WorldWideScience

Sample records for nootka lupine vein-clearing

  1. The nootka and sandwich vocabularies in the relación de la entrada de san lorenzo de nutka

    NARCIS (Netherlands)

    Fernández Rodríguez, R.

    2013-01-01

    Nootka is an historical fur-trading centre in Yuquot, on the west coast of Vancouver Island, British Columbia, Canada. In 1788, the Spanish king Charles III sent an expedition to Nootka commanded by Ignacio Arteaga (1731-1783). A year later, Spain established a military post, San Lorenzo de Nutka,

  2. Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene

    NARCIS (Netherlands)

    Beekwilder, M.J.; Houwelingen, van A.M.M.L.; Cankar, K.; Dijk, van A.D.J.; Jong, de R.; Stoopen, G.M.; Bouwmeester, H.J.; Achkar, J.; Sonke, Th.; Bosch, H.J.

    2014-01-01

    Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most

  3. Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

    Science.gov (United States)

    Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

    2014-02-01

    Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Molecular strategies towards anthracnose resistance in lupin

    OpenAIRE

    2008-01-01

    The aim of the project was to develop a strategy towards anthracnose resistance in lupin using molecular techniques. Colletotrichum species are considered to be major plant pathogens of cereals and legumes around the world, causing significant crop losses. Colletotrichum acutatum causes anthracnose disease on lupin. Sweet white lupin (Lupinus albus) is a high protein grain crop that could alleviate protein shortage in South Africa, since it has the highest protein levels (34-45%) compared to ...

  5. Functionality-driven fractionation of lupin seeds

    NARCIS (Netherlands)

    Berghout, J.A.M.

    2015-01-01

    Functionality-driven fractionation of lupin seeds

    The growth in the world population requires an increase in the production of protein-rich foods from plant-based materials. Lupin seeds have potential to become a novel plant protein source for food products because they are rich

  6. Sensitization to lupine flour: is it clinically relevant?

    NARCIS (Netherlands)

    de Jong, N. W.; van Maaren, M. S.; Vlieg-Boersta, B. J.; Dubois, A. E. J.; de Groot, H.; Gerth van Wijk, R.

    2010-01-01

    Lupinus angustifolius (blue lupine) is used for human and animal consumption. Currently, the lupine content in bread varies from 0% to 10% and from 0.5% to 3% in pastry. Although lupine flour is present in many products, anaphylaxis on lupine flour is rarely seen. The aim of our study was to

  7. Sensitization to lupine flour : is it clinically relevant?

    NARCIS (Netherlands)

    de Jong, N. W.; van Maaren, M. S.; Vlieg-Boersta, B. J.; Dubois, A. E. J.; de Groot, H.; van Wijk, R. Gerth

    2010-01-01

    Background Lupinus angustifolius (blue lupine) is used for human and animal consumption. Currently, the lupine content in bread varies from 0% to 10% and from 0.5% to 3% in pastry. Although lupine flour is present in many products, anaphylaxis on lupine flour is rarely seen. Objective The aim of our

  8. Patogenic fungi associated with blue lupine seeds

    Directory of Open Access Journals (Sweden)

    Bogdan Nowicki

    2013-12-01

    Full Text Available Over 10% ofseeds harvested in 1991 and 1992 (50 samples, 400 seeds in each sample proved to be infested with various fungi. Fusarium spp. and Botrytis cinerea were the most common pathogens isolated. Fusarium avenaceum was the most common and highIy pathogenic species. Fusarium semitectum and F. tricinctum were highly pathogenic to lupin seedlings but they were the least common Fusarium isolated from seeds. Similarily, Sclerotinia sclerotiorum was isolated only from 0,2% seeds tested but this fungus was highly pathogenic to lupin seedlings. Some other fungi know as lupin pathogens (F. oxysporum, Stemphylium botryosum, Pleiochaeta setosa and Phomopsis leptostromiformis were also noted in tested seeds.

  9. WRKY71 and TGA1a physically interact and synergistically regulate the activity of a novel promoter isolated from Petunia vein-clearing virus.

    Science.gov (United States)

    Shrestha, Ankita; Khan, Ahamed; Mishra, Dipti Ranjan; Bhuyan, Kashyap; Sahoo, Bhabani; Maiti, Indu B; Dey, Nrisingha

    2018-02-01

    Caulimoviral promoters have become excellent tools for efficient transgene expression in plants. However, the transcriptional framework controlling their systematic regulation is poorly understood. To understand this regulatory mechanism, we extensively studied a novel caulimoviral promoter, PV8 (-163 to +138, 301 bp), isolated from Petunia vein-clearing virus (PVCV). PVCV was found to be Salicylic acid (SA)-inducible and 2.5-3.0 times stronger than the widely used CaMV35S promoter. In silico analysis of the PV8 sequence revealed a unique clustering of two stress-responsive cis-elements, namely, as-1 1 and W-box 1-2 , located within a span of 31 bp (-74 to -47) that bound to the TGA1a and WRKY71 plant transcription factors (TFs), respectively. We found that as-1 (TTACG) and W-box (TGAC) elements occupied both TGA1a and WRKY71 on the PV8 backbone. Mutational studies demonstrated that the combinatorial influence of as-1 (-57) and W-box 1-2 (-74 and -47) on the PV8 promoter sequence largely modulated its activity. TGA1a and WRKY71 physically interacted and cooperatively enhanced the transcriptional activity of the PV8 promoter. Biotic stress stimuli induced PV8 promoter activity by ~1.5 times. We also established the possible pathogen-elicitor function of AtWRKY71 and NtabWRKY71 TFs. Altogether, this study elucidates the interplay between TFs, biotic stress and caulimoviral promoter function. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Permafrost at Lupin. Interpretation of SAMPO electromagnetic soundings at Lupin

    International Nuclear Information System (INIS)

    Paananen, M.; Ruskeeniemi, T.

    2003-01-01

    The Permafrost Project at the Lupin Mine in northern Canada is an international project, aiming to improve the understanding of behaviour and processes of crystalline bedrock under permafrost conditions. As a part of this project, the Geological Survey of Finland carried out electromagnetic SAMPO soundings in the vicinity of the mine between 11th and 23rd of June 2002 in order to give additional information on the permafrost depth, the location and electrical characteristics of fracture zones and possible talik structures. The total number of sounding points was 214, forming 17 separate survey lines. Used coil separation was 100 - 800 m. According to the temperature data from Lupin Mine, the base of the permafrost is at the depth of 540 m. However, there is no information about the depth distribution outside the mine. The starting point of this survey was the possible existence of a saline water horizon below the permafrost, resulting from repeated segregation and enrichment of salts in front of advancing freezing front. The main result of the survey was a deep conductor, observed at numerous sounding points irrespectively of the measurement configuration. These sounding anomalies form a subhorizontal layer at the depths between 400 and 700 m, in contrast to the vertical orientation of the geological units in the area. According to the results, the conductor gets weaker or deeper close to the Lake Contwoyto and seems to be absent below the lake. There also seems to be a lithological control, since the conducting layer is not observed in granodiorite. It is assumed that the conducting layer represents saline or brackish waters at the base of the permafrost; their calculated TDS-values are in a realistic range for such waters (5000-30 000 mg/l). The subvertical fracture zone VI, previously interpreted from the seismic survey, could be observed as a slight decrease in resistivity in 3 survey profiles using a coil separation of 100 m. (orig.)

  11. Permafrost at Lupin. Interpretation of SAMPO electromagnetic soundings at Lupin

    Energy Technology Data Exchange (ETDEWEB)

    Paananen, M.; Ruskeeniemi, T

    2003-07-01

    The Permafrost Project at the Lupin Mine in northern Canada is an international project, aiming to improve the understanding of behaviour and processes of crystalline bedrock under permafrost conditions. As a part of this project, the Geological Survey of Finland carried out electromagnetic SAMPO soundings in the vicinity of the mine between 11th and 23rd of June 2002 in order to give additional information on the permafrost depth, the location and electrical characteristics of fracture zones and possible talik structures. The total number of sounding points was 214, forming 17 separate survey lines. Used coil separation was 100 - 800 m. According to the temperature data from Lupin Mine, the base of the permafrost is at the depth of 540 m. However, there is no information about the depth distribution outside the mine. The starting point of this survey was the possible existence of a saline water horizon below the permafrost, resulting from repeated segregation and enrichment of salts in front of advancing freezing front. The main result of the survey was a deep conductor, observed at numerous sounding points irrespectively of the measurement configuration. These sounding anomalies form a subhorizontal layer at the depths between 400 and 700 m, in contrast to the vertical orientation of the geological units in the area. According to the results, the conductor gets weaker or deeper close to the Lake Contwoyto and seems to be absent below the lake. There also seems to be a lithological control, since the conducting layer is not observed in granodiorite. It is assumed that the conducting layer represents saline or brackish waters at the base of the permafrost; their calculated TDS-values are in a realistic range for such waters (5000-30 000 mg/l). The subvertical fracture zone VI, previously interpreted from the seismic survey, could be observed as a slight decrease in resistivity in 3 survey profiles using a coil separation of 100 m. (orig.)

  12. Determination of phomopsin-A in lupin seeds and lupin-derived products

    NARCIS (Netherlands)

    Top, van den H.J.; Mol, J.G.J.

    2017-01-01

    An interlaboratory study was performed for the determination of phomopsin A in lupin seeds and lupin derived products. This was done in the frame of the 2nd Standardization Mandate (M/520) in the field of methods of analysis for mycotoxins in food, which had been issued by the European Commission in

  13. Rotational and nematicidal effect of lupine (Lupinus albus L ...

    African Journals Online (AJOL)

    Jane

    2011-10-10

    Oct 10, 2011 ... Key words: Lupine, lupine seed extract, nematodes, nematicidal effect. INTRODUCTION ... alternative in winter and dry land production systems where other ... effects on germination and seedling growth of lettuce. Yorgancilar ...

  14. An evaluation of fababean ( Vicia faba ) and lupin ( Lupinus albus ...

    African Journals Online (AJOL)

    The experiment was carried out to compare fababean with lupin crop residues for summer grazing by young Merino wethers. The crude protein (CP) and dry matter (DM) degradability as well as chemical composition of fababean and lupin seed and stalks were also determined. Sheep which utilized both crop residues ...

  15. Lupine protein enrichment by milling and electrostatic separation

    NARCIS (Netherlands)

    Wang, Jue; Zhao, Jun; Wit, De Martin; Boom, Remko M.; Schutyser, Maarten A.I.

    2016-01-01

    Lupine seeds are excellent source of plant protein. We here report on dry fractionation by combining milling and electrostatic separation providing an alternative to wet extraction of protein from lupine seeds. Relatively coarse milling was preferred as this provides sufficient detached protein

  16. Clinical relevance of sensitization to peanut and lupine

    NARCIS (Netherlands)

    Peeters, K.A.B.M.

    2007-01-01

    This thesis demonstrates that the use of purified allergens and techniques such as NMR spectroscopy has the potential to improve current diagnostic capabilities. It also shows that lupine allergy is fairly common in The Netherlands. Characteristics of lupine allergy such as the eliciting dose and

  17. Lupin sensitization and clinical allergy in food allergic children in Norway.

    Science.gov (United States)

    Lindvik, Helene; Holden, Lise; Løvik, Martinus; Cvancarova, Milada; Halvorsen, Ragnhild

    2008-01-01

    The aim of the present pilot study was to investigate to what extent children in Norway sensitized to lupin had clinical lupin allergy, and to compare sensitization to lupin with sensitization to other legumes. Thirty-five children with food allergy referred to a national referral hospital were evaluated with skin prick test (SPT) and analysis of serum-specific IgE to lupin, peanut, pea and soy. The children with positive SPTs to lupin were offered oral food challenges with lupin flour. Fifteen children (43%) had positive SPT and 17 children (49%) had serum-specific IgE to lupin. Ten SPT-positive children underwent oral food challenges and one experienced an allergic reaction to lupin flour. This child was one of six challenged children with IgE antibodies to peanut >15 kU(A)/L. There was a strong relationship between positive SPT to lupin flour and positive SPT to soy and between positive SPT to lupin and specific IgE to soy, pea and peanut. Children with sensitization to lupin are not likely to have a clinical lupin allergy. Avoidance of lupin on the basis of lupin sensitization or peanut allergy would lead to unnecessarily strict diets. Food challenge is currently necessary to diagnose lupin allergy.

  18. The future of lupin as a protein crop in Europe

    Directory of Open Access Journals (Sweden)

    M. Mercedes eLucas

    2015-09-01

    Full Text Available Europe has become heavily dependent on soya bean imports, entailing trade agreements and quality standards that do not satisfy the European citizen’s expectations. White, yellow and narrow-leafed lupins are native European legumes that can become true alternatives to soya bean, given their elevated and high-quality protein content, potential health benefits, suitability for sustainable production, and acceptability to consumers. Nevertheless, lupin cultivation in Europe remains largely insufficient to guarantee a steady supply to the food industry, which in turn must innovate to produce attractive lupin-based protein-rich foods. Here, we address different aspects of the food supply chain that should be considered for lupin exploitation as a high-value protein source. Advanced breeding techniques are needed to provide new lupin varieties for socio-economically and environmentally sustainable cultivation. Novel processes should be optimized to obtain high-quality, safe lupin protein ingredients, and marketable foods need to be developed and offered to consumers. With such an integrated strategy, lupins can be established as an alternative protein crop, capable of promoting socio-economic growth and environmental benefits in Europe.

  19. Assessment of Antioxidant Properties of Radiation Processed Lupin Seeds

    International Nuclear Information System (INIS)

    El-Niely, H.F.G.

