WorldWideScience

Sample records for normal cellular prion

  1. Cellular Aspects of Prion Replication In Vitro

    Science.gov (United States)

    Grassmann, Andrea; Wolf, Hanna; Hofmann, Julia; Graham, James; Vorberg, Ina

    2013-01-01

    Prion diseases or transmissible spongiform encephalopathies (TSEs) are fatal neurodegenerative disorders in mammals that are caused by unconventional agents predominantly composed of aggregated misfolded prion protein (PrP). Prions self-propagate by recruitment of host-encoded PrP into highly ordered β-sheet rich aggregates. Prion strains differ in their clinical, pathological and biochemical characteristics and are likely to be the consequence of distinct abnormal prion protein conformers that stably replicate their alternate states in the host cell. Understanding prion cell biology is fundamental for identifying potential drug targets for disease intervention. The development of permissive cell culture models has greatly enhanced our knowledge on entry, propagation and dissemination of TSE agents. However, despite extensive research, the precise mechanism of prion infection and potential strain effects remain enigmatic. This review summarizes our current knowledge of the cell biology and propagation of prions derived from cell culture experiments. We discuss recent findings on the trafficking of cellular and pathologic PrP, the potential sites of abnormal prion protein synthesis and potential co-factors involved in prion entry and propagation. PMID:23340381

  2. Prion search and cellular prion protein expression in stranded dolphins.

    Science.gov (United States)

    Di Guardo, G; Cocumelli, C; Meoli, R; Barbaro, K; Terracciano, G; Di Francesco, C E; Mazzariol, S; Eleni, C

    2012-01-01

    The recent description of a prion disease (PD) case in a free-ranging bottlenose dolphin (Tursiops truncatus) prompted us to carry out an extensive search for the disease-associated isoform (PrPSc) of the cellular prion protein (PrPC) in the brain and in a range of lymphoid tissues from 23 striped dolphins (Stenella coeruleoalba), 5 bottlenose dolphins and 2 Risso s dolphins (Grampus griseus) found stranded between 2007 and 2012 along the Italian coastline. Three striped dolphins and one bottlenose dolphin showed microscopic lesions of encephalitis, with no evidence of spongiform brain lesions being detected in any of the 30 free-ranging cetaceans investigated herein. Nevertheless, we could still observe a prominent PrPC immunoreactivity in the brain as well as in lymphoid tissues from these dolphins. Although immunohistochemical and Western blot investigations yielded negative results for PrPSc deposition in all tissues from the dolphins under study, the reported occurrence of a spontaneous PD case in a wild dolphin is an intriguing issue and a matter of concern for both prion biology and intra/inter-species transmissibility, as well as for cetacean conservation medicine.

  3. Expression of cellular prion protein in the frontal and occipital lobe in Alzheimer's disease, diffuse Lewy body disease, and in normal brain: an immunohistochemical study.

    Science.gov (United States)

    Rezaie, Payam; Pontikis, Charlie C; Hudson, Lance; Cairns, Nigel J; Lantos, Peter L

    2005-08-01

    Cellular prion protein (PrP(c)) is a glycoprotein expressed at low to moderate levels within the nervous system. Recent studies suggest that PrP(c) may possess neuroprotective functions and that its expression is upregulated in certain neurodegenerative disorders. We investigated whether PrP(c) expression is altered in the frontal and occipital cortex in two well-characterized neurodegenerative disorders--Alzheimer's disease (AD) and diffuse Lewy body disease (DLBD)--compared with that in normal human brain using immunohistochemistry and computerized image analysis. The distribution of PrP(c) was further tested for correlation with glial reactivity. We found that PrP(c) was localized mainly in the gray matter (predominantly in neurons) and expressed at higher levels within the occipital cortex in the normal human brain. Image analysis revealed no significant variability in PrP(c) expression between DLBD and control cases. However, blood vessels within the white matter of DLBD cases showed immunoreactivity to PrP(c). By contrast, this protein was differentially expressed in the frontal and occipital cortex of AD cases; it was markedly overexpressed in the former and significantly reduced in the latter. Epitope specificity of antibodies appeared important when detecting PrP(c). The distribution of PrP(c) did not correlate with glial immunoreactivity. In conclusion, this study supports the proposal that regional changes in expression of PrP(c) may occur in certain neurodegenerative disorders such as AD, but not in other disorders such as DLBD.

  4. Protease resistance of infectious prions is suppressed by removal of a single atom in the cellular prion protein.

    Science.gov (United States)

    Leske, Henning; Hornemann, Simone; Herrmann, Uli Simon; Zhu, Caihong; Dametto, Paolo; Li, Bei; Laferriere, Florent; Polymenidou, Magdalini; Pelczar, Pawel; Reimann, Regina Rose; Schwarz, Petra; Rushing, Elisabeth Jane; Wüthrich, Kurt; Aguzzi, Adriano

    2017-01-01

    Resistance to proteolytic digestion has long been considered a defining trait of prions in tissues of organisms suffering from transmissible spongiform encephalopathies. Detection of proteinase K-resistant prion protein (PrPSc) still represents the diagnostic gold standard for prion diseases in humans, sheep and cattle. However, it has become increasingly apparent that the accumulation of PrPSc does not always accompany prion infections: high titers of prion infectivity can be reached also in the absence of protease resistant PrPSc. Here, we describe a structural basis for the phenomenon of protease-sensitive prion infectivity. We studied the effect on proteinase K (PK) resistance of the amino acid substitution Y169F, which removes a single oxygen atom from the β2-α2 loop of the cellular prion protein (PrPC). When infected with RML or the 263K strain of prions, transgenic mice lacking wild-type (wt) PrPC but expressing MoPrP169F generated prion infectivity at levels comparable to wt mice. The newly generated MoPrP169F prions were biologically indistinguishable from those recovered from prion-infected wt mice, and elicited similar pathologies in vivo. Surprisingly, MoPrP169F prions showed greatly reduced PK resistance and density gradient analyses showed a significant reduction in high-density aggregates. Passage of MoPrP169F prions into mice expressing wt MoPrP led to full recovery of protease resistance, indicating that no strain shift had taken place. We conclude that a subtle structural variation in the β2-α2 loop of PrPC affects the sensitivity of PrPSc to protease but does not impact prion replication and infectivity. With these findings a specific structural feature of PrPC can be linked to a physicochemical property of the corresponding PrPSc.

  5. Correlation of cellular factors and differential scrapie prion permissiveness in ovine microglia

    Science.gov (United States)

    Prion diseases are fatal neurodegenerative disorders by which the native cellular prion protein (PrP-C) is misfolded into an accumulating, disease-associated isoform (PrP-D). To improve the understanding of prion pathogenesis and develop effective treatments, it is essential to elucidate factors con...

  6. Orally administered indomethacin acutely reduces cellular prion protein in the small intestine and modestly increases survival of mice exposed to infectious prions.

    Science.gov (United States)

    Martin, Gary R; Sharkey, Keith A; Jirik, Frank R

    2015-05-01

    The oral uptake of infectious prions represents a common way to acquire a prion disease; thus, host factors, such as gut inflammation and intestinal "leakiness", have the potential to influence infectivity. For example, the ingestion of nonsteroidal anti-inflammatory drugs (NSAIDs) is known to induce intestinal inflammation and increase intestinal permeability. Previously, we reported that normal cellular prion protein (PrP(C)) expression was increased in experimental colitis, and since the level of PrP(C) expressed is a determinant of prion disease propagation, we hypothesized that NSAID administration prior to the oral inoculation of mice with infectious prions would increase intestinal PrP(C) expression and accelerate the onset of neurological disease. In the long-term experiments, one group of mice was gavaged with indomethacin, followed by a second gavage with brain homogenate containing mouse-adapted scrapie (ME7). Control mice received ME7 brain homogenate alone. Brain and splenic tissues were harvested at several time points for immunoblotting, including at the onset of clinical signs of disease. In a second series of experiments, mice were gavaged with indomethacin to assess the acute effects of this treatment on intestinal PrP(C) expression. Acutely, NSAID treatment reduced intestinal PrP(C) expression, and chronically, there was a modest delay in the onset of neurological disease. In contrast to our hypothesis, brief exposure to an NSAID decreased intestinal PrP(C) expression and led to a modest survival advantage following oral ingestion of infectious prions.

  7. Patterns of [PSI+] aggregation allow insights into cellular organization of yeast prion aggregates

    Science.gov (United States)

    Tyedmers, Jens

    2012-01-01

    The yeast prion phenomenon is very widespread and mounting evidence suggests that it has an impact on cellular regulatory mechanisms related to phenotypic responses to changing environments. Studying the aggregation patterns of prion amyloids during different stages of the prion life cycle is a first key step to understand major principles of how and where cells generate, organize and turn-over prion aggregates. The induction of the [PSI+] state involves the actin cytoskeleton and quality control compartments such as the Insoluble Protein Deposit (IPOD). An initially unstable transitional induction state can be visualized by overexpression of the prion determinant and displays characteristic large ring- and ribbon-shaped aggregates consisting of poorly fragmented bundles of very long prion fibrils. In the mature prion state, the aggregation pattern is characterized by highly fragmented, shorter prion fibrils that form aggregates, which can be visualized through tagging with fluorescent proteins. The number of aggregates formed varies, ranging from a single large aggregate at the IPOD to multiple smaller ones, depending on several parameters discussed. Aggregate units below the resolution of light microscopy that are detectable by fluorescence correlation spectroscopy are in equilibrium with larger aggregates in this stage and can mediate faithful inheritance of the prion state. Loss of the prion state is often characterized by reduced fragmentation of prion fibrils and fewer, larger aggregates. PMID:22449721

  8. Insights into the physiological function of cellular prion protein

    Directory of Open Access Journals (Sweden)

    Martins V.R.

    2001-01-01

    Full Text Available Prions have been extensively studied since they represent a new class of infectious agents in which a protein, PrPsc (prion scrapie, appears to be the sole component of the infectious particle. They are responsible for transmissible spongiform encephalopathies, which affect both humans and animals. The mechanism of disease propagation is well understood and involves the interaction of PrPsc with its cellular isoform (PrPc and subsequently abnormal structural conversion of the latter. PrPc is a glycoprotein anchored on the cell surface by a glycosylphosphatidylinositol moiety and expressed in most cell types but mainly in neurons. Prion diseases have been associated with the accumulation of the abnormally folded protein and its neurotoxic effects; however, it is not known if PrPc loss of function is an important component. New efforts are addressing this question and trying to characterize the physiological function of PrPc. At least four different mouse strains in which the PrP gene was ablated were generated and the results regarding their phenotype are controversial. Localization of PrPc on the cell membrane makes it a potential candidate for a ligand uptake, cell adhesion and recognition molecule or a membrane signaling molecule. Recent data have shown a potential role for PrPc in the metabolism of copper and moreover that this metal stimulates PrPc endocytosis. Our group has recently demonstrated that PrPc is a high affinity laminin ligand and that this interaction mediates neuronal cell adhesion and neurite extension and maintenance. Moreover, PrPc-caveolin-1 dependent coupling seems to trigger the tyrosine kinase Fyn activation. These data provide the first evidence for PrPc involvement in signal transduction.

  9. Molecular modeling of the conformational dynamics of the cellular prion protein

    Science.gov (United States)

    Nguyen, Charles; Colling, Ian; Bartz, Jason; Soto, Patricia

    2014-03-01

    Prions are infectious agents responsible for transmissible spongiform encephalopathies (TSEs), a type of fatal neurodegenerative disease in mammals. Prions propagate biological information by conversion of the non-pathological version of the prion protein to the infectious conformation, PrPSc. A wealth of knowledge has shed light on the nature and mechanism of prion protein conversion. In spite of the significance of this problem, we are far from fully understanding the conformational dynamics of the cellular isoform. To remedy this situation we employ multiple biomolecular modeling techniques such as docking and molecular dynamics simulations to map the free energy landscape and determine what specific regions of the prion protein are most conductive to binding. The overall goal is to characterize the conformational dynamics of the cell form of the prion protein, PrPc, to gain insight into inhibition pathways against misfolding. NE EPSCoR FIRST Award to Patricia Soto.

  10. Discovery of small molecules binding to the normal conformation of prion by combining virtual screening and multiple biological activity evaluation methods

    Science.gov (United States)

    Li, Lanlan; Wei, Wei; Jia, Wen-Juan; Zhu, Yongchang; Zhang, Yan; Chen, Jiang-Huai; Tian, Jiaqi; Liu, Huanxiang; He, Yong-Xing; Yao, Xiaojun

    2017-12-01

    Conformational conversion of the normal cellular prion protein, PrPC, into the misfolded isoform, PrPSc, is considered to be a central event in the development of fatal neurodegenerative diseases. Stabilization of prion protein at the normal cellular form (PrPC) with small molecules is a rational and efficient strategy for treatment of prion related diseases. However, few compounds have been identified as potent prion inhibitors by binding to the normal conformation of prion. In this work, to rational screening of inhibitors capable of stabilizing cellular form of prion protein, multiple approaches combining docking-based virtual screening, steady-state fluorescence quenching, surface plasmon resonance and thioflavin T fluorescence assay were used to discover new compounds interrupting PrPC to PrPSc conversion. Compound 3253-0207 that can bind to PrPC with micromolar affinity and inhibit prion fibrillation was identified from small molecule databases. Molecular dynamics simulation indicated that compound 3253-0207 can bind to the hotspot residues in the binding pocket composed by β1, β2 and α2, which are significant structure moieties in conversion from PrPC to PrPSc.

  11. Covalent surface modification of prions: a mass spectrometry-based means of detecting distinctive structural features of prion strains

    Science.gov (United States)

    Prions (PrPSc) are molecular pathogens that are able to convert the isosequential normal cellular prion protein (PrPC) into a prion. The only demonstrated differences between PrPC and PrPSc is conformational, they are isoforms. A given host can be infected by more than one kind or strain of prion. F...

  12. Prions

    Directory of Open Access Journals (Sweden)

    W. Bodemer

    2016-09-01

    BSE is always unknown. Telemetry revealed a shift in sleep–wake cycles early on, long before behavioral changes or clinical symptoms appeared. Pathology confirmed non-neuronal tissue as hidden places where prions exist. The rhesus model also allowed first comparative studies of epigenetic modifications on RNA in peripheral blood and brain tissue collected from uninfected and prion-infected animals. To conclude, our studies clearly demonstrated that this model is valid since progression to disease is almost identical to human CJD.

  13. Prions in Variably Protease-Sensitive Prionopathy: An Update

    NARCIS (Netherlands)

    Zou, W.Q.; Gambetti, P.; Xiao, X.; Yuan, J.; Langeveld, J.P.M.; Pirisinu, L.

    2013-01-01

    Human prion diseases, including sporadic, familial, and acquired forms such as Creutzfeldt-Jakob disease (CJD), are caused by prions in which an abnormal prion protein (PrPSc) derived from its normal cellular isoform (PrPC) is the only known component. The recently-identified variably

  14. Quantifying the relative amounts of PrP polymorphisms present in prions isolated from heterozygous prion-infected animals

    Science.gov (United States)

    Prions cause protein misfolding diseases, such as transmissible spongiform encephalopathy. They propagate infections by converting a normal cellular prion protein into a prion (PrPSc). PrPC and PrPSc are isosequential and differ only in their respective conformations. PrPC is monomeric and sensit...

  15. Sheep scrapie susceptibility-linked polymorphisms do not modulate the initial binding of cellular to disease-associated prion protein prior to conversion

    NARCIS (Netherlands)

    Rigter, A.; Bossers, A.

    2005-01-01

    Conversion of the host-encoded protease-sensitive cellular prion protein (PrPC) into the scrapie-associated protease-resistant isoform (PrPSc) of prion protein (PrP) is the central event in transmissible spongiform encephalopathies or prion diseases. Differences in transmissibility and

  16. Use of bovine recombinant prion protein and real-time quaking-induced conversion to detect transmissible mink encephalopathy prions and discriminate classical and atypical L- and H-type bovine spongiform encephalopathy

    Science.gov (United States)

    Prions are amyloid-forming proteins that cause transmissible spongiform encephalopathies through a process involving conversion from normal cellular prion protein to pathogenic misfolded conformation. This conversion has been used for in vitro assays including serial protein misfolding amplification...

  17. Yeast and Fungal Prions: Amyloid-Handling Systems, Amyloid Structure, and Prion Biology.

    Science.gov (United States)

    Wickner, R B; Edskes, H K; Gorkovskiy, A; Bezsonov, E E; Stroobant, E E

    2016-01-01

    Yeast prions (infectious proteins) were discovered by their outré genetic properties and have become important models for an array of human prion and amyloid diseases. A single prion protein can become any of many distinct amyloid forms (called prion variants or strains), each of which is self-propagating, but with different biological properties (eg, lethal vs mild). The folded in-register parallel β sheet architecture of the yeast prion amyloids naturally suggests a mechanism by which prion variant information can be faithfully transmitted for many generations. The yeast prions rely on cellular chaperones for their propagation, but can be cured by various chaperone imbalances. The Btn2/Cur1 system normally cures most variants of the [URE3] prion that arise. Although most variants of the [PSI+] and [URE3] prions are toxic or lethal, some are mild in their effects. Even the most mild forms of these prions are rare in the wild, indicating that they too are detrimental to yeast. The beneficial [Het-s] prion of Podospora anserina poses an important contrast in its structure, biology, and evolution to the yeast prions characterized thus far. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Using small molecule reagents to help distinguish among prion structural models

    Science.gov (United States)

    The only demonstrated difference between infectious prions (PrPSc) and the isosequential normal cellular prion protein (PrPC) is conformation. The structure of PrPC has been determined by a variety of instrumental techniques. The structure of prions remains uncertain. Recent instrumental analysis h...

  19. Cellular prion protein expression is not regulated by the Alzheimer's amyloid precursor protein intracellular domain.

    Directory of Open Access Journals (Sweden)

    Victoria Lewis

    Full Text Available There is increasing evidence of molecular and cellular links between Alzheimer's disease (AD and prion diseases. The cellular prion protein, PrP(C, modulates the post-translational processing of the AD amyloid precursor protein (APP, through its inhibition of the β-secretase BACE1, and oligomers of amyloid-β bind to PrP(C which may mediate amyloid-β neurotoxicity. In addition, the APP intracellular domain (AICD, which acts as a transcriptional regulator, has been reported to control the expression of PrP(C. Through the use of transgenic mice, cell culture models and manipulation of APP expression and processing, this study aimed to clarify the role of AICD in regulating PrP(C. Over-expression of the three major isoforms of human APP (APP(695, APP(751 and APP(770 in cultured neuronal and non-neuronal cells had no effect on the level of endogenous PrP(C. Furthermore, analysis of brain tissue from transgenic mice over-expressing either wild type or familial AD associated mutant human APP revealed unaltered PrP(C levels. Knockdown of endogenous APP expression in cells by siRNA or inhibition of γ-secretase activity also had no effect on PrP(C levels. Overall, we did not detect any significant difference in the expression of PrP(C in any of the cell or animal-based paradigms considered, indicating that the control of cellular PrP(C levels by AICD is not as straightforward as previously suggested.

  20. Using mass spectrometry and small molecule reagents to detect distinctive structural features of different prion conformations (strains)

    Science.gov (United States)

    A prion (PrPSc) is a conformer of a normal cellular prion protein (PrPC). Although they are isosequential, PrPSc is an infectious protein able to convert PrPC into the prion conformation and thereby propagate an infection. PrPC is monomeric while PrPSc is a multimer. PrPSc can adopt more than one co...

  1. Domain-Specific Activation of Death-Associated Intracellular Signalling Cascades by the Cellular Prion Protein in Neuroblastoma Cells.

    Science.gov (United States)

    Vilches, Silvia; Vergara, Cristina; Nicolás, Oriol; Mata, Ágata; Del Río, José A; Gavín, Rosalina

    2016-09-01

    The biological functions of the cellular prion protein remain poorly understood. In fact, numerous studies have aimed to determine specific functions for the different protein domains. Studies of cellular prion protein (PrP(C)) domains through in vivo expression of molecules carrying internal deletions in a mouse Prnp null background have provided helpful data on the implication of the protein in signalling cascades in affected neurons. Nevertheless, understanding of the mechanisms underlying the neurotoxicity induced by these PrP(C) deleted forms is far from complete. To better define the neurotoxic or neuroprotective potential of PrP(C) N-terminal domains, and to overcome the heterogeneity of results due to the lack of a standardized model, we used neuroblastoma cells to analyse the effects of overexpressing PrP(C) deleted forms. Results indicate that PrP(C) N-terminal deleted forms were properly processed through the secretory pathway. However, PrPΔF35 and PrPΔCD mutants led to death by different mechanisms sharing loss of alpha-cleavage and activation of caspase-3. Our data suggest that both gain-of-function and loss-of-function pathogenic mechanisms may be associated with N-terminal domains and may therefore contribute to neurotoxicity in prion disease. Dissecting the molecular response induced by PrPΔF35 may be the key to unravelling the physiological and pathological functions of the prion protein.

  2. The Prion Concept and Synthetic Prions.

    Science.gov (United States)

    Legname, Giuseppe; Moda, Fabio

    2017-01-01

    Transmissible spongiform encephalopathies or prion diseases are a group of fatal neurodegenerative diseases caused by unconventional infectious agents, known as prions (PrP Sc ). Prions derive from a conformational conversion of the normally folded prion protein (PrP C ), which acquires pathological and infectious features. Moreover, PrP Sc is able to transmit the pathological conformation to PrP C through a mechanism that is still not well understood. The generation of synthetic prions, which behave like natural prions, is of fundamental importance to study the process of PrP C conversion and to assess the efficacy of therapeutic strategies to interfere with this process. Moreover, the ability of synthetic prions to induce pathology in animals confirms that the pathological properties of the prion strains are all enciphered in abnormal conformations, characterizing these infectious agents. © 2017 Elsevier Inc. All rights reserved.

  3. Insights into mechanisms of transmission and pathogenesis from transgenic mouse models of prion diseases

    Science.gov (United States)

    Moreno, Julie A.; Telling, Glenn C.

    2018-01-01

    Prions represent a new paradigm of protein-mediated information transfer. In the case of mammals, prions are the cause of fatal, transmissible neurodegenerative diseases, sometimes referred to as transmissible spongiform encephalopathies (TSE’s), which frequently occur as epidemics. An increasing body of evidence indicates that the canonical mechanism of conformational corruption of cellular prion protein (PrPC) by the pathogenic isoform (PrPSc) that is the basis of prion formation in TSE’s, is common to a spectrum of proteins associated with various additional human neurodegenerative disorders, including the more common Alzheimer’s and Parkinson’s diseases. The peerless infectious properties of TSE prions, and the unparalleled tools for their study, therefore enable elucidation of mechanisms of template-mediated conformational propagation that are generally applicable to these related disease states. Many unresolved issues remain including the exact molecular nature of the prion, the detailed cellular and molecular mechanisms of prion propagation, and the means by which prion diseases can be both genetic and infectious. In addition, we know little about the mechanism by which neurons degenerate during prion diseases. Tied to this, the physiological role of the normal form of the prion protein remains unclear and it is uncertain whether or not loss of this function contributes to prion pathogenesis. The factors governing the transmission of prions between species remain unclear, in particular the means by which prion strains and PrP primary structure interact to affect inter-species prion transmission. Despite all these unknowns, advances in our understanding of prions have occurred because of their transmissibility to experimental animals and the development of transgenic (Tg) mouse models has done much to further our understanding about various aspects of prion biology. In this review we will focus on advances in our understanding of prion biology that

  4. The Cellular Prion Protein Prevents Copper-Induced Inhibition of P2X4 Receptors

    Directory of Open Access Journals (Sweden)

    Ramón A. Lorca

    2011-01-01

    Full Text Available Although the physiological function of the cellular prion protein (PrPC remains unknown, several evidences support the notion of its role in copper homeostasis. PrPC binds Cu2+ through a domain composed by four to five repeats of eight amino acids. Previously, we have shown that the perfusion of this domain prevents and reverses the inhibition by Cu2+ of the adenosine triphosphate (ATP-evoked currents in the P2X4 receptor subtype, highlighting a modulatory role for PrPC in synaptic transmission through regulation of Cu2+ levels. Here, we study the effect of full-length PrPC in Cu2+ inhibition of P2X4 receptor when both are coexpressed. PrPC expression does not significantly change the ATP concentration-response curve in oocytes expressing P2X4 receptors. However, the presence of PrPC reduces the inhibition by Cu2+ of the ATP-elicited currents in these oocytes, confirming our previous observations with the Cu2+ binding domain. Thus, our observations suggest a role for PrPC in modulating synaptic activity through binding of extracellular Cu2+.

  5. Melatonin Promotes Apoptosis of Oxaliplatin-resistant Colorectal Cancer Cells Through Inhibition of Cellular Prion Protein.

    Science.gov (United States)

    Lee, Jun Hee; Yoon, Yeo Min; Han, Yong-Seok; Yun, Chul Won; Lee, Sang Hun

    2018-04-01

    Drug resistance restricts the efficacy of chemotherapy in colorectal cancer. However, the detailed molecular mechanism of drug resistance in colorectal cancer cells remains unclear. The level of cellular prion protein (PrP C ) in oxaliplatin-resistant colorectal cancer (SNU-C5/Oxal-R) cells was assessed. PrP C level in SNU-C5/Oxal-R cells was significantly increased compared to that in wild-type (SNU-C5) cells. Superoxide dismutase and catalase activities were higher in SNU-C5/Oxal-R cells than in SNU-C5 cells. Treatment of SNU-C5/Oxal-R cells with oxaliplatin and melatonin reduced PrP C expression, while suppressing antioxidant enzyme activity and increasing superoxide anion generation. In SNU-C5/Oxal-R cells, endoplasmic reticulum stress and apoptosis were significantly increased following co-treatment with oxaliplatin and melatonin compared to treatment with oxaliplatin alone. Co-treatment with oxaliplatin and melatonin increased endoplasmic reticulum stress in and apoptosis of SNU-C5/Oxal-R cells through inhibition of PrP C , suggesting that PrP C could be a key molecule in oxaliplatin resistance of colorectal cancer cells. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  6. Identification of novel putative-binding proteins for cellular prion protein and a specific interaction with the STIP1 homology and U-Box-containing protein 1

    OpenAIRE

    Gimenez, Ana Paula Lappas; Richter, Larissa Morato Luciani; Atherino, Mariana Campos; Beirão, Breno Castello Branco; Fávaro, Celso; Costa, Michele Dietrich Moura; Zanata, Silvio Marques; Malnic, Bettina; Mercadante, Adriana Frohlich

    2015-01-01

    Prion diseases involve the conversion of the endogenous cellular prion protein, PrPC, into a misfolded infectious isoform, PrPSc. Several functions have been attributed to PrPC, and its role has also been investigated in the olfactory system. PrPC is expressed in both the olfactory bulb (OB) and olfactory epithelium (OE) and the nasal cavity is an important route of transmission of diseases caused by prions. Moreover, Prnp−/− mice showed impaired behavior in olfactory tests. Given the high Pr...

  7. Prions and neuro degenerative diseases | Nair | African Journal of ...

    African Journals Online (AJOL)

    Prion is a disease-causing agent that is neither bacterial nor fungal nor viral and contains no genetic material. A prion is a protein that occurs normally in a harmless form. By folding into an aberrant shape, the normal prion turns into a rogue agent. It then co-opts other normal prions to become rogue prions. Prions have ...

  8. Spermidine cures yeast of prions

    Directory of Open Access Journals (Sweden)

    Shaun H. Speldewinde

    2015-12-01

    Full Text Available Prions are self-perpetuating amyloid protein aggregates which underlie various neurodegenerative diseases in mammals. The molecular basis underlying their conversion from a normally soluble protein into the prion form remains largely unknown. Studies aimed at uncovering these mechanism(s are therefore essential if we are to develop effective therapeutic strategies to counteract these disease-causing entities. Autophagy is a cellular degradation system which has predominantly been considered as a non-selective bulk degradation process which recycles macromolecules in response to starvation conditions. We now know that autophagy also serves as a protein quality control mechanism which selectively degrades protein aggregates and damaged organelles. These are commonly accumulated in various neurodegenerative disorders including prion diseases. In our recent study [Speldewinde et al. Mol. Biol. Cell. (2015] we used the well-established yeast [PSI+]/Sup35 and [PIN­+]/Rnq1 prion models to show that autophagy prevents sporadic prion formation. Importantly, we found that spermidine, a polyamine that has been used to increase autophagic flux, acts as a protective agent which prevents spontaneous prion formation.

  9. Prion-based memory of heat stress in yeast.

    Science.gov (United States)

    Chernova, Tatiana A; Chernoff, Yury O; Wilkinson, Keith D

    2017-05-04

    Amyloids and amyloid-based prions are self-perpetuating protein aggregates which can spread by converting a normal protein of the same sequence into a prion form. They are associated with diseases in humans and mammals, and control heritable traits in yeast and other fungi. Some amyloids are implicated in biologically beneficial processes. As prion formation generates reproducible memory of a conformational change, prions can be considered as molecular memory devices.  We have demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature. This prion promotes conversion of other proteins into prions and can persist in a fraction of cells for a significant number of cell generations after stress, thus maintaining the memory of stress in a population of surviving cells. Acquisition of an amino acid substitution required for Lsb2 to form a prion coincides with acquisition of increased thermotolerance in the evolution of Saccharomyces yeast. Thus the ability to form an Lsb2 prion in response to stress coincides with yeast adaptation to growth at higher temperatures. These findings intimately connect prion formation to the cellular response to environmental stresses.

  10. Activation of human natural killer cells by the soluble form of cellular prion protein

    Energy Technology Data Exchange (ETDEWEB)

    Seong, Yeon-Jae [Laboratory of Immunology and Infectious Diseases, Graduate School of Medical Science and Engineering, KAIST, Daejeon (Korea, Republic of); Hafis Clinic, Seoul (Korea, Republic of); Sung, Pil Soo; Jang, Young-Soon; Choi, Young Joon [Laboratory of Immunology and Infectious Diseases, Graduate School of Medical Science and Engineering, KAIST, Daejeon (Korea, Republic of); Park, Bum-Chan [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon (Korea, Republic of); Park, Su-Hyung [Laboratory of Translational Immunology and Vaccinology, Graduate School of Medical Science and Engineering, KAIST, Daejeon (Korea, Republic of); Park, Young Woo [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon (Korea, Republic of); Shin, Eui-Cheol, E-mail: ecshin@kaist.ac.kr [Laboratory of Immunology and Infectious Diseases, Graduate School of Medical Science and Engineering, KAIST, Daejeon (Korea, Republic of)

    2015-08-21

    Cellular prion protein (PrP{sup C}) is widely expressed in various cell types, including cells of the immune system. However, the specific roles of PrP{sup C} in the immune system have not been clearly elucidated. In the present study, we investigated the effects of a soluble form of recombinant PrP{sup C} protein on human natural killer (NK) cells. Recombinant soluble PrP{sup C} protein was generated by fusion of human PrP{sup C} with the Fc portion of human IgG{sub 1} (PrP{sup C}-Fc). PrP{sup C}-Fc binds to the surface of human NK cells, particularly to CD56{sup dim} NK cells. PrP{sup C}-Fc induced the production of cytokines and chemokines and the degranulation of granzyme B from NK cells. In addition, PrP{sup C}-Fc facilitated the IL-15-induced proliferation of NK cells. PrP{sup C}-Fc induced phosphorylation of ERK-1/2 and JNK in NK cells, and inhibitors of the ERK or the JNK pathways abrogated PrP{sup C}-Fc-induced cytokine production in NK cells. In conclusion, the soluble form of recombinant PrP{sup C}-Fc protein activates human NK cells via the ERK and JNK signaling pathways. - Highlights: • Recombinant soluble PrP{sup C} (PrP{sup C}-Fc) was generated by fusion of human PrP{sup C} with IgG1 Fc portion. • PrP{sup C}-Fc protein induces the production of cytokines and degranulation from human NK cells. • PrP{sup C}-Fc protein enhances the IL-15-induced proliferation of human NK cells. • PrP{sup C}-Fc protein activates human NK cells via the ERK and JNK signaling pathways.

  11. Activation of human natural killer cells by the soluble form of cellular prion protein

    International Nuclear Information System (INIS)

    Seong, Yeon-Jae; Sung, Pil Soo; Jang, Young-Soon; Choi, Young Joon; Park, Bum-Chan; Park, Su-Hyung; Park, Young Woo; Shin, Eui-Cheol

    2015-01-01

    Cellular prion protein (PrP C ) is widely expressed in various cell types, including cells of the immune system. However, the specific roles of PrP C in the immune system have not been clearly elucidated. In the present study, we investigated the effects of a soluble form of recombinant PrP C protein on human natural killer (NK) cells. Recombinant soluble PrP C protein was generated by fusion of human PrP C with the Fc portion of human IgG 1 (PrP C -Fc). PrP C -Fc binds to the surface of human NK cells, particularly to CD56 dim NK cells. PrP C -Fc induced the production of cytokines and chemokines and the degranulation of granzyme B from NK cells. In addition, PrP C -Fc facilitated the IL-15-induced proliferation of NK cells. PrP C -Fc induced phosphorylation of ERK-1/2 and JNK in NK cells, and inhibitors of the ERK or the JNK pathways abrogated PrP C -Fc-induced cytokine production in NK cells. In conclusion, the soluble form of recombinant PrP C -Fc protein activates human NK cells via the ERK and JNK signaling pathways. - Highlights: • Recombinant soluble PrP C (PrP C -Fc) was generated by fusion of human PrP C with IgG1 Fc portion. • PrP C -Fc protein induces the production of cytokines and degranulation from human NK cells. • PrP C -Fc protein enhances the IL-15-induced proliferation of human NK cells. • PrP C -Fc protein activates human NK cells via the ERK and JNK signaling pathways

  12. Functional interactions of nucleocapsid protein of feline immunodeficiency virus and cellular prion protein with the viral RNA.

    Science.gov (United States)

    Moscardini, Mila; Pistello, Mauro; Bendinelli, M; Ficheux, Damien; Miller, Jennifer T; Gabus, Caroline; Le Grice, Stuart F J; Surewicz, Witold K; Darlix, Jean-Luc

    2002-04-19

    All lentiviruses and oncoretroviruses examined so far encode a major nucleic-acid binding protein (nucleocapsid or NC* protein), approximately 2500 molecules of which coat the dimeric RNA genome. Studies on HIV-1 and MoMuLV using in vitro model systems and in vivo have shown that NC protein is required to chaperone viral RNA dimerization and packaging during virus assembly, and proviral DNA synthesis by reverse transcriptase (RT) during infection. The human cellular prion protein (PrP), thought to be the major component of the agent causing transmissible spongiform encephalopathies (TSE), was recently found to possess a strong affinity for nucleic acids and to exhibit chaperone properties very similar to HIV-1 NC protein in the HIV-1 context in vitro. Tight binding of PrP to nucleic acids is proposed to participate directly in the prion disease process. To extend our understanding of lentiviruses and of the unexpected nucleic acid chaperone properties of the human prion protein, we set up an in vitro system to investigate replication of the feline immunodeficiency virus (FIV), which is functionally and phylogenetically distant from HIV-1. The results show that in the FIV model system, NC protein chaperones viral RNA dimerization, primer tRNA(Lys,3) annealing to the genomic primer-binding site (PBS) and minus strand DNA synthesis by the homologous FIV RT. FIV NC protein is able to trigger specific viral DNA synthesis by inhibiting self-priming of reverse transcription. The human prion protein was found to mimic the properties of FIV NC with respect to primer tRNA annealing to the viral RNA and chaperoning minus strand DNA synthesis. Copyright 2002 Elsevier Science Ltd.

  13. Prions and prion-like proteins.

    Science.gov (United States)

    Fraser, Paul E

    2014-07-18

    Prions are self-replicating protein aggregates and are the primary causative factor in a number of neurological diseases in mammals. The prion protein (PrP) undergoes a conformational transformation leading to aggregation into an infectious cellular pathogen. Prion-like protein spreading and transmission of aggregates between cells have also been demonstrated for other proteins associated with Alzheimer disease and Parkinson disease. This protein-only phenomenon may therefore have broader implications in neurodegenerative disorders. The minireviews in this thematic series highlight the recent advances in prion biology and the roles these unique proteins play in disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Determining the relative susceptibility of four prion protein genotypes to atypical scrapie

    Science.gov (United States)

    Atypical scrapie is a sheep prion (PrPSc) disease whose epidemiology is consistent with a sporadic origin and is associated with specific polymorphisms of the normal cellular prion protein (PrPC). We describe a mass spectrometry-based method of detecting and quantifying the polymorphisms of sheep P...

  15. Yeast prions: structure, biology, and prion-handling systems.

    Science.gov (United States)

    Wickner, Reed B; Shewmaker, Frank P; Bateman, David A; Edskes, Herman K; Gorkovskiy, Anton; Dayani, Yaron; Bezsonov, Evgeny E

    2015-03-01

    A prion is an infectious protein horizontally transmitting a disease or trait without a required nucleic acid. Yeast and fungal prions are nonchromosomal genes composed of protein, generally an altered form of a protein that catalyzes the same alteration of the protein. Yeast prions are thus transmitted both vertically (as genes composed of protein) and horizontally (as infectious proteins, or prions). Formation of amyloids (linear ordered β-sheet-rich protein aggregates with β-strands perpendicular to the long axis of the filament) underlies most yeast and fungal prions, and a single prion protein can have any of several distinct self-propagating amyloid forms with different biological properties (prion variants). Here we review the mechanism of faithful templating of protein conformation, the biological roles of these prions, and their interactions with cellular chaperones, the Btn2 and Cur1 aggregate-handling systems, and other cellular factors governing prion generation and propagation. Human amyloidoses include the PrP-based prion conditions and many other, more common amyloid-based diseases, several of which show prion-like features. Yeast prions increasingly are serving as models for the understanding and treatment of many mammalian amyloidoses. Patients with different clinical pictures of the same amyloidosis may be the equivalent of yeasts with different prion variants. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Gene knockout of tau expression does not contribute to the pathogenesis of prion disease.

    Science.gov (United States)

    Lawson, Victoria A; Klemm, Helen M; Welton, Jeremy M; Masters, Colin L; Crouch, Peter; Cappai, Roberto; Ciccotosto, Giuseppe D

    2011-11-01

    Prion diseases or transmissible spongiform encephalopathies are a group of fatal and transmissible disorders affecting the central nervous system of humans and animals. The principal agent of prion disease transmission and pathogenesis is proposed to be an abnormal protease-resistant isoform of the normal cellular prion protein. The microtubule-associated protein tau is elevated in patients with Creutzfeldt-Jakob disease. To determine whether tau expression contributes to prion disease pathogenesis, tau knockout and control wild-type mice were infected with the M1000 strain of mouse-adapted human prions. Immunohistochemical analysis for total tau expression in prion-infected wild-type mice indicated tau aggregation in the cytoplasm of a subpopulation of neurons in regions associated with spongiform change. Western immunoblot analysis of brain homogenates revealed a decrease in total tau immunoreactivity and epitope-specific changes in tau phosphorylation. No significant difference in incubation period or other disease features were observed between tau knockout and wild-type mice with clinical prion disease. These results demonstrate that, in this model of prion disease, tau does not contribute to the pathogenesis of prion disease and that changes in the tau protein profile observed in mice with clinical prion disease occurs as a consequence of the prion-induced pathogenesis.

  17. Iron-Restricted Diet Affects Brain Ferritin Levels, Dopamine Metabolism and Cellular Prion Protein in a Region-Specific Manner

    Directory of Open Access Journals (Sweden)

    Jessica M. V. Pino

    2017-05-01

    Full Text Available Iron is an essential micronutrient for several physiological functions, including the regulation of dopaminergic neurotransmission. On the other hand, both iron, and dopamine can affect the folding and aggregation of proteins related with neurodegenerative diseases, such as cellular prion protein (PrPC and α-synuclein, suggesting that deregulation of iron homeostasis and the consequential disturbance of dopamine metabolism can be a risk factor for conformational diseases. These proteins, in turn, are known to participate in the regulation of iron and dopamine metabolism. In this study, we evaluated the effects of dietary iron restriction on brain ferritin levels, dopamine metabolism, and the expression levels of PrPC and α-synuclein. To achieve this goal, C57BL/6 mice were fed with iron restricted diet (IR or with normal diet (CTL for 1 month. IR reduced iron and ferritin levels in liver. Ferritin reduction was also observed in the hippocampus. However, in the striatum of IR group, ferritin level was increased, suggesting that under iron-deficient condition, each brain area might acquire distinct capacity to store iron. Increased lipid peroxidation was observed only in hippocampus of IR group, where ferritin level was reduced. IR also generated discrete results regarding dopamine metabolism of distinct brain regions: in striatum, the level of dopamine metabolites (DOPAC and HVA was reduced; in prefrontal cortex, only HVA was increased along with the enhanced MAO-A activity; in hippocampus, no alterations were observed. PrPC levels were increased only in the striatum of IR group, where ferritin level was also increased. PrPC is known to play roles in iron uptake. Thus, the increase of PrPC in striatum of IR group might be related to the increased ferritin level. α-synuclein was not altered in any regions. Abnormal accumulation of ferritin, increased MAO-A activity or lipid peroxidation are molecular features observed in several neurological

  18. Cellular Analysis of Adult Neural Stem Cells for Investigating Prion Biology.

    Science.gov (United States)

    Haigh, Cathryn L

    2017-01-01

    Traditional primary and secondary cell cultures have been used for the investigation of prion biology and disease for many years. While both types of cultures produce highly valid and immensely valuable results, they also have their limitations; traditional cell lines are often derived from cancers, therefore subject to numerous DNA changes, and primary cultures are labor-intensive and expensive to produce requiring sacrifice of many animals. Neural stem cell (NSC) cultures are a relatively new technology to be used for the study of prion biology and disease. While NSCs are subject to their own limitations-they are generally cultured ex vivo in environments that artificially force their growth-they also have their own unique advantages. NSCs retain the ability for self-renewal and can therefore be propagated in culture similarly to secondary cultures without genetic manipulation. In addition, NSCs are multipotent; they can be induced to differentiate into mature cells of central nervous system (CNS) linage. The combination of self-renewal and multipotency allows NSCs to be used as a primary cell line over multiple generations saving time, costs, and animal harvests, thus providing a valuable addition to the existing cell culture repertoire used for investigation of prion biology and disease. Furthermore, NSC cultures can be generated from mice of any genotype, either by embryonic harvest or harvest from adult brain, allowing gene expression to be studied without further genetic manipulation. This chapter describes a standard method of culturing adult NSCs and assays for monitoring NSC growth, migration, and differentiation and revisits basic reactive oxygen species detection in the context of NSC cultures.

  19. Clinical features in prion protein-deficient and wild-type cattle inoculated with transmissible mink encephalopathy (TME)

    Science.gov (United States)

    Background: Transmissible spongiform encephalopathies (TSEs) or prion diseases are caused by the propagation of a misfolded form (PrP**d) of the normal cellular prion protein, PrP**c. Recently, we have reported the generation and characterization of PrP**C-deficient cattle (PrP-/-) produced by a seq...

  20. Prion Diseases

    Science.gov (United States)

    ... with facebook share with twitter share with linkedin Prion Diseases Prion diseases are a related group of ... deer and elk. Why Is the Study of Prion Diseases a Priority for NIAID? Much about TSE ...

  1. Neuronal low-density lipoprotein receptor-related protein 1 binds and endocytoses prion fibrils via receptor cluster 4

    DEFF Research Database (Denmark)

    Jen, Angela; Parkyn, Celia J; Mootoosamy, Roy C

    2010-01-01

    For infectious prion protein (designated PrP(Sc)) to act as a template to convert normal cellular protein (PrP(C)) to its distinctive pathogenic conformation, the two forms of prion protein (PrP) must interact closely. The neuronal receptor that rapidly endocytoses PrP(C) is the low......-density lipoprotein receptor-related protein 1 (LRP1). We show here that on sensory neurons LRP1 is also the receptor that binds and rapidly endocytoses smaller oligomeric forms of infectious prion fibrils, and recombinant PrP fibrils. Although LRP1 binds two molecules of most ligands independently to its receptor...... both prion and LRP1 biology....

  2. Identification of novel putative-binding proteins for cellular prion protein and a specific interaction with the STIP1 homology and U-Box-containing protein 1

    Science.gov (United States)

    Gimenez, Ana Paula Lappas; Richter, Larissa Morato Luciani; Atherino, Mariana Campos; Beirão, Breno Castello Branco; Fávaro, Celso; Costa, Michele Dietrich Moura; Zanata, Silvio Marques; Malnic, Bettina; Mercadante, Adriana Frohlich

    2015-01-01

    ABSTRACT Prion diseases involve the conversion of the endogenous cellular prion protein, PrPC, into a misfolded infectious isoform, PrPSc. Several functions have been attributed to PrPC, and its role has also been investigated in the olfactory system. PrPC is expressed in both the olfactory bulb (OB) and olfactory epithelium (OE) and the nasal cavity is an important route of transmission of diseases caused by prions. Moreover, Prnp−/− mice showed impaired behavior in olfactory tests. Given the high PrPC expression in OE and its putative role in olfaction, we screened a mouse OE cDNA library to identify novel PrPC-binding partners. Ten different putative PrPC ligands were identified, which were involved in functions such as cellular proliferation and apoptosis, cytoskeleton and vesicle transport, ubiquitination of proteins, stress response, and other physiological processes. In vitro binding assays confirmed the interaction of PrPC with STIP1 homology and U-Box containing protein 1 (Stub1) and are reported here for the first time. Stub1 is a co-chaperone with ubiquitin E3-ligase activity, which is associated with neurodegenerative diseases characterized by protein misfolding and aggregation. Physiological and pathological implications of PrPC-Stub1 interaction are under investigation. The PrPC-binding proteins identified here are not exclusive to the OE, suggesting that these interactions may occur in other tissues and play general biological roles. These data corroborate the proposal that PrPC is part of a multiprotein complex that modulates several cellular functions and provide a platform for further studies on the physiological and pathological roles of prion protein. PMID:26237451

  3. Monoacylated Cellular Prion Proteins Reduce Amyloid-β-Induced Activation of Cytoplasmic Phospholipase A2 and Synapse Damage

    Directory of Open Access Journals (Sweden)

    Ewan West

    2015-06-01

    Full Text Available Alzheimer’s disease (AD is a progressive neurodegenerative disease characterized by the accumulation of amyloid-β (Aβ and the loss of synapses. Aggregation of the cellular prion protein (PrPC by Aβ oligomers induced synapse damage in cultured neurons. PrPC is attached to membranes via a glycosylphosphatidylinositol (GPI anchor, the composition of which affects protein targeting and cell signaling. Monoacylated PrPC incorporated into neurons bound “natural Aβ”, sequestering Aβ outside lipid rafts and preventing its accumulation at synapses. The presence of monoacylated PrPC reduced the Aβ-induced activation of cytoplasmic phospholipase A2 (cPLA2 and Aβ-induced synapse damage. This protective effect was stimulus specific, as treated neurons remained sensitive to α-synuclein, a protein associated with synapse damage in Parkinson’s disease. In synaptosomes, the aggregation of PrPC by Aβ oligomers triggered the formation of a signaling complex containing the cPLA2.a process, disrupted by monoacylated PrPC. We propose that monoacylated PrPC acts as a molecular sponge, binding Aβ oligomers at the neuronal perikarya without activating cPLA2 or triggering synapse damage.

  4. The cellular prion protein negatively regulates phagocytosis and cytokine expression in murine bone marrow-derived macrophages.

    Directory of Open Access Journals (Sweden)

    Min Wang

    Full Text Available The cellular prion protein (PrP(C is a glycosylphosphatidylinositol (GPI-anchored glycoprotein on the cell surface. Previous studies have demonstrated contradictory roles for PrP(C in connection with the phagocytic ability of macrophages. In the present work, we investigated the function of PrP(C in phagocytosis and cytokine expression in bone marrow-derived macrophages infected with Escherichia coli. E. coli infection induced an increase in the PRNP mRNA level. Knockout of PrP(C promoted bacterial uptake; upregulated Rab5, Rab7, and Eea1 mRNA expression; and increased the recruitment of lysosomal-associated membrane protein-2 to phagosomes, suggesting enhanced microbicidal activity. Remarkably, knockout of PrP(C suppressed the proliferation of internalized bacteria and increased the expression of cytokines such as interleukin-1β. Collectively, our data reveal an important role of PrP(C as a negative regulator for phagocytosis, phagosome maturation, cytokine expression, and macrophage microbicidal activity.

  5. The expanded octarepeat domain selectively binds prions and disrupts homomeric prion protein interactions

    NARCIS (Netherlands)

    Leliveld, S. R.; Dame, R.T.; Wuite, G.J.L.; Stitz, L.; Korth, C.

    2006-01-01

    Insertion of additional octarepeats into the prion protein gene has been genetically linked to familial Creutzfeldt Jakob disease and hence to de novo generation of infectious prions. The pivotal event during prion formation is the conversion of the normal prion protein (PrP

  6. The cellular prion protein interacts with the tissue non-specific alkaline phosphatase in membrane microdomains of bioaminergic neuronal cells.

    Directory of Open Access Journals (Sweden)

    Myriam Ermonval

    Full Text Available BACKGROUND: The cellular prion protein, PrP(C, is GPI anchored and abundant in lipid rafts. The absolute requirement of PrP(C in neurodegeneration associated to prion diseases is well established. However, the function of this ubiquitous protein is still puzzling. Our previous work using the 1C11 neuronal model, provided evidence that PrP(C acts as a cell surface receptor. Besides a ubiquitous signaling function of PrP(C, we have described a neuronal specificity pointing to a role of PrP(C in neuronal homeostasis. 1C11 cells, upon appropriate induction, engage into neuronal differentiation programs, giving rise either to serotonergic (1C11(5-HT or noradrenergic (1C11(NE derivatives. METHODOLOGY/PRINCIPAL FINDINGS: The neuronal specificity of PrP(C signaling prompted us to search for PrP(C partners in 1C11-derived bioaminergic neuronal cells. We show here by immunoprecipitation an association of PrP(C with an 80 kDa protein identified by mass spectrometry as the tissue non-specific alkaline phosphatase (TNAP. This interaction occurs in lipid rafts and is restricted to 1C11-derived neuronal progenies. Our data indicate that TNAP is implemented during the differentiation programs of 1C11(5-HT and 1C11(NE cells and is active at their cell surface. Noteworthy, TNAP may contribute to the regulation of serotonin or catecholamine synthesis in 1C11(5-HT and 1C11(NE bioaminergic cells by controlling pyridoxal phosphate levels. Finally, TNAP activity is shown to modulate the phosphorylation status of laminin and thereby its interaction with PrP. CONCLUSION/SIGNIFICANCE: The identification of a novel PrP(C partner in lipid rafts of neuronal cells favors the idea of a role of PrP in multiple functions. Because PrP(C and laminin functionally interact to support neuronal differentiation and memory consolidation, our findings introduce TNAP as a functional protagonist in the PrP(C-laminin interplay. The partnership between TNAP and PrP(C in neuronal cells may

  7. Signal transduction in neurons: effects of cellular prion protein on fyn kinase and ERK1/2 kinase

    Directory of Open Access Journals (Sweden)

    Tomasi Vittorio

    2010-12-01

    Full Text Available Abstract Background It has been reported that cellular prion protein (PrPc co-localizes with caveolin-1 and participates to signal transduction events by recruiting Fyn kinase. As PrPc is a secreted protein anchored to the outer surface membrane through a glycosylphosphatidylinositol (GPI anchor (secPrP and caveolin-1 is located in the inner leaflet of plasma membrane, there is a problem of how the two proteins can physically interact each other and transduce signals. Results By using the GST-fusion proteins system we observed that PrPc strongly interacts with caveolin-1 scaffolding domain and with a caveolin-1 hydrophilic C-terminal region, but not with the caveolin-1 N-terminal region. In vitro binding experiments were also performed to define the site(s of PrPc interacting with cav-1. The results are consistent with a participation of PrPc octapeptide repeats motif in the binding to caveolin-1 scaffolding domain. The caveolar localization of PrPc was ascertained by co-immunoprecipitation, by co-localization after flotation in density gradients and by confocal microscopy analysis of PrPc and caveolin-1 distributions in a neuronal cell line (GN11 expressing caveolin-1 at high levels. Conclusions We observed that, after antibody-mediated cross-linking or copper treatment, PrPc was internalized probably into caveolae. We propose that following translocation from rafts to caveolae or caveolae-like domains, secPrP could interact with caveolin-1 and induce signal transduction events.

  8. Signal transduction in neurons: effects of cellular prion protein on fyn kinase and ERK1/2 kinase.

    Science.gov (United States)

    Tomasi, Vittorio

    2010-12-16

    It has been reported that cellular prion protein (PrPc) co-localizes with caveolin-1 and participates to signal transduction events by recruiting Fyn kinase. As PrPc is a secreted protein anchored to the outer surface membrane through a glycosylphosphatidylinositol (GPI) anchor (secPrP) and caveolin-1 is located in the inner leaflet of plasma membrane, there is a problem of how the two proteins can physically interact each other and transduce signals. By using the GST-fusion proteins system we observed that PrPc strongly interacts with caveolin-1 scaffolding domain and with a caveolin-1 hydrophilic C-terminal region, but not with the caveolin-1 N-terminal region. In vitro binding experiments were also performed to define the site(s) of PrPc interacting with cav-1. The results are consistent with a participation of PrPc octapeptide repeats motif in the binding to caveolin-1 scaffolding domain. The caveolar localization of PrPc was ascertained by co-immunoprecipitation, by co-localization after flotation in density gradients and by confocal microscopy analysis of PrPc and caveolin-1 distributions in a neuronal cell line (GN11) expressing caveolin-1 at high levels. We observed that, after antibody-mediated cross-linking or copper treatment, PrPc was internalized probably into caveolae. We propose that following translocation from rafts to caveolae or caveolae-like domains, secPrP could interact with caveolin-1 and induce signal transduction events.

  9. The complexity and implications of yeast prion domains

    Science.gov (United States)

    2011-01-01

    Prions are infectious proteins with altered conformations converted from otherwise normal host proteins. While there is only one known mammalian prion protein, PrP, a handful of prion proteins have been identified in the yeast Saccharomyces cerevisiae. Yeast prion proteins usually have a defined region called prion domain (PrD) essential for prion properties, which are typically rich in glutamine (Q) and asparagine (N). Despite sharing several common features, individual yeast PrDs are generally intricate and divergent in their compositional characteristics, which potentially implicates their prion phenotypes, such as prion-mediated transcriptional regulations. PMID:22156731

  10. Genetic human prion disease modelled in PrP transgenic Drosophila.

    Science.gov (United States)

    Thackray, Alana M; Cardova, Alzbeta; Wolf, Hanna; Pradl, Lydia; Vorberg, Ina; Jackson, Walker S; Bujdoso, Raymond

    2017-09-20

    Inherited human prion diseases, such as fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD), are associated with autosomal dominant mutations in the human prion protein gene PRNP and accumulation of PrP Sc , an abnormal isomer of the normal host protein PrP C , in the brain of affected individuals. PrP Sc is the principal component of the transmissible neurotoxic prion agent. It is important to identify molecular pathways and cellular processes that regulate prion formation and prion-induced neurotoxicity. This will allow identification of possible therapeutic interventions for individuals with, or at risk from, genetic human prion disease. Increasingly, Drosophila has been used to model human neurodegenerative disease. An important unanswered question is whether genetic prion disease with concomitant spontaneous prion formation can be modelled in Drosophila We have used pUAST/PhiC31-mediated site-directed mutagenesis to generate Drosophila transgenic for murine or hamster PrP (prion protein) that carry single-codon mutations associated with genetic human prion disease. Mouse or hamster PrP harbouring an FFI (D178N) or fCJD (E200K) mutation showed mild Proteinase K resistance when expressed in Drosophila Adult Drosophila transgenic for FFI or fCJD variants of mouse or hamster PrP displayed a spontaneous decline in locomotor ability that increased in severity as the flies aged. Significantly, this mutant PrP-mediated neurotoxic fly phenotype was transferable to recipient Drosophila that expressed the wild-type form of the transgene. Collectively, our novel data are indicative of the spontaneous formation of a PrP-dependent neurotoxic phenotype in FFI- or CJD-PrP transgenic Drosophila and show that inherited human prion disease can be modelled in this invertebrate host. © 2017 The Author(s).

  11. Generating Bona Fide Mammalian Prions with Internal Deletions.

    Science.gov (United States)

    Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel

    2016-08-01

    Mammalian prions are PrP proteins with altered structures causing transmissible fatal neurodegenerative diseases. They are self-perpetuating through formation of beta-sheet-rich assemblies that seed conformational change of cellular PrP. Pathological PrP usually forms an insoluble protease-resistant core exhibiting beta-sheet structures but no more alpha-helical content, loosing the three alpha-helices contained in the correctly folded PrP. The lack of a high-resolution prion structure makes it difficult to understand the dynamics of conversion and to identify elements of the protein involved in this process. To determine whether completeness of residues within the protease-resistant domain is required for prions, we performed serial deletions in the helix H2 C terminus of ovine PrP, since this region has previously shown some tolerance to sequence changes without preventing prion replication. Deletions of either four or five residues essentially preserved the overall PrP structure and mutant PrP expressed in RK13 cells were efficiently converted into bona fide prions upon challenge by three different prion strains. Remarkably, deletions in PrP facilitated the replication of two strains that otherwise do not replicate in this cellular context. Prions with internal deletion were self-propagating and de novo infectious for naive homologous and wild-type PrP-expressing cells. Moreover, they caused transmissible spongiform encephalopathies in mice, with similar biochemical signatures and neuropathologies other than the original strains. Prion convertibility and transfer of strain-specific information are thus preserved despite shortening of an alpha-helix in PrP and removal of residues within prions. These findings provide new insights into sequence/structure/infectivity relationship for prions. Prions are misfolded PrP proteins that convert the normal protein into a replicate of their own abnormal form. They are responsible for invariably fatal neurodegenerative

  12. Synthetic prions and other human neurodegenerative proteinopathies.

    Science.gov (United States)

    Le, Nhat Tran Thanh; Narkiewicz, Joanna; Aulić, Suzana; Salzano, Giulia; Tran, Hoa Thanh; Scaini, Denis; Moda, Fabio; Giachin, Gabriele; Legname, Giuseppe

    2015-09-02

    Transmissible spongiform encephalopathies (TSE) are a heterogeneous group of neurodegenerative disorders. The common feature of these diseases is the pathological conversion of the normal cellular prion protein (PrP(C)) into a β-structure-rich conformer-termed PrP(Sc). The latter can induce a self-perpetuating process leading to amplification and spreading of pathological protein assemblies. Much evidence suggests that PrP(Sc) itself is able to recruit and misfold PrP(C) into the pathological conformation. Recent data have shown that recombinant PrP(C) can be misfolded in vitro and the resulting synthetic conformers are able to induce the conversion of PrP(C) into PrP(Sc)in vivo. In this review we describe the state-of-the-art of the body of literature in this field. In addition, we describe a cell-based assay to test synthetic prions in cells, providing further evidence that synthetic amyloids are able to template conversion of PrP into prion inclusions. Studying prions might help to understand the pathological mechanisms governing other neurodegenerative diseases. Aggregation and deposition of misfolded proteins is a common feature of several neurodegenerative disorders, such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis and other disorders. Although the proteins implicated in each of these diseases differ, they share a common prion mechanism. Recombinant proteins are able to aggregate in vitro into β-rich amyloid fibrils, sharing some features of the aggregates found in the brain. Several studies have reported that intracerebral inoculation of synthetic aggregates lead to unique pathology, which spread progressively to distal brain regions and reduced survival time in animals. Here, we review the prion-like features of different proteins involved in neurodegenerative disorders, such as α-synuclein, superoxide dismutase-1, amyloid-β and tau. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Prion subcellular fractionation reveals infectivity spectrum, with a high titre-low PrPres level disparity

    Directory of Open Access Journals (Sweden)

    Lewis Victoria

    2012-04-01

    Full Text Available Abstract Background Prion disease transmission and pathogenesis are linked to misfolded, typically protease resistant (PrPres conformers of the normal cellular prion protein (PrPC, with the former posited to be the principal constituent of the infectious 'prion'. Unexplained discrepancies observed between detectable PrPres and infectivity levels exemplify the complexity in deciphering the exact biophysical nature of prions and those host cell factors, if any, which contribute to transmission efficiency. In order to improve our understanding of these important issues, this study utilized a bioassay validated cell culture model of prion infection to investigate discordance between PrPres levels and infectivity titres at a subcellular resolution. Findings Subcellular fractions enriched in lipid rafts or endoplasmic reticulum/mitochondrial marker proteins were equally highly efficient at prion transmission, despite lipid raft fractions containing up to eight times the levels of detectable PrPres. Brain homogenate infectivity was not differentially enhanced by subcellular fraction-specific co-factors, and proteinase K pre-treatment of selected fractions modestly, but equally reduced infectivity. Only lipid raft associated infectivity was enhanced by sonication. Conclusions This study authenticates a subcellular disparity in PrPres and infectivity levels, and eliminates simultaneous divergence of prion strains as the explanation for this phenomenon. On balance, the results align best with the concept that transmission efficiency is influenced more by intrinsic characteristics of the infectious prion, rather than cellular microenvironment conditions or absolute PrPres levels.

  14. Protease-sensitive synthetic prions.

    Directory of Open Access Journals (Sweden)

    David W Colby

    2010-01-01

    Full Text Available Prions arise when the cellular prion protein (PrP(C undergoes a self-propagating conformational change; the resulting infectious conformer is designated PrP(Sc. Frequently, PrP(Sc is protease-resistant but protease-sensitive (s prions have been isolated in humans and other animals. We report here that protease-sensitive, synthetic prions were generated in vitro during polymerization of recombinant (rec PrP into amyloid fibers. In 22 independent experiments, recPrP amyloid preparations, but not recPrP monomers or oligomers, transmitted disease to transgenic mice (n = 164, denoted Tg9949 mice, that overexpress N-terminally truncated PrP. Tg9949 control mice (n = 174 did not spontaneously generate prions although they were prone to late-onset spontaneous neurological dysfunction. When synthetic prion isolates from infected Tg9949 mice were serially transmitted in the same line of mice, they exhibited sPrP(Sc and caused neurodegeneration. Interestingly, these protease-sensitive prions did not shorten the life span of Tg9949 mice despite causing extensive neurodegeneration. We inoculated three synthetic prion isolates into Tg4053 mice that overexpress full-length PrP; Tg4053 mice are not prone to developing spontaneous neurological dysfunction. The synthetic prion isolates caused disease in 600-750 days in Tg4053 mice, which exhibited sPrP(Sc. These novel synthetic prions demonstrate that conformational changes in wild-type PrP can produce mouse prions composed exclusively of sPrP(Sc.

  15. Prions: Beyond a Single Protein

    Science.gov (United States)

    Das, Alvin S.

    2016-01-01

    SUMMARY Since the term protein was first coined in 1838 and protein was discovered to be the essential component of fibrin and albumin, all cellular proteins were presumed to play beneficial roles in plants and mammals. However, in 1967, Griffith proposed that proteins could be infectious pathogens and postulated their involvement in scrapie, a universally fatal transmissible spongiform encephalopathy in goats and sheep. Nevertheless, this novel hypothesis had not been evidenced until 1982, when Prusiner and coworkers purified infectious particles from scrapie-infected hamster brains and demonstrated that they consisted of a specific protein that he called a “prion.” Unprecedentedly, the infectious prion pathogen is actually derived from its endogenous cellular form in the central nervous system. Unlike other infectious agents, such as bacteria, viruses, and fungi, prions do not contain genetic materials such as DNA or RNA. The unique traits and genetic information of prions are believed to be encoded within the conformational structure and posttranslational modifications of the proteins. Remarkably, prion-like behavior has been recently observed in other cellular proteins—not only in pathogenic roles but also serving physiological functions. The significance of these fascinating developments in prion biology is far beyond the scope of a single cellular protein and its related disease. PMID:27226089

  16. STAT proteins: from normal control of cellular events to tumorigenesis.

    Science.gov (United States)

    Calò, Valentina; Migliavacca, Manuela; Bazan, Viviana; Macaluso, Marcella; Buscemi, Maria; Gebbia, Nicola; Russo, Antonio

    2003-11-01

    Signal transducers and activators of transcription (STAT) proteins comprise a family of transcription factors latent in the cytoplasm that participate in normal cellular events, such as differentiation, proliferation, cell survival, apoptosis, and angiogenesis following cytokine, growth factor, and hormone signaling. STATs are activated by tyrosine phosphorylation, which is normally a transient and tightly regulates process. Nevertheless, several constitutively activated STATs have been observed in a wide number of human cancer cell lines and primary tumors, including blood malignancies and solid neoplasias. STATs can be divided into two groups according to their specific functions. One is made up of STAT2, STAT4, and STAT6, which are activated by a small number of cytokines and play a distinct role in the development of T-cells and in IFNgamma signaling. The other group includes STAT1, STAT3, and STAT5, activated in different tissues by means of a series of ligands and involved in IFN signaling, development of the mammary gland, response to GH, and embriogenesis. This latter group of STATS plays an important role in controlling cell-cycle progression and apoptosis and thus contributes to oncogenesis. Although an increased expression of STAT1 has been observed in many human neoplasias, this molecule can be considered a potential tumor suppressor, since it plays an important role in growth arrest and in promoting apoptosis. On the other hand, STAT3 and 5 are considered as oncogenes, since they bring about the activation of cyclin D1, c-Myc, and bcl-xl expression, and are involved in promoting cell-cycle progression, cellular transformation, and in preventing apoptosis.

  17. Prion protein accumulation in lipid rafts of mouse aging brain.

    Directory of Open Access Journals (Sweden)

    Federica Agostini

    Full Text Available The cellular form of the prion protein (PrP(C is a normal constituent of neuronal cell membranes. The protein misfolding causes rare neurodegenerative disorders known as transmissible spongiform encephalopathies or prion diseases. These maladies can be sporadic, genetic or infectious. Sporadic prion diseases are the most common form mainly affecting aging people. In this work, we investigate the biochemical environment in which sporadic prion diseases may develop, focusing our attention on the cell membrane of neurons in the aging brain. It is well established that with aging the ratio between the most abundant lipid components of rafts undergoes a major change: while cholesterol decreases, sphingomyelin content rises. Our results indicate that the aging process modifies the compartmentalization of PrP(C. In old mice, this change favors PrP(C accumulation in detergent-resistant membranes, particularly in hippocampi. To confirm the relationship between lipid content changes and PrP(C translocation into detergent-resistant membranes (DRMs, we looked at PrP(C compartmentalization in hippocampi from acid sphingomyelinase (ASM knockout (KO mice and synaptosomes enriched in sphingomyelin. In the presence of high sphingomyelin content, we observed a significant increase of PrP(C in DRMS. This process is not due to higher levels of total protein and it could, in turn, favor the onset of sporadic prion diseases during aging as it increases the PrP intermolecular contacts into lipid rafts. We observed that lowering sphingomyelin in scrapie-infected cells by using fumonisin B1 led to a 50% decrease in protease-resistant PrP formation. This may suggest an involvement of PrP lipid environment in prion formation and consequently it may play a role in the onset or development of sporadic forms of prion diseases.

  18. Prion replication without host adaptation during interspecies transmissions.

    Science.gov (United States)

    Bian, Jifeng; Khaychuk, Vadim; Angers, Rachel C; Fernández-Borges, Natalia; Vidal, Enric; Meyerett-Reid, Crystal; Kim, Sehun; Calvi, Carla L; Bartz, Jason C; Hoover, Edward A; Agrimi, Umberto; Richt, Jürgen A; Castilla, Joaquín; Telling, Glenn C

    2017-01-31

    Adaptation of prions to new species is thought to reflect the capacity of the host-encoded cellular form of the prion protein (PrP C ) to selectively propagate optimized prion conformations from larger ensembles generated in the species of origin. Here we describe an alternate replicative process, termed nonadaptive prion amplification (NAPA), in which dominant conformers bypass this requirement during particular interspecies transmissions. To model susceptibility of horses to prions, we produced transgenic (Tg) mice expressing cognate PrP C Although disease transmission to only a subset of infected TgEq indicated a significant barrier to EqPrP C conversion, the resulting horse prions unexpectedly failed to cause disease upon further passage to TgEq. TgD expressing deer PrP C was similarly refractory to deer prions from diseased TgD infected with mink prions. In both cases, the resulting prions transmitted to mice expressing PrP C from the species of prion origin, demonstrating that transmission barrier eradication of the originating prions was ephemeral and adaptation superficial in TgEq and TgD. Horse prions produced in vitro by protein misfolding cyclic amplification of mouse prions using horse PrP C also failed to infect TgEq but retained tropism for wild-type mice. Concordant patterns of neuropathology and prion deposition in susceptible mice infected with NAPA prions and the corresponding prion of origin confirmed preservation of strain properties. The comparable responses of both prion types to guanidine hydrochloride denaturation indicated this occurs because NAPA precludes selection of novel prion conformations. Our findings provide insights into mechanisms regulating interspecies prion transmission and a framework to reconcile puzzling epidemiological features of certain prion disorders.

  19. Soluble Aβ aggregates can inhibit prion propagation.

    Science.gov (United States)

    Sarell, Claire J; Quarterman, Emma; Yip, Daniel C-M; Terry, Cassandra; Nicoll, Andrew J; Wadsworth, Jonathan D F; Farrow, Mark A; Walsh, Dominic M; Collinge, John

    2017-11-01

    Mammalian prions cause lethal neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD) and consist of multi-chain assemblies of misfolded cellular prion protein (PrP C ). Ligands that bind to PrP C can inhibit prion propagation and neurotoxicity. Extensive prior work established that certain soluble assemblies of the Alzheimer's disease (AD)-associated amyloid β-protein (Aβ) can tightly bind to PrP C , and that this interaction may be relevant to their toxicity in AD. Here, we investigated whether such soluble Aβ assemblies might, conversely, have an inhibitory effect on prion propagation. Using cellular models of prion infection and propagation and distinct Aβ preparations, we found that the form of Aβ assemblies which most avidly bound to PrP in vitro also inhibited prion infection and propagation. By contrast, forms of Aβ which exhibit little or no binding to PrP were unable to attenuate prion propagation. These data suggest that soluble aggregates of Aβ can compete with prions for binding to PrP C and emphasize the bidirectional nature of the interplay between Aβ and PrP C in Alzheimer's and prion diseases. Such inhibitory effects of Aβ on prion propagation may contribute to the apparent fall-off in the incidence of sporadic CJD at advanced age where cerebral Aβ deposition is common. © 2017 The Authors.

  20. The inhibition of prions through blocking prion conversion by permanently charged branched polyamines of low cytotoxicity.

