, the epidermal SAX-7 pattern was severely affected in dli-1 and eff-1 mutants. Second, the abnormal SAX-7 pattern was predictive of the ectopic PVD dendrites. Third, expression of DLI-1 or EFF-1 in the epidermis rescued both the SAX-7 pattern and the disorganized PVD dendrite phenotypes, whereas expression of these molecules in the PVD did not. We also show that DLI-1 functions cell-autonomously in the PVD to promote distal branch formation. These results demonstrate the unexpected roles of DLI-1 and EFF-1 in the epidermis in the control of PVD dendrite morphogenesis. © 2017. Published by The Company of Biologists Ltd.
L. Cao (Lu); M. Graauw (Marjo de); K. Yan (Kuan); L.C.J. Winkel (Leah C.J.); F.J. Verbeek (Fons)
2016-01-01
textabstractBackground: Endocytosis is regarded as a mechanism of attenuating the epidermal growth factor receptor (EGFR) signaling and of receptor degradation. There is increasing evidence becoming available showing that breast cancer progression is associated with a defect in EGFR endocytosis. In
Directory of Open Access Journals (Sweden)
Santosh K Katiyar
Full Text Available Solar ultraviolet (UV radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum, inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells.
A longitudinal study of structural brain network changes with normal aging
Directory of Open Access Journals (Sweden)
Kai eWu
2013-04-01
Full Text Available The aim of this study was to investigate age-related changes in the topological organization of structural brain networks by applying a longitudinal design over 6 years. Structural brain networks were derived from measurements of regional gray matter volume and were constructed in age-specific groups from baseline and follow-up scans. The structural brain networks showed economical small-world properties, providing high global and local efficiency for parallel information processing at low connection costs. In the analysis of the global network properties, the local and global efficiency of the baseline scan were significantly lower compared to the follow-up scan. Moreover, the annual rate of changes in local and global efficiency showed a positive and negative quadratic correlation with the baseline age, respectively; both curvilinear correlations peaked at approximately the age of 50. In the analysis of the regional nodal properties, significant negative correlations between the annual rate of changes in nodal strength and the baseline age were found in the brain regions primarily involved in the visual and motor/ control systems, whereas significant positive quadratic correlations were found in the brain regions predominately associated with the default-mode, attention, and memory systems. The results of the longitudinal study are consistent with the findings of our previous cross-sectional study: the structural brain networks develop into a fast distribution from young to middle age (approximately 50 years old and eventually became a fast localization in the old age. Our findings elucidate the network topology of structural brain networks and its longitudinal changes, thus enhancing the understanding of the underlying physiology of normal aging in the human brain.
Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.
Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R
1991-12-01
The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.
Protective immunity to UV radiation-induced skin tumours induced by skin grafts and epidermal cells
International Nuclear Information System (INIS)
Ronald Sluyter; Kylie S Yuen; Gary M Halliday
2001-01-01
There is little evidence that cutaneous dendritic cells (DC), including epidermal Langerhans cells (LC), can induce immunity to UV radiation (UVR)-induced skin tumours. Here, it is shown that cells within skin can induce protective antitumour immunity against a UVR-induced fibrosarcoma. Transplantation of the skin overlying subcutaneous tumours onto naive recipients could induce protective antitumour immunity, probably because the grafting stimulated the tumour Ag-loaded DC to migrate to local lymph nodes. This suggests that cutaneous APC can present tumour Ag to induce protective antitumour immunity. Previously, it has been shown that immunization of mice with MHC class II+ epidermal cells (EC) pulsed with tumour extracts could induce delayed-type hypersensitivity against tumour cells. Here, this same immunization protocol could induce protective immunity against a minimum tumorigenic dose of UVR-induced fibrosarcoma cells, but not higher doses. Epidermal cells obtained from semiallogeneic donors and pulsed with tumour extract could also induce protective immunity. However, presentation of BSA Ag from the culture medium was found to contribute to this result using semiallogeneic EC. The results suggest that LC overlying skin tumours may be able to induce protective immunity to UVR-induced tumours if stimulated to migrate from the skin. Copyright (2001) Australasian Society of Immunology Inc
Kim, Jungmin; Cho, Yunhi
2013-01-01
We have previously reported that dietary gromwell (Lithospermum erythrorhizon; LE) prevents the development of atopic dermatitis (AD) with increased epidermal levels of total ceramide (Cer), the major lipid maintaining epidermal barrier. In this study, we investigated whether the increased level of total Cer induced by dietary LE would be related to the altered metabolism of glucosylceramide (GlcCer) and sphingomyelin (SM), two major precursor lipids in Cer generation. NC/Nga mice, an animal ...
DEFF Research Database (Denmark)
Christensen, M E; Therkildsen, M H; Poulsen, Steen Seier
1993-01-01
the basal cell layer. The present investigation and our previous results confirm the existence of EGF receptors, TGF-alpha and EGF in laryngeal carcinomas. In addition, we conclude that the conditions do exist for growth factors to act through an autocrine system in poorly differentiated tumours and through......Fifteen laryngeal squamous cell carcinomas were investigated for the presence of transforming growth factor alpha (TGF-alpha) and epidermal growth factor (EGF) using immunohistochemical methods. In a recent study the same material was characterized for epidermal growth factor receptors (EGF...... receptors) which were confined predominantly to the undifferentiated cells. The expression of this growth factor system in malignant cells may play a role in carcinogenesis and/or tumour growth. All carcinomas were positive for TGF-alpha and 12 were positive for EGF. In moderately-to-well differentiated...
A novel role of RASSF9 in maintaining epidermal homeostasis.
Directory of Open Access Journals (Sweden)
Chiou-Mei Lee
Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.
The DAF-16/FOXO transcription factor functions as a regulator of epidermal innate immunity.
Zou, Cheng-Gang; Tu, Qiu; Niu, Jie; Ji, Xing-Lai; Zhang, Ke-Qin
2013-01-01
The Caenorhabditis elegans DAF-16 transcription factor is critical for diverse biological processes, particularly longevity and stress resistance. Disruption of the DAF-2 signaling cascade promotes DAF-16 activation, and confers resistance to killing by pathogenic bacteria, such as Pseudomonas aeruginosa, Staphylococcus aureus, and Enterococcus faecalis. However, daf-16 mutants exhibit similar sensitivity to these bacteria as wild-type animals, suggesting that DAF-16 is not normally activated by these bacterial pathogens. In this report, we demonstrate that DAF-16 can be directly activated by fungal infection and wounding in wild-type animals, which is independent of the DAF-2 pathway. Fungal infection and wounding initiate the Gαq signaling cascade, leading to Ca(2+) release. Ca(2+) mediates the activation of BLI-3, a dual-oxidase, resulting in the production of reactive oxygen species (ROS). ROS then activate DAF-16 through a Ste20-like kinase-1/CST-1. Our results indicate that DAF-16 in the epidermis is required for survival after fungal infection and wounding. Thus, the EGL-30-Ca(2+)-BLI-3-CST-1-DAF-16 signaling represents a previously unknown pathway to regulate epidermal damage response.
Association of structural global brain network properties with intelligence in normal aging.
Directory of Open Access Journals (Sweden)
Florian U Fischer
Full Text Available Higher general intelligence attenuates age-associated cognitive decline and the risk of dementia. Thus, intelligence has been associated with cognitive reserve or resilience in normal aging. Neurophysiologically, intelligence is considered as a complex capacity that is dependent on a global cognitive network rather than isolated brain areas. An association of structural as well as functional brain network characteristics with intelligence has already been reported in young adults. We investigated the relationship between global structural brain network properties, general intelligence and age in a group of 43 cognitively healthy elderly, age 60-85 years. Individuals were assessed cross-sectionally using Wechsler Adult Intelligence Scale-Revised (WAIS-R and diffusion-tensor imaging. Structural brain networks were reconstructed individually using deterministic tractography, global network properties (global efficiency, mean shortest path length, and clustering coefficient were determined by graph theory and correlated to intelligence scores within both age groups. Network properties were significantly correlated to age, whereas no significant correlation to WAIS-R was observed. However, in a subgroup of 15 individuals aged 75 and above, the network properties were significantly correlated to WAIS-R. Our findings suggest that general intelligence and global properties of structural brain networks may not be generally associated in cognitively healthy elderly. However, we provide first evidence of an association between global structural brain network properties and general intelligence in advanced elderly. Intelligence might be affected by age-associated network deterioration only if a certain threshold of structural degeneration is exceeded. Thus, age-associated brain structural changes seem to be partially compensated by the network and the range of this compensation might be a surrogate of cognitive reserve or brain resilience.
Association of Structural Global Brain Network Properties with Intelligence in Normal Aging
Fischer, Florian U.; Wolf, Dominik; Scheurich, Armin; Fellgiebel, Andreas
2014-01-01
Higher general intelligence attenuates age-associated cognitive decline and the risk of dementia. Thus, intelligence has been associated with cognitive reserve or resilience in normal aging. Neurophysiologically, intelligence is considered as a complex capacity that is dependent on a global cognitive network rather than isolated brain areas. An association of structural as well as functional brain network characteristics with intelligence has already been reported in young adults. We investigated the relationship between global structural brain network properties, general intelligence and age in a group of 43 cognitively healthy elderly, age 60–85 years. Individuals were assessed cross-sectionally using Wechsler Adult Intelligence Scale-Revised (WAIS-R) and diffusion-tensor imaging. Structural brain networks were reconstructed individually using deterministic tractography, global network properties (global efficiency, mean shortest path length, and clustering coefficient) were determined by graph theory and correlated to intelligence scores within both age groups. Network properties were significantly correlated to age, whereas no significant correlation to WAIS-R was observed. However, in a subgroup of 15 individuals aged 75 and above, the network properties were significantly correlated to WAIS-R. Our findings suggest that general intelligence and global properties of structural brain networks may not be generally associated in cognitively healthy elderly. However, we provide first evidence of an association between global structural brain network properties and general intelligence in advanced elderly. Intelligence might be affected by age-associated network deterioration only if a certain threshold of structural degeneration is exceeded. Thus, age-associated brain structural changes seem to be partially compensated by the network and the range of this compensation might be a surrogate of cognitive reserve or brain resilience. PMID:24465994
Directory of Open Access Journals (Sweden)
Lakshmana K Yerneni
2007-01-01
Full Text Available Closure of burn wound is the primary requirement in order to reduce morbidity and mortality that are otherwise very high due to non-availability of permanent wound covering materials. Sheets of cultured epidermis grown from autologous epidermal keratinocyte stem cells are accepted world over as one of the best wound covering materials. In a largely populated country like ours where burn casualties occur more frequently due to inadequate safety practices, there is a need for indigenous research inputs to develop such methodologies. The technique to culturing epidermal sheets in vitro involves the basic Reheinwald-Green method with our own beneficial inputs. The technique employs attenuated 3T3 cells as feeders for propagating keratinocyte stem cells that are isolated from the epidermis of an initial skin biopsy of about 5 cm2 from the patient. The cultures are then maintained in Dulbecco's modified Eagle's medium strengthened with Ham's F12 formula, bovine fetal serum and various specific growth-promoting agents and factors in culture flasks under standard culture conditions. The primary cultures thus established would be serially passaged to achieve the required expansion. Our major inputs are into the establishment of (1 an efficient differential trypsinization protocol to isolate large number epidermal keratinocytes from the skin biopsy, (2 a highly specific, unique and foolproof attenuation protocol for 3T3 cells and (3 a specialized and significant decontamination protocol. The fully formed epidermal sheet as verified by immuno-histochemical and light & electron microscopic studies, is lifted on to paraffin gauze by incubating in a neutral protease. The graft is then ready to be transported to the operating theatre for autologous application. We have a capability of growing cultured epidermal sheets sufficient enough to cover 40 per cent burn wound in 28 days. The preliminary small area clinical applications undertaken so far revealed
Structural performance of a multipurpose canister shell for HLNW under normal handling conditions
International Nuclear Information System (INIS)
Ladkany, S.G.; Rajagopalan, R.
1994-01-01
A Multipurpose Canister (MPC) is analyzed for critical stresses that occur during normal handling conditions and accidental scenarios. Linear and Non-linear Finite Element Analysis is performed and the stresses at various critical locations in the MPC and its weldments are studied extensively. Progressive failure analysis of the MPC's groove and fillet welds, is presented. The structural response of the MPC to dynamic lifting loads, to loads resulting from an accidental slippage of a crane cable carrying the MPC, and from the impact between two canisters, is evaluated. Nonlinear structural analysis is used in the evaluation of the local buckling and the ultimate failure phenomena in the shell when the steel is in the strain hardening state during impact. Results make a case for increasing the thickness of the shell and all the welds
Isolation and In Vitro Characterization of Epidermal Stem Cells
DEFF Research Database (Denmark)
Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak
2017-01-01
flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...