    2011-01-01

    In the present study, the radiation processing of lupin seeds (Lupinus albus spp. Giza 2) were carried out at dose levels of 2.5, 5 and 10 kGy. The chemical composition (protein, fat, total phenolic compounds, total flavonoids and fatty acids) and antioxidant properties of its methanolic extracts were assessed. The result showed that there were non-significant changes observed for protein, fat and ash of processed samples as compared with non-irradiated samples. Meanwhile, the crude fiber was decreased linearly as a function of radiation dose. The total phenolic compounds were increased by 9.92%, 11.75% and 13.82% and flavonoids by 2.5%, 7.1% and 7.5% for the 2.5, 5 and 10 kGy irradiated samples, respectively. Regarding lupin fatty acid contents, the results indicated that gamma irradiation up to 10 kGy did not cause important changes in the percentage of the fatty acids. At 7.5 and 10.0 mg/ml of sample concentration, the antioxidant activities of methanolic extracts for 2.5 to 10 kGy irradiated lupin seeds were significantly higher than those of methanolic extracts of the non-irradiated control. Reducing powers of methanolic extracts from lupin irradiated at 2.5 and 5 kGy were comparable except for 10 kGy irradiated lupin seeds, and had more power than methanolic extracts from non-irradiated lupin. The reducing powers of the methanolic extract from 10 kGy irradiated lupin was decreased at all concentrations (from 0.5 to 10 mg/ml) than of methanolic extracts from non-irradiated or irradiated lupin seeds at 2.5 and 5 kGy. At 2.5 mg/ml, all methanolic extracts showed excellent scavenging abilities of 91.6 to 103.27% against DPPH radicals. The scavenging abilities of methanolic extracts from 2.5 to 10 kGy irradiated lupin were better than that of the non-irradiated control at 10 mg/ml. With irradiation at 2.5-10 kGy, lupin seeds showed higher chelating ability on ferrous ions than did the non-irradiated control. It could be concluded that gamma irradiation of lupin

  20. Chemical and nutritional changes in bitter and sweet lupin seeds (Lupinus albus L.) during bulgur production.

    Science.gov (United States)

    Yorgancilar, Mustafa; Bilgiçli, Nermin

    2014-07-01

    In this research, bitter and sweet Lupin (Lupinus albus L.) seeds were used in bulgur production. The proximate chemical compositions and the contents of phytic acid, mineral, amino acid and fatty acid of raw material and processed lupin seeds as bulgur were determined. The sensory properties of bulgur samples were also researched. Bulgur process decreased ash, fat and phytic acid content of lupin seeds while significant increase (p sweet lupin bulgurs were found as 18.8% and 21.3%, respectively. Generally sweet lupin seeds/bulgurs showed rich essential amino acids composition than that of bitter seeds/bulgurs. Linoleic and linolenic acid content of the lupin was negatively affected by bulgur process. Bitter lupin bulgur received lower scores in terms of taste, odor and overall acceptability than sweet lupin bulgur in sensory evaluation. Sweet lupin bulgur can be used as new legume-based product with high nutritional and sensorial properties.

  1. An evaluation of fababean (Vicia faba) and lupin (Lupinus albus ...

    African Journals Online (AJOL)

    Sheep which utilized both crop residues gained in live mass ... live masses than sheep which grazed lupin crop residues at the fourth week .... model of 0rskov & McDonald (1979): p .... Production Laboratory are thanked for chemical analyses.

  2. Lupine Alleviate Hyperglycemia in Streptozotocin Diabetic gamma- Irradiated Rats

    International Nuclear Information System (INIS)

    El-Sayed, S.M.

    2010-01-01

    This study was to examine the regulatory effect of lupine on the diabetic profile developed in Streptozotocin (STZ) induced diabetic albino rats. The effectiveness of lupine against diabetes in gamma irradiated rats was purposed in the present study. Rats were received lupine seeds powder suspension (1 g/kg body weight for 14 consecutive days) before whole body exposure to 8 Gy of gamma radiation and /or STZ (55 mg/kg body weight, single dose) injection. The results pointed out that radiation exposure sustained the diabetic profile in rats received STZ comparing with STZ diabetic not irradiated rats. The prolonged administration of lupine suspension before STZ induction of diabetic and/or irradiated rats reduced the changes in the level of blood glucose, insulin concentration, liver glycogen, and the activity of glucose-6-phosphatase associated with significant amelioration in blood antioxidant status (superoxide dismutase, SOD; catalase, CAT; glucose-6-phosphate dehydrogenase, G-6-PD activities and reduced glutathione concentration GSH). Also, the level of blood lipid peroxides (TBARS) were reduced greatly when compared with its matched value in diabetic and /or gamma irradiated rats. It could be postulated that lupine powder suspension might be attenuate the diabetic profile development throughout reducing oxidative damages and modulating the antioxidant status. In addition, lupine could be considered as one of a remarkable radio protective agent owing to its antioxidants property

  3. Maize-common bean/lupine intercrop productivity and profitability in ...

    African Journals Online (AJOL)

    Phaseolus vulgaris L.), narrow-leaf lupine (Lupinus angustifolius L.), and white lupine (Lupinus albus L.) with maize (Zea mays L.) were conducted under two intercrop planting arrangements (IPA), single row of legume in between maize rows and ...

  4. Characterization of New Isolates of Apricot vein clearing-associated virus and of a New Prunus-Infecting Virus: Evidence for Recombination as a Driving Force in Betaflexiviridae Evolution.

    Directory of Open Access Journals (Sweden)

    Armelle Marais

    Full Text Available Double stranded RNAs from Prunus samples gathered from various surveys were analyzed by a deep-sequencing approach. Contig annotations revealed the presence of a potential new viral species in an Azerbaijani almond tree (Prunus amygdalus and its genome sequence was completed. Its genomic organization is similar to that of the recently described Apricot vein clearing associated virus (AVCaV for which two new isolates were also characterized, in a similar fashion, from two Japanese plums (Prunus salicina from a French germplasm collection. The amino acid identity values between the four proteins encoded by the genome of the new virus have identity levels with those of AVCaV which fall clearly outside the species demarcation criteria. The new virus should therefore be considered as a new species for which the name of Caucasus prunus virus (CPrV has been proposed. Phylogenetic relationships and nucleotide comparisons suggested that together with AVCaV, CPrV could define a new genus (proposed name: Prunevirus in the family Betaflexiviridae. A molecular test targeting both members of the new genus was developed, allowing the detection of additional AVCaV isolates, and therefore extending the known geographical distribution and the host range of AVCaV. Moreover, the phylogenetic trees reconstructed with the amino acid sequences of replicase, movement and coat proteins of representative Betaflexiviridae members suggest that Citrus leaf blotch virus (CLBV, type member of the genus Citrivirus may have evolved from a recombination event involving a Prunevirus, further highlighting the importance of recombination as a driving force in Betaflexiviridae evolution. The sequences reported in the present manuscript have been deposited in the GenBank database under accession numbers KM507061-KM504070.

  5. QUALITY AND SENSORY EVALUATIONS OF TEMPE PREPARED FROM VARIOUS PARTICLE SIZES OF LUPIN BEANS [Evaluasi Sensorik dan Kualitas Tempe dari Kacang Lupin Berbagai Ukuran Partikel

    Directory of Open Access Journals (Sweden)

    Sri Priatni*

    2013-12-01

    Full Text Available Tempe is an Indonesian fermented soy bean, produced by using mainly Rhizopus oligosporus. Diversification of tempe raw materials is required for better food security, e.g., using lupin. The potency of lupin bean has been studied as a substitute of soy in tempe production. Nutritionally, lupin bean offers additional advantages over soy bean, i.e., it has a lower level of many anti-nutritional factors (ANFs but contains higher protein (32-36% than most pulses. The objectives of this study were to select the most suitable lupin bean from different particle sizes for tempe production and to characterize the quality of lupin tempe. In this study, the lupin tempe samples were analyzed for moisture content, firmness, aroma, and the total count of colony after 1 and 2 days of fermentation. Sensory evaluation was conducted by 17 Indonesian untrained panelists (hedonic in three different days. The data were evaluated statistically using General Linear Model (GLM and Tukey’s Honest Significant Difference (HSD. Results showed that the moisture content of lupin tempe ranged from 60 to 66%, higher than that of soy tempe (58.90%. Meanwhile, the firmness of lupin tempe was between 21.38-30.89 N. Mostly, tempes which were produced from ≤50% of particles sized ≥5 mm (L3, L5 and L6 exhibited poor quality in terms of firmness and aroma. The mean of total count of colony in lupin tempe were 3.0x104 CFU/g, lower than that of soy tempe (218x103 CFU/g, indicating a slower growth of mycelia on lupin beans. However, the overall acceptability of lupin tempe which was prepared from whole beans (L4 and L7 was not significantly different from that of soy tempe. Based on these quality and sensory tests, lupin tempe using whole lupin beans was recommended for substitute of soy bean in tempe production.

  6. Molecular cloning of lupin leghemoglobin cDNA

    DEFF Research Database (Denmark)

    Konieczny, A; Jensen, E O; Marcker, K A

    1987-01-01

    Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

  7. Evaluation of total polyphenol content and antioxidant capacity of different verity lupin seeds

    Directory of Open Access Journals (Sweden)

    Ismael Sulaiman Dalaram

    2017-01-01

    Full Text Available Legumes, including lupins, beans, lentil and chickpea, are one of the most important crops in the world because of their nutritional quality. Lupin seeds have been used as human food and animal feed since ancient times. It was known that antioxidant photochemical in foods have many health benefits including prevention of various diseases associated with oxidative stress such as cancer, cardiovascular disease, neuro-degeneration and diabetes. Lupin grains are rich sources of complex carbohydrates, protein, vitamins and minerals. Antioxidants can be found naturally in foods. Total polyphenols content and antioxidant activity were measured in four varieties of lupin, namely in white lupin, blue lupin, yellow lupin and Mutabilis lupin species. A majority of antioxidants naturally present in foods occur in phenolic structures and especially in flavonoid structures. The content of the total polyphenols was determined by using the Folin-Ciocalteu reagent (FCR. Antioxidant activity was measured by using a compound DPPH˙ (2.2-diphenyl-1-picrylhydrazyl. In the present experiment according to the average contents of total polyphenols (TPC in dry matter of lupin seeds there was the following line: L. Angustifolius (blue lupin (696.212 mg GAE.100g-1 > L. Albus (white lupin (614.13 mg GAE.100g-1 > L. Luteus (yellow lupin (467.78 mg GAE.100g-1 > L. Mutabilis (pearl lupin (367.36 mg GAE.100g-1. Based on the measured values of total antioxidant capacity (TAC of lupin samples can be classified as follows: L. Albus (white lupin (43.44% >L. Angustifolius (blue lupin (38.27% >L. Luteus (yellow lupin (22.29% >L. Mutabilis (Pearl lupin (20.80%. The relationship of antioxidant capacity with total polyphenolic was discussed. According to used statistical analyzes. Correlation between the phenolic contents and antioxidant capacity was significantly positive (r = 0.88. Our results confirmed that legumes can be a good source of bioactive compounds in the human nutrition

  8. Preparation of functional lupine protein fractions by dry separation

    NARCIS (Netherlands)

    Pelgrom, P.J.M.; Berghout, J.A.M.; Goot, van der A.J.; Boom, R.M.; Schutyser, M.A.I.

    2014-01-01

    Lupine protein concentrate is a promising ingredient that can be obtained by a combination of milling and air classification, generally called dry fractionation. This is a more sustainable route than conventional wet extraction and delivers a protein concentrate with native functional properties.

  9. Development and validation of an LC-MS/MS method for the detection of phomopsin A in lupin and lupin-containing retail food samples from the Netherlands

    NARCIS (Netherlands)

    Nijs, de W.C.M.; Pereboom-de Fauw, D.P.K.H.; Dam, van R.C.J.; Rijk, de T.C.; Egmond, van H.P.; Mol, J.G.J.

    2013-01-01

    Phomopsins (PHO) are mycotoxins produced by the fungus Diaporthe toxica (also referred to as Phomopsis leptostromiformis). Lupin is the most important host crop for this fungus and PHO are suspected as cause of lupinosis, a deadly liver disease, in sheep. Lupin is currently in use to replace

  10. Chemical and nutritional changes in bitter and sweet lupin seeds (Lupinus albus L.) during bulgur production

    OpenAIRE

    Yorgancilar, Mustafa; Bilgiçli, Nermin

    2012-01-01

    In this research, bitter and sweet Lupin (Lupinus albus L.) seeds were used in bulgur production. The proximate chemical compositions and the contents of phytic acid, mineral, amino acid and fatty acid of raw material and processed lupin seeds as bulgur were determined. The sensory properties of bulgur samples were also researched. Bulgur process decreased ash, fat and phytic acid content of lupin seeds while significant increase (p 

  11. Effect of Chernobyl radionuclides accumulation on the photosynthetic processes and nitrogen metabolism of Lupines Luteus L

    International Nuclear Information System (INIS)

    Zabolotnyj, A.I.; Goncharova, N.V.; Domash, V.I.; Sheverdov, V.V.; Akadehmiya Navuk Belarusi, Minsk

    1995-01-01

    The 134 Cs, 137 Cs and chlorophyll content activity of photochemical reaction in chloroplasts and symbiotic nitrogen fixation in root modules, activity of neutral protease, BAPAse and trypsin inhibitors were investigated for seeds to yellow lupine (Lupines luteus L). The level of radioactive contamination induced a tendency to change the activity of photosynthetic reaction and nitrogen fixation, significant changes in a set of trypsin inhibitors were found in nature lupine seeds

  12. Bread making properties of wheat flour supplemented with thermally processed hypoallergenic lupine flour

    Energy Technology Data Exchange (ETDEWEB)

    Guillamon, E.; Cuadrado, C.; Pedrosa, M. M.; Varela, A.; Cabellos, B.

    2010-07-01

    In recent years there has been increased interest in using lupine for human nutrition due to its nutritional properties and health benefits. Moreover, lupine is used as an ingredient in bread making because of its functional and technological properties. However, a higher number of allergic reactions to this legume have recently been reported as a consequence of a more widespread consumption of lupine-based foods. In a previous study, several thermal treatments were applied to lupine seeds and flours resulting in reduced allergenicity. In order to study how this thermal processing (autoclaving and boiling) affects the bread making properties, raw and thermally processed lupine flours were used to replace 10% of wheat flour. The effect of supplementing wheat flour with lupine flour on physical dough properties, bread structure and sensory characteristics were analysed. The results indicated that thermally-treated lupine flours, had similar bread making and sensorial properties as untreated lupine flour. These thermal treatments could increase the potential use of lupine flour as a food ingredient while reducing the risk to provoke allergic reactions. (Author) 36 refs.

  13. Phenotypic, Molecular, and Pathological Characterization of Colletotrichum acutatum Associated with Andean Lupine and Tamarillo in the Ecuadorian Andes

    NARCIS (Netherlands)

    Falconi, C.; Visser, R.G.F.; Heusden, van A.W.

    2013-01-01

    Anthracnose is a serious problem of both Andean lupine and tamarillo in Ecuador. Morphological features, internal transcribed spacer (ITS) sequences, and host specificity were used to characterize Colletotrichum isolates from lupine and tamarillo. Based on phenotypic and molecular characterization,

  14. Lupin seed meal (Lupinus albus cv. Buttercup) as a source of ...

    African Journals Online (AJOL)

    (teen 'n 8%-insluitingspell) as gedeeltelike vervanger vir volvetsojabone, te evalueer. Die ... lupins, digestibility, N retention, growth, alkaloids, pigs. Introduction. Lupin-seed has been used extensively in pig diets ... meal, but at higher levels both growth rate and feed conversion efficiency were significantly depressed. Feed.

  15. Evaluation of thermal, chemical, and mechanical seed scarification methods for 4 Great Basin lupine species

    Science.gov (United States)

    Covy D. Jones; Mikel R. Stevens; Von D. Jolley; Bryan G. Hopkins; Scott L. Jensen; Dave Turner; Jason M. Stettler

    2016-01-01

    Seeds of most Great Basin lupine (Lupinus spp. [Fabaceae]) species are physically dormant and thus, difficult to establish in uniform stands in seed production fields. We designed this study to examine 5 seed scarification techniques, each with 11 levels of application (including a non-scarified control), to reduce the physical seed dormancy of longspur lupine...