    Science.gov (United States)

    Lim, Yong-beom; Mays, Charles E; Kim, Younghwan; Titlow, William B; Ryou, Chongsuk

    2010-03-01

    Branched polyamines are effective in inhibiting prions in a cationic surface charge density dependent manner. However, toxicity associated with branched polyamines, in general, often hampers the successful application of the compounds to treat prion diseases. Here, we report that constitutively maintained cationic properties in branched polyamines reduced the intrinsic toxicity of the compounds while retaining the anti-prion activities. In prion-infected neuroblastoma cells, quaternization of amines in polyethyleneimine (PEI) and polyamidoamine (PAMAM) dendrimers markedly increased the nontoxic concentration ranges of the compounds and still supported, albeit reduced, an appreciable level of anti-prion activity in clearing prions from the infected cells. Furthermore, quaternized PEI was able to degrade prions at acidic pH conditions and inhibit the in vitro prion propagation facilitated by conversion of the normal prion protein isoform to its misfolded counterpart, although such activities were decreased by quaternization. Quaternized PAMAM was least effective in degrading prions but efficiently inhibited prion conversion with the same efficacy as unmodified PAMAM. Our results suggest that quaternization represents an effective strategy for developing nontoxic branched polyamines with potent anti-prion activity. This study highlights the importance of polyamine structural control for developing polyamine-based anti-prion agents and understanding of an action mechanism of quaternized branched polyamines. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

  1. Prion disease tempo determined by host-dependent substrate reduction

    NARCIS (Netherlands)

    Mays, C.E.; Kim, C.; Haldiman, T.; Merwe, v.d. J.; Lau, A.; Yang, J.; Grams, J.; Bari, Di M.A.; Nonno, R.; Telling, G.C.; Kong, Q.; Langeveld, J.P.M.; McKenzie, D.; Westaway, D.; Safar, J.G.

    2014-01-01

    The symptoms of prion infection can take years or decades to manifest following the initial exposure. Molecular markers of prion disease include accumulation of the misfolded prion protein (PrPSc), which is derived from its cellular precursor (PrPC), as well as downregulation of the PrP-like Shadoo

  2. Mammalian prions

    Science.gov (United States)

    Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel

    2013-01-01

    Upon prion infection, abnormal prion protein (PrPSc) self-perpetuate by conformational conversion of α-helix-rich PrPC into β sheet enriched form, leading to formation and deposition of PrPSc aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrPSc and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region. PMID:23232499

  3. Classifying prion and prion-like phenomena.

    Science.gov (United States)

    Harbi, Djamel; Harrison, Paul M

    2014-01-01

    The universe of prion and prion-like phenomena has expanded significantly in the past several years. Here, we overview the challenges in classifying this data informatically, given that terms such as "prion-like", "prion-related" or "prion-forming" do not have a stable meaning in the scientific literature. We examine the spectrum of proteins that have been described in the literature as forming prions, and discuss how "prion" can have a range of meaning, with a strict definition being for demonstration of infection with in vitro-derived recombinant prions. We suggest that although prion/prion-like phenomena can largely be apportioned into a small number of broad groups dependent on the type of transmissibility evidence for them, as new phenomena are discovered in the coming years, a detailed ontological approach might be necessary that allows for subtle definition of different "flavors" of prion / prion-like phenomena.

  4. Functional cross-talk between the cellular prion protein and the neural cell adhesion molecule is critical for neuronal differentiation of neural stem/precursor cells.

    Science.gov (United States)

    Prodromidou, Kanella; Papastefanaki, Florentia; Sklaviadis, Theodoros; Matsas, Rebecca

    2014-06-01

    Cellular prion protein (PrP) is prominently expressed in brain, in differentiated neurons but also in neural stem/precursor cells (NPCs). The misfolding of PrP is a central event in prion diseases, yet the physiological function of PrP is insufficiently understood. Although PrP has been reported to associate with the neural cell adhesion molecule (NCAM), the consequences of concerted PrP-NCAM action in NPC physiology are unknown. Here, we generated NPCs from the subventricular zone (SVZ) of postnatal day 5 wild-type and PrP null (-/-) mice and observed that PrP is essential for proper NPC proliferation and neuronal differentiation. Moreover, we found that PrP is required for the NPC response to NCAM-induced neuronal differentiation. In the absence of PrP, NCAM not only fails to promote neuronal differentiation but also induces an accumulation of doublecortin-positive neuronal progenitors at the proliferation stage. In agreement, we noted an increase in cycling neuronal progenitors in the SVZ of PrP-/- mice compared with PrP+/+ mice, as evidenced by double labeling for the proliferation marker Ki67 and doublecortin as well as by 5-bromo-2'-deoxyuridine incorporation experiments. Additionally, fewer newly born neurons were detected in the rostral migratory stream of PrP-/- mice. Analysis of the migration of SVZ cells in microexplant cultures from wild-type and PrP-/- mice revealed no differences between genotypes or a role for NCAM in this process. Our data demonstrate that PrP plays a critical role in neuronal differentiation of NPCs and suggest that this function is, at least in part, NCAM-dependent. © 2014 AlphaMed Press.

  5. Cellular prion protein (PrPc and hypoxia: true to each other in good times and in bad, in sickness and in health

    Directory of Open Access Journals (Sweden)

    Sanja Ramljak

    2016-12-01

    Full Text Available The cellular prion protein (PrPc and hypoxia appear to be tightly intertwined. Beneficial effects of PrPc on neuronal survival under hypoxic conditions such as focal cerebral ischemia are strongly supported. Conversely, increasing evidence indicates detrimental effects of increased PrPc expression on cancer progression, another condition accompanied by low oxygen tensions. A switch between anaerobic and aerobic metabolism characterizes both conditions. A cellular process that might unite both is glycolysis. Putative role of PrPc in stimulation of glycolysis in times of need is indeed thought provoking. A significance of astrocytic PrPc expression for neuronal survival under hypoxic conditions and possible association of PrPc with the astrocyte-neuron lactate shuttle (ANLS is considered. We posit PrPc-induced lactate production via transactivation of lactate dehydrogenase A by hypoxia inducible factor 1α as an important factor for survival of both neurons and tumor cells in hypoxic microenvironment. Concomitantly, we discuss a cross-talk between Wnt/ß-catenin and PI-3K/Akt signaling pathways in executing PrPc-induced activation of glycolysis. Finally, we would like to emphasize that we see a great potential in joining expertise from both fields, neuroscience and cancer research in revealing the mechanisms underlying hypoxia-related pathologies. PrPc may prove focal point for future research.

  6. A closer look at prion strains

    Science.gov (United States)

    Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto

    2013-01-01

    Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrPSc), a pathogenic isoform of the host-encoded cellular prion protein (PrPC). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrPSc conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrPSc biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves. PMID:23357828

  7. Use of bovine recombinant prion protein and real-time quaking-induced conversion to detect cattle transmissible mink encephalopathy prions and discriminate classical and atypical L- and H-Type bovine spongiform encephalopathy.

    Science.gov (United States)

    Hwang, Soyoun; Greenlee, Justin J; Nicholson, Eric M

    2017-01-01

    Prions are amyloid-forming proteins that cause transmissible spongiform encephalopathies through a process involving conversion from the normal cellular prion protein to the pathogenic misfolded conformation (PrPSc). This conversion has been used for in vitro assays including serial protein misfolding amplification and real-time quaking induced conversion (RT-QuIC). RT-QuIC can be used for the detection of prions in a variety of biological tissues from humans and animals. Extensive work has been done to demonstrate that RT-QuIC is a rapid, specific, and highly sensitive prion detection assay. RT-QuIC uses recombinant prion protein to detect minute amounts of PrPSc. RT-QuIC has been successfully used to detect PrPSc from different prion diseases with a variety of substrates including hamster, human, sheep, bank vole, bovine and chimeric forms of prion protein. However, recombinant bovine prion protein has not been used to detect transmissible mink encephalopathy (TME) or to differentiate types of bovine spongiform encephalopathy (BSE) in samples from cattle. We evaluated whether PrPSc from TME and BSE infected cattle can be detected with RT-QuIC using recombinant bovine prion proteins, and optimized the reaction conditions to specifically detect cattle TME and to discriminate between classical and atypical BSE by conversion efficiency. We also found that substrate composed of the disease associated E211K mutant protein can be effective for the detection of TME in cattle and that wild type prion protein appears to be a practical substrate to discriminate between the different types of BSEs.

  8. Neurotoxic Antibodies against the Prion Protein Do Not Trigger Prion Replication.

    Directory of Open Access Journals (Sweden)

    Karl Frontzek

    Full Text Available Prions are the infectious agents causing transmissible spongiform encephalopathies (TSE, progressive, inexorably lethal neurological diseases. Antibodies targeting the globular domain (GD of the cellular prion protein PrPC trigger a neurotoxic syndrome morphologically and molecularly similar to prion disease. This phenomenon raises the question whether such antibodies induce infectious prions de novo. Here we exposed cerebellar organotypic cultured slices (COCS to the neurotoxic antibody, POM1. We then inoculated COCS homogenates into tga20 mice, which overexpress PrPC and are commonly utilized as sensitive indicators of prion infectivity. None of the mice inoculated with COCS-derived lysates developed any signs of disease, and all mice survived for at least 200 days post-inoculation. In contrast, all mice inoculated with bona fide prions succumbed to TSE after 55-95 days. Post-mortem analyses did not reveal any signs of prion pathology in mice inoculated with POM1-COCS lysates. Also, lysates from POM1-exposed COCS were unable to convert PrP by quaking. Hence, anti-GD antibodies do not catalyze the generation of prion infectivity. These data indicate that prion replication can be separated from prion toxicity, and suggest that anti-GD antibodies exert toxicity by acting downstream of prion replication.

  9. Prions in yeast

    OpenAIRE

    Bezdíčka, Martin

    2013-01-01

    The thesis describes yeast prions and their biological effects on yeast in general. It defines the basic characteristics of yeast prions, that distinguish prions from other proteins. The thesis introduces various possibilities of prion formation, and propagation as well as specific types of yeast prions, including various functions of most studied types of prions. The thesis also focuses on chaperones that affect the state of yeast prions in cells. Lastly, the thesis indicates similarities be...

  10. Prion Protein and Aging

    Directory of Open Access Journals (Sweden)

    Lisa eGasperini

    2014-08-01

    Full Text Available The cellular prion protein (PrPC has been widely investigated ever since its conformational isoform, the prion (or PrPSc, was identified as the etiological agent of prion disorders. The high homology shared by the PrPC-encoding gene among mammals, its high turnover rate and expression in every tissue strongly suggest that PrPC may possess key physiological functions. Therefore, defining PrPC roles, properties and fate in the physiology of mammalian cells would be fundamental to understand its pathological involvement in prion diseases. Since the incidence of these neurodegenerative disorders is enhanced in aging, understanding PrPC functions in this life phase may be of crucial importance. Indeed, a large body of evidence suggests that PrPC plays a neuroprotective and antioxidant role. Moreover, it has been suggested that PrPC is involved in Alzheimer disease, another neurodegenerative pathology that develops predominantly in the aging population. In prion diseases, PrPC function is likely lost upon protein aggregation occurring in the course of the disease. Additionally, the aging process may alter PrPC biochemical properties, thus influencing its propensity to convert into PrPSc. Both phenomena may contribute to the disease development and progression. In Alzheimer disease, PrPC has a controversial role because its presence seems to mediate β-amyloid toxicity, while its down-regulation correlates with neuronal death. The role of PrPC in aging has been investigated from different perspectives, often leading to contrasting results. The putative protein functions in aging have been studied in relation to memory, behavior and myelin maintenance. In aging mice, PrPC changes in subcellular localization and post-translational modifications have been explored in an attempt to relate them to different protein roles and propensity to convert into PrPSc. Here we provide an overview of the most relevant studies attempting to delineate PrPC functions and

  11. Cellular Prion Protein and Caveolin-1 Interaction in a Neuronal Cell Line Precedes Fyn/Erk 1/2 Signal Transduction

    Directory of Open Access Journals (Sweden)

    Mattia Toni

    2006-01-01

    Full Text Available It has been reported that cellular prion protein (PrPc is enriched in caveolae or caveolae-like domains with caveolin-1 (Cav-1 participating to signal transduction events by Fyn kinase recruitment. By using the Glutathione-S-transferase (GST-fusion proteins assay, we observed that PrPc strongly interacts in vitro with Cav-1. Thus, we ascertained the PrPc caveolar localization in a hypothalamic neuronal cell line (GN11, by confocal microscopy analysis, flotation on density gradient, and coimmunoprecipitation experiments. Following the anti-PrPc antibody-mediated stimulation of live GN11 cells, we observed that PrPc clustered on plasma membrane domains rich in Cav-1 in which Fyn kinase converged to be activated. After these events, a signaling cascade through p42/44 MAP kinase (Erk 1/2 was triggered, suggesting that following translocations from rafts to caveolae or caveolae-like domains PrPc could interact with Cav-1 and induce signal transduction events.

  12. Alzheimer's Disease Brain-Derived Amyloid-{beta}-Mediated Inhibition of LTP In Vivo Is Prevented by Immunotargeting Cellular Prion Protein.

    LENUS (Irish Health Repository)

    Barry, Andrew E

    2011-05-18

    Synthetic amyloid-β protein (Aβ) oligomers bind with high affinity to cellular prion protein (PrP(C)), but the role of this interaction in mediating the disruption of synaptic plasticity by such soluble Aβ in vitro is controversial. Here we report that intracerebroventricular injection of Aβ-containing aqueous extracts of Alzheimer\\'s disease (AD) brain robustly inhibits long-term potentiation (LTP) without significantly affecting baseline excitatory synaptic transmission in the rat hippocampus in vivo. Moreover, the disruption of LTP was abrogated by immunodepletion of Aβ. Importantly, intracerebroventricular administration of antigen-binding antibody fragment D13, directed to a putative Aβ-binding site on PrP(C), prevented the inhibition of LTP by AD brain-derived Aβ. In contrast, R1, a Fab directed to the C terminus of PrP(C), a region not implicated in binding of Aβ, did not significantly affect the Aβ-mediated inhibition of LTP. These data support the pathophysiological significance of SDS-stable Aβ dimer and the role of PrP(C) in mediating synaptic plasticity disruption by soluble Aβ.

  13. A comparative molecular dynamics study on thermostability of human and chicken prion proteins

    International Nuclear Information System (INIS)

    Ji, Hong-Fang; Zhang, Hong-Yu

    2007-01-01

    To compare the thermostabilities of human and chicken normal cellular prion proteins (HuPrP C and CkPrP C ), molecular dynamics (MD) simulations were performed for both proteins at an ensemble level (10 parallel simulations at 400 K and 5 parallel simulations at 300 K as a control). It is found that the thermostability of HuPrP C is comparable with that of CkPrP C , which implicates that the non-occurrence of prion diseases in non-mammals cannot be completely attributed to the thermodynamic properties of non-mammalian PrP C

  14. Glycoform-selective prion formation in sporadic and familial forms of prion disease

    NARCIS (Netherlands)

    Xiao, X.; Yuan, J.; Haïk, S.; Cali, I.; Zhan, Y.; Moudjou, M.; Li, B.; Laplanche, J.L.; Laude, H.; Langeveld, J.P.M.; Gambetti, P.

    2013-01-01

    The four glycoforms of the cellular prion protein (PrP(C)) variably glycosylated at the two N-linked glycosylation sites are converted into their pathological forms (PrP(Sc)) in most cases of sporadic prion diseases. However, a prominent molecular characteristic of PrP(Sc) in the recently identified

  15. Prion pathogenesis and secondary lymphoid organs (SLO)

    Science.gov (United States)

    Mabbott, Neil A.

    2012-01-01

    Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrPSc, an abnormally folded isoform of the cellular prion protein (PrPC), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases. PMID:22895090

  16. Secretin receptor involvement in prion-infected cells and animals.

    Science.gov (United States)

    Kimura, Tomohiro; Nishizawa, Keiko; Oguma, Ayumi; Nishimura, Yuki; Sakasegawa, Yuji; Teruya, Kenta; Nishijima, Ichiko; Doh-ura, Katsumi

    2015-07-08

    The cellular mechanisms behind prion biosynthesis and metabolism remain unclear. Here we show that secretin signaling via the secretin receptor regulates abnormal prion protein formation in prion-infected cells. Animal studies demonstrate that secretin receptor deficiency slightly, but significantly, prolongs incubation time in female but not male mice. This gender-specificity is consistent with our finding that prion-infected cells are derived from females. Therefore, our results provide initial insights into the reasons why age of disease onset in certain prion diseases is reported to occur slightly earlier in females than males. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  17. Translational errors as an early event in prion conversion.

    Science.gov (United States)

    Hatin, I; Bidou, L; Cullin, C; Rousset, J P

    2001-01-01

    A prion is an infectious, altered form of a cellular protein which can self-propagate and affect normal phenotype. Prion conversion has been observed for mammalian and yeast proteins but molecular mechanisms that trigger this process remain unclear. Up to now, only post-translational models have been explored. In this work, we tested the hypothesis that co-translational events may be implicated in the conformation changes of the Ure2p protein of Saccharomyces cerevisiae. This protein can adopt a prion conformation leading to an [URE3] phenotype which can be easily assessed and quantified. We analyzed the effect of two antibiotics, known to affect translation, on [URE3] conversion frequency. For cells treated with G418 we observed a parallel increase of translational errors rate and frequency of [URE3] conversion. By contrast, cycloheximide which was not found to affect translational fidelity, has no influence on the induction of [URE3] phenotype. These results raise the possibility that the mechanism of prion conversion might not only involve alternative structures of strictly identical molecules but also aberrant proteins resulting from translational errors.

  18. New insights into structural determinants of prion protein folding and stability.

    Science.gov (United States)

    Benetti, Federico; Legname, Giuseppe

    2015-01-01

    Prions are the etiological agent of fatal neurodegenerative diseases called prion diseases or transmissible spongiform encephalopathies. These maladies can be sporadic, genetic or infectious disorders. Prions are due to post-translational modifications of the cellular prion protein leading to the formation of a β-sheet enriched conformer with altered biochemical properties. The molecular events causing prion formation in sporadic prion diseases are still elusive. Recently, we published a research elucidating the contribution of major structural determinants and environmental factors in prion protein folding and stability. Our study highlighted the crucial role of octarepeats in stabilizing prion protein; the presence of a highly enthalpically stable intermediate state in prion-susceptible species; and the role of disulfide bridge in preserving native fold thus avoiding the misfolding to a β-sheet enriched isoform. Taking advantage from these findings, in this work we present new insights into structural determinants of prion protein folding and stability.

  19. Molecular Pathology of Human Prion Diseases

    Directory of Open Access Journals (Sweden)

    2009-03-01

    Full Text Available Prion diseases are fatal neurodegenerative conditions in humans and animals. In this review, we summarize the molecular background of phenotypic variability, relation of prion protein (PrP to other proteins associated with neurodegenerative diseases, and pathogenesis of neuronal vulnerability. PrP exists in different forms that may be present in both diseased and non-diseased brain, however, abundant disease-associated PrP together with tissue pathology characterizes prion diseases and associates with transmissibility. Prion diseases have different etiological background with distinct pathogenesis and phenotype. Mutations of the prion protein gene are associated with genetic forms. The codon 129 polymorphism in combination with the Western blot pattern of PrP after proteinase K digestion serves as a basis for molecular subtyping of sporadic Creutzfeldt-Jakob disease. Tissue damage may result from several parallel, interacting or subsequent pathways that involve cellular systems associated with synapses, protein processing, oxidative stress, autophagy, and apoptosis.

  20. Accelerating Yeast Prion Biology using Droplet Microfluidics

    Science.gov (United States)

    Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David

    2012-02-01

    Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.

  1. Recombinant human prion protein inhibits prion propagation in vitro.

    Science.gov (United States)

    Yuan, Jue; Zhan, Yi-An; Abskharon, Romany; Xiao, Xiangzhu; Martinez, Manuel Camacho; Zhou, Xiaochen; Kneale, Geoff; Mikol, Jacqueline; Lehmann, Sylvain; Surewicz, Witold K; Castilla, Joaquín; Steyaert, Jan; Zhang, Shulin; Kong, Qingzhong; Petersen, Robert B; Wohlkonig, Alexandre; Zou, Wen-Quan

    2013-10-09

    Prion diseases are associated with the conformational conversion of the cellular prion protein (PrP(C)) into the pathological scrapie isoform (PrP(Sc)) in the brain. Both the in vivo and in vitro conversion of PrP(C) into PrP(Sc) is significantly inhibited by differences in amino acid sequence between the two molecules. Using protein misfolding cyclic amplification (PMCA), we now report that the recombinant full-length human PrP (rHuPrP23-231) (that is unglycosylated and lacks the glycophosphatidylinositol anchor) is a strong inhibitor of human prion propagation. Furthermore, rHuPrP23-231 also inhibits mouse prion propagation in a scrapie-infected mouse cell line. Notably, it binds to PrP(Sc), but not PrP(C), suggesting that the inhibitory effect of recombinant PrP results from blocking the interaction of brain PrP(C) with PrP(Sc). Our findings suggest a new avenue for treating prion diseases, in which a patient's own unglycosylated and anchorless PrP is used to inhibit PrP(Sc) propagation without inducing immune response side effects.

  2. LRP1 controls biosynthetic and endocytic trafficking of neuronal prion protein

    DEFF Research Database (Denmark)

    Parkyn, Celia J; Vermeulen, Esmeralda G M; Mootoosamy, Roy C

    2008-01-01

    The trafficking of normal cellular prion protein (PrP(C)) is believed to control its conversion to the altered conformation (designated PrP(Sc)) associated with prion disease. Although anchored to the membrane by means of glycosylphosphatidylinositol (GPI), PrP(C) on neurons is rapidly and consti......The trafficking of normal cellular prion protein (PrP(C)) is believed to control its conversion to the altered conformation (designated PrP(Sc)) associated with prion disease. Although anchored to the membrane by means of glycosylphosphatidylinositol (GPI), PrP(C) on neurons is rapidly...... required for this process. Moreover, sustained inhibition of LRP1 levels by siRNA leads to the accumulation of PrP(C) in biosynthetic compartments, with a concomitant lowering of surface PrP(C), suggesting that LRP1 expedites the trafficking of PrP(C) to the neuronal surface. PrP(C) and LRP1 can be co......-immunoprecipitated from the endoplasmic reticulum in normal neurons. The N-terminal domain of PrP(C) binds to purified human LRP1 with nanomolar affinity, even in the presence of 1 microM of the LRP-specific chaperone, receptor-associated protein (RAP). Taken together, these data argue that LRP1 controls both the surface...

  3. A brief history of prions

    Science.gov (United States)

    Zabel, Mark D.; Reid, Crystal

    2015-01-01

    Proteins were described as distinct biological molecules and their significance in cellular processes was recognized as early as the 18th century. At the same time, Spanish shepherds observed a disease that compelled their Merino sheep to pathologically scrape against fences, a defining clinical sign that led to the disease being named scrapie. In the late 19th century, Robert Koch published his postulates for defining causative agents of disease. In the early 20th century, pathologists Creutzfeldt and Jakob described a neurodegenerative disease that would later be included with scrapie into a group of diseases known as transmissible spongiform encephalopathies (TSEs). Later that century, mounting evidence compelled a handful of scientists to betray the prevailing biological dogma governing pathogen replication that Watson and Crick so convincingly explained by cracking the genetic code just two decades earlier. Because TSEs seemed to defy these new rules, J.S. Griffith theorized mechanisms by which a pathogenic protein could encipher its own replication blueprint without a genetic code. Stanley Prusiner called this proteinaceous infectious pathogen a prion. Here we offer a concise account of the discovery of prions, the causative agent of TSEs, in the wider context of protein biochemistry and infectious disease. We highlight the discovery of prions in yeast and discuss the implication of prions as epigenomic carriers of biological and pathological information. We also consider expanding the prion hypothesis to include other proteins whose alternate isoforms confer new biological or pathological properties. PMID:26449713

  4. Cellular prion protein is required for neuritogenesis: fine-tuning of multiple signaling pathways involved in focal adhesions and actin cytoskeleton dynamics

    Directory of Open Access Journals (Sweden)

    Alleaume-Butaux A

    2013-07-01

    Full Text Available Aurélie Alleaume-Butaux,1,2 Caroline Dakowski,1,2 Mathéa Pietri,1,2 Sophie Mouillet-Richard,1,2 Jean-Marie Launay,3,4 Odile Kellermann,1,2 Benoit Schneider1,2 1INSERM, UMR-S 747, 2Paris Descartes University, Sorbonne Paris Cité, UMR-S 747, 3Public Hospital of Paris, Department of Biochemistry, INSERM UMR-S 942, Lariboisière Hospital, Paris, France; 4Pharma Research Department, Hoffmann La Roche Ltd, Basel, Switzerland Abstract: Neuritogenesis is a dynamic phenomenon associated with neuronal differentiation that allows a rather spherical neuronal stem cell to develop dendrites and axon, a prerequisite for the integration and transmission of signals. The acquisition of neuronal polarity occurs in three steps: (1 neurite sprouting, which consists of the formation of buds emerging from the postmitotic neuronal soma; (2 neurite outgrowth, which represents the conversion of buds into neurites, their elongation and evolution into axon or dendrites; and (3 the stability and plasticity of neuronal polarity. In neuronal stem cells, remodeling and activation of focal adhesions (FAs associated with deep modifications of the actin cytoskeleton is a prerequisite for neurite sprouting and subsequent neurite outgrowth. A multiple set of growth factors and interactors located in the extracellular matrix and the plasma membrane orchestrate neuritogenesis by acting on intracellular signaling effectors, notably small G proteins such as RhoA, Rac, and Cdc42, which are involved in actin turnover and the dynamics of FAs. The cellular prion protein (PrPC, a glycosylphosphatidylinositol (GPI-anchored membrane protein mainly known for its role in a group of fatal neurodegenerative diseases, has emerged as a central player in neuritogenesis. Here, we review the contribution of PrPC to neuronal polarization and detail the current knowledge on the signaling pathways fine-tuned by PrPC to promote neurite sprouting, outgrowth, and maintenance. We emphasize that Pr

  5. Prion pathogenesis and secondary lymphoid organs (SLO): tracking the SLO spread of prions to the brain.

    Science.gov (United States)

    Mabbott, Neil A

    2012-01-01

    Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrP (Sc), an abnormally folded isoform of the cellular prion protein (PrP (C)), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases.

  6. Increased infectivity of anchorless mouse scrapie prions in transgenic mice overexpressing human prion protein.

    Science.gov (United States)

    Race, Brent; Phillips, Katie; Meade-White, Kimberly; Striebel, James; Chesebro, Bruce

    2015-06-01

    Prion protein (PrP) is found in all mammals, mostly as a glycoprotein anchored to the plasma membrane by a C-terminal glycosylphosphatidylinositol (GPI) linkage. Following prion infection, host protease-sensitive prion protein (PrPsen or PrPC) is converted into an abnormal, disease-associated, protease-resistant form (PrPres). Biochemical characteristics, such as the PrP amino acid sequence, and posttranslational modifications, such as glycosylation and GPI anchoring, can affect the transmissibility of prions as well as the biochemical properties of the PrPres generated. Previous in vivo studies on the effects of GPI anchoring on prion infectivity have not examined cross-species transmission. In this study, we tested the effect of lack of GPI anchoring on a species barrier model using mice expressing human PrP. In this model, anchorless 22L prions derived from tg44 mice were more infectious than 22L prions derived from C57BL/10 mice when tested in tg66 transgenic mice, which expressed wild-type anchored human PrP at 8- to 16-fold above normal. Thus, the lack of the GPI anchor on the PrPres from tg44 mice appeared to reduce the effect of the mouse-human PrP species barrier. In contrast, neither source of prions induced disease in tgRM transgenic mice, which expressed human PrP at 2- to 4-fold above normal. Prion protein (PrP) is found in all mammals, usually attached to cells by an anchor molecule called GPI. Following prion infection, PrP is converted into a disease-associated form (PrPres). While most prion diseases are species specific, this finding is not consistent, and species barriers differ in strength. The amino acid sequence of PrP varies among species, and this variability affects prion species barriers. However, other PrP modifications, including glycosylation and GPI anchoring, may also influence cross-species infectivity. We studied the effect of PrP GPI anchoring using a mouse-to-human species barrier model. Experiments showed that prions produced by

  7. Mapping of possible prion protein self interaction domains using peptide arrays

    NARCIS (Netherlands)

    Rigter, A.; Langeveld, J.P.M.; Timmers-Parohi, D.; Jacobs, J.G.; Moonen, P.L.J.M.; Bossers, A.

    2007-01-01

    Background The common event in transmissible spongiform encephalopathies (TSEs) or prion diseases is the conversion of host-encoded protease sensitive cellular prion protein (PrPC) into strain dependent isoforms of scrapie associated protease resistant isoform (PrPSc) of prion protein (PrP). These

  8. Chronic Lymphocytic Leukemia B-Cell Normal Cellular Counterpart: Clues From a Functional Perspective.

    Science.gov (United States)

    Darwiche, Walaa; Gubler, Brigitte; Marolleau, Jean-Pierre; Ghamlouch, Hussein

    2018-01-01

    Chronic lymphocytic leukemia (CLL) is characterized by the clonal expansion of small mature-looking CD19+ CD23+ CD5+ B-cells that accumulate in the blood, bone marrow, and lymphoid organs. To date, no consensus has been reached concerning the normal cellular counterpart of CLL B-cells and several B-cell types have been proposed. CLL B-cells have remarkable phenotypic and gene expression profile homogeneity. In recent years, the molecular and cellular biology of CLL has been enriched by seminal insights that are leading to a better understanding of the natural history of the disease. Immunophenotypic and molecular approaches (including immunoglobulin heavy-chain variable gene mutational status, transcriptional and epigenetic profiling) comparing the normal B-cell subset and CLL B-cells provide some new insights into the normal cellular counterpart. Functional characteristics (including activation requirements and propensity for plasma cell differentiation) of CLL B-cells have now been investigated for 50 years. B-cell subsets differ substantially in terms of their functional features. Analysis of shared functional characteristics may reveal similarities between normal B-cell subsets and CLL B-cells, allowing speculative assignment of a normal cellular counterpart for CLL B-cells. In this review, we summarize current data regarding peripheral B-cell differentiation and human B-cell subsets and suggest possibilities for a normal cellular counterpart based on the functional characteristics of CLL B-cells. However, a definitive normal cellular counterpart cannot be attributed on the basis of the available data. We discuss the functional characteristics required for a cell to be logically considered to be the normal counterpart of CLL B-cells.

  9. Discovery of a novel, monocationic, small-molecule inhibitor of scrapie prion accumulation in cultured sheep microglia and Rov cells.

    Directory of Open Access Journals (Sweden)

    James B Stanton

    Full Text Available Prion diseases, including sheep scrapie, are neurodegenerative diseases with the fundamental pathogenesis involving conversion of normal cellular prion protein (PrP(C to disease-associated prion protein (PrP(Sc. Chemical inhibition of prion accumulation is widely investigated, often using rodent-adapted prion cell culture models. Using a PrP(Sc-specific ELISA we discovered a monocationic phenyl-furan-benzimidazole (DB772, which has previously demonstrated anti-pestiviral activity and represents a chemical category previously untested for anti-prion activity, that inhibited PrP(Sc accumulation and prion infectivity in primary sheep microglial cell cultures (PRNP 136VV/154RR/171QQ and Rov9 cultures (VRQ-ovinized RK13 cells. We investigated potential mechanisms of this anti-prion activity by evaluating PrP(C expression with quantitative RT-PCR and PrP ELISA, comparing the concentration-dependent anti-prion and anti-pestiviral effects of DB772, and determining the selectivity index. Results demonstrate at least an approximate two-log inhibition of PrP(Sc accumulation in the two cell systems and confirmed that the inhibition of PrP(Sc accumulation correlates with inhibition of prion infectivity. PRNP transcripts and total PrP protein concentrations within cell lysates were not decreased; thus, decreased PrP(C expression is not the mechanism of PrP(Sc inhibition. PrP(Sc accumulation was multiple logs more resistant than pestivirus to DB772, suggesting that the anti-PrP(Sc activity was independent of anti-pestivirus activity. The anti-PrP(Sc selectivity index in cell culture was approximately 4.6 in microglia and 5.5 in Rov9 cells. The results describe a new chemical category that inhibits ovine PrP(Sc accumulation in primary sheep microglia and Rov9 cells, and can be used for future studies into the treatment and mechanism of prion diseases.

  10. Treatment with a non-toxic, self-replicating anti-prion delays or prevents prion disease in vivo.

    Science.gov (United States)

    Diaz-Espinoza, R; Morales, R; Concha-Marambio, L; Moreno-Gonzalez, I; Moda, F; Soto, C

    2018-03-01

    Transmissible spongiform encephalopathies (TSEs) are fatal neurological disorders caused by prions, which are composed of a misfolded protein (PrP Sc ) that self-propagates in the brain of infected individuals by converting the normal prion protein (PrP C ) into the pathological isoform. Here, we report a novel experimental strategy for preventing prion disease based on producing a self-replicating, but innocuous PrP Sc -like form, termed anti-prion, which can compete with the replication of pathogenic prions. Our results show that a prophylactic inoculation of prion-infected animals with an anti-prion delays the onset of the disease and in some animals completely prevents the development of clinical symptoms and brain damage. The data indicate that a single injection of the anti-prion eliminated ~99% of the infectivity associated to pathogenic prions. Furthermore, this treatment caused significant changes in the profile of regional PrP Sc deposition in the brains of animals that were treated, but still succumbed to the disease. Our findings provide new insights for a mechanistic understanding of prion replication and support the concept that prion replication can be separated from toxicity, providing a novel target for therapeutic intervention.

  11. A closer look at prion strains: characterization and important implications.

    Science.gov (United States)

    Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto

    2013-01-01

    Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrP (Sc) ), a pathogenic isoform of the host-encoded cellular prion protein (PrP (C) ). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrP (Sc) conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrP (Sc) biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves.

  12. Prions amplify through degradation of the VPS10P sorting receptor sortilin.

    Science.gov (United States)

    Uchiyama, Keiji; Tomita, Mitsuru; Yano, Masashi; Chida, Junji; Hara, Hideyuki; Das, Nandita Rani; Nykjaer, Anders; Sakaguchi, Suehiro

    2017-06-01

    Prion diseases are a group of fatal neurodegenerative disorders caused by prions, which consist mainly of the abnormally folded isoform of prion protein, PrPSc. A pivotal pathogenic event in prion disease is progressive accumulation of prions, or PrPSc, in brains through constitutive conformational conversion of the cellular prion protein, PrPC, into PrPSc. However, the cellular mechanism by which PrPSc is progressively accumulated in prion-infected neurons remains unknown. Here, we show that PrPSc is progressively accumulated in prion-infected cells through degradation of the VPS10P sorting receptor sortilin. We first show that sortilin interacts with PrPC and PrPSc and sorts them to lysosomes for degradation. Consistently, sortilin-knockdown increased PrPSc accumulation in prion-infected cells. In contrast, overexpression of sortilin reduced PrPSc accumulation in prion-infected cells. These results indicate that sortilin negatively regulates PrPSc accumulation in prion-infected cells. The negative role of sortilin in PrPSc accumulation was further confirmed in sortilin-knockout mice infected with prions. The infected mice had accelerated prion disease with early accumulation of PrPSc in their brains. Interestingly, sortilin was reduced in prion-infected cells and mouse brains. Treatment of prion-infected cells with lysosomal inhibitors, but not proteasomal inhibitors, increased the levels of sortilin. Moreover, sortilin was reduced following PrPSc becoming detectable in cells after infection with prions. These results indicate that PrPSc accumulation stimulates sortilin degradation in lysosomes. Taken together, these results show that PrPSc accumulation of itself could impair the sortilin-mediated sorting of PrPC and PrPSc to lysosomes for degradation by stimulating lysosomal degradation of sortilin, eventually leading to progressive accumulation of PrPSc in prion-infected cells.

  13. Isolation of cellular prion protein PRPC from brain homogenate and cerebrospinal fluid by immunoaffinity chromatography and structural analysis by 2-D map, immunoblot and by MS

    Czech Academy of Sciences Publication Activity Database

    Bílková, Z.; Castagna, A.; Zanusso, G.; Farinazzo, A.; Monaco, S.; Lenfeld, Jiří; Viovy, J.-L.; Righetti, P. G.

    2003-01-01

    Roč. 41, - (2003), s. S530 ISSN 1434-6621. [IFCC-FESCC European Congress of Clinical Chemistry and Laboratory Medicine žEuromedlabŽ /15./. 01.06.2003-05.06.2003, Barcelona] R&D Projects: GA ČR GA203/02/0023 Institutional research plan: CEZ:AV0Z4050913 Keywords : immunoaffinity chromatography * prion protein Subject RIV: CB - Analytical Chemistry, Separation

  14. Structural characterization of POM6 Fab and mouse prion protein complex identifies key regions for prions conformational conversion.

    Science.gov (United States)

    Baral, Pravas Kumar; Swayampakula, Mridula; Aguzzi, Adriano; James, Michael N G

    2018-05-01

    Conversion of the cellular prion protein PrP C into its pathogenic isoform PrP S c is the hallmark of prion diseases, fatal neurodegenerative diseases affecting many mammalian species including humans. Anti-prion monoclonal antibodies can arrest the progression of prion diseases by stabilizing the cellular form of the prion protein. Here, we present the crystal structure of the POM6 Fab fragment, in complex with the mouse prion protein (moPrP). The prion epitope of POM6 is in close proximity to the epitope recognized by the purportedly toxic antibody fragment, POM1 Fab also complexed with moPrP. The POM6 Fab recognizes a larger binding interface indicating a likely stronger binding compared to POM1. POM6 and POM1 exhibit distinct biological responses. Structural comparisons of the bound mouse prion proteins from the POM6 Fab:moPrP and POM1 Fab:moPrP complexes reveal several key regions of the prion protein that might be involved in initiating mis-folding events. The structural data of moPrP:POM6 Fab complex are available in the PDB under the accession number www.rcsb.org/pdb/search/structidSearch.do?structureId=6AQ7. © 2018 Federation of European Biochemical Societies.

  15. A systematic investigation of production of synthetic prions from recombinant prion protein.

    Science.gov (United States)

    Schmidt, Christian; Fizet, Jeremie; Properzi, Francesca; Batchelor, Mark; Sandberg, Malin K; Edgeworth, Julie A; Afran, Louise; Ho, Sammy; Badhan, Anjna; Klier, Steffi; Linehan, Jacqueline M; Brandner, Sebastian; Hosszu, Laszlo L P; Tattum, M Howard; Jat, Parmjit; Clarke, Anthony R; Klöhn, Peter C; Wadsworth, Jonathan D F; Jackson, Graham S; Collinge, John

    2015-12-01

    According to the protein-only hypothesis, infectious mammalian prions, which exist as distinct strains with discrete biological properties, consist of multichain assemblies of misfolded cellular prion protein (PrP). A critical test would be to produce prion strains synthetically from defined components. Crucially, high-titre 'synthetic' prions could then be used to determine the structural basis of infectivity and strain diversity at the atomic level. While there have been multiple reports of production of prions from bacterially expressed recombinant PrP using various methods, systematic production of high-titre material in a form suitable for structural analysis remains a key goal. Here, we report a novel high-throughput strategy for exploring a matrix of conditions, additives and potential cofactors that might generate high-titre prions from recombinant mouse PrP, with screening for infectivity using a sensitive automated cell-based bioassay. Overall, approximately 20,000 unique conditions were examined. While some resulted in apparently infected cell cultures, this was transient and not reproducible. We also adapted published methods that reported production of synthetic prions from recombinant hamster PrP, but again did not find evidence of significant infectious titre when using recombinant mouse PrP as substrate. Collectively, our findings are consistent with the formation of prion infectivity from recombinant mouse PrP being a rare stochastic event and we conclude that systematic generation of prions from recombinant PrP may only become possible once the detailed structure of authentic ex vivo prions is solved. © 2015 The Authors.

  16. A naturally occurring variant of the human prion protein completely prevents prion disease.

    Science.gov (United States)

    Asante, Emmanuel A; Smidak, Michelle; Grimshaw, Andrew; Houghton, Richard; Tomlinson, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Richard-Londt, Angela; Linehan, Jacqueline M; Brandner, Sebastian; Alpers, Michael; Whitfield, Jerome; Mead, Simon; Wadsworth, Jonathan D F; Collinge, John

    2015-06-25

    Mammalian prions, transmissible agents causing lethal neurodegenerative diseases, are composed of assemblies of misfolded cellular prion protein (PrP). A novel PrP variant, G127V, was under positive evolutionary selection during the epidemic of kuru--an acquired prion disease epidemic of the Fore population in Papua New Guinea--and appeared to provide strong protection against disease in the heterozygous state. Here we have investigated the protective role of this variant and its interaction with the common, worldwide M129V PrP polymorphism. V127 was seen exclusively on a M129 PRNP allele. We demonstrate that transgenic mice expressing both variant and wild-type human PrP are completely resistant to both kuru and classical Creutzfeldt-Jakob disease (CJD) prions (which are closely similar) but can be infected with variant CJD prions, a human prion strain resulting from exposure to bovine spongiform encephalopathy prions to which the Fore were not exposed. Notably, mice expressing only PrP V127 were completely resistant to all prion strains, demonstrating a different molecular mechanism to M129V, which provides its relative protection against classical CJD and kuru in the heterozygous state. Indeed, this single amino acid substitution (G→V) at a residue invariant in vertebrate evolution is as protective as deletion of the protein. Further study in transgenic mice expressing different ratios of variant and wild-type PrP indicates that not only is PrP V127 completely refractory to prion conversion but acts as a potent dose-dependent inhibitor of wild-type prion propagation.

  17. Cellular prion protein and γ-synuclein overexpression in LS 174T colorectal cancer cell drives endothelial proliferation-to-differentiation switch

    Directory of Open Access Journals (Sweden)

    Sing-Hui Ong

    2018-03-01

    Full Text Available Background Tumor-induced angiogenesis is an imperative event in pledging new vasculature for tumor metastasis. Since overexpression of neuronal proteins gamma-synuclein (γ-Syn and cellular prion protein (PrPC is always detected in advanced stages of cancer diseases which involve metastasis, this study aimed to investigate whether γ-Syn or PrPC overexpression in colorectal adenocarcinoma, LS 174T cells affects angiogenesis of endothelial cells, EA.hy 926 (EA. Methods EA cells were treated with conditioned media (CM of LS 174T-γ-Syn or LS 174T-PrP, and their proliferation, invasion, migration, adhesion and ability to form angiogenic tubes were assessed using a range of biological assays. To investigate plausible background mechanisms in conferring the properties of EA cells above, nitrite oxide (NO levels were measured and the expression of angiogenesis-related factors was assessed using a human angiogenesis antibody array. Results EA proliferation was significantly inhibited by LS 174T-PrP CM whereas its telomerase activity was reduced by CM of LS 174T-γ-Syn or LS 174T-PrP, as compared to EA incubated with LS 174T CM. Besides, LS 174T-γ-Syn CM or LS 174T-PrP CM inhibited EA invasion and migration in Boyden chamber assay. Furthermore, LS 174T-γ-Syn CM significantly inhibited EA migration in scratch wound assay. Gelatin zymography revealed reduced secretion of MMP-2 and MMP-9 by EA treated with LS 174T-γ-Syn CM or LS 174T-PrP CM. In addition, cell adhesion assay showed lesser LS 174T-γ-Syn or LS 174T-PrP cells adhered onto EA, as compared to LS 174T. In tube formation assay, LS 174T-γ-Syn CM or LS 174T-PrP CM induced EA tube formation. Increased NO secretion by EA treated with LS 174T-γ-Syn CM or LS 174T-PrP CM was also detected. Lastly, decreased expression of pro-angiogenic factors like CXCL16, IGFBP-2 and amphiregulin in LS 174T-γ-Syn CM or LS 174T-PrP CM was detected using the angiogenesis antibody array. Discussion These results

  18. Generation of human scFvs antibodies recognizing a prion protein epitope expressed on the surface of human lymphoblastoid cells

    Directory of Open Access Journals (Sweden)

    Imperiale Valentina

    2007-07-01

    Full Text Available Abstract Background A hallmark of prion disease is the transformation of normal cellular prion protein (PrPc into an infectious disease-associated isoform, (PrPsc. Anti-prion protein monoclonal antibodies are invaluable for structure-function studies of PrP molecules. Furthermore recent in vitro and in vivo studies indicate that anti-PrP monoclonal antibodies can prevent the incorporation of PrPc into propagating prions. In the present article, we show two new human phage antibodies, isolated on recombinant hamster prion protein (rHaPrP. Results We adopted an antibody phage display strategy to isolate specific human antibodies directed towards rHaPrP which has been used as a bait for panning the synthetic ETH-2 antibody phage library. Two phage antibodies clones named MA3.B4 and MA3.G3 were isolated and characterized under genetic biochemical and immunocytochemical aspects. The clones were found to recognize the prion protein in ELISA studies. In flow-cytometry studies, these human single chain Fragment variable (scFv phage-antibodies show a well defined pattern of reactivity on human lymphoblastoid and myeloid cells. Conclusion Sequence analysis of the gene encoding for the antibody fragments and antigen recognition patterns determined by flow-cytometry analysis indicate that the isolated scFvs recognize novel epitopes in the PrPc molecule. These new anti PrPc human antibodies are unique reagents for prion protein detection and may represent a biologic platform to develop new reagents to treat PrPsc associated disease.

  19. Sub-cellular force microscopy in single normal and cancer cells.

    Science.gov (United States)

    Babahosseini, H; Carmichael, B; Strobl, J S; Mahmoodi, S N; Agah, M

    2015-08-07

    This work investigates the biomechanical properties of sub-cellular structures of breast cells using atomic force microscopy (AFM). The cells are modeled as a triple-layered structure where the Generalized Maxwell model is applied to experimental data from AFM stress-relaxation tests to extract the elastic modulus, the apparent viscosity, and the relaxation time of sub-cellular structures. The triple-layered modeling results allow for determination and comparison of the biomechanical properties of the three major sub-cellular structures between normal and cancerous cells: the up plasma membrane/actin cortex, the mid cytoplasm/nucleus, and the low nuclear/integrin sub-domains. The results reveal that the sub-domains become stiffer and significantly more viscous with depth, regardless of cell type. In addition, there is a decreasing trend in the average elastic modulus and apparent viscosity of the all corresponding sub-cellular structures from normal to cancerous cells, which becomes most remarkable in the deeper sub-domain. The presented modeling in this work constitutes a unique AFM-based experimental framework to study the biomechanics of sub-cellular structures. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Ultraviolet-ozone treatment reduces levels of disease-associated prion protein and prion infectivity

    Science.gov (United States)

    Johnson, C.J.; Gilbert, P.; McKenzie, D.; Pedersen, J.A.; Aiken, Judd M.

    2009-01-01

    Background. Transmissible spongiform encephalopathies (TSEs) are a group of fatal neurodegenerative diseases caused by novel infectious agents referred to as prions. Prions appear to be composed primarily, if not exclusively, of a misfolded isoform of the cellular prion protein. TSE infectivity is remarkably stable and can resist many aggressive decontamination procedures, increasing human, livestock and wildlife exposure to TSEs. Findings. We tested the hypothesis that UV-ozone treatment reduces levels of the pathogenic prion protein and inactivates the infectious agent. We found that UV-ozone treatment decreased the carbon and prion protein content in infected brain homogenate to levels undetectable by dry-ashing carbon analysis or immunoblotting, respectively. After 8 weeks of ashing, UV-ozone treatment reduced the infectious titer of treated material by a factor of at least 105. A small amount of infectivity, however, persisted despite UV-ozone treatment. When bound to either montmorillonite clay or quartz surfaces, PrPTSE was still susceptible to degradation by UV-ozone. Conclusion. Our findings strongly suggest that UV-ozone treatment can degrade pathogenic prion protein and inactivate prions, even when the agent is associated with surfaces. Using larger UV-ozone doses or combining UV-ozone treatment with other decontaminant methods may allow the sterilization of TSE-contaminated materials. ?? 2009 Aiken et al; licensee BioMed Central Ltd.

  1. Prions and lymphoid organs

    Science.gov (United States)

    O’Connor, Tracy; Aguzzi, Adriano

    2013-01-01

    Prion colonization of secondary lymphoid organs (SLOs) is a critical step preceding neuroinvasion in prion pathogenesis. Follicular dendritic cells (FDCs), which depend on both tumor necrosis factor receptor 1 (TNFR1) and lymphotoxin β receptor (LTβR) signaling for maintenance, are thought to be the primary sites of prion accumulation in SLOs. However, prion titers in RML-infected TNFR1−/− lymph nodes and rates of neuroinvasion in TNFR1−/− mice remain high despite the absence of mature FDCs. Recently, we discovered that TNFR1-independent prion accumulation in lymph nodes relies on LTβR signaling. Loss of LTβR signaling in TNFR1−/− lymph nodes coincided with the de-differentiation of high endothelial venules (HEVs)—the primary sites of lymphocyte entry into lymph nodes. These findings suggest that HEVs are the sites through which prions initially invade lymph nodes from the bloodstream. Identification of HEVs as entry portals for prions clarifies a number of previous observations concerning peripheral prion pathogenesis. However, a number of questions still remain: What is the mechanism by which prions are taken up by HEVs? Which cells are responsible for delivering prions to lymph nodes? Are HEVs the main entry site for prions into lymph nodes or do alternative routes also exist? These questions and others are considered in this article. PMID:23357827

  2. Sub-cellular force microscopy in single normal and cancer cells

    International Nuclear Information System (INIS)

    Babahosseini, H.; Carmichael, B.; Strobl, J.S.; Mahmoodi, S.N.; Agah, M.

    2015-01-01

    This work investigates the biomechanical properties of sub-cellular structures of breast cells using atomic force microscopy (AFM). The cells are modeled as a triple-layered structure where the Generalized Maxwell model is applied to experimental data from AFM stress-relaxation tests to extract the elastic modulus, the apparent viscosity, and the relaxation time of sub-cellular structures. The triple-layered modeling results allow for determination and comparison of the biomechanical properties of the three major sub-cellular structures between normal and cancerous cells: the up plasma membrane/actin cortex, the mid cytoplasm/nucleus, and the low nuclear/integrin sub-domains. The results reveal that the sub-domains become stiffer and significantly more viscous with depth, regardless of cell type. In addition, there is a decreasing trend in the average elastic modulus and apparent viscosity of the all corresponding sub-cellular structures from normal to cancerous cells, which becomes most remarkable in the deeper sub-domain. The presented modeling in this work constitutes a unique AFM-based experimental framework to study the biomechanics of sub-cellular structures. - Highlights: • The cells are modeled as a triple-layered structure using Generalized Maxwell model. • The sub-domains include membrane/cortex, cytoplasm/nucleus, and nuclear/integrin. • Biomechanics of corresponding sub-domains are compared among normal and cancer cells. • Viscoelasticity of sub-domains show a decreasing trend from normal to cancer cells. • The decreasing trend becomes most significant in the deeper sub-domain

  3. Sub-cellular force microscopy in single normal and cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Babahosseini, H. [VT MEMS Laboratory, The Bradley Department of Electrical and Computer Engineering, Blacksburg, VA 24061 (United States); Carmichael, B. [Nonlinear Intelligent Structures Laboratory, Department of Mechanical Engineering, University of Alabama, Tuscaloosa, AL 35487-0276 (United States); Strobl, J.S. [VT MEMS Laboratory, The Bradley Department of Electrical and Computer Engineering, Blacksburg, VA 24061 (United States); Mahmoodi, S.N., E-mail: nmahmoodi@eng.ua.edu [Nonlinear Intelligent Structures Laboratory, Department of Mechanical Engineering, University of Alabama, Tuscaloosa, AL 35487-0276 (United States); Agah, M., E-mail: agah@vt.edu [VT MEMS Laboratory, The Bradley Department of Electrical and Computer Engineering, Blacksburg, VA 24061 (United States)

    2015-08-07

    This work investigates the biomechanical properties of sub-cellular structures of breast cells using atomic force microscopy (AFM). The cells are modeled as a triple-layered structure where the Generalized Maxwell model is applied to experimental data from AFM stress-relaxation tests to extract the elastic modulus, the apparent viscosity, and the relaxation time of sub-cellular structures. The triple-layered modeling results allow for determination and comparison of the biomechanical properties of the three major sub-cellular structures between normal and cancerous cells: the up plasma membrane/actin cortex, the mid cytoplasm/nucleus, and the low nuclear/integrin sub-domains. The results reveal that the sub-domains become stiffer and significantly more viscous with depth, regardless of cell type. In addition, there is a decreasing trend in the average elastic modulus and apparent viscosity of the all corresponding sub-cellular structures from normal to cancerous cells, which becomes most remarkable in the deeper sub-domain. The presented modeling in this work constitutes a unique AFM-based experimental framework to study the biomechanics of sub-cellular structures. - Highlights: • The cells are modeled as a triple-layered structure using Generalized Maxwell model. • The sub-domains include membrane/cortex, cytoplasm/nucleus, and nuclear/integrin. • Biomechanics of corresponding sub-domains are compared among normal and cancer cells. • Viscoelasticity of sub-domains show a decreasing trend from normal to cancer cells. • The decreasing trend becomes most significant in the deeper sub-domain.

  4. Anti-prion activity of Brilliant Blue G.

    Directory of Open Access Journals (Sweden)

    Yoshifumi Iwamaru

    Full Text Available BACKGROUND: Prion diseases are fatal neurodegenerative disorders with no effective therapy currently available. Accumulating evidence has implicated over-activation of P2X7 ionotropic purinergic receptor (P2X7R in the progression of neuronal loss in several neurodegenerative diseases. This has led to the speculation that simultaneous blockade of this receptor and prion replication can be an effective therapeutic strategy for prion diseases. We have focused on Brilliant Blue G (BBG, a well-known P2X7R antagonist, possessing a chemical structure expected to confer anti-prion activity and examined its inhibitory effect on the accumulation of pathogenic isoforms of prion protein (PrPres in a cellular and a mouse model of prion disease in order to determine its therapeutic potential. PRINCIPAL FINDINGS: BBG prevented PrPres accumulation in infected MG20 microglial and N2a neural cells at 50% inhibitory concentrations of 14.6 and 3.2 µM, respectively. Administration of BBG in vivo also reduced PrPres accumulation in the brains of mice with prion disease. However, it did not appear to alleviate the disease progression compared to the vehicle-treated controls, implying a complex role of P2X7R on the neuronal degeneration in prion diseases. SIGNIFICANCE: These results provide novel insights into the pathophysiology of prion diseases and have important implications for the treatment.

  5. The celecoxib derivatives AR-12 and AR-14 induce autophagy and clear prion-infected cells from prions.

    Science.gov (United States)

    Abdulrahman, Basant A; Abdelaziz, Dalia; Thapa, Simrika; Lu, Li; Jain, Shubha; Gilch, Sabine; Proniuk, Stefan; Zukiwski, Alexander; Schatzl, Hermann M

    2017-12-14

    Prion diseases are fatal infectious neurodegenerative disorders that affect both humans and animals. The autocatalytic conversion of the cellular prion protein (PrP C ) into the pathologic isoform PrP Sc is a key feature in prion pathogenesis. AR-12 is an IND-approved derivative of celecoxib that demonstrated preclinical activity against several microbial diseases. Recently, AR-12 has been shown to facilitate clearance of misfolded proteins. The latter proposes AR-12 to be a potential therapeutic agent for neurodegenerative disorders. In this study, we investigated the role of AR-12 and its derivatives in controlling prion infection. We tested AR-12 in prion infected neuronal and non-neuronal cell lines. Immunoblotting and confocal microscopy results showed that AR-12 and its analogue AR-14 reduced PrP Sc levels after only 72 hours of treatment. Furthermore, infected cells were cured of PrP Sc after exposure of AR-12 or AR-14 for only two weeks. We partially attribute the influence of the AR compounds on prion propagation to autophagy stimulation, in line with our previous findings that drug-induced stimulation of autophagy has anti-prion effects in vitro and in vivo. Taken together, this study demonstrates that AR-12 and the AR-14 analogue are potential new therapeutic agents for prion diseases and possibly protein misfolding disorders involving prion-like mechanisms.

  6. Scrapie susceptibility-linked polymorphisms modulate the in vitro conversion of sheep prion protein to protease-resistant forms

    NARCIS (Netherlands)

    Bossers, A.; Belt, P.B.G.M.; Raymond, G.J.; Caughey, B.; Vries, de R.; Smits, M.

    1997-01-01

    Prion diseases are natural transmissible neurodegenerative disorders in humans and animals. They are characterized by the accumulation of a protease-resistant scrapie-associated prion protein (PrPSc) of the host-encoded cellular prion protein (PrPC) mainly in the central nervous system.

  7. Advancing prion science: guidance for the National Prion Research Program

    National Research Council Canada - National Science Library

    Erdtmann, Rick; Sivitz, Laura

    2004-01-01

    ...€™s National Prion Research Program (NPRP). Transmissible spongiform encephalopathies (TSEs), also called prion diseases, are invariably fatal neurodegenerative infectious diseases that include bovine spongiform encephalopathy...

  8. Immunology of Prion Protein and Prions.

    Science.gov (United States)

    Mabbott, Neil A

    2017-01-01

    Many natural prion diseases are acquired peripherally, such as following the oral consumption of contaminated food or pasture. After peripheral exposure many prion isolates initially accumulate to high levels within the host's secondary lymphoid tissues. The replication of prions within these tissues is essential for their efficient spread to the brain where they ultimately cause neurodegeneration. This chapter describes our current understanding of the critical tissues, cells, and molecules which the prions exploit to mediate their efficient propagation from the site of exposure (such as the intestine) to the brain. Interactions between the immune system and prions are not only restricted to the secondary lymphoid tissues. Therefore, an account of how the activation status of the microglial in the brain can also influence progression of prion disease pathogenesis is provided. Prion disease susceptibility may also be influenced by additional factors such as chronic inflammation, coinfection with other pathogens, and aging. Finally, the potential for immunotherapy to provide a means of safe and effective prophylactic or therapeutic intervention in these currently untreatable diseases is considered. © 2017 Elsevier Inc. All rights reserved.

  9. Porcine prion protein amyloid.

    Science.gov (United States)

    Hammarström, Per; Nyström, Sofie

    2015-01-01

    Mammalian prions are composed of misfolded aggregated prion protein (PrP) with amyloid-like features. Prions are zoonotic disease agents that infect a wide variety of mammalian species including humans. Mammals and by-products thereof which are frequently encountered in daily life are most important for human health. It is established that bovine prions (BSE) can infect humans while there is no such evidence for any other prion susceptible species in the human food chain (sheep, goat, elk, deer) and largely prion resistant species (pig) or susceptible and resistant pets (cat and dogs, respectively). PrPs from these species have been characterized using biochemistry, biophysics and neurobiology. Recently we studied PrPs from several mammals in vitro and found evidence for generic amyloidogenicity as well as cross-seeding fibril formation activity of all PrPs on the human PrP sequence regardless if the original species was resistant or susceptible to prion disease. Porcine PrP amyloidogenicity was among the studied. Experimentally inoculated pigs as well as transgenic mouse lines overexpressing porcine PrP have, in the past, been used to investigate the possibility of prion transmission in pigs. The pig is a species with extraordinarily wide use within human daily life with over a billion pigs harvested for human consumption each year. Here we discuss the possibility that the largely prion disease resistant pig can be a clinically silent carrier of replicating prions.

  10. Prion Protein on Astrocytes or in Extracellular Fluid Impedes Neurodegeneration Induced by Truncated Prion Protein

    OpenAIRE

    Race, Brent; Meade-White, Kimberly; Race, Richard; Baumann, Frank; Aguzzi, Adriano; Chesebro, Bruce

    2009-01-01

    Prion protein (PrP) is a host-encoded membrane-anchored glycoprotein which is required for susceptibility to prion disease. PrP may also be important for normal brain functions such as hippocampal spatial memory. Previously transgenic mice expressing amino terminally truncated mouse PrP (Δ32–134) spontaneously developed a fatal disease associated with degeneration of cerebellar granular neurons as well as vacuolar degeneration of deep cerebellar and brain stem white matter. This disease could...

  11. Expression of Cellular Isoform of Prion Protein on the Surface of Peripheral Blood Lymphocytes Among Women Exposed to Low Doses of Ionizing Radiation

    International Nuclear Information System (INIS)

    Klucinski, P.; Martirosian, G.; Mazur, B.; Kaufman, J.; Hrycek, A.; Masluch, E.; Cieslik, P.

    2007-01-01

    Ionizing radiation affect the expression of adhesive and co-stimulation molecules in lymphocytes. The objective of this study was to determinate the effect of low doses of ionizing radiation on the expression of prion protein PrPc on the surface peripheral blood lymphocytes in the women operating X-ray equipment. In female workers and persons of the control group the PrPc expression on CD3 (T-lymphocytes), Cd4 (T-helper), CD8 (T-cytotoxic) and CD19 (B- lymphocytes), were tested. We conclude that in women operating X-ray equipment the relationship between low doses of ionizing radiation and expression of PrPc on lymphocytes does exist concerning CD3, CD4 and CD lymphocytes. (author)

  12. Thermodynamic Stabilization of the Folded Domain of Prion Protein Inhibits Prion Infection in Vivo

    Directory of Open Access Journals (Sweden)

    Qingzhong Kong

    2013-07-01

    Full Text Available Prion diseases, or transmissible spongiform encephalopathies (TSEs, are associated with the conformational conversion of the cellular prion protein, PrPC, into a protease-resistant form, PrPSc. Here, we show that mutation-induced thermodynamic stabilization of the folded, α-helical domain of PrPC has a dramatic inhibitory effect on the conformational conversion of prion protein in vitro, as well as on the propagation of TSE disease in vivo. Transgenic mice expressing a human prion protein variant with increased thermodynamic stability were found to be much more resistant to infection with the TSE agent than those expressing wild-type human prion protein, in both the primary passage and three subsequent subpassages. These findings not only provide a line of evidence in support of the protein-only model of TSEs but also yield insight into the molecular nature of the PrPC→PrPSc conformational transition, and they suggest an approach to the treatment of prion diseases.

  13. Role of Prion Replication in the Strain-dependent Brain Regional Distribution of Prions.

    Science.gov (United States)

    Hu, Ping Ping; Morales, Rodrigo; Duran-Aniotz, Claudia; Moreno-Gonzalez, Ines; Khan, Uffaf; Soto, Claudio

    2016-06-10

    One intriguing feature of prion diseases is their strain variation. Prion strains are differentiated by the clinical consequences they generate in the host, their biochemical properties, and their potential to infect other animal species. The selective targeting of these agents to specific brain structures have been extensively used to characterize prion strains. However, the molecular basis dictating strain-specific neurotropism are still elusive. In this study, isolated brain structures from animals infected with four hamster prion strains (HY, DY, 139H, and SSLOW) were analyzed for their content of protease-resistant PrP(Sc) Our data show that these strains have different profiles of PrP deposition along the brain. These patterns of accumulation, which were independent of regional PrP(C) production, were not reproduced by in vitro replication when different brain regions were used as substrate for the misfolding-amplification reaction. On the contrary, our results show that in vitro replication efficiency depended exclusively on the amount of PrP(C) present in each part of the brain. Our results suggest that the variable regional distribution of PrP(Sc) in distinct strains is not determined by differences on prion formation, but on other factors or cellular pathways. Our findings may contribute to understand the molecular mechanisms of prion pathogenesis and strain diversity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. An acoustic prion assay

    Directory of Open Access Journals (Sweden)

    Gordon Hayward

    2016-12-01

    Full Text Available An acoustic prion assay has been demonstrated for sheep brain samples. Only five false positives and no false negatives were observed in a test of 45 positive and 45 negative samples. The acoustic prion sensor was constructed using a thickness shear mode quartz resonator coated with a covalently bound recombinant prion protein. The characteristic indicator of a scrapie infected sheep brain sample was an observed shoulder in the frequency decrease in response to a sample.The response of the sensor aligns with a conformational shift in the surface protein and with the propagation mechanism of the disease. This alignment is evident in the response timing and shape, dependence on concentration, cross species behaviour and impact of blood plasma. This alignment is far from sufficient to prove the mechanism of the sensor but it does offer the possibility of a rapid and inexpensive additional tool to explore prion disease. Keywords: Prions, Thickness shear mode quartz sensor

  15. Chronic wasting disease prion infection of differentiated neurospheres.

    Science.gov (United States)

    Iwamaru, Yoshifumi; Mathiason, Candace K; Telling, Glenn C; Hoover, Edward A

    2017-07-04

    A possible strategy to develop more diverse cell culture systems permissive to infection with naturally occurring prions is to exploit culture of neurospheres from transgenic mice expressing the normal prion protein (PrP) of the native host species. Accordingly, we developed differentiated neurosphere cultures from the cervid PrP-expressing mice to investigate whether this in vitro system would support replication of non-adapted cervid-origin chronic wasting disease (CWD) prions. Here we report the successful amplification of disease-associated PrP in differentiated neurosphere cultures within 3 weeks after exposure to CWD prions from both white-tailed deer or elk. This neurosphere culture system provides a new in vitro tool that can be used to assess non-adapted CWD prion propagation and transmission.

  16. Prion Replication Elicits Cytopathic Changes in Differentiated Neurosphere Cultures

    Science.gov (United States)

    Iwamaru, Yoshifumi; Takenouchi, Takato; Imamura, Morikazu; Shimizu, Yoshihisa; Miyazawa, Kohtaro; Mohri, Shirou; Yokoyama, Takashi

    2013-01-01

    The molecular mechanisms of prion-induced cytotoxicity remain largely obscure. Currently, only a few cell culture models have exhibited the cytopathic changes associated with prion infection. In this study, we introduced a cell culture model based on differentiated neurosphere cultures isolated from the brains of neonatal prion protein (PrP)-null mice and transgenic mice expressing murine PrP (dNP0 and dNP20 cultures). Upon exposure to mouse Chandler prions, dNP20 cultures supported the de novo formation of abnormal PrP and the resulting infectivity, as assessed by bioassays. Furthermore, this culture was susceptible to various prion strains, including mouse-adapted scrapie, bovine spongiform encephalopathy, and Gerstmann-Sträussler-Scheinker syndrome prions. Importantly, a subset of the cells in the infected culture that was mainly composed of astrocyte lineage cells consistently displayed late-occurring, progressive signs of cytotoxicity as evidenced by morphological alterations, decreased cell viability, and increased lactate dehydrogenase release. These signs of cytotoxicity were not observed in infected dNP0 cultures, suggesting the requirement of endogenous PrP expression for prion-induced cytotoxicity. Degenerated cells positive for glial fibrillary acidic protein accumulated abnormal PrP and exhibited features of apoptotic death as assessed by active caspase-3 and terminal deoxynucleotidyltransferase nick-end staining. Furthermore, caspase inhibition provided partial protection from prion-mediated cell death. These results suggest that differentiated neurosphere cultures can provide an in vitro bioassay for mouse prions and permit the study of the molecular basis for prion-induced cytotoxicity at the cellular level. PMID:23740992

  17. Protease-resistant prions selectively decrease Shadoo protein.

    Directory of Open Access Journals (Sweden)

    Joel C Watts

    2011-11-01

    Full Text Available The central event in prion diseases is the conformational conversion of the cellular prion protein (PrP(C into PrP(Sc, a partially protease-resistant and infectious conformer. However, the mechanism by which PrP(Sc causes neuronal dysfunction remains poorly understood. Levels of Shadoo (Sho, a protein that resembles the flexibly disordered N-terminal domain of PrP(C, were found to be reduced in the brains of mice infected with the RML strain of prions [1], implying that Sho levels may reflect the presence of PrP(Sc in the brain. To test this hypothesis, we examined levels of Sho during prion infection using a variety of experimental systems. Sho protein levels were decreased in the brains of mice, hamsters, voles, and sheep infected with different natural and experimental prion strains. Furthermore, Sho levels were decreased in the brains of prion-infected, transgenic mice overexpressing Sho and in infected neuroblastoma cells. Time-course experiments revealed that Sho levels were inversely proportional to levels of protease-resistant PrP(Sc. Membrane anchoring and the N-terminal domain of PrP both influenced the inverse relationship between Sho and PrP(Sc. Although increased Sho levels had no discernible effect on prion replication in mice, we conclude that Sho is the first non-PrP marker specific for prion disease. Additional studies using this paradigm may provide insight into the cellular pathways and systems subverted by PrP(Sc during prion disease.

  18. Cholesterol Balance in Prion Diseases and Alzheimer’s Disease

    Science.gov (United States)

    Hannaoui, Samia; Shim, Su Yeon; Cheng, Yo Ching; Corda, Erica; Gilch, Sabine

    2014-01-01

    Prion diseases are transmissible and fatal neurodegenerative disorders of humans and animals. They are characterized by the accumulation of PrPSc, an aberrantly folded isoform of the cellular prion protein PrPC, in the brains of affected individuals. PrPC is a cell surface glycoprotein attached to the outer leaflet of the plasma membrane by a glycosyl-phosphatidyl-inositol (GPI) anchor. Specifically, it is associated with lipid rafts, membrane microdomains enriched in cholesterol and sphinoglipids. It has been established that inhibition of endogenous cholesterol synthesis disturbs lipid raft association of PrPC and prevents PrPSc accumulation in neuronal cells. Additionally, prion conversion is reduced upon interference with cellular cholesterol uptake, endosomal export, or complexation at the plasma membrane. Altogether, these results demonstrate on the one hand the importance of cholesterol for prion propagation. On the other hand, growing evidence suggests that prion infection modulates neuronal cholesterol metabolism. Similar results were reported in Alzheimer’s disease (AD): whereas amyloid β peptide formation is influenced by cellular cholesterol, levels of cholesterol in the brains of affected individuals increase during the clinical course of the disease. In this review, we summarize commonalities of alterations in cholesterol homeostasis and discuss consequences for neuronal function and therapy of prion diseases and AD. PMID:25419621

  19. Cholesterol Balance in Prion Diseases and Alzheimer’s Disease

    Directory of Open Access Journals (Sweden)

    Samia Hannaoui

    2014-11-01

    Full Text Available Prion diseases are transmissible and fatal neurodegenerative disorders of humans and animals. They are characterized by the accumulation of PrPSc, an aberrantly folded isoform of the cellular prion protein PrPC, in the brains of affected individuals. PrPC is a cell surface glycoprotein attached to the outer leaflet of the plasma membrane by a glycosyl-phosphatidyl-inositol (GPI anchor. Specifically, it is associated with lipid rafts, membrane microdomains enriched in cholesterol and sphinoglipids. It has been established that inhibition of endogenous cholesterol synthesis disturbs lipid raft association of PrPC and prevents PrPSc accumulation in neuronal cells. Additionally, prion conversion is reduced upon interference with cellular cholesterol uptake, endosomal export, or complexation at the plasma membrane. Altogether, these results demonstrate on the one hand the importance of cholesterol for prion propagation. On the other hand, growing evidence suggests that prion infection modulates neuronal cholesterol metabolism. Similar results were reported in Alzheimer’s disease (AD: whereas amyloid β peptide formation is influenced by cellular cholesterol, levels of cholesterol in the brains of affected individuals increase during the clinical course of the disease. In this review, we summarize commonalities of alterations in cholesterol homeostasis and discuss consequences for neuronal function and therapy of prion diseases and AD.