Vaccine-induced toxic epidermal necrolysis: A case and systematic review
Chahal, Dev; Aleshin, Maria; Turegano, Mamina; Chiu, Melvin; Worswick, Scott
2018-01-01
Background: Erythema multiforme (EM), Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are cutaneous hypersensitivityreactions that develop in response to specific triggers such as medications and certain infections. Vaccines, which undergo rigorous safety testing prior to use in humans, are a rare cause of SJS/TEN and little is known about the frequency of such events and corresponding pathogenesis. Objective: Herein, we discuss a case of suspected TEN in a 19-yea...
Rastogi, Anshu; Pospísil, Pavel
2010-08-01
All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.
Development of epidermal growth factor receptor targeted therapy in pancreatic cancer.
Qing, Liu; Qing, Wang
2018-02-01
The epidermal growth factor receptor (EGFR) family are a series of important cancer therapeutic targets involved in cancer biology. These genes play an important role in tumor biological characteristics including angiogenesis, cell survival, invasion and glucose metabolism. In recent years, progresses have been achieved upon the cellular and molecular biological characteristics of EGFR and its role in cancer development based on the study of tumor specimens and experimental animal model. EGFR(HER1/ErbB) is overexpressed in over sixty percent of triple-negative breast cancers and occurs in pancreatic, bladder, lung and head-and-neck cancers. Up to now, EGFR inhibitors have been applied in various of cancer, such as lung, breast, bladder and head and neck cancers etc., in which the combination of EGFR inhibitors plus chemotherapeutic agents is now seen as the standard of care for advanced/metastatic pancreatic cancer. For these reasons, EGFR inhibitors and their therapeutic effect for pancreatic cancer is becoming the focus in Laboratory and clinical research. In this paper, research progress of the development of epidermal growth factor receptor targeted therapy in pancreatic cancer is introduced.
Directory of Open Access Journals (Sweden)
Yung-Yi Lee
2013-06-01
Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.
International Nuclear Information System (INIS)
Kobayashi, Koshi
1977-01-01
Epidermal mitotic activity during wound healing was estimated both in the adrenalectomized, head-irradiated mice and in the adrenalectomized, non-irradiated mice, and was compared with those obtained previously from the unoperated, head-irradiated mice. It was found that head-irradiation caused a mitotic depression to a much smaller extent in the adrenalectomized mice than it did in the unoperated mice, though adrenalectomy itself had exerted a great inhibitory effect upon the mitosis induced by an injury. Whether this abscopal effect of head-irradiation upon the mitotic activity was mediated via the adrenals, and whether in the adrenalectomized mice the head-irradiation acted to increase epidermal response to injury, making the mitotic pattern of adrenalectomized mice to come near that of control mice were discussed. (auth.)
Flexible pH-Sensing Hydrogel Fibers for Epidermal Applications.
Tamayol, Ali; Akbari, Mohsen; Zilberman, Yael; Comotto, Mattia; Lesha, Emal; Serex, Ludovic; Bagherifard, Sara; Chen, Yu; Fu, Guoqing; Ameri, Shideh Kabiri; Ruan, Weitong; Miller, Eric L; Dokmeci, Mehmet R; Sonkusale, Sameer; Khademhosseini, Ali
2016-03-01
Epidermal pH is an indication of the skin's physiological condition. For example, pH of wound can be correlated to angiogenesis, protease activity, bacterial infection, etc. Chronic nonhealing wounds are known to have an elevated alkaline environment, while healing process occurs more readily in an acidic environment. Thus, dermal patches capable of continuous pH measurement can be used as point-of-care systems for monitoring skin disorder and the wound healing process. Here, pH-responsive hydrogel fibers are presented that can be used for long-term monitoring of epidermal wound condition. pH-responsive dyes are loaded into mesoporous microparticles and incorporated into hydrogel fibers using a microfluidic spinning system. The fabricated pH-responsive microfibers are flexible and can create conformal contact with skin. The response of pH-sensitive fibers with different compositions and thicknesses are characterized. The suggested technique is scalable and can be used to fabricate hydrogel-based wound dressings with clinically relevant dimensions. Images of the pH-sensing fibers during real-time pH measurement can be captured with a smart phone camera for convenient readout on-site. Through image processing, a quantitative pH map of the hydrogel fibers and the underlying tissue can be extracted. The developed skin dressing can act as a point-of-care device for monitoring the wound healing process. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Griffiths, Paul D.; Batty, Ruth; Connolly, Dan J.A.; Reeves, Michael J.
2009-01-01
The midline structures of the supra-tentorial brain are important landmarks for judging if the brain has formed correctly. In this article, we consider the normal appearances of the corpus callosum, septum pellucidum and fornix as shown on MR imaging in normal and near-normal states. (orig.)
Chen, Yaojing; Chen, Kewei; Zhang, Junying; Li, Xin; Shu, Ni; Wang, Jun; Zhang, Zhanjun; Reiman, Eric M
2015-03-13
As the Apolipoprotein E (APOE) ɛ4 allele is a major genetic risk factor for sporadic Alzheimer's disease (AD), which has been suggested as a disconnection syndrome manifested by the disruption of white matter (WM) integrity and functional connectivity (FC), elucidating the subtle brain structural and functional network changes in cognitively normal ɛ4 carriers is essential for identifying sensitive neuroimaging based biomarkers and understanding the preclinical AD-related abnormality development. We first constructed functional network on the basis of resting-state functional magnetic resonance imaging and a structural network on the basis of diffusion tensor image. Using global, local and nodal efficiencies of these two networks, we then examined (i) the differences of functional and WM structural network between cognitively normal ɛ4 carriers and non-carriers simultaneously, (ii) the sensitivity of these indices as biomarkers, and (iii) their relationship to behavior measurements, as well as to cholesterol level. For ɛ4 carriers, we found reduced global efficiency significantly in WM and marginally in FC, regional FC dysfunctions mainly in medial temporal areas, and more widespread for WM network. Importantly, the right parahippocampal gyrus (PHG.R) was the only region with simultaneous functional and structural damage, and the nodal efficiency of PHG.R in WM network mediates the APOE ɛ4 effect on memory function. Finally, the cholesterol level correlated with WM network differently than with the functional network in ɛ4 carriers. Our results demonstrated ɛ4-specific abnormal structural and functional patterns, which may potentially serve as biomarkers for early detection before the onset of the disease.
Epidermal growth factor receptor structural alterations in gastric cancer
International Nuclear Information System (INIS)
Moutinho, Cátia; Mateus, Ana R; Milanezi, Fernanda; Carneiro, Fátima; Seruca, Raquel; Suriano, Gianpaolo
2008-01-01
EGFR overexpression has been described in many human tumours including gastric cancer. In NSCLC patients somatic EGFR mutations, within the kinase domain of the protein, as well as gene amplification were associated with a good clinical response to EGFR inhibitors. In gastric tumours data concerning structural alterations of EGFR remains controversial. Given its possible therapeutic relevance, we aimed to determine the frequency and type of structural alterations of the EGFR gene in a series of primary gastric carcinomas. Direct sequencing of the kinase domain of the EGFR gene was performed in a series of 77 primary gastric carcinomas. FISH analysis was performed in 30 cases. Association studies between EGFR alterations and the clinical pathological features of the tumours were performed. Within the 77 primary gastric carcinomas we found two EGFR somatic mutations and several EGFR polymorphisms in exon 20. Six different intronic sequence variants of EGFR were also found. Four gastric carcinomas showed balanced polysomy or EGFR gene amplification. We verified that gastric carcinoma with alterations of EGFR (somatic mutations or copy number variation) showed a significant increase of tumour size (p = 0.0094) in comparison to wild-type EGFR carcinomas. We demonstrate that EGFR structural alterations are rare in gastric carcinoma, but whenever present, it leads to tumour growth. We considered that searching for EGFR alterations in gastric cancer is likely to be clinically important in order to identify patients susceptible to respond to tyrosine kinase inhibitors
Wang, Shujun; Wang, Jinrong; Yu, Jinglin; Wang, Shuo
2016-01-01
The effects of three saturated fatty acids on functional properties of normal wheat and waxy wheat starches were investigated. The complexing index (CI) of normal wheat starch-fatty acid complexes decreased with increasing carbon chain length. In contrast, waxy wheat starch-fatty acid complexes presented much lower CI. V-type crystalline polymorphs were formed between normal wheat starch and three fatty acids, with shorter chain fatty acids producing more crystalline structure. FTIR and Raman spectroscopy presented the similar results with XRD. The formation of amylose-fatty acid complex inhibited granule swelling, gelatinization progression, retrogradation and pasting development of normal wheat starch, with longer chain fatty acids showing greater inhibition. Amylopectin can also form complexes with fatty acids, but the amount of complex was too little to be detected by XRD, FTIR, Raman and DSC. As a consequence, small changes were observed in the functional properties of waxy wheat starch with the addition of fatty acids. Copyright © 2015 Elsevier Ltd. All rights reserved.
Nandakumar, Vivek; Kelbauskas, Laimonas; Hernandez, Kathryn F; Lintecum, Kelly M; Senechal, Patti; Bussey, Kimberly J; Davies, Paul C W; Johnson, Roger H; Meldrum, Deirdre R
2012-01-01
Grading schemes for breast cancer diagnosis are predominantly based on pathologists' qualitative assessment of altered nuclear structure from 2D brightfield microscopy images. However, cells are three-dimensional (3D) objects with features that are inherently 3D and thus poorly characterized in 2D. Our goal is to quantitatively characterize nuclear structure in 3D, assess its variation with malignancy, and investigate whether such variation correlates with standard nuclear grading criteria. We applied micro-optical computed tomographic imaging and automated 3D nuclear morphometry to quantify and compare morphological variations between human cell lines derived from normal, benign fibrocystic or malignant breast epithelium. To reproduce the appearance and contrast in clinical cytopathology images, we stained cells with hematoxylin and eosin and obtained 3D images of 150 individual stained cells of each cell type at sub-micron, isotropic resolution. Applying volumetric image analyses, we computed 42 3D morphological and textural descriptors of cellular and nuclear structure. We observed four distinct nuclear shape categories, the predominant being a mushroom cap shape. Cell and nuclear volumes increased from normal to fibrocystic to metastatic type, but there was little difference in the volume ratio of nucleus to cytoplasm (N/C ratio) between the lines. Abnormal cell nuclei had more nucleoli, markedly higher density and clumpier chromatin organization compared to normal. Nuclei of non-tumorigenic, fibrocystic cells exhibited larger textural variations than metastatic cell nuclei. At pfibrocystic from the metastatic cell populations. Our results provide a new perspective on nuclear structure variations associated with malignancy and point to the value of automated quantitative 3D nuclear morphometry as an objective tool to enable development of sensitive and specific nuclear grade classification in breast cancer diagnosis.
Matsumoto, Reiko; Sugimoto, Masazumi
2007-02-01
We have established a new culture system to study re-epithelialization during fish epidermal wound healing. In this culture system, fetal bovine serum (FBS) stimulates the epidermal outgrowth of multi-cellular layers from scale skin mounted on a coverslip, even when cell proliferation is blocked. The rate of outgrowth is about 0.4 mm/h, and at 3 h after incubation, the area occupied by the epidermal sheet is nine times larger than the area of the original scale skin. Cells at the bottom of the outgrowth show a migratory phenotype with lamellipodia, and "purse string"-like actin bundles have been found over the leading-edge cells with polarized lamellipodia. In the superficial cells, re-development of adherens junctions and microridges has been detected, together with the appearance and translocation of phosphorylated p38 MAPK into nuclear areas. Thus, this culture system provides an excellent model to study the mechanisms of epidermal outgrowth accompanied by migration and re-differentiation. We have also examined the role of extracellular matrix proteins in the outgrowth. Type I collagen or fibronectin stimulates moderate outgrowth in the absence of FBS, but development of microridges and the distribution of phosphorylated p38 MAPK are attenuated in the superficial cells. In addition, the leading-edge cells do not have apparent "purse string"-like actin bundles. The outgrowth stimulated by FBS is inhibited by laminin. These results suggest that dermal substrates such as type I collagen and fibronectin are able to initiate epidermal outgrowth but require other factors to enhance such outgrowth, together with coordinated alterations in cellular phenotype.
International Nuclear Information System (INIS)
Ejaz, A.; Raza, N.; Iftikhar, N.; Muzzafar, F.
2008-01-01
To compare the efficacy and safety of Jessner's solution with 30% salicylic acid as superficial chemical peeling agents in treating epidermal melasma in Asian skin. Sixty consenting patients with epidermal melasma were randomly divided into two groups. Group A was treated with Jessner's solution and Group B with 30% salicylic acid. Baseline Melasma Area Severity Index (MASI) score was noted and peeling started at 2-weekly intervals. Sunscreen in morning and moisturizer at night were prescribed in all patients. MASI score and adverse effects were recorded biweekly. Treatment was stopped at 12 weeks and patients were followed-up at 4 weekly intervals for further 12 weeks. Final MASI score and adverse effects were noted at the end of follow-up period. Mean MASI scores were compared using paired sample t-test and one-way ANOVA. Difference in baseline, treatment end and follow-up end MASI scores was not statistically significant between the two groups (p=0.54, 0.26, and 0.55 respectively). On the other hand, within group analysis of difference between pre and posttreatment MASI score was highly significant in both groups (p < 0.0001). Adverse effects were mild and comparable in both groups. Jessner's solution and 30% salicylic acid are equally effective and safe peeling agents for use in epidermal melasma in Asian skin. (author)
International Nuclear Information System (INIS)
Reinink, Shawn K.; Yaras, Metin I.