  16. Additive effects of lupin protein and phytic acid on aortic calcification in ApoE deficient mice

    Directory of Open Access Journals (Sweden)

    Alexandra Schutkowski

    2015-03-01

    A two-factorial study with ApoE knockout mice was conducted in which mice received lupin protein isolate or casein with or without phytase. Phytic acid was added to the casein diets to a final concentration identical to the lupin protein diets. Here we show that the serum concentrations of cholesterol, lathosterol and desmosterol were lower and the faecal bile acid excretion was higher in the groups fed lupin proteins than in the groups fed casein (p < 0.05. Mice that received the lupin protein diet containing phytic acid were characterized by a lower aortic calcification than mice of the other three groups (p < 0.05. In conclusion, our results show that the cholesterol lowering properties of lupin protein isolate were not caused by phytic acid. However, the hypocalcific action of lupin proteins appears to depend on the combination of lupin proteins and phytic acid.

  17. Hereditary dwarfism in yellow lupin (Lupinus luteus L

    Directory of Open Access Journals (Sweden)

    Tadeusz Kazimierski

    2015-01-01

    Full Text Available A dwarf plant was found in the F4 generation of a hybrid between two yellow lupin subspecies. Genetic analysis demonstrated that the dwarf grwoth is conditioned by one recessive factor which was named nanus. This factor acts pleiotroipically since it reduces the height, changes the morphological structure and some anatomical traits and reduces fertility in the dwarf plants. It is believed that in the chromosome with translocation a gene block arose in the F4, plant. These genes acting as a compact system cause dwarfism, changes in the anatomical structure and reduce fertility.

  18. Congenital deformity in calves induced by the maternal consumption of lupin

    Energy Technology Data Exchange (ETDEWEB)

    Shupe, J.L.; Binns, W.; James, L.F.; Keeler, R.F.

    1968-01-01

    A congenital skeletal deformity called crooked calf syndrome occurs in many of the beef cattle-producing areas of the western United States. This deformity is characterized by arthrogryposis, torticollis, scoliosis, and cleft palate. The condition is non-hereditary, and is due to the consumption of lupin by the dam. The most severe and characteristic deformities are produced between the 40th and 70th days of gestation. Experimental analyses were performed to ascertain the teratogenic effect of lupin plants, lupin and lead, and lead alone upon cattle.

  19. Lupines, manganese, and devil-sickness: an Anglo-Saxon medical response to epilepsy.

    Science.gov (United States)

    Dendle, P

    2001-01-01

    The most frequently prescribed herb for "devil-sickness" in the vernacular medical books from Anglo-Saxon England, the lupine, is exceptionally high in manganese. Since manganese depletion has been linked with recurring seizures in both clinical and experimental studies, it is possible that lupine administration responded to the particular pathophysiology of epilepsy. Lupine is not prescribed for seizures in classical Mediterranean medical sources, implying that the Northern European peoples (if not the Anglo-Saxons themselves) discovered whatever anticonvulsive properties the herb may exhibit.

  20. Effect of lupine as cheese base substitution on technological and nutritional properties of processed cheese analogue.

    Science.gov (United States)

    Awad, Rezik Azab; Salama, Wafaa Mohammed; Farahat, Azza Mahmoud

    2014-01-01

    Healthy foods have been met with marked success in the last two decades. Lupine flours, protein concentrates, and isolates can be applied as a substance for enriching different kinds of food systems such as bakery products, lupine pasta, ice cream, milk substitutes. Imitation processed cheese is made from mixtures of dairy and/or non dairy proteins and fat/oils and is variously labeled analogue, artificial, extruded, synthetic and/or filled. Processed cheese can be formulated using different types of cheese with different degree of maturation, flavorings, emulsifying, salts, and/or several ingredients of non-dairy components. Non-dairy ingredients have been used in processed cheese for many dietary and economic reasons. In this study, lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA). Matured Ras cheese (3 months old) was manufactured using fresh cow milk. Soft cheese curd was manufactured using fresh buffalo skim milk. Emulsifying salts S9s and Unsalted butter were used. Lupine termis paste was prepared by soaking the seeds in tap water for week with changing the water daily, and then boiled in water for 2 hrs, cooled and peeled. The peeled seeds were minced, blended to get very fine paste and kept frozen until used. Lupine paste was used to substitute 25, 50, 75 and 100% of cheese in base formula of processed cheese analogue (PCA). The obtained PCA were analysed when fresh and during storage up to 3 months at 5±2°C for chemical composition, physical and sensory properties. The histopathological effect of lupines on alloxan diabetic albino rats and nutritional parameters were also investigated. Incorporation of lupine paste in PCA increased the ash and protein contents while meltability and penetration values of resultant products were decreased. Adding lupine in PSA formula had relatively increased the oil index and firmness of products. Feeding rats a balanced diet containing processed cheese

  1. Nutritional, Health, and Technological Functionality of Lupin Flour Addition to Bread and Other Baked Products: Benefits and Challenges.

    Science.gov (United States)

    Villarino, C B J; Jayasena, V; Coorey, R; Chakrabarti-Bell, S; Johnson, S K

    2016-01-01

    Lupin is an undervalued legume despite its high protein and dietary fiber content and potential health benefits. This review focuses on the nutritional value, health benefits, and technological effects of incorporating lupin flour into wheat-based bread. Results of clinical studies suggest that consuming lupin compared to wheat bread and other baked products reduce chronic disease risk markers; possibly due to increased protein and dietary fiber and bioactive compounds. However, lupin protein allergy has also been recorded. Bread quality has been improved when 10% lupin flour is substituted for refined wheat flour; possibly due to lupin-wheat protein cross-linking assisting bread volume and the high water-binding capacity (WBC) of lupin fiber delaying staling. Above 10% substitution appears to reduce bread quality due to lupin proteins low elasticity and the high WBC of its dietary fiber interrupting gluten network development. Gaps in understanding of the role of lupin flour in bread quality include the optimal formulation and processing conditions to maximize lupin incorporation, role of protein cross-linking, antistaling functionality, and bioactivity of its γ-conglutin protein.

  2. Additive effects of lupin protein and phytic acid on aortic calcification in ApoE deficient mice.

    Science.gov (United States)

    Schutkowski, Alexandra; Hirche, Frank; Geissler, Stefanie; Radtke, Juliane; Stangl, Gabriele I

    2015-03-01

    Lupin proteins have repeatedly been shown to exhibit lipid lowering properties and reduce aortic calcification in atherosclerosis models. Despite many efforts on its identification, the component which is responsible for the observed effects is still under debate. Phytic acid which is generally associated with lupin protein isolates has currently been described as bioactive plant compound. The objective of the study was to determine the role of associated phytic acid for the described lupin protein effects. A two-factorial study with ApoE knockout mice was conducted in which mice received lupin protein isolate or casein with or without phytase. Phytic acid was added to the casein diets to a final concentration identical to the lupin protein diets. Here we show that the serum concentrations of cholesterol, lathosterol and desmosterol were lower and the faecal bile acid excretion was higher in the groups fed lupin proteins than in the groups fed casein ( p  < 0.05). Mice that received the lupin protein diet containing phytic acid were characterized by a lower aortic calcification than mice of the other three groups ( p  < 0.05). In conclusion, our results show that the cholesterol lowering properties of lupin protein isolate were not caused by phytic acid. However, the hypocalcific action of lupin proteins appears to depend on the combination of lupin proteins and phytic acid.

  3. Introduction of novel legume crops in Serbia: White lupin (Lupinus albus

    Directory of Open Access Journals (Sweden)

    Mikić Aleksandar

    2010-01-01

    Full Text Available The renewed interest in introducing white lupin in Serbia is its high crude protein content in grain dry matter of nearly 400 g kg-1, which makes it a potential supplement for soybean meal in animal feeding. The only collection of white and other lupins in Serbia is maintained at Institute of Field and Vegetable Crops in Novi Sad, with about 200 accessions of 10 species, containing about 70 accessions of white lupin. The accessions with high tolerance to alkaline soil reaction of about pH=8 in a carbonated chernozem in Novi Sad regularly formed two orders of pods and grains and produced grain yields of more than 5 t ha-1, 45 t ha-1 of green forage and 8 t ha-1 of forage dry matter. The first Serbian white lupin breeding programme carried out at Institute of Field and Vegetable Crops in Novi Sad has resulted in developing cultivars Vesna and Panorama, registered in 2008. .

  4. Lupin seed (Lupinus albus and Lupinus luteus) as a protein source for fermentation use

    DEFF Research Database (Denmark)

    Jul, L.B.; Flengmark, Poul Kristiansen; Gylling, M.

    2003-01-01

    and substances known to inhibit or activate fermentation processes. For three chosen varieties (Juno, Borsaja (yellow lupins) and Amiga (white lupin)) fermentation tests were performed each year in laboratory fermentors. Three different fermentation models were applied: production of amylase by Aspergillus...... led to yields similar to those of soybean meal as a protein source though there were minor differences between the model fermentations with regard to the best protein source. The conclusion of the fermentation tests is that dehulled and ground lupin seed is a suitable substitute for soybean meal...... oryzae and by Bacillus amyloliquefaciens, and production of protease by B. amyloliquefaciens. In all cases the fermentation yields were compared with the yields of similar fermentations carried out with soybean meal as the source of protein. The use of lupins as a protein source in fermentation trials...

  5. LUPIN, a new instrument for pulsed neutron fields

    Energy Technology Data Exchange (ETDEWEB)

    Caresana, M. [Politecnico di Milano, Department of Energy, Via Ponzio 34/3, 20133 Milan (Italy); Ferrarini, M. [Politecnico di Milano, Department of Energy, Via Ponzio 34/3, 20133 Milan (Italy); CNAO, Via Privata Campeggi, 27100 Pavia (Italy); Manessi, G.P., E-mail: giacomo.paolo.manessi@cern.ch [CERN, 1211 Geneva 23 (Switzerland); University of Liverpool, Department of Physics, L69 7ZE Liverpool (United Kingdom); Silari, M. [CERN, 1211 Geneva 23 (Switzerland); Varoli, V. [Politecnico di Milano, Department of Energy, Via Ponzio 34/3, 20133 Milan (Italy)

    2013-06-01

    A number of studies focused in the last decades on the development of survey meters to be used in pulsed radiation fields. This is a topic attracting widespread interest for applications such as radiation protection and beam diagnostics in accelerators. This paper describes a new instrument specifically conceived for applications in pulsed neutron fields (PNF). The detector, called LUPIN, is a rem counter type instrument consisting of a {sup 3}He proportional counter placed inside a spherical moderator. It works in current mode with a front-end electronics consisting of a current–voltage logarithmic amplifier, whose output signal is acquired with an ADC and processed on a PC. This alternative signal processing allows the instrument to be used in PNF without being affected by saturation effects. Moreover, it has a measurement capability ranging over many orders of burst intensity. Despite the fact that it works in current mode, it can measure a single neutron interaction. The LUPIN was first calibrated in CERN's calibration laboratory with a PuBe source. Measurements were carried out under various experimental conditions at the Helmholtz-Zentrum in Berlin, in the stray field at various locations of the CERN Proton Synchrotron complex and around a radiotherapy linear accelerator at the S. Raffaele hospital in Milan. The detector can withstand single bursts with values of H⁎(10) up to 16 nSv/burst without showing any saturation effect. It efficiently works in pulsed stray fields, where a conventional rem-counter underestimates by a factor of 2. It is also able to reject the very intense and pulsed photon contribution that often accompanies the neutron field with good reliability. -- Highlights: ► LUPIN is a new detector specifically conceived to work in neutron pulsed fields. ► The detector is a rem counter type instrument working in current mode. ► The performances of the detectors were studied under various experimental conditions. ► The detector

  6. Shaping of the fungal communities isolated from yellow lupin seeds (Lupinus luteus L. throughout storage time

    Directory of Open Access Journals (Sweden)

    Bożena Cwalina-Ambroziak

    2012-12-01

    Full Text Available The object of the experiment were seeds of two traditional cultivars of yellow lupin (Juno and Amulet cultivated in 1999 in two crop-rotation with 20% and 33% yellow lupine contribution. The quantitative and qualitative composition of the fungal community colonizing the seeds were determined in the laboratory conditions after 0.5-, 1.5- and 2.5-year of storage time. In total 1077 fungal colonies were isolated from the lupin seeds. Fungi representing the species of Penicillium - 29.3%, Alternaria alternata - 26.7% and Rhizopus nigricans - 12.7% were isolated most widely. Among the fungi pathogenic to lupin, the species of Colletotrichum gloeosporioides (16.3% isolates was dominant. The crop rotation with 20% lupin reduced the number of fungal colonies colonizing the seeds including the pathogens from the species of C. gloeosporioides. Seed disinfection decreased the total number of fungal colonies isolated from both cultivars. Higher number of C. gloeosporioides isolates was found in the combination with disinfected seeds. More fungal colonies were obtained from seeds of cv. Amulet than from those of cv. Juno. The storage duration had an effect on the population and the composition of species of fungi isolated from seeds of yellow lupine. With longer storage population of Penicillium spp. and Rhizopus spp. increased, whereas the population of C. gloeosporioides decreased.

  7. Proteomics for exploiting diversity of lupin seed storage proteins and their use as nutraceuticals for health and welfare.