  20. Neuroinflammation, hyperphosphorylated tau, diffuse amyloid plaques, and down-regulation of the cellular prion protein in air pollution exposed children and young adults.

    Science.gov (United States)

    Calderón-Garcidueñas, Lilian; Kavanaugh, Michael; Block, Michelle; D'Angiulli, Amedeo; Delgado-Chávez, Ricardo; Torres-Jardón, Ricardo; González-Maciel, Angelica; Reynoso-Robles, Rafael; Osnaya, Norma; Villarreal-Calderon, Rodolfo; Guo, Ruixin; Hua, Zhaowei; Zhu, Hongtu; Perry, George; Diaz, Philippe

    2012-01-01

    Air pollution exposures have been linked to neuroinflammation and neuropathology. Autopsy samples of the frontal cortex from control (n = 8) and pollution-exposed (n = 35) children and young adults were analyzed by RT-PCR (n = 43) and microarray analysis (n = 12) for gene expression changes in oxidative stress, DNA damage signaling, NFκB signaling, inflammation, and neurodegeneration pathways. The effect of apolipoprotein E (APOE) genotype on the presence of protein aggregates associated with Alzheimer's disease (AD) pathology was also explored. Exposed urbanites displayed differential (>2-fold) regulation of 134 genes. Forty percent exhibited tau hyperphosphorylation with pre-tangle material and 51% had amyloid-β (Aβ) diffuse plaques compared with 0% in controls. APOE4 carriers had greater hyperphosphorylated tau and diffuse Aβ plaques versus E3 carriers (Q = 7.82, p = 0.005). Upregulated gene network clusters included IL1, NFκB, TNF, IFN, and TLRs. A 15-fold frontal down-regulation of the prion-related protein (PrP(C)) was seen in highly exposed subjects. The down-regulation of the PrP(C) is critical given its important roles for neuroprotection, neurodegeneration, and mood disorder states. Elevation of indices of neuroinflammation and oxidative stress, down-regulation of the PrP(C) and AD-associated pathology are present in young megacity residents. The inducible regulation of gene expression suggests they are evolving different mechanisms in an attempt to cope with the constant state of inflammation and oxidative stress related to their environmental exposures. Together, these data support a role for air pollution in CNS damage and its impact upon the developing brain and the potential etiology of AD and mood disorders.

  1. Prion protein in milk.

    Directory of Open Access Journals (Sweden)

    Nicola Franscini

    Full Text Available BACKGROUND: Prions are known to cause transmissible spongiform encephalopathies (TSE after accumulation in the central nervous system. There is increasing evidence that prions are also present in body fluids and that prion infection by blood transmission is possible. The low concentration of the proteinaceous agent in body fluids and its long incubation time complicate epidemiologic analysis and estimation of spreading and thus the risk of human infection. This situation is particularly unsatisfactory for food and pharmaceutical industries, given the lack of sensitive tools for monitoring the infectious agent. METHODOLOGY/PRINCIPAL FINDINGS: We have developed an adsorption matrix, Alicon PrioTrap, which binds with high affinity and specificity to prion proteins. Thus we were able to identify prion protein (PrP(C--the precursor of prions (PrP(Sc--in milk from humans, cows, sheep, and goats. The absolute amount of PrP(C differs between the species (from microg/l range in sheep to ng/l range in human milk. PrP(C is also found in homogenised and pasteurised off-the-shelf milk, and even ultrahigh temperature treatment only partially diminishes endogenous PrP(C concentration. CONCLUSIONS/SIGNIFICANCE: In view of a recent study showing evidence of prion replication occurring in the mammary gland of scrapie infected sheep suffering from mastitis, the appearance of PrP(C in milk implies the possibility that milk of TSE-infected animals serves as source for PrP(Sc.

  2. Prion protein-deficient mice exhibit decreased CD4 T and LTi cell numbers and impaired spleen structure.

    Science.gov (United States)

    Kim, Soochan; Han, Sinsuk; Lee, Ye Eun; Jung, Woong-Jae; Lee, Hyung Soo; Kim, Yong-Sun; Choi, Eun-Kyoung; Kim, Mi-Yeon

    2016-01-01

    The cellular prion protein is expressed in almost all tissues, including the central nervous system and lymphoid tissues. To investigate the effects of the prion protein in lymphoid cells and spleen structure formation, we used prion protein-deficient (Prnp(0/0)) Zürich I mice generated by inactivation of the Prnp gene. Prnp(0/0) mice had decreased lymphocytes, in particular, CD4 T cells and lymphoid tissue inducer (LTi) cells. Decreased CD4 T cells resulted from impaired expression of CCL19 and CCL21 in the spleen rather than altered chemokine receptor CCR7 expression. Importantly, some of the white pulp regions in spleens from Prnp(0/0) mice displayed impaired T zone structure as a result of decreased LTi cell numbers and altered expression of the lymphoid tissue-organizing genes lymphotoxin-α and CXCR5, although expression of the lymphatic marker podoplanin and CXCL13 by stromal cells was not affected. In addition, CD3(-)CD4(+)IL-7Rα(+) LTi cells were rarely detected in impaired white pulp in spleens of these mice. These data suggest that the prion protein is required to form the splenic white pulp structure and for development of normal levels of CD4 T and LTi cells. Copyright © 2015. Published by Elsevier GmbH.

  3. Prion Protein Regulates Iron Transport by Functioning as a Ferrireductase

    Science.gov (United States)

    Singh, Ajay; Haldar, Swati; Horback, Katharine; Tom, Cynthia; Zhou, Lan; Meyerson, Howard; Singh, Neena

    2017-01-01

    Prion protein (PrPC) is implicated in the pathogenesis of prion disorders, but its normal function is unclear. We demonstrate that PrPC is a ferrireductase (FR), and its absence causes systemic iron deficiency in PrP knock-out mice (PrP−/−). When exposed to non-transferrin-bound (NTB) radioactive-iron (59FeCl3) by gastric-gavage, PrP−/− mice absorb significantly more 59Fe from the intestinal lumen relative to controls, indicating appropriate systemic response to the iron deficiency. Chronic exposure to excess dietary iron corrects this deficiency, but unlike wild-type (PrP+/+) controls that remain iron over-loaded, PrP−/− mice revert back to the iron deficient phenotype after 5 months of chase on normal diet. Bone marrow (BM) preparations of PrP−/− mice on normal diet show relatively less stainable iron, and this phenotype is only partially corrected by intraperitoneal administration of excess iron-dextran. Cultured PrP−/− BM-macrophages incorporate significantly less NTB-59Fe in the absence or presence of excess extracellular iron, indicating reduced uptake and/or storage of available iron in the absence of PrPC. When expressed in neuroblastoma cells, PrPC exhibits NAD(P)H-dependent cell-surface and intracellular FR activity that requires the copper-binding octa-peptide-repeat region and linkage to the plasma membrane for optimal function. Incorporation of NTB-59Fe by neuroblastoma cells correlates with FR activity of PrPC, implicating PrPC in cellular iron uptake and metabolism. These observations explain the correlation between PrPC expression and cellular iron levels, and the cause of iron imbalance in sporadic-Creutzfeldt-Jakob-disease brains where PrPC accumulates as insoluble aggregates. PMID:23478311

  4. Biosafety of Prions.

    Science.gov (United States)

    Bistaffa, Edoardo; Rossi, Martina; De Luca, Chiara M G; Moda, Fabio

    2017-01-01

    Prions are the infectious agents that cause devastating and untreatable disorders known as Transmissible Spongiform Encephalopathies (TSEs). The pathologic events and the infectious nature of these transmissible agents are not completely understood yet. Due to the difficulties in inactivating prions, working with them requires specific recommendations and precautions. Moreover, with the advent of innovative technologies, such as the Protein Misfolding Cyclic Amplification (PMCA) and the Real Time Quaking-Induced Conversion (RT-QuIC), prions could be amplified in vitro and the infectious features of the amplified products need to be carefully assessed. © 2017 Elsevier Inc. All rights reserved.

  5. The ribosome-associated complex antagonizes prion formation in yeast.

    Science.gov (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  6. Prion protein β2-α2 loop conformational landscape.

    Science.gov (United States)

    Caldarulo, Enrico; Barducci, Alessandro; Wüthrich, Kurt; Parrinello, Michele

    2017-09-05

    In transmissible spongiform encephalopathies (TSEs), which are lethal neurodegenerative diseases that affect humans and a wide range of other mammalian species, the normal "cellular" prion protein ([Formula: see text]) is transformed into amyloid aggregates representing the "scrapie form" of the protein ([Formula: see text]). Continued research on this system is of keen interest, since new information on the physiological function of [Formula: see text] in healthy organisms is emerging, as well as new data on the mechanism of the transformation of [Formula: see text] to [Formula: see text] In this paper we used two different approaches: a combination of the well-tempered ensemble (WTE) and parallel tempering (PT) schemes and metadynamics (MetaD) to characterize the conformational free-energy surface of [Formula: see text] The focus of the data analysis was on an 11-residue polypeptide segment in mouse [Formula: see text](121-231) that includes the [Formula: see text]2-[Formula: see text]2 loop of residues 167-170, for which a correlation between structure and susceptibility to prion disease has previously been described. This study includes wild-type mouse [Formula: see text] and a variant with the single-residue replacement Y169A. The resulting detailed conformational landscapes complement in an integrative manner the available experimental data on [Formula: see text], providing quantitative insights into the nature of the structural transition-related function of the [Formula: see text]2-[Formula: see text]2 loop.

  7. Mutation directional selection sheds light on prion pathogenesis

    International Nuclear Information System (INIS)

    Shen, Liang; Ji, Hong-Fang

    2011-01-01

    Highlights: → Most pathogenic mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. → Mutation-induced changes may strengthen the interactions between PrP and facilitating factors. → The findings also have significant implications for exploring potential regions involved in the conformational transition from PrP C to PrP Sc . -- Abstract: As mutations in the PRNP gene account for human hereditary prion diseases (PrDs), it is crucial to elucidating how these mutations affect the central pathogenic conformational transition of normal cellular prion protein (PrP C ) to abnormal scrapie isoform (PrP Sc ). Many studies proposed that these pathogenic mutations may make PrP more susceptible to conformational change through altering its structure stability. By evaluating the most recent observations regarding pathogenic mutations, it was found that the pathogenic mutations do not exert a uniform effect on the thermodynamic stability of the human PrP's structure. Through analyzing the reported PrDs-related mutations, we found that 25 out of 27 mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. Based on the triggering role reported by previous studies of facilitating factors in PrP C conversion, e.g., lipid and polyanion, we proposed that the mutation-induced changes may strengthen the interaction between PrP and facilitating factors, which will accelerate PrP conversion and cause PrDs.

  8. Prions, From Structure to Epigenetics and Neuronal Functions

    Science.gov (United States)

    Lindquist, Susan

    2012-02-01

    Prions are a unique type of protein that can misfold and convert other proteins to the same shape. The well-characterized yeast prion [PSI+] is formed from an inactive amyloid fiber conformation of the translation-termination factor, Sup35. This altered conformation is passed from mother cells to daughters, acting as a template to perpetuate the prion state and providing a mechanism of protein-based inheritance. We employed a variety of methods to determine the structure of Sup35 amyloid fibrils. First, using fluorescent tags and cross-linking we identified specific segments of the protein monomer that form intermolecular contacts in a ``Head-to-Head,'' ``Tail-to-Tail'' fashion while a central region forms intramolecular contacts. Then, using peptide arrays we mapped the region responsible for the prion transmission barrier between two different yeast species. We have also used optical tweezers to reveal that the non-covalent intermolecular contacts between monomers are unusually strong, and maintain fibril integrity even under forces that partially unfold individual monomers and extend fibril length. Based on the handful of known yeast prion proteins we predicted sequences that could be responsible for prion-like amyloid folding. Our screen identified 19 new candidate prions, whose protein-folding properties and diverse cellular functions we have characterized using a combination of genetic and biochemical techniques. Prion-driven phenotypic diversity increases under stress, and can be amplified by the dynamic maturation of prion-initiating states. These qualities allow prions to act as ``bet-hedging'' devices that facilitate the adaptation of yeast to stressful environments, and might speed the evolution of new traits. Together with Kandel and Si, we have also found that a regulatory protein that plays an important role in synaptic plasticity behaves as a prion in yeast. Cytoplasmic polyAdenylation element binding protein, CPEB, maintains synapses by promoting

  9. Antimicrobial Activity of Human Prion Protein Is Mediated by Its N-Terminal Region

    OpenAIRE

    Pasupuleti, Mukesh; Roupe, Markus; Rydeng?rd, Victoria; Surewicz, Krystyna; Surewicz, Witold K.; Chalupka, Anna; Malmsten, Martin; S?rensen, Ole E.; Schmidtchen, Artur

    2009-01-01

    BACKGROUND: Cellular prion-related protein (PrP(c)) is a cell-surface protein that is ubiquitously expressed in the human body. The multifunctionality of PrP(c), and presence of an exposed cationic and heparin-binding N-terminus, a feature characterizing many antimicrobial peptides, made us hypothesize that PrP(c) could exert antimicrobial activity. METHODOLOGY AND PRINCIPAL FINDINGS: Intact recombinant PrP exerted antibacterial and antifungal effects at normal and low pH. Studies employing r...

  10. How do PrPSc Prions Spread between Host Species, and within Hosts?

    Directory of Open Access Journals (Sweden)

    Neil A. Mabbott

    2017-11-01

    Full Text Available Prion diseases are sub-acute neurodegenerative diseases that affect humans and some domestic and free-ranging animals. Infectious prion agents are considered to comprise solely of abnormally folded isoforms of the cellular prion protein known as PrPSc. Pathology during prion disease is restricted to the central nervous system where it causes extensive neurodegeneration and ultimately leads to the death of the host. The first half of this review provides a thorough account of our understanding of the various ways in which PrPSc prions may spread between individuals within a population, both horizontally and vertically. Many natural prion diseases are acquired peripherally, such as by oral exposure, lesions to skin or mucous membranes, and possibly also via the nasal cavity. Following peripheral exposure, some prions accumulate to high levels within the secondary lymphoid organs as they make their journey from the site of infection to the brain, a process termed neuroinvasion. The replication of PrPSc prions within secondary lymphoid organs is important for their efficient spread to the brain. The second half of this review describes the key tissues, cells and molecules which are involved in the propagation of PrPSc prions from peripheral sites of exposure (such as the lumen of the intestine to the brain. This section also considers how additional factors such as inflammation and aging might influence prion disease susceptibility.

  11. Follicular dendritic cell-specific prion protein (PrP expression alone is sufficient to sustain prion infection in the spleen.

    Directory of Open Access Journals (Sweden)

    Laura McCulloch

    2011-12-01

    Full Text Available Prion diseases are characterised by the accumulation of PrP(Sc, an abnormally folded isoform of the cellular prion protein (PrP(C, in affected tissues. Following peripheral exposure high levels of prion-specific PrP(Sc accumulate first upon follicular dendritic cells (FDC in lymphoid tissues before spreading to the CNS. Expression of PrP(C is mandatory for cells to sustain prion infection and FDC appear to express high levels. However, whether FDC actively replicate prions or simply acquire them from other infected cells is uncertain. In the attempts to-date to establish the role of FDC in prion pathogenesis it was not possible to dissociate the Prnp expression of FDC from that of the nervous system and all other non-haematopoietic lineages. This is important as FDC may simply acquire prions after synthesis by other infected cells. To establish the role of FDC in prion pathogenesis transgenic mice were created in which PrP(C expression was specifically "switched on" or "off" only on FDC. We show that PrP(C-expression only on FDC is sufficient to sustain prion replication in the spleen. Furthermore, prion replication is blocked in the spleen when PrP(C-expression is specifically ablated only on FDC. These data definitively demonstrate that FDC are the essential sites of prion replication in lymphoid tissues. The demonstration that Prnp-ablation only on FDC blocked splenic prion accumulation without apparent consequences for FDC status represents a novel opportunity to prevent neuroinvasion by modulation of PrP(C expression on FDC.

  12. Transmissible Spongiform Encephalopathies (Prion Diseases)

    Science.gov (United States)

    ... This research is aimed at determining how abnormal prion proteins lead to disease, at finding better tests ... This research is aimed at determining how abnormal prion proteins lead to disease, at finding better tests ...

  13. Region-specific protein misfolding cyclic amplification reproduces brain tropism of prion strains.

    Science.gov (United States)

    Privat, Nicolas; Levavasseur, Etienne; Yildirim, Serfildan; Hannaoui, Samia; Brandel, Jean-Philippe; Laplanche, Jean-Louis; Béringue, Vincent; Seilhean, Danielle; Haïk, Stéphane

    2017-10-06

    Human prion diseases such as Creutzfeldt-Jakob disease are transmissible brain proteinopathies, characterized by the accumulation of a misfolded isoform of the host cellular prion protein (PrP) in the brain. According to the prion model, prions are defined as proteinaceous infectious particles composed solely of this abnormal isoform of PrP (PrP Sc ). Even in the absence of genetic material, various prion strains can be propagated in experimental models. They can be distinguished by the pattern of disease they produce and especially by the localization of PrP Sc deposits within the brain and the spongiform lesions they induce. The mechanisms involved in this strain-specific targeting of distinct brain regions still are a fundamental, unresolved question in prion research. To address this question, we exploited a prion conversion in vitro assay, protein misfolding cyclic amplification (PMCA), by using experimental scrapie and human prion strains as seeds and specific brain regions from mice and humans as substrates. We show here that region-specific PMCA in part reproduces the specific brain targeting observed in experimental, acquired, and sporadic Creutzfeldt-Jakob diseases. Furthermore, we provide evidence that, in addition to cellular prion protein, other region- and species-specific molecular factors influence the strain-dependent prion conversion process. This important step toward understanding prion strain propagation in the human brain may impact research on the molecular factors involved in protein misfolding and the development of ultrasensitive methods for diagnosing prion disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Infectious prion diseases in humans: cannibalism, iatrogenicity and zoonoses.

    Science.gov (United States)

    Haïk, Stéphane; Brandel, Jean-Philippe

    2014-08-01

    In contrast with other neurodegenerative disorders associated to protein misfolding, human prion diseases include infectious forms (also called transmitted forms) such as kuru, iatrogenic Creutzfeldt-Jakob disease and variant Creutzfeldt-Jakob disease. The transmissible agent is thought to be solely composed of the abnormal isoform (PrP(Sc)) of the host-encoded prion protein that accumulated in the central nervous system of affected individuals. Compared to its normal counterpart, PrP(Sc) is β-sheet enriched and aggregated and its propagation is based on an autocatalytic conversion process. Increasing evidence supports the view that conformational variations of PrP(Sc) encoded the biological properties of the various prion strains that have been isolated by transmission studies in experimental models. Infectious forms of human prion diseases played a pivotal role in the emergence of the prion concept and in the characterization of the very unconventional properties of prions. They provide a unique model to understand how prion strains are selected and propagate in humans. Here, we review and discuss how genetic factors interplay with strain properties and route of transmission to influence disease susceptibility, incubation period and phenotypic expression in the light of the kuru epidemics due to ritual endocannibalism, the various series iatrogenic diseases secondary to extractive growth hormone treatment or dura mater graft and the epidemics of variant Creutzfeldt-Jakob disease linked to dietary exposure to the agent of bovine spongiform encephalopathy. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Cleaning, disinfection and sterilization of surface prion contamination.

    Science.gov (United States)

    McDonnell, G; Dehen, C; Perrin, A; Thomas, V; Igel-Egalon, A; Burke, P A; Deslys, J P; Comoy, E

    2013-12-01

    Prion contamination is a risk during device reprocessing, being difficult to remove and inactivate. Little is known of the combined effects of cleaning, disinfection and sterilization during a typical reprocessing cycle in clinical practice. To investigate the combination of cleaning, disinfection and/or sterilization on reducing the risk of surface prion contamination. In vivo test methods were used to study the impact of cleaning alone and cleaning combined with thermal disinfection and high- or low-temperature sterilization processes. A standardized test method, based on contamination of stainless steel wires with high titres of scrapie-infected brain homogenates, was used to determine infectivity reduction. Traditional chemical methods of surface decontamination against prions were confirmed to be effective, but extended steam sterilization was more variable. Steam sterilization alone reduced the risk of prion contamination under normal or extended exposure conditions, but did show significant variation. Thermal disinfection had no impact in these studies. Cleaning with certain defined formulations in combination with steam sterilization can be an effective prion decontamination process, in particular with alkaline formulations. Low-temperature, gaseous hydrogen peroxide sterilization was also confirmed to reduce infectivity in the presence and absence of cleaning. Prion decontamination is affected by the full reprocessing cycle used on contaminated surfaces. The correct use of defined cleaning, disinfection and sterilization methods as tested in this report in the scrapie infectivity assay can provide a standard precaution against prion contamination. Copyright © 2013 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  16. Adenylate kinase I does not affect cellular growth characteristics under normal and metabolic stress conditions.

    Science.gov (United States)

    de Bruin, Wieke; Oerlemans, Frank; Wieringa, Bé

    2004-07-01

    Adenylate kinase (AK)-catalyzed phosphotransfer is essential in the maintenance of cellular energetic economy in cells of fully differentiated tissues with highly variable energy demand, such as muscle and brain. To investigate if AK isoenzymes have a comparable function in the energy-demand management of proliferating cells, AK1 and AK1beta were expressed in mouse neuroblastoma N2a cells and in human colon carcinoma SW480 cells. Glucose deprivation, galactose feeding, and metabolic inhibitor tests revealed a differential energy dependency for these two cell lines. N2a cells showed a faster proliferation rate and strongest coupling to mitochondrial activity, SW480 proliferation was more dependent on glycolysis. Despite these differences, ectopic expression of AK1 or AK1beta did not affect their growth characteristics under normal conditions. Also, no differential effects were seen under metabolic stress upon treatment with mitochondrial and glycolytic inhibitors in in vitro culture or in solid tumors grown in vivo. Although many intimate connections have been revealed between cell death and metabolism, our results suggest that AK1- or AK1beta-mediated high-energy phosphoryl transfer is not a modulating factor in the survival of tumor cells during episodes of metabolic crisis.

  17. Correlating two-photon excited fluorescence imaging of breast cancer cellular redox state with seahorse flux analysis of normalized cellular oxygen consumption

    Science.gov (United States)

    Hou, Jue; Wright, Heather J.; Chan, Nicole; Tran, Richard; Razorenova, Olga V.; Potma, Eric O.; Tromberg, Bruce J.

    2016-06-01

    Two-photon excited fluorescence (TPEF) imaging of the cellular cofactors nicotinamide adenine dinucleotide and oxidized flavin adenine dinucleotide is widely used to measure cellular metabolism, both in normal and pathological cells and tissues. When dual-wavelength excitation is used, ratiometric TPEF imaging of the intrinsic cofactor fluorescence provides a metabolic index of cells-the "optical redox ratio" (ORR). With increased interest in understanding and controlling cellular metabolism in cancer, there is a need to evaluate the performance of ORR in malignant cells. We compare TPEF metabolic imaging with seahorse flux analysis of cellular oxygen consumption in two different breast cancer cell lines (MCF-7 and MDA-MB-231). We monitor metabolic index in living cells under both normal culture conditions and, for MCF-7, in response to cell respiration inhibitors and uncouplers. We observe a significant correlation between the TPEF-derived ORR and the flux analyzer measurements (R=0.7901, p<0.001). Our results confirm that the ORR is a valid dynamic index of cell metabolism under a range of oxygen consumption conditions relevant for cancer imaging.

  18. 3D local structure around copper site of rabbit prion-related protein: Quantitative determination by XANES spectroscopy combined with multiple-scattering calculations

    International Nuclear Information System (INIS)

    Cui, P.X.; Lian, F.L.; Wang, Y.; Wen, Yi; Chu, W.S.; Zhao, H.F.; Zhang, S.; Li, J.; Lin, D.H.; Wu, Z.Y.

    2014-01-01

    Prion-related protein (PrP), a cell-surface copper-binding glycoprotein, is considered to be responsible for a number of transmissible spongiform encephalopathies (TSEs). The structural conversion of PrP from the normal cellular isoform (PrP C ) to the post-translationally modified form (PrP Sc ) is thought to be relevant to Cu 2+ binding to histidine residues. Rabbits are one of the few mammalian species that appear to be resistant to TSEs, because of the structural characteristics of the rabbit prion protein (RaPrP C ) itself. Here we determined the three-dimensional local structure around the C-terminal high-affinity copper-binding sites using X-ray absorption near-edge structure combined with ab initio calculations in the framework of the multiple-scattering (MS) theory. Result shows that two amino acid resides, Gln97 and Met108, and two histidine residues, His95 and His110, are involved in binding this copper(II) ion. It might help us understand the roles of copper in prion conformation conversions, and the molecular mechanisms of prion-involved diseases. - Highlights: ► The first structure of the metal ion binding site in RaPrP fifth copper-binding site. ► Quantitative determination by XANES spectroscopy combined with ab initio calculations. ► Provide a proof of the roles of copper in prion conformation conversions. ► Provide a proof of the molecular mechanisms of prion-involved diseases

  19. PrionHome: a database of prions and other sequences relevant to prion phenomena.

    Directory of Open Access Journals (Sweden)

    Djamel Harbi

    Full Text Available Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions, prionoids (i.e., proteins that propagate like prions between individual cells, and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant, and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments. We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic

  20. PrionHome: a database of prions and other sequences relevant to prion phenomena.

    Science.gov (United States)

    Harbi, Djamel; Parthiban, Marimuthu; Gendoo, Deena M A; Ehsani, Sepehr; Kumar, Manish; Schmitt-Ulms, Gerold; Sowdhamini, Ramanathan; Harrison, Paul M

    2012-01-01

    Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions), prionoids (i.e., proteins that propagate like prions between individual cells), and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant), and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments). We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic sequences, showing

  1. Human prion diseases: surgical lessons learned from iatrogenic prion transmission.

    Science.gov (United States)

    Bonda, David J; Manjila, Sunil; Mehndiratta, Prachi; Khan, Fahd; Miller, Benjamin R; Onwuzulike, Kaine; Puoti, Gianfranco; Cohen, Mark L; Schonberger, Lawrence B; Cali, Ignazio

    2016-07-01

    The human prion diseases, or transmissible spongiform encephalopathies, have captivated our imaginations since their discovery in the Fore linguistic group in Papua New Guinea in the 1950s. The mysterious and poorly understood "infectious protein" has become somewhat of a household name in many regions across the globe. From bovine spongiform encephalopathy (BSE), commonly identified as mad cow disease, to endocannibalism, media outlets have capitalized on these devastatingly fatal neurological conditions. Interestingly, since their discovery, there have been more than 492 incidents of iatrogenic transmission of prion diseases, largely resulting from prion-contaminated growth hormone and dura mater grafts. Although fewer than 9 cases of probable iatrogenic neurosurgical cases of Creutzfeldt-Jakob disease (CJD) have been reported worldwide, the likelihood of some missed cases and the potential for prion transmission by neurosurgery create considerable concern. Laboratory studies indicate that standard decontamination and sterilization procedures may be insufficient to completely remove infectivity from prion-contaminated instruments. In this unfortunate event, the instruments may transmit the prion disease to others. Much caution therefore should be taken in the absence of strong evidence against the presence of a prion disease in a neurosurgical patient. While the Centers for Disease Control and Prevention (CDC) and World Health Organization (WHO) have devised risk assessment and decontamination protocols for the prevention of iatrogenic transmission of the prion diseases, incidents of possible exposure to prions have unfortunately occurred in the United States. In this article, the authors outline the historical discoveries that led from kuru to the identification and isolation of the pathological prion proteins in addition to providing a brief description of human prion diseases and iatrogenic forms of CJD, a brief history of prion disease nosocomial transmission

  2. A Neuronal Culture System to Detect Prion Synaptotoxicity.

    Directory of Open Access Journals (Sweden)

    Cheng Fang

    2016-05-01

    Full Text Available Synaptic pathology is an early feature of prion as well as other neurodegenerative diseases. Although the self-templating process by which prions propagate is well established, the mechanisms by which prions cause synaptotoxicity are poorly understood, due largely to the absence of experimentally tractable cell culture models. Here, we report that exposure of cultured hippocampal neurons to PrPSc, the infectious isoform of the prion protein, results in rapid retraction of dendritic spines. This effect is entirely dependent on expression of the cellular prion protein, PrPC, by target neurons, and on the presence of a nine-amino acid, polybasic region at the N-terminus of the PrPC molecule. Both protease-resistant and protease-sensitive forms of PrPSc cause dendritic loss. This system provides new insights into the mechanisms responsible for prion neurotoxicity, and it provides a platform for characterizing different pathogenic forms of PrPSc and testing potential therapeutic agents.

  3. Yeast prions form infectious amyloid inclusion bodies in bacteria

    Directory of Open Access Journals (Sweden)

    Espargaró Alba

    2012-06-01

    Full Text Available Abstract Background Prions were first identified as infectious proteins associated with fatal brain diseases in mammals. However, fungal prions behave as epigenetic regulators that can alter a range of cellular processes. These proteins propagate as self-perpetuating amyloid aggregates being an example of structural inheritance. The best-characterized examples are the Sup35 and Ure2 yeast proteins, corresponding to [PSI+] and [URE3] phenotypes, respectively. Results Here we show that both the prion domain of Sup35 (Sup35-NM and the Ure2 protein (Ure2p form inclusion bodies (IBs displaying amyloid-like properties when expressed in bacteria. These intracellular aggregates template the conformational change and promote the aggregation of homologous, but not heterologous, soluble prionogenic molecules. Moreover, in the case of Sup35-NM, purified IBs are able to induce different [PSI+] phenotypes in yeast, indicating that at least a fraction of the protein embedded in these deposits adopts an infectious prion fold. Conclusions An important feature of prion inheritance is the existence of strains, which are phenotypic variants encoded by different conformations of the same polypeptide. We show here that the proportion of infected yeast cells displaying strong and weak [PSI+] phenotypes depends on the conditions under which the prionogenic aggregates are formed in E. coli, suggesting that bacterial systems might become useful tools to generate prion strain diversity.

  4. Prion infections and anti-PrP antibodies trigger converging neurotoxic pathways.

    Directory of Open Access Journals (Sweden)

    Uli S Herrmann

    2015-02-01

    Full Text Available Prions induce lethal neurodegeneration and consist of PrPSc, an aggregated conformer of the cellular prion protein PrPC. Antibody-derived ligands to the globular domain of PrPC (collectively termed GDL are also neurotoxic. Here we show that GDL and prion infections activate the same pathways. Firstly, both GDL and prion infection of cerebellar organotypic cultured slices (COCS induced the production of reactive oxygen species (ROS. Accordingly, ROS scavenging, which counteracts GDL toxicity in vitro and in vivo, prolonged the lifespan of prion-infected mice and protected prion-infected COCS from neurodegeneration. Instead, neither glutamate receptor antagonists nor inhibitors of endoplasmic reticulum calcium channels abolished neurotoxicity in either model. Secondly, antibodies against the flexible tail (FT of PrPC reduced neurotoxicity in both GDL-exposed and prion-infected COCS, suggesting that the FT executes toxicity in both paradigms. Thirdly, the PERK pathway of the unfolded protein response was activated in both models. Finally, 80% of transcriptionally downregulated genes overlapped between prion-infected and GDL-treated COCS. We conclude that GDL mimic the interaction of PrPSc with PrPC, thereby triggering the downstream events characteristic of prion infection.

  5. Role of cellular oxalate in oxalate clearance of patients with calcium oxalate monohydrate stone formation and normal controls.

    Science.gov (United States)

    Oehlschläger, Sven; Fuessel, Susanne; Meye, Axel; Herrmann, Jana; Froehner, Michael; Albrecht, Steffen; Wirth, Manfred P

    2009-03-01

    To examine the cellular, plasma, and urinary oxalate and erythrocyte oxalate flux in patients with calcium oxalate monohydrate (COM) stone formation vs normal controls. Pathologic oxalate clearance in humans is mostly integrated in calcium oxalate stone formation. An underlying cause of deficient oxalate clearance could be defective transmembrane oxalate transport, which, in many tissues, is regulated by an anion exchanger (SLC26). We studied 2 groups: 40 normal controls and 41 patients with COM stone formation. Red blood cells were divided for cellular oxalate measurement and for resuspension in a buffered solution (pH 7.40); 0.1 mmol/L oxalate was added. The supernatant was measured for oxalate immediately and 1 hour after incubation. The plasma and urinary oxalate were analyzed in parallel. The mean cellular oxalate concentrations were significantly greater in the normal controls (5.25 +/- 0.47 micromol/L) than in those with COM stone formation (2.36 +/- 0.28 micromol/L; P stone formation (0.31 +/- 0.02 mmol/L) than in the controls (0.24 +/- 0.02 mmol/L; P r = 0.49-0.63; P r = -0.29-0.41; P r = -0.30; P r = 0.25; P stone formation. Our data implicate the presence of a cellular oxalate buffer to stabilize plasma and urinary oxalate concentrations in normal controls.

  6. Disease Transmission by Misfolded Prion-Protein Isoforms, Prion-Like Amyloids, Functional Amyloids and the Central Dogma.

    Science.gov (United States)

    Daus, Martin L

    2016-01-04

    In 1982, the term "prions" (proteinaceous infectious particles) was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE) was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid) can store and transmit information similarly to DNA was initially even denoted as being "heretical" but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the "protein-only hypothesis" expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed.

  7. Prions, prion-like prionoids, and neurodegenerative disordersVacancy

    Directory of Open Access Journals (Sweden)

    Ashok Verma

    2016-01-01

    Full Text Available Prion diseases or transmissible spongiform encephalopathies are fatal neurodegenerative diseases characterized by the aggregation and deposition of the misfolded prion protein in the brain. α-synuclein (α-syn-associated multiple system atrophy has been recently shown to be caused by a bona fide α-syn prion strain. Several other misfolded native proteins such as β-amyloid, tau and TDP-43 share some aspects of prions although none of them is shown to be transmissible in nature or in experimental animals. However, these prion-like “prionoids” are causal to a variety of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis. The remarkable recent discovery of at least two new α-syn prion strains and their transmissibility in transgenic mice and in vitro cell models raises a distinct question as to whether some specific strain of other prionoids could have the capability of disease transmission in a manner similar to prions. In this overview, we briefly describe human and other mammalian prion diseases and comment on certain similarities between prion and prionoid and the possibility of prion-like transmissibility of some prionoid strains.

  8. Prognostic role of ‘prion-like propagation’ in SOD1-linked familial ALS: an alternative view

    Directory of Open Access Journals (Sweden)

    Keizo eSugaya

    2014-10-01

    Full Text Available ‘Prion-like propagation’ has recently been proposed for disease spread in Cu/Zn superoxide dismutase 1 (SOD1-linked familial amyotrophic lateral sclerosis (ALS. Pathological SOD1 conformers are presumed to propagate via cell-to-cell transmission. In this model, the risk-based kinetics of neuronal cell loss over time appears to be represented by a sigmoidal function that reflects the kinetics of intercellular transmission. Here, we describe an alternative view of prion-like propagation in SOD1-linked ALS−its relation to disease prognosis under the protective-aggregation hypothesis. Nucleation-dependent polymerization has been widely accepted as the molecular mechanism of prion propagation. If toxic species of misfolded SOD1, as soluble oligomers, are formed as on-pathway intermediates of nucleation-dependent polymerization, further fibril extension via sequential addition of monomeric mutant SOD1 would be protective against neurodegeneration. This is because the concentration of unfolded mutant SOD1 monomers, which serve as precursor of nucleation and toxic species of mutant SOD1, would decline in proportion to the extent of aggregation. The nucleation process requires that native conformers exist in an unfolded state that may result from escaping the cellular protein quality control machinery. However, prion-like propagation−SOD1 aggregated form self-propagates by imposing its altered conformation on normal SOD1−appears to antagonize the protective role of aggregate growth. The cross-seeding reaction with normal SOD1 would lead to a failure to reduce the concentration of unfolded mutant SOD1 monomers, resulting in continuous nucleation and subsequent generation of toxic species, and influence disease prognosis. In this alternative view, the kinetics of neuronal loss appears to be represented by an exponential function, with decreasing risk reflecting the protective role of aggregate and the potential for cross-seeding reactions between

  9. Incunabular Immunological Events in Prion Trafficking

    Science.gov (United States)

    Michel, Brady; Meyerett-Reid, Crystal; Johnson, Theodore; Ferguson, Adam; Wyckoff, Christy; Pulford, Bruce; Bender, Heather; Avery, Anne; Telling, Glenn; Dow, Steven; Zabel, Mark D.

    2012-01-01

    While prions probably interact with the innate immune system immediately following infection, little is known about this initial confrontation. Here we investigated incunabular events in lymphotropic and intranodal prion trafficking by following highly enriched, fluorescent prions from infection sites to draining lymph nodes. We detected biphasic lymphotropic transport of prions from the initial entry site upon peripheral prion inoculation. Prions arrived in draining lymph nodes cell autonomously within two hours of intraperitoneal administration. Monocytes and dendritic cells (DCs) required Complement for optimal prion delivery to lymph nodes hours later in a second wave of prion trafficking. B cells constituted the majority of prion-bearing cells in the mediastinal lymph node by six hours, indicating intranodal prion reception from resident DCs or subcapsulary sinus macrophages or directly from follicular conduits. These data reveal novel, cell autonomous prion lymphotropism, and a prominent role for B cells in intranodal prion movement. PMID:22679554

  10. 3D local structure around copper site of rabbit prion-related protein: Quantitative determination by XANES spectroscopy combined with multiple-scattering calculations

    Science.gov (United States)

    Cui, P. X.; Lian, F. L.; Wang, Y.; Wen, Yi; Chu, W. S.; Zhao, H. F.; Zhang, S.; Li, J.; Lin, D. H.; Wu, Z. Y.

    2014-02-01

    Prion-related protein (PrP), a cell-surface copper-binding glycoprotein, is considered to be responsible for a number of transmissible spongiform encephalopathies (TSEs). The structural conversion of PrP from the normal cellular isoform (PrPC) to the post-translationally modified form (PrPSc) is thought to be relevant to Cu2+ binding to histidine residues. Rabbits are one of the few mammalian species that appear to be resistant to TSEs, because of the structural characteristics of the rabbit prion protein (RaPrPC) itself. Here we determined the three-dimensional local structure around the C-terminal high-affinity copper-binding sites using X-ray absorption near-edge structure combined with ab initio calculations in the framework of the multiple-scattering (MS) theory. Result shows that two amino acid resides, Gln97 and Met108, and two histidine residues, His95 and His110, are involved in binding this copper(II) ion. It might help us understand the roles of copper in prion conformation conversions, and the molecular mechanisms of prion-involved diseases.

  11. Muscle biopsies off-set normal cellular signaling in surrounding musculature

    DEFF Research Database (Denmark)

    Krag, Thomas O; Hauerslev, Simon; Dahlqvist, Julia R

    2013-01-01

    muscle tissue for at least 3 weeks after the biopsy was performed and magnetic resonance imaging suggests that an effect of a biopsy may persist for at least 5 months. Cellular signaling after a biopsy resembles what is seen in severe limb-girdle muscular dystrophy type 2I with respect to protein......Studies of muscle physiology and muscular disorders often require muscle biopsies to answer questions about muscle biology. In this context, we have often wondered if muscle biopsies, especially if performed repeatedly, would affect interpretation of muscle morphology and cellular signaling. We...... hypothesized that muscle morphology and cellular signaling involved in myogenesis/regeneration and protein turnover can be changed by a previous muscle biopsy in close proximity to the area under investigation. Here we report a case where a past biopsy or biopsies affect cellular signaling of the surrounding...

  12. Normal cellular radiosensitivity in an adult Fanconi anaemia patient with marked clinical radiosensitivity

    International Nuclear Information System (INIS)

    Marcou, Yiola; D'Andrea, Andrew; Jeggo, Penelope A.; Plowman, Piers N.

    2001-01-01

    Background: Fanconi anaemia is a rare disease associated with cellular sensitivity to chemicals (e.g. mitomycin C and diepoxybutane); variable but mild cellular radiosensitivity has also been reported. Materials and methods: A 32-year-old patient with Fanconi anaemia and tonsillar carcinoma, treated by radiotherapy, was found to exhibit profound clinical radiosensitivity. Confluent, ulcerating oropharyngeal mucositis developed after a conventionally fractionated dose of 34 Gy and healing was incomplete by 2 months after cessation of therapy. Results: Cellular radiosensitivity assays and RPLD studies from this patient did not suggest any major detectable radiosensitivity. Conclusion: There is a discrepancy between the observed clinical radiosensitivity and the usual 'predictive' radiosensitivity assays in this patient with Fanconi anaemia

  13. Acrolein-exposed normal human lung fibroblasts in vitro: cellular senescence, enhanced telomere erosion, and degradation of Werner's syndrome protein.

    Science.gov (United States)

    Jang, Jun-Ho; Bruse, Shannon; Huneidi, Salam; Schrader, Ronald M; Monick, Martha M; Lin, Yong; Carter, A Brent; Klingelhutz, Aloysius J; Nyunoya, Toru

    2014-09-01

    Acrolein is a ubiquitous environmental hazard to human health. Acrolein has been reported to activate the DNA damage response and induce apoptosis. However, little is known about the effects of acrolein on cellular senescence. We examined whether acrolein induces cellular senescence in cultured normal human lung fibroblasts (NHLF). We cultured NHLF in the presence or absence of acrolein and determined the effects of acrolein on cell proliferative capacity, senescence-associated β-galactosidase activity, the known senescence-inducing pathways (e.g., p53, p21), and telomere length. We found that acrolein induced cellular senescence by increasing both p53 and p21. The knockdown of p53 mediated by small interfering RNA (siRNA) attenuated acrolein-induced cellular senescence. Acrolein decreased Werner's syndrome protein (WRN), a member of the RecQ helicase family involved in DNA repair and telomere maintenance. Acrolein-induced down-regulation of WRN protein was rescued by p53 knockdown or proteasome inhibition. Finally, we found that acrolein accelerated p53-mediated telomere shortening. These results suggest that acrolein induces p53-mediated cellular senescence accompanied by enhanced telomere attrition and WRN protein down-regulation.

  14. Genes contributing to prion pathogenesis

    DEFF Research Database (Denmark)

    Tamgüney, Gültekin; Giles, Kurt; Glidden, David V

    2008-01-01

    incubation times, indicating that the conversion reaction may be influenced by other gene products. To identify genes that contribute to prion pathogenesis, we analysed incubation times of prions in mice in which the gene product was inactivated, knocked out or overexpressed. We tested 20 candidate genes...... show that many genes previously implicated in prion replication have no discernible effect on the pathogenesis of prion disease. While most genes tested did not significantly affect survival times, ablation of the amyloid beta (A4) precursor protein (App) or interleukin-1 receptor, type I (Il1r1...

  15. Adenylate kinase I does not affect cellular growth characteristics under normal and metabolic stress conditions.

    NARCIS (Netherlands)

    Bruin, W.C.C. de; Oerlemans, F.T.J.J.; Wieringa, B.

    2004-01-01

    Adenylate kinase (AK)-catalyzed phosphotransfer is essential in the maintenance of cellular energetic economy in cells of fully differentiated tissues with highly variable energy demand, such as muscle and brain. To investigate if AK isoenzymes have a comparable function in the energy-demand

  16. Involvement of Endogenous Retroviruses in Prion Diseases

    Directory of Open Access Journals (Sweden)

    Yong-Sun Kim

    2013-08-01

    Full Text Available For millions of years, vertebrates have been continuously exposed to infection by retroviruses. Ancient retroviral infection of germline cells resulted in the formation and accumulation of inherited retrovirus sequences in host genomes. These inherited retroviruses are referred to as endogenous retroviruses (ERVs, and recent estimates have revealed that a significant portion of animal genomes is made up of ERVs. Although various host factors have suppressed ERV activation, both positive and negative functions have been reported for some ERVs in normal and abnormal physiological conditions, such as in disease states. Similar to other complex diseases, ERV activation has been observed in prion diseases, and this review will discuss the potential involvement of ERVs in prion diseases.

  17. Prion Fragment Peptides Are Digested with Membrane Type Matrix Metalloproteinases and Acquire Enzyme Resistance through Cu2+-Binding

    Directory of Open Access Journals (Sweden)

    Aya Kojima

    2014-05-01

    Full Text Available Prions are the cause of neurodegenerative disease in humans and other mammals. The structural conversion of the prion protein (PrP from a normal cellular protein (PrPC to a protease-resistant isoform (PrPSc is thought to relate to Cu2+ binding to histidine residues. In this study, we focused on the membrane-type matrix metalloproteinases (MT-MMPs such as MT1-MMP and MT3-MMP, which are expressed in the brain as PrPC-degrading proteases. We synthesized 21 prion fragment peptides. Each purified peptide was individually incubated with recombinant MT1-MMP or MT3-MMP in the presence or absence of Cu2+ and the cleavage sites determined by LC-ESI-MS analysis. Recombinant MMP-7 and human serum (HS were also tested as control. hPrP61-90, from the octapeptide-repeat region, was cleaved by HS but not by the MMPs tested here. On the other hand, hPrP92-168 from the central region was cleaved by MT1-MMP and MT3-MMP at various sites. These cleavages were inhibited by treatment with Cu2+. The C-terminal peptides had higher resistance than the central region. The data obtained from this study suggest that MT-MMPs expressed in the brain might possess PrPC-degrading activity.

  18. Mutation directional selection sheds light on prion pathogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Shen, Liang [Shandong Provincial Research Center for Bioinformatic Engineering and Technique, Shandong University of Technology, Zibo 255049 (China); Ji, Hong-Fang, E-mail: jhf@sdut.edu.cn [Shandong Provincial Research Center for Bioinformatic Engineering and Technique, Shandong University of Technology, Zibo 255049 (China)

    2011-07-01

    Highlights: {yields} Most pathogenic mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. {yields} Mutation-induced changes may strengthen the interactions between PrP and facilitating factors. {yields} The findings also have significant implications for exploring potential regions involved in the conformational transition from PrP{sup C} to PrP{sup Sc}. -- Abstract: As mutations in the PRNP gene account for human hereditary prion diseases (PrDs), it is crucial to elucidating how these mutations affect the central pathogenic conformational transition of normal cellular prion protein (PrP{sup C}) to abnormal scrapie isoform (PrP{sup Sc}). Many studies proposed that these pathogenic mutations may make PrP more susceptible to conformational change through altering its structure stability. By evaluating the most recent observations regarding pathogenic mutations, it was found that the pathogenic mutations do not exert a uniform effect on the thermodynamic stability of the human PrP's structure. Through analyzing the reported PrDs-related mutations, we found that 25 out of 27 mutations possess strong directional selection, i.e., enhancing hydrophobicity or decreasing negative and increasing positive charge. Based on the triggering role reported by previous studies of facilitating factors in PrP{sup C} conversion, e.g., lipid and polyanion, we proposed that the mutation-induced changes may strengthen the interaction between PrP and facilitating factors, which will accelerate PrP conversion and cause PrDs.

  19. Encephalopathy for prions

    International Nuclear Information System (INIS)

    Colegial, Carlos; Silva, Federico; Perez, Carlos

    1999-01-01

    The encephalopathy spongyform for prions are neuro degenerative illness that can be sporadic or transferable, for infectious or hereditary mechanisms. Their investigation has outlined enormous challenges and in the historical journey in search of its cause two doctors have received the Nobel prize of medicine Carleton Gajdusek, for its works in New Guinea where it described the infectious transmission for cannibalistic rites that it took to studies of experimental transmission in chimpanzees and to its theory of the slow virus; later on, Stanley Prusiner developed its experimental works in hamsters, throwing to the neurobiology the prion concept (particles infectious proteinaceous not viral). The paper narrates the history of a patient that died in the San Juan de Dios of Bogota Hospital by cause of this prionic illness and clinical and pathological aspects are discussed

  20. Differentially expressed genes in iron-induced prion protein conversion

    International Nuclear Information System (INIS)

    Kim, Minsun; Kim, Eun-hee; Choi, Bo-Ran; Woo, Hee-Jong

    2016-01-01

    The conversion of the cellular prion protein (PrP C ) to the protease-resistant isoform is the key event in chronic neurodegenerative diseases, including transmissible spongiform encephalopathies (TSEs). Increased iron in prion-related disease has been observed due to the prion protein-ferritin complex. Additionally, the accumulation and conversion of recombinant PrP (rPrP) is specifically derived from Fe(III) but not Fe(II). Fe(III)-mediated PK-resistant PrP (PrP res ) conversion occurs within a complex cellular environment rather than via direct contact between rPrP and Fe(III). In this study, differentially expressed genes correlated with prion degeneration by Fe(III) were identified using Affymetrix microarrays. Following Fe(III) treatment, 97 genes were differentially expressed, including 85 upregulated genes and 12 downregulated genes (≥1.5-fold change in expression). However, Fe(II) treatment produced moderate alterations in gene expression without inducing dramatic alterations in gene expression profiles. Moreover, functional grouping of identified genes indicated that the differentially regulated genes were highly associated with cell growth, cell maintenance, and intra- and extracellular transport. These findings showed that Fe(III) may influence the expression of genes involved in PrP folding by redox mechanisms. The identification of genes with altered expression patterns in neural cells may provide insights into PrP conversion mechanisms during the development and progression of prion-related diseases. - Highlights: • Differential genes correlated with prion degeneration by Fe(III) were identified. • Genes were identified in cell proliferation and intra- and extracellular transport. • In PrP degeneration, redox related genes were suggested. • Cbr2, Rsad2, Slc40a1, Amph and Mvd were expressed significantly.

  1. Modulation of prion polymerization and toxicity by rationally designed peptidomimetics.

    Science.gov (United States)

    Srivastava, Ankit; Sharma, Sakshi; Sadanandan, Sandhya; Gupta, Sakshi; Singh, Jasdeep; Gupta, Sarika; Haridas, V; Kundu, Bishwajit

    2017-01-01

    Misfolding and aggregation of cellular prion protein is associated with a large array of neurological disorders commonly called the transmissible spongiform encephalopathies. Designing inhibitors against prions has remained a daunting task owing to limited information about mechanism(s) of their pathogenic self-assembly. Here, we explore the anti-prion properties of a combinatorial library of bispidine-based peptidomimetics (BPMs) that conjugate amino acids with hydrophobic and aromatic side chains. Keeping the bispidine unit unaltered, a series of structurally diverse BPMs were synthesized and tested for their prion-modulating properties. Administration of Leu- and Trp-BPMs delayed and completely inhibited the amyloidogenic conversion of human prion protein (HuPrP), respectively. We found that each BPM induced the HuPrP to form unique oligomeric nanostructures differing in their biophysical properties, cellular toxicities and response to conformation-specific antibodies. While Leu-BPMs were found to stabilize the oligomers, Trp-BPMs effected transient oligomerization, resulting in the formation of non-toxic, non-fibrillar aggregates. Yet another aromatic residue, Phe, however, accelerated the aggregation process in HuPrP. Molecular insights obtained through MD (molecular dynamics) simulations suggested that each BPM differently engages a conserved Tyr 169 residue at the α2-β2 loop of HuPrP and affects the stability of α2 and α3 helices. Our results demonstrate that this new class of molecules having chemical scaffolds conjugating hydrophobic/aromatic residues could effectively modulate prion aggregation and toxicity. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  2. High prevalence of a fungal prion

    NARCIS (Netherlands)

    Debets, A.J.M.; Dalstra, H.J.P.; Slakhorst, S.M.; Koopmanschap-Memelink, A.B.; Hoekstra, R.F.; Saupe, S.J.

    2012-01-01

    Prions are infectious proteins that cause fatal diseases in mammals. Prions have also been found in fungi, but studies on their role in nature are scarce. The proposed biological function of fungal prions is debated and varies from detrimental to benign or even beneficial. [Het-s] is a prion of the

  3. Disease Transmission by Misfolded Prion-Protein Isoforms, Prion-Like Amyloids, Functional Amyloids and the Central Dogma

    Directory of Open Access Journals (Sweden)

    Martin L. Daus

    2016-01-01

    Full Text Available In 1982, the term “prions” (proteinaceous infectious particles was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid can store and transmit information similarly to DNA was initially even denoted as being “heretical” but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the “protein-only hypothesis” expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed.

  4. Brain immune interactions and air pollution: macrophage inhibitory factor (MIF), prion cellular protein (PrP(C)), Interleukin-6 (IL-6), interleukin 1 receptor antagonist (IL-1Ra), and interleukin-2 (IL-2) in cerebrospinal fluid and MIF in serum differentiate urban children exposed to severe vs. low air pollution.

    Science.gov (United States)

    Calderón-Garcidueñas, Lilian; Cross, Janet V; Franco-Lira, Maricela; Aragón-Flores, Mariana; Kavanaugh, Michael; Torres-Jardón, Ricardo; Chao, Chih-Kai; Thompson, Charles; Chang, Jing; Zhu, Hongtu; D'Angiulli, Amedeo

    2013-01-01

    Mexico City Metropolitan Area children chronically exposed to high concentrations of air pollutants exhibit an early brain imbalance in genes involved in oxidative stress, inflammation, innate and adaptive immune responses along with accumulation of misfolded proteins observed in the early stages of Alzheimer and Parkinson's diseases. A complex modulation of serum cytokines and chemokines influences children's brain structural and gray/white matter volumetric responses to air pollution. The search for biomarkers associating systemic and CNS inflammation to brain growth and cognitive deficits in the short term and neurodegeneration in the long-term is our principal aim. We explored and compared a profile of cytokines, chemokines (Multiplexing LASER Bead Technology) and Cellular prion protein (PrP(C)) in normal cerebro-spinal-fluid (CSF) of urban children with high vs. low air pollution exposures. PrP(C) and macrophage inhibitory factor (MIF) were also measured in serum. Samples from 139 children ages 11.91 ± 4.2 years were measured. Highly exposed children exhibited significant increases in CSF MIF (p = 0.002), IL6 (p = 0.006), IL1ra (p = 0.014), IL-2 (p = 0.04), and PrP(C) (p = 0.039) vs. controls. MIF serum concentrations were higher in exposed children (p = 0.009). Our results suggest CSF as a MIF, IL6, IL1Ra, IL-2, and PrP(C) compartment that can possibly differentiate air pollution exposures in children. MIF, a key neuro-immune mediator, is a potential biomarker bridge to identify children with CNS inflammation. Fine tuning of immune-to-brain communication is crucial to neural networks appropriate functioning, thus the short and long term effects of systemic inflammation and dysregulated neural immune responses are of deep concern for millions of exposed children. Defining the linkage and the health consequences of the brain / immune system interactions in the developing brain chronically exposed to air pollutants ought to be of pressing importance for public

  5. The N-terminal, polybasic region is critical for prion protein neuroprotective activity.

    Directory of Open Access Journals (Sweden)

    Jessie A Turnbaugh

    Full Text Available Several lines of evidence suggest that the normal form of the prion protein, PrP(C, exerts a neuroprotective activity against cellular stress or toxicity. One of the clearest examples of such activity is the ability of wild-type PrP(C to suppress the spontaneous neurodegenerative phenotype of transgenic mice expressing a deleted form of PrP (Δ32-134, called F35. To define domains of PrP involved in its neuroprotective activity, we have analyzed the ability of several deletion mutants of PrP (Δ23-31, Δ23-111, and Δ23-134 to rescue the phenotype of Tg(F35 mice. Surprisingly, all of these mutants displayed greatly diminished rescue activity, although Δ23-31 PrP partially suppressed neuronal loss when expressed at very high levels. Our results pinpoint the N-terminal, polybasic domain as a critical determinant of PrP(C neuroprotective activity, and suggest that identification of molecules interacting with this region will provide important clues regarding the normal function of the protein. Small molecule ligands targeting this region may also represent useful therapeutic agents for treatment of prion diseases.

  6. Prion protein and scrapie susceptibility

    NARCIS (Netherlands)

    Smits, M.A.; Bossers, A.; Schreuder, B.E.C.

    1997-01-01

    This article presents briefly current views on the role of prion protein (PrP) in Transmissible Spongiform Encephalopathies or prion diseases and the effect of PrP polymoryhisms on the susceptibility to these diseases, with special emphasis on sheep scrapie. The PrP genotype of sheep apears to be a

  7. The many shades of prion strain adaptation.

    Science.gov (United States)

    Baskakov, Ilia V

    2014-01-01

    In several recent studies transmissible prion disease was induced in animals by inoculation with recombinant prion protein amyloid fibrils produced in vitro. Serial transmission of amyloid fibrils gave rise to a new class of prion strains of synthetic origin. Gradual transformation of disease phenotypes and PrP(Sc) properties was observed during serial transmission of synthetic prions, a process that resembled the phenomenon of prion strain adaptation. The current article discusses the remarkable parallels between phenomena of prion strain adaptation that accompanies cross-species transmission and the evolution of synthetic prions occurring within the same host. Two alternative mechanisms underlying prion strain adaptation and synthetic strain evolution are discussed. The current article highlights the complexity of the prion transmission barrier and strain adaptation and proposes that the phenomenon of prion adaptation is more common than previously thought.

  8. Relationship between magnetism and prion protein

    Directory of Open Access Journals (Sweden)

    F. Balzano

    2010-01-01

    Full Text Available The mechanism of conversion of the normal prion protein (PrPC into aggregates of its pathological conformer (PrPSc reamins unclear. The aim of this study was to evaluate the effects induced by exposure of biological samples containing PrPSC to a magnetic field induced prominent molecular changes of samples indicated by the IR spectra located in the region that contains contribution primarily from absorption of amides. This finding suggests the existence of a strong correlation between magnetism and PrPsc and supports a new hypothesis that explains the conversion of normal PrPc to abnormal isoform PrPsc.

  9. Bone marrow cellularity in normal and polycythemic mice estimated by DNA incorporation of /sup 3/H-TdR

    Energy Technology Data Exchange (ETDEWEB)

    Blackwell, L.H.; Ledney, G.D.

    1982-07-01

    Nucleated bone marrow cell numbers in normal and polycythemic mice were determined using /sup 3/H-thymidine (/sup 3/H-TdR). The cellularities were estimated by extrapolating the exponential disappearance of labeled cells after a single injection of /sup 3/H-TdR to the time of injection. Dermestid beetles (Anthrenus piceus) were used to prepare tissue-free skeletons labeled with /sup 3/H-TdR. The correlation between tritium activity in bone marrow DNA and tritium derived from the combusted skeleton was determined. The total skeletal cellularity determined by isotope dilution analysis in both normal and polycythemic mice was 2.6 x 10(8) cells/mouse or 17.6 x 10(9) cells/kg body weight. Although the red cell component of the marrow was reduced in the polycythemic mouse, the total numbers of nucleated cells in both types of animals were similar. The differential distribution of cells in the polycythemic animal showed a twofold increase in granulocytic cells, which may explain the identical nucleated cell count in normal and in polycythemic mice.

  10. Prion disease. The characteristics and diagnostic points in Japan

    International Nuclear Information System (INIS)

    Sanjo, Nobuo; Mizusawa, Hidehiro

    2010-01-01

    Prion disease develops when normal prion proteins change into transmissible abnormal prion proteins and the converted proteins accumulate in the brain. The Japanese Creutzfeldt-Jakob Disease (CJD) Surveillance Committee has identified 1,320 patients with prion diseases in the 10 years since 1999 (classified into 3 types: sporadic, 77.2%; hereditary, 16.7%; and environmentally acquired, 6.1%). Compared with patients in other countries, a relatively larger number of Japanese patients characteristically have dura mater graft-associated CJD and hereditary prion diseases. All the environmentally acquired cases, except 1 case of variant CJD, were acquired from dura grafts. Although most patients were diagnosed with a classical subtype of sporadic CJD (sCJD), whose features include rapidly progressing dementia, myoclonus, hyperintensity in the cerebral cortex and basal ganglia in diffusion-weighted magnetic resonance imaging, and periodic synchronous discharge in electroencephalography, the number of cases with atypical symptoms, such as MM2 (0.8%), MV2 (0.2%), VV1 (0%), and VV2 (0.2%) subtypes of sCJD cases, was not negligible. Appropriate diagnosis should be made based on clinical features, neuroradiological findings, cerebrospinal fluid (CSF) findings (14-3-3 and total tau proteins), and genetic analysis of polymorphisms. Hereditary prion diseases are classified into 3 major phenotypes: familial CJD (fCJD); Gerstmann-Straeussler-Scheinker disease (GSS), which mainly presents as spinocerebellar ataxia; and fatal familial insomnia. Many mutations of the prion protein gene have been identified, but V1801 (fCJD), P102L (GSS), and E200K (fCJD) mutations were the most common among the fCJD cases in Japan. Without a family history, genetic testing is necessary to distinguish even seemingly ''sporadic'' CJD from fCJD. Accurate diagnosis is important for clarification of the pathological process, prevention of secondary infection, and also psychological support. (author)

  11. EXPRESSION OF CELLULAR ADHESION MOLECULES IN LANGERHANS CELL HISTIOCYTOSIS AND NORMAL LANGERHANS CELLS

    NARCIS (Netherlands)

    DEGRAAF, JH; TAMMINGA, RYJ; KAMPS, WA; TIMENS, W

    1995-01-01

    Langerhans cell histiocytosis (LCH) is characterized by lesions with an accumulation and/or proliferation of Langerhans cells (LCs). Little is known of the etiology and pathogenesis of LCH. Although the relation between the LCH cell and normal LCs is currently uncertain, the localizations of the LCH

  12. Infrared microspectroscopy: a multiple-screening platform for investigating single-cell biochemical perturbations upon prion infection.

    Science.gov (United States)

    Didonna, Alessandro; Vaccari, Lisa; Bek, Alpan; Legname, Giuseppe

    2011-03-16

    Prion diseases are a group of fatal neurodegenerative disorders characterized by the accumulation of prions in the central nervous system. The pathogenic prion (PrP(Sc)) possesses the capability to convert the host-encoded cellular isoform of the prion protein, PrP(C), into nascent PrP(Sc). The present work aims at providing novel insight into cellular response upon prion infection evidenced by synchrotron radiation infrared microspectroscopy (SR-IRMS). This non-invasive, label-free analytical technique was employed to investigate the biochemical perturbations undergone by prion infected mouse hypothalamic GT1-1 cells at the cellular and subcellular level. A decrement in total cellular protein content upon prion infection was identified by infrared (IR) whole-cell spectra and validated by bicinchoninic acid assay and single-cell volume analysis by atomic force microscopy (AFM). Hierarchical cluster analysis (HCA) of IR data discriminated between infected and uninfected cells and allowed to deduce an increment of lysosomal bodies within the cytoplasm of infected GT1-1 cells, a hypothesis further confirmed by SR-IRMS at subcellular spatial resolution and fluorescent microscopy. The purpose of this work, therefore, consists of proposing IRMS as a powerful multiscreening platform, drawing on the synergy with conventional biological assays and microscopy techniques in order to increase the accuracy of investigations performed at the single-cell level.

  13. Infrared Microspectroscopy: A Multiple-Screening Platform for Investigating Single-Cell Biochemical Perturbations upon Prion Infection

    Science.gov (United States)

    2011-01-01

    Prion diseases are a group of fatal neurodegenerative disorders characterized by the accumulation of prions in the central nervous system. The pathogenic prion (PrPSc) possesses the capability to convert the host-encoded cellular isoform of the prion protein, PrPC, into nascent PrPSc. The present work aims at providing novel insight into cellular response upon prion infection evidenced by synchrotron radiation infrared microspectroscopy (SR-IRMS). This non-invasive, label-free analytical technique was employed to investigate the biochemical perturbations undergone by prion infected mouse hypothalamic GT1-1 cells at the cellular and subcellular level. A decrement in total cellular protein content upon prion infection was identified by infrared (IR) whole-cell spectra and validated by bicinchoninic acid assay and single-cell volume analysis by atomic force microscopy (AFM). Hierarchical cluster analysis (HCA) of IR data discriminated between infected and uninfected cells and allowed to deduce an increment of lysosomal bodies within the cytoplasm of infected GT1-1 cells, a hypothesis further confirmed by SR-IRMS at subcellular spatial resolution and fluorescent microscopy. The purpose of this work, therefore, consists of proposing IRMS as a powerful multiscreening platform, drawing on the synergy with conventional biological assays and microscopy techniques in order to increase the accuracy of investigations performed at the single-cell level. PMID:22778865

  14. Prying into the Prion Hypothesis for Parkinson's Disease.

    Science.gov (United States)

    Brundin, Patrik; Melki, Ronald

    2017-10-11

    In Parkinson's disease, intracellular α-synuclein inclusions form in neurons. We suggest that prion-like behavior of α-synuclein is a key component in Parkinson's disease pathogenesis. Although multiple molecular changes are involved in the triggering of the disease process, we propose that neuron-to-neuron transfer is a crucial event that is essential for Lewy pathology to spread from one brain region to another. In this review, we describe key findings in human postmortem brains, cultured cells, and animal models of disease that support the idea that α-synuclein can act as a prion. We consider potential triggers of the α-synuclein misfolding and why the aggregates escape cellular degradation under disease conditions. We also discuss whether different strains of α-synuclein fibrils can underlie differences in cellular and regional distribution of aggregates in different synucleinopathies. Our conclusion is that α-synuclein probably acts as a prion in human diseases, and a deeper understanding of this step in the pathogenesis of Parkinson's disease can facilitate the development of disease-modifying therapies in the future. Dual Perspectives Companion Paper: Parkinson's Disease Is Not Simply a Prion Disorder, by D. James Surmeier, José A. Obeso, and Glenda M. Halliday. Copyright © 2017 the authors 0270-6474/17/379808-11$15.00/0.

  15. The measurement of intrinsic cellular radiosensitivity in human tumours and normal tissues

    International Nuclear Information System (INIS)

    Lawton, P.A.

    1995-01-01

    Human tumour and normal cell radiosensitivity are thought to be important factors determining the response of tumour and normal tissues to radiotherapy, respectively. Clonogenic assays are the standard method for measuring radiosensitivity but they are of limited applicability for clinical use with fresh human tumours. The main aim of this work was to evaluate the Adhesive Tumour Cell Culture System (ATCCS), as a method for measuring the radiosensitivity of human tumours. A soft agar clonogenic assay, the modified Courtenay-Mills assay, was used as a standard to compare with the ATCCS. The demonstration that fibroblast contamination could occur with both assay methods led to the investigation of a new technique for removing unwanted fibroblasts from tumour cell suspensions and to the use of a multiwell assay for measuring fibroblast radiosensitivity. (author)

  16. The measurement of intrinsic cellular radiosensitivity in human tumours and normal tissues

    Energy Technology Data Exchange (ETDEWEB)

    Lawton, P.A.

    1995-12-31

    Human tumour and normal cell radiosensitivity are thought to be important factors determining the response of tumour and normal tissues to radiotherapy, respectively. Clonogenic assays are the standard method for measuring radiosensitivity but they are of limited applicability for clinical use with fresh human tumours. The main aim of this work was to evaluate the Adhesive Tumour Cell Culture System (ATCCS), as a method for measuring the radiosensitivity of human tumours. A soft agar clonogenic assay, the modified Courtenay-Mills assay, was used as a standard to compare with the ATCCS. The demonstration that fibroblast contamination could occur with both assay methods led to the investigation of a new technique for removing unwanted fibroblasts from tumour cell suspensions and to the use of a multiwell assay for measuring fibroblast radiosensitivity. (author).

  17. Prion protein induced signaling cascades in monocytes

    International Nuclear Information System (INIS)

    Krebs, Bjarne; Dorner-Ciossek, Cornelia; Schmalzbauer, Ruediger; Vassallo, Neville; Herms, Jochen; Kretzschmar, Hans A.

    2006-01-01

    Prion proteins play a central role in transmission and pathogenesis of transmissible spongiform encephalopathies. The cellular prion protein (PrP C ), whose physiological function remains elusive, is anchored to the surface of a variety of cell types including neurons and cells of the lymphoreticular system. In this study, we investigated the response of a mouse monocyte/macrophage cell line to exposure with PrP C fusion proteins synthesized with a human Fc-tag. PrP C fusion proteins showed an attachment to the surface of monocyte/macrophages in nanomolar concentrations. This was accompanied by an increase of cellular tyrosine phosphorylation as a result of activated signaling pathways. Detailed investigations exhibited activation of downstream pathways through a stimulation with PrP fusion proteins, which include phosphorylation of ERK 1,2 and Akt kinase. Macrophages opsonize and present antigenic structures, contact lymphocytes, and deliver cytokines. The findings reported here may become the basis of understanding the molecular function of PrP C in monocytes and macrophages

  18. Yeast prion architecture explains how proteins can be genes

    Science.gov (United States)

    Wickner, Reed

    2013-03-01

    Prions (infectious proteins) transmit information without an accompanying DNA or RNA. Most yeast prions are self-propagating amyloids that inactivate a normally functional protein. A single protein can become any of several prion variants, with different manifestations due to different amyloid structures. We showed that the yeast prion amyloids of Ure2p, Sup35p and Rnq1p are folded in-register parallel beta sheets using solid state NMR dipolar recoupling experiments, mass-per-filament-length measurements, and filament diameter measurements. The extent of beta sheet structure, measured by chemical shifts in solid-state NMR and acquired protease-resistance on amyloid formation, combined with the measured filament diameters, imply that the beta sheets must be folded along the long axis of the filament. We speculate that prion variants of a single protein sequence differ in the location of these folds. Favorable interactions between identical side chains must hold these structures in-register. The same interactions must guide an unstructured monomer joining the end of a filament to assume the same conformation as molecules already in the filament, with the turns at the same locations. In this way, a protein can template its own conformation, in analogy to the ability of a DNA molecule to template its sequence by specific base-pairing. Bldg. 8, Room 225, NIH, 8 Center Drive MSC 0830, Bethesda, MD 20892-0830, wickner@helix.nih.gov, 301-496-3452

  19. Statistical Mechanics of Prion Diseases

    International Nuclear Information System (INIS)

    Slepoy, A.; Singh, R. R. P.; Pazmandi, F.; Kulkarni, R. V.; Cox, D. L.