2015-01-01
Forced-convection heat transfer in a heated working fluid at a thermodynamic state near its pseudocritical point is poorly predicted by correlations calibrated with data at subcritical temperatures and pressures. This is suggested to be primarily due to the influence of large wall-normal thermophysical property gradients that develop in proximity of the pseudocritical point on the concentration of coherent turbulence structures near the wall. The physical mechanisms dominating this influence remain poorly understood. In the present study, direct numerical simulation is used to study the development of coherent vortical structures within a turbulent spot under the influence of large wall-normal property gradients. A turbulent spot rather than a fully turbulent boundary layer is used for the study, for the coherent structures of turbulence in a spot tend to be in a more organized state which may allow for more effective identification of cause-and-effect relationships. Large wall-normal gradients in thermophysical properties are created by heating the working fluid which is near the pseudocritical thermodynamic state. It is found that during improved heat transfer, wall-normal gradients in density accelerate the growth of the Kelvin-Helmholtz instability mechanism in the shear layer enveloping low-speed streaks, causing it to roll up into hairpin vortices at a faster rate. It is suggested that this occurs by the baroclinic vorticity generation mechanism which accelerates the streamwise grouping of vorticity during shear layer roll-up. The increased roll-up frequency leads to reduced streamwise spacing between hairpin vortices in wave packets. The density gradients also promote the sinuous instability mode in low-speed streaks. The resulting oscillations in the streaks in the streamwise-spanwise plane lead to locally reduced spanwise spacing between hairpin vortices forming over adjacent low-speed streaks. The reduction in streamwise and spanwise spacing between
Hato, Naohito; Tsujimura, Mika; Takagi, Taro; Okada, Masahiro; Gyo, Kiyofumi; Tohyama, Mikiko; Tauchi, Hisamichi
2013-12-01
The first reported case of facial paralysis due to an inflammatory pseudotumor (IPT) of the facial nerve as a complication of epidermal nevus syndrome (ENS) is herein presented. A 10-month-old female patient was diagnosed with ENS at 3 months of age. She was referred to us because of moderate left facial paralysis. Epidermal nevi of her left auricle extended deep into the external ear canal. Otoscopy revealed polypous nevi and cholesteatoma debris filling the left ear. Computed tomography showed a soft mass filling the ear canal, including the middle ear, and an enormously enlarged facial nerve. Surgical exploration revealed numerous polypous nevi, external ear cholesteatoma, and tumorous swelling of the facial nerve. The middle ear ossicles were completely lost. The facial paralysis was improved after decompression surgery, but recurred 5 months later. A second operation was conducted 10 months after the first. During this operation, facial nerve decompression was completed from the geniculate ganglion to near the stylomastoid foramen. Histological diagnosis of the facial nerve tumor was IPT probably caused by chronic external ear inflammation induced by epidermal nevi. The facial paralysis gradually improved to House-Blackmann grade III 5 years after the second operation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Abdullahi Alanamu ABDULRAHAMAN
2016-06-01
Full Text Available Herbal medicine is the oldest and still the most widely used system of medicine in the world today and they are made exclusively from plants. However, most of these medicines or drugs are adulterated due to lack of proper identification of the plant samples. Method of checking adulteration of drug plants is the main focus of this study. The identification and authentication of dry samples of some medicinal plants were carried out using anatomical features. Twenty-five (25 plants materials were collected in Ibadan and Ilorin, Nigeria. The plants studied include Azardiracta indica, Newboudia leavis, Polyalthia longifolia, Cymbopogon citratus, Anarcardium occidentalis, Nicotiana tobbaccum, Jatropha curcas, Chromoleana odorata, Mangifera indica, Terminalia catappa, Ocimum gratisimum, Morus messosygia, Morinda lucida, Psidium guajava, Vitellaria paradoxa, Annona senegalensis, Vernonia amygdalina, Gliricidium sepium, Ravoulvia vomitora, Telferia occindentalis Citrus aurantifolia, C. limon, C. paradisi and C. sinensis. Leaf epidermal anatomy of these selected plants showed no major variations in stomatal complex types, frequency, size and shape of stomatal cells, epidermal cell wall and trichomes between fresh and dry samples. The variations that occur were between different species but not within species. Leaf epidermal anatomy, therefore, proved to be a significant tool for resolution of taxonomic confusion of dried samples of these plants.
Gupta, Lalit Kumar; Martin, Abhay Mani; Agarwal, Nidheesh; D'Souza, Paschal; Das, Sudip; Kumar, Rajesh; Pande, Sushil; Das, Nilay Kanti; Kumaresan, Muthuvel; Kumar, Piyush; Garg, Anubhav; Singh, Saurabh
2016-01-01
Stevens-Johnson syndrome and toxic epidermal necrolysis are severe, life-threatening mucocutaneous adverse drug reactions with a high morbidity and mortality that require immediate medical care. The various immunomodulatory treatments include systemic corticosteroids, cyclosporine, intravenous immunoglobulin, cyclophosphamide, plasmapheresis and tumor necrosis factor-α inhibitors. The ideal therapy of Stevens-Johnson syndrome/toxic epidermal necrolysis still remains a matter of debate as there are only a limited number of studies of good quality comparing the usefulness of different specific treatments. The aim of this article is to comprehensively review the published medical literature and frame management guidelines suitable in the Indian perspective. The Indian Association of Dermatologists, Venereologists and Leprologists (IADVL) assigned the task of preparing these guidelines to its special interest group on cutaneous adverse drug reactions. The group performed a comprehensive English language literature search for management options in Stevens-Johnson syndrome/toxic epidermal necrolysis across multiple databases (PubMed, EMBASE, MEDLINE and Cochrane) for keywords (alone and in combination) and MeSH items such as "guidelines," "Stevens-Johnson syndrome," "toxic epidermal necrolysis," "corticosteroids," "intravenous immunoglobulin," "cyclosporine" and "management." The available evidence was evaluated using the strength of recommendation taxonomy and graded using a three-point scale. A draft of clinical recommendations was developed on the best available evidence which was also scrutinized and critically evaluated by the IADVL Academy of Dermatology. Based on the inputs received, this final consensus statement was prepared. A total of 104 articles (meta-analyses, prospective and retrospective studies, reviews [including chapters in books], previous guidelines [including Indian guidelines of 2006] and case series) were critically evaluated and the evidence
Langer, S L; Vargas, V M F; Flores-Lopes, F; Malabarba, L R
2009-05-01
Manifestation of infectious pathologies in fishes usually increases in environments where organic wastes are disposed. Specimens of Mugil platanus Günther, 1880 and water samples collected at three points of the Tramandaí river were analyzed during a one year period. The macroscopic observation revealed ulcerations in the caudal peduncle area covered with a mass of amorphous and whitened tissues. Histopathologic analysis showed the presence of negative gram bacteria, probably responsible for alterations of the normal structure of the epidermic tissues. Non-parametric statistical analysis for ammonia concentration showed a significant variation among the three collected spots as well as in the multiple comparison between two spots. In this study, we describe cutaneous lesions observed in Mugil platanus specimens and tested their correlation with environmental ammonia concentration.
DEFF Research Database (Denmark)
Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie
2010-01-01
Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...... of the phosphatidylinositol-3 kinase (PI3K)/Akt pathway. Raft disruption was achieved in normal human keratinocytes and precancerous (HaCaT) or transformed (A431) keratinocytes by cholesterol extraction or inactivation with methyl-beta-cyclodextrin, filipin III, or 5-cholestene-5-beta-ol. Lipid raft disruption did not affect...... in deactivation of mammalian target of rapamycin, activation of FoxO3a, and increased sensitivity to apoptosis stimuli. Lipid raft disruption abrogated the binding of Akt and the major Akt kinase, phosphatidylinositol-dependent kinase 1, to the membrane by pleckstrin-homology domains. Thus, the integrity of lipid...
The acyl-CoA binding protein is required for normal epidermal barrier function in mice
DEFF Research Database (Denmark)
Bloksgaard, Maria; Bek, Signe; Marcher, Ann-Britt
2012-01-01
(+/+) and ACBP(-/-) mice showed very similar composition, except for a significant and specific decrease in the very long chain free fatty acids (VLC-FFA) in stratum corneum of ACBP(-/-) mice. This finding indicates that ACBP is critically involved in the processes that lead to production of stratum corneum VLC......The acyl-CoA binding protein (ACBP) is a 10 kDa intracellular protein expressed in all eukaryotic species. Mice with targeted disruption of Acbp (ACBP(-/-) mice) are viable and fertile but present a visible skin and fur phenotype characterized by greasy fur and development of alopecia and scaling...... with age. Morphology and development of skin and appendages are normal in ACBP(-/-) mice; however, the stratum corneum display altered biophysical properties with reduced proton activity and decreased water content. Mass spectrometry analyses of lipids from epidermis and stratum corneum of ACBP...
DEFF Research Database (Denmark)
Juhl, C O; Vinter-Jensen, Lars; Poulsen, Steen Seier
1995-01-01
Epidermal growth factor (EGF) is an important factor for maintaining the esophageal functional integrity. Goettingen minipigs were treated with either placebo or subcutaneous EGF (30 micrograms/kg/day) for four weeks. Wistar rats were treated with either placebo or subcutaneous EGF (150 microgram...
van Belzen, N.; Spaargaren, M.; Verkleij, A. J.; Boonstra, J.
1990-01-01
Recently it has been established that cytoskeleton-associated epidermal growth factor (EGF) receptors are predominantly of the high-affinity class and that EGF induces a recruitment of low-affinity receptors to the cytoskeleton. The nature of this EGF-induced receptor-cytoskeleton interaction,
Bogaard, E.H. van den; Podolsky, M.A.; Smits, J.P.H.; Cui, X.; John, C.; Gowda, K.; Desai, D.; Amin, S.G.; Schalkwijk, J.; Perdew, G.H.; Glick, A.B.
2015-01-01
Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis
Transient expression of P-type ATPases in tobacco epidermal cells
DEFF Research Database (Denmark)
Pedas, Lisbeth Rosager; Palmgren, Michael Broberg; Lopez Marques, Rosa Laura
2016-01-01
Transient expression in tobacco cells is a convenient method for several purposes such as analysis of protein-protein interactions and the subcellular localization of plant proteins. A suspension of Agrobacterium tumefaciens cells carrying the plasmid of interest is injected into the intracellula...... for example protein-protein interaction studies. In this chapter, we describe the procedure to transiently express P-type ATPases in tobacco epidermal cells, with focus on subcellular localization of the protein complexes formed by P4-ATPases and their β-subunits....
Lack of upregulation of epidermal fatty acid binding protein in dithranol induced irritation.
Kucharekova, M.; Vissers, W.H.P.M.; Schalkwijk, J.; Kerkhof, P.C.M. van de; Valk, P.G.M. van der
2003-01-01
The exact role of epidermal fatty acid binding protein (E-FABP) in skin is unknown. A restoration of the barrier function may be associated with an upregulation of E-FABP. Moreover, E-FABP is upregulated in a variety of cells in response to oxidative stress. A recent observation that dithranol
de Carvalho, Paulo Victor Rodrigues; Gomes, José Orlando; Huber, Gilbert Jacob; Vidal, Mario Cesar
2009-05-01
A fundamental challenge in improving the safety of complex systems is to understand how accidents emerge in normal working situations, with equipment functioning normally in normally structured organizations. We present a field study of the en route mid-air collision between a commercial carrier and an executive jet, in the clear afternoon Amazon sky in which 154 people lost their lives, that illustrates one response to this challenge. Our focus was on how and why the several safety barriers of a well structured air traffic system melted down enabling the occurrence of this tragedy, without any catastrophic component failure, and in a situation where everything was functioning normally. We identify strong consistencies and feedbacks regarding factors of system day-to-day functioning that made monitoring and awareness difficult, and the cognitive strategies that operators have developed to deal with overall system behavior. These findings emphasize the active problem-solving behavior needed in air traffic control work, and highlight how the day-to-day functioning of the system can jeopardize such behavior. An immediate consequence is that safety managers and engineers should review their traditional safety approach and accident models based on equipment failure probability, linear combinations of failures, rules and procedures, and human errors, to deal with complex patterns of coincidence possibilities, unexpected links, resonance among system functions and activities, and system cognition.
Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei
2016-02-01
Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor
Fatal toxic epidermal necrolysis associated with minoxidil.