    Science.gov (United States)

    Cabello-Hurtado, Francisco; Keller, Jean; Ley, José; Sanchez-Lucas, Rosa; Jorrín-Novo, Jesús V; Aïnouche, Abdelkader

    2016-06-30

    Lupins have a variety of both traditional and modern uses. In the last decade, reports assessing the benefits of lupin seed proteins have proliferated and, nowadays, the pharmaceutical industry is interested in lupin proteins for human health. Modern genomics and proteomics have hugely contributed to describing the diversity of lupin storage genes and, above all, proteins. Most of these studies have been centered on few edible lupin species. However, Lupinus genus comprises hundreds of species spread throughout the Old and New Worlds, and these resources have been scarcely explored and exploited. We present here a detailed review of the literature on the potential of lupin seed proteins as nutraceuticals, and the use of -omic tools to analyze seed storage polypeptides in main edible lupins and their diversity at the Lupinus inter- and intra-species level. In this sense, proteomics, more than any other, has been a key approach. Proteomics has shown that lupin seed protein diversity, where post-translational modifications yield a large number of peptide variants with a potential concern in bioactivity, goes far beyond gene diversity. The future extended use of second and third generation proteomics should definitely help to go deeper into coverage and characterization of lupin seed proteome. Some important topics concerning storage proteins from lupin seeds are presented and analyzed in an integrated way in this review. Proteomic approaches have been essential in characterizing lupin seed protein diversity, which goes far beyond gene diversity since the protein level adds to the latter differential proteolytic cleavage of conglutin pro-proteins and a diverse array of glycosylation forms and sites. Proteomics has also proved helpful for screening and studying Lupinus germplasm with the future aim of exploiting and improving food production, quality, and nutritional values. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. A first glimpse of wild lupin karyotype variation as revealed by comparative cytogenetic mapping

    Directory of Open Access Journals (Sweden)

    Karolina Susek

    2016-07-01

    Full Text Available Insight into plant genomes at the cytomolecular level provides useful information about their karyotype structure, enabling inferences about taxonomic relationships and evolutionary origins. The Old World lupins demonstrate a high level of genomic diversification involving variation in chromosome numbers (2n=32-52, basic chromosome numbers (x=5-7, 9, 13 and in nuclear genome size (2C DNA=0.97-2.68 pg. Lupins comprise both crop and wild species and provide an intriguing system to study karyotype evolution.In order to investigate lupin chromosome structure, heterologous FISH was used. Sixteen BACs that had been generated as chromosome markers for the reference species, Lupinus angustifolius, were used to identify chromosomes in the wild species and explore karyotype variation. While all ‘single-locus’ in L. angustifolius, in the wild lupins these clones proved to be ‘single-locus’, ‘single-locus’ with additional signals, ‘repetitive’ or had no detectable BAC-FISH signal. The diverse distribution of the clones in the targeted genomes suggests a complex evolution history, which possibly involved multiple chromosomal changes such as fusions/fissions and repetitive sequence amplification. Twelve BACs were sequenced and we found numerous transposable elements including DNA transposons as well as LTR and non-LTR retrotransposons with varying quantity and composition among the different lupin species. However, at this preliminary stage, no correlation was observed between the pattern of BAC-FISH signals and the repeat content in particular BACs. Here, we describe the first BAC-based chromosome-specific markers for the wild species: L. cosentinii, L. cryptanthus, L. pilosus, L. micranthus and one New World lupin, L. multiflorus. These BACs could constitute the basis for an assignment of the chromosomal and genetic maps of other lupins, e.g. L. albus and L. luteus. Moreover, we identified karyotype variation that helps illustrate the

  9. Comparison of fermentation profiles between lupine and soybean by Aspergillus oryzae and Aspergillus sojae in solid-state culture systems

    NARCIS (Netherlands)

    Sardjono; Zhu, Y.; Knol, W.

    1998-01-01

    To explore the possibilities of using lupine as a soybean replacement in fermented foods, fermentation profiles of lupine and soybean by Aspergillus oryzae and A. sojae, respectively, in a solid-state culture were compared. Biomass, spore concentration, oxygen consumption rate, carbon dioxide

  10. Transcript and proteomic analysis of developing white lupin (Lupinus albus L. roots

    Directory of Open Access Journals (Sweden)

    Watson Bonnie

    2009-01-01

    Full Text Available Abstract Background White lupin (Lupinus albus L. roots efficiently take up and accumulate (heavy metals, adapt to phosphate deficiency by forming cluster roots, and secrete antimicrobial prenylated isoflavones during development. Genomic and proteomic approaches were applied to identify candidate genes and proteins involved in antimicrobial defense and (heavy metal uptake and translocation. Results A cDNA library was constructed from roots of white lupin seedlings. Eight thousand clones were randomly sequenced and assembled into 2,455 unigenes, which were annotated based on homologous matches in the NCBInr protein database. A reference map of developing white lupin root proteins was established through 2-D gel electrophoresis and peptide mass fingerprinting. High quality peptide mass spectra were obtained for 170 proteins. Microsomal membrane proteins were separated by 1-D gel electrophoresis and identified by LC-MS/MS. A total of 74 proteins were putatively identified by the peptide mass fingerprinting and the LC-MS/MS methods. Genomic and proteomic analyses identified candidate genes and proteins encoding metal binding and/or transport proteins, transcription factors, ABC transporters and phenylpropanoid biosynthetic enzymes. Conclusion The combined EST and protein datasets will facilitate the understanding of white lupin's response to biotic and abiotic stresses and its utility for phytoremediation. The root ESTs provided 82 perfect simple sequence repeat (SSR markers with potential utility in breeding white lupin for enhanced agronomic traits.

  11. Intercropping with white lupin (Lupinus albus L.); a promising tool for phytoremediation and phytomining research

    Science.gov (United States)

    Wiche, Oliver; Székely, Balazs; Moschner, Christin; Heilmeier, Hermann

    2015-04-01

    In recent studies root-soil interactions of white lupine (Lupinus albus L.) have drawn special attention to researchers due to its particularly high potential to increase bioavailability of phosphorous (P) and trace nutrients in soils. In mixed cultures, white lupine has the ability to mobilize P and trace nutrients in soil in excess of its own need and make this excess available for other intercropped companion species. While improved acquisition of P and improved yield parameters have mostly been documented in cereal-lupine intercrops, compared to sole crops, only a few recent studies have evidenced similar effects for trace elements e.g. Fe, Zn and Mn. In this preliminary study we tried to obtain more information about the mobilization of trace elements due to intercropping under field conditions. We hypothesize, that processes that lead to a better acquisition of trace nutrients might also affect other trace elements what could be useful for phytoremediation and phytomining research. Here we report the results of a semi-field experiment were we investigated the effects of an intercropping of white lupine with oat (Avena sativa L.) on the concentrations of trace metals in shoots of oat. We investigated the effects on 12 trace elements, including 4 elements with relevance for plant nutrition (P, Fe, Mn, Zn) and 8 trace elements, belonging to the group of metalloids, lanthanides and actinides with high relevance in phytoremediation (Cd, Pb Th, U) and phytomining research (Sc, La, Nd, Ge). The experiment was carried out on a semi-field lysimer at the off-site soil recycling and remediation center in Hirschfeld (Saxony, Germany). To test the intercropping-dependent mobilization of trace metals in soil and enhanced uptake of elements by oat, white lupine and oat were cultivated on 20 plots (4 m² each) in monocultures and mixed cultures and two different white lupin /oat-ratios (11% and 33%, respectively) applying various treatments. The geometrical arrangement of

  12. Ileal digestibility of sunfl ower meal, pea, rapeseed cake, and lupine in pigs

    DEFF Research Database (Denmark)

    Nørgaard, Jan Værum; Fernández, José Adalberto; Jørgensen, Henry

    2012-01-01

    .05) for soybean meal and pea compared to sunfl ower meal, rapeseed cake, and lupine. The SID of Lys and His were lowest (P pea to be a high-digestible protein source relative to sunfl ower......The standardized ileal digestibility (SID) of CP and AA was evaluated in soybean (Glycine max) meal, sunfl ower (Helianthus annuus) meal, rapeseed cake, and fi eld pea (Pisum sativum) using 10 pigs and in lupine (Lupinus angustifolius) using 7 pigs. Pigs were fi tted with either a T...

  13. Molecular genetic diversity and population structure of Ethiopian white lupin landraces: Implications for breeding and conservation

    Science.gov (United States)

    Yao, Nasser; Martina, Kyalo; Dagne, Kifle; Wegary, Dagne; Tesfaye, Kassahun

    2017-01-01

    White lupin is one of the four economically important species of the Lupinus genus and is an important grain legume in the Ethiopian farming system. However, there has been limited research effort to characterize the Ethiopian white lupin landraces. Fifteen polymorphic simple sequence repeat (SSR) markers were used to assess the genetic diversity and population structure of 212 Ethiopian white lupin (Lupinus albus) landraces and two genotypes from different species (Lupinus angustifolius and Lupinus mutabilis) were used as out-group. The SSR markers revealed 108 different alleles, 98 of them from 212 landraces and 10 from out-group genotypes, with an average of 6.5 alleles per locus. The average gene diversity was 0.31. Twenty eight landraces harbored one or more private alleles from the total of 28 private alleles identified in the 212 white lupin accessions. Seventy-seven rare alleles with a frequency of less than 5% were identified and accounted for 78.6% of the total alleles detected. Analysis of molecular variance (AMOVA) showed that 92% of allelic diversity was attributed to individual accessions within populations while only 8% was distributed among populations. At 70% similarity level, the UPGMA dendrogram resulted in the formation of 13 clusters comprised of 2 to 136 landraces, with the out-group genotypes and five landraces remaining distinct and ungrouped. Population differentiation and genetic distance were relatively high between Gondar and Ethiopian white lupin populations collected by Australians. A model-based population structure analysis divided the white lupin landraces into two populations. All Ethiopian white lupin landrace populations, except most of the landraces collected by Australians (77%) and about 44% from Awi, were grouped together with significant admixtures. The study also suggested that 34 accessions, as core collections, were sufficient to retain 100% of SSR diversity. These accessions (core G-34) represent 16% of the whole 212

  14. NODULATION OF YELLOW LUPIN (Lupinus luteus L. DEPENDING ON THE FORECROP, SEED INOCULATION WITH Bradyrhizobium lupini AND GENISTEIN

    Directory of Open Access Journals (Sweden)

    Janusz PRUSIŃSKI

    2012-12-01

    Full Text Available A strict two-factor field ‘Mister’ yellow lupin experiment was made in a split-plot design in poor rye complex soil (soil valuation class IVb at the Experiment Station of the Faculty of Agriculture and Biotechnology, the University of Technology and Life Sciences at Mochełek over 2008-2011. The experiment design covered 2 factors: growing yellow lupin after intercrops of ‘Bardena’ white mustard and ‘Pastar’ winter rye as well as seed inoculation with Bradyrhizobium lupini with or without genistein added. Growing intercrops in the poor rye complex soil considerably decreased neither the Nmin content in early spring nor the size of nodulation in yellow lupin. After lupin harvest, slightly more Nmin was noted for the treatments where intercrops were applied, especially rye in the 0-30 cm layer. The weather pattern, especially moisture conditions, pointed to a special sensitivity of nodulation to water deficit or excess in the rhizosphere. The method of preparing seeds for sowing did not play a greater role in developing the Nmin content in both soil profile layers analysed. White mustard showed a negative effect on the dry weight of nodules and the total N content in the plants and the seeds of yellow lupin as well as created the least favourable conditions for the survival and the capacity for symbiosis by symbiotic bacteria remaining in soil after lupin harvest. The state of yellow lupin plant nitrogen nutrition did not depend on the experimental factors.

  15. Hypocholesterolaemic effects of lupin protein and pea protein/fibre combinations in moderately hypercholesterolaemic individuals.

    Science.gov (United States)

    Sirtori, Cesare R; Triolo, Michela; Bosisio, Raffaella; Bondioli, Alighiero; Calabresi, Laura; De Vergori, Viviana; Gomaraschi, Monica; Mombelli, Giuliana; Pazzucconi, Franco; Zacherl, Christian; Arnoldi, Anna

    2012-04-01

    The present study was aimed to evaluate the effect of plant proteins (lupin protein or pea protein) and their combinations with soluble fibres (oat fibre or apple pectin) on plasma total and LDL-cholesterol levels. A randomised, double-blind, parallel group design was followed: after a 4-week run-in period, participants were randomised into seven treatment groups, each consisting of twenty-five participants. Each group consumed two bars containing specific protein/fibre combinations: the reference group consumed casein+cellulose; the second and third groups consumed bars containing lupin or pea proteins+cellulose; the fourth and fifth groups consumed bars containing casein and oat fibre or apple pectin; the sixth group and seventh group received bars containing combinations of pea protein and oat fibre or apple pectin, respectively. Bars containing lupin protein+cellulose ( - 116 mg/l, - 4·2%), casein+apple pectin ( - 152 mg/l, - 5·3%), pea protein+oat fibre ( - 135 mg/l, - 4·7%) or pea protein+apple pectin ( - 168 mg/l, - 6·4%) resulted in significant reductions of total cholesterol levels (Ppea protein+cellulose. The present study shows the hypocholesterolaemic activity and potential clinical benefits of consuming lupin protein or combinations of pea protein and a soluble fibre, such as oat fibre or apple pectin.

  16. The Effect of Lupin (Lupinus Angustifolius Supplementation on Adaptation of Ewes after Short Transport Stress

    Directory of Open Access Journals (Sweden)

    Sopková D.

    2016-03-01

    Full Text Available Vehicle transportation represents acute stress to animals with release of catecholamines and glucocorticoids from the adrenal gland resulting in impaired metabolic state. Such changes in metabolism may be reduced by the application of suitable feed supplement. The aim of this study was to test the effects of lupin supplementation applied after 1-hour transportation. Ewes in the control group (n = 7 were fed on trefoil-grass silage and hay, while the diet of the experimental group (n = 7 was supplemented with lupin groats (Lupinus angustifolius, var. SONET; 500 g per head per day for 8 days. In both groups, blood was collected on the day of transportation and on Days 6 and 11 thereafter. Total blood parameters were assayed using spectrophotometry and fractions of protein, cholesterol, and lactate dehydrogenase using agarose electrophoresis. Lupin increased the albumin: globulin (ALB : GLB ratio and beta-hydroxybutyrate (BHB concentration and reduced serum cholesterol and lactate, however it had no effect on body weight, body condition score (BCS, plasma glucose, serum protein, high-density lipoprotein (HDL, low-density lipoprotein (LDL, and very low-density lipoprotein (VLDL cholesterol, lactate dehydrogenase (LDH or alkaline phosphatise (ALP. Lupin may therefore be used as suitable feed supplement for sheep at times of high nutrient requirement.

  17. Influence of bitter lupin on consumption and digestibility in organic dairy cattle soya bean free diets

    Directory of Open Access Journals (Sweden)

    R. Tocci

    2010-04-01

    Full Text Available One of the main principles of organic husbandry is that animal feed must be GMO free, and soya bean is well-known as a high risk GMO alimentary source. About 25 dry dairy cattle of the Italian Holstein breed, from the Cooperativa Emilio Sereni of Borgo S. Lorenzo (FI, were fed in two successive diets: the first with extruded soya bean (A, and the second in which bitter lupin, faba bean and proteinic pea substituted the soya bean (B. We evaluated both the consumption and the apparent digestibility (using acid insoluble ash as internal marker of the two diets, repeating the trial twice. The presence of bitter lupin did not influence either the consumption of other feed, or the faecal water content. The apparent digestibility of the organic matter resulted satisfactory in both the diets, but was significantly higher in diet (A than in diet (B (71,6% vs 67,3%. In conclusion, even though we wish the cultivation of sweet lupin would be increase in Italy, we retain that also bitter lupin (mixed with other feed to increase the palatability could be used as alternative protein source in dairy cattle diets.