    2001-01-01

    We present a two-dimensional, lattice based, protein-level statistical mechanical model for prion diseases (e.g., mad cow disease) with concomitant prion protein misfolding and aggregation. Our studies lead us to the hypothesis that the observed broad incubation time distribution in epidemiological data reflect fluctuation dominated growth seeded by a few nanometer scale aggregates, while much narrower incubation time distributions for innoculated lab animals arise from statistical self-averaging. We model ''species barriers'' to prion infection and assess a related treatment protocol

  20. Probing Early Misfolding Events in Prion Protein Mutants by NMR Spectroscopy

    Directory of Open Access Journals (Sweden)

    Gregor Ilc

    2013-08-01

    Full Text Available The post-translational conversion of the ubiquitously expressed cellular form of the prion protein, PrPC, into its misfolded and pathogenic isoform, known as prion or PrPSc, plays a key role in prion diseases. These maladies are denoted transmissible spongiform encephalopathies (TSEs and affect both humans and animals. A prerequisite for understanding TSEs is unraveling the molecular mechanism leading to the conversion process whereby most α-helical motifs are replaced by β-sheet secondary structures. Importantly, most point mutations linked to inherited prion diseases are clustered in the C-terminal domain region of PrPC and cause spontaneous conversion to PrPSc. Structural studies with PrP variants promise new clues regarding the proposed conversion mechanism and may help identify “hot spots” in PrPC involved in the pathogenic conversion. These investigations may also shed light on the early structural rearrangements occurring in some PrPC epitopes thought to be involved in modulating prion susceptibility. Here we present a detailed overview of our solution-state NMR studies on human prion protein carrying different pathological point mutations and the implications that such findings may have for the future of prion research.

  1. The Prion Protein Preference of Sporadic Creutzfeldt-Jakob Disease Subtypes*

    Science.gov (United States)

    Klemm, Helen M. J.; Welton, Jeremy M.; Masters, Colin L.; Klug, Genevieve M.; Boyd, Alison; Hill, Andrew F.; Collins, Steven J.; Lawson, Victoria A.

    2012-01-01

    Sporadic Creutzfeldt-Jakob disease (CJD) is the most prevalent manifestation of the transmissible spongiform encephalopathies or prion diseases affecting humans. The disease encompasses a spectrum of clinical phenotypes that have been correlated with molecular subtypes that are characterized by the molecular mass of the protease-resistant fragment of the disease-related conformation of the prion protein and a polymorphism at codon 129 of the gene encoding the prion protein. A cell-free assay of prion protein misfolding was used to investigate the ability of these sporadic CJD molecular subtypes to propagate using brain-derived sources of the cellular prion protein (PrPC). This study confirmed the presence of three distinct sporadic CJD molecular subtypes with PrPC substrate requirements that reflected their codon 129 associations in vivo. However, the ability of a sporadic CJD molecular subtype to use a specific PrPC substrate was not determined solely by codon 129 as the efficiency of prion propagation was also influenced by the composition of the brain tissue from which the PrPC substrate was sourced, thus indicating that nuances in PrPC or additional factors may determine sporadic CJD subtype. The results of this study will aid in the design of diagnostic assays that can detect prion disease across the diversity of sporadic CJD subtypes. PMID:22930754

  2. Synthetic Prions Provide Clues for Understanding Prion Diseases.

    Science.gov (United States)

    Imberdis, Thibaut; Harris, David A

    2016-04-01

    This Commentary highlights the article by Makarava et al that discusses the formation of synthetic prions and the role of substrate levels in their evolution. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  3. Advancing prion science: guidance for the National Prion Research Program

    National Research Council Canada - National Science Library

    Erdtmann, Rick; Sivitz, Laura

    2004-01-01

    In Advancing Prion Science , the Institute of Medicine’s Committee on Transmissible Spongiform Encephalopathies Assessment of Relevant Science recommends priorities for research and investment to the Department of Defenseâ...

  4. Cellular proliferation and infiltration following interstitial irradiation of normal dog brain is altered by an inhibitor of polyamine synthesis

    International Nuclear Information System (INIS)

    Fike, John R.; Gobbel, Glenn T.; Chou, Dean; Wijnhoven, Bas P. L.; Bellinzona, Mattia; Nakagawa, Minoru; Seilhan, Theresa M.

    1995-01-01

    Purpose: The objectives of this study were to quantitatively define proliferative and infiltrative cell responses after focal 125 I irradiation of normal brain, and to determine the effects of an intravenous infusion of α-difluoromethylornithine (DFMO) on those responses. Methods and Materials: Adult beagle dogs were irradiated using high activity 125 I sources. Saline (control) or DFMO (150 mg/kg/day) was infused for 18 days starting 2 days before irradiation. At varying times up to 8 weeks after irradiation, brain tissues were collected and the cell responses in and around the focal lesion were quantified. Immunohistochemical stains were used to label astrocytes (GFAP), vascular endothelial cells (Factor VIII), polymorphonuclear leukocytes (PMNs; MAC 387) and cells synthesizing deoxyribonucleic acid (DNA) (BrdU). Cellular responses were quantified using a histomorphometric analysis. Results: After radiation alone, cellular events included a substantial acute inflammatory response followed by increased BrdU labeling and progressive increases in numbers of capillaries and astrocytes. α-Difluoromethylornithine treatment significantly affected the measured cell responses. As in controls, an early inflammatory response was measured, but after 2 weeks there were more PMNs/unit area than in controls. The onset of measurable BrdU labeling was delayed in DFMO-treated animals, and the magnitude of labeling was significantly reduced. Increases in astrocyte and vessel numbers/mm 2 were observed after a 2-week delay. At the site of implant, astrocytes from DFMO-treated dogs were significantly smaller than those from controls. Conclusions: There is substantial cell proliferation and infiltration in response to interstitial irradiation of normal brain, and these responses are significantly altered by DFMO treatment. Although the precise mechanisms by which DFMO exerts its effects in this model are not known, the results from this study suggest that modification of radiation

  5. Quantitating PrP Polymorphisms Present in Prions from Heterozygous Scrapie-Infected Sheep.

    Science.gov (United States)

    Silva, Christopher J; Erickson-Beltran, Melissa L; Hui, Colleen; Badiola, Juan José; Nicholson, Eric M; Requena, Jesús R; Bolea, Rosa

    2017-01-03

    Scrapie is a prion (PrP Sc ) disease of sheep. The incubation period of sheep scrapie is strongly influenced by polymorphisms at positions 136, 154, and 171 of a sheep's normal cellular prion protein (PrP C ). Chymotrypsin was used to digest sheep recombinant PrP to identify a set of characteristic peptides [M 132 LGSXMSRPL 141 (X = A or V), Y 153 XENMY 158 (X,= H or R), and Y 166 RPVDXY 172 (X = H, K, Q, or R)] that could be used to detect and quantitate polymorphisms at positions 136, 154, and 171 of sheep PrP C or PrP Sc . These peptides were used to develop a multiple reaction monitoring method (MRM) to detect the amounts of a particular polymorphism in a sample of PrP Sc isolated from sheep heterozygous for their PrP C proteins. The limit of detection for these peptides was less than 50 attomole. Spinal cord tissue from heterozygous (ARQ/VRQ or ARH/ARQ) scrapie-infected Rasa Aragonesa sheep was analyzed using this MRM method. Both sets of heterozygotes show the presence of both polymorphisms in PrP Sc . This was true for samples containing both proteinase K (PK)-sensitive and PK-resistant PrP Sc and samples containing only the PK-resistant PrP Sc . These results show that heterozygous animals contain PrP Sc that is composed of significant amounts of both PrP polymorphisms.

  6. The Gut-Associated Lymphoid Tissues in the Small Intestine, Not the Large Intestine, Play a Major Role in Oral Prion Disease Pathogenesis

    Science.gov (United States)

    Donaldson, David S.; Else, Kathryn J.

    2015-01-01

    ABSTRACT Prion diseases are infectious neurodegenerative disorders characterized by accumulations of abnormally folded cellular prion protein in affected tissues. Many natural prion diseases are acquired orally, and following exposure, the early replication of some prion isolates upon follicular dendritic cells (FDC) within gut-associated lymphoid tissues (GALT) is important for the efficient spread of disease to the brain (neuroinvasion). Prion detection within large intestinal GALT biopsy specimens has been used to estimate human and animal disease prevalence. However, the relative contributions of the small and large intestinal GALT to oral prion pathogenesis were unknown. To address this issue, we created mice that specifically lacked FDC-containing GALT only in the small intestine. Our data show that oral prion disease susceptibility was dramatically reduced in mice lacking small intestinal GALT. Although these mice had FDC-containing GALT throughout their large intestines, these tissues were not early sites of prion accumulation or neuroinvasion. We also determined whether pathology specifically within the large intestine might influence prion pathogenesis. Congruent infection with the nematode parasite Trichuris muris in the large intestine around the time of oral prion exposure did not affect disease pathogenesis. Together, these data demonstrate that the small intestinal GALT are the major early sites of prion accumulation and neuroinvasion after oral exposure. This has important implications for our understanding of the factors that influence the risk of infection and the preclinical diagnosis of disease. IMPORTANCE Many natural prion diseases are acquired orally. After exposure, the accumulation of some prion diseases in the gut-associated lymphoid tissues (GALT) is important for efficient spread of disease to the brain. However, the relative contributions of GALT in the small and large intestines to oral prion pathogenesis were unknown. We show that the

  7. The Gut-Associated Lymphoid Tissues in the Small Intestine, Not the Large Intestine, Play a Major Role in Oral Prion Disease Pathogenesis.

    Science.gov (United States)

    Donaldson, David S; Else, Kathryn J; Mabbott, Neil A

    2015-09-01

    Prion diseases are infectious neurodegenerative disorders characterized by accumulations of abnormally folded cellular prion protein in affected tissues. Many natural prion diseases are acquired orally, and following exposure, the early replication of some prion isolates upon follicular dendritic cells (FDC) within gut-associated lymphoid tissues (GALT) is important for the efficient spread of disease to the brain (neuroinvasion). Prion detection within large intestinal GALT biopsy specimens has been used to estimate human and animal disease prevalence. However, the relative contributions of the small and large intestinal GALT to oral prion pathogenesis were unknown. To address this issue, we created mice that specifically lacked FDC-containing GALT only in the small intestine. Our data show that oral prion disease susceptibility was dramatically reduced in mice lacking small intestinal GALT. Although these mice had FDC-containing GALT throughout their large intestines, these tissues were not early sites of prion accumulation or neuroinvasion. We also determined whether pathology specifically within the large intestine might influence prion pathogenesis. Congruent infection with the nematode parasite Trichuris muris in the large intestine around the time of oral prion exposure did not affect disease pathogenesis. Together, these data demonstrate that the small intestinal GALT are the major early sites of prion accumulation and neuroinvasion after oral exposure. This has important implications for our understanding of the factors that influence the risk of infection and the preclinical diagnosis of disease. Many natural prion diseases are acquired orally. After exposure, the accumulation of some prion diseases in the gut-associated lymphoid tissues (GALT) is important for efficient spread of disease to the brain. However, the relative contributions of GALT in the small and large intestines to oral prion pathogenesis were unknown. We show that the small intestinal

  8. Cellular and molecular effects for mutation induction in normal human cells irradiated with accelerated neon ions

    International Nuclear Information System (INIS)

    Suzuki, Masao; Tsuruoka, Chizuru; Kanai, Tatsuaki; Kato, Takeshi; Yatagai, Fumio; Watanabe, Masami

    2006-01-01

    We investigated the linear energy transfer (LET) dependence of mutation induction on the hypoxanthine-guanine phosphoribosyl transferase (HPRT) locus in normal human fibroblast-like cells irradiated with accelerated neon-ion beams. The cells were irradiated with neon-ion beams at various LETs ranging from 63 to 335 keV/μm. Neon-ion beams were accelerated by the Riken Ring Cyclotron at the Institute of Physical and Chemical Research in Japan. Mutation induction at the HPRT locus was detected to measure 6-thioguanine-resistant clones. The mutation spectrum of the deletion pattern of exons of mutants was analyzed using the multiplex polymerase chain reaction (PCR). The dose-response curves increased steeply up to 0.5 Gy and leveled off or decreased between 0.5 and 1.0 Gy, compared to the response to 137 Cs γ-rays. The mutation frequency increased up to 105 keV/μm and then there was a downward trend with increasing LET values. The deletion pattern of exons was non-specific. About 75-100% of the mutants produced using LETs ranging from 63 to 335 keV/μm showed all or partial deletions of exons, while among γ-ray-induced mutants 30% showed no deletions, 30% partial deletions and 40% complete deletions. These results suggested that the dose-response curves of neon-ion-induced mutations were dependent upon LET values, but the deletion pattern of DNA was not

  9. Amidation and structure relaxation abolish the neurotoxicity of the prion peptide PrP106-126 in vivo and in vitro

    DEFF Research Database (Denmark)

    Bergstrøm, Linda Alice; Hvass, Henriette Cordes; Zsurger, N.

    2005-01-01

    One of the major pathological hallmarks of transmissible spongiform encephalopathies (TSEs) is the accumulation of a pathogenic (scrapie) isoform (PrPSc) of the cellular prion protein (PrPC) primarily in the central nervous system. The synthetic prion peptide PrP106-126 shares many characteristics...

  10. Pros and cons of a prion-like pathogenesis in Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Brotchie Jonathan M

    2011-06-01

    Full Text Available Abstract Background Parkinson's disease (PD is a slowly progressive neurodegenerative disorder which affects widespread areas of the brainstem, basal ganglia and cerebral cortex. A number of proteins are known to accumulate in parkinsonian brains including ubiquitin and α-synuclein. Prion diseases are sporadic, genetic or infectious disorders with various clinical and histopathological features caused by prion proteins as infectious proteinaceous particles transmitting a misfolded protein configuration through brain tissue. The most important form is Creutzfeldt-Jakob disease which is associated with a self-propagating pathological precursor form of the prion protein that is physiologically widely distributed in the central nervous system. Discussion It has recently been found that α-synuclein may behave similarly to the prion precursor and propagate between cells. The post-mortem proof of α-synuclein containing Lewy bodies in embryonic dopamine cells transplants in PD patient suggests that the misfolded protein might be transmitted from the diseased host to donor neurons reminiscent of prion behavior. The involvement of the basal ganglia and brainstem in the degenerative process are other congruencies between Parkinson's and Creutzfeldt-Jakob disease. However, a number of issues advise caution before categorizing Parkinson's disease as a prion disorder, because clinical appearance, brain imaging, cerebrospinal fluid and neuropathological findings exhibit fundamental differences between both disease entities. Most of all, infectiousness, a crucial hallmark of prion diseases, has never been observed in PD so far. Moreover, the cellular propagation of the prion protein has not been clearly defined and it is, therefore, difficult to assess the molecular similarities between the two disease entities. Summary At the current state of knowledge, the molecular pathways of transmissible pathogenic proteins are not yet fully understood. Their exact

  11. Histomorphometric analysis of nuclear and cellular volumetric alterations in oral lichen planus, lichenoid lesions and normal oral mucosa using image analysis software.

    Science.gov (United States)

    Venkatesiah, Sowmya S; Kale, Alka D; Hallikeremath, Seema R; Kotrashetti, Vijayalakshmi S

    2013-01-01

    Lichen planus is a chronic inflammatory mucocutaneous disease that clinically and histologically resembles lichenoid lesions, although the latter has a different etiology. Though criteria have been suggested for differentiating oral lichen planus from lichenoid lesions, confusion still prevails. To study the cellular and nuclear volumetric features in the epithelium of normal mucosa, lichen planus, and lichenoid lesions to determine variations if any. A retrospective study was done on 25 histologically diagnosed cases each of oral lichen planus, oral lichenoid lesions, and normal oral mucosa. Cellular and nuclear morphometric measurements were assessed on hematoxylin and eosin sections using image analysis software. Analysis of variance test (ANOVA) and Tukey's post-hoc test. The basal cells of oral lichen planus showed a significant increase in the mean nuclear and cellular areas, and in nuclear volume; there was a significant decrease in the nuclear-cytoplasmic ratio as compared to normal mucosa. The suprabasal cells showed a significant increase in nuclear and cellular areas, nuclear diameter, and nuclear and cellular volumes as compared to normal mucosa. The basal cells of oral lichenoid lesions showed significant difference in the mean cellular area and the mean nuclear-cytoplasmic ratio as compared to normal mucosa, whereas the suprabasal cells differed significantly from normal mucosa in the mean nuclear area and the nuclear and cellular volumes. Morphometry can differentiate lesions of oral lichen planus and oral lichenoid lesions from normal oral mucosa. Thus, morphometry may serve to discriminate between normal and premalignant lichen planus and lichenoid lesions. These lesions might have a high risk for malignant transformation and may behave in a similar manner with respect to malignant transformation.

  12. Small protease sensitive oligomers of PrPSc in distinct human prions determine conversion rate of PrP(C.

    Directory of Open Access Journals (Sweden)

    Chae Kim

    Full Text Available The mammalian prions replicate by converting cellular prion protein (PrP(C into pathogenic conformational isoform (PrP(Sc. Variations in prions, which cause different disease phenotypes, are referred to as strains. The mechanism of high-fidelity replication of prion strains in the absence of nucleic acid remains unsolved. We investigated the impact of different conformational characteristics of PrP(Sc on conversion of PrP(C in vitro using PrP(Sc seeds from the most frequent human prion disease worldwide, the Creutzfeldt-Jakob disease (sCJD. The conversion potency of a broad spectrum of distinct sCJD prions was governed by the level, conformation, and stability of small oligomers of the protease-sensitive (s PrP(Sc. The smallest most potent prions present in sCJD brains were composed only of∼20 monomers of PrP(Sc. The tight correlation between conversion potency of small oligomers of human sPrP(Sc observed in vitro and duration of the disease suggests that sPrP(Sc conformers are an important determinant of prion strain characteristics that control the progression rate of the disease.

  13. An ancient conserved role for prion protein in learning and memory

    Directory of Open Access Journals (Sweden)

    Patricia L. A. Leighton

    2018-01-01

    Full Text Available The misfolding of cellular prion protein (PrPC to form PrP Scrapie (PrPSc is an exemplar of toxic gain-of-function mechanisms inducing propagated protein misfolding and progressive devastating neurodegeneration. Despite this, PrPC function in the brain is also reduced and subverted during prion disease progression; thus understanding the normal function of PrPC in healthy brains is key. Disrupting PrPC in mice has led to a myriad of controversial functions that sometimes map onto disease symptoms, including a proposed role in memory or learning. Intriguingly, PrPC interaction with amyloid beta (Aβ oligomers at synapses has also linked its function to Alzheimer's disease and dementia in recent years. We set out to test the involvement of PrPC in memory using a disparate animal model, the zebrafish. Here we document an age-dependent memory decline in prp2−/− zebrafish, pointing to a conserved and ancient role of PrPC in memory. Specifically, we found that aged (3-year-old prp2−/− fish performed poorly in an object recognition task relative to age-matched prp2+/+ fish or 1-year-old prp2−/− fish. Further, using a novel object approach (NOA test, we found that aged (3-year-old prp2−/− fish approached the novel object more than either age-matched prp2+/+ fish or 1-year-old prp2−/− fish, but did not have decreased anxiety when we tested them in a novel tank diving test. Taken together, the results of the NOA and novel tank diving tests suggest an altered cognitive appraisal of the novel object in the 3-year-old prp2−/− fish. The learning paradigm established here enables a path forward to study PrPC interactions of relevance to Alzheimer's disease and prion diseases, and to screen for candidate therapeutics for these diseases. The findings underpin a need to consider the relative contributions of loss- versus gain-of-function of PrPC during Alzheimer's and prion diseases, and have implications upon the prospects of several

  14. Prion Protein Devoid of the Octapeptide Repeat Region Delays Bovine Spongiform Encephalopathy Pathogenesis in Mice.

    Science.gov (United States)

    Hara, Hideyuki; Miyata, Hironori; Das, Nandita Rani; Chida, Junji; Yoshimochi, Tatenobu; Uchiyama, Keiji; Watanabe, Hitomi; Kondoh, Gen; Yokoyama, Takashi; Sakaguchi, Suehiro

    2018-01-01

    Conformational conversion of the cellular isoform of prion protein, PrP C , into the abnormally folded, amyloidogenic isoform, PrP Sc , is a key pathogenic event in prion diseases, including Creutzfeldt-Jakob disease in humans and scrapie and bovine spongiform encephalopathy (BSE) in animals. We previously reported that the octapeptide repeat (OR) region could be dispensable for converting PrP C into PrP Sc after infection with RML prions. We demonstrated that mice transgenically expressing mouse PrP with deletion of the OR region on the PrP knockout background, designated Tg(PrPΔOR)/ Prnp 0 / 0 mice, did not show reduced susceptibility to RML scrapie prions, with abundant accumulation of PrP Sc ΔOR in their brains. We show here that Tg(PrPΔOR)/ Prnp 0 / 0 mice were highly resistant to BSE prions, developing the disease with markedly elongated incubation times after infection with BSE prions. The conversion of PrPΔOR into PrP Sc ΔOR was markedly delayed in their brains. These results suggest that the OR region may have a crucial role in the conversion of PrP C into PrP Sc after infection with BSE prions. However, Tg(PrPΔOR)/ Prnp 0 / 0 mice remained susceptible to RML and 22L scrapie prions, developing the disease without elongated incubation times after infection with RML and 22L prions. PrP Sc ΔOR accumulated only slightly less in the brains of RML- or 22L-infected Tg(PrPΔOR)/ Prnp 0 / 0 mice than PrP Sc in control wild-type mice. Taken together, these results indicate that the OR region of PrP C could play a differential role in the pathogenesis of BSE prions and RML or 22L scrapie prions. IMPORTANCE Structure-function relationship studies of PrP C conformational conversion into PrP Sc are worthwhile to understand the mechanism of the conversion of PrP C into PrP Sc We show here that, by inoculating Tg(PrPΔOR)/ Prnp 0 / 0 mice with the three different strains of RML, 22L, and BSE prions, the OR region could play a differential role in the conversion of

  15. Prion-Like Domains in Phagobiota

    Directory of Open Access Journals (Sweden)

    George Tetz

    2017-11-01

    Full Text Available Prions are molecules characterized by self-propagation, which can undergo a conformational switch leading to the creation of new prions. Prion proteins have originally been associated with the development of mammalian pathologies; however, recently they have been shown to contribute to the environmental adaptation in a variety of prokaryotic and eukaryotic organisms. Bacteriophages are widespread and represent the important regulators of microbiota homeostasis and have been shown to be diverse across various bacterial families. Here, we examined whether bacteriophages contain prion-like proteins and whether these prion-like protein domains are involved in the regulation of homeostasis. We used a computational algorithm, prion-like amino acid composition, to detect prion-like domains in 370,617 publicly available bacteriophage protein sequences, which resulted in the identification of 5040 putative prions. We analyzed a set of these prion-like proteins, and observed regularities in their distribution across different phage families, associated with their interactions with the bacterial host cells. We found that prion-like domains could be found across all phages of various groups of bacteria and archaea. The results obtained in this study indicate that bacteriophage prion-like proteins are predominantly involved in the interactions between bacteriophages and bacterial cell, such as those associated with the attachment and penetration of bacteriophage in the cell, and the release of the phage progeny. These data allow the identification of phage prion-like proteins as novel regulators of the interactions between bacteriophages and bacterial cells.

  16. Assessment of the PrPc Amino-Terminal Domain in Prion Species Barriers.

    Science.gov (United States)

    Davenport, Kristen A; Henderson, Davin M; Mathiason, Candace K; Hoover, Edward A

    2016-12-01

    Chronic wasting disease (CWD) in cervids and bovine spongiform encephalopathy (BSE) in cattle are prion diseases that are caused by the same protein-misfolding mechanism, but they appear to pose different risks to humans. We are interested in understanding the differences between the species barriers of CWD and BSE. We used real-time, quaking-induced conversion (RT-QuIC) to model the central molecular event in prion disease, the templated misfolding of the normal prion protein, PrP c , to a pathogenic, amyloid isoform, scrapie prion protein, PrP Sc We examined the role of the PrP c amino-terminal domain (N-terminal domain [NTD], amino acids [aa] 23 to 90) in cross-species conversion by comparing the conversion efficiency of various prion seeds in either full-length (aa 23 to 231) or truncated (aa 90 to 231) PrP c We demonstrate that the presence of white-tailed deer and bovine NTDs hindered seeded conversion of PrP c , but human and bank vole NTDs did the opposite. Additionally, full-length human and bank vole PrP c s were more likely to be converted to amyloid by CWD prions than were their truncated forms. A chimera with replacement of the human NTD by the bovine NTD resembled human PrP c The requirement for an NTD, but not for the specific human sequence, suggests that the NTD interacts with other regions of the human PrP c to increase promiscuity. These data contribute to the evidence that, in addition to primary sequence, prion species barriers are controlled by interactions of the substrate NTD with the rest of the substrate PrP c molecule. We demonstrate that the amino-terminal domain of the normal prion protein, PrP c , hinders seeded conversion of bovine and white-tailed deer PrP c s to the prion forms, but it facilitates conversion of the human and bank vole PrP c s to the prion forms. Additionally, we demonstrate that the amino-terminal domain of human and bank vole PrP c s requires interaction with the rest of the molecule to facilitate conversion by CWD

  17. Yeast prions assembly and propagation: contributions of the prion and non-prion moieties and the nature of assemblies.

    Science.gov (United States)

    Kabani, Mehdi; Melki, Ronald

    2011-01-01

    Yeast prions are self-perpetuating protein aggregates that are at the origin of heritable and transmissible non-Mendelian phenotypic traits. Among these, [PSI+], [URE3] and [PIN+] are the most well documented prions and arise from the assembly of Sup35p, Ure2p and Rnq1p, respectively, into insoluble fibrillar assemblies. Fibril assembly depends on the presence of N- or C-terminal prion domains (PrDs) which are not homologous in sequence but share unusual amino-acid compositions, such as enrichment in polar residues (glutamines and asparagines) or the presence of oligopeptide repeats. Purified PrDs form amyloid fibrils that can convert prion-free cells to the prion state upon transformation. Nonetheless, isolated PrDs and full-length prion proteins have different aggregation, structural and infectious properties. In addition, mutations in the "non-prion" domains (non-PrDs) of Sup35p, Ure2p and Rnq1p were shown to affect their prion properties in vitro and in vivo. Despite these evidences, the implication of the functional non-PrDs in fibril assembly and prion propagation has been mostly overlooked. In this review, we discuss the contribution of non-PrDs to prion assemblies, and the structure-function relationship in prion infectivity in the light of recent findings on Sup35p and Ure2p assembly into infectious fibrils from our laboratory and others.

  18. Atypical scrapie prions from sheep and lack of disease in transgenic mice overexpressing human prion protein.

    Science.gov (United States)

    Wadsworth, Jonathan D F; Joiner, Susan; Linehan, Jacqueline M; Balkema-Buschmann, Anne; Spiropoulos, John; Simmons, Marion M; Griffiths, Peter C; Groschup, Martin H; Hope, James; Brandner, Sebastian; Asante, Emmanuel A; Collinge, John

    2013-11-01

    Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants.

  19. Controlling the prion propensity of glutamine/asparagine-rich proteins.

    Science.gov (United States)

    Paul, Kacy R; Ross, Eric D

    2015-01-01

    The yeast Saccharomyces cerevisiae can harbor a number of distinct prions. Most of the yeast prion proteins contain a glutamine/asparagine (Q/N) rich region that drives prion formation. Prion-like domains, defined as regions with high compositional similarity to yeast prion domains, are common in eukaryotic proteomes, and mutations in various human proteins containing prion-like domains have been linked to degenerative diseases, including amyotrophic lateral sclerosis. Here, we discuss a recent study in which we utilized two strategies to generate prion activity in non-prion Q/N-rich domains. First, we made targeted mutations in four non-prion Q/N-rich domains, replacing predicted prion-inhibiting amino acids with prion-promoting amino acids. All four mutants formed foci when expressed in yeast, and two acquired bona fide prion activity. Prion activity could be generated with as few as two mutations, suggesting that many non-prion Q/N-rich proteins may be just a small number of mutations from acquiring aggregation or prion activity. Second, we created tandem repeats of short prion-prone segments, and observed length-dependent prion activity. These studies demonstrate the considerable progress that has been made in understanding the sequence basis for aggregation of prion and prion-like domains, and suggest possible mechanisms by which new prion domains could evolve.

  20. The Structural Architecture of an Infectious Mammalian Prion Using Electron Cryomicroscopy.

    Directory of Open Access Journals (Sweden)

    Ester Vázquez-Fernández

    2016-09-01

    Full Text Available The structure of the infectious prion protein (PrPSc, which is responsible for Creutzfeldt-Jakob disease in humans and bovine spongiform encephalopathy, has escaped all attempts at elucidation due to its insolubility and propensity to aggregate. PrPSc replicates by converting the non-infectious, cellular prion protein (PrPC into the misfolded, infectious conformer through an unknown mechanism. PrPSc and its N-terminally truncated variant, PrP 27-30, aggregate into amorphous aggregates, 2D crystals, and amyloid fibrils. The structure of these infectious conformers is essential to understanding prion replication and the development of structure-based therapeutic interventions. Here we used the repetitive organization inherent to GPI-anchorless PrP 27-30 amyloid fibrils to analyze their structure via electron cryomicroscopy. Fourier-transform analyses of averaged fibril segments indicate a repeating unit of 19.1 Å. 3D reconstructions of these fibrils revealed two distinct protofilaments, and, together with a molecular volume of 18,990 Å3, predicted the height of each PrP 27-30 molecule as ~17.7 Å. Together, the data indicate a four-rung β-solenoid structure as a key feature for the architecture of infectious mammalian prions. Furthermore, they allow to formulate a molecular mechanism for the replication of prions. Knowledge of the prion structure will provide important insights into the self-propagation mechanisms of protein misfolding.

  1. Virus Infections on Prion Diseased Mice Exacerbate Inflammatory Microglial Response

    Science.gov (United States)

    Lins, Nara; Mourão, Luiz; Trévia, Nonata; Passos, Aline; Farias, José Augusto; Assunção, Jarila; Bento-Torres, João; Consentino Kronka Sosthenes, Marcia; Diniz, José Antonio Picanço; Vasconcelos, Pedro Fernando da Costa

    2016-01-01

    We investigated possible interaction between an arbovirus infection and the ME7 induced mice prion disease. C57BL/6, females, 6-week-old, were submitted to a bilateral intrahippocampal injection of ME7 prion strain (ME7) or normal brain homogenate (NBH). After injections, animals were organized into two groups: NBH (n = 26) and ME7 (n = 29). At 15th week after injections (wpi), animals were challenged intranasally with a suspension of Piry arbovirus 0.001% or with NBH. Behavioral changes in ME7 animals appeared in burrowing activity at 14 wpi. Hyperactivity on open field test, errors on rod bridge, and time reduction in inverted screen were detected at 15th, 19th, and 20th wpi respectively. Burrowing was more sensitive to earlier hippocampus dysfunction. However, Piry-infection did not significantly affect the already ongoing burrowing decline in the ME7-treated mice. After behavioral tests, brains were processed for IBA1, protease-resistant form of PrP, and Piry virus antigens. Although virus infection in isolation did not change the number of microglia in CA1, virus infection in prion diseased mice (at 17th wpi) induced changes in number and morphology of microglia in a laminar-dependent way. We suggest that virus infection exacerbates microglial inflammatory response to a greater degree in prion-infected mice, and this is not necessarily correlated with hippocampal-dependent behavioral deficits. PMID:28003864

  2. Mutated but Not Deleted Ovine PrP(C) N-Terminal Polybasic Region Strongly Interferes with Prion Propagation in Transgenic Mice.

    Science.gov (United States)

    Khalifé, Manal; Reine, Fabienne; Paquet-Fifield, Sophie; Castille, Johan; Herzog, Laetitia; Vilotte, Marthe; Moudjou, Mohammed; Moazami-Goudarzi, Katayoun; Makhzami, Samira; Passet, Bruno; Andréoletti, Olivier; Vilette, Didier; Laude, Hubert; Béringue, Vincent; Vilotte, Jean-Luc

    2016-02-01

    Mammalian prions are proteinaceous infectious agents composed of misfolded assemblies of the host-encoded, cellular prion protein (PrP). Physiologically, the N-terminal polybasic region of residues 23 to 31 of PrP has been shown to be involved in its endocytic trafficking and interactions with glycosaminoglycans or putative ectodomains of membrane-associated proteins. Several recent reports also describe this PrP region as important for the toxicity of mutant prion proteins and the efficiency of prion propagation, both in vitro and in vivo. The question remains as to whether the latter observations made with mouse PrP and mouse prions would be relevant to other PrP species/prion strain combinations given the dramatic impact on prion susceptibility of minimal amino acid substitutions and structural variations in PrP. Here, we report that transgenic mouse lines expressing ovine PrP with a deletion of residues 23 to 26 (KKRP) or mutated in this N-terminal region (KQHPH instead of KKRPK) exhibited a variable, strain-dependent susceptibility to prion infection with regard to the proportion of affected mice and disease tempo relative to findings in their wild-type counterparts. Deletion has no major effect on 127S scrapie prion pathogenesis, whereas mutation increased by almost 3-fold the survival time of the mice. Deletion marginally affected the incubation time of scrapie LA19K and ovine bovine spongiform encephalopathy (BSE) prions, whereas mutation caused apparent resistance to disease. Recent reports suggested that the N-terminal polybasic region of the prion protein could be a therapeutic target to prevent prion propagation or toxic signaling associated with more common neurodegenerative diseases such as Alzheimer's disease. Mutating or deleting this region in ovine PrP completes the data previously obtained with the mouse protein by identifying the key amino acid residues involved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  3. Cytosolic PrP Can Participate in Prion-Mediated Toxicity

    Science.gov (United States)

    Thackray, Alana M.; Zhang, Chang; Arndt, Tina

    2014-01-01

    ABSTRACT Prion diseases are characterized by a conformational change in the normal host protein PrPC. While the majority of mature PrPC is tethered to the plasma membrane by a glycosylphosphatidylinositol anchor, topological variants of this protein can arise during its biosynthesis. Here we have generated Drosophila transgenic for cytosolic ovine PrP in order to investigate its toxic potential in flies in the absence or presence of exogenous ovine prions. While cytosolic ovine PrP expressed in Drosophila was predominantly detergent insoluble and showed resistance to low concentrations of proteinase K, it was not overtly detrimental to the flies. However, Drosophila transgenic for cytosolic PrP expression exposed to classical or atypical scrapie prion inocula showed a faster decrease in locomotor activity than similar flies exposed to scrapie-free material. The susceptibility to classical scrapie inocula could be assessed in Drosophila transgenic for panneuronal expression of cytosolic PrP, whereas susceptibility to atypical scrapie required ubiquitous PrP expression. Significantly, the toxic phenotype induced by ovine scrapie in cytosolic PrP transgenic Drosophila was transmissible to recipient PrP transgenic flies. These data show that while cytosolic PrP expression does not adversely affect Drosophila, this topological PrP variant can participate in the generation of transmissible scrapie-induced toxicity. These observations also show that PrP transgenic Drosophila are susceptible to classical and atypical scrapie prion strains and highlight the utility of this invertebrate host as a model of mammalian prion disease. IMPORTANCE During prion diseases, the host protein PrPC converts into an abnormal conformer, PrPSc, a process coupled to the generation of transmissible prions and neurotoxicity. While PrPC is principally a glycosylphosphatidylinositol-anchored membrane protein, the role of topological variants, such as cytosolic PrP, in prion-mediated toxicity and

  4. Utilizing NMR and EPR spectroscopy to probe the role of copper in prion diseases

    KAUST Repository

    Emwas, Abdul-Hamid M.

    2013-02-24

    Copper is an essential nutrient for the normal development of the brain and nervous system, although the hallmark of several neurological diseases is a change in copper concentrations in the brain and central nervous system. Prion protein (PrP) is a copper-binding, cell-surface glycoprotein that exists in two alternatively folded conformations: a normal isoform (PrPC) and a disease-associated isoform (PrPSc). Prion diseases are a group of lethal neurodegenerative disorders that develop as a result of conformational conversion of PrPC into PrPSc. The pathogenic mechanism that triggers this conformational transformation with the subsequent development of prion diseases remains unclear. It has, however, been shown repeatedly that copper plays a significant functional role in the conformational conversion of prion proteins. In this review, we focus on current research that seeks to clarify the conformational changes associated with prion diseases and the role of copper in this mechanism, with emphasis on the latest applications of NMR and EPR spectroscopy to probe the interactions of copper with prion proteins. Copyright © 2013 John Wiley & Sons, Ltd.

  5. Utilizing NMR and EPR spectroscopy to probe the role of copper in prion diseases

    KAUST Repository

    Emwas, Abdul-Hamid M.; Al-Talla, Zeyad; Guo, Xianrong; Al-Ghamdi, Suliman; Al-Masri, Harbi Tomah

    2013-01-01

    Copper is an essential nutrient for the normal development of the brain and nervous system, although the hallmark of several neurological diseases is a change in copper concentrations in the brain and central nervous system. Prion protein (PrP) is a copper-binding, cell-surface glycoprotein that exists in two alternatively folded conformations: a normal isoform (PrPC) and a disease-associated isoform (PrPSc). Prion diseases are a group of lethal neurodegenerative disorders that develop as a result of conformational conversion of PrPC into PrPSc. The pathogenic mechanism that triggers this conformational transformation with the subsequent development of prion diseases remains unclear. It has, however, been shown repeatedly that copper plays a significant functional role in the conformational conversion of prion proteins. In this review, we focus on current research that seeks to clarify the conformational changes associated with prion diseases and the role of copper in this mechanism, with emphasis on the latest applications of NMR and EPR spectroscopy to probe the interactions of copper with prion proteins. Copyright © 2013 John Wiley & Sons, Ltd.

  6. Epigenetic dominance of prion conformers.

    Directory of Open Access Journals (Sweden)

    Eri Saijo

    2013-10-01

    Full Text Available Although they share certain biological properties with nucleic acid based infectious agents, prions, the causative agents of invariably fatal, transmissible neurodegenerative disorders such as bovine spongiform encephalopathy, sheep scrapie, and human Creutzfeldt Jakob disease, propagate by conformational templating of host encoded proteins. Once thought to be unique to these diseases, this mechanism is now recognized as a ubiquitous means of information transfer in biological systems, including other protein misfolding disorders such as those causing Alzheimer's and Parkinson's diseases. To address the poorly understood mechanism by which host prion protein (PrP primary structures interact with distinct prion conformations to influence pathogenesis, we produced transgenic (Tg mice expressing different sheep scrapie susceptibility alleles, varying only at a single amino acid at PrP residue 136. Tg mice expressing ovine PrP with alanine (A at (OvPrP-A136 infected with SSBP/1 scrapie prions propagated a relatively stable (S prion conformation, which accumulated as punctate aggregates in the brain, and produced prolonged incubation times. In contrast, Tg mice expressing OvPrP with valine (V at 136 (OvPrP-V136 infected with the same prions developed disease rapidly, and the converted prion was comprised of an unstable (U, diffusely distributed conformer. Infected Tg mice co-expressing both alleles manifested properties consistent with the U conformer, suggesting a dominant effect resulting from exclusive conversion of OvPrP-V136 but not OvPrP-A136. Surprisingly, however, studies with monoclonal antibody (mAb PRC5, which discriminates OvPrP-A136 from OvPrP-V136, revealed substantial conversion of OvPrP-A136. Moreover, the resulting OvPrP-A136 prion acquired the characteristics of the U conformer. These results, substantiated by in vitro analyses, indicated that co-expression of OvPrP-V136 altered the conversion potential of OvPrP-A136 from the S to

  7. Prion diseases of the brain

    International Nuclear Information System (INIS)

    Lutz, Kira; Urbach, Horst

    2015-01-01

    The prion diseases of the brain, especially Creutzfeldt-Jakob disease, are rare fatal neurodegenerative disorders. A definitive CJD diagnosis is currently only possible by a brain biopsy or post mortem autopsy. The diagnosis of Creutzfeldt-Jakob disease is based on clinical signs, pathognomonic EEG, on typical MRI findings and the examination of the cerebrospinal fluid. Using the MRI the diagnosis Creutzfeldt-Jakob disease can be confirmed or excluded with high certainty. The MRI examination should contain diffusion-weighted and FLAIR imaging sequences. This review article provides an overview of the prion diseases of the brain with the corresponding imaging findings.

  8. Prion Strain Characterization of a Novel Subtype of Creutzfeldt-Jakob Disease.

    Science.gov (United States)

    Galeno, Roberta; Di Bari, Michele Angelo; Nonno, Romolo; Cardone, Franco; Sbriccoli, Marco; Graziano, Silvia; Ingrosso, Loredana; Fiorini, Michele; Valanzano, Angelina; Pasini, Giulia; Poleggi, Anna; Vinci, Ramona; Ladogana, Anna; Puopolo, Maria; Monaco, Salvatore; Agrimi, Umberto; Zanusso, Gianluigi; Pocchiari, Maurizio

    2017-06-01

    In 2007, we reported a patient with an atypical form of Creutzfeldt-Jakob disease (CJD) heterozygous for methionine-valine (MV) at codon 129 who showed a novel pathological prion protein (PrP TSE ) conformation with an atypical glycoform (AG) profile and intraneuronal PrP deposition. In the present study, we further characterize the conformational properties of this pathological prion protein (PrP TSE MV AG ), showing that PrP TSE MV AG is composed of multiple conformers with biochemical properties distinct from those of PrP TSE type 1 and type 2 of MV sporadic CJD (sCJD). Experimental transmission of CJD-MV AG to bank voles and gene-targeted transgenic mice carrying the human prion protein gene (TgHu mice) showed unique transmission rates, survival times, neuropathological changes, PrP TSE deposition patterns, and PrP TSE glycotypes that are distinct from those of sCJD-MV1 and sCJD-MV2. These biochemical and experimental data suggest the presence of a novel prion strain in CJD-MV AG IMPORTANCE Sporadic Creutzfeldt-Jakob disease is caused by the misfolding of the cellular prion protein, which assumes two different major conformations (type 1 and type 2) and, together with the methionine/valine polymorphic codon 129 of the prion protein gene, contribute to the occurrence of distinct clinical-pathological phenotypes. Inoculation in laboratory rodents of brain tissues from the six possible combinations of pathological prion protein types with codon 129 genotypes results in the identification of 3 or 4 strains of prions. We report on the identification of a novel strain of Creutzfeldt-Jakob disease isolated from a patient who carried an abnormally glycosylated pathological prion protein. This novel strain has unique biochemical characteristics, does not transmit to humanized transgenic mice, and shows exclusive transmission properties in bank voles. The identification of a novel human prion strain improves our understanding of the pathogenesis of the disease and of

  9. Implications of prion adaptation and evolution paradigm for human neurodegenerative diseases.

    Science.gov (United States)

    Kabir, M Enamul; Safar, Jiri G

    2014-01-01

    There is a growing body of evidence indicating that number of human neurodegenerative diseases, including Alzheimer disease, Parkinson disease, fronto-temporal dementias, and amyotrophic lateral sclerosis, propagate in the brain via prion-like intercellular induction of protein misfolding. Prions cause lethal neurodegenerative diseases in humans, the most prevalent being sporadic Creutzfeldt-Jakob disease (sCJD); they self-replicate and spread by converting the cellular form of prion protein (PrP(C)) to a misfolded pathogenic conformer (PrP(Sc)). The extensive phenotypic heterogeneity of human prion diseases is determined by polymorphisms in the prion protein gene, and by prion strain-specific conformation of PrP(Sc). Remarkably, even though informative nucleic acid is absent, prions may undergo rapid adaptation and evolution in cloned cells and upon crossing the species barrier. In the course of our investigation of this process, we isolated distinct populations of PrP(Sc) particles that frequently co-exist in sCJD. The human prion particles replicate independently and undergo competitive selection of those with lower initial conformational stability. Exposed to mutant substrate, the winning PrP(Sc) conformers are subject to further evolution by natural selection of the subpopulation with the highest replication rate due to the lowest stability. Thus, the evolution and adaptation of human prions is enabled by a dynamic collection of distinct populations of particles, whose evolution is governed by the selection of progressively less stable, faster replicating PrP(Sc) conformers. This fundamental biological mechanism may explain the drug resistance that some prions gained after exposure to compounds targeting PrP(Sc). Whether the phenotypic heterogeneity of other neurodegenerative diseases caused by protein misfolding is determined by the spectrum of misfolded conformers (strains) remains to be established. However, the prospect that these conformers may evolve and

  10. Prions And Prion Diseases | Obi | African Journal of Clinical and ...

    African Journals Online (AJOL)

    Patients also may experience involuntary jerking movements called myoclonus, unusual sensation, insomnia, and confusion or memory problems. In the later stages of the disease, patients may have severe mental impairment (dementia) and may lose the ability to move or speak. Well known prion diseases include scrapie ...

  11. Quinacrine reactivity with prion proteins and prion-derived peptides

    Czech Academy of Sciences Publication Activity Database

    Zawada, Zbigniew; Šafařík, Martin; Dvořáková, E.; Janoušková, O.; Březinová, Anna; Stibor, Ivan; Holada, K.; Bouř, Petr; Hlaváček, Jan; Šebestík, Jaroslav

    2013-01-01

    Roč. 44, č. 5 (2013), s. 1279-1292 ISSN 0939-4451 R&D Projects: GA ČR GA203/07/1517 Institutional support: RVO:61388963 Keywords : quinacrine * prion protein and peptide model reactions * solid phase and recombinant synthesis Subject RIV: CE - Biochemistry Impact factor: 3.653, year: 2013

  12. Prion protein self-interaction in prion disease therapy approaches

    NARCIS (Netherlands)

    Rigter, A.; Priem, J.; Langeveld, J.P.M.; Bossers, A.

    2011-01-01

    Transmissible spongiform encephalopathies (TSEs) or prion diseases are unique disorders that are not caused by infectious micro-organisms (bacteria or fungi), viruses or parasites, but rather seem to be the result of an infectious protein. TSEs are comprised of fatal neurodegenerative disorders

  13. Infectivity-associated PrP(Sc) and disease duration-associated PrP(Sc) of mouse BSE prions.

    Science.gov (United States)

    Miyazawa, Kohtaro; Okada, Hiroyuki; Masujin, Kentaro; Iwamaru, Yoshifumi; Yokoyama, Takashi

    2015-01-01

    Disease-related prion protein (PrP(Sc)), which is a structural isoform of the host-encoded cellular prion protein, is thought to be a causative agent of transmissible spongiform encephalopathies. However, the specific role of PrP(Sc) in prion pathogenesis and its relationship to infectivity remain controversial. A time-course study of prion-affected mice was conducted, which showed that the prion infectivity was not simply proportional to the amount of PrP(Sc) in the brain. Centrifugation (20,000 ×g) of the brain homogenate showed that most of the PrP(Sc) was precipitated into the pellet, and the supernatant contained only a slight amount of PrP(Sc). Interestingly, mice inoculated with the obtained supernatant showed incubation periods that were approximately 15 d longer than those of mice inoculated with the crude homogenate even though both inocula contained almost the same infectivity. Our results suggest that a small population of fine PrP(Sc) may be responsible for prion infectivity and that large, aggregated PrP(Sc) may contribute to determining prion disease duration.

  14. Yeast prions and human prion-like proteins: sequence features and prediction methods.

    Science.gov (United States)

    Cascarina, Sean M; Ross, Eric D

    2014-06-01

    Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis. This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms.

  15. Genetics Home Reference: prion disease

    Science.gov (United States)

    ... which have overlapping signs and symptoms, include familial Creutzfeldt-Jakob disease (CJD), Gerstmann-Sträussler-Scheinker syndrome (GSS), and fatal ... Sc . Sporadic forms of prion disease include sporadic Creutzfeldt-Jakob disease (sCJD), sporadic fatal insomnia (sFI), and variably protease- ...

  16. Potential contribution of exosomes to the prion-like propagation of lesions in Alzheimer’s disease

    Directory of Open Access Journals (Sweden)

    Valerie eVingtdeux

    2012-07-01

    Full Text Available Since the discovery of prion diseases, the concept that a transmissible pathogen could be a protein has emerged. As such, this transmissible protein agent can transfer its pathological mis-folded shape to the same but normally folded protein thus leading to the propagation of a disease. This idea is now extrapolate to several neurological diseases associated with protein mis-folding and aggregation, such as Alzheimer’s disease. Alzheimer’s disease (AD is a slowly developing dementing disease characterized by the coexistence of two types of lesions: the parenchymal amyloid deposits and the intraneuronal neurofibrillary tangles (NFT. Amyloid deposits are composed of amyloid-beta peptides that derive from sequential cleavages of its precursor named amyloid protein precursor. Neurofibrillary tangle is characterized by intraneuronal aggregation of abnormally modified microtubule-associated Tau proteins. A synergistic relationship between the two lesions may trigger the progression of the disease. Thus, starting in the medial temporal lobe and slowly progressing through temporal, frontal, parietal and occipital cortex, the progression of NFT is well correlated with clinical expression of the disease. However, little is known about the mechanism driving the spatiotemporal propagation of these lesions ultimately leading to the disease. A growing number of studies suggest a prion-like diffusion of amyloid deposits and NFT. In the present chapter, we will develop the current hypotheses regarding the molecular and cellular mechanisms driving the development and spreading of Alzheimer disease lesions from the window of multivesicular bodies and exosomes.

  17. An insight into the complex prion-prion interaction network in the budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Du, Zhiqiang; Valtierra, Stephanie; Li, Liming

    2014-01-01

    The budding yeast Saccharomyces cerevisiae is a valuable model system for studying prion-prion interactions as it contains multiple prion proteins. A recent study from our laboratory showed that the existence of Swi1 prion ([SWI(+)]) and overproduction of Swi1 can have strong impacts on the formation of 2 other extensively studied yeast prions, [PSI(+)] and [PIN(+)] ([RNQ(+)]) (Genetics, Vol. 197, 685-700). We showed that a single yeast cell is capable of harboring at least 3 heterologous prion elements and these prions can influence each other's appearance positively and/or negatively. We also showed that during the de novo [PSI(+)] formation process upon Sup35 overproduction, the aggregation patterns of a preexisting inducer ([RNQ(+)] or [SWI(+)]) can undergo significant remodeling from stably transmitted dot-shaped aggregates to aggregates that co-localize with the newly formed Sup35 aggregates that are ring/ribbon/rod- shaped. Such co-localization disappears once the newly formed [PSI(+)] prion stabilizes. Our finding provides strong evidence supporting the "cross-seeding" model for prion-prion interactions and confirms earlier reports that the interactions among different prions and their prion proteins mostly occur at the initiation stages of prionogenesis. Our results also highlight a complex prion interaction network in yeast. We believe that elucidating the mechanism underlying the yeast prion-prion interaction network will not only provide insight into the process of prion de novo generation and propagation in yeast but also shed light on the mechanisms that govern protein misfolding, aggregation, and amyloidogenesis in higher eukaryotes.

  18. Chronic wasting disease prions are not transmissible to transgenic mice overexpressing human prion protein.

    Science.gov (United States)

    Sandberg, Malin K; Al-Doujaily, Huda; Sigurdson, Christina J; Glatzel, Markus; O'Malley, Catherine; Powell, Caroline; Asante, Emmanuel A; Linehan, Jacqueline M; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

    2010-10-01

    Chronic wasting disease (CWD) is a prion disease that affects free-ranging and captive cervids, including mule deer, white-tailed deer, Rocky Mountain elk and moose. CWD-infected cervids have been reported in 14 USA states, two Canadian provinces and in South Korea. The possibility of a zoonotic transmission of CWD prions via diet is of particular concern in North America where hunting of cervids is a popular sport. To investigate the potential public health risks posed by CWD prions, we have investigated whether intracerebral inoculation of brain and spinal cord from CWD-infected mule deer transmits prion infection to transgenic mice overexpressing human prion protein with methionine or valine at polymorphic residue 129. These transgenic mice have been utilized in extensive transmission studies of human and animal prion disease and are susceptible to BSE and vCJD prions, allowing comparison with CWD. Here, we show that these mice proved entirely resistant to infection with mule deer CWD prions arguing that the transmission barrier associated with this prion strain/host combination is greater than that observed with classical BSE prions. However, it is possible that CWD may be caused by multiple prion strains. Further studies will be required to evaluate the transmission properties of distinct cervid prion strains as they are characterized.

  19. S. pombe placed on the prion map

    Directory of Open Access Journals (Sweden)

    Jacqueline Hayles

    2017-02-01

    Full Text Available Schizosaccharomyces pombe has been used extensively as a model organism, however it is only recently that the first prion in this organism, a copper transporter protein encoded by ctr4, has been conclusively demonstrated. Prions are found in a wide range of organisms and have been implicated in a number of human neurodegenerative diseases. Research into the biology of prions has been carried out mainly in the budding yeast Saccharomyces cerevisiae, however there are many questions still to be addressed. Now, with the identification of the Ctr4 prion in S. pombe, further work in the two yeasts and comparisons of prion biology in these organisms should lead to a greater understanding of prions and their role in disease.

  20. Prions: the danger of biochemical weapons

    Directory of Open Access Journals (Sweden)

    Eric Almeida Xavier

    2014-09-01

    Full Text Available The knowledge of biotechnology increases the risk of using biochemical weapons for mass destruction. Prions are unprecedented infectious pathogens that cause a group of fatal neurodegenerative diseases by a novel mechanism. They are transmissible particles that are devoid of nucleic acid. Due to their singular characteristics, Prions emerge as potential danger since they can be used in the development of such weapons. Prions cause fatal infectious diseases, and to date there is no therapeutic or prophylactic approach against these diseases. Furthermore, Prions are resistant to food-preparation treatments such as high heat and can find their way from the digestive system into the nervous system; recombinant Prions are infectious either bound to soil particles or in aerosols. Therefore, lethal Prions can be developed by malicious researchers who could use it to attack political enemies since such weapons cause diseases that could be above suspicion.

  1. PrP P102L and Nearby Lysine Mutations Promote Spontaneous In Vitro Formation of Transmissible Prions.

    Science.gov (United States)

    Kraus, Allison; Raymond, Gregory J; Race, Brent; Campbell, Katrina J; Hughson, Andrew G; Anson, Kelsie J; Raymond, Lynne D; Caughey, Byron

    2017-11-01

    Accumulation of fibrillar protein aggregates is a hallmark of many diseases. While numerous proteins form fibrils by prion-like seeded polymerization in vitro , only some are transmissible and pathogenic in vivo To probe the structural features that confer transmissibility to prion protein (PrP) fibrils, we have analyzed synthetic PrP amyloids with or without the human prion disease-associated P102L mutation. The formation of infectious prions from PrP molecules in vitro has required cofactors and/or unphysiological denaturing conditions. Here, we demonstrate that, under physiologically compatible conditions without cofactors, the P102L mutation in recombinant hamster PrP promoted prion formation when seeded by minute amounts of scrapie prions in vitro Surprisingly, combination of the P102L mutation with charge-neutralizing substitutions of four nearby lysines promoted spontaneous prion formation. When inoculated into hamsters, both of these types of synthetic prions initiated substantial accumulation of prion seeding activity and protease-resistant PrP without transmissible spongiform encephalopathy (TSE) clinical signs or notable glial activation. Our evidence suggests that PrP's centrally located proline and lysine residues act as conformational switches in the in vitro formation of transmissible PrP amyloids. IMPORTANCE Many diseases involve the damaging accumulation of specific misfolded proteins in thread-like aggregates. These threads (fibrils) are capable of growing on the ends by seeding the refolding and incorporation of the normal form of the given protein. In many cases such aggregates can be infectious and propagate like prions when transmitted from one individual host to another. Some transmitted aggregates can cause fatal disease, as with human iatrogenic prion diseases, while other aggregates appear to be relatively innocuous. The factors that distinguish infectious and pathogenic protein aggregates from more innocuous ones are poorly understood

  2. The Endoplasmic Reticulum Chaperone GRP78/BiP Modulates Prion Propagation in vitro and in vivo.

    Science.gov (United States)

    Park, Kyung-Won; Eun Kim, Gyoung; Morales, Rodrigo; Moda, Fabio; Moreno-Gonzalez, Ines; Concha-Marambio, Luis; Lee, Amy S; Hetz, Claudio; Soto, Claudio

    2017-03-23

    Prion diseases are fatal neurodegenerative disorders affecting several mammalian species, characterized by the accumulation of the misfolded form of the prion protein, which is followed by the induction of endoplasmic reticulum (ER) stress and the activation of the unfolded protein response (UPR). GRP78, also called BiP, is a master regulator of the UPR, reducing ER stress levels and apoptosis due to an enhancement of the cellular folding capacity. Here, we studied the role of GRP78 in prion diseases using several in vivo and in vitro approaches. Our results show that a reduction in the expression of this molecular chaperone accelerates prion pathogenesis in vivo. In addition, we observed that prion replication in cell culture was inversely related to the levels of expression of GRP78 and that both proteins interact in the cellular context. Finally, incubation of PrP Sc with recombinant GRP78 led to the dose-dependent reduction of protease-resistant PrP Sc in vitro. Our results uncover a novel role of GRP78 in reducing prion pathogenesis, suggesting that modulating its levels/activity may offer a novel opportunity for designing therapeutic approaches for these diseases. These findings may also have implications for other diseases involving the accumulation of misfolded proteins.

  3. The Effects of Imatinib Mesylate on Cellular Viability, Platelet Derived Growth Factor and Stem Cell Factor in Mouse Testicular Normal Leydig Cells.

    Science.gov (United States)

    Kheradmand, Fatemeh; Hashemnia, Seyyed Mohammad Reza; Valizadeh, Nasim; Roshan-Milani, Shiva

    2016-01-01

    Growth factors play an essential role in the development of tumor and normal cells like testicular leydig cells. Treatment of cancer with anti-cancer agents like imatinib mesylate may interfere with normal leydig cell activity, growth and fertility through failure in growth factors' production or their signaling pathways. The purpose of the study was to determine cellular viability and the levels of, platelet derived growth factor (PDGF) and stem cell factor (SCF) in normal mouse leydig cells exposed to imatinib, and addressing the effect of imatinib on fertility potential. The mouse TM3 leydig cells were treated with 0 (control), 2.5, 5, 10 and 20 μM imatinib for 2, 4 and 6 days. Each experiment was repeated three times (15 experiments in each day).The cellular viability and growth factors levels were assessed by MTT and ELISA methods, respectively. For statistical analysis, one-way ANOVA with Tukey's post hoc and Kruskal-Wallis test were performed. A p-value less than 0.05 was considered statistically significant. With increasing drug concentration, cellular viability decreased significantly (pcellular viability, PDGF and SCF levels. Imatinib may reduce fertility potential especially at higher concentrations in patients treated with this drug by decreasing cellular viability. The effect of imatinib on leydig cells is associated with PDGF stimulation. Of course future studies can be helpful in exploring the long term effects of this drug.

  4. A role for astroglia in prion diseases.

    Science.gov (United States)

    Aguzzi, Adriano; Liu, Yingjun

    2017-12-04

    In this issue of JEM, Krejciova et al. (https://doi.org/10.1084/jem.20161547) report that astrocytes derived from human iPSCs can replicate human CJD prions. These observations provide a new, potentially very valuable model for studying human prions in cellula and for identifying antiprion compounds that might serve as clinical candidates. Furthermore, they add to the evidence that astrocytes may not be just innocent bystanders in prion diseases. © 2017 Aguzzi and Liu.

  5. Lichens: Unexpected anti-prion agents?

    Science.gov (United States)

    Rodriguez, Cynthia M.; Bennett, James P.; Johnson, Christopher J.

    2012-01-01

    The prion diseases sheep scrapie and cervid chronic wasting disease are transmitted, in part, via an environmental reservoir of infectivity; prions released from infected animals persist in the environment and can cause disease years later. Central to controlling disease transmission is the identification of methods capable of inactivating these agents on the landscape. We have found that certain lichens, common, ubiquitous, symbiotic organisms, possess a serine protease capable of degrading prion protein (PrP) from prion-infected animals. The protease functions against a range of prion strains from various hosts and reduces levels of abnormal PrP by at least two logs. We have now tested more than 20 lichen species from several geographical locations and from various taxa and found that approximately half of these species degrade PrP. Critical next steps include examining the effect of lichens on prion infectivity and cloning the protease responsible for PrP degradation. The impact of lichens on prions in the environment remains unknown. We speculate that lichens could have the potential to degrade prions when they are shed from infected animals onto lichens or into environments where lichens are abundant. In addition, lichens are frequently consumed by cervids and many other animals and the effect of dietary lichens on prion disease transmission should also be considered.

  6. Prion propagation and toxicity occur in vitro with two-phase kinetics specific to strain and neuronal type.

    Science.gov (United States)

    Hannaoui, Samia; Maatouk, Layal; Privat, Nicolas; Levavasseur, Etienne; Faucheux, Baptiste A; Haïk, Stéphane

    2013-03-01

    Prion diseases, or transmissible spongiform encephalopathies (TSEs), are fatal neurodegenerative disorders that occur in humans and animals. The neuropathological hallmarks of TSEs are spongiosis, glial proliferation, and neuronal loss. The only known specific molecular marker of TSEs is the abnormal isoform (PrP(Sc)) of the host-encoded prion protein (PrP(C)), which accumulates in the brain of infected subjects and forms infectious prion particles. Although this transmissible agent lacks a specific nucleic acid component, several prion strains have been isolated. Prion strains are characterized by differences in disease outcome, PrP(Sc) distribution patterns, and brain lesion profiles at the terminal stage of the disease. The molecular factors and cellular mechanisms involved in strain-specific neuronal tropism and toxicity remain largely unknown. Currently, no cellular model exists to facilitate in vitro studies of these processes. A few cultured cell lines that maintain persistent scrapie infections have been developed, but only two of them have shown the cytotoxic effects associated with prion propagation. In this study, we have developed primary neuronal cultures to assess in vitro neuronal tropism and toxicity of different prion strains (scrapie strains 139A, ME7, and 22L). We have tested primary neuronal cultures enriched in cerebellar granular, striatal, or cortical neurons. Our results showed that (i) a strain-specific neuronal tropism operated in vitro; (ii) the cytotoxic effect varied among strains and neuronal cell types; (iii) prion propagation and toxicity occurred in two kinetic phases, a replicative phase followed by a toxic phase; and (iv) neurotoxicity peaked when abnormal PrP accumulation reached a plateau.

  7. PrP(Sc-specific antibodies with the ability to immunodetect prion oligomers.

    Directory of Open Access Journals (Sweden)

    Mourad Tayebi

    Full Text Available The development of antibodies with binding capacity towards soluble oligomeric forms of PrPSc recognised in the aggregation process in early stage of the disease would be of paramount importance in diagnosing prion diseases before extensive neuropathology has ensued. As blood transfusion appears to be efficient in the transmission of the infectious prion agent, there is an urgent need to develop reagents that would specifically recognize oligomeric forms of the abnormally folded prion protein, PrPSc.To that end, we show that anti-PrP monoclonal antibodies (called PRIOC mAbs derived from mice immunised with native PrP-coated microbeads are able to immunodetect oligomers/multimers of PrPSc. Oligomer-specific immunoreactivity displayed by these PRIOC mAbs was demonstrated as large aggregates of immunoreactive deposits in prion-permissive neuroblastoma cell lines but not in equivalent non-infected or prn-p(0/0 cell lines. In contrast, an anti-monomer PrP antibody displayed diffuse immunoreactivity restricted to the cell membrane. Furthermore, our PRIOC mAbs did not display any binding with monomeric recombinant and cellular prion proteins but strongly detected PrPSc oligomers as shown by a newly developed sensitive and specific ELISA. Finally, PrioC antibodies were also able to bind soluble oligomers formed of Aβ and α-synuclein. These findings demonstrate the potential use of anti-prion antibodies that bind PrPSc oligomers, recognised in early stage of the disease, for the diagnosis of prion diseases in blood and other body fluids.

  8. Logical design of anti-prion agents using NAGARA

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Biao; Yamaguchi, Keiichi; Fukuoka, Mayuko [United Graduate School of Drug Discovery and Medical Information Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193 (Japan); Kuwata, Kazuo, E-mail: kuwata@gifu-u.ac.jp [United Graduate School of Drug Discovery and Medical Information Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193 (Japan); Department of Gene and Development, Graduate School of Medicine, Gifu University, 1-1 Yanagido, Gifu 501-1193 (Japan)

    2016-01-22

    To accelerate the logical drug design procedure, we created the program “NAGARA,” a plugin for PyMOL, and applied it to the discovery of small compounds called medical chaperones (MCs) that stabilize the cellular form of a prion protein (PrP{sup C}). In NAGARA, we constructed a single platform to unify the docking simulation (DS), free energy calculation by molecular dynamics (MD) simulation, and interfragment interaction energy (IFIE) calculation by quantum chemistry (QC) calculation. NAGARA also enables large-scale parallel computing via a convenient graphical user interface. Here, we demonstrated its performance and its broad applicability from drug discovery to lead optimization with full compatibility with various experimental methods including Western blotting (WB) analysis, surface plasmon resonance (SPR), and nuclear magnetic resonance (NMR) measurements. Combining DS and WB, we discovered anti-prion activities for two compounds and tegobuvir (TGV), a non-nucleoside non-structural protein NS5B polymerase inhibitor showing activity against hepatitis C virus genotype 1. Binding profiles predicted by MD and QC are consistent with those obtained by SPR and NMR. Free energy analyses showed that these compounds stabilize the PrP{sup C} conformation by decreasing the conformational fluctuation of the PrP{sup C}. Because TGV has been already approved as a medicine, its extension to prion diseases is straightforward. Finally, we evaluated the affinities of the fragmented regions of TGV using QC and found a clue for its further optimization. By repeating WB, MD, and QC recursively, we were able to obtain the optimum lead structure. - Highlights: • NAGARA integrates docking simulation, molecular dynamics, and quantum chemistry. • We found many compounds, e.g., tegobuvir (TGV), that exhibit anti-prion activities. • We obtained insights into the action mechanism of TGV as a medical chaperone. • Using QC, we obtained useful information for optimization of the

  9. Prion diseases: immunotargets and therapy

    Directory of Open Access Journals (Sweden)

    Burchell JT

    2016-06-01

    Full Text Available Jennifer T Burchell, Peter K Panegyres Neurodegenerative Disorders Research Pty Ltd, West Perth, Western Australia, Australia Abstract: Transmissible spongiform encephathalopathies or prion diseases are a group of neurological disorders characterized by neuronal loss, spongiform degeneration, and activation of astrocytes or microglia. These diseases affect humans and animals with an extremely high prevalence in some species such as deer and elk in North America. Although rare in humans, they result in a devastatingly swift neurological progression with dementia and ataxia. Patients usually die within a year of diagnosis. Prion diseases are familial, sporadic, iatrogenic, or transmissible. Human prion diseases include Kuru, sporadic, iatrogenic, and familial forms of Creutzfeldt–Jakob disease, variant Creutzfeldt–Jakob disease, Gerstmann–Sträussler–Scheinker disease, and fatal familial insomnia. The causative agent is a misfolded version of the physiological prion protein called PrPSc in the brain. There are a number of therapeutic options currently under investigation. A number of small molecules have had some success in delaying disease progression in animal models and mixed results in clinical trials, including pentosan polysulfate, quinacrine, and amphotericin B. More promisingly, immunotherapy has reported success in vitro and in vivo in animal studies and clinical trials. The three main branches of immunotherapy research are focus on antibody vaccines, dendritic cell vaccines, and adoptive transfer of physiological prion protein-specific CD4+ T-lymphocytes. Vaccines utilizing antibodies generally target disease-specific epitopes that are only exposed in the misfolded PrPSc conformation. Vaccines utilizing antigen-loaded dendritic cell have the ability to bypass immune tolerance and prime CD4+ cells to initiate an immune response. Adoptive transfer of CD4+ T-cells is another promising target as this cell type can orchestrate the

  10. Using precursor ion scan of 184 with liquid chromatography-electrospray ionization-tandem mass spectrometry for concentration normalization in cellular lipidomic studies.

    Science.gov (United States)

    Chao, Hsi-Chun; Chen, Guan-Yuan; Hsu, Lih-Ching; Liao, Hsiao-Wei; Yang, Sin-Yu; Wang, San-Yuan; Li, Yu-Liang; Tang, Sung-Chun; Tseng, Yufeng Jane; Kuo, Ching-Hua

    2017-06-08

    Cellular lipidomic studies have been favored approaches in many biomedical research areas. To provide fair comparisons of the studied cells, it is essential to perform normalization of the determined concentration before lipidomic analysis. This study proposed a cellular lipidomic normalization method by measuring the phosphatidylcholine (PC) and sphingomyelin (SM) contents in cell extracts. To provide efficient analysis of PC and SM in cell extracts, flow injection analysis-electrospray ionization-tandem mass spectrometry (FIA-ESI-MS/MS) with a precursor ion scan (PIS) of m/z 184 was used, and the parameters affecting the performance of the method were optimized. Good linearity could be observed between the cell extract dilution factor and the reciprocal of the total ion chromatogram (TIC) area in the PIS of m/z 184 within the dilution range of 1- to 16-fold (R 2  = 0.998). The calibration curve could be used for concentration adjustment of the unknown concentration of a cell extract. The intraday and intermediate precisions were below 10%. The accuracy ranged from 93.0% to 105.6%. The performance of the new normalization method was evaluated using different numbers of HCT-116 cells. Sphingosine, ceramide (d18:1/18:0), SM (d18:1/18:0) and PC (16:1/18:0) were selected as the representative test lipid species, and the results showed that the peak areas of each lipid species obtained from different cell numbers were within a 20% variation after normalization. Finally, the PIS of 184 normalization method was applied to study ischemia-induced neuron injury using oxygen and glucose deprivation (OGD) on primary neuronal cultured cells. Our results showed that the PIS of 184 normalization method is an efficient and effective approach for concentration normalization in cellular lipidomic studies. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. The prion protein has DNA strand transfer properties similar to retroviral nucleocapsid protein.

    Science.gov (United States)

    Gabus, C; Auxilien, S; Péchoux, C; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W; Nandi, P; Darlix, J L

    2001-04-06

    The transmissible spongiform encephalopathies are fatal neurodegenerative diseases that are associated with the accumulation of a protease-resistant form of the cellular prion protein (PrP). Although PrP is highly conserved and widely expressed in vertebrates, its function remains a matter of speculation. Indeed PrP null mice develop normally and are healthy. Recent results show that PrP binds to nucleic acids in vitro and is found associated with retroviral particles. Furthermore, in mice the scrapie infectious process appears to be accelerated by MuLV replication. These observations prompted us to further investigate the interaction between PrP and nucleic acids, and compare it with that of the retroviral nucleocapsid protein (NC). As the major nucleic acid-binding protein of the retroviral particle, NC protein is tightly associated with the genomic RNA in the virion nucleocapsid, where it chaperones proviral DNA synthesis by reverse transcriptase. Our results show that the human prion protein (huPrP) functionally resembles NCp7 of HIV-1. Both proteins form large nucleoprotein complexes upon binding to DNA. They accelerate the hybridization of complementary DNA strands and chaperone viral DNA synthesis during the minus and plus DNA strand transfers necessary to generate the long terminal repeats. The DNA-binding and strand transfer properties of huPrP appear to map to the N-terminal fragment comprising residues 23 to 144, whereas the C-terminal domain is inactive. These findings suggest that PrP could be involved in nucleic acid metabolism in vivo. Copyright 2001 Academic Press.