Karaoui, Lamis R; Chahine-Chakhtoura, Corinne
2009-04-01
Minoxidil is a direct-acting peripheral vasodilator for the treatment of symptomatic hypertension, or refractory hypertension associated with target organ damage, that is not manageable with a diuretic and two other antihypertensive drugs. The most frequent adverse events associated with minoxidil include hypertrichosis and cardiovascular events related to its powerful antihypertensive effect, and less frequently, rashes, bullous eruptions, and Stevens-Johnson syndrome (SJS). Evidence suggests that SJS and toxic epidermal necrolysis (TEN) are variants of a single disease with common causes and mechanisms, but differing severities. Epidermal detachment is mild in SJS, moderate in overlap SJS-TEN, and severe (> 30% of body surface area) in TEN. We describe a case of minoxidil-associated SJS that evolved into fatal TEN. A 69-year-old African-American woman with a history of chronic kidney disease was admitted to the hospital for a cerebrovascular accident and uncontrolled hypertension. On hospital day 12, oral minoxidil was added to her drug regimen. On day 23, she developed a maculopapular rash on her face that gradually diffused to her chest and back. Vesicles and papular lesions extended to her extremities and mucosal membranes; results of a skin biopsy revealed SJS. A positive Nikolsky's sign (blisters spread on application of pressure) was detected. On days 27-31, diffuse bullae developed with rash exacerbation. Skin detachment exceeded 30% and was consistent with TEN. The patient died on day 39. An evaluation of the causality and time course suggested that minoxidil was the most likely culpable drug, with a Naranjo adverse drug reaction probability scale score indicating that the likelihood of the association was possible (score of 3). The mechanism of this reaction has not been well elucidated. It may be related to an impaired clearance of the minoxidil metabolite, or an immune stimulation resulting in apoptosis and epidermis destruction. To our knowledge, this
International Nuclear Information System (INIS)
Villano, C.M.; White, L.A.
2006-01-01
The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes
Acyl-CoA binding protein and epidermal barrier function
DEFF Research Database (Denmark)
Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J
2014-01-01
The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...
Epidermal segmentation in high-definition optical coherence tomography.
Li, Annan; Cheng, Jun; Yow, Ai Ping; Wall, Carolin; Wong, Damon Wing Kee; Tey, Hong Liang; Liu, Jiang
2015-01-01
Epidermis segmentation is a crucial step in many dermatological applications. Recently, high-definition optical coherence tomography (HD-OCT) has been developed and applied to imaging subsurface skin tissues. In this paper, a novel epidermis segmentation method using HD-OCT is proposed in which the epidermis is segmented by 3 steps: the weighted least square-based pre-processing, the graph-based skin surface detection and the local integral projection-based dermal-epidermal junction detection respectively. Using a dataset of five 3D volumes, we found that this method correlates well with the conventional method of manually marking out the epidermis. This method can therefore serve to effectively and rapidly delineate the epidermis for study and clinical management of skin diseases.
DEFF Research Database (Denmark)
Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus
2003-01-01
Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...... activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology...
Directory of Open Access Journals (Sweden)
Erol Koç
2014-03-01
Full Text Available Background: Er: YAG lasers are precise ablation systems used in the treatment epidermal and dermal benign skin lesions. In this study, we restrospectively analysed efficiency of Er: YAG laser therapy in the treatment of epidermal and dermal benign skin lesions. Materials and Methods: We retrospectively investigated our clinical records of 116 patients treated with Er: YAG laser between April 2011 and April 2013. The clinical records of 103 patients (47 men, 56 women were included in our study. Of these 103 patients included in the study were xanthelasma, solar lentigo, epidermal nevus, seborrheic keratosis, nevus of ota, syringoma, cafe au lait macules (CALM and other than these. Treatment parameters, demographic features and before and after photographs of the lesions were investigated from patients’ records in order to evaluate efficiency of Er: YAG laser therapy. Results: Of these 103 patients included in the study were evaluated in 8 groups, described as xanthelasma (n=21, syringoma (n=17, solar lentigo (n=16, epidermal nevus (n=11, seborrheic keratosis (n=9, nevus of ota (n=5, CALM (n=3 and other than these (n=21. In the Er: YAG laser treatment, the average energy flow was 3-7 J/cm2, the average pulse duration was 300 ms, the average number of passes was 3-5 repeat, and the average pulse frequency was 3-7 Hz. While 4.9% of the patients showed no improvement, 59.2% showed marked improvement, 26.2% showed moderate improvement and 9.7% showed mild improvement. Treatment responses in xanthelasma, syringoma, epidermal nevus, solar lentigo and CALM lesions were statistically significant. Observed side effects were hyperpigmentation in 4 patients, hypopigmentation in 3 patients, hypertrophic scar in 2 patients and persistent erythema in one patient and the treatment was well tolerated by all the patients. Conclusion: Er: YAG laser is an effective and safe treatment option in the treatment of benign skin lesions especially in epidermal lesions.
Mawson, Anthony R; Eriator, Ike; Karre, Sridhar
2015-01-12
Stevens-Johnson syndrome and toxic epidermal necrolysis (SJS/TEN) are overlapping manifestations on a spectrum of acute drug-induced conditions associated with severe blistering, skin peeling, and multi-organ damage. TEN is an eruption resembling severe scalding, with ≥30% skin detachment. SJS is a mild form of TEN, characterized histologically by epidermal keratinocyte apoptosis with dermo-epidermal separation and extensive small blisters with <10% body surface skin detachment. The syndrome can be induced by numerous medications and typically occurs 1-4 weeks after the initiation of therapy. Granulysin is found in the lesions of patients with SJS/TEN and plays a significant pathogenic role in the condition, but the overall mechanisms linking medications, granulysin, and disease manifestations remain obscure. This paper reviews evidence suggesting that the different medications implicated in SJS/TEN have the common property of interacting and synergizing with endogenous retinoids (vitamin A and its congeners), in many instances causing the latter to accumulate in and damage the liver, the main storage organ for vitamin A. It is hypothesized that liver damage leads to the spillage of toxic retinoid compounds into the circulation, resulting in an endogenous form of hypervitaminosis A and cytotoxicity with widespread apoptosis, mediated by granulysin and recognized as SJS/TEN. Subject to testing, the model suggests that symptom worsening could be arrested at onset by lowering the concentration of circulating retinoids and/or granulysin via phlebotomy or plasmapheresis or by pharmacological measures to limit their expression.
Normally closed microgrippers using a highly stressed diamond-like carbon and Ni bimorph structure
Luo, J. K.; Flewitt, A. J.; Spearing, S. M.; Fleck, N. A.; Milne, W. I.
2004-12-01
A normally closed microgripper with a radius of curvature of 18-50 μm using a diamond-like carbon (DLC) and stress free electroplated Ni bimorph structure has been demonstrated. The large curvature in the fingers of the microgrippers is due to the high compressive stress of the DLC layer. The radius of curvature of the figures can be adjusted by the thickness ratio, and the closure of the devices can also be adjusted by varying the finger length. This device works much more efficiently than other bimorph structures due to the large difference in thermal expansion coefficients between the DLC and the Ni layers. Preliminary electrical tests have shown these microgrippers can be opened by 60°-90° at an applied power of <20mW.
Energy Technology Data Exchange (ETDEWEB)
Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando
2000-02-01
The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG{sub 1}), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of {sup 99m}Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14{+-}2.50 %ID/g, 5.06{+-}2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy.
International Nuclear Information System (INIS)
Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando
2000-01-01
The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG 1 ), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 μg/100 μCi of 99m Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of 99m Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14±2.50 %ID/g, 5.06±2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy
Expression of epidermal growth factor receptors in human endometrial carcinoma
DEFF Research Database (Denmark)
Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B
1993-01-01
Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...
DEFF Research Database (Denmark)
Ejskjaer, Kirsten; Sorensen, Boe Sandahl; Poulsen, Steen Seier
2008-01-01
BACKGROUND: The epidermal growth factor (EGF) system comprises four receptors, HER1-4, and several ligands, and is cyclically expressed in endometrium from healthy fertile women. Our aim is to identify differences in expression of the EGF system between endometriotic and normal endometrium. METHODS......: We previously examined the EGF system in endometrial samples from healthy women (n = 14). Here we examine samples from endometrium (n = 23), endometriomas (n = 10) and peritoneal endometriosis (n = 9) from women with endometriosis (n = 23). mRNA expression of receptors and ligands from the EGF system...... was analyzed by real-time PCR, and proteins were localized by immunohistochemistry. RESULTS: Endometrial mRNA for HER1-3 was high compared with our previous findings in healthy endometrium, whereas HER4 and the ligands were unchanged. Endometriomas show lower expression of HER1-3 and no HER4 expression...
Ferrer, C; Solano, F; Zuasti, A
1999-04-01
We have studied the pigmentary system of the teleost Sparus aurata skin by electron microscopy and chromatographic analysis. Under electron microscopy, we found the dermis to contain the three major types of recognized chromatophores: melanophores, xanthophores and iridophores. Melanophores were more abundant in the dorsal region, whereas the iridophores were more abundant in the ventral region. The most important discovery was that of epidermal xanthophores. Epidermal xanthophores were the only chromatophores in the epidermis, something only found in S aurata and in a teleost species living in the Antartic sea. In contrast, the biochemical analysis did not establish any special characteristics: we found pteridine and flavin pigments located mostly in the pigmented dorsal region. Riboflavin and pterin were two of the most abundant coloured pigment types, but other colourless pigments such as xanthopterin and isoxanthopterin were also detected.
Directory of Open Access Journals (Sweden)
Ethan Frank
2018-03-01
Full Text Available Epidermal inclusion cysts are common lesions that rarely develop into squamous cell carcinoma (SCC. Neoplastic change in these cysts can be associated with prominent symptoms such as pain, rapid growth, or ulceration. This study describes the case of a 64-year-old woman with a 4-year history of a largely asymptomatic neck mass, which after routine excision was found to be an epidermal inclusion cyst harboring well-differentiated SCC. The diagnosis was made incidentally after routine cyst bisection and hematoxylin and eosin staining. Given the potential for variable presentation and low cost of hematoxylin and eosin analysis, we recommend a low threshold for a comprehensive pathological search for malignancy in excised cysts when appropriate.
Energy Technology Data Exchange (ETDEWEB)
Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.
1988-01-01
Specific binding of /sup 125/I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class AB diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more /sup 125/I-hEGF than did fetal membranes (P<0.0001). There was no significant differnce in /sup 125/I-hEGF binding to fetal membranes from the various pregnancy states (P<0.05). /sup 125/I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P<0.05). The binding to placentas from pregnancies complicated by White class AB diabetes or large for gestational age infants, on the other hand, was not significantly different from that to placentas from normal and appropriate for gestational age pregnancies. /sup 125/I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P<0.05). Placental and fetal membrane /sup 125/I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P<0.05). Placental but not fetal membrane /sup 125/I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone.
DEFF Research Database (Denmark)
Koukoura, Christina; Natarajan, Anand; Vesth, Allan
2015-01-01
damping from the decaying time series. The Enhanced Frequency Domain Decomposition (EFDD) method was applied to the wind turbine response under ambient excitation, for estimation of the damping in normal operation. The aero-servo-hydro-elastic tool HAWC2 is validated with offshore foundation load...... maxima of an impulse response caused by a boat impact. The result is used in the verification of the non aerodynamic damping in normal operation for low wind speeds. The auto-correlation function technique for damping estimation of a structure under ambient excitation was validated against the identified...... measurements. The model was tuned to the damping values obtained from the boat impact to match the measured loads. Wind turbulence intensity and wave characteristics used in the simulations are based on site measurements. A flexible soil model is included in the analysis. The importance of the correctly...
DEFF Research Database (Denmark)
Locsei, Gusztav; Pedersen, Julie Hefting; Laugesen, Søren
2016-01-01
This study investigated the relationship between speech perception performance in spatially complex, lateralized listening scenarios and temporal fine-structure (TFS) coding at low frequencies. Young normal-hearing (NH) and two groups of elderly hearing-impaired (HI) listeners with mild or moderate...... hearing loss above 1.5 kHz participated in the study. Speech reception thresholds (SRTs) were estimated in the presence of either speech-shaped noise, two-, four-, or eight-talker babble played reversed, or a nonreversed two-talker masker. Target audibility was ensured by applying individualized linear...... threshold nor the interaural phase difference threshold tasks showed a correlation with the SRTs or with the amount of masking release due to binaural unmasking, respectively. The results suggest that, although HI listeners with normal hearing thresholds below 1.5 kHz experienced difficulties with speech...
Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha
2015-06-25
Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.