  18. Lupines, poison-hemlock and Nicotiana spp: toxicity and teratogenicity in livestock.

    Science.gov (United States)

    Panter, K E; James, L F; Gardner, D R

    1999-02-01

    Many species of lupines contain quinolizidine or piperidine alkaloids known to be toxic or teratogenic to livestock. Poison-hemlock (Conium maculatum) and Nicotiana spp. including N. tabacum and N. glauca contain toxic and teratogenic piperidine alkaloids. The toxic and teratogenic effects from these plant species have distinct similarities including maternal muscular weakness and ataxia and fetal contracture-type skeletal defects and cleft palate. It is believed that the mechanism of action of the piperidine and quinolizidine alkaloid-induced teratogenesis is the same; however, there are some differences in incidence, susceptible gestational periods, and severity between livestock species. Wildlife species have also been poisoned after eating poison-hemlock but no terata have been reported. The most widespread problem for livestock producers in recent times has been lupine-induced "crooked calf disease." Crooked calf disease is characterized as skeletal contracture-type malformations and occasional cleft palate in calves after maternal ingestion of lupines containing the quinolizidine alkaloid anagyrine during gestation days 40-100. Similar malformations have been induced in cattle and goats with lupines containing the piperidine alkaloids ammodendrine, N-methyl ammodendrine, and N-acetyl hystrine and in cattle, sheep, goats, and pigs with poison-hemlock containing predominantly coniine or gamma-coniceine and N. glauca containing anabasine. Toxic and teratogenic effects have been linked to structural aspects of these alkaloids, and the mechanism of action is believed to be associated with an alkaloid-induced inhibition of fetal movement during specific gestational periods. This review presents a historical perspective, description and distribution of lupines, poison-hemlock and Nicotiana spp., toxic and teratogenic effects and management information to reduce losses.

  19. The role of acid anion on the inhibition of the acidic corrosion of steel by lupine extract

    Energy Technology Data Exchange (ETDEWEB)

    Abdel-Gaber, A.M. [Chemistry Department, Faculty of Science, Alexandria University, Ibrahimia, P.O. Box 426, Alexandria 21321 (Egypt)], E-mail: ashrafmoustafa@yahoo.com; Abd-El-Nabey, B.A.; Saadawy, M. [Chemistry Department, Faculty of Science, Alexandria University, Ibrahimia, P.O. Box 426, Alexandria 21321 (Egypt)

    2009-05-15

    The inhibitive effect of lupine (Lupinous albus L.) extract on the corrosion of steel in aqueous solution of 1 M sulphuric and 2 M hydrochloric acids was investigated by potentiodynamic polarization and electrochemical impedance spectroscopy (EIS) techniques. Potentiodynamic polarization curves indicated that the lupine extract acts as a mixed-type inhibitor. EIS measurements showed that the dissolution process is under activation control. The inhibition efficiency of the extract obtained from impedance and polarization measurements was in a good agreement and was found to increase with increasing concentration of the extract. The obtained results showed that, the lupine extract could serve as an effective inhibitor for the corrosion of steel in acid media and the extract was more effective in case of hydrochloric acid. Theoretical fitting of the corrosion data to the kinetic-thermodynamic model was tested to show the nature of adsorption.

  20. Solid state fermentation with lactic acid bacteria to improve the nutritional quality of lupin and soya bean.

    Science.gov (United States)

    Bartkiene, Elena; Krungleviciute, Vita; Juodeikiene, Grazina; Vidmantiene, Daiva; Maknickiene, Zita

    2015-04-01

    The ability of bacteriocin-like inhibitory substance (BLIS)-producing lactic acid bacteria (LAB) to degrade biogenic amines as well as to produce L(+) and D(-)-lactic acid during solid state fermentation (SSF) of lupin and soya bean was investigated. In addition, the protein digestibility and formation of organic acids during SSF of legume were investigated. Protein digestibility of fermented lupin and soya bean was found higher on average by 18.3% and 15.9%, respectively, compared to untreated samples. Tested LAB produced mainly L-lactic acid in soya bean and lupin (D/L ratio 0.38-0.42 and 0.35-0.54, respectively), while spontaneous fermentation gave almost equal amounts of both lactic acid isomers (D/L ratio 0.82-0.98 and 0.92, respectively). Tested LAB strains were able to degrade phenylethylamine, spermine and spermidine, whereas they were able to produce putrescine, histamine and tyramine. SSF improved lupin and soya bean protein digestibility. BLIS-producing LAB in lupin and soya bean medium produced a mixture of D- and L-lactic acid with a major excess of the latter isomer. Most toxic histamine and tyramine in fermented lupin and soya bean were found at levels lower those causing adverse health effects. Selection of biogenic amines non-producing bacteria is essential in the food industry to avoid the risk of amine formation. © 2014 Society of Chemical Industry.

  1. Characterization and mapping of LanrBo: a locus conferring anthracnose resistance in narrow-leafed lupin (Lupinus angustifolius L.).

    Science.gov (United States)

    Fischer, Kristin; Dieterich, Regine; Nelson, Matthew N; Kamphuis, Lars G; Singh, Karam B; Rotter, Björn; Krezdorn, Nicolas; Winter, Peter; Wehling, Peter; Ruge-Wehling, Brigitte

    2015-10-01

    A novel and highly effective source of anthracnose resistance in narrow-leafed lupin was identified. Resistance was shown to be governed by a single dominant locus. Molecular markers have been developed, which can be used for selecting resistant genotypes in lupin breeding. A screening for anthracnose resistance of a set of plant genetic resources of narrow-leafed lupin (Lupinus angustifolius L.) identified the breeding line Bo7212 as being highly resistant to anthracnose (Colletotrichum lupini). Segregation analysis indicated that the resistance of Bo7212 is inherited by a single dominant locus. The corresponding resistance gene was given the designation LanrBo. Previously published molecular anchor markers allowed us to locate LanrBo on linkage group NLL-11 of narrow-leafed lupin. Using information from RNAseq data obtained with inoculated resistant vs. susceptible lupin entries as well as EST-sequence information from the model genome Lotus japonicus, additional SNP and EST markers linked to LanrBo were derived. A bracket of two LanrBo-flanking markers allows for precise marker-assisted selection of the novel resistance gene in narrow-leafed lupin breeding programs.

  2. Short-Term Effects of Lupin vs. Whey Supplementation on Glucose and Insulin Responses to a Standardized Meal in a Randomized Cross-Over Trial.

    Science.gov (United States)

    Schopen, Kathrin; Ewald, Ann C; Johannes, Bernd W; Bloch, Wilhelm; Rittweger, Jörn; Frings-Meuthen, Petra

    2017-01-01

    Background: Whey protein is known to reduce postprandial glycaemia in people with type 2 diabetes mellitus. Lupin as a vegetable source of protein could be considered as an alternative, as the percentage of vegetarian and vegan consumers is raising. The present study compares the acute glycemic effects of whey and lupin in healthy volunteers following a carbohydrate-rich reference meal. Methods In cross-over design, three standardized meals (reference meal; reference meal + whey; reference meal + lupin) were provided to 12 healthy male and female volunteers, aged between 23 and 33, in a balanced, randomized order. Volunteers' blood glucose and insulin concentrations were analyzed at baseline and at seven time points following the ingestion of the meals. Results: The supplementation of whey or lupin significantly blunted the postprandial increase in blood glucose concentrations compared to the reference meal ( p AUC whey-lupin = 8%, 0-60 min area under the curve (0-60 min AUC), p = 0.937], with a blunting effect of -46% by whey ( p = 0.005, 0-60 min AUC) and of -54% by lupin ( p AUC). When comparing whey and lupin data only, the insulin increase was found to be more pronounced for whey protein than for lupin supplementation (Δ AUC whey-lupin = 39%, 0-60 min AUC, p = 0.022). However, when comparing the insulin response of each supplementation to the one of the reference meal, no differences could be detected (whey p = 0.259, 0-60 min AUC; lupin p = 0.275, 0-60 min AUC). Conclusions: Results suggest that lupin and whey can both lower the increase of postprandial blood glucose concentrations to a comparable extent, implying the usability of lupin to reduce postprandial glycaemia. However, the insulin response following the supplementations to a carbohydrate-rich meal seems to differ for these two protein sources.

  3. Effects of intercropping of oat (Avena sativa L.) with white lupin (Lupinus albus L.) on the mobility of target elements for phytoremediation and phytomining in soil solution.

    Science.gov (United States)

    Wiche, Oliver; Székely, Balazs; Kummer, Nicolai-Alexeji; Moschner, Christin; Heilmeier, Hermann

    2016-09-01

    This study aims to investigate how intercropping of oat (Avena sativa L.) with white lupin (Lupinus albus L.) affects the mobile fractions of trace metals (Fe, Mn, Pb, Cd, Th, U, Sc, La, Nd, Ge) in soil solution. Oat and white lupin were cultivated in monocultures and mixed cultures with differing oat/white lupin ratios (11% and 33% lupin, respectively). Temporal variation of soil solution chemistry was compared with the mobilization of elements in the rhizosphere of white lupin and concentrations in plant tissues. Relative to the monocrops, intercropping of oat with 11% white lupin significantly increased the concentrations of Fe, Pb, Th, La and Nd in soil solution as well as the concentrations of Fe, Pb, Th, Sc, La and Nd in tissues of oat. Enhanced mobility of the mentioned elements corresponded to a depletion of elements in the rhizosphere soil of white lupin. In mixed cultures with 33% lupin, concentrations in soil solution only slightly increased. We conclude that intercropping with 11% white lupin might be a promising tool for phytoremediation and phytomining research enhancing mobility of essential trace metals as well as elements with relevance for phytoremediation (Pb, Th) and phytomining (La, Nd, Sc) in soil.

  4. Evaluation of faba beans ( Vicia faba cv. Fiord) and sweet lupins ...

    African Journals Online (AJOL)

    Evaluation of faba beans ( Vicia faba cv. Fiord) and sweet lupins ( Lupizus albus cv. Kiev) as protein sources for ... P igsi n the metabolisrna ndN balance trial consurned5 % less( P < 0.01)o 1'thel upind ietc omparedto the fabab eand iet (l 370 vs. | 440 gld).N o significandt ift'erenceisn the digestiblee nergy( DE) contenta nd ...

  5. Microencapsulation by spray drying of nitrogen-fixing bacteria associated with lupin nodules.

    Science.gov (United States)

    Campos, Daniela C; Acevedo, Francisca; Morales, Eduardo; Aravena, Javiera; Amiard, Véronique; Jorquera, Milko A; Inostroza, Nitza G; Rubilar, Mónica

    2014-09-01

    Plant growth promoting bacteria and nitrogen-fixing bacteria (NFB) used for crop inoculation have important biotechnological potential as a sustainable fertilization tool. However, the main limitation of this technology is the low inoculum survival rate under field conditions. Microencapsulation of bacterial cells in polymer matrices provides a controlled release and greater protection against environmental conditions. In this context, the aim of this study was to isolate and characterize putative NFB associated with lupin nodules and to evaluate their microencapsulation by spray drying. For this purpose, 21 putative NFB were isolated from lupin nodules and characterized (16S rRNA genes). Microencapsulation of bacterial cells by spray drying was studied using a mixture of sodium alginate:maltodextrin at different ratios (0:15, 1:14, 2:13) and concentrations (15 and 30% solids) as the wall material. The microcapsules were observed under scanning electron microscopy to verify their suitable morphology. Results showed the association between lupin nodules of diverse known NFB and nodule-forming bacteria belonging to Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria and Bacteroidetes. In microencapsulation assays, the 1:14 ratio of sodium alginate:maltodextrin (15% solids) showed the highest cell survival rate (79%), with a microcapsule yield of 27% and spherical microcapsules of 5-50 µm in diameter. In conclusion, diverse putative NFB genera and nodule-forming bacteria are associated with the nodules of lupine plants grown in soils in southern Chile, and their microencapsulation by spray drying using sodium alginate:maltodextrin represents a scalable process to generate a biofertilizer as an alternative to traditional nitrogen fertilization.

  6. Xylem-to-phloem transfer of boron in broccoli and lupin during early reproductive growth

    Energy Technology Data Exchange (ETDEWEB)

    Shelp, B J; Kitheka, A M; Cauwenberghe, O.R. Van [Univ. of Guelph, Dept. of Horticultural Science, Guelph, ON (Canada); Vanderpool, R A [Grand Forks Human Nutrition Research Center, Agricultural Research service, Grand Forks, ND (United States); Spiers, G A [Univ. of Guelph, Dept. of Land Resource Science, Guelph, ON (Canada)

    1998-12-01

    The aim of this study was to test the hypothesis that newly-acquired boron (B) undergoes rapid xylem-to-phloem transfer in plants with restricted mobility. Analysis of the element accumulation and water usage by shoots of intact broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants provided with a non-deficient supply of B, revealed that the concentration of various mineral elements (K, P, Mg, Ca, B, Fe, Zn, Mo, Cu, Mn) in xylem sap of intact plants ranged from 0.3 {mu}M to 3.5 mM, with B being present at 2.9-3.5 {mu}M. For each element assayed, the concentration was higher in phloem exudate (1.6 {mu}M to 91 mM) than in xylem sap; B was present at about 0.4 mM. Intact broccoli and lupin plants or detached transpiring broccoli shoots were supplied simultaneously with enriched {sup 10}B, strontium (a xylem marker) and rubidium (a xylem/phloem marker) during early reproductive growth. The contents of these three compounds were determined in foliage and florets or fruits as a function of time (i.e. up to 12 h and 4 days for broccoli and lupin plants, respectively), and the content in florets or fruits was expressed as a percent of the total recovered. In general, the percent recovery of both {sup 10}B and rubidium in florets or fruits was similar and markedly greater than that for strontium, even at the earliest harvest times (within 2 h for broccoli and 1 day for lupin). The data indicate that in plants with restricted B mobility, B is supplied to sink tissues in the phloem, and the extent of B xylem-to-phloem transfer is closely determined by current uptake. (au) 35 refs.

  7. Xylem-to-phloem transfer of boron in broccoli and lupin during early reproductive growth

    International Nuclear Information System (INIS)

    Shelp, B.J.; Kitheka, A.M.; Cauwenberghe, O.R. Van; Vanderpool, R.A.; Spiers, G.A.