  12. Monitoring prion protein expression in complex biological samples by SERS for diagnostic applications

    International Nuclear Information System (INIS)

    Manno, D; Filippo, E; Fiore, R; Serra, A; Urso, E; Rizzello, A; Maffia, M

    2010-01-01

    Surface-enhanced Raman spectroscopy (SERS) allows a new insight into the analysis of cell physiology. In this work, the difficulty of producing suitable substrates that, besides permitting the amplification of the Raman signal, do not interact with the biological material causing alteration, has been overcome by a combined method of hydrothermal green synthesis and thermal annealing. The SERS analysis of the cell membrane has been performed with special attention to the cellular prion protein PrP C . In addition, SERS has also been used to reveal the prion protein-Cu(II) interaction in four different cell models (B104, SH-SY5Y, GN11, HeLa), expressing PrP C at different levels. A significant implication of the current work consists of the intriguing possibility of revealing and quantifying prion protein expression in complex biological samples by a cheap SERS-based method, replacing the expensive and time-consuming immuno-assay systems commonly employed.

  13. Accelerated high fidelity prion amplification within and across prion species barriers.

    Directory of Open Access Journals (Sweden)

    Kristi M Green

    2008-08-01

    Full Text Available Experimental obstacles have impeded our ability to study prion transmission within and, more particularly, between species. Here, we used cervid prion protein expressed in brain extracts of transgenic mice, referred to as Tg(CerPrP, as a substrate for in vitro generation of chronic wasting disease (CWD prions by protein misfolding cyclic amplification (PMCA. Characterization of this infectivity in Tg(CerPrP mice demonstrated that serial PMCA resulted in the high fidelity amplification of CWD prions with apparently unaltered properties. Using similar methods to amplify mouse RML prions and characterize the resulting novel cervid prions, we show that serial PMCA abrogated a transmission barrier that required several hundred days of adaptation and subsequent stabilization in Tg(CerPrP mice. While both approaches produced cervid prions with characteristics distinct from CWD, the subtly different properties of the resulting individual prion isolates indicated that adaptation of mouse RML prions generated multiple strains following inter-species transmission. Our studies demonstrate that combined transgenic mouse and PMCA approaches not only expedite intra- and inter-species prion transmission, but also provide a facile means of generating and characterizing novel prion strains.

  14. Classical Bovine Spongiform Encephalopathy by Transmission of H-Type Prion in Homologous Prion Protein Context

    Science.gov (United States)

    Andréoletti, Olivier; Lacroux, Caroline; Prieto, Irene; Lorenzo, Patricia; Larska, Magdalena; Baron, Thierry; Espinosa, Juan-Carlos

    2011-01-01

    Bovine spongiform encephalopathy (BSE) and BSE-related disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profiles of abnormal protease-resistant prion protein (PrPres), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molecular and neuropathologic properties during transmission in transgenic mice expressing homologous bovine prion protein. Unexpectedly, in several inoculated animals, strain features emerged that were highly similar to those of classical BSE agent. These findings demonstrate the capability of an atypical bovine prion to acquire classical BSE–like properties during propagation in a homologous bovine prion protein context and support the view that the epidemic BSE agent could have originated from such a cattle prion. PMID:21888788

  15. Acrolein-Exposed Normal Human Lung Fibroblasts in Vitro: Cellular Senescence, Enhanced Telomere Erosion, and Degradation of Werner’s Syndrome Protein

    Science.gov (United States)

    Jang, Jun-Ho; Bruse, Shannon; Huneidi, Salam; Schrader, Ronald M.; Monick, Martha M.; Lin, Yong; Carter, A. Brent; Klingelhutz, Aloysius J.

    2014-01-01

    Background: Acrolein is a ubiquitous environmental hazard to human health. Acrolein has been reported to activate the DNA damage response and induce apoptosis. However, little is known about the effects of acrolein on cellular senescence. Objectives: We examined whether acrolein induces cellular senescence in cultured normal human lung fibroblasts (NHLF). Methods: We cultured NHLF in the presence or absence of acrolein and determined the effects of acrolein on cell proliferative capacity, senescence-associated β-galactosidase activity, the known senescence-inducing pathways (e.g., p53, p21), and telomere length. Results: We found that acrolein induced cellular senescence by increasing both p53 and p21. The knockdown of p53 mediated by small interfering RNA (siRNA) attenuated acrolein-induced cellular senescence. Acrolein decreased Werner’s syndrome protein (WRN), a member of the RecQ helicase family involved in DNA repair and telomere maintenance. Acrolein-induced down-regulation of WRN protein was rescued by p53 knockdown or proteasome inhibition. Finally, we found that acrolein accelerated p53-mediated telomere shortening. Conclusions: These results suggest that acrolein induces p53-mediated cellular senescence accompanied by enhanced telomere attrition and WRN protein down-regulation. Citation: Jang JH, Bruse S, Huneidi S, Schrader RM, Monick MM, Lin Y, Carter AB, Klingelhutz AJ, Nyunoya T. 2014. Acrolein-exposed normal human lung fibroblasts in vitro: cellular senescence, enhanced telomere erosion, and degradation of Werner’s syndrome protein. Environ Health Perspect 122:955–962; http://dx.doi.org/10.1289/ehp.1306911 PMID:24747221

  16. Assessing transmissible spongiform encephalopathy species barriers with an in vitro prion protein conversion assay

    Science.gov (United States)

    Johnson, Christopher J.; Carlson, Christina M.; Morawski, Aaron R.; Manthei, Alyson; Cashman, Neil R.

    2015-01-01

    Studies to understanding interspecies transmission of transmissible spongiform encephalopathies (TSEs, prion diseases) are challenging in that they typically rely upon lengthy and costly in vivo animal challenge studies. A number of in vitro assays have been developed to aid in measuring prion species barriers, thereby reducing animal use and providing quicker results than animal bioassays. Here, we present the protocol for a rapid in vitroprion conversion assay called the conversion efficiency ratio (CER) assay. In this assay cellular prion protein (PrPC) from an uninfected host brain is denatured at both pH 7.4 and 3.5 to produce two substrates. When the pH 7.4 substrate is incubated with TSE agent, the amount of PrPC that converts to a proteinase K (PK)-resistant state is modulated by the original host’s species barrier to the TSE agent. In contrast, PrPC in the pH 3.5 substrate is misfolded by any TSE agent. By comparing the amount of PK-resistant prion protein in the two substrates, an assessment of the host’s species barrier can be made. We show that the CER assay correctly predicts known prion species barriers of laboratory mice and, as an example, show some preliminary results suggesting that bobcats (Lynx rufus) may be susceptible to white-tailed deer (Odocoileus virginianus) chronic wasting disease agent.

  17. Small stress molecules inhibit aggregation and neurotoxicity of prion peptide 106-126

    International Nuclear Information System (INIS)

    Kanapathipillai, Mathumai; Ku, Sook Hee; Girigoswami, Koyeli; Park, Chan Beum

    2008-01-01

    In prion diseases, the posttranslational modification of host-encoded prion protein PrP c yields a high β-sheet content modified protein PrP sc , which further polymerizes into amyloid fibrils. PrP106-126 initiates the conformational changes leading to the conversion of PrP c to PrP sc . Molecules that can defunctionalize such peptides can serve as a potential tool in combating prion diseases. In microorganisms during stressed conditions, small stress molecules (SSMs) are formed to prevent protein denaturation and maintain protein stability and function. The effect of such SSMs on PrP106-126 amyloid formation is explored in the present study using turbidity, atomic force microscopy (AFM), and cellular toxicity assay. Turbidity and AFM studies clearly depict that the SSMs-ectoine and mannosylglyceramide (MGA) inhibit the PrP106-126 aggregation. Our study also connotes that ectoine and MGA offer strong resistance to prion peptide-induced toxicity in human neuroblastoma cells, concluding that such molecules can be potential inhibitors of prion aggregation and toxicity

  18. Defining the conformational features of anchorless, poorly neuroinvasive prions.

    Directory of Open Access Journals (Sweden)

    Cyrus Bett

    Full Text Available Infectious prions cause diverse clinical signs and form an extraordinary range of structures, from amorphous aggregates to fibrils. How the conformation of a prion dictates the disease phenotype remains unclear. Mice expressing GPI-anchorless or GPI-anchored prion protein exposed to the same infectious prion develop fibrillar or nonfibrillar aggregates, respectively, and show a striking divergence in the disease pathogenesis. To better understand how a prion's physical properties govern the pathogenesis, infectious anchorless prions were passaged in mice expressing anchorless prion protein and the resulting prions were biochemically characterized. Serial passage of anchorless prions led to a significant decrease in the incubation period to terminal disease and altered the biochemical properties, consistent with a transmission barrier effect. After an intraperitoneal exposure, anchorless prions were only weakly neuroinvasive, as prion plaques rarely occurred in the brain yet were abundant in extracerebral sites such as heart and adipose tissue. Anchorless prions consistently showed very high stability in chaotropes or when heated in SDS, and were highly resistant to enzyme digestion. Consistent with the results in mice, anchorless prions from a human patient were also highly stable in chaotropes. These findings reveal that anchorless prions consist of fibrillar and highly stable conformers. The additional finding from our group and others that both anchorless and anchored prion fibrils are poorly neuroinvasive strengthens the hypothesis that a fibrillar prion structure impedes efficient CNS invasion.

  19. Localization of A11-reactive oligomeric species in prion diseases

    DEFF Research Database (Denmark)

    Aidt, Frederik H; Hasholt, Lis F; Christiansen, Michael

    2013-01-01

    To investigate in prion diseases the in-situ localization of prion protein oligomers sharing a common epitope with amyloid oligomers involved in a range of neurodegenerative diseases.......To investigate in prion diseases the in-situ localization of prion protein oligomers sharing a common epitope with amyloid oligomers involved in a range of neurodegenerative diseases....

  20. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  1. Direct Detection of Soil-Bound Prions

    Science.gov (United States)

    Genovesi, Sacha; Leita, Liviana; Sequi, Paolo; Andrighetto, Igino; Sorgato, M. Catia; Bertoli, Alessandro

    2007-01-01

    Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrPSc) of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challanged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures. PMID:17957252

  2. Direct detection of soil-bound prions.

    Directory of Open Access Journals (Sweden)

    Sacha Genovesi

    Full Text Available Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrP(Sc of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challenged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures.

  3. Fibrillarin, a nucleolar protein, is required for normal nuclear morphology and cellular growth in HeLa cells

    International Nuclear Information System (INIS)

    Amin, Mohammed Abdullahel; Matsunaga, Sachihiro; Ma, Nan; Takata, Hideaki; Yokoyama, Masami; Uchiyama, Susumu; Fukui, Kiichi

    2007-01-01

    Fibrillarin is a key small nucleolar protein in eukaryotes, which has an important role in pre-rRNA processing during ribosomal biogenesis. Though several functions of fibrillarin are known, its function during the cell cycle is still unknown. In this study, we confirmed the dynamic localization of fibrillarin during the cell cycle of HeLa cells and also performed functional studies by using a combination of immunofluorescence microscopy and RNAi technique. We observed that depletion of fibrillarin has almost no effect on the nucleolar structure. However, fibrillarin-depleted cells showed abnormal nuclear morphology. Moreover, fibrillarin depletion resulted in the reduction of the cellular growth and modest accumulation of cells with 4n DNA content. Our data suggest that fibrillarin would play a critical role in the maintenance of nuclear shape and cellular growth

  4. Brain delivery of AAV9 expressing an anti-PrP monovalent antibody delays prion disease in mice.

    Science.gov (United States)

    Moda, Fabio; Vimercati, Chiara; Campagnani, Ilaria; Ruggerone, Margherita; Giaccone, Giorgio; Morbin, Michela; Zentilin, Lorena; Giacca, Mauro; Zucca, Ileana; Legname, Giuseppe; Tagliavini, Fabrizio

    2012-01-01

    Prion diseases are caused by a conformational modification of the cellular prion protein (PrP (C)) into disease-specific forms, termed PrP (Sc), that have the ability to interact with PrP (C) promoting its conversion to PrP (Sc). In vitro studies demonstrated that anti-PrP antibodies inhibit this process. In particular, the single chain variable fragment D18 antibody (scFvD18) showed high efficiency in curing chronically prion-infected cells. This molecule binds the PrP (C) region involved in the interaction with PrP (Sc) thus halting further prion formation. These findings prompted us to test the efficiency of scFvD18 in vivo. A recombinant Adeno-Associated Viral vector serotype 9 was used to deliver scFvD18 to the brain of mice that were subsequently infected by intraperitoneal route with the mouse-adapted scrapie strain RML. We found that the treatment was safe, prolonged the incubation time of scrapie-infected animals and decreased the burden of total proteinase-resistant PrP (Sc) in the brain, suggesting that scFvD18 interferes with prion replication in vivo. This approach is relevant for designing new therapeutic strategies for prion diseases and other disorders characterized by protein misfolding.

  5. Glycoform-Selective Prion Formation in Sporadic and Familial Forms of Prion Disease

    Science.gov (United States)

    Xiao, Xiangzhu; Yuan, Jue; Haïk, Stéphane; Cali, Ignazio; Zhan, Yian; Moudjou, Mohammed; Li, Baiya; Laplanche, Jean-Louis; Laude, Hubert; Langeveld, Jan; Gambetti, Pierluigi; Kitamoto, Tetsuyuki; Kong, Qingzhong; Brandel, Jean-Philippe; Cobb, Brian A.; Petersen, Robert B.; Zou, Wen-Quan

    2013-01-01

    The four glycoforms of the cellular prion protein (PrPC) variably glycosylated at the two N-linked glycosylation sites are converted into their pathological forms (PrPSc) in most cases of sporadic prion diseases. However, a prominent molecular characteristic of PrPSc in the recently identified variably protease-sensitive prionopathy (VPSPr) is the absence of a diglycosylated form, also notable in familial Creutzfeldt-Jakob disease (fCJD), which is linked to mutations in PrP either from Val to Ile at residue 180 (fCJDV180I) or from Thr to Ala at residue 183 (fCJDT183A). Here we report that fCJDV180I, but not fCJDT183A, exhibits a proteinase K (PK)-resistant PrP (PrPres) that is markedly similar to that observed in VPSPr, which exhibits a five-step ladder-like electrophoretic profile, a molecular hallmark of VPSPr. Remarkably, the absence of the diglycosylated PrPres species in both fCJDV180I and VPSPr is likewise attributable to the absence of PrPres glycosylated at the first N-linked glycosylation site at residue 181, as in fCJDT183A. In contrast to fCJDT183A, both VPSPr and fCJDV180I exhibit glycosylation at residue 181 on di- and monoglycosylated (mono181) PrP prior to PK-treatment. Furthermore, PrPV180I with a typical glycoform profile from cultured cells generates detectable PrPres that also contains the diglycosylated PrP in addition to mono- and unglycosylated forms upon PK-treatment. Taken together, our current in vivo and in vitro studies indicate that sporadic VPSPr and familial CJDV180I share a unique glycoform-selective prion formation pathway in which the conversion of diglycosylated and mono181 PrPC to PrPSc is inhibited, probably by a dominant-negative effect, or by other co-factors. PMID:23527023

  6. Prion disease susceptibility is affected by β-structure folding propensity and local side-chain interactions in PrP

    Science.gov (United States)

    Khan, M. Qasim; Sweeting, Braden; Mulligan, Vikram Khipple; Arslan, Pharhad Eli; Cashman, Neil R.; Pai, Emil F.; Chakrabartty, Avijit

    2010-01-01

    Prion diseases occur when the normally α-helical prion protein (PrP) converts to a pathological β-structured state with prion infectivity (PrPSc). Exposure to PrPSc from other mammals can catalyze this conversion. Evidence from experimental and accidental transmission of prions suggests that mammals vary in their prion disease susceptibility: Hamsters and mice show relatively high susceptibility, whereas rabbits, horses, and dogs show low susceptibility. Using a novel approach to quantify conformational states of PrP by circular dichroism (CD), we find that prion susceptibility tracks with the intrinsic propensity of mammalian PrP to convert from the native, α-helical state to a cytotoxic β-structured state, which exists in a monomer–octamer equilibrium. It has been controversial whether β-structured monomers exist at acidic pH; sedimentation equilibrium and dual-wavelength CD evidence is presented for an equilibrium between a β-structured monomer and octamer in some acidic pH conditions. Our X-ray crystallographic structure of rabbit PrP has identified a key helix-capping motif implicated in the low prion disease susceptibility of rabbits. Removal of this capping motif increases the β-structure folding propensity of rabbit PrP to match that of PrP from mouse, a species more susceptible to prion disease. PMID:21041683

  7. Prion disease susceptibility is affected by beta-structure folding propensity and local side-chain interactions in PrP.

    Science.gov (United States)

    Khan, M Qasim; Sweeting, Braden; Mulligan, Vikram Khipple; Arslan, Pharhad Eli; Cashman, Neil R; Pai, Emil F; Chakrabartty, Avijit

    2010-11-16

    Prion diseases occur when the normally α-helical prion protein (PrP) converts to a pathological β-structured state with prion infectivity (PrP(Sc)). Exposure to PrP(Sc) from other mammals can catalyze this conversion. Evidence from experimental and accidental transmission of prions suggests that mammals vary in their prion disease susceptibility: Hamsters and mice show relatively high susceptibility, whereas rabbits, horses, and dogs show low susceptibility. Using a novel approach to quantify conformational states of PrP by circular dichroism (CD), we find that prion susceptibility tracks with the intrinsic propensity of mammalian PrP to convert from the native, α-helical state to a cytotoxic β-structured state, which exists in a monomer-octamer equilibrium. It has been controversial whether β-structured monomers exist at acidic pH; sedimentation equilibrium and dual-wavelength CD evidence is presented for an equilibrium between a β-structured monomer and octamer in some acidic pH conditions. Our X-ray crystallographic structure of rabbit PrP has identified a key helix-capping motif implicated in the low prion disease susceptibility of rabbits. Removal of this capping motif increases the β-structure folding propensity of rabbit PrP to match that of PrP from mouse, a species more susceptible to prion disease.

  8. Interaction of the 106-126 prion peptide with lipid membranes and potential implication for neurotoxicity

    International Nuclear Information System (INIS)

    Dupiereux, Ingrid; Zorzi, Willy; Lins, Laurence; Brasseur, Robert; Colson, Pierre; Heinen, Ernst; Elmoualij, Benaissa

    2005-01-01

    Prion diseases are fatal neurodegenerative disorders characterized by the accumulation in the brain of an abnormally misfolded, protease-resistant, and β-sheet rich pathogenic isoform (PrP sc ) of the cellular prion protein (PrP c ). In the present work, we were interested to study the mode of prion protein interaction with the membrane using the 106-126 peptide and small unilamellar lipid vesicles as model. As previously demonstrated, we showed by MTS assay that PrP 106-126 induces alterations in the human neuroblastoma SH-SY5Y cell line. We demonstrated for the first time by lipid-mixing assay and by the liposome vesicle leakage test that PrP 106-126, a non-tilted peptide, induces liposome fusion thus a potential cell membrane destabilization, as supported by membrane integrity assay (LDH). By circular dichroism (CD) analysis we showed that the fusogenic property of PrP 106-126 in the presence of liposome is associated with a predominantly β-sheet structure. These data suggest that the fusogenic property associated with a predominant β-sheet structure exhibited by the prion peptides contributes to the neurotoxicity of these peptides by destabilizing cellular membranes. The latter might be attached at the membrane surface in a parallel orientation as shown by molecular modeling

  9. Prion protein immunocytochemistry helps to establish the true incidence of prion diseases.

    Science.gov (United States)

    Lantos, P L; McGill, I S; Janota, I; Doey, L J; Collinge, J; Bruce, M T; Whatley, S A; Anderton, B H; Clinton, J; Roberts, G W

    1992-11-23

    Creutzfeldt-Jakob disease (CJD) and Gerstmann-Strüssler-Scheinker disease (GSSD) are transmissible spongiform encephalopathies or prion diseases affecting man. It has been reported that prion diseases may occur without the histological hallmarks of spongiform encephalopathies: vacuolation of the cerebral grey matter, neuronal loss and astrocytosis. These cases without characteristic neuropathology may go undiagnosed and consequently the true incidence of transmissible dementias is likely to have been under-estimated. Immunocytochemistry using antibodies to prion protein gives positive staining of these cases, albeit the pattern of immunostaining differs from that seen in typical forms. Accumulation of prion protein is a molecular hallmark of prion diseases, and thus a reproducible, speedy and cost-efficient immunocytochemical screening of unusual dementias may help to establish the true incidence of prion diseases.

  10. Phosphatidylinositol-glycan-phospholipase D is involved in neurodegeneration in prion disease.

    Directory of Open Access Journals (Sweden)

    Jae-Kwang Jin

    Full Text Available PrPSc is formed from a normal glycosylphosphatidylinositol (GPI-anchored prion protein (PrPC by a posttranslational modification. Most GPI-anchored proteins have been shown to be cleaved by GPI phospholipases. Recently, GPI-phospholipase D (GPI-PLD was shown to be a strictly specific enzyme for GPI anchors. To investigate the involvement of GPI-PLD in the processes of neurodegeneration in prion diseases, we examined the mRNA and protein expression levels of GPI-PLD in the brains of a prion animal model (scrapie, and in both the brains and cerebrospinal fluids (CSF of sporadic and familial Creutzfeldt-Jakob disease (CJD patients. We found that compared with controls, the expression of GPI-PLD was dramatically down-regulated in the brains of scrapie-infected mice, especially in the caveolin-enriched membrane fractions. Interestingly, the observed decrease in GPI-PLD expression levels began at the same time that PrPSc began to accumulate in the infected brains and this decrease was also observed in both the brain and CSF of CJD patients; however, no differences in expression were observed in either the brains or CSF specimens from Alzheimer's disease patients. Taken together, these results suggest that the down-regulation of GPI-PLD protein may be involved in prion propagation in the brains of prion diseases.

  11. Differential effects of divalent cations on elk prion protein fibril formation and stability

    Science.gov (United States)

    Misfolding of the normally folded prion protein of mammals (PrPC) into infectious fibrils causes a variety of different diseases, from scrapie in sheep to bovine spongiform encephalopathy in cattle to chronic wasting disease (CWD) in deer and elk. The misfolded form of PrPC, termed PrPSc, or in this...

  12. Methamphetamine increases Prion Protein and induces dopamine-dependent expression of protease resistant PrPsc.

    Science.gov (United States)

    Ferrucci, M; Ryskalin, L; Biagioni, F; Gambardella, S; Busceti, C L; Falleni, A; Lazzeri, G; Fornai, F

    2017-07-01

    The cellular prion protein (PrPc) is physiologically expressed within selective brain areas of mammals. Alterations in the secondary structure of this protein lead to scrapie-like prion protein (PrPsc), which precipitates in the cell. PrPsc has been detected in infectious, inherited or sporadic neurodegenerative disorders. Prion protein metabolism is dependent on autophagy and ubiquitin proteasome. Despite not being fully elucidated, the physiological role of prion protein relates to chaperones which rescue cells under stressful conditions.Methamphetamine (METH) is a widely abused drug which produces oxidative stress in various brain areas causing mitochondrial alterations and protein misfolding. These effects produce a compensatory increase of chaperones while clogging cell clearing pathways. In the present study, we explored whether METH administration modifies the amount of PrPc. Since high levels of PrPc when the clearing systems are clogged may lead to its misfolding into PrPsc, we further tested whether METH exposure triggers the appearance of PrPsc. We analysed the effects of METH and dopamine administration in PC12 and striatal cells by using SDS-PAGE Coomassie blue, immune- histochemistry and immune-gold electron microscopy. To analyze whether METH administration produces PrPsc aggregates we used antibodies directed against PrP following exposure to proteinase K or sarkosyl which digest folded PrPc but misfolded PrPsc. We fond that METH triggers PrPsc aggregates in DA-containing cells while METH is not effective in primary striatal neurons which do not produce DA. In the latter cells exogenous DA is needed to trigger PrPsc accumulation similarly to what happens in DA containing cells under the effects of METH. The present findings, while fostering novel molecular mechanisms involving prion proteins, indicate that, cell pathology similar to prion disorders can be mimicked via a DA-dependent mechanism by a drug of abuse.

  13. Sialic Acid on the Glycosylphosphatidylinositol Anchor Regulates PrP-mediated Cell Signaling and Prion Formation.

    Science.gov (United States)

    Bate, Clive; Nolan, William; Williams, Alun

    2016-01-01

    The prion diseases occur following the conversion of the cellular prion protein (PrP(C)) into disease-related isoforms (PrP(Sc)). In this study, the role of the glycosylphosphatidylinositol (GPI) anchor attached to PrP(C) in prion formation was examined using a cell painting technique. PrP(Sc) formation in two prion-infected neuronal cell lines (ScGT1 and ScN2a cells) and in scrapie-infected primary cortical neurons was increased following the introduction of PrP(C). In contrast, PrP(C) containing a GPI anchor from which the sialic acid had been removed (desialylated PrP(C)) was not converted to PrP(Sc). Furthermore, the presence of desialylated PrP(C) inhibited the production of PrP(Sc) within prion-infected cortical neurons and ScGT1 and ScN2a cells. The membrane rafts surrounding desialylated PrP(C) contained greater amounts of sialylated gangliosides and cholesterol than membrane rafts surrounding PrP(C). Desialylated PrP(C) was less sensitive to cholesterol depletion than PrP(C) and was not released from cells by treatment with glimepiride. The presence of desialylated PrP(C) in neurons caused the dissociation of cytoplasmic phospholipase A2 from PrP-containing membrane rafts and reduced the activation of cytoplasmic phospholipase A2. These findings show that the sialic acid moiety of the GPI attached to PrP(C) modifies local membrane microenvironments that are important in PrP-mediated cell signaling and PrP(Sc) formation. These results suggest that pharmacological modification of GPI glycosylation might constitute a novel therapeutic approach to prion diseases. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. The spread of prion-like proteins by lysosomes and tunneling nanotubes: Implications for neurodegenerative diseases.

    Science.gov (United States)

    Victoria, Guiliana Soraya; Zurzolo, Chiara

    2017-09-04

    Progression of pathology in neurodegenerative diseases is hypothesized to be a non-cell-autonomous process that may be mediated by the productive spreading of prion-like protein aggregates from a "donor cell" that is the source of misfolded aggregates to an "acceptor cell" in which misfolding is propagated by conversion of the normal protein. Although the proteins involved in the various diseases are unrelated, common pathways appear to be used for their intercellular propagation and spreading. Here, we summarize recent evidence of the molecular mechanisms relevant for the intercellular trafficking of protein aggregates involved in prion, Alzheimer's, Huntington's, and Parkinson's diseases. We focus in particular on the common roles that lysosomes and tunneling nanotubes play in the formation and spreading of prion-like assemblies. © 2017 Victoria and Zurzolo.

  15. De novo generation of infectious prions with bacterially expressed recombinant prion protein.

    Science.gov (United States)

    Zhang, Zhihong; Zhang, Yi; Wang, Fei; Wang, Xinhe; Xu, Yuanyuan; Yang, Huaiyi; Yu, Guohua; Yuan, Chonggang; Ma, Jiyan

    2013-12-01

    The prion hypothesis is strongly supported by the fact that prion infectivity and the pathogenic conformer of prion protein (PrP) are simultaneously propagated in vitro by the serial protein misfolding cyclic amplification (sPMCA). However, due to sPMCA's enormous amplification power, whether an infectious prion can be formed de novo with bacterially expressed recombinant PrP (rPrP) remains to be satisfactorily resolved. To address this question, we performed unseeded sPMCA with rPrP in a laboratory that has never been exposed to any native prions. Two types of proteinase K (PK)-resistant and self-perpetuating recombinant PrP conformers (rPrP-res) with PK-resistant cores of 17 or 14 kDa were generated. A bioassay revealed that rPrP-res(17kDa) was highly infectious, causing prion disease in wild-type mice with an average survival time of about 172 d. In contrast, rPrP-res(14kDa) completely failed to induce any disease. Our findings reveal that sPMCA is sufficient to initiate various self-perpetuating PK-resistant rPrP conformers, but not all of them possess in vivo infectivity. Moreover, generating an infectious prion in a prion-free environment establishes that an infectious prion can be formed de novo with bacterially expressed rPrP.

  16. Ex vivo mammalian prions are formed of paired double helical prion protein fibrils.

    Science.gov (United States)

    Terry, Cassandra; Wenborn, Adam; Gros, Nathalie; Sells, Jessica; Joiner, Susan; Hosszu, Laszlo L P; Tattum, M Howard; Panico, Silvia; Clare, Daniel K; Collinge, John; Saibil, Helen R; Wadsworth, Jonathan D F

    2016-05-01

    Mammalian prions are hypothesized to be fibrillar or amyloid forms of prion protein (PrP), but structures observed to date have not been definitively correlated with infectivity and the three-dimensional structure of infectious prions has remained obscure. Recently, we developed novel methods to obtain exceptionally pure preparations of prions from mouse brain and showed that pathogenic PrP in these high-titre preparations is assembled into rod-like assemblies. Here, we have used precise cell culture-based prion infectivity assays to define the physical relationship between the PrP rods and prion infectivity and have used electron tomography to define their architecture. We show that infectious PrP rods isolated from multiple prion strains have a common hierarchical assembly comprising twisted pairs of short fibres with repeating substructure. The architecture of the PrP rods provides a new structural basis for understanding prion infectivity and can explain the inability to systematically generate high-titre synthetic prions from recombinant PrP. © 2016 The Authors.

  17. Behavioral abnormalities in prion protein knockout mice and the potential relevance of PrPc for the cytoskeleton

    Science.gov (United States)

    The cellular prion protein (PrPC) is a highly conserved protein, which is anchored to the outer surface of the plasma membrane. Even though its physiological function has already been investigated in different cell or mouse models where PrPC expression is either up-regulated or depleted, its exact p...

  18. PrionScan: an online database of predicted prion domains in complete proteomes.

    Science.gov (United States)

    Espinosa Angarica, Vladimir; Angulo, Alfonso; Giner, Arturo; Losilla, Guillermo; Ventura, Salvador; Sancho, Javier

    2014-02-05

    Prions are a particular type of amyloids related to a large variety of important processes in cells, but also responsible for serious diseases in mammals and humans. The number of experimentally characterized prions is still low and corresponds to a handful of examples in microorganisms and mammals. Prion aggregation is mediated by specific protein domains with a remarkable compositional bias towards glutamine/asparagine and against charged residues and prolines. These compositional features have been used to predict new prion proteins in the genomes of different organisms. Despite these efforts, there are only a few available data sources containing prion predictions at a genomic scale. Here we present PrionScan, a new database of predicted prion-like domains in complete proteomes. We have previously developed a predictive methodology to identify and score prionogenic stretches in protein sequences. In the present work, we exploit this approach to scan all the protein sequences in public databases and compile a repository containing relevant information of proteins bearing prion-like domains. The database is updated regularly alongside UniprotKB and in its present version contains approximately 28000 predictions in proteins from different functional categories in more than 3200 organisms from all the taxonomic subdivisions. PrionScan can be used in two different ways: database query and analysis of protein sequences submitted by the users. In the first mode, simple queries allow to retrieve a detailed description of the properties of a defined protein. Queries can also be combined to generate more complex and specific searching patterns. In the second mode, users can submit and analyze their own sequences. It is expected that this database would provide relevant insights on prion functions and regulation from a genome-wide perspective, allowing researches performing cross-species prion biology studies. Our database might also be useful for guiding experimentalists

  19. Prions in milk from ewes incubating natural scrapie.

    Directory of Open Access Journals (Sweden)

    Caroline Lacroux

    2008-12-01

    Full Text Available Since prion infectivity had never been reported in milk, dairy products originating from transmissible spongiform encephalopathy (TSE-affected ruminant flocks currently enter unrestricted into the animal and human food chain. However, a recently published study brought the first evidence of the presence of prions in mammary secretions from scrapie-affected ewes. Here we report the detection of consistent levels of infectivity in colostrum and milk from sheep incubating natural scrapie, several months prior to clinical onset. Additionally, abnormal PrP was detected, by immunohistochemistry and PET blot, in lacteal ducts and mammary acini. This PrP(Sc accumulation was detected only in ewes harbouring mammary ectopic lymphoid follicles that developed consequent to Maedi lentivirus infection. However, bioassay revealed that prion infectivity was present in milk and colostrum, not only from ewes with such lympho-proliferative chronic mastitis, but also from those displaying lesion-free mammary glands. In milk and colostrum, infectivity could be recovered in the cellular, cream, and casein-whey fractions. In our samples, using a Tg 338 mouse model, the highest per ml infectious titre measured was found to be equivalent to that contained in 6 microg of a posterior brain stem from a terminally scrapie-affected ewe. These findings indicate that both colostrum and milk from small ruminants incubating TSE could contribute to the animal TSE transmission process, either directly or through the presence of milk-derived material in animal feedstuffs. It also raises some concern with regard to the risk to humans of TSE exposure associated with milk products from ovine and other TSE-susceptible dairy species.

  20. Propagation of Mammalian Prions in Yeast

    National Research Council Canada - National Science Library

    Harris, David A

    2006-01-01

    ...: the budding yeast Saccharomyces cerevisiae. This unicellular organism offers a number of potential advantages for the study of prion biology, including rapid generation time, ease of culturing, and facile genetics...

  1. Molecular Modeling of Prion Transmission to Humans

    Directory of Open Access Journals (Sweden)

    Etienne Levavasseur

    2014-10-01

    Full Text Available Using different prion strains, such as the variant Creutzfeldt-Jakob disease agent and the atypical bovine spongiform encephalopathy agents, and using transgenic mice expressing human or bovine prion protein, we assessed the reliability of protein misfolding cyclic amplification (PMCA to model interspecies and genetic barriers to prion transmission. We compared our PMCA results with in vivo transmission data characterized by attack rates, i.e., the percentage of inoculated mice that developed the disease. Using 19 seed/substrate combinations, we observed that a significant PMCA amplification was only obtained when the mouse line used as substrate is susceptible to the corresponding strain. Our results suggest that PMCA provides a useful tool to study genetic barriers to transmission and to study the zoonotic potential of emerging prion strains.

  2. Protein Misfolding Cyclic Amplification of Infectious Prions.

    Science.gov (United States)

    Moda, Fabio

    2017-01-01

    Transmissible spongiform encephalopathies, or prion diseases, are a group of incurable disorders caused by the accumulation of an abnormally folded prion protein (PrP Sc ) in the brain. According to the "protein-only" hypothesis, PrP Sc is the infectious agent able to propagate the disease by acting as a template for the conversion of the correctly folded prion protein (PrP C ) into the pathological isoform. Recently, the mechanism of PrP C conversion has been mimicked in vitro using an innovative technique named protein misfolding cyclic amplification (PMCA). This technology represents a great tool for studying diverse aspects of prion biology in the field of basic research and diagnosis. Moreover, PMCA can be expanded for the study of the misfolding process associated to other neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, and frontotemporal lobar degeneration. © 2017 Elsevier Inc. All rights reserved.

  3. Real-time visualization of prion transport in single live cells using quantum dots

    International Nuclear Information System (INIS)

    Luo, Kan; Li, Shu; Xie, Min; Wu, Di; Wang, WenXi; Chen, Rui; Huang, Liqin; Huang, Tao; Pang, Daiwen; Xiao, Gengfu

    2010-01-01

    Prion diseases are fatal neurodegenerative disorders resulting from structural conversion of the cellular isoform of PrP C to the infectious scrapie isoform PrP Sc . It is believed that such structural alteration may occur within the internalization pathway. However, there is no direct evidence to support this hypothesis. Employing quantum dots (QDs) as a probe, we have recorded a real-time movie demonstrating the process of prion internalization in a living cell for the first time. The entire internalization process can be divided into four discrete but connected stages. In addition, using methyl-beta-cyclodextrin to disrupt cell membrane cholesterol, we show that lipid rafts play an important role in locating cellular PrP C to the cell membrane and in initiating PrP C endocytosis.

  4. Real-time visualization of prion transport in single live cells using quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Kan [State Key Laboratory of Virology and Modern Virology Research Centre, College of Life Sciences, Wuhan University, Wuhan 430072 (China); Li, Shu [AIDS Research Centre, Institute of Pathogen Biology, Chinese Academy of Medical Science, Beijing 100730 (China); Xie, Min [College of Chemistry and Molecular Science, Wuhan University, Wuhan 430072 (China); Wu, Di; Wang, WenXi; Chen, Rui; Huang, Liqin; Huang, Tao [State Key Laboratory of Virology and Modern Virology Research Centre, College of Life Sciences, Wuhan University, Wuhan 430072 (China); Pang, Daiwen, E-mail: dwpang@whu.edu.cn [College of Chemistry and Molecular Science, Wuhan University, Wuhan 430072 (China); Xiao, Gengfu, E-mail: xiaogf@wh.iov.cn [State Key Laboratory of Virology and Modern Virology Research Centre, College of Life Sciences, Wuhan University, Wuhan 430072 (China); Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071 (China)

    2010-04-09

    Prion diseases are fatal neurodegenerative disorders resulting from structural conversion of the cellular isoform of PrP{sup C} to the infectious scrapie isoform PrP{sup Sc}. It is believed that such structural alteration may occur within the internalization pathway. However, there is no direct evidence to support this hypothesis. Employing quantum dots (QDs) as a probe, we have recorded a real-time movie demonstrating the process of prion internalization in a living cell for the first time. The entire internalization process can be divided into four discrete but connected stages. In addition, using methyl-beta-cyclodextrin to disrupt cell membrane cholesterol, we show that lipid rafts play an important role in locating cellular PrP{sup C} to the cell membrane and in initiating PrP{sup C} endocytosis.

  5. Crystallization and preliminary X-ray diffraction analysis of prion protein bound to the Fab fragment of the POM1 antibody

    International Nuclear Information System (INIS)

    Baral, Pravas Kumar; Wieland, Barbara; Swayampakula, Mridula; Polymenidou, Magdalini; Aguzzi, Adriano; Kav, Nat N. V.; James, Michael N. G.

    2011-01-01

    The complex of MoPrP(120–232) and Fab POM1 has been crystallized (space group C2, unit-cell parameters a = 83.68, b = 106.9, c = 76.25 Å, β = 95.6°). Diffraction data to 2.30 Å resolution have been collected using synchrotron radiation. Prion diseases are neurodegenerative diseases that are characterized by the conversion of the cellular prion protein PrP c to the pathogenic isoform PrP sc . Several antibodies are known to interact with the cellular prion protein and to inhibit this transition. An antibody Fab fragment, Fab POM1, was produced that recognizes a structural motif of the C-terminal domain of mouse prion protein. To study the mechanism by which Fab POM1 recognizes and binds the prion molecule, the complex between Fab POM1 and the C-terminal domain of mouse prion (residues 120–232) was prepared and crystallized. Crystals of this binary complex belonged to the monoclinic space group C2, with unit-cell parameters a = 83.68, b = 106.9, c = 76.25 Å, β = 95.6°

  6. Prion replication occurs in endogenous adult neural stem cells and alters their neuronal fate: involvement of endogenous neural stem cells in prion diseases.

    Directory of Open Access Journals (Sweden)

    Aroa Relaño-Ginès

    Full Text Available Prion diseases are irreversible progressive neurodegenerative diseases, leading to severe incapacity and death. They are characterized in the brain by prion amyloid deposits, vacuolisation, astrocytosis, neuronal degeneration, and by cognitive, behavioural and physical impairments. There is no treatment for these disorders and stem cell therapy therefore represents an interesting new approach. Gains could not only result from the cell transplantation, but also from the stimulation of endogenous neural stem cells (NSC or by the combination of both approaches. However, the development of such strategies requires a detailed knowledge of the pathology, particularly concerning the status of the adult neurogenesis and endogenous NSC during the development of the disease. During the past decade, several studies have consistently shown that NSC reside in the adult mammalian central nervous system (CNS and that adult neurogenesis occurs throughout the adulthood in the subventricular zone of the lateral ventricle or the Dentate Gyrus of the hippocampus. Adult NSC are believed to constitute a reservoir for neuronal replacement during normal cell turnover or after brain injury. However, the activation of this system does not fully compensate the neuronal loss that occurs during neurodegenerative diseases and could even contribute to the disease progression. We investigated here the status of these cells during the development of prion disorders. We were able to show that NSC accumulate and replicate prions. Importantly, this resulted in the alteration of their neuronal fate which then represents a new pathologic event that might underlie the rapid progression of the disease.

  7. Dissociation of recombinant prion autocatalysis from infectivity.

    Science.gov (United States)

    Noble, Geoffrey P; Supattapone, Surachai

    2015-01-01

    Within the mammalian prion field, the existence of recombinant prion protein (PrP) conformers with self-replicating (ie. autocatalytic) activity in vitro but little to no infectious activity in vivo challenges a key prediction of the protein-only hypothesis of prion replication--that autocatalytic PrP conformers should be infectious. To understand this dissociation of autocatalysis from infectivity, we recently performed a structural and functional comparison between a highly infectious and non-infectious pair of autocatalytic recombinant PrP conformers derived from the same initial prion strain. (1) We identified restricted, C-terminal structural differences between these 2 conformers and provided evidence that these relatively subtle differences prevent the non-infectious conformer from templating the conversion of native PrP(C) substrates containing a glycosylphosphatidylinositol (GPI) anchor. (1) In this article we discuss a model, consistent with these findings, in which recombinant PrP, lacking post-translational modifications and associated folding constraints, is capable of adopting a wide variety of autocatalytic conformations. Only a subset of these recombinant conformers can be adopted by post-translationally modified native PrP(C), and this subset represents the recombinant conformers with high specific infectivity. We examine this model's implications for the generation of highly infectious recombinant prions and the protein-only hypothesis of prion replication.

  8. Soil clay content underlies prion infection odds

    Science.gov (United States)

    David, Walter W.; Walsh, D.P.; Farnsworth, Matthew L.; Winkelman, D.L.; Miller, M.W.

    2011-01-01

    Environmental factors-especially soil properties-have been suggested as potentially important in the transmission of infectious prion diseases. Because binding to montmorillonite (an aluminosilicate clay mineral) or clay-enriched soils had been shown to enhance experimental prion transmissibility, we hypothesized that prion transmission among mule deer might also be enhanced in ranges with relatively high soil clay content. In this study, we report apparent influences of soil clay content on the odds of prion infection in free-ranging deer. Analysis of data from prion-infected deer herds in northern Colorado, USA, revealed that a 1% increase in the clay-sized particle content in soils within the approximate home range of an individual deer increased its odds of infection by up to 8.9%. Our findings suggest that soil clay content and related environmental properties deserve greater attention in assessing risks of prion disease outbreaks and prospects for their control in both natural and production settings. ?? 2011 Macmillan Publishers Limited. All rights reserved.

  9. Plasma soluble prion protein, a potential biomarker for sport-related concussions: a pilot study.

    Science.gov (United States)

    Pham, Nam; Akonasu, Hungbo; Shishkin, Rhonda; Taghibiglou, Changiz

    2015-01-01

    Sport-related mild traumatic brain injury (mTBI) or concussion is a significant health concern to athletes with potential long-term consequences. The diagnosis of sport concussion and return to sport decision making is one of the greatest challenges facing health care clinicians working in sports. Blood biomarkers have recently demonstrated their potential in assisting the detection of brain injury particularly, in those cases with no obvious physical injury. We have recently discovered plasma soluble cellular prion protein (PrP(C)) as a potential reliable biomarker for blast induced TBI (bTBI) in a rodent animal model. In order to explore the application of this novel TBI biomarker to sport-related concussion, we conducted a pilot study at the University of Saskatchewan (U of S) by recruiting athlete and non-athlete 18 to 30 year-old students. Using a modified quantitative ELISA method, we first established normal values for the plasma soluble PrP(C) in male and female students. The measured plasma soluble PrP(C) in confirmed concussion cases demonstrated a significant elevation of this analyte in post-concussion samples. Data collected from our pilot study indicates that the plasma soluble PrP(C) is a potential biomarker for sport-related concussion, which may be further developed into a clinical diagnostic tool to assist clinicians in the assessment of sport concussion and return-to-play decision making.

  10. Plasma soluble prion protein, a potential biomarker for sport-related concussions: a pilot study.

    Directory of Open Access Journals (Sweden)

    Nam Pham

    Full Text Available Sport-related mild traumatic brain injury (mTBI or concussion is a significant health concern to athletes with potential long-term consequences. The diagnosis of sport concussion and return to sport decision making is one of the greatest challenges facing health care clinicians working in sports. Blood biomarkers have recently demonstrated their potential in assisting the detection of brain injury particularly, in those cases with no obvious physical injury. We have recently discovered plasma soluble cellular prion protein (PrP(C as a potential reliable biomarker for blast induced TBI (bTBI in a rodent animal model. In order to explore the application of this novel TBI biomarker to sport-related concussion, we conducted a pilot study at the University of Saskatchewan (U of S by recruiting athlete and non-athlete 18 to 30 year-old students. Using a modified quantitative ELISA method, we first established normal values for the plasma soluble PrP(C in male and female students. The measured plasma soluble PrP(C in confirmed concussion cases demonstrated a significant elevation of this analyte in post-concussion samples. Data collected from our pilot study indicates that the plasma soluble PrP(C is a potential biomarker for sport-related concussion, which may be further developed into a clinical diagnostic tool to assist clinicians in the assessment of sport concussion and return-to-play decision making.

  11. Cryo-immunogold electron microscopy for prions: toward identification of a conversion site.

    Science.gov (United States)

    Godsave, Susan F; Wille, Holger; Kujala, Pekka; Latawiec, Diane; DeArmond, Stephen J; Serban, Ana; Prusiner, Stanley B; Peters, Peter J

    2008-11-19

    Prion diseases are caused by accumulation of an abnormally folded isoform (PrP(Sc)) of the cellular prion protein (PrP(C)). The subcellular distribution of PrP(Sc) and the site of its formation in brain are still unclear. We performed quantitative cryo-immunogold electron microscopy on hippocampal sections from mice infected with the Rocky Mountain Laboratory strain of prions. Two antibodies were used: R2, which recognizes both PrP(C) and PrP(Sc); and F4-31, which only detects PrP(C) in undenatured sections. At a late subclinical stage of prion infection, both PrP(C) and PrP(Sc) were detected principally on neuronal plasma membranes and on vesicles resembling early endocytic or recycling vesicles in the neuropil. The R2 labeling was approximately six times higher in the infected than the uninfected hippocampus and gold clusters were only evident in infected tissue. The biggest increase in labeling density (24-fold) was found on the early/recycling endosome-like vesicles of small-diameter neurites, suggesting these as possible sites of conversion. Trypsin digestion of infected hippocampal sections resulted in a reduction in R2 labeling of >85%, which suggests that a high proportion of PrP(Sc) may be oligomeric, protease-sensitive PrP(Sc).

  12. Glycoform-independent prion conversion by highly efficient, cell-based, protein misfolding cyclic amplification.

    Science.gov (United States)

    Moudjou, Mohammed; Chapuis, Jérôme; Mekrouti, Mériem; Reine, Fabienne; Herzog, Laetitia; Sibille, Pierre; Laude, Hubert; Vilette, Didier; Andréoletti, Olivier; Rezaei, Human; Dron, Michel; Béringue, Vincent

    2016-07-07

    Prions are formed of misfolded assemblies (PrP(Sc)) of the variably N-glycosylated cellular prion protein (PrP(C)). In infected species, prions replicate by seeding the conversion and polymerization of host PrP(C). Distinct prion strains can be recognized, exhibiting defined PrP(Sc) biochemical properties such as the glycotype and specific biological traits. While strain information is encoded within the conformation of PrP(Sc) assemblies, the storage of the structural information and the molecular requirements for self-perpetuation remain uncertain. Here, we investigated the specific role of PrP(C) glycosylation status. First, we developed an efficient protein misfolding cyclic amplification method using cells expressing the PrP(C) species of interest as substrate. Applying the technique to PrP(C) glycosylation mutants expressing cells revealed that neither PrP(C) nor PrP(Sc) glycoform stoichiometry was instrumental to PrP(Sc) formation and strainness perpetuation. Our study supports the view that strain properties, including PrP(Sc) glycotype are enciphered within PrP(Sc) structural backbone, not in the attached glycans.

  13. The Role of the Mammalian Prion Protein in the Control of Sleep

    Directory of Open Access Journals (Sweden)

    Amber Roguski

    2017-11-01

    Full Text Available Sleep disruption is a prevalent clinical feature in many neurodegenerative disorders, including human prion diseases where it can be the defining dysfunction, as in the case of the “eponymous” fatal familial insomnia, or an early-stage symptom as in certain types of Creutzfeldt-Jakob disease. It is important to establish the role of the cellular prion protein (PrPC, the key molecule involved in prion pathogenesis, within the sleep-wake system in order to understand fully the mechanisms underlying its contribution to both healthy circadian rhythmicity and sleep dysfunction during disease. Although severe disruption to the circadian rhythm and melatonin release is evident during the pathogenic phases of some prion diseases, untangling whether PrPC plays a role in circadian rhythmicity, as suggested in mice deficient for PrPC expression, is challenging given the lack of basic experimental research. We provide a short review of the small amount of direct literature focused on the role of PrPC in melatonin and circadian rhythm regulation, as well as suggesting mechanisms by which PrPC might exert influence upon noradrenergic and dopaminergic signaling and melatonin synthesis. Future research in this area should focus upon isolating the points of dysfunction within the retino-pineal pathway and further investigate PrPC mediation of pinealocyte GPCR activity.

  14. Mouse-hamster chimeric prion protein (PrP) devoid of N-terminal residues 23-88 restores susceptibility to 22L prions, but not to RML prions in PrP-knockout mice.

    Science.gov (United States)

    Uchiyama, Keiji; Miyata, Hironori; Yano, Masashi; Yamaguchi, Yoshitaka; Imamura, Morikazu; Muramatsu, Naomi; Das, Nandita Rani; Chida, Junji; Hara, Hideyuki; Sakaguchi, Suehiro

    2014-01-01

    Prion infection induces conformational conversion of the normal prion protein PrPC, into the pathogenic isoform PrPSc, in prion diseases. It has been shown that PrP-knockout (Prnp0/0) mice transgenically reconstituted with a mouse-hamster chimeric PrP lacking N-terminal residues 23-88, or Tg(MHM2Δ23-88)/Prnp 0/0 mice, neither developed the disease nor accumulated MHM2ScΔ23-88 in their brains after inoculation with RML prions. In contrast, RML-inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice developed the disease with abundant accumulation of MHM2ScΔ23-88 in their brains. These results indicate that MHM2Δ23-88 itself might either lose or greatly reduce the converting capacity to MHM2ScΔ23-88, and that the co-expressing wild-type PrPC can stimulate the conversion of MHM2Δ23-88 to MHM2ScΔ23-88 in trans. In the present study, we confirmed that Tg(MHM2Δ23-88)/Prnp 0/0 mice remained resistant to RML prions for up to 730 days after inoculation. However, we found that Tg(MHM2Δ23-88)/Prnp 0/0 mice were susceptible to 22L prions, developing the disease with prolonged incubation times and accumulating MHM2ScΔ23-88 in their brains. We also found accelerated conversion of MHM2Δ23-88 into MHM2ScΔ23-88 in the brains of RML- and 22L-inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice. However, wild-type PrPSc accumulated less in the brains of these inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice, compared with RML- and 22L-inoculated Prnp 0/+ mice. These results show that MHM2Δ23-88 itself can convert into MHM2ScΔ23-88 without the help of the trans-acting PrPC, and that, irrespective of prion strains inoculated, the co-expressing wild-type PrPC stimulates the conversion of MHM2Δ23-88 into MHM2ScΔ23-88, but to the contrary, the co-expressing MHM2Δ23-88 disturbs the conversion of wild-type PrPC into PrPSc.

  15. Cell type-specific neuroprotective activity of untranslocated prion protein.

    Directory of Open Access Journals (Sweden)

    Elena Restelli

    2010-10-01

    Full Text Available A key pathogenic role in prion diseases was proposed for a cytosolic form of the prion protein (PrP. However, it is not clear how cytosolic PrP localization influences neuronal viability, with either cytotoxic or anti-apoptotic effects reported in different studies. The cellular mechanism by which PrP is delivered to the cytosol of neurons is also debated, and either retrograde transport from the endoplasmic reticulum or inefficient translocation during biosynthesis has been proposed. We investigated cytosolic PrP biogenesis and effect on cell viability in primary neuronal cultures from different mouse brain regions.Mild proteasome inhibition induced accumulation of an untranslocated form of cytosolic PrP in cortical and hippocampal cells, but not in cerebellar granules. A cyclopeptolide that interferes with the correct insertion of the PrP signal sequence into the translocon increased the amount of untranslocated PrP in cortical and hippocampal cells, and induced its synthesis in cerebellar neurons. Untranslocated PrP boosted the resistance of cortical and hippocampal neurons to apoptotic insults but had no effect on cerebellar cells.These results indicate cell type-dependent differences in the efficiency of PrP translocation, and argue that cytosolic PrP targeting might serve a physiological neuroprotective function.

  16. Prion Infectivity in Fat of Deer with Chronic Wasting Disease▿

    OpenAIRE

    Race, Brent; Meade-White, Kimberly; Race, Richard; Chesebro, Bruce

    2009-01-01

    Chronic wasting disease (CWD) is a neurodegenerative prion disease of cervids. Some animal prion diseases, such as bovine spongiform encephalopathy, can infect humans; however, human susceptibility to CWD is unknown. In ruminants, prion infectivity is found in central nervous system and lymphoid tissues, with smaller amounts in intestine and muscle. In mice, prion infectivity was recently detected in fat. Since ruminant fat is consumed by humans and fed to animals, we determined infectivity t...

  17. The Rho Termination Factor of Clostridium botulinum contains a Prion-Like Domain with a highly Amyloidogenic Core

    Directory of Open Access Journals (Sweden)

    Irantzu ePallares

    2016-01-01

    Full Text Available Prion-like proteins can switch between a soluble intrinsically disordered conformation and a highly ordered amyloid assembly. This conformational promiscuity is encoded in specific sequence regions, known as prion domains (PrDs. Prions are best known as the causative factors of neurological diseases in mammals. However, bioinformatics analyses reveal that proteins bearing PrDs are present in all kingdoms of life, including bacteria, thus supporting the idea that they serve conserved beneficial cellular functions. Despite the proportion of predicted prion-like proteins in bacterial proteomes is generally low, pathogenic species seem to have a higher prionic load, suggesting that these malleable proteins may favor pathogenic traits. In the present work, we performed a stringent computational analysis of the Clostridium botulinum pathogen proteome in the search for prion-like proteins. A total of 54 candidates were predicted for this anaerobic bacterium, including the transcription termination Rho factor. This RNA-binding protein has been shown to play a crucial role in bacterial adaptation to changing environments. We show here that the predicted disordered PrD domain of this RNA-binding protein contains an inner, highly polar, asparagine-rich short sequence able to spontaneously self-assemble into amyloid-like structures, bearing thus the potential to induce a Rho factor conformational switch that might rewire gene expression in response to environmental conditions.

  18. Defining the Conformational Features of Anchorless, Poorly Neuroinvasive Prions

    NARCIS (Netherlands)

    Bett, C.; Kurt, T.D.; Lucero, M.; Trejo, M.; Rozemuller, A.J.M.; Kong, Q.Z.; Nilsson, K.P.R.; Masliah, E.; Oldstone, M.B.; Sigurdson, C.J.

    2013-01-01

    Infectious prions cause diverse clinical signs and form an extraordinary range of structures, from amorphous aggregates to fibrils. How the conformation of a prion dictates the disease phenotype remains unclear. Mice expressing GPI-anchorless or GPI-anchored prion protein exposed to the same

  19. Peroxiredoxin 6 promotes upregulation of the prion protein (PrP in neuronal cells of prion-infected mice

    Directory of Open Access Journals (Sweden)

    Wagner Wibke

    2012-12-01

    Full Text Available Abstract Background It has been widely established that the conversion of the cellular prion protein (PrPC into its abnormal isoform (PrPSc is responsible for the development of transmissible spongiform encephalopathies (TSEs. However, the knowledge of the detailed molecular mechanisms and direct functional consequences within the cell is rare. In this study, we aimed at the identification of deregulated proteins which might be involved in prion pathogenesis. Findings Apolipoprotein E and peroxiredoxin 6 (PRDX6 were identified as upregulated proteins in brains of scrapie-infected mice and cultured neuronal cell lines. Downregulation of PrP gene expression using specific siRNA did not result in a decrease of PRDX6 amounts. Interestingly, selective siRNA targeting PRDX6 or overexpression of PRDX6 controlled PrPC and PrPSc protein amounts in neuronal cells. Conclusions Besides its possible function as a novel marker protein in the diagnosis of TSEs, PDRX6 represents an attractive target molecule in putative pharmacological intervention strategies in the future.

  20. A human pericardium biopolymeric scaffold for autologous heart valve tissue engineering: cellular and extracellular matrix structure and biomechanical properties in comparison with a normal aortic heart valve.

    Science.gov (United States)

    Straka, Frantisek; Schornik, David; Masin, Jaroslav; Filova, Elena; Mirejovsky, Tomas; Burdikova, Zuzana; Svindrych, Zdenek; Chlup, Hynek; Horny, Lukas; Daniel, Matej; Machac, Jiri; Skibová, Jelena; Pirk, Jan; Bacakova, Lucie

    2018-04-01

    The objective of our study was to compare the cellular and extracellular matrix (ECM) structure and the biomechanical properties of human pericardium (HP) with the normal human aortic heart valve (NAV). HP tissues (from 12 patients) and NAV samples (from 5 patients) were harvested during heart surgery. The main cells in HP were pericardial interstitial cells, which are fibroblast-like cells of mesenchymal origin similar to the valvular interstitial cells in NAV tissue. The ECM of HP had a statistically significantly (p structures of the two tissues, the dense part of fibrous HP (49 ± 2%) and the lamina fibrosa of NAV (47 ± 4%), was similar. In both tissues, the secant elastic modulus (Es) was significantly lower in the transversal direction (p structure and has the biomechanical properties required for a tissue from which an autologous heart valve replacement may be constructed.

  1. Comparative studies of host-cell reactivation, cellular capacity and enhanced reactivation of herpes simplex virus in normal, xeroderma pigmentosum and Cockayne syndrome fibroblasts

    International Nuclear Information System (INIS)

    Ryan, D.K.G.; Rainbow, A.J.; McMaster Univ., Hamilton, Ontario

    1986-01-01

    Host-cell reactivation (HCR) of UV-irradiated herpes simplex virus type 2 (HSV-2), capacity of UV-irradiated cells to support HSV-2 plaque formation and UV-enhanced reactivation (UVER) of UV-irradiated HSV-2 were examined in fibroblasts from 4 patients with Cockayne syndrome (CS), 5 with xeroderma pigmentosum and 5 normals. The results indicate that delayed capacity for HSV-2 plaque formation is a more sensitive assay than HCR in the detection of cellular DNA-repair deficiency for XP and CS. For the examination of UVER, fibroblasts were irradiated with various UV doses and subsequently infected with either unirradiated or UV-irradiated HSV and scored for plaque formation 2 days later. UVER expression was maximum when the delay between UV-irradiation of the cells and HSV infection was 48 h. (Auth.)

  2. 76 FR 71294 - Prions; Proposed Amendment To Clarify Product Performance Data for Products With Prion-Related...

    Science.gov (United States)

    2011-11-17

    ... (FIFRA), and to amend its regulations to expressly include prion within the regulatory definition of pest... observed by the user including, but not limited to, microorganisms infectious to man in any area of the... prion within the regulatory definition of pest. EPA currently considers a prion to be a pest under FIFRA...

  3. Production of a Marfan cellular phenotype by expressing a mutant human fibrillin allele on a normal human or murine genetic background

    Energy Technology Data Exchange (ETDEWEB)

    Eldadah, Z.A.; Dietz, H.C. [Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States); Brenn, T. [Stanford Univ. Medical Center, CA (United States)] [and others

    1994-09-01

    The Marfan Syndrome (MFS) is a heritable disorder of connective tissue caused by defects in fibrillin (FBN1), a 350 kD glycoprotein and principal component of the extracellular microfibril. Previous correlations of mutant transcript level and disease severity suggested a dominant negative model of MFS pathogenesis. To address this hypothesis we assembled an expression construct containing the mutant allele from a patient with severe MFS. This mutation causes skipping of FBN1 exon 2 and a frame shift, leading to a premature termination codon in exon 4. The predicted peptide would thus consist of 55 wild type and 45 missense amino acids. The construct was stably transfected into cultured human and mouse fibroblasts, and several clonal cell populations were established. Human and mouse cells expressing the truncated peptide exhibited markedly diminished fibrillin deposition and disorganized microfibrillar architecture by immunofluorescence. Pulse-chase analysis of these cells demonstrated normal levels of fibrillin synthesis but substantially decreased fibrillin deposition into the extracellular matrix. These data illustrate that expression of a mutant FBN1 allele, on a background of two normal alleles, is sufficient to disrupt normal fibrillin aggregation and reproduce the MFS cellular phenotype. This provides confirmation of a dominant negative model of MFS pathogenesis and may offer mutant allele knockout as a strategy for gene therapy. In addition, these data underscore the importance of the FBN1 amino-terminus in normal multimer formation and suggest that expression of the human extreme 5{prime} FBN1 coding sequence may be sufficient, in isolation, to produce an animal model of MFS. Indeed, transgenic mice harboring this mutant allele have been produced, and phenotype analysis is currently in progress.

  4. Mammalian amyloidogenic proteins promote prion nucleation in yeast.

    Science.gov (United States)

    Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O

    2018-03-02

    Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Generic amyloidogenicity of mammalian prion proteins from species susceptible and resistant to prions.

    Science.gov (United States)

    Nyström, Sofie; Hammarström, Per

    2015-05-11

    Prion diseases are lethal, infectious diseases associated with prion protein (PrP) misfolding. A large number of mammals are susceptible to both sporadic and acquired prion diseases. Although PrP is highly conserved and ubiquitously expressed in all mammals, not all species exhibit prion disease. By employing full length recombinant PrP from five known prion susceptible species (human, cattle, cat, mouse and hamster) and two species considered to be prion resistant (pig and dog) the amyloidogenicity of these PrPs has been delineated. All the mammalian PrPs, even from resistant species, were swiftly converted from the native state to amyloid-like structure when subjected to a native condition conversion assay. The PrPs displayed amyloidotypic tinctorial and ultrastructural hallmarks. Self-seeded conversion of the PrPs displayed significantly decreased lag phases demonstrating that nucleation dependent polymerization is a dominating mechanism in the fibrillation process. Fibrils from Aβ1-40, Aβ1-42, Lysozyme, Insulin and Transthyretin did not accelerate conversion of HuPrP whereas fibrils from HuPrP90-231 and HuPrP121-231 as well as full length PrPs of all PrPs efficiently seeded conversion showing specificity of the assay requiring the C-terminal PrP sequence. Our findings have implications for PrP misfolding and could have ramifications in the context of prion resistant species and silent carriers.

  6. The POM monoclonals: a comprehensive set of antibodies to non-overlapping prion protein epitopes.

    Directory of Open Access Journals (Sweden)

    Magdalini Polymenidou

    Full Text Available PrP(Sc, a misfolded and aggregated form of the cellular prion protein PrP(C, is the only defined constituent of the transmissible agent causing prion diseases. Expression of PrP(C in the host organism is necessary for prion replication and for prion neurotoxicity. Understanding prion diseases necessitates detailed structural insights into PrP(C and PrP(Sc. Towards this goal, we have developed a comprehensive collection of monoclonal antibodies denoted POM1 to POM19 and directed against many different epitopes of mouse PrP(C. Three epitopes are located within the N-terminal octarepeat region, one is situated within the central unstructured region, and four epitopes are discontinuous within the globular C-proximal domain of PrP(C. Some of these antibodies recognize epitopes that are resilient to protease digestion in PrP(Sc. Other antibodies immunoprecipitate PrP(C, but not PrP(Sc. A third group was found to immunoprecipitate both PrP isoforms. Some of the latter antibodies could be blocked with epitope-mimicking peptides, and incubation with an excess of these peptides allowed for immunochromatography of PrP(C and PrP(Sc. Amino-proximal antibodies were found to react with repetitive PrP(C epitopes, thereby vastly increasing their avidity. We have also created functional single-chain miniantibodies from selected POMs, which retained the binding characteristics despite their low molecular mass. The POM collection, thus, represents a unique set of reagents allowing for studies with a variety of techniques, including western blotting, ELISA, immunoprecipitation, conformation-dependent immunoassays, and plasmon surface plasmon resonance-based assays.

  7. Prions

    NARCIS (Netherlands)

    Zijderveld, van F.G.

    2007-01-01

    The report 'Zoonoses and Zoonotic Agents in Humans, Food, Animals and Feed in The Netherlands 2003 - 2006' is based on data that is reported annually to the European Commission, in accordance with the Directive 2003/99/EC on the monitoring of zoonoses and zoonotic agents. They are supplemented with

  8. Prions and animal transmissible spongiform encephalopathies

    Directory of Open Access Journals (Sweden)

    Juntes Polona

    2017-01-01

    Full Text Available Background. Transmissible spongiform encephalopathies (TSEs or prion diseases are a unique group of neurodegenerative diseases of animals and humans, which always have a fatal outcome and are transmissible among animals of the same or different species. Scope and Approach. The aim of this work is to review some recent data about animal TSEs, with the emphasis on their causative agents and zoonotic potential, and to discuss why the surveillance and control measures over animal TSEs should remain in force. Key Findings and Conclusions. We still have incomplete knowledge of prions and prion diseases. Scrapie has been present for a very long time and controlled with varied success. Bovine spongiform encephalopathy (BSE emerged unnoticed, and spread within a few years to epidemic proportions, entailing enormous economic consequences and public concerns. Currently, the classical BSE epidemic is under control, but atypical cases do, and probably will, persist in bovine populations. The Chronic Wasting Disease (CWD of the cervids has been spreading in North America and has recently been detected in Europe. Preventive measures for the control of classical BSE remain in force, including the feed ban and removal of specified risk materials. However, active BSE surveillance has considerably decreased. In the absence of such preventive and control measures, atypical BSE cases in healthy slaughtered bovines might persist in the human food chain, and BSE prions might resurface. Moreover, other prion strains might emerge and spread undetected if the appropriate preventive and surveillance measures were to cease, leaving behind inestimable consequences.

  9. Lions and prions and deer demise.

    Directory of Open Access Journals (Sweden)

    Michael W Miller

    Full Text Available BACKGROUND: Contagious prion diseases--scrapie of sheep and chronic wasting disease of several species in the deer family--give rise to epidemics that seem capable of compromising host population viability. Despite this prospect, the ecological consequences of prion disease epidemics in natural populations have received little consideration. METHODOLOGY/PRINCIPAL FINDINGS: Using a cohort study design, we found that prion infection dramatically lowered survival of free-ranging adult (>2-year-old mule deer (Odocoileus hemionus: estimated average life expectancy was 5.2 additional years for uninfected deer but only 1.6 additional years for infected deer. Prion infection also increased nearly fourfold the rate of mountain lions (Puma concolor preying on deer, suggesting that epidemics may alter predator-prey dynamics by facilitating hunting success. Despite selective predation, about one fourth of the adult deer we sampled were infected. High prevalence and low survival of infected deer provided a plausible explanation for the marked decline in this deer population since the 1980s. CONCLUSION: Remarkably high infection rates sustained in the face of intense predation show that even seemingly complete ecosystems may offer little resistance to the spread and persistence of contagious prion diseases. Moreover, the depression of infected populations may lead to local imbalances in food webs and nutrient cycling in ecosystems in which deer are important herbivores.

  10. Inactivation of prion infectivity by ionizing rays

    Energy Technology Data Exchange (ETDEWEB)

    Gominet, M. [Ionisos, ZI les Chatinieres, F01120 Dagneux (France); Vadrot, C.; Austruy, G. [Paris V University, Central Pharmacy of Hospitals, 4 avenue de l' Observatoire, F-75006, Paris (France); Darbord, J.C. [Paris V University, Central Pharmacy of Hospitals, 4 avenue de l' Observatoire, F-75006, Paris (France)], E-mail: darbord@pharmacie.univ-paris5.fr

    2007-11-15

    Inactivation of prion deposits on medical devices or prion contamination in pharmaceutical raw materials is considered as impossible by using gamma irradiation. Early, the guideline WHO/CDS/CSR/APH/2000 has described irradiation as an ineffective process. But, in 2003, S. Miekka et al. noted radiation inactivation of prions in a particular application to purify human albumin, shown by the physical denaturation of the infectious protein (PrP). The aim of our study was to determine the inactivation of prions with a scrapie model (strain C506M3) by irradiating standardised preparations. Results: Gamma irradiation was partially effective, showing a 4-5 log reduction on exposure to 50 kGy. A characteristic effect-dose curve was not observed (25, 50 and 100 kGy), only an increase in the incubation period of the murine disease (229 days with 25 kGy to 290 days with 100 kGy) compared with 170 days without irradiation. Since the inactivation was not a total one, the observed effect is significant. It is proposed that further work be undertaken with the model to investigate the application of gamma radiation known levels of prion contamination.

  11. Inactivation of prion infectivity by ionizing rays

    International Nuclear Information System (INIS)

    Gominet, M.; Vadrot, C.; Austruy, G.; Darbord, J.C.

    2007-01-01

    Inactivation of prion deposits on medical devices or prion contamination in pharmaceutical raw materials is considered as impossible by using gamma irradiation. Early, the guideline WHO/CDS/CSR/APH/2000 has described irradiation as an ineffective process. But, in 2003, S. Miekka et al. noted radiation inactivation of prions in a particular application to purify human albumin, shown by the physical denaturation of the infectious protein (PrP). The aim of our study was to determine the inactivation of prions with a scrapie model (strain C506M3) by irradiating standardised preparations. Results: Gamma irradiation was partially effective, showing a 4-5 log reduction on exposure to 50 kGy. A characteristic effect-dose curve was not observed (25, 50 and 100 kGy), only an increase in the incubation period of the murine disease (229 days with 25 kGy to 290 days with 100 kGy) compared with 170 days without irradiation. Since the inactivation was not a total one, the observed effect is significant. It is proposed that further work be undertaken with the model to investigate the application of gamma radiation known levels of prion contamination

  12. Classical Bovine Spongiform Encephalopathy by Transmission of H-Type Prion in Homologous Prion Protein Context

    OpenAIRE

    Torres, Juan-María; Andréoletti, Olivier; Lacroux, Caroline; Prieto, Irene; Lorenzo, Patricia; Larska, Magdalena; Baron, Thierry; Espinosa, Juan-Carlos

    2011-01-01

    Bovine spongiform encephalopathy (BSE) and BSErelated disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profi les of abnormal protease-resistant prion protein (PrPres), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molec...

  13. Soluble polymorphic bank vole prion proteins induced by co-expression of quiescin sulfhydryl oxidase in E. coli and their aggregation behaviors.