Directory of Open Access Journals (Sweden)
Ewa Stocka-Łabno
2016-10-01
Full Text Available Introduction: Toxic epidermal necrolysis and Stevens–Johnson syndrome are acute life-threatening mucocutaneous reactions to drugs. The aims of the study were to identify these drugs and characterize population prone to these reactions. Materials and Methods: Data including demographics, culprit drug, clinical characteristics, course of disease, treatment given, and therapeutic responses were retrospectively collected from medical records of 31 patients admitted to Department of Dermatology from January 2009 to December 2014. Results: Drugs most commonly involved in Stevens–Johnson syndrome were antimicrobials: ciprofloxacin, doxycycline, cefuroxime, trimethoprim, amoxicillin, clindamycin, co-trimoxazole (50% of patients and nonsteroidal anti-inflammatory drugs: ibuprofen, naproxen, metamizole, piroxicam (29% of patients. Drugs involved in toxic epidermal necrolysis were antimicrobials: sulfasalazine, co-trimoxazole, cefuroxime, clindamycin (71% of patients and anticonvulsants: lamotrigine (29% of patients. The comorbidities’ characteristic for the group of patients affected by toxic epidermal necrolysis were psychiatric and autoimmune disorders. The most common complication was infection. Two patients died and in both cases the cause of death was sepsis. Conclusion: The study indicates that in observed population drugs with the highest risk of most severe reactions are lamotrigine (anticonvulsant and antimicrobials (most commonly sulfonamides, therefore it is advisable to consider carefully administration of these drugs, especially to patients with history of autoimmune reactions.
Directory of Open Access Journals (Sweden)
Shadmehr Demehri
2008-05-01
Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.
Directory of Open Access Journals (Sweden)
Vivek Nandakumar
Full Text Available Grading schemes for breast cancer diagnosis are predominantly based on pathologists' qualitative assessment of altered nuclear structure from 2D brightfield microscopy images. However, cells are three-dimensional (3D objects with features that are inherently 3D and thus poorly characterized in 2D. Our goal is to quantitatively characterize nuclear structure in 3D, assess its variation with malignancy, and investigate whether such variation correlates with standard nuclear grading criteria.We applied micro-optical computed tomographic imaging and automated 3D nuclear morphometry to quantify and compare morphological variations between human cell lines derived from normal, benign fibrocystic or malignant breast epithelium. To reproduce the appearance and contrast in clinical cytopathology images, we stained cells with hematoxylin and eosin and obtained 3D images of 150 individual stained cells of each cell type at sub-micron, isotropic resolution. Applying volumetric image analyses, we computed 42 3D morphological and textural descriptors of cellular and nuclear structure.We observed four distinct nuclear shape categories, the predominant being a mushroom cap shape. Cell and nuclear volumes increased from normal to fibrocystic to metastatic type, but there was little difference in the volume ratio of nucleus to cytoplasm (N/C ratio between the lines. Abnormal cell nuclei had more nucleoli, markedly higher density and clumpier chromatin organization compared to normal. Nuclei of non-tumorigenic, fibrocystic cells exhibited larger textural variations than metastatic cell nuclei. At p<0.0025 by ANOVA and Kruskal-Wallis tests, 90% of our computed descriptors statistically differentiated control from abnormal cell populations, but only 69% of these features statistically differentiated the fibrocystic from the metastatic cell populations.Our results provide a new perspective on nuclear structure variations associated with malignancy and point to the
DEFF Research Database (Denmark)
Jakobsen, Jan Nyrop; Santoni-Rugiu, Eric; Sørensen, Jens Benn
2014-01-01
BACKGROUND: Antibodies targeting epidermal growth factor receptor (EGFR), such as cetuximab, may potentially improve outcome in non-small cell lung cancer (NSCLC) patients with high EGFR expression. The EGFR expression may be heterogeneously distributed within tumors, and small biopsies may thus...
Wu, Weijuan; Yang, Qing; Fung, Kar-Ming; Humphreys, Mitchell R; Brame, Lacy S; Cao, Amy; Fang, Yu-Ting; Shih, Pin-Tsen; Kropp, Bradley P; Lin, Hsueh-Kung
2014-03-05
Neuroendocrine (NE) differentiation has been attributed to the progression of castration-resistant prostate cancer (CRPC). Growth factor pathways including the epidermal growth factor receptor (EGFR) signaling have been implicated in the development of NE features and progression to a castration-resistant phenotype. However, upstream molecules that regulate the growth factor pathway remain largely unknown. Using androgen-insensitive bone metastasis PC-3 cells and androgen-sensitive lymph node metastasis LNCaP cells derived from human prostate cancer (PCa) patients, we demonstrated that γ-aminobutyric acid A receptor (GABA(A)R) ligand (GABA) and agonist (isoguvacine) stimulate cell proliferation, enhance EGF family members expression, and activate EGFR and a downstream signaling molecule, Src, in both PC-3 and LNCaP cells. Inclusion of a GABA(A)R antagonist, picrotoxin, or an EGFR tyrosine kinase inhibitor, Gefitinib (ZD1839 or Iressa), blocked isoguvacine and GABA-stimulated cell growth, trans-phospohorylation of EGFR, and tyrosyl phosphorylation of Src in both PCa cell lines. Spatial distributions of GABAAR α₁ and phosphorylated Src (Tyr416) were studied in human prostate tissues by immunohistochemistry. In contrast to extremely low or absence of GABA(A)R α₁-positive immunoreactivity in normal prostate epithelium, elevated GABA(A)R α₁ immunoreactivity was detected in prostate carcinomatous glands. Similarly, immunoreactivity of phospho-Src (Tyr416) was specifically localized and limited to the nucleoli of all invasive prostate carcinoma cells, but negative in normal tissues. Strong GABAAR α₁ immunoreactivity was spatially adjacent to the neoplastic glands where strong phospho-Src (Tyr416)-positive immunoreactivity was demonstrated, but not in adjacent to normal glands. These results suggest that the GABA signaling is linked to the EGFR pathway and may work through autocrine or paracine mechanism to promote CRPC progression. Copyright © 2013 Elsevier
Li, Ruilong; Tan, Huadong; Zhu, Yaxian; Zhang, Yong
2017-07-01
The polycyclic aromatic hydrocarbons (PAHs) located on the epidermal tissues showed distinctive toxic effects to root, while the retention and distribution of PAHs on mangrove seedlings poorly understood. Our results confirmed that the partition coefficients (K f ) of the PAHs retained on the epidermal tissue of mangrove roots, such as Kandelia obovata, Avicennia marina and Aegiceras corniculatum, were much higher than the Poaceae plants roots, for example wheat and maize (Wild et al., 2005). Moreover, to the parent and alkyl PAHs, a well negative correlation was observed between the surface polarity of these three species of mangrove root and the K f values (p mangrove root epidermal tissues formed larger clusters than that of on Poaceae plants, such as wheat and maize (Wild et al., 2005) due to the limitation of the suberization of the root exodermis and endodermis. After exposure of 30 d, rhizo- and endophytic bacteria degraded parts of the N/O/S-containing PAHs to medium-lifetime fluorescence substances. To our knowledge, this is the first time to assess the retention of PAHs on the epidermal tissue of mangrove root, which will improve our understanding of the root uptake PAHs process. Copyright © 2017 Elsevier Ltd. All rights reserved.
Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis
2008-12-01
Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.
DEFF Research Database (Denmark)
Drzewiecki, K T; Piltz-Drzewiecka, J
1979-01-01
The quantitative evaluation of DOPA-positive epidermal melanocytes in 16 patients of Scandinavian origin showed both individual and regional differences in the melanocyte count. Our data is in agreement with other published studies. The distribution in the number of melanocytes varies significant...
Expressão dos marcadores tumorais CD-34 e CASPASE-3 no carcinoma epidermóide de esôfago
Ferreira,Valério Alves; Czeczko,Nicolau Gregori; Ribas-Filho,Jurandir Marcondes; Malafaia,Osvaldo; Ribas,Carmen Austrália Paredes Marcondes; Gomes,Claudia Stein; Cunha,Regina Maria da; Cuenca,Ronaldo M.
2009-01-01
OBJETIVO: Analisar citofotometricamente a expressão do marcador de densidade microvascular CD-34 e de apoptose caspase-3 no carcinoma epidermóide de esôfago, e correlacionar os marcadores entre si. MÉTODOS: Análise imunoistoquímica de 29 peças cirúrgicas de carcinomas epidermóides de esôfago, baseada nos índices de marcagem dos anticorpos CD-34 e caspase-3, utilizando-se sistema de citofotometria computadorizada. Comparou-se a expressão quantitativa destes marcadores, a relação entre eles, a ...
Skin pattern structure and function of juvenile ages of Chameleo chameleon
Directory of Open Access Journals (Sweden)
Yosra A. Fouda
2017-03-01
Full Text Available Little is known about the skin structure of juvenile chameleon especially its sensory function of their integumentary structure. Fifteen juvenile Chameleo chameleon are collected from Abu Rawash, Northern area of Giza, Egypt during Summer of 2015. It is belong to the order Squamata, family, Chamaeleonidae. Three ages are used in the present study and categorized according to the morphological criteria of head, abdomen and limb lengths. Dorsal abdominal surfaces are covered with abdominal scales of varying sizes either conical or elliptical-structures, regularly arranged in rows and imbricated with each other. Each scale possessed one cylindrical lenticular epidermal sense organ containing heavy sensillia. Histologically, the scales are characterized by wider conical surfaces and intermingled with another one by hinge region. The epidermal layer of outer scale surface is composed of five-layered stratified squamous epithelium including the stratum germinativum, intermediate zone of stratum spinosum and granulosum, α-keratin layer, β-keratin layer and outer superficial Oberhaütchen. Melanosomes are abundant in the intermediate zone as well as in the peripheral dermal layer underneath stratum germinativum layer. The melanosomes possessed long cellular processes with their content of melanin granules underneath the epidermis. The dermis is composed of upper collagenous and inner compact layer. Semithin sections revealed the presence of fibroblast cells, collagenous fibrils, nerve axons, melanosomes and mast cells in the connective tissue core. Increased immunoreaction of cytokeratin is observed in the epidermal layers of G3; meanwhile, an increased proliferation of epidermal and dermal cells was detected in G1. Transmission electron microscopy exhibited striking formation of dermal sense organs containing neuronal cells of both oligodendrocytes and Schwann cells with myelinated and unmyelinated nerve axons ensheathed externally by thin
International Nuclear Information System (INIS)
Roy, L.M.; Gittinger, C.K.; Landreth, G.E.
1991-01-01
Epidermal growth factor receptor interacts with structural elements of A431 cells and remains associated with the cytoskeleton following extraction with nonionic detergents. Extraction of cells with 0.15% Triton X-100 resulted in detection of only approximately 40% of the EGF binding sites on the cytoskeleton. If the cells were exposed to EGF prior to extraction, approximately twofold higher levels of low-affinity EGF binding sites were detected. The difference in number of EGF binding sites was not a consequence of differences in numbers of EGF receptors associated with the cytoskeleton; equal amounts of 35S-labeled receptor were immunoprecipitated from the cytoskeletons of both control and EGF-treated cells. The effect of EGF pretreatment on binding activity was coincident with a change in the mobility of the receptor from a doublet of Mr approximately 160-180 kDa to a single sharp band at 180 kDa. The alteration in receptor mobility was not a simple consequence of receptor phosphorylation in that the alteration was not reversed by alkaline phosphatase treatment, nor was the shift produced by treatment of the cells with phorbol ester. The two EGF receptor species demonstrated differential susceptibility to V8 proteinase digestion. The EGF-induced 180 kDa species was preferentially digested by the proteinase relative to the 160 kDa species, indicating that EGF binding results in a conformational change in the receptor. The EGF-mediated preservation of binding activity and altered conformation may be related to receptor oligomerization
Energy Technology Data Exchange (ETDEWEB)
Marks, Shawn M. [Univ. of California, Berkeley, CA (United States). Helen Wills Neuroscience Inst.; Lockhart, Samuel N. [Univ. of California, Berkeley, CA (United States). Helen Wills Neuroscience Inst.; Baker, Suzanne L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Molecular Biophysics and Integrated Bioimaging; Jagust, William J. [Univ. of California, Berkeley, CA (United States). Helen Wills Neuroscience Inst.; Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Molecular Biophysics and Integrated Bioimaging
2017-03-22
Normal aging is associated with a decline in episodic memory and also with aggregation of the β-amyloid (Aβ) and tau proteins and atrophy of medial temporal lobe (MTL) structures crucial to memory formation. Although some evidence suggests that Aβ is associated with aberrant neural activity, the relationships among these two aggregated proteins, neural function, and brain structure are poorly understood. Using in vivo human Aβ and tau imaging, we demonstrate that increased Aβ and tau are both associated with aberrant fMRI activity in the MTL during memory encoding in cognitively normal older adults. This pathological neural activity was in turn associated with worse memory performance and atrophy within the MTL. A mediation analysis revealed that the relationship with regional atrophy was explained by MTL tau. These findings broaden the concept of cognitive aging to include evidence of Alzheimer’s disease-related protein aggregation as an underlying mechanism of age-related memory impairment.
Directory of Open Access Journals (Sweden)
SL. Langer
Full Text Available Manifestation of infectious pathologies in fishes usually increases in environments where organic wastes are disposed. Specimens of Mugil platanus Günther, 1880 and water samples collected at three points of the Tramandaí river were analyzed during a one year period. The macroscopic observation revealed ulcerations in the caudal peduncle area covered with a mass of amorphous and whitened tissues. Histopathologic analysis showed the presence of negative gram bacteria, probably responsible for alterations of the normal structure of the epidermic tissues. Non-parametric statistical analysis for ammonia concentration showed a significant variation among the three collected spots as well as in the multiple comparison between two spots. In this study, we describe cutaneous lesions observed in Mugil platanus specimens and tested their correlation with environmental ammonia concentration.