    1998-01-01

    The aim of this study was to test the hypothesis that newly-acquired boron (B) undergoes rapid xylem-to-phloem transfer in plants with restricted mobility. Analysis of the element accumulation and water usage by shoots of intact broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants provided with a non-deficient supply of B, revealed that the concentration of various mineral elements (K, P, Mg, Ca, B, Fe, Zn, Mo, Cu, Mn) in xylem sap of intact plants ranged from 0.3 μM to 3.5 mM, with B being present at 2.9-3.5 μM. For each element assayed, the concentration was higher in phloem exudate (1.6 μM to 91 mM) than in xylem sap; B was present at about 0.4 mM. Intact broccoli and lupin plants or detached transpiring broccoli shoots were supplied simultaneously with enriched 10 B, strontium (a xylem marker) and rubidium (a xylem/phloem marker) during early reproductive growth. The contents of these three compounds were determined in foliage and florets or fruits as a function of time (i.e. up to 12 h and 4 days for broccoli and lupin plants, respectively), and the content in florets or fruits was expressed as a percent of the total recovered. In general, the percent recovery of both 10 B and rubidium in florets or fruits was similar and markedly greater than that for strontium, even at the earliest harvest times (within 2 h for broccoli and 1 day for lupin). The data indicate that in plants with restricted B mobility, B is supplied to sink tissues in the phloem, and the extent of B xylem-to-phloem transfer is closely determined by current uptake. (au)

  8. KINETICS OF EXTRACTION OF EXTRACTIVE SUBSTANCES FROM A LUPINE WITH VARIOUS GEOMETRICAL FORM

    Directory of Open Access Journals (Sweden)

    S. S. Ivanov

    2014-01-01

    Full Text Available Summary. Relevance of a subject is proved and the main directions of researches are defined. The research problem is formulated – to predict rate of decrease in a mass-containingf a firm phase and to establish functional connection of concentration of extract over time. Soy and lupine, as sources of valuable nutritious components are analysed. The soy shortcomings which chemical components are inhibitors of a number of digestive enzymes, such as pepsin and chymotrypsin are convincingly shown. The carbohydrate fraction of soy is rich with the oligosaccharides causing an intestinal meteorism. Therefore topical issue about replacement of soy with perspective leguminous culture – the lupine, deprived of the shortcomings inherent in soy. The structure and physical and chemical properties of subcheese serum is presented. The method of calculation of the average sizes of particles of raw materials of a sphere having a geometrical form, the cylinder and an unlimited plate is received. Results of research of kinetics of extraction from a lupine are given at various geometrical form of raw materials. The preferable shape of a body is defined at exhausting course of process of extraction of raw materials in the form of a plate. At the same time, other geometrical forms aren't denied as the form of crumbled, for example, is more technological in production. Graphic dependences are in details described and the analysis of the obtained data is made. Composition use – dairy plant extract in various industries and, in particular, in dairy for receiving lactic products is offered. Further work is determination of coefficients of molecular diffusion, creation of mathematical models with use of the received extraction dependences, and also the process software. This material, in its cumulative analysis, gives the chance to choose hardware and technological registration of process of extraction which will provide the maximum extraction from a lupine of a

  9. Effect of Germination and Fermentation on Carbohydrate Composition of Australian Sweet Lupin and Soybean Seeds and Flours.

    Science.gov (United States)

    Kaczmarska, Kornelia T; Chandra-Hioe, Maria V; Zabaras, Dimitrios; Frank, Damian; Arcot, Jayashree

    2017-11-22

    This study investigated the effect of germination and fermentation on the composition of carbohydrates in Australian sweet lupin. Specifically, the amount of sugars (sucrose, fructose, and glucose), starch, oligosaccharides (verbascose, stachyose, and raffinose), and dietary fiber were measured in germinated lupin seeds and fermented lupin flour, and compared with those in soy. High performance liquid chromatography coupled with refractive index was employed for quantitation of sugars, starch, and oligosaccharides, and gas chromatography coupled with a flame ionization detector was used for quantitation of simple sugars in total, and soluble, and insoluble dietary fiber. The enzyme activities of α-amylase and α-glucosidase were compared before and after germination or fermentation. The α-amylase activity in germinated lupin increased to  ∼17 nmol/mL/min/0.1 g and in germinated soy∼32; in fermented lupin, the activity increased to ∼52, while in fermented soy it decreased to ∼20. In general, germination or fermentation decreased the oligosaccharide content, and increased the total sugar in samples (p Fermentation with yogurt culture lowered the content of total oligosaccharides due to 94% decrease in stachyose. Total oligosaccharides in soy flour prior to fermentation were 180 mg/g and significantly decreased to ∼124 mg/g in fermented soy. Germination did not affect the starch content. There was no significant change in the amounts of total, soluble, and insoluble dietary fiber after germination or fermentation of lupin except for galactose, which was significantly reduced in germinated lupin seeds. Soluble dietary fiber in germinated soy significantly increased. Germination and fermentation are simple and effective techniques to reduce the oligosaccharides while maintaining the composition of dietary fibers.

  10. Development of a testing system for the documentation and evaluation of the weed-suppressing ability of blue lupins

    Directory of Open Access Journals (Sweden)

    Böhm, Herwart

    2016-02-01

    Full Text Available Within the framework of a joint research project for breeding advancement of blue and yellow lupins, which is being conducted in cooperation with the Julius Kühn-Institute, Institute for Breeding Research on Agricultural Crops (coordinator, Saatzucht Steinach and the IPK Gatersleben, in a sub-project at the Thünen-Institute of Organic Farming 1. a test system for detection and assessment of weed-suppressing effect of blue lupins will be developed, and 2. this test system will be tested to pre-breeding lines of blue lupin. In the first year of the project, plot trials were conducted in 3-fold field repetition with two phenological widely differing varieties (cv. Boruta [terminated type], cv. Boregine [branched type] in combination with selected partners with four different seed rates. As partners, monocotyledonous species (e.g., cereals and dicotyledonous species (false flax or resp., a mixture of oil seed rape, phacelia and buckwheat, are used. Twice during the growing season and at harvest, the aboveground biomass, separated by lupin, partners and weeds, were recorded. The results of the first project year show that all the partner plants which should serve as artificial weeds were successfully established. False flax leads to the strongest effect on the development of lupins, which showed the lowest biomass production in these variants. In comparison to the sown partners, the false flax variants also showed the highest biomass production, while the lowest biomass production was recorded for the natural weeds occurring at the site. The species mixture of oil seed rape, phacelia and buckwheat, however, led to the lowest biomass production; contemporaneously the biomass production of lupins in these variants was only affected slightly. Comparing the two cultivated lupin varieties, Boruta showed a better weed suppressive effect.

  11. European Origin of Bradyrhizobium Populations Infecting Lupins and Serradella in Soils of Western Australia and South Africa† ‡

    Science.gov (United States)

    Stępkowski, Tomasz; Moulin, Lionel; Krzyżańska, Agnieszka; McInnes, Alison; Law, Ian J.; Howieson, John

    2005-01-01

    We applied a multilocus phylogenetic approach to elucidate the origin of serradella and lupin Bradyrhizobium strains that persist in soils of Western Australia and South Africa. The selected strains belonged to different randomly amplified polymorphic DNA (RAPD)-PCR clusters that were distinct from RAPD clusters of applied inoculant strains. Phylogenetic analyses were performed with nodulation genes (nodA, nodZ, nolL, noeI), housekeeping genes (dnaK, recA, glnII, atpD), and 16S-23S rRNA intergenic transcribed spacer sequences. Housekeeping gene phylogenies revealed that all serradella and Lupinus cosentinii isolates from Western Australia and three of five South African narrow-leaf lupin strains were intermingled with the strains of Bradyrhizobium canariense, forming a well supported branch on each of the trees. All nodA gene sequences of the lupin and serradella bradyrhizobia formed a single branch, referred to as clade II, together with the sequences of other lupin and serradella strains. Similar patterns were detected in nodZ and nolL trees. In contrast, nodA sequences of the strains isolated from native Australian legumes formed either a new branch called clade IV or belonged to clade I or III, whereas their nonsymbiotic genes grouped outside the B. canariense branch. These data suggest that the lupin and serradella strains, including the strains from uncultivated L. cosentinii plants, are descendants of strains that most likely were brought from Europe accidentally with lupin and serradella seeds. The observed dominance of B. canariense strains may be related to this species' adaptation to acid soils common in Western Australia and South Africa and, presumably, to their intrinsic ability to compete for nodulation of lupins and serradella. PMID:16269740

  12. European origin of Bradyrhizobium populations infecting lupins and serradella in soils of Western Australia and South Africa.

    Science.gov (United States)

    Stepkowski, Tomasz; Moulin, Lionel; Krzyzańska, Agnieszka; McInnes, Alison; Law, Ian J; Howieson, John

    2005-11-01

    We applied a multilocus phylogenetic approach to elucidate the origin of serradella and lupin Bradyrhizobium strains that persist in soils of Western Australia and South Africa. The selected strains belonged to different randomly amplified polymorphic DNA (RAPD)-PCR clusters that were distinct from RAPD clusters of applied inoculant strains. Phylogenetic analyses were performed with nodulation genes (nodA, nodZ, nolL, noeI), housekeeping genes (dnaK, recA, glnII, atpD), and 16S-23S rRNA intergenic transcribed spacer sequences. Housekeeping gene phylogenies revealed that all serradella and Lupinus cosentinii isolates from Western Australia and three of five South African narrow-leaf lupin strains were intermingled with the strains of Bradyrhizobium canariense, forming a well supported branch on each of the trees. All nodA gene sequences of the lupin and serradella bradyrhizobia formed a single branch, referred to as clade II, together with the sequences of other lupin and serradella strains. Similar patterns were detected in nodZ and nolL trees. In contrast, nodA sequences of the strains isolated from native Australian legumes formed either a new branch called clade IV or belonged to clade I or III, whereas their nonsymbiotic genes grouped outside the B. canariense branch. These data suggest that the lupin and serradella strains, including the strains from uncultivated L. cosentinii plants, are descendants of strains that most likely were brought from Europe accidentally with lupin and serradella seeds. The observed dominance of B. canariense strains may be related to this species' adaptation to acid soils common in Western Australia and South Africa and, presumably, to their intrinsic ability to compete for nodulation of lupins and serradella.

  13. Distribution of radionuclides in leaf-stem biomass of lupine and clover under production of protein concentrates

    International Nuclear Information System (INIS)

    Novikov, Yu.F.; Lobach, G.A.; Buzenko, T.A.; Zaretskaya, T.P.

    1993-01-01

    The basic regularities of radionuclide distribution between the obtained products have been studied using the fractionation of lupine and clover phytomass as an example. The content of radionuclides in protein concentrates has been shown to be strongly related to the crop species. A scheme and a regime of the fractionation of leaf-stem lupine biomass contaminated with cesium radioisotopes and strontium-90 which ensured the minimizing of their residual content in protein-vitaminic and protein concentrates have been selected with due accout of experimental data

  14. Lupin seeds lower plasma lipid concentrations and normalize antioxidant parameters in rats

    Directory of Open Access Journals (Sweden)

    Osman, M.

    2011-06-01

    Full Text Available This study was designed to test bitter and sweet lupin seeds for lipid-lowering and for their antioxidative activities in hypercholesterolemic rats. The levels of plasma lipid, malondialdehyde (MDA and whole blood reduced glutathione (GSH, as well as the activities of transaminases (ALT and AST, lactate dehydrogenase (LDH in plasma, superoxide dismutase (SOD, glutathione peroxidase (GPx in erythrocytes and plasma glutathione reductase (GR, glutathione-S-transferase (GST and catalase (CAT were examined. A hypercholesterolemia-induced diet manifested in the elevation of total lipids (TL, total cholesterol (TC, triglycerides (TG, LDL-C and MDA levels, ALT, AST, LDH activities and the depletion of GSH and enzymic antioxidants. The supplementation of a hypercholesterolemia-induced diet with bitter and sweet lupin seeds significantly lowered the plasma levels of TL, TC, TG and LDL-C. ALT, AST and LDH activities slightly decreased in treated groups compared with the hypercholesterolemic group (HC. Furthermore, the content of GSH significantly increased while MDA significantly decreased in treated groups compared with the HC group. In addition, the bitter lupin seed group improved enzymic antioxidants compared with the HC group. In general, the results indicated that the bitter lupin seed supplements are better than those containing sweet lupin seeds. These results suggested that the hypocholesterolemic effect of bitter and sweet lupin seed supplements might be due to their abilities to lower the plasma cholesterol level as well as to slow down the lipid peroxidation process and to enhance the antioxidant enzyme activity.

    Este estudio fue diseñado para evaluar semillas de altramuces dulces y amargas como agentes que bajan los lípidos y estudiar su efecto en la actividad antioxidante en ratas hipercolesterolémicas. El nivel de lípidos en plasma, malondialdehido (MDA y glutatión reducido (GSH, así como la actividad transaminasa (ALT y AST

  15. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  16. Comparing of organic nutrients digestibility in the feed rations containing lupin and peas in horses

    OpenAIRE

    Pavel Šajdler; Ladislav Zeman

    2005-01-01

    The aim of this study was to find out and compare organic nutrients digestibility in feed rations containing different forage legumes in balance trials on horses. The trials were always performed on a group of six sports horses (weight of 495 to 742 kg). Six feed rations were tested, which contained different proportion of certain forage legume in empirical feed mixtures. Three feed mixtures contained white lupine seeds (WLS) – Lu 0 (0.01% WLS), Lu 7 (7% WLS), Lu 14 (14% WLS) and surplus thre...

  17. Effect of extrusion, espansion and toasting on the nutritional value of peas, faba beans and lupins

    Directory of Open Access Journals (Sweden)

    Filippo Rossi

    2010-01-01

    Full Text Available An assessment was made of the effect that different treatments (toasting, expansion, extrusion have on the nutritionalvalue of protein plants (pea, faba bean, lupin. In a randomized block design, feeds were screened for enzymaticdigestibility of starch and protein, N solubility and in vitro protein degradability. Expansion and extrusion cause increasedstarch enzymatic degradability while toasting produced virtually no effects. In peas this value increased from 11.80% inmeal to 39.70% in the extruded product; 85.37% is the percentage for the expanded product, while 10.90% is the starchdigestibility value for toasted peas. In faba beans the extrusion process increased starch digestibility from 11.39% to85.05%, while in extruded lupins a complete starch hydrolysis was obtained, while in the meal the polysaccharide digestionwas 54.48%.The expansion and extrusion processes significantly decreased rumen degradability during the first 8 hours of incubation.Toasted peas had lower degradability if compared with controls but not with the other treatments. The onlypotentially alternative source to soybean is the extruded faba bean. In spite of its lower protein content, this feed ischaracterized by a considerably lower in vitro protein degradability than soybean. This implies that the digestible foodprotein content is comparable (124.90 g/kg DM to that of soybean (109.78 g/kg DM and definitely higher than thatof all other protein plants.

  18. A novel technique for compensation of space charge effects in the LUPIN-II detector

    Energy Technology Data Exchange (ETDEWEB)

    Cassell, C., E-mail: cc878@uowmail.edu.au [Politecnico of Milan, Department of Energy, Via la Masa 34, 20154 Milan (Italy); University of Wollongong, Centre for Medical Physics, NSW 2522 (Australia); Ferrarini, M. [Fondazione CNAO, via Caminadella16, 20123 Milano (Italy); Rosenfeld, A. [University of Wollongong, Centre for Medical Physics, NSW 2522 (Australia); Caresana, M. [Politecnico of Milan, Department of Energy, Via la Masa 34, 20154 Milan (Italy)

    2015-12-21

    A new method for improving REM counter performance in Pulsed Neutron Fields (PNFs) has been developed. This method uses an analysis of the build-up of space charge in the counter to compensate for an underestimation of Ambient Dose Equivalent (H*(10)) in intense pulsed fields. It was applied to three sets of experimental data acquired using the LUPIN-II REM counter device, which is designed for use in PNFs. The data was acquired using the cyclotron at Helmholtz-Zentrum Berlin für Materialien und Energie GmbH (HZB), at the HiRadMat facility at CERN and at the ‘Elettra Sincrotrone Trieste’ (ELETTRA), Italy. A comparison of the data with and without this compensation method is used to highlight its effectiveness. The LUPIN-II performance, which has already been shown to be able to cope with fields of up to hundreds of nSv/burst, is improved by at least one order of magnitude, with further potential for improvement.