    Science.gov (United States)

    Abskharon, Romany; Dang, Johnny; Elfarash, Ameer; Wang, Zerui; Shen, Pingping; Zou, Lewis S; Hassan, Sedky; Wang, Fei; Fujioka, Hisashi; Steyaert, Jan; Mulaj, Mentor; Surewicz, Witold K; Castilla, Joaquín; Wohlkonig, Alexandre; Zou, Wen-Quan

    2017-10-04

    The infectious prion protein (PrP Sc or prion) is derived from its cellular form (PrP C ) through a conformational transition in animal and human prion diseases. Studies have shown that the interspecies conversion of PrP C to PrP Sc is largely swayed by species barriers, which is mainly deciphered by the sequence and conformation of the proteins among species. However, the bank vole PrP C (BVPrP) is highly susceptible to PrP Sc from different species. Transgenic mice expressing BVPrP with the polymorphic isoleucine (109I) but methionine (109M) at residue 109 spontaneously develop prion disease. To explore the mechanism underlying the unique susceptibility and convertibility, we generated soluble BVPrP by co-expression of BVPrP with Quiescin sulfhydryl oxidase (QSOX) in Escherichia coli. Interestingly, rBVPrP-109M and rBVPrP-109I exhibited distinct seeded aggregation pathways and aggregate morphologies upon seeding of mouse recombinant PrP fibrils, as monitored by thioflavin T fluorescence and electron microscopy. Moreover, they displayed different aggregation behaviors induced by seeding of hamster and mouse prion strains under real-time quaking-induced conversion. Our results suggest that QSOX facilitates the formation of soluble prion protein and provide further evidence that the polymorphism at residue 109 of QSOX-induced BVPrP may be a determinant in mediating its distinct convertibility and susceptibility.

  14. The Role of Unfolded Protein Response and Mitogen-Activated Protein Kinase Signaling in Neurodegenerative Diseases with Special Focus on Prion Diseases

    Directory of Open Access Journals (Sweden)

    Lifeng Yang

    2017-05-01

    Full Text Available Prion diseases are neurodegenerative pathologies characterized by the accumulation of a protease-resistant form of the cellular prion protein named prion protein scrapie (PrPSc in the brain. PrPSc accumulation in the endoplasmic reticulum (ER result in a dysregulated calcium (Ca2+ homeostasis and subsequent initiation of unfolded protein response (UPR leading to neuronal dysfunction and apoptosis. The molecular mechanisms for the transition between adaptation to ER stress and ER stress-induced apoptosis are still unclear. Mitogen-activated protein kinases (MAPKs are serine/threonine protein kinases that rule the signaling of many extracellular stimuli from plasma membrane to the nucleus. However the identification of numerous points of cross talk between the UPR and MAPK signaling pathways may contribute to our understanding of the consequences of ER stress in prion diseases. Indeed the MAPK signaling network is known to regulate cell cycle progression and cell survival or death responses following a variety of stresses including misfolded protein response stress. In this article, we review the UPR signaling in prion diseases and discuss the triad of MAPK signaling pathways. We also describe the role played by MAPK signaling cascades in Alzheimer’s (AD and Parkinson’s disease (PD. We will also overview the mechanisms of cell death and the role of MAPK signaling in prion disease progression and highlight potential avenues for therapeutic intervention.

  15. Unraveling Prion Protein Interactions with Aptamers and Other PrP-Binding Nucleic Acids.

    Science.gov (United States)

    Macedo, Bruno; Cordeiro, Yraima

    2017-05-17

    Transmissible spongiform encephalopathies (TSEs) are a group of neurodegenerative disorders that affect humans and other mammals. The etiologic agents common to these diseases are misfolded conformations of the prion protein (PrP). The molecular mechanisms that trigger the structural conversion of the normal cellular PrP (PrP C ) into the pathogenic conformer (PrP Sc ) are still poorly understood. It is proposed that a molecular cofactor would act as a catalyst, lowering the activation energy of the conversion process, therefore favoring the transition of PrP C to PrP Sc . Several in vitro studies have described physical interactions between PrP and different classes of molecules, which might play a role in either PrP physiology or pathology. Among these molecules, nucleic acids (NAs) are highlighted as potential PrP molecular partners. In this context, the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) methodology has proven extremely valuable to investigate PrP-NA interactions, due to its ability to select small nucleic acids, also termed aptamers, that bind PrP with high affinity and specificity. Aptamers are single-stranded DNA or RNA oligonucleotides that can be folded into a wide range of structures (from harpins to G-quadruplexes). They are selected from a nucleic acid pool containing a large number (10 14 -10 16 ) of random sequences of the same size (~20-100 bases). Aptamers stand out because of their potential ability to bind with different affinities to distinct conformations of the same protein target. Therefore, the identification of high-affinity and selective PrP ligands may aid the development of new therapies and diagnostic tools for TSEs. This review will focus on the selection of aptamers targeted against either full-length or truncated forms of PrP, discussing the implications that result from interactions of PrP with NAs, and their potential advances in the studies of prions. We will also provide a critical evaluation

  16. Quantitative detection and biological propagation of scrapie seeding activity in vitro facilitate use of prions as model pathogens for disinfection.

    Directory of Open Access Journals (Sweden)

    Sandra Pritzkow

    Full Text Available Prions are pathogens with an unusually high tolerance to inactivation and constitute a complex challenge to the re-processing of surgical instruments. On the other hand, however, they provide an informative paradigm which has been exploited successfully for the development of novel broad-range disinfectants simultaneously active also against bacteria, viruses and fungi. Here we report on the development of a methodological platform that further facilitates the use of scrapie prions as model pathogens for disinfection. We used specifically adapted serial protein misfolding cyclic amplification (PMCA for the quantitative detection, on steel wires providing model carriers for decontamination, of 263K scrapie seeding activity converting normal protease-sensitive into abnormal protease-resistant prion protein. Reference steel wires carrying defined amounts of scrapie infectivity were used for assay calibration, while scrapie-contaminated test steel wires were subjected to fifteen different procedures for disinfection that yielded scrapie titre reductions of ≤10(1- to ≥10(5.5-fold. As confirmed by titration in hamsters the residual scrapie infectivity on test wires could be reliably deduced for all examined disinfection procedures, from our quantitative seeding activity assay. Furthermore, we found that scrapie seeding activity present in 263K hamster brain homogenate or multiplied by PMCA of scrapie-contaminated steel wires both triggered accumulation of protease-resistant prion protein and was further propagated in a novel cell assay for 263K scrapie prions, i.e., cerebral glial cell cultures from hamsters. The findings from our PMCA- and glial cell culture assays revealed scrapie seeding activity as a biochemically and biologically replicative principle in vitro, with the former being quantitatively linked to prion infectivity detected on steel wires in vivo. When combined, our in vitro assays provide an alternative to titrations of biological

  17. Grass Plants Bind, Retain, Uptake, and Transport Infectious Prions

    Directory of Open Access Journals (Sweden)

    Sandra Pritzkow

    2015-05-01

    Full Text Available Prions are the protein-based infectious agents responsible for prion diseases. Environmental prion contamination has been implicated in disease transmission. Here, we analyzed the binding and retention of infectious prion protein (PrPSc to plants. Small quantities of PrPSc contained in diluted brain homogenate or in excretory materials (urine and feces can bind to wheat grass roots and leaves. Wild-type hamsters were efficiently infected by ingestion of prion-contaminated plants. The prion-plant interaction occurs with prions from diverse origins, including chronic wasting disease. Furthermore, leaves contaminated by spraying with a prion-containing preparation retained PrPSc for several weeks in the living plant. Finally, plants can uptake prions from contaminated soil and transport them to aerial parts of the plant (stem and leaves. These findings demonstrate that plants can efficiently bind infectious prions and act as carriers of infectivity, suggesting a possible role of environmental prion contamination in the horizontal transmission of the disease.

  18. Grass plants bind, retain, uptake, and transport infectious prions.

    Science.gov (United States)

    Pritzkow, Sandra; Morales, Rodrigo; Moda, Fabio; Khan, Uffaf; Telling, Glenn C; Hoover, Edward; Soto, Claudio

    2015-05-26

    Prions are the protein-based infectious agents responsible for prion diseases. Environmental prion contamination has been implicated in disease transmission. Here, we analyzed the binding and retention of infectious prion protein (PrP(Sc)) to plants. Small quantities of PrP(Sc) contained in diluted brain homogenate or in excretory materials (urine and feces) can bind to wheat grass roots and leaves. Wild-type hamsters were efficiently infected by ingestion of prion-contaminated plants. The prion-plant interaction occurs with prions from diverse origins, including chronic wasting disease. Furthermore, leaves contaminated by spraying with a prion-containing preparation retained PrP(Sc) for several weeks in the living plant. Finally, plants can uptake prions from contaminated soil and transport them to aerial parts of the plant (stem and leaves). These findings demonstrate that plants can efficiently bind infectious prions and act as carriers of infectivity, suggesting a possible role of environmental prion contamination in the horizontal transmission of the disease. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Experimental Models of Inherited PrP Prion Diseases.

    Science.gov (United States)

    Watts, Joel C; Prusiner, Stanley B

    2017-11-01

    The inherited prion protein (PrP) prion disorders, which include familial Creutzfeldt-Jakob disease, Gerstmann-Sträussler-Scheinker disease, and fatal familial insomnia, constitute ∼10%-15% of all PrP prion disease cases in humans. Attempts to generate animal models of these disorders using transgenic mice expressing mutant PrP have produced variable results. Although many lines of mice develop spontaneous signs of neurological illness with accompanying prion disease-specific neuropathological changes, others do not. Furthermore, demonstrating the presence of protease-resistant PrP species and prion infectivity-two of the hallmarks of the PrP prion disorders-in the brains of spontaneously sick mice has proven particularly challenging. Here, we review the progress that has been made toward developing accurate mouse models of the inherited PrP prion disorders. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.

  20. Trafficking and degradation pathways in pathogenic conversion of prions and prion-like proteins in neurodegenerative diseases.

    Science.gov (United States)

    Victoria, Guiliana Soraya; Zurzolo, Chiara

    2015-09-02

    Several neurodegenerative diseases such as transmissible spongiform encephalopathies, Alzheimer's and Parkinson's diseases are caused by the conversion of cellular proteins to a pathogenic conformer. Despite differences in the primary structure and subcellular localization of these proteins, which include the prion protein, α-synuclein and amyloid precursor protein (APP), striking similarity has been observed in their ability to seed and convert naïve protein molecules as well as transfer between cells. This review aims to cover what is known about the intracellular trafficking of these proteins as well as their degradation mechanisms and highlight similarities in their movement through the endocytic pathway that could contribute to the pathogenic conversion and seeding of these proteins which underlies the basis of these diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  2. Loss of prion protein induces a primed state of type I interferon-responsive genes

    DEFF Research Database (Denmark)

    Malachin, Giulia; Reiten, Malin R.; Salvesen, Øyvind

    2017-01-01

    The cellular prion protein (PrPC) has been extensively studied because of its pivotal role in prion diseases; however, its functions remain incompletely understood. A unique line of goats has been identified that carries a nonsense mutation that abolishes synthesis of PrPC. In these animals, the Pr...... genotypes. About 70% of these were classified as interferon-responsive genes. In goats without PrPC, the majority of type I interferon-responsive genes were in a primed, modestly upregulated state, with fold changes ranging from 1.4 to 3.7. Among these were ISG15, DDX58 (RIG-1), MX1, MX2, OAS1, OAS2...... and DRAM1, all of which have important roles in pathogen defense, cell proliferation, apoptosis, immunomodulation and DNA damage response. Our data suggest that PrPC contributes to the fine-tuning of resting state PBMCs expression level of type I interferon-responsive genes. The molecular mechanism...

  3. Lesion of the olfactory epithelium accelerates prion neuroinvasion and disease onset when prion replication is restricted to neurons.

    Directory of Open Access Journals (Sweden)

    Jenna Crowell

    Full Text Available Natural prion diseases of ruminants are moderately contagious and while the gastrointestinal tract is the primary site of prion agent entry, other mucosae may be entry sites in a subset of infections. In the current study we examined prion neuroinvasion and disease induction following disruption of the olfactory epithelium in the nasal mucosa since this site contains environmentally exposed olfactory sensory neurons that project directly into the central nervous system. Here we provide evidence for accelerated prion neuroinvasion and clinical onset from the olfactory mucosa after disruption and regeneration of the olfactory epithelium and when prion replication is restricted to neurons. In transgenic mice with neuron restricted replication of prions, there was a reduction in survival when the olfactory epithelium was disrupted prior to intranasal inoculation and there was >25% decrease in the prion incubation period. In a second model, the neurotropic DY strain of transmissible mink encephalopathy was not pathogenic in hamsters by the nasal route, but 50% of animals exhibited brain infection and/or disease when the olfactory epithelium was disrupted prior to intranasal inoculation. A time course analysis of prion deposition in the brain following loss of the olfactory epithelium in models of neuron-restricted prion replication suggests that neuroinvasion from the olfactory mucosa is via the olfactory nerve or brain stem associated cranial nerves. We propose that induction of neurogenesis after damage to the olfactory epithelium can lead to prion infection of immature olfactory sensory neurons and accelerate prion spread to the brain.

  4. Effects of solution chemistry and aging time on prion protein adsorption and replication of soil-bound prions.

    Directory of Open Access Journals (Sweden)

    Samuel E Saunders

    2011-04-01

    Full Text Available Prion interactions with soil may play an important role in the transmission of chronic wasting disease (CWD and scrapie. Prions are known to bind to a wide range of soil surfaces, but the effects of adsorption solution chemistry and long-term soil binding on prion fate and transmission risk are unknown. We investigated HY TME prion protein (PrP(Sc adsorption to soil minerals in aqueous solutions of phosphate buffered saline (PBS, sodium chloride, calcium chloride, and deionized water using western blotting. The replication efficiency of bound prions following adsorption in these solutions was also evaluated by protein misfolding cyclic amplification (PMCA. Aging studies investigated PrP(Sc desorption and replication efficiency up to one year following adsorption in PBS or DI water. Results indicate that adsorption solution chemistry can affect subsequent prion replication or desorption ability, especially after incubation periods of 30 d or longer. Observed effects were minor over the short-term (7 d or less. Results of long-term aging experiments demonstrate that unbound prions or prions bound to a diverse range of soil surfaces can readily replicate after one year. Our results suggest that while prion-soil interactions can vary with solution chemistry, prions bound to soil could remain a risk for transmitting prion diseases after months in the environment.

  5. Lesion of the Olfactory Epithelium Accelerates Prion Neuroinvasion and Disease Onset when Prion Replication Is Restricted to Neurons

    Science.gov (United States)

    Crowell, Jenna; Wiley, James A.; Bessen, Richard A.

    2015-01-01

    Natural prion diseases of ruminants are moderately contagious and while the gastrointestinal tract is the primary site of prion agent entry, other mucosae may be entry sites in a subset of infections. In the current study we examined prion neuroinvasion and disease induction following disruption of the olfactory epithelium in the nasal mucosa since this site contains environmentally exposed olfactory sensory neurons that project directly into the central nervous system. Here we provide evidence for accelerated prion neuroinvasion and clinical onset from the olfactory mucosa after disruption and regeneration of the olfactory epithelium and when prion replication is restricted to neurons. In transgenic mice with neuron restricted replication of prions, there was a reduction in survival when the olfactory epithelium was disrupted prior to intranasal inoculation and there was >25% decrease in the prion incubation period. In a second model, the neurotropic DY strain of transmissible mink encephalopathy was not pathogenic in hamsters by the nasal route, but 50% of animals exhibited brain infection and/or disease when the olfactory epithelium was disrupted prior to intranasal inoculation. A time course analysis of prion deposition in the brain following loss of the olfactory epithelium in models of neuron-restricted prion replication suggests that neuroinvasion from the olfactory mucosa is via the olfactory nerve or brain stem associated cranial nerves. We propose that induction of neurogenesis after damage to the olfactory epithelium can lead to prion infection of immature olfactory sensory neurons and accelerate prion spread to the brain. PMID:25822718

  6. Amyloid cores in prion domains: Key regulators for prion conformational conversion.

    Science.gov (United States)

    Fernández, María Rosario; Batlle, Cristina; Gil-García, Marcos; Ventura, Salvador

    2017-01-02

    Despite the significant efforts devoted to decipher the particular protein features that encode for a prion or prion-like behavior, they are still poorly understood. The well-characterized yeast prions constitute an ideal model system to address this question, because, in these proteins, the prion activity can be univocally assigned to a specific region of their sequence, known as the prion forming domain (PFD). These PFDs are intrinsically disordered, relatively long and, in many cases, of low complexity, being enriched in glutamine/asparagine residues. Computational analyses have identified a significant number of proteins having similar domains in the human proteome. The compositional bias of these regions plays an important role in the transition of the prions to the amyloid state. However, it is difficult to explain how composition alone can account for the formation of specific contacts that position correctly PFDs and provide the enthalpic force to compensate for the large entropic cost of immobilizing these domains in the initial assemblies. We have hypothesized that short, sequence-specific, amyloid cores embedded in PFDs can perform these functions and, accordingly, act as preferential nucleation centers in both spontaneous and seeded aggregation. We have shown that the implementation of this concept in a prediction algorithm allows to score the prion propensities of putative PFDs with high accuracy. Recently, we have provided experimental evidence for the existence of such amyloid cores in the PFDs of Sup35, Ure2, Swi1, and Mot3 yeast prions. The fibrils formed by these short stretches may recognize and promote the aggregation of the complete proteins inside cells, being thus a promising tool for targeted protein inactivation.

  7. Experimental approaches to the interaction of the prion protein with nucleic acids and glycosaminoglycans: Modulators of the pathogenic conversion.

    Science.gov (United States)

    Silva, Jerson L; Vieira, Tuane C R G; Gomes, Mariana P B; Rangel, Luciana P; Scapin, Sandra M N; Cordeiro, Yraima

    2011-03-01

    The concept that transmissible spongiform encephalopathies (TSEs) are caused only by proteins has changed the traditional paradigm that disease transmission is due solely to an agent that carries genetic information. The central hypothesis for prion diseases proposes that the conversion of a cellular prion protein (PrP(C)) into a misfolded, β-sheet-rich isoform (PrP(Sc)) accounts for the development of (TSE). There is substantial evidence that the infectious material consists chiefly of a protein, PrP(Sc), with no genomic coding material, unlike a virus particle, which has both. However, prions seem to have other partners that chaperone their activities in converting the PrP(C) into the disease-causing isoform. Nucleic acids (NAs) and glycosaminoglycans (GAGs) are the most probable accomplices of prion conversion. Here, we review the recent experimental approaches that have been employed to characterize the interaction of prion proteins with nucleic acids and glycosaminoglycans. A PrP recognizes many nucleic acids and GAGs with high affinities, and this seems to be related to a pathophysiological role for this interaction. A PrP binds nucleic acids and GAGs with structural selectivity, and some PrP:NA complexes can become proteinase K-resistant, undergoing amyloid oligomerization and conversion to a β-sheet-rich structure. These results are consistent with the hypothesis that endogenous polyanions (such as NAs and GAGs) may accelerate the rate of prion disease progression by acting as scaffolds or lattices that mediate the interaction between PrP(C) and PrP(Sc) molecules. In addition to a still-possible hypothesis that nucleic acids and GAGs, especially those from the host, may modulate the conversion, the recent structural characterization of the complexes has raised the possibility of developing new diagnostic and therapeutic strategies. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. Prion diseases and adult neurogenesis: how do prions counteract the brain's endogenous repair machinery?

    Science.gov (United States)

    Relaño-Ginés, Aroa; Lehmann, Sylvain; Crozet, Carole

    2014-01-01

    Scientific advances in stem cell biology and adult neurogenesis have raised the hope that neurodegenerative disorders could benefit from stem cell-based therapy. Adult neurogenesis might be part of the physiological regenerative process, however it might become impaired by the disease's mechanism and therefore contribute to neurodegeneration. In prion disorders this endogenous repair system has rarely been studied. Whether adult neurogenesis plays a role or not in brain repair or in the propagation of prion pathology remains unclear. We have recently investigated the status of adult neural stem cells isolated from prion-infected mice. We were able to show that neural stem cells accumulate and replicate prions thus resulting in an alteration of their neuronal destiny. We also reproduced these results in adult neural stem cells, which were infected in vitro. The fact that endogenous adult neurogenesis could be altered by the accumulation of misfolded prion protein represents another great challenge. Inhibiting prion propagation in these cells would thus help the endogenous neurogenesis to compensate for the injured neuronal system. Moreover, understanding the endogenous modulation of the neurogenesis system would help develop effective neural stem cell-based therapies.

  9. Prion infected meat-and-bone meal is still infectious after biodiesel production.

    Directory of Open Access Journals (Sweden)

    Cathrin E Bruederle

    2008-08-01

    Full Text Available The epidemic of bovine spongiform encephalopathy (BSE has led to a world-wide drop in the market for beef by-products, such as Meat-and-Bone Meal (MBM, a fat-containing but mainly proteinaceaous product traditionally used as an animal feed supplement. While normal rendering is insufficient, the production of biodiesel from MBM has been suggested to destroy infectivity from transmissible spongiform encephalopathies (TSEs. In addition to producing fuel, this method simultaneously generates a nutritious solid residue. In our study we produced biodiesel from MBM under defined conditions using a modified form of alkaline methanolysis. We evaluated the presence of prion in the three resulting phases of the biodiesel reaction (Biodiesel, Glycerol and Solid Residue in vitro and in vivo. Analysis of the reaction products from 263K scrapie infected MBM led to no detectable immunoreactivity by Western Blot. Importantly, and in contrast to the biochemical results the solid MBM residue from the reaction retained infectivity when tested in an animal bioassay. Histochemical analysis of hamster brains inoculated with the solid residue showed typical spongiform degeneration and vacuolation. Re-inoculation of these brains into a new cohort of hamsters led to onset of clinical scrapie symptoms within 75 days, suggesting that the specific infectivity of the prion protein was not changed during the biodiesel process. The biodiesel reaction cannot be considered a viable prion decontamination method for MBM, although we observed increased survival time of hamsters and reduced infectivity greater than 6 log orders in the solid MBM residue. Furthermore, results from our study compare for the first time prion detection by Western Blot versus an infectivity bioassay for analysis of biodiesel reaction products. We could show that biochemical analysis alone is insufficient for detection of prion infectivity after a biodiesel process.

  10. Efficient prion disease transmission through common environmental materials.

    Science.gov (United States)

    Pritzkow, Sandra; Morales, Rodrigo; Lyon, Adam; Concha-Marambio, Luis; Urayama, Akihiko; Soto, Claudio

    2018-03-02

    Prion diseases are a group of fatal neurodegenerative diseases associated with a protein-based infectious agent, termed prion. Compelling evidence suggests that natural transmission of prion diseases is mediated by environmental contamination with infectious prions. We hypothesized that several natural and man-made materials, commonly found in the environments of wild and captive animals, can bind prions and may act as vectors for disease transmission. To test our hypothesis, we exposed surfaces composed of various common environmental materials ( i.e. wood, rocks, plastic, glass, cement, stainless steel, aluminum, and brass) to hamster-adapted 263K scrapie prions and studied their attachment and retention of infectivity in vitro and in vivo Our results indicated that these surfaces, with the sole exception of brass, efficiently bind, retain, and release prions. Prion replication was studied in vitro using the protein misfolding cyclic amplification technology, and infectivity of surface-bound prions was analyzed by intracerebrally challenging hamsters with contaminated implants. Our results revealed that virtually all prion-contaminated materials transmitted the disease at high rates. To investigate a more natural form of exposure to environmental contamination, we simply housed animals with large contaminated spheres made of the different materials under study. Strikingly, most of the hamsters developed classical clinical signs of prion disease and typical disease-associated brain changes. Our findings suggest that prion contamination of surfaces commonly present in the environment can be a source of disease transmission, thus expanding our understanding of the mechanisms for prion spreading in nature. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. PrPC expression and prion seeding activity in the alimentary tract and lymphoid tissue of deer.

    Science.gov (United States)

    Davenport, Kristen A; Hoover, Clare E; Bian, Jifeng; Telling, Glenn C; Mathiason, Candace K; Hoover, Edward A

    2017-01-01

    The agent responsible for prion diseases is a misfolded form of a normal protein (PrPC). The prion hypothesis stipulates that PrPC must be present for the disease to manifest. Cervid populations across the world are infected with chronic wasting disease, a horizontally-transmissible prion disease that is likely spread via oral exposure to infectious prions (PrPCWD). Though PrPCWD has been identified in many tissues, there has been little effort to characterize the overall PrPC expression in cervids and its relationship to PrPCWD accumulation. We used immunohistochemistry (IHC), western blot and enzyme-linked immunosorbent assay to describe PrPC expression in naïve white-tailed deer. We used real-time, quaking-induced conversion (RT-QuIC) to detect prion seeding activity in CWD-infected deer. We assessed tissues comprising the alimentary tract, alimentary-associated lymphoid tissue and systemic lymphoid tissue from 5 naïve deer. PrPC was expressed in all tissues, though expression was often very low compared to the level in the CNS. IHC identified specific cell types wherein PrPC expression is very high. To compare the distribution of PrPC to PrPCWD, we examined 5 deer with advanced CWD infection. Using RT-QuIC, we detected prion seeding activity in all 21 tissues. In 3 subclinical deer sacrificed 4 months post-inoculation, we detected PrPCWD consistently in alimentary-associated lymphoid tissue, irregularly in alimentary tract tissues, and not at all in the brain. Contrary to our hypothesis that PrPC levels dictate prion accumulation, PrPC expression was higher in the lower gastrointestinal tissues than in the alimentary-associated lymphoid system and was higher in salivary glands than in the oropharyngeal lymphoid tissue. These data suggest that PrPC expression is not the sole driver of prion accumulation and that alimentary tract tissues accumulate prions before centrifugal spread from the brain occurs.

  12. Role of Prion Protein Aggregation in Neurotoxicity

    Directory of Open Access Journals (Sweden)

    Tullio Florio

    2012-07-01

    Full Text Available In several neurodegenerative diseases, such as Parkinson, Alzheimer’s, Huntington, and prion diseases, the deposition of aggregated misfolded proteins is believed to be responsible for the neurotoxicity that characterizes these diseases. Prion protein (PrP, the protein responsible of prion diseases, has been deeply studied for the peculiar feature of its misfolded oligomers that are able to propagate within affected brains, inducing the conversion of the natively folded PrP into the pathological conformation. In this review, we summarize the available experimental evidence concerning the relationship between aggregation status of misfolded PrP and neuronal death in the course of prion diseases. In particular, we describe the main findings resulting from the use of different synthetic (mainly PrP106-126 and recombinant PrP-derived peptides, as far as mechanisms of aggregation and amyloid formation, and how these different spatial conformations can affect neuronal death. In particular, most data support the involvement of non-fibrillar oligomers rather than actual amyloid fibers as the determinant of neuronal death.

  13. The structural core of prion disease

    NARCIS (Netherlands)

    Boshuizen, R.S.

    2010-01-01

    Transmissible spongiform encephalopathies (TSEs) or prion diseases are serious neurological ailments, in which the brain tissue deteriorates by progressive loss of brain cells which results in the loss of a wide variety of brain functions, including memory, speech and locomotion. Similar conditions

  14. Neuroinflammation in Alzheimer's disease and prion disease

    NARCIS (Netherlands)

    Eikelenboom, P.; Bate, C.; van Gool, W. A.; Hoozemans, J. J. M.; Rozemuller, J. M.; Veerhuis, R.; Williams, A.

    2002-01-01

    Alzheimer's disease (AD) and prion disease are characterized neuropathologically by extracellular deposits of Abeta and PrP amyloid fibrils, respectively. In both disorders, these cerebral amyloid deposits are co-localized with a broad variety of inflammation-related proteins (complement factors,

  15. Chronic wasting disease: Bambi vs. the prion

    Science.gov (United States)

    Chronic wasting disease (CWD) was first described in Colorado in 1967 and subsequently recognized as a prion disease in 1980. CWD has a long and asymptomatic incubation period (> 1 year) followed by a short disease course that ends in the death of the animal. There is no known treatment or cure for ...

  16. Prions: Protein Rebels with a Cause!

    Science.gov (United States)

    Marshall, Karen E.; Serpell, Louise C.

    2017-01-01

    Traditionally we consider infection to arise from viruses, bacteria and parasites. Prions are infectious proteins without any nucleic acids, and therefore do not represent living things. Despite this, they have the ability to replicate themselves and cause diseases such as mad cow disease (bovine spongiform encepthalopathy) and human…

  17. The expanding universe of prion diseases.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Prions cause fatal and transmissible neurodegenerative disease. These etiological infectious agents are formed in greater part from a misfolded cell-surface protein called PrP(C. Several mammalian species are affected by the diseases, and in the case of "mad cow disease" (BSE the agent has a tropism for humans, with negative consequences for agribusiness and public health. Unfortunately, the known universe of prion diseases is expanding. At least four novel prion diseases-including human diseases variant Creutzfeldt-Jakob disease (vCJD and sporadic fatal insomnia (sFI, bovine amyloidotic spongiform encephalopathy (BASE, and Nor98 of sheep-have been identified in the last ten years, and chronic wasting disease (CWD of North American deer (Odocoileus Specis and Rocky Mountain elk (Cervus elaphus nelsoni is undergoing a dramatic spread across North America. While amplification (BSE and dissemination (CWD, commercial sourcing of cervids from the wild and movement of farmed elk can be attributed to human activity, the origins of emergent prion diseases cannot always be laid at the door of humankind. Instead, the continued appearance of new outbreaks in the form of "sporadic" disease may be an inevitable outcome in a situation where the replicating pathogen is host-encoded.

  18. The expanding universe of prion diseases.

    Directory of Open Access Journals (Sweden)

    Joel C Watts

    2006-03-01

    Full Text Available Prions cause fatal and transmissible neurodegenerative disease. These etiological infectious agents are formed in greater part from a misfolded cell-surface protein called PrP(C. Several mammalian species are affected by the diseases, and in the case of "mad cow disease" (BSE the agent has a tropism for humans, with negative consequences for agribusiness and public health. Unfortunately, the known universe of prion diseases is expanding. At least four novel prion diseases--including human diseases variant Creutzfeldt-Jakob disease (vCJD and sporadic fatal insomnia (sFI, bovine amyloidotic spongiform encephalopathy (BASE, and Nor98 of sheep--have been identified in the last ten years, and chronic wasting disease (CWD of North American deer (Odocoileus Specis and Rocky Mountain elk (Cervus elaphus nelsoni is undergoing a dramatic spread across North America. While amplification (BSE and dissemination (CWD, commercial sourcing of cervids from the wild and movement of farmed elk can be attributed to human activity, the origins of emergent prion diseases cannot always be laid at the door of humankind. Instead, the continued appearance of new outbreaks in the form of "sporadic" disease may be an inevitable outcome in a situation where the replicating pathogen is host-encoded.

  19. The expanding universe of prion diseases.

    Science.gov (United States)

    Watts, Joel C; Balachandran, Aru; Westaway, David

    2006-03-01

    Prions cause fatal and transmissible neurodegenerative disease. These etiological infectious agents are formed in greater part from a misfolded cell-surface protein called PrP(C). Several mammalian species are affected by the diseases, and in the case of "mad cow disease" (BSE) the agent has a tropism for humans, with negative consequences for agribusiness and public health. Unfortunately, the known universe of prion diseases is expanding. At least four novel prion diseases--including human diseases variant Creutzfeldt-Jakob disease (vCJD) and sporadic fatal insomnia (sFI), bovine amyloidotic spongiform encephalopathy (BASE), and Nor98 of sheep--have been identified in the last ten years, and chronic wasting disease (CWD) of North American deer (Odocoileus Specis) and Rocky Mountain elk (Cervus elaphus nelsoni) is undergoing a dramatic spread across North America. While amplification (BSE) and dissemination (CWD, commercial sourcing of cervids from the wild and movement of farmed elk) can be attributed to human activity, the origins of emergent prion diseases cannot always be laid at the door of humankind. Instead, the continued appearance of new outbreaks in the form of "sporadic" disease may be an inevitable outcome in a situation where the replicating pathogen is host-encoded.

  20. Prion Disease: Learn the Facts. Avoid Exposure.

    Centers for Disease Control (CDC) Podcasts

    2011-05-23

    This podcast discusses prion diseases and the risk of exposure associated with some common activities.  Created: 5/23/2011 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 5/23/2011.

  1. Guinea Pig Prion Protein Supports Rapid Propagation of Bovine Spongiform Encephalopathy and Variant Creutzfeldt-Jakob Disease Prions.

    Science.gov (United States)

    Watts, Joel C; Giles, Kurt; Saltzberg, Daniel J; Dugger, Brittany N; Patel, Smita; Oehler, Abby; Bhardwaj, Sumita; Sali, Andrej; Prusiner, Stanley B

    2016-11-01

    The biochemical and neuropathological properties of bovine spongiform encephalopathy (BSE) and variant Creutzfeldt-Jakob disease (vCJD) prions are faithfully maintained upon transmission to guinea pigs. However, primary and secondary transmissions of BSE and vCJD in guinea pigs result in long incubation periods of ∼450 and ∼350 days, respectively. To determine if the incubation periods of BSE and vCJD prions could be shortened, we generated transgenic (Tg) mice expressing guinea pig prion protein (GPPrP). Inoculation of Tg(GPPrP) mice with BSE and vCJD prions resulted in mean incubation periods of 210 and 199 days, respectively, which shortened to 137 and 122 days upon serial transmission. In contrast, three different isolates of sporadic CJD prions failed to transmit disease to Tg(GPPrP) mice. Many of the strain-specified biochemical and neuropathological properties of BSE and vCJD prions, including the presence of type 2 protease-resistant PrP Sc , were preserved upon propagation in Tg(GPPrP) mice. Structural modeling revealed that two residues near the N-terminal region of α-helix 1 in GPPrP might mediate its susceptibility to BSE and vCJD prions. Our results demonstrate that expression of GPPrP in Tg mice supports the rapid propagation of BSE and vCJD prions and suggest that Tg(GPPrP) mice may serve as a useful paradigm for bioassaying these prion isolates. Variant Creutzfeldt-Jakob disease (vCJD) and bovine spongiform encephalopathy (BSE) prions are two of the prion strains most relevant to human health. However, propagating these strains in mice expressing human or bovine prion protein has been difficult because of prolonged incubation periods or inefficient transmission. Here, we show that transgenic mice expressing guinea pig prion protein are fully susceptible to vCJD and BSE prions but not to sporadic CJD prions. Our results suggest that the guinea pig prion protein is a better, more rapid substrate than either bovine or human prion protein for

  2. Inherited prion disease A117V is not simply a proteinopathy but produces prions transmissible to transgenic mice expressing homologous prion protein.

    Directory of Open Access Journals (Sweden)

    Emmanuel A Asante

    Full Text Available Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP gene (PRNP and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc, pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((CtmPrP. Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc was demonstrated in the brains of recipient transgenic mice. This PrP(Sc rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (CtmPrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.

  3. Inherited prion disease A117V is not simply a proteinopathy but produces prions transmissible to transgenic mice expressing homologous prion protein.

    Science.gov (United States)

    Asante, Emmanuel A; Linehan, Jacqueline M; Smidak, Michelle; Tomlinson, Andrew; Grimshaw, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Powell, Caroline; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John

    2013-01-01

    Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP) gene (PRNP) and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS) caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc)), pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((Ctm)PrP). Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc) was demonstrated in the brains of recipient transgenic mice. This PrP(Sc) rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (Ctm)PrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.

  4. Live-cell FRET imaging reveals clustering of the prion protein at the cell surface induced by infectious prions.

    Science.gov (United States)

    Tavares, Evandro; Macedo, Joana A; Paulo, Pedro M R; Tavares, Catarina; Lopes, Carlos; Melo, Eduardo P

    2014-07-01

    Prion diseases are associated to the conversion of the prion protein into a misfolded pathological isoform. The mechanism of propagation of protein misfolding by protein templating remains largely unknown. Neuroblastoma cells were transfected with constructs of the prion protein fused to both CFP-GPI-anchored and to YFP-GPI-anchored and directed to its cell membrane location. Live-cell FRET imaging between the prion protein fused to CFP or YFP was measured giving consistent values of 10±2%. This result was confirmed by fluorescence lifetime imaging microscopy and indicates intermolecular interactions between neighbor prion proteins. In particular, considering that a maximum FRET efficiency of 17±2% was determined from a positive control consisting of a fusion CFP-YFP-GPI-anchored. A stable cell clone expressing the two fusions containing the prion protein was also selected to minimize cell-to-cell variability. In both, stable and transiently transfected cells, the FRET efficiency consistently increased in the presence of infectious prions - from 4±1% to 7±1% in the stable clone and from 10±2% to 16±1% in transiently transfected cells. These results clearly reflect an increased clustering of the prion protein on the membrane in the presence of infectious prions, which was not observed in negative control using constructs without the prion protein and upon addition of non-infected brain. Our data corroborates the recent view that the primary site for prion conversion is the cell membrane. Since our fluorescent cell clone is not susceptible to propagate infectivity, we hypothesize that the initial event of prion infectivity might be the clustering of the GPI-anchored prion protein. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Prion protein expression regulates embryonic stem cell pluripotency and differentiation.

    Directory of Open Access Journals (Sweden)

    Alberto Miranda

    2011-04-01

    Full Text Available Cellular prion protein (PRNP is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs. Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB differentiation in mouse Prnp-null (KO and WT embryonic stem cell (ESC lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5 in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel and SPRN (Shadoo, whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.

  6. Saccharomyces cerevisiae: a sexy yeast with a prion problem.

    Science.gov (United States)

    Kelly, Amy C; Wickner, Reed B

    2013-01-01

    Yeast prions are infectious proteins that spread exclusively by mating. The frequency of prions in the wild therefore largely reflects the rate of spread by mating counterbalanced by prion growth slowing effects in the host. We recently showed that the frequency of outcross mating is about 1% of mitotic doublings with 23-46% of total matings being outcrosses. These findings imply that even the mildest forms of the [PSI+], [URE3] and [PIN+] prions impart > 1% growth/survival detriment on their hosts. Our estimate of outcrossing suggests that Saccharomyces cerevisiae is far more sexual than previously thought and would therefore be more responsive to the adaptive effects of natural selection compared with a strictly asexual yeast. Further, given its large effective population size, a growth/survival detriment of > 1% for yeast prions should strongly select against prion-infected strains in wild populations of Saccharomyces cerevisiae.

  7. Heterologous aggregates promote de novo prion appearance via more than one mechanism.

    Directory of Open Access Journals (Sweden)

    Fatih Arslan

    2015-01-01

    Full Text Available Prions are self-perpetuating conformational variants of particular proteins. In yeast, prions cause heritable phenotypic traits. Most known yeast prions contain a glutamine (Q/asparagine (N-rich region in their prion domains. [PSI+], the prion form of Sup35, appears de novo at dramatically enhanced rates following transient overproduction of Sup35 in the presence of [PIN+], the prion form of Rnq1. Here, we establish the temporal de novo appearance of Sup35 aggregates during such overexpression in relation to other cellular proteins. Fluorescently-labeled Sup35 initially forms one or a few dots when overexpressed in [PIN+] cells. One of the dots is perivacuolar, colocalizes with the aggregated Rnq1 dot and grows into peripheral rings/lines, some of which also colocalize with Rnq1. Sup35 dots that are not near the vacuole do not always colocalize with Rnq1 and disappear by the time rings start to grow. Bimolecular fluorescence complementation failed to detect any interaction between Sup35-VN and Rnq1-VC in [PSI+][PIN+] cells. In contrast, all Sup35 aggregates, whether newly induced or in established [PSI+], completely colocalize with the molecular chaperones Hsp104, Sis1, Ssa1 and eukaryotic release factor Sup45. In the absence of [PIN+], overexpressed aggregating proteins such as the Q/N-rich Pin4C or the non-Q/N-rich Mod5 can also promote the de novo appearance of [PSI+]. Similar to Rnq1, overexpressed Pin4C transiently colocalizes with newly appearing Sup35 aggregates. However, no interaction was detected between Mod5 and Sup35 during [PSI+] induction in the absence of [PIN+]. While the colocalization of Sup35 and aggregates of Rnq1 or Pin4C are consistent with the model that the heterologous aggregates cross-seed the de novo appearance of [PSI+], the lack of interaction between Mod5 and Sup35 leaves open the possibility of other mechanisms. We also show that Hsp104 is required in the de novo appearance of [PSI+] aggregates in a [PIN

  8. Monitoring prion protein expression in complex biological samples by SERS for diagnostic applications

    Energy Technology Data Exchange (ETDEWEB)

    Manno, D; Filippo, E; Fiore, R; Serra, A [Dipartimento di Scienza dei Materiali, Universita del Salento, Lecce (Italy); Urso, E; Rizzello, A; Maffia, M [Dipartimento di Scienze e Tecnologie Biologiche ed Ambientali, Universita del Salento, Lecce (Italy)

    2010-04-23

    Surface-enhanced Raman spectroscopy (SERS) allows a new insight into the analysis of cell physiology. In this work, the difficulty of producing suitable substrates that, besides permitting the amplification of the Raman signal, do not interact with the biological material causing alteration, has been overcome by a combined method of hydrothermal green synthesis and thermal annealing. The SERS analysis of the cell membrane has been performed with special attention to the cellular prion protein PrP{sup C}. In addition, SERS has also been used to reveal the prion protein-Cu(II) interaction in four different cell models (B104, SH-SY5Y, GN11, HeLa), expressing PrP{sup C} at different levels. A significant implication of the current work consists of the intriguing possibility of revealing and quantifying prion protein expression in complex biological samples by a cheap SERS-based method, replacing the expensive and time-consuming immuno-assay systems commonly employed.

  9. Cavitation during the protein misfolding cyclic amplification (PMCA) method – The trigger for de novo prion generation?

    International Nuclear Information System (INIS)

    Haigh, Cathryn L.; Drew, Simon C.

    2015-01-01

    The protein misfolding cyclic amplification (PMCA) technique has become a widely-adopted method for amplifying minute amounts of the infectious conformer of the prion protein (PrP). PMCA involves repeated cycles of 20 kHz sonication and incubation, during which the infectious conformer seeds the conversion of normally folded protein by a templating interaction. Recently, it has proved possible to create an infectious PrP conformer without the need for an infectious seed, by including RNA and the phospholipid POPG as essential cofactors during PMCA. The mechanism underpinning this de novo prion formation remains unknown. In this study, we first establish by spin trapping methods that cavitation bubbles formed during PMCA provide a radical-rich environment. Using a substrate preparation comparable to that employed in studies of de novo prion formation, we demonstrate by immuno-spin trapping that PrP- and RNA-centered radicals are generated during sonication, in addition to PrP-RNA cross-links. We further show that serial PMCA produces protease-resistant PrP that is oxidatively modified. We suggest a unique confluence of structural (membrane-mimetic hydrophobic/hydrophilic bubble interface) and chemical (ROS) effects underlie the phenomenon of de novo prion formation by PMCA, and that these effects have meaningful biological counterparts of possible relevance to spontaneous prion formation in vivo. - Highlights: • Sonication during PMCA generates free radicals at the surface of cavitation bubbles. • PrP-centered and RNA-centered radicals are formed in addition to PrP-RNA adducts. • De novo prions may result from ROS and structural constraints during cavitation

  10. The human prion diseases. A review with special emphasis on new variant CJD and comments on surveillance.

    LENUS (Irish Health Repository)

    Keohane, C

    2012-02-03

    The transmissible spongiform encephalopathies or prion diseases represent a new group of diseases with unique clinical and neuropathological features, the transmission of which is both genetic and infectious. The responsible agent is unconventional and appears to be largely composed of a glycoprotein, the prion protein PrP. This is normally present on different cells. In prion diseases, it becomes converted to the pathogenic form PrPres which is resistant to proteinase and accumulates within the brain and this process is accompanied by the development of spongiform change, gliosis and neuronal loss. The human prion diseases include Kuru a progressive cerebellar degeneration with late dementia affecting Fore tribes in New-Guinea, now almost extinct, regarded as being related to cannibalism. Creutzfeldt-Jakob disease is the more frequent human prion disease. Its incidence is approximately one case per million per year. Four variants are now recognized: sporadic, familial, iatrogenic and the new variant. The latter represents a distinct clinico-pathological entity. It is now widely accepted that it is due to the same agent responsible for Bovine Spongiform Encephalopathy in cattle. Gerstmann-Straussler-Scheinker disease is a very rare inherited disorder due to a number of different mutations in the PRP gene, characterized by abundant deposits of plaque PrPres in the cerebral grey matter. Fatal familial insomnia is another inherited disorder due to a mutation at codon 178 of the PRP gene associated with methionine on codon 129 of the mutant allele. The main neuropathological change is neuronal loss in the thalamus with little or no spongiosis and usually no PrPres deposition. Following the emergence of new variant CJD in 1996, surveillance of all forms of prion diseases has been now been actively introduced in many European nations in order to determine the true incidence and geographic distribution of these rare disorders in humans.

  11. Cavitation during the protein misfolding cyclic amplification (PMCA) method – The trigger for de novo prion generation?

    Energy Technology Data Exchange (ETDEWEB)

    Haigh, Cathryn L., E-mail: chaigh@unimelb.edu.au [Department of Pathology, The University of Melbourne, Victoria 3010 (Australia); Drew, Simon C., E-mail: sdrew@unimelb.edu.au [Florey Department of Neuroscience and Mental Health, The University of Melbourne, Victoria 3010 (Australia)

    2015-06-05

    The protein misfolding cyclic amplification (PMCA) technique has become a widely-adopted method for amplifying minute amounts of the infectious conformer of the prion protein (PrP). PMCA involves repeated cycles of 20 kHz sonication and incubation, during which the infectious conformer seeds the conversion of normally folded protein by a templating interaction. Recently, it has proved possible to create an infectious PrP conformer without the need for an infectious seed, by including RNA and the phospholipid POPG as essential cofactors during PMCA. The mechanism underpinning this de novo prion formation remains unknown. In this study, we first establish by spin trapping methods that cavitation bubbles formed during PMCA provide a radical-rich environment. Using a substrate preparation comparable to that employed in studies of de novo prion formation, we demonstrate by immuno-spin trapping that PrP- and RNA-centered radicals are generated during sonication, in addition to PrP-RNA cross-links. We further show that serial PMCA produces protease-resistant PrP that is oxidatively modified. We suggest a unique confluence of structural (membrane-mimetic hydrophobic/hydrophilic bubble interface) and chemical (ROS) effects underlie the phenomenon of de novo prion formation by PMCA, and that these effects have meaningful biological counterparts of possible relevance to spontaneous prion formation in vivo. - Highlights: • Sonication during PMCA generates free radicals at the surface of cavitation bubbles. • PrP-centered and RNA-centered radicals are formed in addition to PrP-RNA adducts. • De novo prions may result from ROS and structural constraints during cavitation.

  12. Antimicrobial activity of human prion protein is mediated by its N-terminal region.

    Directory of Open Access Journals (Sweden)

    Mukesh Pasupuleti

    Full Text Available BACKGROUND: Cellular prion-related protein (PrP(c is a cell-surface protein that is ubiquitously expressed in the human body. The multifunctionality of PrP(c, and presence of an exposed cationic and heparin-binding N-terminus, a feature characterizing many antimicrobial peptides, made us hypothesize that PrP(c could exert antimicrobial activity. METHODOLOGY AND PRINCIPAL FINDINGS: Intact recombinant PrP exerted antibacterial and antifungal effects at normal and low pH. Studies employing recombinant PrP and N- and C-terminally truncated variants, as well as overlapping peptide 20mers, demonstrated that the antimicrobial activity is mediated by the unstructured N-terminal part of the protein. Synthetic peptides of the N-terminus of PrP killed the Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa, and the Gram-positive Bacillus subtilis and Staphylococcus aureus, as well as the fungus Candida parapsilosis. Fluorescence studies of peptide-treated bacteria, paired with analysis of peptide effects on liposomes, showed that the peptides exerted membrane-breaking effects similar to those seen after treatment with the "classical" human antimicrobial peptide LL-37. In contrast to LL-37, however, no marked helix induction was detected for the PrP-derived peptides in presence of negatively charged (bacteria-mimicking liposomes. PrP furthermore showed an inducible expression during wounding of human skin ex vivo and in vivo, as well as stimulation of keratinocytes with TGF-alpha in vitro. CONCLUSIONS: The demonstration of an antimicrobial activity of PrP, localisation of its activity to the N-terminal and heparin-binding region, combined with results showing an increased expression of PrP during wounding, indicate that PrPs could have a previously undisclosed role in host defense.

  13. Plasminogen stimulates propagation of protease-resistant prion protein in vitro.

    Science.gov (United States)

    Mays, Charles E; Ryou, Chongsuk

    2010-12-01

    To clarify the role of plasminogen as a cofactor for prion propagation, we conducted functional assays using a cell-free prion protein (PrP) conversion assay termed protein misfolding cyclic amplification (PMCA) and prion-infected cell lines. Here, we report that plasminogen stimulates propagation of the protease-resistant scrapie PrP (PrP(Sc)). Compared to control PMCA conducted without plasminogen, addition of plasminogen in PMCA using wild-type brain material significantly increased PrP conversion, with an EC(50) = ∼56 nM. PrP conversion in PMCA was substantially less efficient with plasminogen-deficient brain material than with wild-type material. The activity stimulating PrP conversion was specific for plasminogen and conserved in its kringle domains. Such activity was abrogated by modification of plasminogen structure and interference of PrP-plasminogen interaction. Kinetic analysis of PrP(Sc) generation demonstrated that the presence of plasminogen in PMCA enhanced the PrP(Sc) production rate to ∼0.97 U/μl/h and reduced turnover time to ∼1 h compared to those (∼0.4 U/μl/h and ∼2.5 h) obtained without supplementation. Furthermore, as observed in PMCA, plasminogen and kringles promoted PrP(Sc) propagation in ScN2a and Elk 21(+) cells. Our results demonstrate that plasminogen functions in stimulating conversion processes and represents the first cellular protein cofactor that enhances the hypothetical mechanism of prion propagation.

  14. Insights into alternative prion protein topologies induced under high hydrostatic pressure

    International Nuclear Information System (INIS)

    Torrent, Joan; Alvarez-Martinez, Maria Teresa; Heitz, Frederic; Liautard, Jean-Pierre; Balny, Claude; Lange, Reinhard

    2004-01-01

    The critical step in the pathogenesis of transmissible spongiform encephalopathies (TSEs) appears to be a conformational transition of a normal prion protein (PrP C ) into a misfolded isoform (PrP Sc ). To gain insight into the structural conversion of the prion protein we have exploited the use of high hydrostatic pressure combined with various spectroscopic techniques. In vitro transitions of the recombinant PrP to a scrapie-like form have never resulted in an infectious structure. It is our hypothesis that the acquisition of the disease-causing conformation depends on folding pathways which are difficult to attain. We attempt to favour, via specific reaction conditions at high pressure, alternative routes of misfolding leading to a stable infectious amyloidogenic conformer. Our results have demonstrated the potential of high pressure to reveal various prion structural changes, which are inaccessible by conventional methods. Especially, we have characterized a pressure-induced conformer in which the normal α-helical structure is changed into a highly aggregated β-sheet conformation showing markedly increased resistance to proteolysis (key markers of potential infectious agents). Our work may have important implications, not only for ultimately proving the protein-only hypothesis and for understanding the basic mechanism of the disease, but also for developing preventative and therapeutic measures

  15. Insights into alternative prion protein topologies induced under high hydrostatic pressure

    Energy Technology Data Exchange (ETDEWEB)

    Torrent, Joan [INSERM U128, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France); Alvarez-Martinez, Maria Teresa [INSERM U431, IFR 122, Place Eugene Bataillon, F-34095 Montpellier cedex 5 (France); Heitz, Frederic [CRBM, CNRS-UPR 1086, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France); Liautard, Jean-Pierre [INSERM U431, IFR 122, Place Eugene Bataillon, F-34095 Montpellier cedex 5 (France); Balny, Claude [INSERM U128, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France); Lange, Reinhard [INSERM U128, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France)

    2004-04-14

    The critical step in the pathogenesis of transmissible spongiform encephalopathies (TSEs) appears to be a conformational transition of a normal prion protein (PrP{sup C}) into a misfolded isoform (PrP{sup Sc}). To gain insight into the structural conversion of the prion protein we have exploited the use of high hydrostatic pressure combined with various spectroscopic techniques. In vitro transitions of the recombinant PrP to a scrapie-like form have never resulted in an infectious structure. It is our hypothesis that the acquisition of the disease-causing conformation depends on folding pathways which are difficult to attain. We attempt to favour, via specific reaction conditions at high pressure, alternative routes of misfolding leading to a stable infectious amyloidogenic conformer. Our results have demonstrated the potential of high pressure to reveal various prion structural changes, which are inaccessible by conventional methods. Especially, we have characterized a pressure-induced conformer in which the normal {alpha}-helical structure is changed into a highly aggregated {beta}-sheet conformation showing markedly increased resistance to proteolysis (key markers of potential infectious agents). Our work may have important implications, not only for ultimately proving the protein-only hypothesis and for understanding the basic mechanism of the disease, but also for developing preventative and therapeutic measures.

  16. The effects of glutamine/asparagine content on aggregation and heterologous prion induction by yeast prion-like domains.

    Science.gov (United States)

    Shattuck, Jenifer E; Waechter, Aubrey C; Ross, Eric D

    2017-07-04

    Prion-like domains are low complexity, intrinsically disordered domains that compositionally resemble yeast prion domains. Many prion-like domains are involved in the formation of either functional or pathogenic protein aggregates. These aggregates range from highly dynamic liquid droplets to highly ordered detergent-insoluble amyloid-like aggregates. To better understand the amino acid sequence features that promote conversion to stable, detergent-insoluble aggregates, we used the prediction algorithm PAPA to identify predicted aggregation-prone prion-like domains with a range of compositions. While almost all of the predicted aggregation-prone domains formed foci when expressed in cells, the ability to form the detergent-insoluble aggregates was highly correlated with glutamine/asparagine (Q/N) content, suggesting that high Q/N content may specifically promote conversion to the amyloid state in vivo. We then used this data set to examine cross-seeding between prion-like proteins. The prion protein Sup35 requires the presence of a second prion, [PIN + ], to efficiently form prions, but this requirement can be circumvented by the expression of various Q/N-rich protein fragments. Interestingly, almost all of the Q/N-rich domains that formed SDS-insoluble aggregates were able to promote prion formation by Sup35, highlighting the highly promiscuous nature of these interactions.

  17. Exacerbation of experimental autoimmune encephalomyelitis in prion protein (PrPc-null mice: evidence for a critical role of the central nervous system

    Directory of Open Access Journals (Sweden)

    Gourdain Pauline

    2012-01-01

    Full Text Available Abstract Background The cellular prion protein (PrPc is a host-encoded glycoprotein whose transconformation into PrP scrapie (PrPSc initiates prion diseases. The role of PrPc in health is still obscure, but many candidate functions have been attributed to the protein, both in the immune and the nervous systems. Recent data show that experimental autoimmune encephalomyelitis (EAE is worsened in mice lacking PrPc. Disease exacerbation has been attributed to T cells that would differentiate into more aggressive effectors when deprived of PrPc. However, alternative interpretations such as reduced resistance of neurons to autoimmune insult and exacerbated gliosis leading to neuronal deficits were not considered. Method To better discriminate the contribution of immune cells versus neural cells, reciprocal bone marrow chimeras with differential expression of PrPc in the lymphoid or in the central nervous system (CNS were generated. Mice were subsequently challenged with MOG35-55 peptide and clinical disease as well as histopathology were compared in both groups. Furthermore, to test directly the T cell hypothesis, we compared the encephalitogenicity of adoptively transferred PrPc-deficient versus PrPc-sufficient, anti-MOG T cells. Results First, EAE exacerbation in PrPc-deficient mice was confirmed. Irradiation exacerbated EAE in all the chimeras and controls, but disease was more severe in mice with a PrPc-deleted CNS and a normal immune system than in the reciprocal construction. Moreover, there was no indication that anti-MOG responses were different in PrPc-sufficient and PrPc-deficient mice. Paradoxically, PrPc-deficient anti-MOG 2D2 T cells were less pathogenic than PrPc-expressing 2D2 T cells. Conclusions In view of the present data, it can be concluded that the origin of EAE exacerbation in PrPc-ablated mice resides in the absence of the prion protein in the CNS. Furthermore, the absence of PrPc on both neural and immune cells does not

  18. Effects of heme-PrP complex on cell-free conversion and peroxidase-linked immunodetection of prions in blood-based assays.

    Science.gov (United States)

    Soutyrine, Andrei; Yogasingam, Nishandan; Huang, Hongsheng; Mitchell, Gordon

    2015-08-01

    Prion protein (PrP) binding to natural and synthetic porphyrins has been previously demonstrated but the effects of endogenous heme interactions with PrP remain uncertain. This study investigated implications of this interaction in blood-based peroxidase-linked prion immunodetection and seeded conversion of cellular prion (PrP(C)) into disease associated form (PrP(Sc)). Heme binding to recombinant PrP(C) enhanced intrinsic peroxidase activity (POD) by 2.5-fold and POD inherent to denatured blood accounted for over 84% of luminol-based substrate oxidation in a prion immunodetection assay. An immuno-capture assay showed that 75-98% of blood POD was attributable to binding of PrP(C) with endogenous heme. Additionally, 10 μM heme inhibited (PPrP(C) to PrP(Sc) through the protein misfolding cycling amplification assay. We conclude that the observed effects can interfere with cell-free conversion and peroxidase-linked immunodetection of prions in blood-based assays. These results indicate that heme-PrP interactions could modulate intrinsic POD and protect PrP(C) from conversion into PrP(Sc). Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  19. PrPc Does Not Mediate Internalization of PrPSc but Is Required at an Early Stage for De Novo Prion Infection of Rov Cells▿

    Science.gov (United States)

    Paquet, Sophie; Daude, Nathalie; Courageot, Marie-Pierre; Chapuis, Jérôme; Laude, Hubert; Vilette, Didier

    2007-01-01

    We have studied the interactions of exogenous prions with an epithelial cell line inducibly expressing PrPc protein and permissive to infection by a sheep scrapie agent. We demonstrate that abnormal PrP (PrPSc) and prion infectivity are efficiently internalized in Rov cells, whether or not PrPc is expressed. At odds with earlier studies implicating cellular heparan sulfates in PrPSc internalization, we failed to find any involvement of such molecules in Rov cells, indicating that prions can enter target cells by several routes. We further show that PrPSc taken up in the absence of PrPc was unable to promote efficient prion multiplication once PrPc expression was restored in the cells. This observation argues that interaction of PrPSc with PrPc has to occur early, in a specific subcellular compartment(s), and is consistent with the view that the first prion multiplication events may occur at the cell surface. PMID:17626095

  20. Methods and Protocols for Developing Prion Vaccines.

    Science.gov (United States)

    Marciniuk, Kristen; Taschuk, Ryan; Napper, Scott

    2016-01-01

    Prion diseases denote a distinct form of infectivity that is based in the misfolding of a self-protein (PrP(C)) into a pathological, infectious conformation (PrP(Sc)). Efforts to develop vaccines for prion diseases have been complicated by the potential dangers that are associated with induction of immune responses against a self-protein. As a consequence, there is considerable appeal for vaccines that specifically target the misfolded prion conformation. Such conformation-specific immunotherapy is made possible through the identification of vaccine targets (epitopes) that are exclusively presented as a consequence of misfolding. An immune response directed against these targets, termed disease-specific epitopes (DSEs), has the potential to spare the function of the native form of the protein while clearing, or neutralizing, the infectious isomer. Although identification of DSEs represents a critical first step in the induction of conformation-specific immune responses, substantial efforts are required to translate these targets into functional vaccines. Due to the poor immunogenicity that is inherent to self-proteins, and that is often associated with short peptides, substantial efforts are required to overcome tolerance-to-self and maximize the resultant immune response following DSE-based immunization. This often includes optimization of target sequences in terms of immunogenicity and development of effective formulation and delivery strategies for the associated peptides. Further, these vaccines must satisfy additional criteria from perspectives of specificity (PrP(C) vs. PrP(Sc)) and safety (antibody-induced template-driven misfolding of PrP(C)). The emphasis of this report is on the steps required to translate DSEs into prion vaccines and subsequent evaluation of the resulting immune responses.

  1. Intraperitoneal Infection of Wild-Type Mice with Synthetically Generated Mammalian Prion.

    Directory of Open Access Journals (Sweden)

    Xinhe Wang

    2015-07-01

    Full Text Available The prion hypothesis postulates that the infectious agent in transmissible spongiform encephalopathies (TSEs is an unorthodox protein conformation based agent. Recent successes in generating mammalian prions in vitro with bacterially expressed recombinant prion protein provide strong support for the hypothesis. However, whether the pathogenic properties of synthetically generated prion (rec-Prion recapitulate those of naturally occurring prions remains unresolved. Using end-point titration assay, we showed that the in vitro prepared rec-Prions have infectious titers of around 104 LD50/μg. In addition, intraperitoneal (i.p. inoculation of wild-type mice with rec-Prion caused prion disease with an average survival time of 210-220 days post inoculation. Detailed pathological analyses revealed that the nature of rec-Prion induced lesions, including spongiform change, disease specific prion protein accumulation (PrP-d and the PrP-d dissemination amongst lymphoid and peripheral nervous system tissues, the route and mechanisms of neuroinvasion were all typical of classical rodent prions. Our results revealed that, similar to naturally occurring prions, the rec-Prion has a titratable infectivity and is capable of causing prion disease via routes other than direct intra-cerebral challenge. More importantly, our results established that the rec-Prion caused disease is pathogenically and pathologically identical to naturally occurring contagious TSEs, supporting the concept that a conformationally altered protein agent is responsible for the infectivity in TSEs.

  2. Prion Protein Promotes Kidney Iron Uptake via Its Ferrireductase Activity*

    Science.gov (United States)

    Haldar, Swati; Tripathi, Ajai; Qian, Juan; Beserra, Amber; Suda, Srinivas; McElwee, Matthew; Turner, Jerrold; Hopfer, Ulrich; Singh, Neena

    2015-01-01

    Brain iron-dyshomeostasis is an important cause of neurotoxicity in prion disorders, a group of neurodegenerative conditions associated with the conversion of prion protein (PrPC) from its normal conformation to an aggregated, PrP-scrapie (PrPSc) isoform. Alteration of iron homeostasis is believed to result from impaired function of PrPC in neuronal iron uptake via its ferrireductase activity. However, unequivocal evidence supporting the ferrireductase activity of PrPC is lacking. Kidney provides a relevant model for this evaluation because PrPC is expressed in the kidney, and ∼370 μg of iron are reabsorbed daily from the glomerular filtrate by kidney proximal tubule cells (PT), requiring ferrireductase activity. Here, we report that PrPC promotes the uptake of transferrin (Tf) and non-Tf-bound iron (NTBI) by the kidney in vivo and mainly NTBI by PT cells in vitro. Thus, uptake of 59Fe administered by gastric gavage, intravenously, or intraperitoneally was significantly lower in PrP-knock-out (PrP−/−) mouse kidney relative to PrP+/+ controls. Selective in vivo radiolabeling of plasma NTBI with 59Fe revealed similar results. Expression of exogenous PrPC in immortalized PT cells showed localization on the plasma membrane and intracellular vesicles and increased transepithelial transport of 59Fe-NTBI and to a smaller extent 59Fe-Tf from the apical to the basolateral domain. Notably, the ferrireductase-deficient mutant of PrP (PrPΔ51–89) lacked this activity. Furthermore, excess NTBI and hemin caused aggregation of PrPC to a detergent-insoluble form, limiting iron uptake. Together, these observations suggest that PrPC promotes retrieval of iron from the glomerular filtrate via its ferrireductase activity and modulates kidney iron metabolism. PMID:25572394

  3. Detection of prion infectivity in fat tissues of scrapie-infected mice.

    Directory of Open Access Journals (Sweden)

    Brent Race

    2008-12-01

    Full Text Available Distribution of prion infectivity in organs and tissues is important in understanding prion disease pathogenesis and designing strategies to prevent prion infection in animals and humans. Transmission of prion disease from cattle to humans resulted in banning human consumption of ruminant nervous system and certain other tissues. In the present study, we surveyed tissue distribution of prion infectivity in mice with prion disease. We show for the first time detection of infectivity in white and brown fat. Since high amounts of ruminant fat are consumed by humans and also incorporated into animal feed, fat-containing tissues may pose a previously unappreciated hazard for spread of prion infection.

  4. Resistance of soil-bound prions to rumen digestion.

    Directory of Open Access Journals (Sweden)

    Samuel E Saunders

    Full Text Available Before prion uptake and infection can occur in the lower gastrointestinal system, ingested prions are subjected to anaerobic digestion in the rumen of cervids and bovids. The susceptibility of soil-bound prions to rumen digestion has not been evaluated previously. In this study, prions from infectious brain homogenates as well as prions bound to a range of soils and soil minerals were subjected to in vitro rumen digestion, and changes in PrP levels were measured via western blot. Binding to clay appeared to protect noninfectious hamster PrP(c from complete digestion, while both unbound and soil-bound infectious PrP(Sc proved highly resistant to rumen digestion. In addition, no change in intracerebral incubation period was observed following active rumen digestion of unbound hamster HY TME prions and HY TME prions bound to a silty clay loam soil. These results demonstrate that both unbound and soil-bound prions readily survive rumen digestion without a reduction in infectivity, further supporting the potential for soil-mediated transmission of chronic wasting disease (CWD and scrapie in the environment.

  5. Disturbed vesicular trafficking of membrane proteins in prion disease.

    Science.gov (United States)

    Uchiyama, Keiji; Miyata, Hironori; Sakaguchi, Suehiro

    2013-01-01

    The pathogenic mechanism of prion diseases remains unknown. We recently reported that prion infection disturbs post-Golgi trafficking of certain types of membrane proteins to the cell surface, resulting in reduced surface expression of membrane proteins and abrogating the signal from the proteins. The surface expression of the membrane proteins was reduced in the brains of mice inoculated with prions, well before abnormal symptoms became evident. Prions or pathogenic prion proteins were mainly detected in endosomal compartments, being particularly abundant in recycling endosomes. Some newly synthesized membrane proteins are delivered to the surface from the Golgi apparatus through recycling endosomes, and some endocytosed membrane proteins are delivered back to the surface through recycling endosomes. These results suggest that prions might cause neuronal dysfunctions and cell loss by disturbing post-Golgi trafficking of membrane proteins via accumulation in recycling endosomes. Interestingly, it was recently shown that delivery of a calcium channel protein to the cell surface was impaired and its function was abrogated in a mouse model of hereditary prion disease. Taken together, these results suggest that impaired delivery of membrane proteins to the cell surface is a common pathogenic event in acquired and hereditary prion diseases.

  6. Selfish prion of Rnq1 mutant in yeast.

    Science.gov (United States)

    Kurahashi, Hiroshi; Shibata, Shoichiro; Ishiwata, Masao; Nakamura, Yoshikazu

    2009-05-01

    [PIN(+)] is a prion form of Rnq1 in Saccharomyces cerevisiae and is necessary for the de novo induction of a second prion, [PSI(+)]. We previously isolated a truncated form of Rnq1, named Rnq1Delta100, as a [PSI(+)]-eliminating factor in S. cerevisiae. Rnq1Delta100 deletes the N-terminal non-prion domain of Rnq1, and eliminates [PSI(+)] in [PIN(+)] yeast. Here we found that [PIN(+)] is transmissible to Rnq1Delta100 in the absence of full-length Rnq1, forming a novel prion variant [RNQ1Delta100(+)]. [RNQ1Delta100(+)] has similar [PIN(+)] properties as it stimulates the de novo induction of [PSI(+)] and is eliminated by the null hsp104Delta mutation, but not by Hsp104 overproduction. In contrast, [RNQ1Delta100(+)] inherits the inhibitory activity and hampers the maintenance of [PSI(+)] though less efficiently than [PIN(+)] made of Rnq1-Rnq1Delta100 co-aggregates. Interestingly, [RNQ1Delta100(+)] prion was eliminated by de novo [PSI(+)] induction. Thus, the [RNQ1Delta100(+)] prion demonstrates selfish activity to eliminate a heterologous prion in S. cerevisiae, showing the first instance of a selfish prion variant in living organisms.

  7. Resistance of Soil-Bound Prions to Rumen Digestion

    Science.gov (United States)

    Saunders, Samuel E.; Bartelt-Hunt, Shannon L.; Bartz, Jason C.

    2012-01-01

    Before prion uptake and infection can occur in the lower gastrointestinal system, ingested prions are subjected to anaerobic digestion in the rumen of cervids and bovids. The susceptibility of soil-bound prions to rumen digestion has not been evaluated previously. In this study, prions from infectious brain homogenates as well as prions bound to a range of soils and soil minerals were subjected to in vitro rumen digestion, and changes in PrP levels were measured via western blot. Binding to clay appeared to protect noninfectious hamster PrPc from complete digestion, while both unbound and soil-bound infectious PrPSc proved highly resistant to rumen digestion. In addition, no change in intracerebral incubation period was observed following active rumen digestion of unbound hamster HY TME prions and HY TME prions bound to a silty clay loam soil. These results demonstrate that both unbound and soil-bound prions readily survive rumen digestion without a reduction in infectivity, further supporting the potential for soil-mediated transmission of chronic wasting disease (CWD) and scrapie in the environment. PMID:22937149

  8. Do prion protein gene polymorphisms induce apoptosis in non ...

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... Genetic variations such as single nucleotide polymorphisms (SNPs) in prion protein coding gene, Prnp, greatly affect susceptibility to prion diseases in mammals. Here, the coding region of Prnp was screened for polymorphisms in redeared turtle, Trachemys scripta. Four polymorphisms, L203V, N205I, ...

  9. Semisynthetic prion protein (PrP) variants carrying glycan mimics at position 181 and 197 do not form fibrils.

    Science.gov (United States)

    Araman, Can; Thompson, Robert E; Wang, Siyao; Hackl, Stefanie; Payne, Richard J; Becker, Christian F W

    2017-09-01

    The prion protein (PrP) is an N -glycosylated protein attached to the outer leaflet of eukaryotic cell membranes via a glycosylphosphatidylinositol (GPI) anchor. Different prion strains have distinct glycosylation patterns and the extent of glycosylation of potentially pathogenic misfolded prion protein (PrP Sc ) has a major impact on several prion-related diseases (transmissible spongiform encephalopathies, TSEs). Based on these findings it is hypothesized that posttranslational modifications (PTMs) of PrP influence conversion of cellular prion protein (PrP C ) into PrP Sc and, as such, modified PrP variants are critical tools needed to investigate the impact of PTMs on the pathogenesis of TSEs. Here we report a semisynthetic approach to generate PrP variants modified with monodisperse polyethyleneglycol (PEG) units as mimics of N-glycans. Incorporating PEG at glycosylation sites 181 and 197 in PrP induced only small changes to the secondary structure when compared to unmodified, wildtype PrP. More importantly, in vitro aggregation was abrogated for all PEGylated PrP variants under conditions at which wildtype PrP aggregated. Furthermore, the addition of PEGylated PrP as low as 10 mol% to wildtype PrP completely blocked aggregation. A similar effect was observed for synthetic PEGylated PrP segments comprising amino acids 179-231 alone if these were added to wildtype PrP in aggregation assays. This behavior raises the question if large N-glycans interfere with aggregation in vivo and if PEGylated PrP peptides could serve as potential therapeutics.