International Nuclear Information System (INIS)
Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A.
1998-01-01
The pharmacokinetics, biodistribution and dosimetry of 99m Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t (1(2α)) ) of 0.250 h and a mean elimination (t (1(2β)) ) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with 99m Tc-labeled humanized MAb R3 conjugate in patients should be supported
Directory of Open Access Journals (Sweden)
Ajay Kumar
2011-01-01
Full Text Available Carbamazepine and other anticonvulsants are commoner cause of severe adverse cutaneous drug reactions such as erythema multiforme, toxic epidermal necrolysis (TEN, and Stevens-Johnson syndrome (SJS. We report a case of SJS rapidly progressing to TEN with a combination of haloperidol and carbamazepine in a patient with bipolar affective disorder. The pathophysiological mechanism underlying this reaction is discussed.
International Nuclear Information System (INIS)
Graem, N.
1986-01-01
Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue
Moore, Carlene; Cevikbas, Ferda; Pasolli, H Amalia; Chen, Yong; Kong, Wei; Kempkes, Cordula; Parekh, Puja; Lee, Suk Hee; Kontchou, Nelly-Ange; Yeh, Iwei; Ye, Iwei; Jokerst, Nan Marie; Fuchs, Elaine; Steinhoff, Martin; Liedtke, Wolfgang B
2013-08-20
At our body surface, the epidermis absorbs UV radiation. UV overexposure leads to sunburn with tissue injury and pain. To understand how, we focus on TRPV4, a nonselective cation channel highly expressed in epithelial skin cells and known to function in sensory transduction, a property shared with other transient receptor potential channels. We show that following UVB exposure mice with induced Trpv4 deletions, specifically in keratinocytes, are less sensitive to noxious thermal and mechanical stimuli than control animals. Exploring the mechanism, we find that epidermal TRPV4 orchestrates UVB-evoked skin tissue damage and increased expression of the proalgesic/algogenic mediator endothelin-1. In culture, UVB causes a direct, TRPV4-dependent Ca(2+) response in keratinocytes. In mice, topical treatment with a TRPV4-selective inhibitor decreases UVB-evoked pain behavior, epidermal tissue damage, and endothelin-1 expression. In humans, sunburn enhances epidermal expression of TRPV4 and endothelin-1, underscoring the potential of keratinocyte-derived TRPV4 as a therapeutic target for UVB-induced sunburn, in particular pain.
Maslen, Sarah; Sadowski, Pawel; Adam, Alex; Lilley, Kathryn; Stephens, Elaine
2006-12-15
The detailed characterization of protein N-glycosylation is very demanding given the many different glycoforms and structural isomers that can exist on glycoproteins. Here we report a fast and sensitive method for the extensive structure elucidation of reducing-end labeled N-glycan mixtures using a combination of capillary normal-phase HPLC coupled off-line to matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and TOF/TOF-MS/MS. Using this method, isobaric N-glycans released from honey bee phospholipase A2 and Arabidopsis thaliana glycoproteins were separated by normal-phase chromatography and subsequently identified by key fragment ions in the MALDI-TOF/TOF tandem mass spectra. In addition, linkage and branching information were provided by abundant cross-ring and "elimination" fragment ions in the MALDI-CID spectra that gave extensive structural information. Furthermore, the fragmentation characteristics of N-glycans reductively aminated with 2-aminobenzoic acid and 2-aminobenzamide were compared. The identification of N-glycans containing 3-linked core fucose was facilitated by distinctive ions present only in the MALDI-CID spectra of 2-aminobenzoic acid-labeled oligosaccharides. To our knowledge, this is the first MS/MS-based technique that allows confident identification of N-glycans containing 3-linked core fucose, which is a major allergenic determinant on insect and plant glycoproteins.
Directory of Open Access Journals (Sweden)
Susan John
Full Text Available Transglutaminases (TGase, a family of cross-linking enzymes present in most cell types, are important in events as diverse as cell-signaling and matrix stabilization. Transglutaminase 1 is crucial in developing the epidermal barrier, however the skin also contains other family members, in particular TGase 3. This isoform is highly expressed in the cornified layer, where it is believed to stabilize the epidermis and its reduction is implicated in psoriasis. To understand the importance of TGase 3 in vivo we have generated and analyzed mice lacking this protein. Surprisingly, these animals display no obvious defect in skin development, no overt changes in barrier function or ability to heal wounds. In contrast, hair lacking TGase 3 is thinner, has major alterations in the cuticle cells and hair protein cross-linking is markedly decreased. Apparently, while TGase 3 is of unique functional importance in hair, in the epidermis loss of TGase 3 can be compensated for by other family members.
Levi, Assi; Amitai, Dan Ben; Mimouni, Daniel; Leshem, Yael A; Arzi, Ofir; Lapidoth, Moshe
2018-04-01
The verrucous epidermal nevus (VEN) is the most common type of epidermal nevi. As lesions can be disfiguring, treatment is often sought. Many therapeutic approaches have been reported, with variable efficacy and safety. Picosecond (PS) lasers are novel laser devices designated to target small chromophores. A side effect of these lasers is blistering due to epidermal-dermal separation. We aimed to harness this side effect of the PS lasers to treat patients with VEN. The purpose of this study was to report our experience treating VEN using a PS 532-nm laser. We present a retrospective case series of six patients with large VEN who were treated using a PS 532-nm laser (2-6 treatments, 8-10 weeks apart). Response in clinical photographs was assessed by two independent dermatologists and graded on a scale of 0 (exacerbation) to 4 (76-100% improvement). Patient satisfaction was recorded on a scale of 1-5. All patients demonstrated significant improvement. Average improvement was 3.7 on the quartile scale of improvement. Patient satisfaction rate averaged 4.7. The PS 532-nm laser is a promising novel modality for the treatment of large VEN.
Grigore, M; Furtunescu, F; Minca, D; Costache, M; Garbe, C; Simionescu, O
2018-03-10
Eye and skin share the embryological origin. Both are established risk factors in epidermal skin cancer. There are few reports using iris colour classification scales, most of them analyse colour in general or are too complex to use in daily practice. To investigate which iris colour pattern is associated with epidermal skin cancer in a S-E European Caucasian population. A case-control study was conducted on 480 patients: 229 skin cancers patients and 251 controls (dermatological patients free of skin cancers) admitted in two medical clinics of Dermatology in Bucharest, between October 2011 and May 2014. High-resolution iris photographs were taken for each patient. Three parameters of the iris were analysed individually and in association patterns for each patient: periphery, collaret and freckles. The most frequent iris colour pattern associated with epidermal skin cancer was blue periphery with light brown collaret and freckles present. In terms of individual parameters, the strongest indicators for skin cancer patients were blue periphery and blue collaret. The results of this study sustain the hypothesis that blue periphery with light brown collaret and freckles iris pattern is a reliable phenotypic marker for epidermal skin cancer. The results of this study differ from previous reports in which skin cancer risk was associated with a homogeneous blue iris. We account these differences in the characteristics of the recruited patients (S-E European, skin type II and III). The assessment of iris colour patterns is an easy and inexpensive detection tool in skin cancer risk assessment. © 2018 European Academy of Dermatology and Venereology.
Dohata, A; Chambers, J K; Uchida, K; Nakazono, S; Kinoshita, Y; Nibe, K; Nakayama, H
2015-11-01
The authors herein describe the morphologic and immunohistochemical features of normal Merkel cells as well as the clinicopathologic findings of Merkel cell carcinoma in cats. Merkel cells were characterized as vacuolated clear cells and were individually located in the epidermal basal layer of all regions examined. Clusters of Merkel cells were often observed adjacent to the sinus hair of the face and carpus. Immunohistochemically, Merkel cells were positive for cytokeratin (CK) 20, CK18, p63, neuron-specific enolase, synaptophysin, and protein gene product 9.5. Merkel cell carcinoma was detected as a solitary cutaneous mass in 3 aged cats (13 to 16 years old). On cytology, large lymphocyte-like cells were observed in all cases. Histologic examinations of surgically resected tumors revealed nests of round cells separated by various amounts of a fibrous stroma. Tumor cells were commonly immunopositive for CK20, CK18, p63, neuron-specific enolase, and synaptophysin, representing the characteristics of normal Merkel cells. © The Author(s) 2015.
Alibardi, Lorenzo; Holthaus, Karin Brigit; Sukseree, Supawadee; Hermann, Marcela; Tschachler, Erwin; Eckhart, Leopold
2016-01-01
The morphogenesis of feathers is a complex process that depends on a tight spatiotemporal regulation of gene expression and assembly of the protein components of mature feathers. Recent comparative genomics and gene transcription studies have indicated that genes within the epidermal differentiation complex (EDC) encode numerous structural proteins of cornifying skin cells in amniotes including birds. Here, we determined the localization of one of these proteins, termed EDMTFH (Epidermal Differentiation Protein starting with a MTF motif and rich in Histidine), which belongs to a group of EDC-encoded proteins rich in aromatic amino acid residues. We raised an antibody against an EDMTFH-specific epitope and performed immunohistochemical investigations by light microscopy and immunogold labeling by electron microscopy of chicken embryos at days 14-18 of development. EDMTFH was specifically present in the subperiderm, a transient layer of the embryonic epidermis, and in barbs and barbules of feathers. In the latter, it partially localized to bundles of so-called feather beta-keratins (corneous beta-proteins, CBPs). Cells of the embryonic periderm, the epidermis proper, and the feather sheath were immunonegative for EDMTFH. The results of this study indicate that EDMTFH may contribute to the unique mechanical properties of feathers and define EDMTFH as a common marker of the subperiderm and the feather barbules. This expression pattern of EDMTFH resembles that of epidermal differentiation cysteine-rich protein (EDCRP) and feather CBPs and is in accordance with the hypothesis that a major part of the cyclically regenerating feather follicle is topologically, developmentally and evolutionarily related to the embryonic subperiderm.
Directory of Open Access Journals (Sweden)
Lorenzo Alibardi
Full Text Available The morphogenesis of feathers is a complex process that depends on a tight spatiotemporal regulation of gene expression and assembly of the protein components of mature feathers. Recent comparative genomics and gene transcription studies have indicated that genes within the epidermal differentiation complex (EDC encode numerous structural proteins of cornifying skin cells in amniotes including birds. Here, we determined the localization of one of these proteins, termed EDMTFH (Epidermal Differentiation Protein starting with a MTF motif and rich in Histidine, which belongs to a group of EDC-encoded proteins rich in aromatic amino acid residues. We raised an antibody against an EDMTFH-specific epitope and performed immunohistochemical investigations by light microscopy and immunogold labeling by electron microscopy of chicken embryos at days 14-18 of development. EDMTFH was specifically present in the subperiderm, a transient layer of the embryonic epidermis, and in barbs and barbules of feathers. In the latter, it partially localized to bundles of so-called feather beta-keratins (corneous beta-proteins, CBPs. Cells of the embryonic periderm, the epidermis proper, and the feather sheath were immunonegative for EDMTFH. The results of this study indicate that EDMTFH may contribute to the unique mechanical properties of feathers and define EDMTFH as a common marker of the subperiderm and the feather barbules. This expression pattern of EDMTFH resembles that of epidermal differentiation cysteine-rich protein (EDCRP and feather CBPs and is in accordance with the hypothesis that a major part of the cyclically regenerating feather follicle is topologically, developmentally and evolutionarily related to the embryonic subperiderm.
Aberrant Wound Healing in an Epidermal Interleukin-4 Transgenic Mouse Model of Atopic Dermatitis
Zhao, Yan; Bao, Lei; Chan, Lawrence S.; DiPietro, Luisa A.; Chen, Lin
2016-01-01
Wound healing in a pre-existing Th2-dominated skin milieu was assessed by using an epidermal specific interleukin-4 (IL-4) transgenic (Tg) mouse model, which develops a pruritic inflammatory skin condition resembling human atopic dermatitis. Our results demonstrated that IL-4 Tg mice had delayed wound closure and re-epithelialization even though these mice exhibited higher degrees of epithelial cell proliferation. Wounds in IL-4 Tg mice also showed a marked enhancement in expression of inflammatory cytokines/chemokines, elevated infiltration of inflammatory cells including neutrophils, macrophages, CD3+ lymphocytes, and epidermal dendritic T lymphocytes. In addition, these mice exhibited a significantly higher level of angiogenesis as compared to wild type mice. Furthermore, wounds in IL-4 Tg mice presented with larger amounts of granulation tissue, but had less expression and deposition of collagen. Taken together, an inflamed skin condition induced by IL-4 has a pronounced negative influence on the healing process. Understanding more about the pathogenesis of wound healing in a Th2- dominated environment may help investigators explore new potential therapeutic strategies. PMID:26752054
Directory of Open Access Journals (Sweden)
Kai Kretzschmar
2016-01-01
Full Text Available Wnt/β-catenin activation in adult epidermis can induce new hair follicle formation and tumor development. We used lineage tracing to uncover the relative contribution of different stem cell populations. LGR6+ and LRIG1+ stem cells contributed to ectopic hair follicles formed in the sebaceous gland upon β-catenin activation, whereas LGR5+ cells did not. Lgr6, but not Lrig1 or Lgr5, was expressed in a subpopulation of interfollicular epidermal cells that were competent to form new hair follicles. Oncogenic β-catenin expression in LGR5+ cells led to formation of pilomatricomas, while LRIG1+ cells formed trichoadenomas and LGR6+ cells formed dermatofibromas. Tumor formation was always accompanied by a local increase in dermal fibroblast density and transient extracellular matrix remodeling. However, each tumor had a distinct stromal signature in terms of immune cell infiltrate and expression of CD26 and CD44. We conclude that compartmentalization of epidermal stem cells underlies different responses to β-catenin and skin tumor heterogeneity.