  19. Evaluation of antihyperglycemic effect of trigonella foenum-graecum (fenugreek) and lupinus albus (lupine) in alloxan-induced diabetic rats

    Energy Technology Data Exchange (ETDEWEB)

    Noaman, E; Mansour, S Z; Ibrahim, N K [Radiation Biology Dept., National Centre for Radiation Research and Technology, Atomic Energy Authority, Cairo (Egypt)

    2007-07-01

    Alloxan induced diabetic rats were used to evaluate the antihyperglycemic effect of Trigonella Foenum graecum (Fenugreek) and Lupinus Albus (Lupine). The parameters measured during the 45 days oral administration of seeds powder suspension of either Fenugreek or Lupine (1 g/ kg body wt) included: blood glucose, body wt, reduced glutathione content, plasma thiobarbituric acid reactive substances (TEARS), and percentage of glycosylated hemoglobin (HbA), plasma insulin and liver free fatty acids. Fenugreek and Lupine resulted in significant reduction in blood glucose and HbA; restored insulin normal range, ameliorated the contents of glutathione and reduced the increase in the content of plasma TBARS. Lupine at dose of 1 g/ kg body wt exhibited better glucose reduction, restored body wt and free fatty acids concentration than Fenugreek. Diabetes mellitus is the most common disease associated with carbohydrate metabolism, affecting about 200 million people worldwide. Extracts of various plant materials capable of decreasing blood sugar have been tested in experimental animal models (Bopanna and Rathod, 1997). Many unknown and lesser known plants are used in traditional medicinal practices in Egypt. The medicinal values of these plants are not much known to the scientific world. Although herbal medicines have long been used effectively in treating many diseases throughout the world, the mechanism of most of the herbals used has not been defined. Many traditional plant treatments for diabetes are also used, but most of the evidence for their beneficial effects is anecdotal (Jelodar et al., 2005)

  20. Plasma membrane H+-ATPase-dependent citrate exudation from cluster roots of phosphate-deficient white lupin

    DEFF Research Database (Denmark)

    Tomasi, Nicola; Kretzschmar, Tobias; Espen, Luca

    2009-01-01

    ABSTRACT White lupin (Lupinus albus L.) is able to grow on soils with sparingly available phosphate (P) by producing specialized structures called cluster roots.To mobilize sparingly soluble P forms in soils, cluster roots release substantial amounts of carboxylates and concomitantly acidify the ...

  1. Intermittent grazing: A management tool to reduce the impact of lupine-induced Crooked Calf Syndrome (CCS)

    Science.gov (United States)

    The Lupinus genus is a large group of legumes, some of which cause a congenital condition in cattle referred to as “Crooked Calf Syndrome” (CCS). Only Lupines that contain the alkaloids anagyrine or ammodendrine are problematic to cattle producers. The syndrome is manifest by a series of multiple ...

  2. Crooked Calf Syndrome: Managing Lupines on Rangelands of the Channel Scablands of East-Central Washington State

    Science.gov (United States)

    “Crooked calf syndrome”, the contracture-type skeletal defects and cleft palate caused by velvet lupine (Lupinus leucophyllus) on the channel Scablands of east-central Washington State are the same as those defects induced by Conium maculatum (poison-hemlock) and Nicotiana spp. (wild tobacco) in rum...

  3. Evaluation of antihyperglycemic effect of trigonella foenum-graecum (fenugreek) and lupinus albus (lupine) in alloxan-induced diabetic rats

    International Nuclear Information System (INIS)

    Noaman, E.; Mansour, S.Z.; Ibrahim, N.K.

    2007-01-01

    Alloxan induced diabetic rats were used to evaluate the antihyperglycemic effect of Trigonella Foenum graecum (Fenugreek) and Lupinus Albus (Lupine). The parameters measured during the 45 days oral administration of seeds powder suspension of either Fenugreek or Lupine (1 g/ kg body wt) included: blood glucose, body wt, reduced glutathione content, plasma thiobarbituric acid reactive substances (TEARS), and percentage of glycosylated hemoglobin (HbA), plasma insulin and liver free fatty acids. Fenugreek and Lupine resulted in significant reduction in blood glucose and HbA; restored insulin normal range, ameliorated the contents of glutathione and reduced the increase in the content of plasma TBARS. Lupine at dose of 1 g/ kg body wt exhibited better glucose reduction, restored body wt and free fatty acids concentration than Fenugreek. Diabetes mellitus is the most common disease associated with carbohydrate metabolism, affecting about 200 million people worldwide. Extracts of various plant materials capable of decreasing blood sugar have been tested in experimental animal models (Bopanna and Rathod, 1997). Many unknown and lesser known plants are used in traditional medicinal practices in Egypt. The medicinal values of these plants are not much known to the scientific world. Although herbal medicines have long been used effectively in treating many diseases throughout the world, the mechanism of most of the herbals used has not been defined. Many traditional plant treatments for diabetes are also used, but most of the evidence for their beneficial effects is anecdotal (Jelodar et al., 2005)

  4. Plant nucleoside 5'-phosphoramidate hydrolase; simple purification from yellow lupin (Lupinus luteus) seeds and properties of homogeneous enzyme.

    Science.gov (United States)

    Guranowski, Andrzej; Wojdyła, Anna M; Rydzik, Anna M; Stepiński, Janusz; Jemielity, Jacek

    2011-01-01

    Adenosine 5'-phosphoramidate (NH₂-pA) is an uncommon natural nucleotide of poorly understood biochemistry and function. We studied a plant enzyme potentially involved in the catabolism of NH₂-pA. A fast and simple method comprising extraction of yellow lupin (Lupinus luteus) seed-meal with a low ionic strength buffer, ammonium sulfate and acetone fractionations, removal of contaminating proteins by heat denaturation, and affinity chromatography on AMP-agarose, yielded homogenous nucleoside 5'-phosphoramidase. Mass spectrometric analysis showed that the lupin hydrolase exhibits closest similarity to Arabidopsis thaliana Hint1 protein. The substrate specificity of the lupin enzyme, in particular its ability to split the P-S bond in adenosine 5'-phosphorothioate, is typical of known Hint1 proteins. Adenosine 5'-phosphofluoride and various derivatives of guanosine 5'-phosphoramidate were also substrates. Neither common divalent metal cations nor 10 mM EDTA or EGTA affected the hydrolysis of NH₂-pA. The enzyme functions as a homodimer (2 x 15,800 Da). At the optimum pH of 7.0, the K(m) for NH₂-pA was 0.5 µM and k(cat) 0.8 s⁻¹ (per monomer active site). The properties of the lupin nucleoside 5'-phosphoramidase are compared with those of its counterparts from other organisms.

  5. An RNA-Seq transcriptome analysis of orthophosphate-deficient white lupin reveals novel insights into phosphorus acclimation in plants.

    Science.gov (United States)

    O'Rourke, Jamie A; Yang, S Samuel; Miller, Susan S; Bucciarelli, Bruna; Liu, Junqi; Rydeen, Ariel; Bozsoki, Zoltan; Uhde-Stone, Claudia; Tu, Zheng Jin; Allan, Deborah; Gronwald, John W; Vance, Carroll P

    2013-02-01

    Phosphorus, in its orthophosphate form (P(i)), is one of the most limiting macronutrients in soils for plant growth and development. However, the whole-genome molecular mechanisms contributing to plant acclimation to P(i) deficiency remain largely unknown. White lupin (Lupinus albus) has evolved unique adaptations for growth in P(i)-deficient soils, including the development of cluster roots to increase root surface area. In this study, we utilized RNA-Seq technology to assess global gene expression in white lupin cluster roots, normal roots, and leaves in response to P(i) supply. We de novo assembled 277,224,180 Illumina reads from 12 complementary DNA libraries to build what is to our knowledge the first white lupin gene index (LAGI 1.0). This index contains 125,821 unique sequences with an average length of 1,155 bp. Of these sequences, 50,734 were transcriptionally active (reads per kilobase per million reads ≥ 3), representing approximately 7.8% of the white lupin genome, using the predicted genome size of Lupinus angustifolius as a reference. We identified a total of 2,128 sequences differentially expressed in response to P(i) deficiency with a 2-fold or greater change and P ≤ 0.05. Twelve sequences were consistently differentially expressed due to P(i) deficiency stress in three species, Arabidopsis (Arabidopsis thaliana), potato (Solanum tuberosum), and white lupin, making them ideal candidates to monitor the P(i) status of plants. Additionally, classic physiological experiments were coupled with RNA-Seq data to examine the role of cytokinin and gibberellic acid in P(i) deficiency-induced cluster root development. This global gene expression analysis provides new insights into the biochemical and molecular mechanisms involved in the acclimation to P(i) deficiency.

  6. Effects of Different Amounts of Blue Lupine (L. Angustifolius L. in The Diets of Heavy-Type Turkeys on Their Growth Rate, Carcass and Meat Qualities

    Directory of Open Access Journals (Sweden)

    R Juodka

    Full Text Available ABSTRACT A study was carried out to determine the effects of soybean meal replacement with different amounts of blue lupine in the diets of turkeys on the growth rate, anatomic carcass dissection data, chemical indicators of breast and thigh muscles and the content of tryptophan and oxyprolin. In total three hundred and sixty cross BIG-6 turkeys were allotted to two control and ten experimental groups of 30 one-day-old turkeys. The control group of turkeys was fed the diet containing soybean meal, whereas the trial groups were offered different amounts (from 20 to 30% of lupines. Group 4 and 5 were additionally given probiotic mixture Bio Plus 2B and allzyme SSF, respectively. Soybean oil replacement from 20 to 30% lupine in the diet had no influence on the growth rate, dressing percentage, edible parts and abdominal fat content of turkeys. The study indicated that lupines in the diet of turkeys had a different effect on the meat quality of different genders. Lupines did not have any negative effect on the meat quality of female turkeys and 30% lupines even improved the protein value index of breast muscles. However, 20-30 and 25-30% lupines in male turkey diets lowered dry matter and protein contents in breast muscles but had no negative influence on the main quality indicators in thigh muscles. The results of the study showed that the negative effect on the male breast muscle quality might be avoided using Bio Plus 2B or allzyme SSF additives in the male diets containing 30% lupines.

  7. Effect of a traditional processing method on the chemical composition of local white lupin (Lupinus albus L.) seed in North-Western Ethiopia.

    Science.gov (United States)

    Yeheyis, Likawent; Kijora, Claudia; Wink, Michael; Peters, Kurt J

    2011-01-01

    The effect of a traditional Ethiopian lupin processing method on the chemical composition of lupin seed samples was studied. Two sampling districts, namely Mecha and Sekela, representing the mid- and high-altitude areas of north-western Ethiopia, respectively, were randomly selected. Different types of traditionally processed and marketed lupin seed samples (raw, roasted, and finished) were collected in six replications from each district. Raw samples are unprocessed, and roasted samples are roasted using firewood. Finished samples are those ready for human consumption as snack. Thousand seed weight for raw and roasted samples within a study district was similar (P > 0.05), but it was lower (P seed sample from Mecha was lower (P 0.05). The crude protein and crude fat contents of finished samples within a study district were higher (P seed samples. The crude ash content of raw and roasted lupin samples within a study district was higher (P processing method of lupin seeds in Ethiopia has a positive contribution improving the crude protein and crude fat content, and lowering the alkaloid content of the finished product. The study showed the possibility of adopting the traditional processing method to process bitter white lupin for the use as protein supplement in livestock feed in Ethiopia, but further work has to be done on the processing method and animal evaluation.

  8. Studies on soluble carbohydrates in yellow lupin (Lupinus luteus L. seeds of different age

    Directory of Open Access Journals (Sweden)

    Kazimierz Zalewski

    2011-01-01

    Full Text Available Yellow lupin seeds cv. Juno were stored under laboratory conditions for 2 month, 4, 6 and 8 years. Eighteen soluble carbohydrates were identified in embryonic axes and cotyledons of different age seeds. The concentration of soluble carbohydrates in analysed seeds ranged from 25 to 34% of dry mass. Axes contained more carbohydrates than cotyledons. Stachyose dominated in axes, and verbascose - in cotyledons. Other detected galactosides were: galactinol, galactosyl pinitols and galactosyl chiro-inositols (fagopyritols, but their content was several-fold lower than that of RFOs (in both axes and cotyledons tissues. The concentration of soluble carbohydrates indicated, that sucrose to RFOs mass ratio, or other changes in sugars composition are not indicators of seed storage.

  9. Re-translocation of boron in broccoli and lupin during early reproductive growth

    Energy Technology Data Exchange (ETDEWEB)

    Marentes, E; Shelp, B J [Univ. of Guelph, Dept. of Horticultural Science, Guelph, ON (Canada); Vanderpool, R A [USDA, Human Nutrition Research Center, Agricultural Research Service, ND (United States); [Spiers, G.A. Univ. of Guelph, Dept. of Land Resource Science, Guelph, ON (Canada)

    1997-06-01

    The objective of the present study was to determine if boron (B) re-translocation depends on plant-B status and external-B supply. The stable {sup 10}B isotope was supplied to the root system of broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants to provide a quantitative picture of B distribution during early reproductive development. Regardless of the B regime (i.e. continuous supply with luxury, sufficient or deficient B; transfer at influorescence emergence from either a luxury- or sufficient-B supply to a deficient one) and whether {sup 10}B was acquired before or during influorescence development, a significant proportion of the B recovered in broccoli florest and lupin fruit was {sup 10}B enriched. B acquired during inflorescence development was an important source of B for reproductive structures, but the relative importance of B acquired before and after inflorescence emergence appeared to be species dependent. The occurrence of B re-translocation was not dependent upon the induction of B deficiency. The concentrations of B in phloem exsudates (0.38 to 0.03 mM) were 4- to 23-fold those in xylem sap, and more similar to the concentrations in the reproductive structures (0.86 to 0.07 mM) than those in source leaves (2.4 to 0.19 mM). The decreasing acropetal gradient of tissue-B concentrations with luxury-B supply declined dramatically or was reversed in plants grown with sufficient or deficient B. The data are consistent with B being a phloem-mobile element, and suggest that newly acquired B is particularly important during the early reproductive growth of plants. (au) 36 refs.