  10. Aβ seeds and prions: How close the fit?

    Science.gov (United States)

    Rasmussen, Jay; Jucker, Mathias; Walker, Lary C

    2017-07-04

    The prion paradigm is increasingly invoked to explain the molecular pathogenesis of neurodegenerative diseases involving the misfolding and aggregation of proteins other than the prion protein (PrP). Extensive evidence from in vitro and in vivo studies indicates that misfolded and aggregated Aβ peptide, which is the probable molecular trigger for Alzheimer's disease, manifests all of the key characteristics of canonical mammalian prions. These features include a β-sheet rich architecture, tendency to polymerize into amyloid, templated corruption of like protein molecules, ability to form structurally and functionally variant strains, systematic spread by neuronal transport, and resistance to inactivation by heat and formaldehyde. In addition to Aβ, a growing body of research supports the view that the prion-like molecular transformation of specific proteins drives the onset and course of a remarkable variety of clinicopathologically diverse diseases. As such, the expanded prion paradigm could conceptually unify fundamental and translational investigations of these disorders.

  11. Inter-Kingdom Modification of Metabolic Behavior: [GAR+] Prion Induction in Saccharomyces cerevisiae Mediated by Wine Ecosystem Bacteria

    Directory of Open Access Journals (Sweden)

    Linda F Bisson

    2016-11-01

    Full Text Available The yeast Saccharomyces cerevisiae has evolved to dominate grape juice fermentation. A suite of cellular properties, rapid nutrient depletion, production of inhibitory compounds and the metabolic narrowing of the niche, all enable a minor resident of the initial population to dramatically increase its relative biomass in the ecosystem. This dominance of the grape juice environment is fueled by a rapid launch of glycolysis and energy generation mediated by transport of hexoses and an efficient coupling of transport and catabolism. Fermentation occurs in the presence of molecular oxygen as the choice between respiratory or fermentative growth is regulated by the availability of sugar a phenomenon known as glucose or catabolite repression. Induction of the GAR+ prion alters the expression of the major hexose transporter active under these conditions, Hxt3, reducing glycolytic capacity. Bacteria present in the grape juice ecosystem were able to induce the GAR+ prion in wine strains of S. cerevisiae. This induction reduced fermentation capacity but did not block it entirely. However, dominance factors such as the rapid depletion of amino acids and other nitrogen sources from the environment were impeded enabling greater access to these substrates for the bacteria. Bacteria associated with arrested commercial wine fermentations were able to induce the prion state, and yeast cells isolated from arrested commercial fermentations were found to be GAR+ thus confirming the ecological relevance of prion induction. Subsequent analyses demonstrated that the presence of environmental acetic acid could lead to GAR+ induction in yeast strains under certain conditions. The induction of the prion enabled yeast growth on non-preferred substrates, oxidation and reduction products of glucose and fructose, present as a consequence of bacterial energy production. In native ecosystems prion induction never exceeded roughly 50-60% of the population of yeast cells

  12. Molecular architecture of human prion protein amyloid: a parallel, in-register beta-structure.

    Science.gov (United States)

    Cobb, Nathan J; Sönnichsen, Frank D; McHaourab, Hassane; Surewicz, Witold K

    2007-11-27

    Transmissible spongiform encephalopathies (TSEs) represent a group of fatal neurodegenerative diseases that are associated with conformational conversion of the normally monomeric and alpha-helical prion protein, PrP(C), to the beta-sheet-rich PrP(Sc). This latter conformer is believed to constitute the main component of the infectious TSE agent. In contrast to high-resolution data for the PrP(C) monomer, structures of the pathogenic PrP(Sc) or synthetic PrP(Sc)-like aggregates remain elusive. Here we have used site-directed spin labeling and EPR spectroscopy to probe the molecular architecture of the recombinant PrP amyloid, a misfolded form recently reported to induce transmissible disease in mice overexpressing an N-terminally truncated form of PrP(C). Our data show that, in contrast to earlier, largely theoretical models, the con formational conversion of PrP(C) involves major refolding of the C-terminal alpha-helical region. The core of the amyloid maps to C-terminal residues from approximately 160-220, and these residues form single-molecule layers that stack on top of one another with parallel, in-register alignment of beta-strands. This structural insight has important implications for understanding the molecular basis of prion propagation, as well as hereditary prion diseases, most of which are associated with point mutations in the region found to undergo a refolding to beta-structure.

  13. Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure

    Energy Technology Data Exchange (ETDEWEB)

    Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald

    2015-09-01

    Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.

  14. Biological and biochemical characterization of mice expressing prion protein devoid of the octapeptide repeat region after infection with prions.

    Science.gov (United States)

    Yamaguchi, Yoshitaka; Miyata, Hironori; Uchiyama, Keiji; Ootsuyama, Akira; Inubushi, Sachiko; Mori, Tsuyoshi; Muramatsu, Naomi; Katamine, Shigeru; Sakaguchi, Suehiro

    2012-01-01

    Accumulating lines of evidence indicate that the N-terminal domain of prion protein (PrP) is involved in prion susceptibility in mice. In this study, to investigate the role of the octapeptide repeat (OR) region alone in the N-terminal domain for the susceptibility and pathogenesis of prion disease, we intracerebrally inoculated RML scrapie prions into tg(PrPΔOR)/Prnp(0/0) mice, which express mouse PrP missing only the OR region on the PrP-null background. Incubation times of these mice were not extended. Protease-resistant PrPΔOR, or PrP(Sc)ΔOR, was easily detectable but lower in the brains of these mice, compared to that in control wild-type mice. Consistently, prion titers were slightly lower and astrogliosis was milder in their brains. However, in their spinal cords, PrP(Sc)ΔOR and prion titers were abundant and astrogliosis was as strong as in control wild-type mice. These results indicate that the role of the OR region in prion susceptibility and pathogenesis of the disease is limited. We also found that the PrP(Sc)ΔOR, including the pre-OR residues 23-50, was unusually protease-resistant, indicating that deletion of the OR region could cause structural changes to the pre-OR region upon prion infection, leading to formation of a protease-resistant structure for the pre-OR region.

  15. Experimental sheep BSE prions generate the vCJD phenotype when serially passaged in transgenic mice expressing human prion protein.

    Science.gov (United States)

    Joiner, Susan; Asante, Emmanuel A; Linehan, Jacqueline M; Brock, Lara; Brandner, Sebastian; Bellworthy, Susan J; Simmons, Marion M; Hope, James; Collinge, John; Wadsworth, Jonathan D F

    2018-03-15

    The epizootic prion disease of cattle, bovine spongiform encephalopathy (BSE), causes variant Creutzfeldt-Jakob disease (vCJD) in humans following dietary exposure. While it is assumed that all cases of vCJD attributed to a dietary aetiology are related to cattle BSE, sheep and goats are susceptible to experimental oral challenge with cattle BSE prions and farmed animals in the UK were undoubtedly exposed to BSE-contaminated meat and bone meal during the late 1980s and early 1990s. Although no natural field cases of sheep BSE have been identified, it cannot be excluded that some BSE-infected sheep might have entered the European human food chain. Evaluation of the zoonotic potential of sheep BSE prions has been addressed by examining the transmission properties of experimental brain isolates in transgenic mice that express human prion protein, however to-date there have been relatively few studies. Here we report that serial passage of experimental sheep BSE prions in transgenic mice expressing human prion protein with methionine at residue 129 produces the vCJD phenotype that mirrors that seen when the same mice are challenged with vCJD prions from patient brain. These findings are congruent with those reported previously by another laboratory, and thereby strongly reinforce the view that sheep BSE prions could have acted as a causal agent of vCJD within Europe. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure.

    Science.gov (United States)

    Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald

    2015-01-01

    Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.

  17. Rapid antemortem detection of CWD prions in deer saliva.

    Directory of Open Access Journals (Sweden)

    Davin M Henderson

    Full Text Available Chronic wasting disease (CWD is an efficiently transmitted prion disease of cervids, now identified in 22 United States, 2 Canadian provinces and Korea. One hallmark of CWD is the shedding of infectious prions in saliva, as demonstrated by bioassay in deer. It is also clear that the concentration of prions in saliva, blood, urine and feces is much lower than in the nervous system or lymphoid tissues. Rapid in vitro detection of CWD (and other prions in body fluids and excreta has been problematic due to the sensitivity limits of direct assays (western blotting, ELISA and the presence of inhibitors in these complex biological materials that hamper detection. Here we use real-time quaking induced conversion (RT-QuIC to demonstrate CWD prions in both diluted and prion-enriched saliva samples from asymptomatic and symptomatic white-tailed deer. CWD prions were detected in 14 of 24 (58.3% diluted saliva samples from CWD-exposed white-tailed deer, including 9 of 14 asymptomatic animals (64.2%. In addition, a phosphotungstic acid enrichment enhanced the RT-QuIC assay sensitivity, enabling detection in 19 of 24 (79.1% of the above saliva samples. Bioassay in Tg[CerPrP] mice confirmed the presence of infectious prions in 2 of 2 RT-QuIC-positive saliva samples so examined. The modified RT-QuIC analysis described represents a non-invasive, rapid ante-mortem detection of prions in complex biologic fluids, excreta, or environmental samples as well as a tool for exploring prion trafficking, peripheralization, and dissemination.

  18. Proteomics analyses for the global proteins in the brain tissues of different human prion diseases.

    Science.gov (United States)

    Shi, Qi; Chen, Li-Na; Zhang, Bao-Yun; Xiao, Kang; Zhou, Wei; Chen, Cao; Zhang, Xiao-Mei; Tian, Chan; Gao, Chen; Wang, Jing; Han, Jun; Dong, Xiao-Ping

    2015-04-01

    Proteomics changes of brain tissues have been described in different neurodegenerative diseases including Alzheimer's disease and Parkinson's disease. However, the brain proteomics of human prion disease remains less understood. In the study, the proteomics patterns of cortex and cerebellum of brain tissues of sporadic Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD were analyzed with isobaric tags for relative and absolute quantitation combined with multidimensional liquid chromatography and MS analysis, with the brains from three normal individuals as controls. Global protein profiling, significant pathway, and functional categories were analyzed. In total, 2287 proteins were identified with quantitative information both in cortex and cerebellum regions. Cerebellum tissues appeared to contain more up- and down-regulated proteins (727 proteins) than cortex regions (312 proteins) of Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD. Viral myocarditis, Parkinson's disease, Alzheimer's disease, lysosome, oxidative phosphorylation, protein export, and drug metabolism-cytochrome P450 were the most commonly affected pathways of the three kinds of diseases. Almost coincident biological functions were identified in the brain tissues of the three diseases. In all, data here demonstrate that the brain tissues of Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD have obvious proteomics changes at their terminal stages, which show the similarities not only among human prion diseases but also with other neurodegeneration diseases. This is the first study to provide a reference proteome map for human prion diseases and will be helpful for future studies focused on potential biomarkers for the diagnosis and therapy of human prion diseases. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Glypican-1 mediates both prion protein lipid raft association and disease isoform formation.

    Directory of Open Access Journals (Sweden)

    David R Taylor

    2009-11-01

    Full Text Available In prion diseases, the cellular form of the prion protein, PrP(C, undergoes a conformational conversion to the infectious isoform, PrP(Sc. PrP(C associates with lipid rafts through its glycosyl-phosphatidylinositol (GPI anchor and a region in its N-terminal domain which also binds to heparan sulfate proteoglycans (HSPGs. We show that heparin displaces PrP(C from rafts and promotes its endocytosis, suggesting that heparin competes with an endogenous raft-resident HSPG for binding to PrP(C. We then utilised a transmembrane-anchored form of PrP (PrP-TM, which is targeted to rafts solely by its N-terminal domain, to show that both heparin and phosphatidylinositol-specific phospholipase C can inhibit its association with detergent-resistant rafts, implying that a GPI-anchored HSPG targets PrP(C to rafts. Depletion of the major neuronal GPI-anchored HSPG, glypican-1, significantly reduced the raft association of PrP-TM and displaced PrP(C from rafts, promoting its endocytosis. Glypican-1 and PrP(C colocalised on the cell surface and both PrP(C and PrP(Sc co-immunoprecipitated with glypican-1. Critically, treatment of scrapie-infected N2a cells with glypican-1 siRNA significantly reduced PrP(Sc formation. In contrast, depletion of glypican-1 did not alter the inhibitory effect of PrP(C on the beta-secretase cleavage of the Alzheimer's amyloid precursor protein. These data indicate that glypican-1 is a novel cellular cofactor for prion conversion and we propose that it acts as a scaffold facilitating the interaction of PrP(C and PrP(Sc in lipid rafts.

  20. Crystallization and preliminary X-ray diffraction analysis of a specific VHH domain against mouse prion protein

    International Nuclear Information System (INIS)

    Abskharon, Romany N. N.; Soror, Sameh H.; Pardon, Els; El Hassan, Hassan; Legname, Giuseppe; Steyaert, Jan; Wohlkonig, Alexandre

    2010-01-01

    The crystallization of a specific nanobody against mouse PrP C and preliminary diffraction analysis of a crystal that diffracted to 1.23 Å resolution are presented. Prion disorders are infectious diseases that are characterized by the conversion of the cellular prion protein PrP C into the pathogenic isoform PrP Sc . Specific antibodies that interact with the cellular prion protein have been shown to inhibit this transition. Recombinant VHHs (variable domain of dromedary heavy-chain antibodies) or nanobodies are single-domain antibodies, making them the smallest antigen-binding fragments. A specific nanobody (Nb-PrP-01) was raised against mouse PrP C . A crystallization condition for this recombinant nanobody was identified using high-throughput screening. The crystals were optimized using streak-seeding and the hanging-drop method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 30.04, b = 37.15, c = 83.00 Å, and diffracted to 1.23 Å resolution using synchrotron radiation. The crystal structure of this specific nanobody against PrP C together with the known PrP C structure may help in understanding the PrP C /PrP Sc transition mechanism

  1. Prion Amplification and Hierarchical Bayesian Modeling Refine Detection of Prion Infection

    Science.gov (United States)

    Wyckoff, A. Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J.; Pulford, Bruce; Wild, Margaret; Antolin, Michael; Vercauteren, Kurt; Zabel, Mark

    2015-02-01

    Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.

  2. Prion amplification and hierarchical Bayesian modeling refine detection of prion infection.

    Science.gov (United States)

    Wyckoff, A Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J; Pulford, Bruce; Wild, Margaret; Antolin, Michael; VerCauteren, Kurt; Zabel, Mark

    2015-02-10

    Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.

  3. The 26S Proteasome Degrades the Soluble but Not the Fibrillar Form of the Yeast Prion Ure2p In Vitro.

    Directory of Open Access Journals (Sweden)

    Kai Wang

    Full Text Available Yeast prions are self-perpetuating protein aggregates that cause heritable and transmissible phenotypic traits. Among these, [PSI+] and [URE3] stand out as the most studied yeast prions, and result from the self-assembly of the translation terminator Sup35p and the nitrogen catabolism regulator Ure2p, respectively, into insoluble fibrillar aggregates. Protein quality control systems are well known to govern the formation, propagation and transmission of these prions. However, little is known about the implication of the cellular proteolytic machineries in their turnover. We previously showed that the 26S proteasome degrades both the soluble and fibrillar forms of Sup35p and affects [PSI+] propagation. Here, we show that soluble native Ure2p is degraded by the proteasome in an ubiquitin-independent manner. Proteasomal degradation of Ure2p yields amyloidogenic N-terminal peptides and a C-terminal resistant fragment. In contrast to Sup35p, fibrillar Ure2p resists proteasomal degradation. Thus, structural variability within prions may dictate their ability to be degraded by the cellular proteolytic systems.

  4. The 26S Proteasome Degrades the Soluble but Not the Fibrillar Form of the Yeast Prion Ure2p In Vitro

    Science.gov (United States)

    Wang, Kai; Redeker, Virginie; Madiona, Karine; Melki, Ronald; Kabani, Mehdi

    2015-01-01

    Yeast prions are self-perpetuating protein aggregates that cause heritable and transmissible phenotypic traits. Among these, [PSI +] and [URE3] stand out as the most studied yeast prions, and result from the self-assembly of the translation terminator Sup35p and the nitrogen catabolism regulator Ure2p, respectively, into insoluble fibrillar aggregates. Protein quality control systems are well known to govern the formation, propagation and transmission of these prions. However, little is known about the implication of the cellular proteolytic machineries in their turnover. We previously showed that the 26S proteasome degrades both the soluble and fibrillar forms of Sup35p and affects [PSI +] propagation. Here, we show that soluble native Ure2p is degraded by the proteasome in an ubiquitin-independent manner. Proteasomal degradation of Ure2p yields amyloidogenic N-terminal peptides and a C-terminal resistant fragment. In contrast to Sup35p, fibrillar Ure2p resists proteasomal degradation. Thus, structural variability within prions may dictate their ability to be degraded by the cellular proteolytic systems. PMID:26115123

  5. Genesis of mammalian prions: from non-infectious amyloid fibrils to a transmissible prion disease.

    Directory of Open Access Journals (Sweden)

    Natallia Makarava

    2011-12-01

    Full Text Available The transmissible agent of prion disease consists of a prion protein in its abnormal, β-sheet rich state (PrP(Sc, which is capable of replicating itself according to the template-assisted mechanism. This mechanism postulates that the folding pattern of a newly recruited polypeptide chain accurately reproduces that of a PrP(Sc template. Here we report that authentic PrP(Sc and transmissible prion disease can be generated de novo in wild type animals by recombinant PrP (rPrP amyloid fibrils, which are structurally different from PrP(Sc and lack any detectable PrP(Sc particles. When induced by rPrP fibrils, a long silent stage that involved two serial passages preceded development of the clinical disease. Once emerged, the prion disease was characterized by unique clinical, neuropathological, and biochemical features. The long silent stage to the disease was accompanied by significant transformation in neuropathological properties and biochemical features of the proteinase K-resistant PrP material (PrPres before authentic PrP(Sc evolved. The current work illustrates that transmissible prion diseases can be induced by PrP structures different from that of authentic PrP(Sc and suggests that a new mechanism different from the classical templating exists. This new mechanism designated as "deformed templating" postulates that a change in the PrP folding pattern from the one present in rPrP fibrils to an alternative specific for PrP(Sc can occur. The current work provides important new insight into the mechanisms underlying genesis of the transmissible protein states and has numerous implications for understanding the etiology of neurodegenerative diseases.

  6. Analysis of nucleic acid chaperoning by the prion protein and its inhibition by oligonucleotides.

    Science.gov (United States)

    Guichard, Cécile; Ivanyi-Nagy, Roland; Sharma, Kamal Kant; Gabus, Caroline; Marc, Daniel; Mély, Yves; Darlix, Jean-Luc

    2011-10-01

    Prion diseases are unique neurodegenerative illnesses associated with the conversion of the cellular prion protein (PrP(C)) into the aggregated misfolded scrapie isoform, named PrP(Sc). Recent studies on the physiological role of PrP(C) revealed that this protein has probably multiple functions, notably in cell-cell adhesion and signal transduction, and in assisting nucleic acid folding. In fact, in vitro findings indicated that the human PrP (huPrP) possesses nucleic acid binding and annealing activities, similarly to nucleic acid chaperone proteins that play essential roles in cellular DNA and RNA metabolism. Here, we show that a peptide, representing the N-terminal domain of huPrP, facilitates nucleic acid annealing by two parallel pathways nucleated through the stem termini. We also show that PrP of human or ovine origin facilitates DNA strand exchange, ribozyme-directed cleavage of an RNA template and RNA trans-splicing in a manner similar to the nucleocapsid protein of HIV-1. In an attempt to characterize inhibitors of PrP-chaperoning in vitro we discovered that the thioaptamer 5'-GACACAAGCCGA-3' was extensively inhibiting the PrP chaperoning activities. At the same time a recently characterized methylated oligoribonucleotide inhibiting the chaperoning activity of the HIV-1 nucleocapsid protein was poorly impairing the PrP chaperoning activities.

  7. α-Synuclein Amyloids Hijack Prion Protein to Gain Cell Entry, Facilitate Cell-to-Cell Spreading and Block Prion Replication.

    Science.gov (United States)

    Aulić, Suzana; Masperone, Lara; Narkiewicz, Joanna; Isopi, Elisa; Bistaffa, Edoardo; Ambrosetti, Elena; Pastore, Beatrice; De Cecco, Elena; Scaini, Denis; Zago, Paola; Moda, Fabio; Tagliavini, Fabrizio; Legname, Giuseppe

    2017-08-30

    The precise molecular mechanism of how misfolded α-synuclein (α-Syn) accumulates and spreads in synucleinopathies is still unknown. Here, we show the role of the cellular prion protein (PrP C ) in mediating the uptake and the spread of recombinant α-Syn amyloids. The in vitro data revealed that the presence of PrP C fosters the higher uptake of α-Syn amyloid fibrils, which was also confirmed in vivo in wild type (Prnp +/+ ) compared to PrP knock-out (Prnp -/- ) mice. Additionally, the presence of α-Syn amyloids blocked the replication of scrapie prions (PrP Sc ) in vitro and ex vivo, indicating a link between the two proteins. Indeed, whilst PrP C is mediating the internalization of α-Syn amyloids, PrP Sc is not able to replicate in their presence. This observation has pathological relevance, since several reported case studies show that the accumulation of α-Syn amyloid deposits in Creutzfeldt-Jakob disease patients is accompanied by a longer disease course.

  8. Persistence of pathogenic prion protein during simulated wastewater treatment processes

    Science.gov (United States)

    Hinckley, G.T.; Johnson, C.J.; Jacobson, K.H.; Bartholomay, C.; Mcmahon, K.D.; McKenzie, D.; Aiken, Judd M.; Pedersen, J.A.

    2008-01-01

    Transmissible spongiform encephalopathies (TSEs, prion diseases) are a class of fatal neurodegenerative diseases affecting a variety of mammalian species including humans. A misfolded form of the prion protein (PrP TSE) is the major, if not sole, component of the infectious agent. Prions are highly resistant to degradation and to many disinfection procedures suggesting that, if prions enter wastewater treatment systems through sewers and/or septic systems (e.g., from slaughterhouses, necropsy laboratories, rural meat processors, private game dressing) or through leachate from landfills that have received TSE-contaminated material, prions could survive conventional wastewater treatment Here, we report the results of experiments examining the partitioning and persistence of PrPTSE during simulated wastewater treatment processes including activated and mesophilic anaerobic sludge digestion. Incubation with activated sludge did not result in significant PrPTSE degradation. PrPTSE and prion infectivity partitioned strongly to activated sludge solids and are expected to enter biosolids treatment processes. A large fraction of PrPTSE survived simulated mesophilic anaerobic sludge digestion. The small reduction in recoverable PrPTSE after 20-d anaerobic sludge digestion appeared attributable to a combination of declining extractability with time and microbial degradation. Our results suggest that if prions were to enter municipal wastewater treatment systems, most would partition to activated sludge solids, survive mesophilic anaerobic digestion, and be present in treated biosolids. ?? 2008 American Chemical Society.

  9. Physical, chemical and kinetic factors affecting prion infectivity.

    Science.gov (United States)

    Properzi, Francesca; Badhan, Anjna; Klier, Steffi; Schmidt, Christian; Klöhn, Peter C; Wadsworth, Jonathan D F; Clarke, Anthony R; Jackson, Graham S; Collinge, John

    2016-05-03

    The mouse-adapted scrapie prion strain RML is one of the most widely used in prion research. The introduction of a cell culture-based assay of RML prions, the scrapie cell assay (SCA) allows more rapid and precise prion titration. A semi-automated version of this assay (ASCA) was applied to explore a range of conditions that might influence the infectivity and properties of RML prions. These include resistance to freeze-thaw procedures; stability to endogenous proteases in brain homogenate despite prolonged exposure to varying temperatures; distribution of infective material between pellet and supernatant after centrifugation, the effect of reducing agents and the influence of detergent additives on the efficiency of infection. Apparent infectivity is increased significantly by interaction with cationic detergents. Importantly, we have also elucidated the relationship between the duration of exposure of cells to RML prions and the transmission of infection. We established that the infection process following contact of cells with RML prions is rapid and followed an exponential time course, implying a single rate-limiting process.

  10. Molecular pathogenesis of sporadic prion diseases in man

    Science.gov (United States)

    Safar, Jiri G.

    2012-01-01

    The yeast, fungal and mammalian prions determine heritable and infectious traits that are encoded in alternative conformations of proteins. They cause lethal sporadic, familial and infectious neurodegenerative conditions in man, including Creutzfeldt-Jakob disease (CJD), Gerstmann-Sträussler-Scheinker syndrome (GSS), kuru, sporadic fatal insomnia (SFI) and likely variable protease-sensitive prionopathy (VPSPr). The most prevalent of human prion diseases is sporadic (s)CJD. Recent advances in amplification and detection of prions led to considerable optimism that early and possibly preclinical diagnosis and therapy might become a reality. Although several drugs have already been tested in small numbers of sCJD patients, there is no clear evidence of any agent’s efficacy. Therefore, it remains crucial to determine the full spectrum of sCJD prion strains and the conformational features in the pathogenic human prion protein governing replication of sCJD prions. Research in this direction is essential for the rational development of diagnostic as well as therapeutic strategies. Moreover, there is growing recognition that fundamental processes involved in human prion propagation – intercellular induction of protein misfolding and seeded aggregation of misfolded host proteins – are of far wider significance. This insight leads to new avenues of research in the ever-widening spectrum of age-related human neurodegenerative diseases that are caused by protein misfolding and that pose a major challenge for healthcare. PMID:22421210

  11. Mammalian prions: tolerance to sequence changes-how far?

    Science.gov (United States)

    Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel

    2013-01-01

    Upon prion infection, abnormal prion protein (PrP (Sc) ) self-perpetuate by conformational conversion of α-helix-rich PrP (C) into β sheet enriched form, leading to formation and deposition of PrP (Sc) aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrP (Sc) and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region.

  12. Aerosols transmit prions to immunocompetent and immunodeficient mice.

    Directory of Open Access Journals (Sweden)

    Johannes Haybaeck

    Full Text Available Prions, the agents causing transmissible spongiform encephalopathies, colonize the brain of hosts after oral, parenteral, intralingual, or even transdermal uptake. However, prions are not generally considered to be airborne. Here we report that inbred and crossbred wild-type mice, as well as tga20 transgenic mice overexpressing PrP(C, efficiently develop scrapie upon exposure to aerosolized prions. NSE-PrP transgenic mice, which express PrP(C selectively in neurons, were also susceptible to airborne prions. Aerogenic infection occurred also in mice lacking B- and T-lymphocytes, NK-cells, follicular dendritic cells or complement components. Brains of diseased mice contained PrP(Sc and transmitted scrapie when inoculated into further mice. We conclude that aerogenic exposure to prions is very efficacious and can lead to direct invasion of neural pathways without an obligatory replicative phase in lymphoid organs. This previously unappreciated risk for airborne prion transmission may warrant re-thinking on prion biosafety guidelines in research and diagnostic laboratories.

  13. Endogenous proteolytic cleavage of disease-associated prion protein to produce C2 fragments is strongly cell- and tissue-dependent.

    Science.gov (United States)

    Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert

    2010-04-02

    The abnormally folded form of the prion protein (PrP(Sc)) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrP(Sc) N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrP(Sc) accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrP(Sc) proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrP(Sc) fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrP(Sc) and cell pathogenesis of prion infection.

  14. Endogenous Proteolytic Cleavage of Disease-associated Prion Protein to Produce C2 Fragments Is Strongly Cell- and Tissue-dependent*

    Science.gov (United States)

    Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert

    2010-01-01

    The abnormally folded form of the prion protein (PrPSc) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrPSc N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrPSc accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrPSc proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrPSc fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrPSc and cell pathogenesis of prion infection. PMID:20154089

  15. Human prion diseases in the United States.

    Directory of Open Access Journals (Sweden)

    Robert C Holman

    Full Text Available BACKGROUND: Prion diseases are a family of rare, progressive, neurodegenerative disorders that affect humans and animals. The most common form of human prion disease, Creutzfeldt-Jakob disease (CJD, occurs worldwide. Variant CJD (vCJD, a recently emerged human prion disease, is a zoonotic foodborne disorder that occurs almost exclusively in countries with outbreaks of bovine spongiform encephalopathy. This study describes the occurrence and epidemiology of CJD and vCJD in the United States. METHODOLOGY/PRINCIPAL FINDINGS: Analysis of CJD and vCJD deaths using death certificates of US residents for 1979-2006, and those identified through other surveillance mechanisms during 1996-2008. Since CJD is invariably fatal and illness duration is usually less than one year, the CJD incidence is estimated as the death rate. During 1979 through 2006, an estimated 6,917 deaths with CJD as a cause of death were reported in the United States, an annual average of approximately 247 deaths (range 172-304 deaths. The average annual age-adjusted incidence for CJD was 0.97 per 1,000,000 persons. Most (61.8% of the CJD deaths occurred among persons >or=65 years of age for an average annual incidence of 4.8 per 1,000,000 persons in this population. Most deaths were among whites (94.6%; the age-adjusted incidence for whites was 2.7 times higher than that for blacks (1.04 and 0.40, respectively. Three patients who died since 2004 were reported with vCJD; epidemiologic evidence indicated that their infection was acquired outside of the United States. CONCLUSION/SIGNIFICANCE: Surveillance continues to show an annual CJD incidence rate of about 1 case per 1,000,000 persons and marked differences in CJD rates by age and race in the United States. Ongoing surveillance remains important for monitoring the stability of the CJD incidence rates, and detecting occurrences of vCJD and possibly other novel prion diseases in the United States.

  16. Effect of psychological intervention in the form of relaxation and guided imagery on cellular immune function in normal healthy subjects. An overview

    DEFF Research Database (Denmark)

    Zachariae, R; Kristensen, J S; Hokland, P

    1991-01-01

    The present study measured the effects of relaxation and guided imagery on cellular immune function. During a period of 10 days 10 healthy subjects were given one 1-hour relaxation procedure and one combined relaxation and guided imagery procedure, instructing the subjects to imagine their immune...... on the immune defense and could form the basis of further studies on psychological intervention and immunological status. Udgivelsesdato: 1990-null...

  17. Spontaneous generation of rapidly transmissible prions in transgenic mice expressing wild-type bank vole prion protein.

    Science.gov (United States)

    Watts, Joel C; Giles, Kurt; Stöhr, Jan; Oehler, Abby; Bhardwaj, Sumita; Grillo, Sunny K; Patel, Smita; DeArmond, Stephen J; Prusiner, Stanley B

    2012-02-28

    Currently, there are no animal models of the most common human prion disorder, sporadic Creutzfeldt-Jakob disease (CJD), in which prions are formed spontaneously from wild-type (WT) prion protein (PrP). Interestingly, bank voles (BV) exhibit an unprecedented promiscuity for diverse prion isolates, arguing that bank vole PrP (BVPrP) may be inherently prone to adopting misfolded conformations. Therefore, we constructed transgenic (Tg) mice expressing WT BVPrP. Tg(BVPrP) mice developed spontaneous CNS dysfunction between 108 and 340 d of age and recapitulated the hallmarks of prion disease, including spongiform degeneration, pronounced astrogliosis, and deposition of alternatively folded PrP in the brain. Brain homogenates of ill Tg(BVPrP) mice transmitted disease to Tg(BVPrP) mice in ∼35 d, to Tg mice overexpressing mouse PrP in under 100 d, and to WT mice in ∼185 d. Our studies demonstrate experimentally that WT PrP can spontaneously form infectious prions in vivo. Thus, Tg(BVPrP) mice may be useful for studying the spontaneous formation of prions, and thus may provide insight into the etiology of sporadic CJD.

  18. The non-octarepeat copper binding site of the prion protein is a key regulator of prion conversion

    Science.gov (United States)

    Giachin, Gabriele; Mai, Phuong Thao; Tran, Thanh Hoa; Salzano, Giulia; Benetti, Federico; Migliorati, Valentina; Arcovito, Alessandro; Longa, Stefano Della; Mancini, Giordano; D'Angelo, Paola; Legname, Giuseppe

    2015-10-01

    The conversion of the prion protein (PrPC) into prions plays a key role in transmissible spongiform encephalopathies. Despite the importance for pathogenesis, the mechanism of prion formation has escaped detailed characterization due to the insoluble nature of prions. PrPC interacts with copper through octarepeat and non-octarepeat binding sites. Copper coordination to the non-octarepeat region has garnered interest due to the possibility that this interaction may impact prion conversion. We used X-ray absorption spectroscopy to study copper coordination at pH 5.5 and 7.0 in human PrPC constructs, either wild-type (WT) or carrying pathological mutations. We show that mutations and pH cause modifications of copper coordination in the non-octarepeat region. In the WT at pH 5.5, copper is anchored to His96 and His111, while at pH 7 it is coordinated by His111. Pathological point mutations alter the copper coordination at acidic conditions where the metal is anchored to His111. By using in vitro approaches, cell-based and computational techniques, we propose a model whereby PrPC coordinating copper with one His in the non-octarepeat region converts to prions at acidic condition. Thus, the non-octarepeat region may act as the long-sought-after prion switch, critical for disease onset and propagation.

  19. Functional diversification of hsp40: distinct j-protein functional requirements for two prions allow for chaperone-dependent prion selection.

    Science.gov (United States)

    Harris, Julia M; Nguyen, Phil P; Patel, Milan J; Sporn, Zachary A; Hines, Justin K

    2014-07-01

    Yeast prions are heritable amyloid aggregates of functional yeast proteins; their propagation to subsequent cell generations is dependent upon fragmentation of prion protein aggregates by molecular chaperone proteins. Mounting evidence indicates the J-protein Sis1 may act as an amyloid specificity factor, recognizing prion and other amyloid aggregates and enabling Ssa and Hsp104 to act in prion fragmentation. Chaperone interactions with prions, however, can be affected by variations in amyloid-core structure resulting in distinct prion variants or 'strains'. Our genetic analysis revealed that Sis1 domain requirements by distinct variants of [PSI+] are strongly dependent upon overall variant stability. Notably, multiple strong [PSI+] variants can be maintained by a minimal construct of Sis1 consisting of only the J-domain and glycine/phenylalanine-rich (G/F) region that was previously shown to be sufficient for cell viability and [RNQ+] prion propagation. In contrast, weak [PSI+] variants are lost under the same conditions but maintained by the expression of an Sis1 construct that lacks only the G/F region and cannot support [RNQ+] propagation, revealing mutually exclusive requirements for Sis1 function between these two prions. Prion loss is not due to [PSI+]-dependent toxicity or dependent upon a particular yeast genetic background. These observations necessitate that Sis1 must have at least two distinct functional roles that individual prions differentially require for propagation and which are localized to the glycine-rich domains of the Sis1. Based on these distinctions, Sis1 plasmid-shuffling in a [PSI+]/[RNQ+] strain permitted J-protein-dependent prion selection for either prion. We also found that, despite an initial report to the contrary, the human homolog of Sis1, Hdj1, is capable of [PSI+] prion propagation in place of Sis1. This conservation of function is also prion-variant dependent, indicating that only one of the two Sis1-prion functions may have

  20. Competition between clonal plasma cells and normal cells for potentially overlapping bone marrow niches is associated with a progressively altered cellular distribution in MGUS vs myeloma.

    Science.gov (United States)

    Paiva, B; Pérez-Andrés, M; Vídriales, M-B; Almeida, J; de las Heras, N; Mateos, M-V; López-Corral, L; Gutiérrez, N C; Blanco, J; Oriol, A; Hernández, M T; de Arriba, F; de Coca, A G; Terol, M-J; de la Rubia, J; González, Y; Martín, A; Sureda, A; Schmidt-Hieber, M; Schmitz, A; Johnsen, H E; Lahuerta, J-J; Bladé, J; San-Miguel, J F; Orfao, A

    2011-04-01

    Disappearance of normal bone marrow (BM) plasma cells (PC) predicts malignant transformation of monoclonal gammopathy of undetermined significance (MGUS) and smoldering myeloma (SMM) into symptomatic multiple myeloma (MM). The homing, behavior and survival of normal PC, but also CD34(+) hematopoietic stem cells (HSC), B-cell precursors, and clonal PC largely depends on their interaction with stromal cell-derived factor-1 (SDF-1) expressing, potentially overlapping BM stromal cell niches. Here, we investigate the distribution, phenotypic characteristics and competitive migration capacity of these cell populations in patients with MGUS, SMM and MM vs healthy adults (HA) aged >60 years. Our results show that BM and peripheral blood (PB) clonal PC progressively increase from MGUS to MM, the latter showing a slightly more immature immunophenotype. Of note, such increased number of clonal PC is associated with progressive depletion of normal PC, B-cell precursors and CD34(+) HSC in the BM, also with a parallel increase in PB. In an ex vivo model, normal PC, B-cell precursors and CD34(+) HSC from MGUS and SMM, but not MM patients, were able to abrogate the migration of clonal PC into serial concentrations of SDF-1. Overall, our results show that progressive competition and replacement of normal BM cells by clonal PC is associated with more advanced disease in patients with MGUS, SMM and MM.

  1. Prion protein misfolding affects calcium homeostasis and sensitizes cells to endoplasmic reticulum stress.

    Directory of Open Access Journals (Sweden)

    Mauricio Torres

    2010-12-01

    Full Text Available Prion-related disorders (PrDs are fatal neurodegenerative disorders characterized by progressive neuronal impairment as well as the accumulation of an abnormally folded and protease resistant form of the cellular prion protein, termed PrP(RES. Altered endoplasmic reticulum (ER homeostasis is associated with the occurrence of neurodegeneration in sporadic, infectious and familial forms of PrDs. The ER operates as a major intracellular calcium store, playing a crucial role in pathological events related to neuronal dysfunction and death. Here we investigated the possible impact of PrP misfolding on ER calcium homeostasis in infectious and familial models of PrDs. Neuro2A cells chronically infected with scrapie prions showed decreased ER-calcium content that correlated with a stronger upregulation of UPR-inducible chaperones, and a higher sensitivity to ER stress-induced cell death. Overexpression of the calcium pump SERCA stimulated calcium release and increased the neurotoxicity observed after exposure of cells to brain-derived infectious PrP(RES. Furthermore, expression of PrP mutants that cause hereditary Creutzfeldt-Jakob disease or fatal familial insomnia led to accumulation of PrP(RES and their partial retention at the ER, associated with a drastic decrease of ER calcium content and higher susceptibility to ER stress. Finally, similar results were observed when a transmembrane form of PrP was expressed, which is proposed as a neurotoxic intermediate. Our results suggest that alterations in calcium homeostasis and increased susceptibility to ER stress are common pathological features of both infectious and familial PrD models.

  2. Diagnostic approaches for viruses and prions in stem cell banks

    International Nuclear Information System (INIS)

    Cobo, Fernando; Talavera, Paloma; Concha, Angel

    2006-01-01

    Some stem cell lines may contain an endogenous virus or can be contaminated with exogenous viruses (even of animal origin) and may secrete viral particles or express viral antigens on their surface. Moreover, certain biotechnological products (e.g. bovine fetal serum, murine feeder cells) may contain prion particles. Viral and prion contamination of cell cultures and 'feeder' cells, which is a common risk in all biotechnological products derived from the cell lines, is the most challenging and potentially serious outcome to address, due to the difficulty involved in virus and prion detection and the potential to cause serious disease in recipients of these cell products. Stem cell banks should introduce adequate quality assurance programs like the microbiological control program and can provide researchers with valuable support in the standardization and safety of procedures and protocols used for the viral and prion testing and in validation programs to assure the quality and safety of the cells

  3. Current and future molecular diagnostics for prion diseases.

    Science.gov (United States)

    Lehto, Marty T; Peery, Harry E; Cashman, Neil R

    2006-07-01

    It is now widely held that the infectious agents underlying the transmissible spongiform encephalopathies are prions, which are primarily composed of a misfolded, protease-resistant isoform of the host prion protein. Untreatable prion disorders include some human diseases, such as Creutzfeldt-Jakob disease, and diseases of economically important animals, such as bovine spongiform encephalopathy (cattle) and chronic wasting disease (deer and elk). Detection and diagnosis of prion disease (and presymptomatic incubation) is contingent upon developing novel assays, which exploit properties uniquely possessed by this misfolded protein complex, rather than targeting an agent-specific nucleic acid. This review highlights some of the conventional and disruptive technologies developed to respond to this challenge.

  4. Putting prions into focus: application of single molecule detection to the diagnosis of prion diseases.

    Science.gov (United States)

    Giese, A; Bieschke, J; Eigen, M; Kretzschmar, H A

    2000-01-01

    Prion diseases are characterized by the cerebral deposition of an aggregated pathological isoform of the prion protein (PrP(Sc)) which constitutes the principal component of the transmissible agent termed prion. In order to develop a highly sensitive method for the detection of PrP(Sc) aggregates in biological samples such as cerebrospinal fluid (CSF), we used a method based on Fluorescence Correlation Spectroscopy (FCS), a technique which allows detection of single fluorescently labeled molecules in solution. Within the FCS setup, fluorescent photons emitted by molecules passing an open volume element defined by the beam of an excitation laser focussed into a diffraction-limited spot are imaged confocally onto a single photon counting detector. Aggregates of PrP(Sc) could be labeled by co-aggregation of probe molecules such as monomeric recombinant PrP or PrP-specific antibodies tagged with a fluorescent dye. In addition to slow diffusion, labeled aggregates are characterized by high fluorescence intensity, which allows detection and quantification by analysis of fluorescence intensity distribution. To improve detection of rare target particles, the accessible volume element was increased by scanning for intensely fluorescent targets (SIFT). To further improve sensitivity and specificity, two different probes were used simultaneously in a two-color setup. In a diagnostic model system of CSF spiked with purified prion rods, dual-color SIFT was more sensitive than Western blot analysis. In addition, a PrP(Sc)-specific signal was also detected in a number of CSF samples derived from CJD patients but not in controls.

  5. Enzymatic Digestion of Chronic Wasting Disease Prions Bound to Soil

    Science.gov (United States)

    SAUNDERS, SAMUEL E.; BARTZ, JASON C.; VERCAUTEREN, KURT C.; BARTELT-HUNT, SHANNON L.

    2010-01-01

    Chronic wasting disease (CWD) and sheep scrapie can be transmitted via indirect environmental routes, and it is known that soil can serve as a reservoir of prion infectivity. Given the strong interaction between the prion protein (PrP) and soil, we hypothesized that binding to soil enhances prion resistance to enzymatic digestion, thereby facilitating prion longevity in the environment and providing protection from host degradation. We characterized the performance of a commercially available subtilisin enzyme, the Prionzyme, to degrade soil-bound and unbound CWD and HY TME PrP as a function of pH, temperature, and treatment time. The subtilisin enzyme effectively degraded PrP adsorbed to a wide range of soils and soil minerals below the limits of detection. Signal loss occurred rapidly at high pH (12.5) and within 7 d under conditions representative of the natural environment (pH 7.4, 22°C). We observed no apparent difference in enzyme effectiveness between bound and unbound CWD PrP. Our results show that although adsorbed prions do retain relative resistance to enzymatic digestion compared with other brain homogenate proteins, they can be effectively degraded when bound to soil. Our results also suggest a topical application of a subtilisin enzyme solution may be an effective decontamination method to limit disease transmission via environmental ‘hot spots’ of prion infectivity. PMID:20450190

  6. Low copper and high manganese levels in prion protein plaques

    Science.gov (United States)

    Johnson, Christopher J.; Gilbert, P.U.P.A.; Abrecth, Mike; Baldwin, Katherine L.; Russell, Robin E.; Pedersen, Joel A.; McKenzie, Debbie

    2013-01-01

    Accumulation of aggregates rich in an abnormally folded form of the prion protein characterize the neurodegeneration caused by transmissible spongiform encephalopathies (TSEs). The molecular triggers of plaque formation and neurodegeneration remain unknown, but analyses of TSE-infected brain homogenates and preparations enriched for abnormal prion protein suggest that reduced levels of copper and increased levels of manganese are associated with disease. The objectives of this study were to: (1) assess copper and manganese levels in healthy and TSE-infected Syrian hamster brain homogenates; (2) determine if the distribution of these metals can be mapped in TSE-infected brain tissue using X-ray photoelectron emission microscopy (X-PEEM) with synchrotron radiation; and (3) use X-PEEM to assess the relative amounts of copper and manganese in prion plaques in situ. In agreement with studies of other TSEs and species, we found reduced brain levels of copper and increased levels of manganese associated with disease in our hamster model. We also found that the in situ levels of these metals in brainstem were sufficient to image by X-PEEM. Using immunolabeled prion plaques in directly adjacent tissue sections to identify regions to image by X-PEEM, we found a statistically significant relationship of copper-manganese dysregulation in prion plaques: copper was depleted whereas manganese was enriched. These data provide evidence for prion plaques altering local transition metal distribution in the TSE-infected central nervous system.

  7. Reduction of prion infectivity in packed red blood cells

    International Nuclear Information System (INIS)

    Morales, Rodrigo; Buytaert-Hoefen, Kimberley A.; Gonzalez-Romero, Dennisse; Castilla, Joaquin; Hansen, Eric T.; Hlavinka, Dennis; Goodrich, Raymond P.; Soto, Claudio

    2008-01-01

    The link between a new variant form of Creutzfeldt-Jakob disease (vCJD) and the consumption of prion contaminated cattle meat as well as recent findings showing that vCJD can be transmitted by blood transfusion have raised public health concerns. Currently, a reliable test to identify prions in blood samples is not available. The purpose of this study was to evaluate the possibility to remove scrapie prion protein (PrP Sc ) and infectivity from red blood cell (RBC) suspensions by a simple washing procedure using a cell separation and washing device. The extent of prion removal was assessed by Western blot, PMCA and infectivity bioassays. Our results revealed a substantial removal of infectious prions (≥3 logs of infectivity) by all techniques used. These data suggest that a significant amount of infectivity present in RBC preparations can be removed by a simple washing procedure. This technology may lead to increased safety of blood products and reduce the risk of further propagation of prion diseases.

  8. Animal models for testing anti-prion drugs.

    Science.gov (United States)

    Fernández-Borges, Natalia; Elezgarai, Saioa R; Eraña, Hasier; Castilla, Joaquín

    2013-01-01

    Prion diseases belong to a group of fatal infectious diseases with no effective therapies available. Throughout the last 35 years, less than 50 different drugs have been tested in different experimental animal models without hopeful results. An important limitation when searching for new drugs is the existence of appropriate models of the disease. The three different possible origins of prion diseases require the existence of different animal models for testing anti-prion compounds. Wild type, over-expressing transgenic mice and other more sophisticated animal models have been used to evaluate a diversity of compounds which some of them were previously tested in different in vitro experimental models. The complexity of prion diseases will require more pre-screening studies, reliable sporadic (or spontaneous) animal models and accurate chemical modifications of the selected compounds before having an effective therapy against human prion diseases. This review is intended to put on display the more relevant animal models that have been used in the search of new antiprion therapies and describe some possible procedures when handling chemical compounds presumed to have anti-prion activity prior to testing them in animal models.

  9. Strain-dependent profile of misfolded prion protein aggregates.

    Science.gov (United States)

    Morales, Rodrigo; Hu, Ping Ping; Duran-Aniotz, Claudia; Moda, Fabio; Diaz-Espinoza, Rodrigo; Chen, Baian; Bravo-Alegria, Javiera; Makarava, Natallia; Baskakov, Ilia V; Soto, Claudio

    2016-02-15

    Prions are composed of the misfolded prion protein (PrP(Sc)) organized in a variety of aggregates. An important question in the prion field has been to determine the identity of functional PrP(Sc) aggregates. In this study, we used equilibrium sedimentation in sucrose density gradients to separate PrP(Sc) aggregates from three hamster prion strains (Hyper, Drowsy, SSLOW) subjected to minimal manipulations. We show that PrP(Sc) aggregates distribute in a wide range of arrangements and the relative proportion of each species depends on the prion strain. We observed a direct correlation between the density of the predominant PrP(Sc) aggregates and the incubation periods for the strains studied. The relative presence of PrP(Sc) in fractions of different sucrose densities was indicative of the protein deposits present in the brain as analyzed by histology. Interestingly, no association was found between sensitivity to proteolytic degradation and aggregation profiles. Therefore, the organization of PrP molecules in terms of the density of aggregates generated may determine some of the particular strain properties, whereas others are independent from it. Our findings may contribute to understand the mechanisms of strain variation and the role of PrP(Sc) aggregates in prion-induced neurodegeneration.

  10. Synthetic prions with novel strain-specified properties.

    Science.gov (United States)

    Moda, Fabio; Le, Thanh-Nhat T; Aulić, Suzana; Bistaffa, Edoardo; Campagnani, Ilaria; Virgilio, Tommaso; Indaco, Antonio; Palamara, Luisa; Andréoletti, Olivier; Tagliavini, Fabrizio; Legname, Giuseppe

    2015-12-01

    Prions are infectious proteins that possess multiple self-propagating structures. The information for strains and structural specific barriers appears to be contained exclusively in the folding of the pathological isoform, PrP(Sc). Many recent studies determined that de novo prion strains could be generated in vitro from the structural conversion of recombinant (rec) prion protein (PrP) into amyloidal structures. Our aim was to elucidate the conformational diversity of pathological recPrP amyloids and their biological activities, as well as to gain novel insights in characterizing molecular events involved in mammalian prion conversion and propagation. To this end we generated infectious materials that possess different conformational structures. Our methodology for the prion conversion of recPrP required only purified rec full-length mouse (Mo) PrP and common chemicals. Neither infected brain extracts nor amplified PrP(Sc) were used. Following two different in vitro protocols recMoPrP converted to amyloid fibrils without any seeding factor. Mouse hypothalamic GT1 and neuroblastoma N2a cell lines were infected with these amyloid preparations as fast screening methodology to characterize the infectious materials. Remarkably, a large number of amyloid preparations were able to induce the conformational change of endogenous PrPC to harbor several distinctive proteinase-resistant PrP forms. One such preparation was characterized in vivo habouring a synthetic prion with novel strain specified neuropathological and biochemical properties.

  11. Disparate modes of evolution shaped modern prion (PRNP) and prion-related doppel (PRND) variation in domestic cattle

    Science.gov (United States)

    Previous investigations aimed at determining whether the mammalian prion protein actually facilitates tangible molecular aspects of either a discrete or pleiotropic functional niche have been debated, especially given the apparent absence of overt behavioral or physiological phenotypes associated wi...

  12. Instability of buried hydration sites increases protein subdomains fluctuations in the human prion protein by the pathogenic mutation T188R

    Science.gov (United States)

    Tomobe, Katsufumi; Yamamoto, Eiji; Akimoto, Takuma; Yasui, Masato; Yasuoka, Kenji

    2016-05-01

    The conformational change from the cellular prion protein (PrPc) to scrapie prion protein (PrPsc) is a key process in prion diseases. The prion protein has buried water molecules which significantly contribute to the stability of the protein; however, there has been no report investigating the influence on the buried hydration sites by a pathogenic mutation not adjacent to the buried hydration sites. Here, we perform molecular dynamics simulations of wild type (WT) PrPc and pathogenic point mutant T188R to investigate conformational changes and the buried hydration sites. In WT-PrPc, four buried hydration sites are identified by residence time and rotational relaxation analysis. However, there are no stable buried hydration sites in one of T188R simulations, which indicates that T188R sometimes makes the buried hydration sites fragile. We also find that fluctuations of subdomains S1-H1-S2 and H1-H2 increase in T188R when the buried hydration sites become unstable. Since the side chain of arginine which is replaced from threonine in T188R is larger than of threonine, the side chain cannot be embedded in the protein, which is one of the causes of the instability of subdomains. These results show correlations between the buried hydration sites and the mutation which is far from them, and provide a possible explanation for the instability by mutation.

  13. Instability of buried hydration sites increases protein subdomains fluctuations in the human prion protein by the pathogenic mutation T188R

    Directory of Open Access Journals (Sweden)

    Katsufumi Tomobe

    2016-05-01

    Full Text Available The conformational change from the cellular prion protein (PrPc to scrapie prion protein (PrPsc is a key process in prion diseases. The prion protein has buried water molecules which significantly contribute to the stability of the protein; however, there has been no report investigating the influence on the buried hydration sites by a pathogenic mutation not adjacent to the buried hydration sites. Here, we perform molecular dynamics simulations of wild type (WT PrPc and pathogenic point mutant T188R to investigate conformational changes and the buried hydration sites. In WT-PrPc, four buried hydration sites are identified by residence time and rotational relaxation analysis. However, there are no stable buried hydration sites in one of T188R simulations, which indicates that T188R sometimes makes the buried hydration sites fragile. We also find that fluctuations of subdomains S1-H1-S2 and H1-H2 increase in T188R when the buried hydration sites become unstable. Since the side chain of arginine which is replaced from threonine in T188R is larger than of threonine, the side chain cannot be embedded in the protein, which is one of the causes of the instability of subdomains. These results show correlations between the buried hydration sites and the mutation which is far from them, and provide a possible explanation for the instability by mutation.

  14. Proteasome inhibitors promote the sequestration of PrPSc into aggresomes within the cytosol of prion-infected CAD neuronal cells.

    Science.gov (United States)

    Dron, Michel; Dandoy-Dron, Françoise; Farooq Salamat, Muhammad Khalid; Laude, Hubert

    2009-08-01

    Dysfunction of the endoplasmic reticulum associated protein degradation/proteasome system is believed to contribute to the initiation or aggravation of neurodegenerative disorders associated with protein misfolding, and there is some evidence to suggest that proteasome dysfunctions might be implicated in prion disease. This study investigated the effect of proteasome inhibitors on the biogenesis of both the cellular (PrP(C)) and abnormal (PrP(Sc)) forms of prion protein in CAD neuronal cells, a newly introduced prion cell system. In uninfected cells, proteasome impairment altered the intracellular distribution of PrP(C), leading to a strong accumulation in the Golgi apparatus. Moreover, a detergent-insoluble and weakly protease-resistant PrP species of 26 kDa, termed PrP(26K), accumulated in the cells, whether they were prion-infected or not. However, no evidence was found that, in infected cells, this PrP(26K) species converts into the highly proteinase K-resistant PrP(Sc). In the infected cultures, proteasome inhibition caused an increased intracellular aggregation of PrP(Sc) that was deposited into large aggresomes. These findings strengthen the view that, in neuronal cells expressing wild-type PrP(C) from the natural promoter, proteasomal impairment may affect both the process of PrP(C) biosynthesis and the subcellular sites of PrP(Sc) accumulation, despite the fact that these two effects could essentially be disconnected.

  15. Interaction of human laminin receptor with Sup35, the [PSI⁺] prion-forming protein from S. cerevisiae: a yeast model for studies of LamR interactions with amyloidogenic proteins.

    Directory of Open Access Journals (Sweden)

    Christine Pampeno

    Full Text Available The laminin receptor (LamR is a cell surface receptor for extracellular matrix laminin, whereas the same protein within the cell interacts with ribosomes, nuclear proteins and cytoskeletal fibers. LamR has been shown to be a receptor for several bacteria and viruses. Furthermore, LamR interacts with both cellular and infectious forms of the prion protein, PrP(C and PrP(Sc. Indeed, LamR is a receptor for PrP(C. Whether LamR interacts with PrP(Sc exclusively in a capacity of the PrP receptor, or LamR specifically recognizes prion determinants of PrP(Sc, is unclear. In order to explore whether LamR has a propensity to interact with prions and amyloids, we examined LamR interaction with the yeast prion-forming protein, Sup35. Sup35 is a translation termination factor with no homology or functional relationship to PrP. Plasmids expressing LamR or LamR fused with the green fluorescent protein (GFP were transformed into yeast strain variants differing by the presence or absence of the prion conformation of Sup35, respectively [PSI⁺] and [psi⁻]. Analyses by immunoprecipitation, centrifugal fractionation and fluorescent microscopy reveal interaction between LamR and Sup35 in [PSI⁺] strains. The presence of [PSI⁺] promotes LamR co-precipitation with Sup35 as well as LamR aggregation. In [PSI⁺] cells, LamR tagged with GFP or mCherry forms bright fluorescent aggregates that co-localize with visible [PSI⁺] foci. The yeast prion model will facilitate studying the interaction of LamR with amyloidogenic prions in a safe and easily manipulated system that may lead to a better understanding and treatment of amyloid diseases.

  16. Normal and sublethally irradiated stem and granulocyte progenitor cell regeneration in an in vivo culture system. The cellular response to humoral factors released through the action of cyclophosphamide

    International Nuclear Information System (INIS)

    MacVittie, T.

    1977-01-01

    The in vivo diffusion chamber (DC) method of marrow culture was used to determine if the injection of host mice with cyclophosphamide (CY) caused, through its cytoxic action, the release of a humoral factor(s) capable of initiating stem cell (CFU-s) and granulocyte-macrophage progenitor cell (CFU-c) proliferation. Host mice were injected with CY 1-4 days prior to 800 rad of 60 Co WBI and implantation of DCs containing normal or 400 rad sublethally irradiated (SLI) marrow cells. The greatest proliferative response within CFU-s and CFU-c populations occurred in those mice injected with CY 3 days prior to implant. The marked CFU-s and CFU-c regeneration was initiated during the initial 24 hr of culture in both normal and SLI marrow cells. Thereafter growth rates were approximately the same. SLI marrow, however, showed a greater response to the humoral effects of CY injection than did normal marrow. These data provided evidence that CY induced the release of a diffusible factor(s) capable of accelerating regeneration of normal and sublethally irradiated CFU-s and CFU-c, the magnitude of which was dependent upon the time elapsed between CY injected and implantation of DCs. The marked proliferative response of the SLI stem and progenitor cells to the humoral stimulation may be indicative of the heterogeneity of both CFU-s and CFU-c populations surviving sublethal radiation exposure. The target cells may have possessed a differential sensitivity to the factor(s) initiating cell proliferation

  17. Age and Environment Influences on Mouse Prion Disease Progression: Behavioral Changes and Morphometry and Stereology of Hippocampal Astrocytes

    Directory of Open Access Journals (Sweden)

    J. Bento-Torres

    2017-01-01

    Full Text Available Because enriched environment (EE and exercise increase and aging decreases immune response, we hypothesized that environmental enrichment and aging will, respectively, delay and increase prion disease progression. Mice dorsal striatum received bilateral stereotaxic intracerebral injections of normal or ME7 prion infected mouse brain homogenates. After behavior analysis, animals were euthanized and their brains processed for astrocyte GFAP immunolabeling. Our analysis related to the environmental influence are limited to young adult mice, whereas age influence refers to aged mice raised on standard cages. Burrowing activity began to reduce in ME7-SE two weeks before ME7-EE, while no changes were apparent in ME7 aged mice (ME7-A. Object placement recognition was impaired in ME7-SE, NBH-A, and ME7-A but normal in all other groups. Object identity recognition was impaired in ME7-A. Cluster analysis revealed two morphological families of astrocytes in NBH-SE animals, three in NBH-A and ME7-A, and four in NBH-EE, ME7-SE, and ME7-EE. As compared with control groups, astrocytes from DG and CA3 prion-diseased animals show significant numerical and morphological differences and environmental enrichment did not reverse these changes but induced different morphological changes in GFAP+ hippocampal astroglia. We suggest that environmental enrichment and aging delayed hippocampal-dependent behavioral and neuropathological signs of disease progression.

  18. Increased expression of p62/SQSTM1 in prion diseases and its association with pathogenic prion protein.

    Science.gov (United States)

    Homma, Takujiro; Ishibashi, Daisuke; Nakagaki, Takehiro; Satoh, Katsuya; Sano, Kazunori; Atarashi, Ryuichiro; Nishida, Noriyuki

    2014-03-28

    Prion diseases are neurodegenerative disorders characterized by the aggregation of abnormally folded prion protein (PrP(Sc)). In this study, we focused on the mechanism of clearance of PrP(Sc), which remains unclear. p62 is a cytosolic protein known to mediate both the formation and degradation of aggregates of abnormal proteins. The levels of p62 protein increased in prion-infected brains and persistently infected cell cultures. Upon proteasome inhibition, p62 co-localized with PrP(Sc), forming a large aggregate in the perinuclear region, hereafter referred to as PrP(Sc)-aggresome. These aggregates were surrounded with autophagosome marker LC3 and lysosomes in prion-infected cells. Moreover, transient expression of the phosphomimic form of p62, which has enhanced ubiquitin-binding activity, reduced the amount of PrP(Sc) in prion-infected cells, indicating that the activation of p62 could accelerate the clearance of PrP(Sc). Our findings would thus suggest that p62 could be a target for the therapeutic control of prion diseases.

  19. Conformational detection of prion protein with biarsenical labeling and FlAsH fluorescence

    International Nuclear Information System (INIS)

    Coleman, Bradley M.; Nisbet, Rebecca M.; Han, Sen; Cappai, Roberto; Hatters, Danny M.; Hill, Andrew F.

    2009-01-01

    Prion diseases are associated with the misfolding of the host-encoded cellular prion protein (PrP C ) into a disease associated form (PrP Sc ). Recombinant PrP can be refolded into either an α-helical rich conformation (α-PrP) resembling PrP C or a β-sheet rich, protease resistant form similar to PrP Sc . Here, we generated tetracysteine tagged recombinant PrP, folded this into α- or β-PrP and determined the levels of FlAsH fluorescence. Insertion of the tetracysteine tag at three different sites within the 91-111 epitope readily distinguished β-PrP from α-PrP upon FlAsH labeling. Labelling of tetracysteine tagged PrP in the α-helical form showed minimal fluorescence, whereas labeling of tagged PrP in the β-sheet form showed high fluorescence indicating that this region is exposed upon conversion. This highlights a region of PrP that can be implicated in the development of diagnostics and is a novel, protease free mechanism for distinguishing PrP Sc from PrP C . This technique may also be applied to any protein that undergoes conformational change and/or misfolding such as those involved in other neurodegenerative disorders including Alzheimer's, Huntington's and Parkinson's diseases.

  20. The comprehensive native interactome of a fully functional tagged prion protein.

    Directory of Open Access Journals (Sweden)

    Dorothea Rutishauser

    Full Text Available The enumeration of the interaction partners of the cellular prion protein, PrP(C, may help clarifying its elusive molecular function. Here we added a carboxy proximal myc epitope tag to PrP(C. When expressed in transgenic mice, PrP(myc carried a GPI anchor, was targeted to lipid rafts, and was glycosylated similarly to PrP(C. PrP(myc antagonized the toxicity of truncated PrP, restored prion infectibility of PrP(C-deficient mice, and was physically incorporated into PrP(Sc aggregates, indicating that it possessed all functional characteristics of genuine PrP(C. We then immunopurified myc epitope-containing protein complexes from PrP(myc transgenic mouse brains. Gentle differential elution with epitope-mimetic decapeptides, or a scrambled version thereof, yielded 96 specifically released proteins. Quantitative mass spectrometry with isotope-coded tags identified seven proteins which co-eluted equimolarly with PrP(C and may represent component of a multiprotein complex. Selected PrP(C interactors were validated using independent methods. Several of these proteins appear to exert functions in axomyelinic maintenance.

  1. Encefalopatía por priones

    Directory of Open Access Journals (Sweden)

    Carlos Colegial

    1999-01-01

    Full Text Available Las encefalopatías espongiformes por priones son enfermedades neurodegenerativas que pueden ser esporádicas o transmisibles, ya sea por mecanismos infecciosos o hereditarios. Su investigación ha planteado enormes retos y en el recorrido histórico en busca de su causa dos médicos han recibido el premio Nobel de Medicina: Carleton Gajdusek, por sus trabajos en Nueva Guinea donde describió la transmisión infecciosa por ritos canibalísticos, que llevó a estudios de transmisión experimental en chimpancés y a su teoría de los "virus lentos" (por el largo período de incubación de la enfermedad.

  2. Regional brain metabolite abnormalities in inherited prion disease and asymptomatic gene carriers demonstrated in vivo by quantitative proton magnetic resonance spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Waldman, A.D.; Cordery, R.J.; Godbolt, A.; Rossor, M.N. [University College London, Dementia Research Group, Department of Neurodegenerative Disease, Institute of Neurology, London (United Kingdom); Imperial College of Science, Technology and Medicine, Division of Neuroscience and Psychological Medicine, Faculty of Medicine, London (United Kingdom); MacManus, D.G. [University College London, NMR Research Unit, Department of Clinical Neurology, Institute of Neurology, London (United Kingdom); Collinge, J. [University College London, MRC Prion Unit, Department of Neurodegenerative Disease, Institute of Neurology, London (United Kingdom)

    2006-06-15

    Inherited prion diseases are caused by mutations in the gene which codes for prion protein (PrP), leading to proliferation of abnormal PrP isomers in the brain and neurodegeneration; they include Gerstmann-Straeussler-Scheinker disease (GSS), fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD). We studied two patients with symptomatic inherited prion disease (P102L) and two pre-symptomatic P102L gene carriers using quantitative magnetic resonance spectroscopy (MRS). Short echo time spectra were acquired from the thalamus, caudate region and frontal white matter, metabolite levels and ratios were measured and z-scores calculated for individual patients relative to age-matched normal controls. MRS data were compared with structural magnetic resonance imaging. One fCJD case had generalised atrophy and showed increased levels of myo-inositol (MI) in the thalamus (z=3.7). The other had decreased levels of N-acetylaspartate (z=4) and diffuse signal abnormality in the frontal white matter. Both asymptomatic gene carriers had normal imaging, but increased frontal white matter MI (z=4.3, 4.1), and one also had increased MI in the caudate (z=5.3). Isolated MI abnormalities in asymptomatic gene carriers are a novel finding and may reflect early glial proliferation, prior to significant neuronal damage. MRS provides potential non-invasive surrogate markers of early disease and progression in inherited prion disease. (orig.)

  3. Regional brain metabolite abnormalities in inherited prion disease and asymptomatic gene carriers demonstrated in vivo by quantitative proton magnetic resonance spectroscopy

    International Nuclear Information System (INIS)

    Waldman, A.D.; Cordery, R.J.; Godbolt, A.; Rossor, M.N.; MacManus, D.G.; Collinge, J.

    2006-01-01

    Inherited prion diseases are caused by mutations in the gene which codes for prion protein (PrP), leading to proliferation of abnormal PrP isomers in the brain and neurodegeneration; they include Gerstmann-Straeussler-Scheinker disease (GSS), fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD). We studied two patients with symptomatic inherited prion disease (P102L) and two pre-symptomatic P102L gene carriers using quantitative magnetic resonance spectroscopy (MRS). Short echo time spectra were acquired from the thalamus, caudate region and frontal white matter, metabolite levels and ratios were measured and z-scores calculated for individual patients relative to age-matched normal controls. MRS data were compared with structural magnetic resonance imaging. One fCJD case had generalised atrophy and showed increased levels of myo-inositol (MI) in the thalamus (z=3.7). The other had decreased levels of N-acetylaspartate (z=4) and diffuse signal abnormality in the frontal white matter. Both asymptomatic gene carriers had normal imaging, but increased frontal white matter MI (z=4.3, 4.1), and one also had increased MI in the caudate (z=5.3). Isolated MI abnormalities in asymptomatic gene carriers are a novel finding and may reflect early glial proliferation, prior to significant neuronal damage. MRS provides potential non-invasive surrogate markers of early disease and progression in inherited prion disease. (orig.)

  4. Elucidation of Prion Protein Conformational Changes Associated with Infectivity by Fluorescence Spectroscopy

    Science.gov (United States)

    2007-06-01

    is not known. Obtaining structural information on the misfolded isoform of prion may lead to preventative therapies and treatments of prion diseases...the misfolded prion isoform may allow for the development of drug therapies or early detection systems for prion diseases, or illuminate mechanistic...showing fluorescence intensity as a function of time and energy for 2,6-p-toluidinonapththalene adsorbed to egg L-α- lecithin vesicles. The steady

  5. Prion protein amyloidosis with divergent phenotype associated with two novel nonsense mutations in PRNP

    NARCIS (Netherlands)

    Jansen, Casper; Parchi, Piero; Capellari, Sabina; Vermeij, Ad J.; Corrado, Patrizia; Baas, Frank; Strammiello, Rosaria; van Gool, Willem A.; van Swieten, John C.; Rozemuller, Annemieke J. M.

    2010-01-01

    Stop codon mutations in the gene encoding the prion protein (PRNP) are very rare and have thus far only been described in two patients with prion protein cerebral amyloid angiopathy (PrP-CAA). In this report, we describe the clinical, histopathological and pathological prion protein (PrPSc)

  6. Human SNM1B is required for normal cellular response to both DNA interstrand crosslink-inducing agents and ionizing radiation.

    Science.gov (United States)

    Demuth, Ilja; Digweed, Martin; Concannon, Patrick

    2004-11-11

    DNA interstrand crosslinks (ICLs) are critical lesions for the mammalian cell since they affect both DNA strands and block transcription and replication. The repair of ICLs in the mammalian cell involves components of different repair pathways such as nucleotide-excision repair and the double-strand break/homologous recombination repair pathways. However, the mechanistic details of mammalian ICL repair have not been fully delineated. We describe here the complete coding sequence and the genomic organization of hSNM1B, one of at least three human homologs of the Saccharomyces cerevisiae PSO2 gene. Depletion of hSNM1B by RNA interference rendered cells hypersensitive to ICL-inducing agents. This requirement for hSNM1B in the cellular response to ICL has been hypothesized before but never experimentally verified. In addition, siRNA knockdown of hSNM1B rendered cells sensitive to ionizing radiation, suggesting the possibility of hSNM1B involvement in homologous recombination repair of double-strand breaks arising as intermediates of ICL repair. Monoubiquitination of FANCD2, a key step in the FANC/BRCA pathway, is not affected in hSNM1B-depleted HeLa cells, indicating that hSNM1B is probably not a part of the Fanconi anemia core complex. Nonetheless, similarities in the phenotype of hSNM1B-depleted cells and cultured cells from patients suffering from Fanconi anemia make hSNM1B a candidate for one of the as yet unidentified Fanconi anemia genes not involved in monoubiquitination of FANCD2.

  7. Selective propagation of mouse-passaged scrapie prions with long incubation period from a mixed prion population using GT1-7 cells.