Normal mode-guided transition pathway generation in proteins.
Directory of Open Access Journals (Sweden)
Byung Ho Lee
Full Text Available The biological function of proteins is closely related to its structural motion. For instance, structurally misfolded proteins do not function properly. Although we are able to experimentally obtain structural information on proteins, it is still challenging to capture their dynamics, such as transition processes. Therefore, we need a simulation method to predict the transition pathways of a protein in order to understand and study large functional deformations. Here, we present a new simulation method called normal mode-guided elastic network interpolation (NGENI that performs normal modes analysis iteratively to predict transition pathways of proteins. To be more specific, NGENI obtains displacement vectors that determine intermediate structures by interpolating the distance between two end-point conformations, similar to a morphing method called elastic network interpolation. However, the displacement vector is regarded as a linear combination of the normal mode vectors of each intermediate structure, in order to enhance the physical sense of the proposed pathways. As a result, we can generate more reasonable transition pathways geometrically and thermodynamically. By using not only all normal modes, but also in part using only the lowest normal modes, NGENI can still generate reasonable pathways for large deformations in proteins. This study shows that global protein transitions are dominated by collective motion, which means that a few lowest normal modes play an important role in this process. NGENI has considerable merit in terms of computational cost because it is possible to generate transition pathways by partial degrees of freedom, while conventional methods are not capable of this.
Lin, Rong-Dih; Chen, Mei-Chuan; Liu, Yan-Ling; Lin, Yi-Tzu; Lu, Mei-Kuang; Hsu, Feng-Lin; Lee, Mei-Hsien
2015-01-01
Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata) Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9) and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13), as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics. PMID:26633381
Directory of Open Access Journals (Sweden)
Rong-Dih Lin
2015-12-01
Full Text Available Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9 and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13, as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics.
Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal
Directory of Open Access Journals (Sweden)
Kynan T. Lawlor
2015-11-01
Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.
Pastushenko, I; Prieto-Torres, L; Gilaberte, Y; Blanpain, C
2015-11-01
Stem cells are characterized by their ability to self-renew and differentiate into the different cell lineages of their tissue of origin. The discovery of stem cells in adult tissues, together with the description of specific markers for their isolation, has opened up new lines of investigation, expanding the horizons of biomedical research and raising new hope in the treatment of many diseases. In this article, we review in detail the main characteristics of the stem cells that produce the specialized cells of the skin (epidermal, mesenchymal, and melanocyte stem cells) and their potential implications and applications in diseases affecting the skin. Part I deals with the principal characteristics and potential applications of epidermal stem cells in dermatology. Copyright © 2015 Elsevier España, S.L.U. and AEDV. All rights reserved.
powerbox: Arbitrarily structured, arbitrary-dimension boxes and log-normal mocks
Murray, Steven G.
2018-05-01
powerbox creates density grids (or boxes) with an arbitrary two-point distribution (i.e. power spectrum). The software works in any number of dimensions, creates Gaussian or Log-Normal fields, and measures power spectra of output fields to ensure consistency. The primary motivation for creating the code was the simple creation of log-normal mock galaxy distributions, but the methodology can be used for other applications.
Park, Minjoon; Do, Kyungsik; Kim, Jaemin; Son, Donghee; Koo, Ja Hoon; Park, Jinkyung; Song, Jun-Kyul; Kim, Ji Hoon; Lee, Minbaek; Hyeon, Taeghwan; Kim, Dae-Hyeong
2015-05-01
Oxide nanomembrane hybrids with enhanced mechano- and thermo-sensitivity for semitransparent epidermal electronics are developed. The use of nanomaterials (single wall nanotubes and silver nanoparticles) embedded in the oxide nanomembranes significantly enhances mechanical and thermal sensitivities. These mechanical and thermal sensors are utilized in wheelchair control and hypothermia detection, which are useful for patients with strokes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Stegelmeier, B.L.; Gillett, N.A.; Hahn, F.F.; Kelly, G.; Rebar, A.H.
1994-01-01
Ninety-two rat lung proliferative lesions and neoplasms induced by inhaled 239 PuO 2 were evaluated for aberrant expression of transforming growth factor alpha (TGF-α) and epidermal growth factor receptor (EGFR). Expression of TGF-α protein, measured by immunohistochemistry, was higher in 94% of the squamous cell carcinomas and 87% of the foci of alveolar epithelial squamous metaplasia than that exhibited by the normal-appearing, adjacent lung parenchyma. In contrast, only 20% of adenocarcinomas and foci of epithelial hyperplasia expressed elevated levels of TGF-α. Many neoplasms expressing TGF-α also expressed excessive levels of EGFR mRNA. Southern and DNA slot blot analyses showed that the elevated EGFR expression was not due to amplification of the EGFR gene. These data suggest that increased amounts of TGF-α were early alterations in the progression of plutonium-induced squamous cell carcinoma, and these increases may occur in parallel with overexpression of the receptor for this growth factor. Together, these alterations create a potential autocrine loop for sustaining clonal expansion of cells initiated by high-LET radiation. 44 refs., 4 figs., 1 tab
Energy Technology Data Exchange (ETDEWEB)
Cole, S.; Fairweather, J.M.; Townsend, K.M.S.
1987-01-01
Langerhans cell numbers, morphology and distribution were observed in cross sections of footpad epidermis from 1 to 28 days after exposure of the hind feed of CBA/H mice or albino guinea-pigs to a single absorbed dose of 20 Gy of X-rays. In mice, the number of Langerhans cells reactive with anti-macrophage F4/80 monoclonal antibody steadily declined by approximately 85% within 10 days after irradiation. Remaining Langerhans cells were exceptionally dendritic. Very few Birbeck granule-containing cells were found in murine popliteal lymph nodes before or after irradiation but damaged cells were present in superficial strata of irradiated epidermis. The morphology and number of epidermal F4/80-positive cells approached normal by 15 days after irradiation. In guinea-pigs, gradual suprabasal movement and loss of rounded, ATPase-positive Langerhans cells from the epidermis were detectable from 5 to 20 days after irradiation but the magnitude of the cell loss and redistribution was partially obscured by the simultaneous appearance of clusters of replacement Langerhans cells in the basal layer and by keratinocyte hyperplasia.
DEFF Research Database (Denmark)
Vinter-Jensen, Lars; Juhl, C O; Teglbjaerg, P S
1997-01-01
Epidermal growth factor (EGF), transforming growth factor alpha (TGF-alpha), and the EGF receptor are often overexpressed in chronic pancreatitis and in malignant pancreatic growth. Transgenic mice overexpressing TGF-alpha develop tissue changes in the pancrease resembling changes found in chronic...... pancreatitis. The effects of systemic treatment with EGF on the porcine pancrease were investigated in this study....
TNP-specific Lyt-2+ cytolytic T cell clones preferentially respond to TNP-conjugated epidermal cells
International Nuclear Information System (INIS)
Shimada, S.; Katz, S.I.
1985-01-01
A most effective method for the induction of hapten-specific allergic contact sensitivity (CS) is via epicutaneous application of the hapten. Another effective method is by the administration of haptenated epidermal cells (EC) subcutaneously. The latter method induces more intense and longer lasting CS than does the subcutaneous administration of haptenated spleen cells (SC). Thus, there may be something unique about EC which, when haptenated, allows them to generate effector cells more effectively than do SC. The authors therefore, attempted to generate T cell clones that were both hapten- and epidermal-specific. Four days after painting mice with 7% trinitrochlorobenzene, draining lymph node cells were obtained and T cells were purified. These cells were co-cultured with trinitrophenylated (TNP) Langerhans cell-enriched EC. After 4 days, cells were harvested and rested on non-TNP-conjugated EC. The cells were restimulated and rested three times, and were then cloned by limiting dilution with added interleukin 2, which was then continually added. Proliferation of T cells was assessed by [ 3 H]-thymidine incorporation. Cytotoxicity assays utilized TNP-conjugated concanavalin A SC blasts or EC as targets. Clones A-2 and E-4 are Thy-1+, Lyt-2+, and L3T4-, and TNP-specific. In contrast to noncloned TNP-specific T cells, the clones proliferate preferentially in response to TNP-EC rather than TNP-SC. Also in contrast to noncloned T cells, the clones were preferentially cytotoxic for TNP-EC; compared to TNP-SC, there was an eight- to 32-fold increase in killing when TNP-EC were used as targets. Clones A-2 and E-4 therefore exhibit hapten and epidermal specificity
MR imaging of the ankle: Normal variants
International Nuclear Information System (INIS)
Noto, A.M.; Cheung, Y.; Rosenberg, Z.S.; Norman, A.; Leeds, N.E.
1987-01-01
Thirty asymptomatic ankles were studied with high-resolution surface coil MR imaging. The thirty ankles were reviewed for identification or normal structures. The MR appearance of the deltoid and posterior to talo-fibular ligaments, peroneous brevis and longus tendons, and posterior aspect of the tibial-talar joint demonstrated several normal variants not previously described. These should not be misinterpreted as pathologic processes. The specific findings included (1) cortical irregularity of the posterior tibial-talar joint in 27 of 30 cases which should not be mistaken for osteonecrois; (2) normal posterior talo-fibular ligament with irregular and frayed inhomogeneity, which represents a normal variant in seven of ten cases; and (3) fluid in the shared peroneal tendons sheath which may be confused for a longitudinal tendon tear in three of 30 cases. Ankle imaging with the use of MR is still a relatively new procedure. Further investigation is needed to better define normal anatomy as well as normal variants. The authors described several structures that normally present with variable MR imaging appearances. This is clinically significant in order to maintain a high sensitivity and specificity in MR imaging interpretation
leaf epidermal members of the epidermal structures and stomata
African Journals Online (AJOL)
Administrator
temperate regions of the world. ... Indeed, it can be fair accurately stated that ... Journal of Pure and Applied Sciences, 10(1): 670 - 675 ... lopment were examined and to estimate stomata frequency, stoma uated. .... examined under microscope.
DEFF Research Database (Denmark)
Hansen, Harald S.; Jensen, B.
1985-01-01
sphingolipids. These rats showed increased evaporation which was comparable to that of essential fatty acid-deficient rats. We interpret these results as strong evidence for a very specific and essential function of linoleic acid in maintaining the integrity of the epidermal water permeability barrier......Essential fatty acid-deficient rats were supplemented with 300 mg per day of pure fatty acid esters: oleate (O), linoleate (L), arachidonate (A), and columbinate (C) for 10 days. During this period, the rats in groups L, A, and C all showed a decrease in their initially high trans-epidermal water...... loss, a classical essential fatty acid-deficiency symptom, to a level seen in non-deficient rats (group N). The trans-epidermal water loss in rats of group O was unaffected by the supplementation. Fatty acid composition of two epidermal sphingolipids, acylglucosylceramide and acylceramide, from...