    Directory of Open Access Journals (Sweden)

    Kohtaro Miyazawa

    Full Text Available In our previous study, we demonstrated the propagation of mouse-passaged scrapie isolates with long incubation periods (L-type derived from natural Japanese sheep scrapie cases in murine hypothalamic GT1-7 cells, along with disease-associated prion protein (PrPSc accumulation. We here analyzed the susceptibility of GT1-7 cells to scrapie prions by exposure to infected mouse brains at different passages, following interspecies transmission. Wild-type mice challenged with a natural sheep scrapie case (Kanagawa exhibited heterogeneity of transmitted scrapie prions in early passages, and this mixed population converged upon one with a short incubation period (S-type following subsequent passages. However, when GT1-7 cells were challenged with these heterologous samples, L-type prions became dominant. This study demonstrated that the susceptibility of GT1-7 cells to L-type prions was at least 105 times higher than that to S-type prions and that L-type prion-specific biological characteristics remained unchanged after serial passages in GT1-7 cells. This suggests that a GT1-7 cell culture model would be more useful for the economical and stable amplification of L-type prions at the laboratory level. Furthermore, this cell culture model might be used to selectively propagate L-type scrapie prions from a mixed prion population.

  8. 75 FR 38958 - Declaration of Prion as a Pest under FIFRA and Amendment of EPA's Regulatory Definition of Pests...

    Science.gov (United States)

    2010-07-07

    ... Prion as a Pest under FIFRA and Amendment of EPA's Regulatory Definition of Pests to Include Prion....e., proteinaceous infectious particle) a ``pest'' under the Federal Insecticide, Fungicide, and... is adding prion to the list of pests in EPA's regulations. This amendment, together with the formal...

  9. Resistance to chronic wasting disease in transgenic mice expressing a naturally occurring allelic variant of deer prion protein

    NARCIS (Netherlands)

    Meade-White, K.; Race, B.; Trifilo, M.; Bossers, A.; Favara, C.; Lacasse, R.; Miller, M.; Williams, E.; Oldstone, M.; Race, R.; Chesebro, B.

    2007-01-01

    Prion protein (PrP) is a required factor for susceptibility to transmissible spongiform encephalopathy or prion diseases. In transgenic mice, expression of prion protein (PrP) from another species often confers susceptibility to prion disease from that donor species. For example, expression of deer

  10. Early behavioral changes and quantitative analysis of neuropathological features in murine prion disease

    Science.gov (United States)

    Borner, Roseane; Bento-Torres, João; Souza, Diego RV; Sadala, Danyelle B; Trevia, Nonata; Farias, José Augusto; Lins, Nara; Passos, Aline; Quintairos, Amanda; Diniz, José Antônio; Perry, Victor Hugh; Vasconcelos, Pedro Fernando; Cunningham, Colm

    2011-01-01

    Behavioral and neuropathological changes have been widely investigated in murine prion disease but stereological based unbiased estimates of key neuropathological features have not been carried out. After injections of ME7 infected (ME7) or normal brain homogenates (NBH) into dorsal CA1 of albino Swiss mice and C57BL6, we assessed behavioral changes on hippocampal-dependent tasks. We also estimated by optical fractionator at 15 and 18 weeks post-injections (w.p.i.) the total number of neurons, reactive astrocytes, activated microglia and perineuronal nets (PN) in the polymorphic layer of dentate gyrus (PolDG), CA1 and septum in albino Swiss mice. On average, early behavioral changes in albino Swiss mice start four weeks later than in C57BL6. Cluster and discriminant analysis of behavioral data in albino Swiss mice revealed that four of nine subjects start to change their behavior at 12 w.p.i. and reach terminal stage at 22 w.p.i and the remaining subjects start at 22 w.p.i. and reach terminal stage at 26 w.p.i. Biotinylated dextran-amine BDA-tracer experiments in mossy fiber pathway confirmed axonal degeneration and stereological data showed that early astrocytosis, microgliosis and reduction in the perineuronal nets are independent of a change in the number of neuronal cell bodies. Statistical analysis revealed that the septal region had greater levels of neuroinflammation and extracellular matrix damage than CA1. This stereological and multivariate analysis at early stages of disease in an outbred model of prion disease provided new insights connecting behavioral changes and neuroinflammation and seems to be important to understand the mechanisms of prion disease progression. PMID:21862877

  11. Human stefin B normal and patho-physiological role: molecular and cellular aspects of amyloid-type aggregation of certain EPM1 mutants.

    Directory of Open Access Journals (Sweden)

    Mira ePolajnar

    2012-08-01

    Full Text Available Epilepsies are characterised by abnormal electrophysiological activity of the brain. Among various types of inherited epilepsies different epilepsy syndromes, among them progressive myoclonus epilepsies with features of ataxia and neurodegeneration, are counted. The progressive myoclonus epilepsy of type 1 (EPM1, also known as Unverricht-Lundborg disease presents with features of cerebellar atrophy and increased oxidative stress. It has been found that EPM1 is caused by mutations in human cystatin B gene (human stefin B. We first describe the role of protein aggregation in other neurodegenerative conditions. Protein aggregates appear intraneurally but are also excreted, such as is the case with senile plaques of amyloid- β (Aβ that accumulate in the brain parenchyma and vessel walls. A common characteristic of such diseases is the change of the protein conformation towards β secondary structure that accounts for the strong tendency of such proteins to aggregate and form amyloid fibrils. Second, we describe the patho-physiology of EPM1 and the normal and aberrant roles of stefin B in a mouse model of the disease. Furthermore, we discuss how the increased protein aggregation observed with some of the mutants of human stefin B may relate to the neurodegeneration that occurs in rare EPM1 patients. Our hypothesis (Ceru et al., 2005 states that some of the EPM1 mutants of human stefin B may undergo aggregation in neural cells, thus gaining additional toxic function (apart from loss of normal function. Our in vitro experiments thus far have confirmed that 4 mutants undergo increased aggregation relative to the wild-type protein. It has been shown that the R68X mutant forms amyloid-fibrils very rapidly, even at neutral pH and forms perinuclear inclusions, whereas the G4R mutant exhibits a prolonged lag phase, during which the toxic prefibrillar aggregates accumulate and are scattered more diffusely over the cytoplasm. Initial experiments on the G50E

  12. Genetic Predictions of Prion Disease Susceptibility in Carnivore Species Based on Variability of the Prion Gene Coding Region

    Science.gov (United States)

    Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A.; Arnemo, Jon M.; Tryland, Morten; Girling, Simon; Miller, Michael W.; Tranulis, Michael A.; Goldmann, Wilfred

    2012-01-01

    Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrPC) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrPC protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter. PMID:23236380

  13. Genetic predictions of prion disease susceptibility in carnivore species based on variability of the prion gene coding region.

    Directory of Open Access Journals (Sweden)

    Paula Stewart

    Full Text Available Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE during the bovine spongiform encephalopathy (BSE epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD remains an open question. Variation in the host-encoded prion protein (PrP(C largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrP(C protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo and pine marten (Martes martes were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus and mountain lion (Puma concolor from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter.

  14. A visual dual-aptamer logic gate for sensitive discrimination of prion diseases-associated isoform with reusable magnetic microparticles and fluorescence quantum dots.

    Science.gov (United States)

    Xiao, Sai Jin; Hu, Ping Ping; Chen, Li Qiang; Zhen, Shu Jun; Peng, Li; Li, Yuan Fang; Huang, Cheng Zhi

    2013-01-01

    Molecular logic gates, which have attracted increasing research interest and are crucial for the development of molecular-scale computers, simplify the results of measurements and detections, leaving the diagnosis of disease either "yes" or "no". Prion diseases are a group of fatal neurodegenerative disorders that happen in human and animals. The main problem with a diagnosis of prion diseases is how to sensitively and selectively discriminate and detection of the minute amount of PrP(Res) in biological samples. Our previous work had demonstrated that dual-aptamer strategy could achieve highly sensitive and selective discrimination and detection of prion protein (cellular prion protein, PrP(C), and the diseases associated isoform, PrP(Res)) in serum and brain. Inspired by the advantages of molecular logic gate, we further conceived a new concept for dual-aptamer logic gate that responds to two chemical input signals (PrP(C) or PrP(Res) and Gdn-HCl) and generates a change in fluorescence intensity as the output signal. It was found that PrP(Res) performs the "OR" logic operation while PrP(C) performs "XOR" logic operation when they get through the gate consisted of aptamer modified reusable magnetic microparticles (MMPs-Apt1) and quantum dots (QDs-Apt2). The dual-aptamer logic gate simplifies the discrimination results of PrP(Res), leaving the detection of PrP(Res) either "yes" or "no". The development of OR logic gate based on dual-aptamer strategy and two chemical input signals (PrP(Res) and Gdn-HCl) is an important step toward the design of prion diseases diagnosis and therapy systems.

  15. A visual dual-aptamer logic gate for sensitive discrimination of prion diseases-associated isoform with reusable magnetic microparticles and fluorescence quantum dots.

    Directory of Open Access Journals (Sweden)

    Sai Jin Xiao

    Full Text Available Molecular logic gates, which have attracted increasing research interest and are crucial for the development of molecular-scale computers, simplify the results of measurements and detections, leaving the diagnosis of disease either "yes" or "no". Prion diseases are a group of fatal neurodegenerative disorders that happen in human and animals. The main problem with a diagnosis of prion diseases is how to sensitively and selectively discriminate and detection of the minute amount of PrP(Res in biological samples. Our previous work had demonstrated that dual-aptamer strategy could achieve highly sensitive and selective discrimination and detection of prion protein (cellular prion protein, PrP(C, and the diseases associated isoform, PrP(Res in serum and brain. Inspired by the advantages of molecular logic gate, we further conceived a new concept for dual-aptamer logic gate that responds to two chemical input signals (PrP(C or PrP(Res and Gdn-HCl and generates a change in fluorescence intensity as the output signal. It was found that PrP(Res performs the "OR" logic operation while PrP(C performs "XOR" logic operation when they get through the gate consisted of aptamer modified reusable magnetic microparticles (MMPs-Apt1 and quantum dots (QDs-Apt2. The dual-aptamer logic gate simplifies the discrimination results of PrP(Res, leaving the detection of PrP(Res either "yes" or "no". The development of OR logic gate based on dual-aptamer strategy and two chemical input signals (PrP(Res and Gdn-HCl is an important step toward the design of prion diseases diagnosis and therapy systems.

  16. Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.

    Science.gov (United States)

    Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L

    2015-01-01

    The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.

  17. Pin1 and neurodegeneration: a new player for prion disorders?

    Directory of Open Access Journals (Sweden)

    Elisa Isopi

    2015-07-01

    Full Text Available Pin1 is a peptidyl-prolyl isomerase that catalyzes the cis/trans conversion of phosphorylated proteins at serine or threonine residues which precede a proline. The peptidyl-prolyl isomerization induces a conformational change of the proteins involved in cell signaling process. Pin1 dysregulation has been associated with some neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease and Huntington's disease. Proline-directed phosphorylation is a common regulator of these pathologies and a recent work showed that it is also involved in prion disorders. In fact, prion protein phosphorylation at the Ser-43-Pro motif induces prion protein conversion into a disease-associated form. Furthermore, phosphorylation at Ser-43-Pro has been observed to increase in the cerebral spinal fluid of sporadic Creutzfeldt-Jakob Disease patients. These findings provide new insights into the pathogenesis of prion disorders, suggesting Pin1 as a potential new player in the disease. In this paper, we review the mechanisms underlying Pin1 involvement in the aforementioned neurodegenerative pathologies focusing on the potential role of Pin1 in prion disorders.

  18. Role of galectin-3 in prion infections of the CNS

    International Nuclear Information System (INIS)

    Mok, Simon W.F.; Riemer, Constanze; Madela, Kazimierz; Hsu, Daniel K.; Liu, Fu-Tong; Gueltner, Sandra; Heise, Ines; Baier, Michael

    2007-01-01

    Galectin-3 is a multi-functional protein and participates in mediating inflammatory reactions. The pronounced overexpression of galectin-3 in prion-infected brain tissue prompted us to study the role of this protein in a murine prion model. Immunofluorescence double-labelling identified microglia as the major cell type expressing galectin-3. Ablation of galectin-3 did not affect PrP Sc -deposition and development of gliosis. However, galectin-3 -/- -mice showed prolonged survival times upon intracerebral and peripheral scrapie infections. Moreover, protein levels of the lysosomal activation marker LAMP-2 were markedly reduced in prion-infected galectin-3 -/- -mice suggesting a role of galectin-3 in regulation of lysosomal functions. Lower mRNA levels of Beclin-1 and Atg5 in prion-infected wild-type and galectin-3 -/- -mice indicated an impairment of autophagy although autophagosome formation was unchanged. The results point towards a detrimental role of galectin-3 in prion infections of the CNS and suggest that endo-/lysosomal dysfunction in combination with reduced autophagy may contribute to disease development

  19. Structure-based view on [PSI(+)] prion properties.

    Science.gov (United States)

    Bondarev, Stanislav A; Zhouravleva, Galina A; Belousov, Mikhail V; Kajava, Andrey V

    2015-01-01

    Yeast [PSI(+)] prion is one of the most suitable and well characterized system for the investigation of the prion phenomenon. However, until recently, the lack of data on the 3D arrangement of Sup35p prion fibrils hindered progress in this area. The recent arrival in this field of new experimental techniques led to the parallel and in-register superpleated β-structure as a consensus model for Sup35p fibrils. Here, we analyzed the effect of amino acid substitutions of the Sup35 protein through the prism of this structural model. Application of a newly developed computational approach, called ArchCandy, gives us a better understanding of the effect caused by mutations on the fibril forming potential of Sup35 protein. This bioinformatics tool can be used for the design of new mutations with desired modification of prion properties. Thus, we provide examples of how today, having progress toward elucidation of the structural arrangement of Sup35p fibrils, researchers can advance more efficiently to a better understanding of prion [PSI(+)] stability and propagation.

  20. Semi-purification procedures of prions from a prion-infected brain using sucrose has no influence on the nonenzymatic glycation of the disease-associated prion isoform.

    Science.gov (United States)

    Choi, Yeong-Gon; Kim, Jae-Il; Choi, Eun-Kyoung; Carp, Richard I; Kim, Yong-Sun

    2016-01-01

    Previous studies have shown that the Nε-carboxymethyl group is linked to not only one or more N-terminal Lys residues but also to one or more Lys residues of the protease-resistant core region of the pathogenic prion isoform (PrPSc) in prion-infected brains. Using an anti-advanced glycation end product (AGE) antibody, we detected nonenzymatically glycated PrPSc (AGE-PrPSc) in prion-infected brains following concentration by a series of ultracentrifugation steps with a sucrose cushion. In the present study, the levels of in vitro nonenzymatic glycation of PrPSc using sucrose were investigated to determine whether sucrose cushion can artificially and nonenzymatically induce in vitro glycation during ultracentrifugation. The first insoluble pellet fraction following the first ultracentrifugation (PU1st) collected from 263K scrapie-infected brains was incubated with sucrose, glucose or colloidal silica coated with polyvinylpyrrolidone (percoll). None of the compounds in vitro resulted in AGE-PrPSc. Nonetheless, glucose and percoll produced AGEs in vitro from other proteins within PU1st of the infected brains. This reaction could lead to the AGE-modified polymer(s) of nonenzymatic glycation-prone protein(s). This study showed that PrPSc is not nonenzymatically glycated in vitro with sucrose, glucose or percoll and that AGE-modified PrPSc can be isolated and enriched from prion-infected brains.

  1. A simple, versatile and sensitive cell-based assay for prions from various species.

    Directory of Open Access Journals (Sweden)

    Zaira E Arellano-Anaya

    Full Text Available Detection and quantification of prion infectivity is a crucial step for various fundamental and applied aspects of prion research. Identification of cell lines highly sensitive to prion infection led to the development of cell-based titration procedures aiming at replacing animal bioassays, usually performed in mice or hamsters. However, most of these cell lines are only permissive to mouse-adapted prions strains and do not allow titration of prions from other species. In this study, we show that epithelial RK13, a cell line permissive to mouse and bank vole prion strains and to natural prion agents from sheep and cervids, enables a robust and sensitive detection of mouse and ovine-derived prions. Importantly, the cell culture work is strongly reduced as the RK13 cell assay procedure designed here does not require subcultivation of the inoculated cultures. We also show that prions effectively bind to culture plastic vessel and are quantitatively detected by the cell assay. The possibility to easily quantify a wider range of prions, including rodent experimental strains but also natural agents from sheep and cervids, should prompt the spread of cell assays for routine prion titration and lead to valuable information in fundamental and applied studies.

  2. Fungal prion HET-s as a model for structural complexity and self-propagation in prions.

    Science.gov (United States)

    Wan, William; Stubbs, Gerald

    2014-04-08

    The highly ordered and reproducible structure of the fungal prion HET-s makes it an excellent model system for studying the inherent properties of prions, self-propagating infectious proteins that have been implicated in a number of fatal diseases. In particular, the HET-s prion-forming domain readily folds into a relatively complex two-rung β-solenoid amyloid. The faithful self-propagation of this fold involves a diverse array of inter- and intramolecular structural features. These features include a long flexible loop connecting the two rungs, buried polar residues, salt bridges, and asparagine ladders. We have used site-directed mutagenesis and X-ray fiber diffraction to probe the relative importance of these features for the formation of β-solenoid structure, as well as the cumulative effects of multiple mutations. Using fibrillization kinetics and chemical stability assays, we have determined the biophysical effects of our mutations on the assembly and stability of the prion-forming domain. We have found that a diversity of structural features provides a level of redundancy that allows robust folding and stability even in the face of significant sequence alterations and suboptimal environmental conditions. Our findings provide fundamental insights into the structural interactions necessary for self-propagation. Propagation of prion structure seems to require an obligatory level of complexity that may not be reproducible in short peptide models.

  3. Comparative analysis of the prion protein gene sequences in African lion.

    Science.gov (United States)

    Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming

    2006-10-01

    The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.

  4. Ovine recombinant PrP as an inhibitor of ruminant prion propagation in vitro.

    Science.gov (United States)

    Workman, Rob G; Maddison, Ben C; Gough, Kevin C

    2017-07-04

    Prion diseases are fatal and incurable neurodegenerative diseases of humans and animals. Despite years of research, no therapeutic agents have been developed that can effectively manage or reverse disease progression. Recently it has been identified that recombinant prion proteins (rPrP) expressed in bacteria can act as inhibitors of prion replication within the in vitro prion replication system protein misfolding cyclic amplification (PMCA). Here, within PMCA reactions amplifying a range of ruminant prions including distinct Prnp genotypes/host species and distinct prion strains, recombinant ovine VRQ PrP displayed consistent inhibition of prion replication and produced IC50 values of 122 and 171 nM for ovine scrapie and bovine BSE replication, respectively. These findings illustrate the therapeutic potential of rPrPs with distinct TSE diseases.

  5. Humic substances interfere with detection of pathogenic prion protein

    Science.gov (United States)

    Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.

    2014-01-01

    Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.

  6. Disrupting the cortical actin cytoskeleton points to two distinct mechanisms of yeast [PSI+] prion formation

    Science.gov (United States)

    Speldewinde, Shaun H.; Tuite, Mick F.

    2017-01-01

    Mammalian and fungal prions arise de novo; however, the mechanism is poorly understood in molecular terms. One strong possibility is that oxidative damage to the non-prion form of a protein may be an important trigger influencing the formation of its heritable prion conformation. We have examined the oxidative stress-induced formation of the yeast [PSI+] prion, which is the altered conformation of the Sup35 translation termination factor. We used tandem affinity purification (TAP) and mass spectrometry to identify the proteins which associate with Sup35 in a tsa1 tsa2 antioxidant mutant to address the mechanism by which Sup35 forms the [PSI+] prion during oxidative stress conditions. This analysis identified several components of the cortical actin cytoskeleton including the Abp1 actin nucleation promoting factor, and we show that deletion of the ABP1 gene abrogates oxidant-induced [PSI+] prion formation. The frequency of spontaneous [PSI+] prion formation can be increased by overexpression of Sup35 since the excess Sup35 increases the probability of forming prion seeds. In contrast to oxidant-induced [PSI+] prion formation, overexpression-induced [PSI+] prion formation was only modestly affected in an abp1 mutant. Furthermore, treating yeast cells with latrunculin A to disrupt the formation of actin cables and patches abrogated oxidant-induced, but not overexpression-induced [PSI+] prion formation, suggesting a mechanistic difference in prion formation. [PIN+], the prion form of Rnq1, localizes to the IPOD (insoluble protein deposit) and is thought to influence the aggregation of other proteins. We show Sup35 becomes oxidized and aggregates during oxidative stress conditions, but does not co-localize with Rnq1 in an abp1 mutant which may account for the reduced frequency of [PSI+] prion formation. PMID:28369054

  7. Extraneural manifestations of prion infection in GPI-anchorless transgenic mice

    International Nuclear Information System (INIS)

    Lee, Andrew M.; Paulsson, Johan F.; Cruite, Justin; Andaya, Abegail A.; Trifilo, Matthew J.; Oldstone, Michael B.A.

    2011-01-01

    Earlier studies indicated that transgenic (tg) mice engineered to express prion protein (PrP) lacking the glycophosphatidylinositol (GPI -/- ) membrane anchor formed abnormal proteinase-resistant prion (PrPsc) amyloid deposits in their brains and hearts when infected with the RML strain of murine scrapie. In contrast, RML scrapie infection of normal mice with a GPI-anchored PrP did not deposit amyloid with PrPsc in the brain or the heart. Here we report that scrapie-infected GPI -/- PrP tg mice also deposit PrP and transmissible infectious material in the gut, kidneys, and islets of Langerhans. Similar to previously reported amyloid deposits in the brain and heart, amyloid deposits were found in the gut; however, no amyloid deposited in the islets. By high-resolution electron microscopy, we show PrP is located primarily in α cells and also β cells. Islets contain abundant insulin and there is no abnormality in glucose metabolism in infected GPI -/- PrP tg mice.

  8. Prion protein β2–α2 loop conformational landscape

    Science.gov (United States)

    Caldarulo, Enrico; Wüthrich, Kurt; Parrinello, Michele

    2017-01-01

    In transmissible spongiform encephalopathies (TSEs), which are lethal neurodegenerative diseases that affect humans and a wide range of other mammalian species, the normal “cellular” prion protein (PrPC) is transformed into amyloid aggregates representing the “scrapie form” of the protein (PrPSc). Continued research on this system is of keen interest, since new information on the physiological function of PrPC in healthy organisms is emerging, as well as new data on the mechanism of the transformation of PrPC to PrPSc. In this paper we used two different approaches: a combination of the well-tempered ensemble (WTE) and parallel tempering (PT) schemes and metadynamics (MetaD) to characterize the conformational free-energy surface of PrPC. The focus of the data analysis was on an 11-residue polypeptide segment in mouse PrPC(121–231) that includes the β2–α2 loop of residues 167–170, for which a correlation between structure and susceptibility to prion disease has previously been described. This study includes wild-type mouse PrPC and a variant with the single-residue replacement Y169A. The resulting detailed conformational landscapes complement in an integrative manner the available experimental data on PrPC, providing quantitative insights into the nature of the structural transition-related function of the β2–α2 loop. PMID:28827331

  9. Prion propagation in cells expressing PrP glycosylation mutants.

    Science.gov (United States)

    Salamat, Muhammad K; Dron, Michel; Chapuis, Jérôme; Langevin, Christelle; Laude, Hubert

    2011-04-01

    Infection by prions involves conversion of a host-encoded cell surface protein (PrP(C)) to a disease-related isoform (PrP(Sc)). PrP(C) carries two glycosylation sites variably occupied by complex N-glycans, which have been suggested by previous studies to influence the susceptibility to these diseases and to determine characteristics of prion strains. We used the Rov cell system, which is susceptible to sheep prions, to generate a series of PrP(C) glycosylation mutants with mutations at one or both attachment sites. We examined their subcellular trafficking and ability to convert into PrP(Sc) and to sustain stable prion propagation in the absence of wild-type PrP. The susceptibility to infection of mutants monoglycosylated at either site differed dramatically depending on the amino acid substitution. Aglycosylated double mutants showed overaccumulation in the Golgi compartment and failed to be infected. Introduction of an ectopic glycosylation site near the N terminus fully restored cell surface expression of PrP but not convertibility into PrP(Sc), while PrP(C) with three glycosylation sites conferred cell permissiveness to infection similarly to the wild type. In contrast, predominantly aglycosylated molecules with nonmutated N-glycosylation sequons, produced in cells expressing glycosylphosphatidylinositol-anchorless PrP(C), were able to form infectious PrP(Sc). Together our findings suggest that glycosylation is important for efficient trafficking of anchored PrP to the cell surface and sustained prion propagation. However, properly trafficked glycosylation mutants were not necessarily prone to conversion, thus making it difficult in such studies to discern whether the amino acid changes or glycan chain removal most influences the permissiveness to prion infection.

  10. Reduced response of splenocytes after mitogen-stimulation in the prion protein (PrP) gene-deficient mouse: PrPLP/Doppel production and cerebral degeneration

    International Nuclear Information System (INIS)

    Kim, Chi-Kyeong; Hirose, Yuko; Sakudo, Akikazu; Takeyama, Natsumi; Kang, Chung-Boo; Taniuchi, Yojiro; Matsumoto, Yoshitsugu; Itohara, Shigeyoshi; Sakaguchi, Suehiro; Onodera, Takashi

    2007-01-01

    Splenocytes of wild-type (Prnp +/+ ) and prion protein gene-deficient (Prnp -/- ) mice were treated with various activation stimuli such as T cell mitogen concanavalin A (ConA), phorbol 12-myristate 13-acetate (PMA) + ionomycin (Io), or B cell mitogen lipopolysaccharide (LPS). Cellular prion protein (PrP C ) expression was enhanced following ConA stimulation, but not PMA + Io or LPS in Prnp +/+ splenocytes. Rikn Prnp -/- splenocytes elicited lower cell proliferations than Prnp +/+ or Zrch I Prnp -/- splenocytes after LPS stimulation and showed sporadic nerve cells in the cerebral cortex and deeper structure. Around the degenerated nerve cells, mild vacuolation in the neuropil was observed. This neural alteration correlated well to the suppressed response of B cells in the spleen. The finding that discrete lesions within the central nervous systems induced marked modulation of immune function probably indicates the existence of a delicately balanced neural-endocrine network by PrP C and PrPLP/Doppel

  11. Prion potency in stem cells biology.

    Science.gov (United States)

    Lopes, Marilene H; Santos, Tiago G

    2012-01-01

    Prion protein (PrP) can be considered a pivotal molecule because it interacts with several partners to perform a diverse range of critical biological functions that might differ in embryonic and adult cells. In recent years, there have been major advances in elucidating the putative role of PrP in the basic biology of stem cells in many different systems. Here, we review the evidence indicating that PrP is a key molecule involved in driving different aspects of the potency of embryonic and tissue-specific stem cells in self-perpetuation and differentiation in many cell types. It has been shown that PrP is involved in stem cell self-renewal, controlling pluripotency gene expression, proliferation, and neural and cardiomyocyte differentiation. PrP also has essential roles in distinct processes that regulate tissue-specific stem cell biology in nervous and hematopoietic systems and during muscle regeneration. Results from our own investigations have shown that PrP is able to modulate self-renewal and proliferation in neural stem cells, processes that are enhanced by PrP interactions with stress inducible protein 1 (STI1). Thus, the available data reveal the influence of PrP in acting upon the maintenance of pluripotent status or the differentiation of stem cells from the early embryogenesis through adulthood.

  12. Ssb1 chaperone is a [PSI+] prion-curing factor.

    Science.gov (United States)

    Chacinska, A; Szczesniak, B; Kochneva-Pervukhova, N V; Kushnirov, V V; Ter-Avanesyan, M D; Boguta, M

    2001-04-01

    Yeast SUP7' or SUP11 nonsense suppressors have no phenotypic expression in strains deficient in the isopentenylation of A37 in tRNA. Here we show that such strains spontaneously produce cells with a nonsense suppressor phenotype which is related to the cytoplasmically inherited determinant and manifests all the key features of the [PSI+] prion. A screen of a multicopy yeast genomic library for genes that inactivate the [PSI+]-related suppressor phenotype resulted in the isolation of the SSB1 gene. Moreover, we demonstrate that multicopy plasmid encoding the Ssb1 chaperone cures cells of the [PSI+] prion.

  13. Prion diseases of the brain; Prionenerkrankung des Gehirns

    Energy Technology Data Exchange (ETDEWEB)

    Lutz, Kira; Urbach, Horst [Universitaetsklinik Freiburg (Germany). Klinik fuer Neuroradiologie

    2015-09-15

    The prion diseases of the brain, especially Creutzfeldt-Jakob disease, are rare fatal neurodegenerative disorders. A definitive CJD diagnosis is currently only possible by a brain biopsy or post mortem autopsy. The diagnosis of Creutzfeldt-Jakob disease is based on clinical signs, pathognomonic EEG, on typical MRI findings and the examination of the cerebrospinal fluid. Using the MRI the diagnosis Creutzfeldt-Jakob disease can be confirmed or excluded with high certainty. The MRI examination should contain diffusion-weighted and FLAIR imaging sequences. This review article provides an overview of the prion diseases of the brain with the corresponding imaging findings.

  14. Inactivation of Prions and Amyloid Seeds with Hypochlorous Acid.

    Directory of Open Access Journals (Sweden)

    Andrew G Hughson

    2016-09-01

    Full Text Available Hypochlorous acid (HOCl is produced naturally by neutrophils and other cells to kill conventional microbes in vivo. Synthetic preparations containing HOCl can also be effective as microbial disinfectants. Here we have tested whether HOCl can also inactivate prions and other self-propagating protein amyloid seeds. Prions are deadly pathogens that are notoriously difficult to inactivate, and standard microbial disinfection protocols are often inadequate. Recommended treatments for prion decontamination include strongly basic (pH ≥~12 sodium hypochlorite bleach, ≥1 N sodium hydroxide, and/or prolonged autoclaving. These treatments are damaging and/or unsuitable for many clinical, agricultural and environmental applications. We have tested the anti-prion activity of a weakly acidic aqueous formulation of HOCl (BrioHOCl that poses no apparent hazard to either users or many surfaces. For example, BrioHOCl can be applied directly to skin and mucous membranes and has been aerosolized to treat entire rooms without apparent deleterious effects. Here, we demonstrate that immersion in BrioHOCl can inactivate not only a range of target microbes, including spores of Bacillus subtilis, but also prions in tissue suspensions and on stainless steel. Real-time quaking-induced conversion (RT-QuIC assays showed that BrioHOCl treatments eliminated all detectable prion seeding activity of human Creutzfeldt-Jakob disease, bovine spongiform encephalopathy, cervine chronic wasting disease, sheep scrapie and hamster scrapie; these findings indicated reductions of ≥103- to 106-fold. Transgenic mouse bioassays showed that all detectable hamster-adapted scrapie infectivity in brain homogenates or on steel wires was eliminated, representing reductions of ≥~105.75-fold and >104-fold, respectively. Inactivation of RT-QuIC seeding activity correlated with free chlorine concentration and higher order aggregation or destruction of proteins generally, including prion

  15. Prions: Potential Threat to Mankind and Dental Implications

    Directory of Open Access Journals (Sweden)

    Ajay R Bhoosreddy

    2010-01-01

    Full Text Available Prion diseases are fatal, infectious, neurodegenerative disorders with special implications for infection control in the health care system. The causative agent is highly resistant to routine disinfection and sterilization processes and has been transmitted during health care interactions. Thus, it is important to use evidence gained through research and case reports to minimize risk of infection. There is no data suggesting that prions are transmitted easily during dental sittings but there remains a rare risk of such transmission if appropriate infection measures are not adhered to.

  16. Cellular gravity

    NARCIS (Netherlands)

    F.C. Gruau; J.T. Tromp (John)

    1999-01-01

    textabstractWe consider the problem of establishing gravity in cellular automata. In particular, when cellular automata states can be partitioned into empty, particle, and wall types, with the latter enclosing rectangular areas, we desire rules that will make the particles fall down and pile up on

  17. An early function of the adenoviral E1B 55 kDa protein is required for the nuclear relocalization of the cellular p53 protein in adenovirus-infected normal human cells

    International Nuclear Information System (INIS)

    Cardoso, F.M.; Kato, Sayuri E.M.; Huang Wenying; Flint, S. Jane; Gonzalez, Ramon A.

    2008-01-01

    It is well established that the human subgroup C adenovirus type 5 (Ad5) E1B 55 kDa protein can regulate the activity and concentration of the cellular tumor suppressor, p53. However, the contribution(s) of these functions of the E1B protein to viral reproduction remains unclear. To investigate this issue, we examined properties of p53 in normal human cells infected by E1B mutant viruses that display defective entry into the late phase or viral late mRNA export. The steady-state concentrations of p53 were significantly higher in cells infected by the E1B 55 kDa null mutant Hr6 or three mutants carrying small insertions in the E1B 55 kDa protein coding sequence than in Ad5-infected cells. Nevertheless, none of the mutants induced apoptosis in infected cells. Rather, the localization of p53 to E1B containing nuclear sites observed during infection by Ad5 was prevented by mutations that impair interaction of the E1B protein with p53 and/or with the E4 Orf6 protein. These results indicate that the E1B protein fulfills an early function that correlates efficient entry into the late phase with the localization of E1B and p53 in the nucleus of Ad5-infected normal human cells

  18. Prion Protein Gene Polymorphisms in Turkish Native Goat Breeds ...

    Indian Academy of Sciences (India)

    Navya

    In these diseases, a neuronal glycoprotein known as prion protein PrPC ... sheep or goats in Turkey, but the OIE (World Organisation for Animal Health) does not .... Turkish goat breeds was approximately 6.3%, which is a low starting point for ...

  19. Prion Protein Self Interactions; a gateway to novel therapeutic strategies?

    NARCIS (Netherlands)

    Rigter, A.; Langeveld, J.P.M.; Zijderveld, van F.G.; Bossers, A.

    2010-01-01

    Transmissible spongiform encephalopathies (TSEs) or prion diseases are fatal neurodegenerative disorders and include among others Creutzfeldt–Jakob disease in humans, bovine spongiform encephalopathy (BSE) in cattle, and scrapie in sheep. The central event in disease development in TSEs is the

  20. Prion protein degradation by lichens of the genus Cladonia

    Science.gov (United States)

    Bennett, James P.; Rodriguez, Cynthia M.; Johnson, Christopher J.

    2012-01-01

    It has recently been discovered that lichens contain a serine protease capable of degrading the pathogenic prion protein, the etiological agent of prion diseases such as sheep scrapie and cervid chronic wasting disease. Limited methods are available to degrade or inactivate prion disease agents, especially in the environment, and lichens or their serine protease could prove important for management of these diseases. Scant information is available regarding the presence or absence of the protease responsible for degrading prion protein (PrP) in lichen species and, in this study, we tested the hypothesis that PrP degradation activity in lichens is phylogenetically-based by testing 44 species of Cladonia lichens, a genus for which a significant portion of the phylogeny is well established. We categorized PrP degradation activity among the 44 species (high, moderate, low or none) and found that activity in Cladonia species did not correspond with phylogenetic position of the species. Degradation of PrP did correspond, however, with three classical taxonomic characters within the genus: species with brown apothecia, no usnic acid, and the presence of a cortex. Of the 44 species studied, 18 (41%) had either high or moderate PrP degradation activity, suggesting the protease may be frequent in this genus of lichens.

  1. Do prion protein gene polymorphisms induce apoptosis in non ...

    Indian Academy of Sciences (India)

    2016-01-15

    Jan 15, 2016 ... by polymerase chain reaction (PCR) using the following forward and reverse .... A P-value less than 0.05 were deemed to indicate ..... drome in PrP is required to generate a productive PrPSc-PrPC complex that leads to prion ...

  2. Variation in the prion protein sequence in Dutch goat breeds

    NARCIS (Netherlands)

    Windig, J.J.; Hoving, R.A.H.; Priem, J.; Bossers, A.; Keulen, van L.J.M.; Langeveld, J.P.M.

    2016-01-01

    Scrapie is a neurodegenerative disease occurring in goats and sheep. Several haplotypes of the prion protein increase resistance to scrapie infection and may be used in selective breeding to help eradicate scrapie. In this study, frequencies of the allelic variants of the PrP gene are determined

  3. Detection and diagnosis of prions, the causative agent for the ...

    African Journals Online (AJOL)

    The technique is also a sensitive tool for studying and uncovering the mechanism of potential drugs that can inhibit or slow down the spread of TSE infection. It will advance the frontiers on the study of the mode of infection and conversion of prions and has significantly already contributed to the new paradigm that has ...

  4. Co-existence of scrapie prion protein types 1 and 2 in sporadic Creutzfeldt-Jakob disease: its effect on the phenotype and prion-type characteristics

    NARCIS (Netherlands)

    Cali, I.; Castellani, R.; Alshekhlee, A.; Cohen, Y.; Blevins, J.; Yuan, J.; Langeveld, J.P.M.; Parchi, P.; Safar, J.G.; Zou, W.Q.; Gambetti, P.

    2009-01-01

    Five phenotypically distinct subtypes have been identified in sporadic Creutzfeldt-Jakob disease (sCJD), based on the methionine/valine polymorphic genotype of codon 129 of the prion protein (PrP) gene and the presence of either one of the two protease K-resistant scrapie prion protein (PrPSc) types

  5. Differential overexpression of SERPINA3 in human prion diseases.

    Science.gov (United States)

    Vanni, S; Moda, F; Zattoni, M; Bistaffa, E; De Cecco, E; Rossi, M; Giaccone, G; Tagliavini, F; Haïk, S; Deslys, J P; Zanusso, G; Ironside, J W; Ferrer, I; Kovacs, G G; Legname, G

    2017-11-15

    Prion diseases are fatal neurodegenerative disorders with sporadic, genetic or acquired etiologies. The molecular alterations leading to the onset and the spreading of these diseases are still unknown. In a previous work we identified a five-gene signature able to distinguish intracranially BSE-infected macaques from healthy ones, with SERPINA3 showing the most prominent dysregulation. We analyzed 128 suitable frontal cortex samples, from prion-affected patients (variant Creutzfeldt-Jakob disease (vCJD) n = 20, iatrogenic CJD (iCJD) n = 11, sporadic CJD (sCJD) n = 23, familial CJD (gCJD) n = 17, fatal familial insomnia (FFI) n = 9, Gerstmann-Sträussler-Scheinker syndrome (GSS)) n = 4), patients with Alzheimer disease (AD, n = 14) and age-matched controls (n = 30). Real Time-quantitative PCR was performed for SERPINA3 transcript, and ACTB, RPL19, GAPDH and B2M were used as reference genes. We report SERPINA3 to be strongly up-regulated in the brain of all human prion diseases, with only a mild up-regulation in AD. We show that this striking up-regulation, both at the mRNA and at the protein level, is present in all types of human prion diseases analyzed, although to a different extent for each specific disorder. Our data suggest that SERPINA3 may be involved in the pathogenesis and the progression of prion diseases, representing a valid tool for distinguishing different forms of these disorders in humans.

  6. Kosmotropic anions promote conversion of recombinant prion protein into a PrPSc-like misfolded form.

    Directory of Open Access Journals (Sweden)

    Rodrigo Diaz-Espinoza

    Full Text Available Prions are self-propagating proteins involved in transmissible spongiform encephalopaties in mammals. An aberrant conformation with amyloid-like features of a cell surface protein, termed prion protein (PrP, is thought to be the essential component of the infectious particle, though accessory co-factor molecules such as lipids and nucleotides may be involved. The cellular co-factors and environmental conditions implicated in PrP misfolding are not completely understood. To address this issue, several studies have been done inducing misfolding of recombinant PrP (recPrP into classical amyloid structures using partially denaturing conditions. In this work, we report that misfolding of recPrP into PrP(Sc-like aggregates can be induced by simply incubating the protein in the presence of kosmotropic salts at concentrations that are known to retain or increase the stability of the protein. We used a simple experimental reaction (protein, buffer and salts submitted to agitation/incubation cycles at physiological temperature and pH. The formation of protease resistant-recPrP was time and salt-concentration dependent and required the presence of kosmotropic anions such as F(- or SO(4(-2. The molecular weights of the protease resistant recPrP fragments are reminiscent of those found in degradation assays of bona fide PrP(Sc. The aggregates also exhibited PrP(Sc-like ultrastructural features including rod-shape morphology under electron microscope, high beta-sheet content and thioflavin-T positive signal. The formation of recPrP aggregates with PrP(Sc biochemical features under conditions closer to physiological in the absence of organic co-factor molecules provides a simple setup that may prove helpful to understand the molecular mechanism of PrP misfolding.

  7. Ionic mechanisms of action of prion protein fragment PrP(106-126) in rat basal forebrain neurons.

    Science.gov (United States)

    Alier, Kwai; Li, Zongming; Mactavish, David; Westaway, David; Jhamandas, Jack H

    2010-08-01

    Prion diseases are neurodegenerative disorders that are characterized by the presence of the misfolded prion protein (PrP). Neurotoxicity in these diseases may result from prion-induced modulation of ion channel function, changes in neuronal excitability, and consequent disruption of cellular homeostasis. We therefore examined PrP effects on a suite of potassium (K(+)) conductances that govern excitability of basal forebrain neurons. Our study examined the effects of a PrP fragment [PrP(106-126), 50 nM] on rat neurons using the patch clamp technique. In this paradigm, PrP(106-126) peptide, but not the "scrambled" sequence of PrP(106-126), evoked a reduction of whole-cell outward currents in a voltage range between -30 and +30 mV. Reduction of whole-cell outward currents was significantly attenuated in Ca(2+)-free external media and also in the presence of iberiotoxin, a blocker of calcium-activated potassium conductance. PrP(106-126) application also evoked a depression of the delayed rectifier (I(K)) and transient outward (I(A)) potassium currents. By using single cell RT-PCR, we identified the presence of two neuronal chemical phenotypes, GABAergic and cholinergic, in cells from which we recorded. Furthermore, cholinergic and GABAergic neurons were shown to express K(v)4.2 channels. Our data establish that the central region of PrP, defined by the PrP(106-126) peptide used at nanomolar concentrations, induces a reduction of specific K(+) channel conductances in basal forebrain neurons. These findings suggest novel links between PrP signalling partners inferred from genetic experiments, K(+) channels, and PrP-mediated neurotoxicity.

  8. Overexpression of PLK3 Mediates the Degradation of Abnormal Prion Proteins Dependent on Chaperone-Mediated Autophagy.

    Science.gov (United States)

    Wang, Hui; Tian, Chan; Sun, Jing; Chen, Li-Na; Lv, Yan; Yang, Xiao-Dong; Xiao, Kang; Wang, Jing; Chen, Cao; Shi, Qi; Shao, Qi-Xiang; Dong, Xiao-Ping

    2017-08-01

    Polo-like kinase 3 (PLK3) is the main cause of cell cycle reentry-related neuronal apoptosis which has been implicated in the pathogenesis of prion diseases. Previous work also showed the regulatory activity of exogenous PLK3 on the degradation of PrP (prion protein) mutants and pathogenic PrP Sc ; however, the precise mechanisms remain unknown. In this study, we identified that the overexpression of PLK3-mediated degradation of PrP mutant and PrP Sc was repressed by lysosome rather than by proteasomal and macroautophagy inhibitors. Core components of chaperone-mediated autophagy (CMA) effectors, lysosome-associated membrane protein type 2A (LAMP2a), and heat shock cognate protein 70 (Hsc70) are markedly decreased in the HEK293T cells expressing PrP mutant and scrapie-infected cell line SMB-S15. Meanwhile, PrP mutant showed ability to interact with LAMP2a and Hsc70. Overexpression of PLK3 sufficiently increased the cellular levels of LAMP2a and Hsc70, accompanying with declining the accumulations of PrP mutant and PrP Sc . The kinase domain (KD) of PLK3 was responsible for elevating LAMP2a and Hsc70. Knockdown of endogenous PLK3 enhanced the activity of macroautophagy in the cultured cells. Moreover, time-dependent reductions of LAMP2a and Hsc70 were also observed in the brain tissues of hamster-adapted scrapie agent 263K-infected hamsters, indicating an impairment of CMA during prion infection. Those data indicate that the overexpression of PLK3-mediated degradation of abnormal PrP is largely dependent on CMA pathway.

  9. Repetitive immunization enhances the susceptibility of mice to peripherally administered prions.

    Directory of Open Access Journals (Sweden)

    Juliane Bremer

    Full Text Available The susceptibility of humans and animals to prion infections is determined by the virulence of the infectious agent, by genetic modifiers, and by hitherto unknown host and environmental risk factors. While little is known about the latter two, the activation state of the immune system was surmised to influence prion susceptibility. Here we administered prions to mice that were repeatedly immunized by two initial injections of CpG oligodeoxynucleotides followed by repeated injections of bovine serum albumin/alum. Immunization greatly reduced the required dosage of peripherally administered prion inoculum necessary to induce scrapie in 50% of mice. No difference in susceptibility was observed following intracerebral prion challenge. Due to its profound impact onto scrapie susceptibility, the host immune status may determine disease penetrance after low-dose prion exposure, including those that may give rise to iatrogenic and variant Creutzfeldt-Jakob disease.

  10. Clinically Unsuspected Prion Disease Among Patients With Dementia Diagnoses in an Alzheimer's Disease Database.

    Science.gov (United States)

    Maddox, Ryan A; Blase, J L; Mercaldo, N D; Harvey, A R; Schonberger, L B; Kukull, W A; Belay, E D

    2015-12-01

    Brain tissue analysis is necessary to confirm prion diseases. Clinically unsuspected cases may be identified through neuropathologic testing. National Alzheimer's Coordinating Center (NACC) Minimum and Neuropathologic Data Set for 1984 to 2005 were reviewed. Eligible patients had dementia, underwent autopsy, had available neuropathologic data, belonged to a currently funded Alzheimer's Disease Center (ADC), and were coded as having an Alzheimer's disease clinical diagnosis or a nonprion disease etiology. For the eligible patients with neuropathology indicating prion disease, further clinical information, collected from the reporting ADC, determined whether prion disease was considered before autopsy. Of 6000 eligible patients in the NACC database, 7 (0.12%) were clinically unsuspected but autopsy-confirmed prion disease cases. The proportion of patients with dementia with clinically unrecognized but autopsy-confirmed prion disease was small. Besides confirming clinically suspected cases, neuropathology is useful to identify unsuspected clinically atypical cases of prion disease. © The Author(s) 2015.

  11. Destabilization and recovery of a yeast prion after mild heat shock.

    Science.gov (United States)

    Newnam, Gary P; Birchmore, Jennifer L; Chernoff, Yury O

    2011-05-06

    Yeast prion [PSI(+)] is a self-perpetuating amyloid of the translational termination factor Sup35. Although [PSI(+)] propagation is modulated by heat shock proteins (Hsps), high temperature was previously reported to have little or no effect on [PSI(+)]. Our results show that short-term exposure of exponentially growing yeast culture to mild heat shock, followed by immediate resumption of growth, leads to [PSI(+)] destabilization, sometimes persisting for several cell divisions after heat shock. Prion loss occurring in the first division after heat shock is preferentially detected in a daughter cell, indicating the impairment of prion segregation that results in asymmetric prion distribution between a mother cell and a bud. Longer heat shock or prolonged incubation in the absence of nutrients after heat shock led to [PSI(+)] recovery. Both prion destabilization and recovery during heat shock depend on protein synthesis. Maximal prion destabilization coincides with maximal imbalance between Hsp104 and other Hsps such as Hsp70-Ssa. Deletions of individual SSA genes increase prion destabilization and/or counteract recovery. The dynamics of prion aggregation during destabilization and recovery are consistent with the notion that efficient prion fragmentation and segregation require a proper balance between Hsp104 and other (e.g., Hsp70-Ssa) chaperones. In contrast to heat shock, [PSI(+)] destabilization by osmotic stressors does not always depend on cell proliferation and/or protein synthesis, indicating that different stresses may impact the prion via different mechanisms. Our data demonstrate that heat stress causes asymmetric prion distribution in a cell division and confirm that the effects of Hsps on prions are physiologically relevant. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Cellular MR Imaging

    Directory of Open Access Journals (Sweden)

    Michel Modo

    2005-07-01

    Full Text Available Cellular MR imaging is a young field that aims to visualize targeted cells in living organisms. In order to provide a different signal intensity of the targeted cell, they are either labeled with MR contrast agents in vivo or prelabeled in vitro. Either (ultrasmall superparamagnetic iron oxide [(USPIO] particles or (polymeric paramagnetic chelates can be used for this purpose. For in vivo cellular labeling, Gd3+- and Mn2+- chelates have mainly been used for targeted hepatobiliary imaging, and (USPIO-based cellular imaging has been focused on imaging of macrophage activity. Several of these magneto-pharmaceuticals have been FDA-approved or are in late-phase clinical trials. As for prelabeling of cells in vitro, a challenge has been to induce a sufficient uptake of contrast agents into nonphagocytic cells, without affecting normal cellular function. It appears that this issue has now largely been resolved, leading to an active research on monitoring the cellular biodistribution in vivo following transplantation or transfusion of these cells, including cell migration and trafficking. New applications of cellular MR imaging will be directed, for instance, towards our understanding of hematopoietic (immune cell trafficking and of novel guided (stem cell-based therapies aimed to be translated to the clinic in the future.

  13. A bovine cell line that can be infected by natural sheep scrapie prions.

    Directory of Open Access Journals (Sweden)

    Anja M Oelschlegel

    Full Text Available Cell culture systems represent a crucial part in basic prion research; yet, cell lines that are susceptible to prions, especially to field isolated prions that were not adapted to rodents, are very rare. The purpose of this study was to identify and characterize a cell line that was susceptible to ruminant-derived prions and to establish a stable prion infection within it. Based on species and tissue of origin as well as PrP expression rate, we pre-selected a total of 33 cell lines that were then challenged with natural and with mouse propagated BSE or scrapie inocula. Here, we report the successful infection of a non-transgenic bovine cell line, a sub-line of the bovine kidney cell line MDBK, with natural sheep scrapie prions. This cell line retained the scrapie infection for more than 200 passages. Selective cloning resulted in cell populations with increased accumulation of PrPres, although this treatment was not mandatory for retaining the infection. The infection remained stable, even under suboptimal culture conditions. The resulting infectivity of the cells was confirmed by mouse bioassay (Tgbov mice, Tgshp mice. We believe that PES cells used together with other prion permissive cell lines will prove a valuable tool for ongoing efforts to understand and defeat prions and prion diseases.

  14. Hsp40 function in yeast prion propagation: Amyloid diversity necessitates chaperone functional complexity.

    Science.gov (United States)

    Sporn, Zachary A; Hines, Justin K

    2015-01-01

    Yeast prions are heritable protein-based elements, most of which are formed of amyloid aggregates that rely on the action of molecular chaperones for transmission to progeny. Prions can form distinct amyloid structures, known as 'strains' in mammalian systems, that dictate both pathological progression and cross-species infection barriers. In yeast these same amyloid structural polymorphisms, called 'variants', dictate the intensity of prion-associated phenotypes and stability in mitosis. We recently reported that [PSI(+)] prion variants differ in the fundamental domain requirements for one chaperone, the Hsp40/J-protein Sis1, which are mutually exclusive between 2 different yeast prions, demonstrating a functional plurality for Sis1. Here we extend that analysis to incorporate additional data that collectively support the hypothesis that Sis1 has multiple functional roles that can be accomplished by distinct sets of domains. These functions are differentially required by distinct prions and prion variants. We also present new data regarding Hsp104-mediated prion elimination and show that some Sis1 functions, but not all, are conserved in the human homolog Hdj1/DNAJB1. Importantly, of the 10 amyloid-based prions indentified to date in Saccharomyces cerevisiae, the chaperone requirements of only 4 are known, leaving a great diversity of amyloid structures, and likely modes of amyloid-chaperone interaction, largely unexplored.

  15. Inactivation of animal and human prions by hydrogen peroxide gas plasma sterilization.

    Science.gov (United States)

    Rogez-Kreuz, C; Yousfi, R; Soufflet, C; Quadrio, I; Yan, Z-X; Huyot, V; Aubenque, C; Destrez, P; Roth, K; Roberts, C; Favero, M; Clayette, P

    2009-08-01

    Prions cause various transmissible spongiform encephalopathies. They are highly resistant to the chemical and physical decontamination and sterilization procedures routinely used in healthcare facilities. The decontamination procedures recommended for the inactivation of prions are often incompatible with the materials used in medical devices. In this study, we evaluated the use of low-temperature hydrogen peroxide gas plasma sterilization systems and other instrument-processing procedures for inactivating human and animal prions. We provide new data concerning the efficacy of hydrogen peroxide against prions from in vitro or in vivo tests, focusing on the following: the efficiency of hydrogen peroxide sterilization and possible interactions with enzymatic or alkaline detergents, differences in the efficiency of this treatment against different prion strains, and the influence of contaminating lipids. We found that gaseous hydrogen peroxide decreased the infectivity of prions and/or the level of the protease-resistant form of the prion protein on different surface materials. However, the efficiency of this treatment depended strongly on the concentration of hydrogen peroxide and the delivery system used in medical devices, because these effects were more pronounced for the new generation of Sterrad technology. The Sterrad NX sterilizer is 100% efficient (0% transmission and no protease-resistant form of the prion protein signal detected on the surface of the material for the mouse-adapted bovine spongiform encephalopathy 6PB1 strain and a variant Creutzfeldt-Jakob disease strain). Thus, gaseous or vaporized hydrogen peroxide efficiently inactivates prions on the surfaces of medical devices.

  16. Removal process of prion and parvovirus from human platelet lysates used as clinical-grade supplement for ex vivo cell expansion.

    Science.gov (United States)

    Kao, Yu-Chun; Bailey, Andy; Samminger, Bernhard; Tanimoto, Junji; Burnouf, Thierry

    2016-07-01

    Pooled human platelet lysate (HPL) is becoming the new gold standard as supplement for ex vivo cell culture for clinical protocols. However, the risk of pathogen contamination of HPL increases with the platelet pool size. We hypothesized that hollow fiber anion exchange membrane chromatography using QyuSpeed D (QSD) could remove resistant and untested bloodborne pathogens, such as parvoviruses and prions, from HPL-supplemented growth media without substantially affecting their capacity to support ex vivo cell expansion. Frozen or thawed platelet concentrates were serum-converted and centrifuged for obtaining HPL that was added to various growth media (ca. 100 mL), filtered through a 0.6-mL QSD membrane and characterized for proteins, growth factors and chemical composition. Capacity to expand Chinese hamster ovary, periodontal ligament, gingival fibroblast cells and Wharton's jelly mesenchymal stromal cells was studied. Removal of porcine parvovirus (PPV) and of the 263K prion strain of hamster-adapted scrapie was studied by spiking experiments following international guidelines. QSD had minimal impact on HPL-supplemented medium composition in proteins, growth factors and chemical content, nor capacity to expand and differentiate cells. In addition, QSD could remove ≥5.58 log10 [TCID50/mL] and ≥3.72 log10 of PPV and the 263K prion, respectively. QSD hollow fiber chromatography can be used to improve the virus and prion safety of HPL-supplemented media to safely expand cells for clinical protocols. These data bring new perspectives for increasingly safer use of pooled HPL in cell therapy and regenerative medicine applications. Copyright © 2016 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  17. The prion-ZIP connection: From cousins to partners in iron uptake

    Science.gov (United States)

    Singh, Neena; Asthana, Abhishek; Baksi, Shounak; Desai, Vilok; Haldar, Swati; Hari, Sahi; Tripathi, Ajai K

    2015-01-01

    ABSTRACT Converging observations from disparate lines of inquiry are beginning to clarify the cause of brain iron dyshomeostasis in sporadic Creutzfeldt-Jakob disease (sCJD), a neurodegenerative condition associated with the conversion of prion protein (PrPC), a plasma membrane glycoprotein, from α-helical to a β-sheet rich PrP-scrapie (PrPSc) isoform. Biochemical evidence indicates that PrPC facilitates cellular iron uptake by functioning as a membrane-bound ferrireductase (FR), an activity necessary for the transport of iron across biological membranes through metal transporters. An entirely different experimental approach reveals an evolutionary link between PrPC and the Zrt, Irt-like protein (ZIP) family, a group of proteins involved in the transport of zinc, iron, and manganese across the plasma membrane. Close physical proximity of PrPC with certain members of the ZIP family on the plasma membrane and increased uptake of extracellular iron by cells that co-express PrPC and ZIP14 suggest that PrPC functions as a FR partner for certain members of this family. The connection between PrPC and ZIP proteins therefore extends beyond common ancestry to that of functional cooperation. Here, we summarize evidence supporting the facilitative role of PrPC in cellular iron uptake, and implications of this activity on iron metabolism in sCJD brains. PMID:26689487

  18. The roles of the conserved tyrosine in the β2-α2 loop of the prion protein.

    Science.gov (United States)

    Huang, Danzhi; Caflisch, Amedeo

    2015-01-01

    Prions cause neurodegenerative diseases for which no cure exists. Despite decades of research activities the function of the prion protein (PrP) in mammalians is not known. Moreover, little is known on the molecular mechanisms of the self-assembly of the PrP from its monomeric state (cellular PrP, PrP(C)) to the multimeric state. The latter state includes the toxic species (scrapie PrP, PrP(Sc)) knowledge of which would facilitate the development of drugs against prion diseases. Here we analyze the role of a tyrosine residue (Y169) which is strictly conserved in mammalian PrPs. Nuclear magnetic resonance (NMR) spectroscopy studies of many mammalian PrP(C) proteins have provided evidence of a conformational equilibrium between a 3(10)-helical turn and a type I β turn conformation in the β2-α2 loop (residues 165-175). In vitro cell-free experiments of the seeded conversion of PrP(C) indicate that non-aromatic residues at position 169 reduce the formation of proteinase K-resistant PrP. Recent molecular dynamics (MD) simulations of monomeric PrP and several single-point mutants show that Y169 stabilizes the 3(10)-helical turn conformation more than single-point mutants at position 169 or residues in contact with it. In the 3(10)-helical turn conformation the hydrophobic and aggregation-prone segment 169-YSNQNNF-175 is buried and thus not-available for self-assembly. From the combined analysis of simulation and experimental results it emerges that Y169 is an aggregation gatekeeper with a twofold role. Mutations related to 3 human prion diseases are interpreted on the basis of the gatekeeper role in the monomeric state. Another potential role of the Y169 side chain is the stabilization of the ordered aggregates, i.e., reduction of frangibility of filamentous protofibrils and fibrils, which is likely to reduce the generation of toxic species.

  19. Estimating Prion Adsorption Capacity of Soil by BioAssay of Subtracted Infectivity from Complex Solutions (BASICS)

    Science.gov (United States)

    Wyckoff, A. Christy; Lockwood, Krista L.; Meyerett-Reid, Crystal; Michel, Brady A.; Bender, Heather; VerCauteren, Kurt C.; Zabel, Mark D.

    2013-01-01

    Prions, the infectious agent of scrapie, chronic wasting disease and other transmissible spongiform encephalopathies, are misfolded proteins that are highly stable and resistant to degradation. Prions are known to associate with clay and other soil components, enhancing their persistence and surprisingly, transmissibility. Currently, few detection and quantification methods exist for prions in soil, hindering an understanding of prion persistence and infectivity in the environment. Variability in apparent infectious titers of prions when bound to soil has complicated attempts to quantify the binding capacity of soil for prion infectivity. Here, we quantify the prion adsorption capacity of whole, sandy loam soil (SLS) typically found in CWD endemic areas in Colorado; and purified montmorillonite clay (Mte), previously shown to bind prions, by BioAssay of Subtracted Infectivity in Complex Solutions (BASICS). We incubated prion positive 10% brain homogenate from terminally sick mice infected with the Rocky Mountain Lab strain of mouse-adapted prions (RML) with 10% SLS or Mte. After 24 hours samples were centrifuged five minutes at 200×g and soil-free supernatant was intracerebrally inoculated into prion susceptible indicator mice. We used the number of days post inoculation to clinical disease to calculate the infectious titer remaining in the supernatant, which we subtracted from the starting titer to determine the infectious prion binding capacity of SLS and Mte. BASICS indicated SLS bound and removed ≥ 95% of infectivity. Mte bound and removed lethal doses (99.98%) of prions from inocula, effectively preventing disease in the mice. Our data reveal significant prion-binding capacity of soil and the utility of BASICS to estimate prion loads and investigate persistence and decomposition in the environment. Additionally, since Mte successfully rescued the mice from prion disease, Mte might be used for remediation and decontamination protocols. PMID:23484043

  20. Pathways of Prion Spread during Early Chronic Wasting Disease in Deer.

    Science.gov (United States)

    Hoover, Clare E; Davenport, Kristen A; Henderson, Davin M; Denkers, Nathaniel D; Mathiason, Candace K; Soto, Claudio; Zabel, Mark D; Hoover, Edward A

    2017-05-15

    Among prion infections, two scenarios of prion spread are generally observed: (i) early lymphoid tissue replication or (ii) direct neuroinvasion without substantial antecedent lymphoid amplification. In nature, cervids are infected with chronic wasting disease (CWD) prions by oral and nasal mucosal exposure, and studies of early CWD pathogenesis have implicated pharyngeal lymphoid tissue as the earliest sites of prion accumulation. However, knowledge of chronological events in prion spread during early infection remains incomplete. To investigate this knowledge gap in early CWD pathogenesis, we exposed white-tailed deer to CWD prions by mucosal routes and performed serial necropsies to assess PrP CWD tissue distribution by real-time quaking-induced conversion (RT-QuIC) and tyramide signal amplification immunohistochemistry (TSA-IHC). Although PrP CWD was not detected by either method in the initial days (1 and 3) postexposure, we observed PrP CWD seeding activity and follicular immunoreactivity in oropharyngeal lymphoid tissues at 1 and 2 months postexposure (MPE). At 3 MPE, PrP CWD replication had expanded to all systemic lymphoid tissues. By 4 MPE, the PrP CWD burden in all lymphoid tissues had increased and approached levels observed in terminal disease, yet there was no evidence of nervous system invasion. These results indicate the first site of CWD prion entry is in the oropharynx, and the initial phase of prion amplification occurs in the oropharyngeal lymphoid tissues followed by rapid dissemination to systemic lymphoid tissues. This lymphoid replication phase appears to precede neuroinvasion. IMPORTANCE Chronic wasting disease (CWD) is a universally fatal transmissible spongiform encephalopathy affecting cervids, and natural infection occurs through oral and nasal mucosal exposure to infectious prions. Terminal disease is characterized by PrP CWD accumulation in the brain and lymphoid tissues of affected animals. However, the initial sites of prion

  1. Regulation of the Hsp104 middle domain activity is critical for yeast prion propagation.

    Directory of Open Access Journals (Sweden)

    Jennifer E Dulle

    Full Text Available Molecular chaperones play a significant role in preventing protein misfolding and aggregation. Indeed, some protein conformational disorders have been linked to changes in the chaperone network. Curiously, in yeast, chaperones also play a role in promoting prion maintenance and propagation. While many amyloidogenic proteins are associated with disease in mammals, yeast prion proteins, and their ability to undergo conformational conversion into a prion state, are proposed to play a functional role in yeast biology. The chaperone Hsp104, a AAA+ ATPase, is essential for yeast prion propagation. Hsp104 fragments large prion aggregates to generate a population of smaller oligomers that can more readily convert soluble monomer and be transmitted to daughter cells. Here, we show that the middle (M domain of Hsp104, and its mobility, plays an integral part in prion propagation. We generated and characterized mutations in the M-domain of Hsp104 that are predicted to stabilize either a repressed or de-repressed conformation of the M-domain (by analogy to ClpB in bacteria. We show that the predicted stabilization of the repressed conformation inhibits general chaperone activity. Mutation to the de-repressed conformation, however, has differential effects on ATP hydrolysis and disaggregation, suggesting that the M-domain is involved in coupling these two activities. Interestingly, we show that changes in the M-domain differentially affect the propagation of different variants of the [PSI+] and [RNQ+] prions, which indicates that some prion variants are more sensitive to changes in the M-domain mobility than others. Thus, we provide evidence that regulation of the M-domain of Hsp104 is critical for efficient prion propagation. This shows the importance of elucidating the function of the M-domain in order to understand the role of Hsp104 in the propagation of different prions and prion variants.

  2. Co-existence of Distinct Prion Types Enables Conformational Evolution of Human PrPSc by Competitive Selection

    NARCIS (Netherlands)

    Haldiman, T.; Kim, C.; Cohen, Y.; Chen, W.; Blevins, J.; Qing, L.; Cohen, M.L.; Langeveld, J.P.M.; Telling, G.C.; Kong, Q.; Safar, J.G.

    2013-01-01

    The unique phenotypic characteristics of mammalian prions are thought to be encoded in the conformation of pathogenic prion proteins (PrPSc). The molecular mechanism responsible for the adaptation, mutation, and evolution of prions observed in cloned cells and upon crossing the species barrier

  3. Adult human microglia secrete cytokines when exposed to neurotoxic prion protein peptide: no intermediary role for prostaglandin E2

    NARCIS (Netherlands)

    Veerhuis, Robert; Hoozemans, Jeroen J. M.; Janssen, Ingrid; Boshuizen, Ronald S.; Langeveld, Jan P. M.; Eikelenboom, Piet

    2002-01-01

    Prion diseases are characterized by accumulation of protease resistant isoforms of prion protein (termed PrP(SC)), glial activation and neurodegeneration. The time course of PrP deposition, appearance of activated microglia, and of neuronal apoptosis in experimentally-induced prion disease suggests

  4. Ovine leukocyte profiles do not associate with variation in the prion gene, but are breed-dependent

    Science.gov (United States)

    Prion genotype in sheep confer resistance to scrapie. In cattle, lymphocyte profile has been found to be associated with prion genotype. Therefore, the aim of this study was to determine if variations in the sheep prion gene were associated with leukocyte populations as measured by complete blood ce...

  5. Signal Transduction by a Fungal NOD-Like Receptor Based on Propagation of a Prion Amyloid Fold

    NARCIS (Netherlands)

    Daskalov, A.; Habenstein, B.; Martinez, D.; Debets, A.J.M.; Sabate, R.; Loquet, A.; Saupe, S.J.

    2015-01-01

    In the fungus Podospora anserina, the [Het-s] prion induces programmed cell death by activating the HET-S pore-forming protein. The HET-s ß-solenoid prion fold serves as a template for converting the HET-S prion-forming domain into the same fold. This conversion, in turn, activates the HET-S

  6. Mountain lions prey selectively on prion-infected mule deer

    OpenAIRE

    Krumm, Caroline E.; Conner, Mary M.; Hobbs, N. Thompson; Hunter, Don O.; Miller, Michael W.

    2009-01-01

    The possibility that predators choose prey selectively based on age or condition has been suggested but rarely tested. We examined whether mountain lions (Puma concolor) selectively prey upon mule deer (Odocoileus hemionus) infected with chronic wasting disease, a prion disease. We located kill sites of mountain lions in the northern Front Range of Colorado, USA, and compared disease prevalence among lion-killed adult (?2 years old) deer with prevalence among sympatric deer taken by hunters i...

  7. Squalestatin alters the intracellular trafficking of a neurotoxic prion peptide

    Directory of Open Access Journals (Sweden)

    Williams Alun

    2007-11-01

    Full Text Available Abstract Background Neurotoxic peptides derived from the protease-resistant core of the prion protein are used to model the pathogenesis of prion diseases. The current study characterised the ingestion, internalization and intracellular trafficking of a neurotoxic peptide containing amino acids 105–132 of the murine prion protein (MoPrP105-132 in neuroblastoma cells and primary cortical neurons. Results Fluorescence microscopy and cell fractionation techniques showed that MoPrP105-132 co-localised with lipid raft markers (cholera toxin and caveolin-1 and trafficked intracellularly within lipid rafts. This trafficking followed a non-classical endosomal pathway delivering peptide to the Golgi and ER, avoiding classical endosomal trafficking via early endosomes to lysosomes. Fluorescence resonance energy transfer analysis demonstrated close interactions of MoPrP105-132 with cytoplasmic phospholipase A2 (cPLA2 and cyclo-oxygenase-1 (COX-1, enzymes implicated in the neurotoxicity of prions. Treatment with squalestatin reduced neuronal cholesterol levels and caused the redistribution of MoPrP105-132 out of lipid rafts. In squalestatin-treated cells, MoPrP105-132 was rerouted away from the Golgi/ER into degradative lysosomes. Squalestatin treatment also reduced the association between MoPrP105-132 and cPLA2/COX-1. Conclusion As the observed shift in peptide trafficking was accompanied by increased cell survival these studies suggest that the neurotoxicity of this PrP peptide is dependent on trafficking to specific organelles where it activates specific signal transduction pathways.

  8. Cellular metabolism

    International Nuclear Information System (INIS)

    Hildebrand, C.E.; Walters, R.A.

    1977-01-01

    Progress is reported on the following research projects: chromatin structure; the use of circular synthetic polydeoxynucleotides as substrates for the study of DNA repair enzymes; human cellular kinetic response following exposure to DNA-interactive compounds; histone phosphorylation and chromatin structure in cell proliferation; photoaddition products induced in chromatin by uv light; pollutants and genetic information transfer; altered RNA metabolism as a function of cadmium accumulation and intracellular distribution in cultured cells; and thymidylate chromophore destruction by water free radicals

  9. Structural determinants of phenotypic diversity and replication rate of human prions.

    Directory of Open Access Journals (Sweden)

    Jiri G Safar

    2015-04-01

    Full Text Available The infectious pathogen responsible for prion diseases is the misfolded, aggregated form of the prion protein, PrPSc. In contrast to recent progress in studies of laboratory rodent-adapted prions, current understanding of the molecular basis of human prion diseases and, especially, their vast phenotypic diversity is very limited. Here, we have purified proteinase resistant PrPSc aggregates from two major phenotypes of sporadic Creutzfeldt-Jakob disease (sCJD, determined their conformational stability and replication tempo in vitro, as well as characterized structural organization using recently emerged approaches based on hydrogen/deuterium (H/D exchange coupled with mass spectrometry. Our data clearly demonstrate that these phenotypically distant prions differ in a major way with regard to their structural organization, both at the level of the polypeptide backbone (as indicated by backbone amide H/D exchange data as well as the quaternary packing arrangements (as indicated by H/D exchange kinetics for histidine side chains. Furthermore, these data indicate that, in contrast to previous observations on yeast and some murine prion strains, the replication rate of sCJD prions is primarily determined not by conformational stability but by specific structural features that control the growth rate of prion protein aggregates.

  10. Medulla oblongata transcriptome changes during presymptomatic natural scrapie and their associaition with prion-related lesions.

    NARCIS (Netherlands)

    Filali, H.; Martin-Burriel, I.; Harders, F.; Varona, L.; Serrano, C.; Acín, C.; Badiola, J.J.; Bossers, A.; Bolea, R.

    2012-01-01

    Background The pathogenesis of natural scrapie and other prion diseases is still poorly understood. Determining the variations in the transcriptome in the early phases of the disease might clarify some of the molecular mechanisms of the prion-induced pathology and allow for the development of new