An epidermal equivalent assay for identification and ranking potency of contact sensitizers
Energy Technology Data Exchange (ETDEWEB)
Gibbs, Susan, E-mail: S.Gibbs@VUMC.nl [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Corsini, Emanuela [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Spiekstra, Sander W. [Department of Dermatology, VU University Medical Centre, Dept of Oral Cell Biology, ACTA, Amsterdam (Netherlands); Galbiati, Valentina [Laboratory of Toxicology, DiSFeB, Università degli Studi di Milano (Italy); Fuchs, Horst W. [CellSystems GmbH, Troisdorf (Germany); DeGeorge, George; Troese, Matthew [MB Research Labs, Spinnerstown, PA (United States); Hayden, Patrick; Deng, Wei [MatTek Corporation, Ashland, MA (United States); Roggen, Erwin [3Rs Management and Consultancy (Denmark)
2013-10-15
The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC{sub 50}) with human and animal data showed a superior correlation with human DSA{sub 05} (μg/cm{sup 2}) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA{sub 05} = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA{sub 05} data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency
An epidermal equivalent assay for identification and ranking potency of contact sensitizers
International Nuclear Information System (INIS)
Gibbs, Susan; Corsini, Emanuela; Spiekstra, Sander W.; Galbiati, Valentina; Fuchs, Horst W.; DeGeorge, George; Troese, Matthew; Hayden, Patrick; Deng, Wei; Roggen, Erwin
2013-01-01
The purpose of this study was to explore the possibility of combining the epidermal equivalent (EE) potency assay with the assay which assesses release of interleukin-18 (IL-18) to provide a single test for identification and classification of skin sensitizing chemicals, including chemicals of low water solubility or stability. A protocol was developed using different 3D-epidermal models including in house VUMC model, epiCS® (previously EST1000™), MatTek EpiDerm™ and SkinEthic™ RHE and also the impact of different vehicles (acetone:olive oil 4:1, 1% DMSO, ethanol, water) was investigated. Following topical exposure for 24 h to 17 contact allergens and 13 non-sensitizers a robust increase in IL-18 release was observed only after exposure to contact allergens. A putative prediction model is proposed from data obtained from two laboratories yielding 95% accuracy. Correlating the in vitro EE sensitizer potency data, which assesses the chemical concentration which results in 50% cytotoxicity (EE-EC 50 ) with human and animal data showed a superior correlation with human DSA 05 (μg/cm 2 ) data (Spearman r = 0.8500; P value (two-tailed) = 0.0061) compared to LLNA data (Spearman r = 0.5968; P value (two-tailed) = 0.0542). DSA 05 = induction dose per skin area that produces a positive response in 5% of the tested population Also a good correlation was observed for release of IL-18 (SI-2) into culture supernatants with human DSA 05 data (Spearman r = 0.8333; P value (two-tailed) = 0.0154). This easily transferable human in vitro assay appears to be very promising, but additional testing of a larger chemical set with the different EE models is required to fully evaluate the utility of this assay and to establish a definitive prediction model. - Highlights: • A potential epidermal equivalent assay to label and classify sensitizers • Il-18 release distinguishes sensitizers from non sensitizers • IL-18 release can rank sensitizer potency • EC50 (chemical
Energy Technology Data Exchange (ETDEWEB)
Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)
2015-03-01
Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human
International Nuclear Information System (INIS)
Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo
2015-01-01
Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human
Essential contribution of tumor-derived perlecan to epidermal tumor growth and angiogenesis
DEFF Research Database (Denmark)
Jiang, Xinnong; Multhaupt, Hinke; Chan, En
2004-01-01
As a major heparan sulfate proteoglycan (PG) in basement membranes, perlecan has been linked to tumor invasion, metastasis, and angiogenesis. Here we produced epidermal tumors in immunocompromised rats by injection of mouse RT101 tumor cells. Tumor sections stained with species-specific perlecan...... factor. In vivo, antisense perlecan-transfected cells generated no tumors, whereas untransfected and vector-transfected cells formed tumors with obvious neovascularization, suggesting that tumor perlecan rather than host perlecan controls tumor growth and angiogenesis....
Our Approach to Toxic Epidermal Necrolysis and Review of Current Treatment Alternatives
Directory of Open Access Journals (Sweden)
Fatih Uygur
2008-09-01
Full Text Available Toxic epidermal necrolysis (TEN is a clinical entity which has a 30 to 40 % mortality rate, with necrolysis affecting the entire epidermis. Antibiotics, nonsteroidal anti-inflammatory drugs and anticonvulsants are offender drugs in TEN etiology. A standard treatment protocol with proven efficacy is still lacking. In this study, current treatment practice and our treatment strategy for TEN is discussed and eight patients treated in our clinic between the years 2001 and 2008 are reviewed.
Thyroid hormone regulation of epidermal growth factor receptor levels in mouse mammary glands
International Nuclear Information System (INIS)
Vonderhaar, B.K.; Tang, E.; Lyster, R.R.; Nascimento, M.C.
1986-01-01
The specific binding of iodinated epidermal growth factor ([ 125 I]iodo-EGF) to membranes prepared from the mammary glands and spontaneous breast tumors of euthyroid and hypothyroid mice was measured in order to determine whether thyroid hormones regulate the EGF receptor levels in vivo. Membranes from hypothyroid mammary glands of mice at various developmental ages bound 50-65% less EGF than those of age-matched euthyroid controls. Treatment of hypothyroid mice with L-T4 before killing restored binding to the euthyroid control level. Spontaneous breast tumors arising in hypothyroid mice also bound 30-40% less EGF than tumors from euthyroid animals even after in vitro desaturation of the membranes of endogenous growth factors with 3 M MgCl2 treatment. The decrease in binding in hypothyroid membranes was due to a decrease in the number of binding sites, not to a change in affinity of the growth factor for its receptor, as determined by Scatchard analysis of the binding data. Both euthyroid and hypothyroid membranes bound EGF primarily to a single class of high affinity sites [dissociation constant (Kd) = 0.7-1.8 nM]. Euthyroid membranes bound 28.4 +/- (SE) 0.6 fmol/mg protein, whereas hypothyroid membranes bound 15.5 +/- 1.0 fmol/mg protein. These data indicate that EGF receptor levels in normal mammary glands and spontaneous breast tumors in mice are subject to regulation by thyroid status
Directory of Open Access Journals (Sweden)
Oksana Tuchina
Full Text Available Crustaceans have successfully adapted to a variety of environments including fresh- and saltwater as well as land. Transition from an aquatic to a terrestrial lifestyle required adaptations of the sensory equipment of an animal, particularly in olfaction, where the stimulus itself changes from hydrophilic to mainly hydrophobic, air-borne molecules. Hermit crabs Coenobita spp. (Anomura, Coenobitidae have adapted to a fully terrestrial lifestyle as adults and have been shown to rely on olfaction in order to detect distant food items. We observed that the specialized olfactory sensilla in Coenobita, named aesthetascs, are immersed in a layer of mucous-like substance. We hypothesized that the mucous is produced by antennal glands and affects functioning of the aesthetascs. Using various microscopic and histochemical techniques we proved that the mucous is produced by aesthetasc-associated epidermal glands, which we consider to be modified rosette-type aesthetasc tegumental glands known from aquatic decapods. These epidermal glands in Coenobita are multicellular exocrine organs of the recto-canal type with tubulo-acinar arrangement of the secretory cells. Two distinct populations of secretory cells were clearly distinguishable with light and electron microscopy. At least part of the secretory cells contains specific enzymes, CUB-serine proteases, which are likely to be secreted on the surface of the aesthetasc pad and take part in antimicrobial defense. Proteomic analysis of the glandular tissue corroborates the idea that the secretions of the aesthetasc-associated epidermal glands are involved in immune responses. We propose that the mucous covering the aesthetascs in Coenobita takes part in antimicrobial defense and at the same time provides the moisture essential for odor perception in terrestrial hermit crabs. We conclude that the morphological modifications of the aesthetasc-associated epidermal glands as well as the functional characteristics
Ailanen, Liisa; Bezborodkina, Natalia N; Virtanen, Laura; Ruohonen, Suvi T; Malova, Anastasia V; Okovityi, Sergey V; Chistyakova, Elizaveta Y; Savontaus, Eriika
2018-04-01
Hepatic insulin resistance and increased gluconeogenesis are known therapeutic targets of metformin, but the role of hepatic glycogen in the pathogenesis of diabetes is less clear. Mouse model of neuropeptide Y (NPY) overexpression in noradrenergic neurons (OE-NPY D βH ) with a phenotype of late onset obesity, hepatosteatosis, and prediabetes was used to study early changes in glycogen structure and metabolism preceding prediabetes. Furthermore, the effect of the anti-hyperglycemic agent, metformin (300 mg/kg/day/4 weeks in drinking water), was assessed on changes in glycogen metabolism, body weight, fat mass, and glucose tolerance. Glycogen structure was characterized by cytofluorometric analysis in isolated hepatocytes and mRNA expression of key enzymes by qPCR. OE-NPY D βH mice displayed decreased labile glycogen fraction relative to stabile fraction (the intermediate form of glycogen) suggesting enhanced glycogen cycling. This was supported by decreased filling of glucose residues in the 10th outer tier of the glycogen molecule, which suggests accelerated glycogen phosphorylation. Metformin reduced fat mass gain in both genotypes, but glucose tolerance was improved mostly in wild-type mice. However, metformin inhibited glycogen accumulation and normalized the ratio between glycogen structures in OE-NPY D βH mice indicating decreased glycogen synthesis. Furthermore, the presence of glucose residues in the 11th tier together with decreased glycogen phosphorylase expression suggested inhibition of glycogen degradation. In conclusion, structural changes in glycogen of OE-NPY D βH mice point to increased glycogen metabolism, which may predispose them to prediabetes. Metformin treatment normalizes these changes and suppresses both glycogen synthesis and phosphorylation, which may contribute to its preventive effect on the onset of diabetes.
The development of epidermal growth factor receptor molecular imaging in cancer
International Nuclear Information System (INIS)
Zhou Xiaoliang; Wang Hao; Shi Peiji; Liu Jianfeng; Meng Aimin
2013-01-01
In vivo epidermal growth factor receptor (EGFR) targeted therapy has great potential for cancer diagnosis and the evaluation of curative effects. Enhancement of EGFR-targeted therapy needs a reliable quantitative molecular imaging method which could enable monitoring of receptor drug binding and receptor occupancy in vivo, and identification of the mutation in EGFR. PET or SPECT is the most advanced molecular imaging technology of non-invasively selecting responders, predicting therapeutic outcome and monitoring EGFR-targeted treatment. This review analyzed the present situation and research progress of molecular imaging agents. (authors)
Shih, Barbara B; Farrar, Mark D; Cooke, Marcus S; Osman, Joanne; Langton, Abigail K; Kift, Richard; Webb, Ann R; Berry, Jacqueline L; Watson, Rachel E B; Vail, Andy; de Gruijl, Frank R; Rhodes, Lesley E
2018-05-03
Public health guidance recommends limiting sun-exposure to sub-sunburn levels, but it's unknown whether these can gain vitamin D (for musculoskeletal health) whilst avoiding epidermal DNA damage (initiates skin cancer). Well-characterised healthy humans of all skin types (I-VI; lightest to darkest skin) were exposed to a low dose-series of solar simulated UVR of 20-80% their individual sunburn threshold dose (minimal erythemal dose, MED). Significant UVR dose-responses were seen for serum 25(OH)D and whole epidermal CPD, with as little as 0.2 MED concurrently producing 25(OH)D and CPD. Notably, fractional MEDs generated equivalent levels of whole epidermal CPD and 25(OH)D across all skin types. Crucially, we demonstrated an epidermal gradient of CPD formation strongly correlated with skin darkness (r=0.74; Pskin types, ranging from darkest skin, where high CPD levels occurred superficially with none in the germinative basal layer, through to lightest skin where CPD were induced evenly across the epidermal depth. Darker skin people can be encouraged to utilise sub-sunburn UVR-exposure to enhance their vitamin D. In lighter skin people, basal cell damage occurs concurrent with vitamin D synthesis at exquisitely low UVR levels, providing an explanation for their high skin cancer incidence; greater caution is required. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Baĭdik, O D; Logvinov, S V; Zubarev, S G; Sysoliatin, P G; Gurin, A A
2011-01-01
Methods of light, electron microscopy and immunohistochemistry were used to study the samples of maxillary sinus (MS) mucous membrane (MM) under normal conditions and in odontogenic sinusitis. To study the normal structure, the samples were obtained at autopsy from 26 human corpses 12-24 hours after death. Electron microscopic and immunohistochemical study was performed on biopsies of grossly morphologically unchanged MS MM, obtained during the operations for retention cysts in 6 patients. MS MM in perforative sinusitis was studied using the biopsies obtained from 43 patients. The material is broken into 4 groups depending on perforative sinusitis duration. Under normal conditions, MS MM is lined with a pseudostratified columnar ciliated epithelium. Degenerative changes of ciliated epithelial cells were already detected at short time intervals after MS perforations and become apparent due to reduction of specific volume of mitochondria and, rough endoplasmic reticulum, and increase of nuclear-cytoplasmic ratio. In the globlet cells, the reduction of nuclear-cytoplasmic ratio was associated with the disturbance of the secretory product release. At time intervals exceeding 3 months, epithelium underwent metaplasia into simple cuboidal and stratified squamous keratinized, while in MS MM lamina propria, cellular infiltration was increased. CD4+ cell content in sinus MM gradually increased, while at late periods after perforation occurrence it decreased. Low CD4+ cell count within the epithelium and the absence of muromidase on the surface of MS MM was detected. With the increase of the time interval since MS perforation, the number of CD8+ and CD20+ cells in MS MM was found to increase.
DEFF Research Database (Denmark)
Griffiths, C E; Dabelsteen, Erik; Voorhees, J J
1996-01-01
Topical all-trans retinoic acid (RA) produces a number of epidermal changes which are indistinguishable from those observed following treatment with a local irritant, namely sodium lauryl sulphate (SLS). This observation has led to criticism that the efficacy of RA in disorders such as photoageing...