  10. Re-translocation of boron in broccoli and lupin during early reproductive growth

    International Nuclear Information System (INIS)

    Marentes, E.; Shelp, B.J.; Vanderpool, R.A.

    1997-01-01

    The objective of the present study was to determine if boron (B) re-translocation depends on plant-B status and external-B supply. The stable 10 B isotope was supplied to the root system of broccoli (Brassica oleracea var. italica Plenck cv. Commander) and lupin (Lupinus albus L. cv. Ultra) plants to provide a quantitative picture of B distribution during early reproductive development. Regardless of the B regime (i.e. continuous supply with luxury, sufficient or deficient B; transfer at influorescence emergence from either a luxury- or sufficient-B supply to a deficient one) and whether 10 B was acquired before or during influorescence development, a significant proportion of the B recovered in broccoli florest and lupin fruit was 10 B enriched. B acquired during inflorescence development was an important source of B for reproductive structures, but the relative importance of B acquired before and after inflorescence emergence appeared to be species dependent. The occurrence of B re-translocation was not dependent upon the induction of B deficiency. The concentrations of B in phloem exsudates (0.38 to 0.03 mM) were 4- to 23-fold those in xylem sap, and more similar to the concentrations in the reproductive structures (0.86 to 0.07 mM) than those in source leaves (2.4 to 0.19 mM). The decreasing acropetal gradient of tissue-B concentrations with luxury-B supply declined dramatically or was reversed in plants grown with sufficient or deficient B. The data are consistent with B being a phloem-mobile element, and suggest that newly acquired B is particularly important during the early reproductive growth of plants. (au) 36 refs

  11. IDENTIFICATION AND OCCURRENCE OF FUSARIUM SPECIES ON SEEDS OF COMMON WETCH, WHITE LUPINE AND SOME WILD LEGUMES

    Directory of Open Access Journals (Sweden)

    Tihomir Miličević

    2013-06-01

    Full Text Available The presence and occurrence of Fusarium species was examined on the seeds of cultivated legumes – common vetch (Vicia sativa, white lupine (Lupinus albus, and wild legumes: bird’s-foot trefoil (Lotus corniculatus, wild alfalfa (Medicago sativa, black locust (Robinia pseudoacacia, honey locust (Gleditsia triacanthos, sweet clover (Melilotus officinalis, bird vetch (Vicia cracca and meadow vetchling (Lathyrus pratensis. Thirteen Fusarium species were identified - F. verticillioides, F. acuminatum, F. avenaceum, F. tricinctum F. oxysporum, F. scirpi, F. semitectum, F. culmorum, F. proliferatum, F. pseudograminearum, F. sporotrichioides, F. sambucinum and F. heterosporum. Species F. verticillioides and F. proliferatum were determined on seeds of the cultivated legumes (common vetch and white lupine. Other 11 Fusarium species were determined on seeds of wild legumes (bird’s-foot trefoil, wild alfalfa, sweet clover and bird vetch among which the most prevalent were species F. avenaceum and F. acuminatum.

  12. Vegetative growth of raspberry (Rubus idaeus L. ‘Autumn Bliss’ with vermicompost application intercropped with lupine (Lupinus mutabilis Sweet.

    Directory of Open Access Journals (Sweden)

    Enoc Jara-Peña

    2013-06-01

    Full Text Available The present investigation was carried out with objective to determine the response of red raspberry to vermicompost application and lupine (intercropped or not in the phase of vegetative growth under greenhouse conditions in Montecillo, Mexico. In the experiment 11 treatments were studied with 9 replications per treatment, with a complete factorial (5 × 2 plus an additional treatment consisting of a chemical fertilization with N100 P80 K80. As vegetable material adventitious buds of raspberry were used, statistically significant differences were found between treatments in number of leaves, plant height, cane diameter, fresh and dry matter in raspberry. The biggest response was obtained with 90 and 120 g pot–1 of vermicompost. In general, the lupine intercropped with raspberry permitted a slight competion but favored the biggest development in the foliar area.

  13. Biochemical and nutritional studies of lupin (Lupinus jermis) seed cultivated in the Sudan

    International Nuclear Information System (INIS)

    Elamin, Malik El Mubarak Mohamed

    1996-12-01

    Two lupin varieties (Rubatab and Dongola) purchased from the local market were used in this study. Physical properities showed that the weight and volume of cv.Dongola were higher than those of cv.Rubatab while thickness and density of cv.Rubatab were higher than those of cv.Dongola. Moisture content ranged from 4.4 to 5.7%. Fiber content ranged from 8.8 to 10.9% of whole seed and for kernels and testa it ranged from 0.9 to 1.8% and from 45 to 47% respectively. The ash content ranged from 1.3 to 1.9%. Oil content ranged from 9.9 to 10.9% in whole seed (raw, debittered) and in kernels ranged from 11.5 to 12.0% while the testa had very low oil content (0.6-1.1 %). Protein content ranged from 49.4 to 50.4 % for raw whole seed and was 47.1 to 50.4 % for debittered whole seeds. For kernels it ranged from 56 to 59%. The protien content of testa ranged from 5.6 to 9.3%. Carbohydrates content was about 23% for raw whole seed and ranged from 25 to 26% for debittered whole seed. It ranged from 21 to 24% for kernels and increased to 39% in testa. Calorific value for 100 g of whole seed ranged from 381 to 433 kcal. It decreased in testa ranging from 187 to193 kcal. In this study both varieties did not contain antinutritional factors e.g. trypsin inhibitors. The tannins content and phytate was very low presumably due to debittering. Fatty acid composition of lupin seed oil showed that it is composed of ten fatty acids presented by Oleic (52-60%), Linoleic acid (16-19%), Palmatic (10-11%)and palmitoleic, lauric, myristeic, largeric, lenolenic, arrashidic acids. The mineral content of lupin seed showed Ca 0.1%, K 0.4-0.5%. Mg 0.2-0.3%. Zn 107-135 μg/g. Pb 9-10 μg/g. In this study lupin proteins were fractionated by two methods: Mendel-osborne method and landry and moureaux. Protein fractions obtained by the first method were allbumin which ranged from 3.1 to 24.8%, globulin ranged 1.9 to 3%, gluelin raanged from 13.2 to 62% The landry and moureaux method gave globulins in the

  14. Biochemical and nutritional studies of lupin (Lupinus jermis) seed cultivated in the Sudan

    Energy Technology Data Exchange (ETDEWEB)

    Elamin, Malik El Mubarak Mohamed [Department of Biochemistry and Soil Science, Faculty of Agriculture, University of Khartoum, Khartoum (Sudan)

    1996-12-01

    Two lupin varieties (Rubatab and Dongola) purchased from the local market were used in this study. Physical properities showed that the weight and volume of cv.Dongola were higher than those of cv.Rubatab while thickness and density of cv.Rubatab were higher than those of cv.Dongola. Moisture content ranged from 4.4 to 5.7%. Fiber content ranged from 8.8 to 10.9% of whole seed and for kernels and testa it ranged from 0.9 to 1.8% and from 45 to 47% respectively. The ash content ranged from 1.3 to 1.9%. Oil content ranged from 9.9 to 10.9% in whole seed (raw, debittered) and in kernels ranged from 11.5 to 12.0% while the testa had very low oil content (0.6-1.1 %). Protein content ranged from 49.4 to 50.4 % for raw whole seed and was 47.1 to 50.4 % for debittered whole seeds. For kernels it ranged from 56 to 59%. The protien content of testa ranged from 5.6 to 9.3%. Carbohydrates content was about 23% for raw whole seed and ranged from 25 to 26% for debittered whole seed. It ranged from 21 to 24% for kernels and increased to 39% in testa. Calorific value for 100 g of whole seed ranged from 381 to 433 kcal. It decreased in testa ranging from 187 to193 kcal. In this study both varieties did not contain antinutritional factors e.g. trypsin inhibitors. The tannins content and phytate was very low presumably due to debittering. Fatty acid composition of lupin seed oil showed that it is composed of ten fatty acids presented by Oleic (52-60%), Linoleic acid (16-19%), Palmatic (10-11%)and palmitoleic, lauric, myristeic, largeric, lenolenic, arrashidic acids. The mineral content of lupin seed showed Ca 0.1%, K 0.4-0.5%. Mg 0.2-0.3%. Zn 107-135 {mu}g/g. Pb 9-10 {mu}g/g. In this study lupin proteins were fractionated by two methods: Mendel-osborne method and landry and moureaux. Protein fractions obtained by the first method were allbumin which ranged from 3.1 to 24.8%, globulin ranged 1.9 to 3%, gluelin raanged from 13.2 to 62% The landry and moureaux method gave globulins in

  15. Ternary diagram of extract proteins / solvent systems: Sesame, soybean and lupine proteins

    Directory of Open Access Journals (Sweden)

    Mohamed, S. S.

    2004-09-01

    Full Text Available Solvent extraction as a method of extracting protein from oilseed meals offers the advantage of higher efficiency. Unfortunately, the published literature points to the gap in the work concerned with the necessary equilibrium diagram to design due process equipment for such extracts. Initiated by this lack of basic knowledge, the present study has been undertaken to provide the equilibrium data for three different ternary systems, namely: sesame protein / sodium hydroxide solution system, soybean protein / sodium hydroxide solution system and lupine protein / sodium hydroxide solution system. These oilseed meals were selected because of their high protein content (53.4 %, 46.2 % and 42.3 % protein, respectively. The study also concentrated on the evaluation of the major parameters affecting the extraction process, i.e. the normality of the sodium hydroxide solution used as extracting solvent and the initial oilseed solvent to meal feeding ratio. The results obtained indicate that the best normality of sodium hydroxide solution used for extracting soybean and lupine protein is 0.02N, while 0.04N solution is required for extracting sesame protein. Also, operating at a liquid to solid feed ratio of 30:1 and 50:1 for soybean, sesame and lupine, respectively, is enough to reach a high protein extract. Correlations were presented for each locus of under flow compositions, graphically acquired, and the data are compared with those calculated by analytical solutions.La extracción con disolventes es un método de extracción de proteínas de las harinas de semillas oleaginosas que ofrece la ventaja de su elevada eficacia. Desafortunadamente, la bibliografía coincide en el vacío existente con respecto a los diagramas de equilibrio necesarios para el diseño de los equipos adecuados. Debido a esta falta de conocimientos, el presente estudio se ha llevado a cabo para obtener datos de tres sistemas ternarios: sistema proteína de sésamo / disolución de

  16. Effect of Replacing Soybean Meal with Lupin Seed-based Meal in Chicken Diet on Performance, Carcass Value and Meat Quality

    Directory of Open Access Journals (Sweden)

    Pavel Suchý

    2010-01-01

    Full Text Available The main objective of this experimental study was to determine how diets containing lupin meal affect the performance indicators, carcass value, and chemical composition of breast and thigh muscles in broiler chickens. The diets tested in experimental groups E1 and E2 differed as follows: in group E1, one third of nitrogen-containing substances (NSs from extracted soybean meal was replaced with NSs from lupin meal; in group E2, two thirds were replaced compared to the control group. The replacement of soybean meal with lupin meal in experimental diets failed to produce any significant effect on the average live weight of chickens on Day 42 of the fattening period compared to the control group. The replacement of soybean meal with lupin meal resulted in decreased average weight of carcass and breast muscles and in decreased yield of breast muscles. Differences between the control group (C and group E2 were significant (P ⪬ 0.01. Chickens in group E2 also showed a significant increase (P ⪬ 0.01 in the yield of the heart and stomach compared to the control group. The differences in weight and yield of thigh muscles between the control group and the experimental groups (E1 and E2 were not significantly affected. As far as chemical composition is concerned, chickens receiving the lupin-containing feed showed a significant (P ⪬ 0.01 increase in the ash content in breast muscles. On the contrary, in thigh muscles in group E2, the ash content decreased significantly (P ⪬ 0.01. The content of calcium showed an increasing trend in both breast and thigh muscles in both experimental groups. In contrast, the content of magnesium in chicken muscles in both experimental groups decreased. These differences were significant (P ⪬ 0.01 only in thigh muscles. Our results show that lupin seed is a suitable substitute for NSs contained in soybean extracted meal. It is considered optimal to replace up to one third of NSs contained in

  17. Effects of toasting blue lupins, soybeans or barley as supplement for high-yielding organic dairy cows fed grass-clover silage ad libitum

    DEFF Research Database (Denmark)

    Mogensen, Lisbeth; Lund, Peter; Kristensen, Troels

    2008-01-01

    . The supplement under investigation was: lupins in experiment 1, barley in experiment 2 and soybeans in experiment 3. The same forage mixture of grass-clover silage (84% of DM), grass pellets (11% of DM) and straw (5% of DM) was fed ad libitum in all the experiments. Toasting decreased effective rumen protein...... degradability determined in situ for all three supplements. Compared to untreated lupins toasting of lupins tended (P = 0.10) to increase milk yield, whereas toasting of soybeans did not affect milk yield. Toasting of lupins decreased (P = 0.03) milk protein content (32.2 versus 32.7 g/kg), whereas toasting...... of soybeans did not affect milk protein content. ECM yield was significantly higher (P = 0.002) for cows fed toasted soybeans than for cows fed untreated soybeans (28.1 versus 26.4 kg ECM) whereas there was no significant effect on ECM yield from toasting lupins or barley. It can be concluded...

  18. Total phenolic and phytosterol compounds and the radical scavenging activity of germinated Australian sweet lupin flour.

    Science.gov (United States)

    Rumiyati; Jayasena, Vijay; James, Anthony P

    2013-12-01

    In addition to their favourable nutritional profile, legumes also contain a range of bioactive compounds such as phenolic compounds and phytosterols which may protect against chronic diseases including cancer and cardiovascular disease. Germination of some legume seeds has been previously reported to increase the concentration of the bioactive compounds. In this study, the effect of germination of Australian Sweet Lupin (ASL) seeds for 9 days on the concentration of some bioactive compounds and the radical scavenging activity in the resulting flour was determined. The concentration of total phenolic compounds in methanolic extracts of germinated ASL flour was determined using Folin Ciocalteu reagent and phytosterols in oil extracts were analyzed by gas-liquid chromatography. The methanolic and oil extracts were also used to determine radical scavenging activity toward 2,2-diphenyl-1-picrylhydrazyl. In the methanolic extracts of germinated ASL flour, phenolic contents and the antioxidant activity were significantly increased following germination (700 and 1400 %, respectively). Analysis of the oil extracts of germinated ASL flour revealed that the concentration of phytosterols and the antioxidant activity were also increased significantly compared to ungerminated ASL flour (300 and 800 %, respectively). The relative proportion of phytosterols in germinated ASL flour was: β-sitosterol (60 %), stigmasterol (30 %) and campesterol (10 %). Germination increases the concentration of bioactive compounds and the radical scavenging activity in the germinated ASL flour.

  19. Effect of pre-sowing gamma irradiated lupin seeds on growth characters and yield components

    International Nuclear Information System (INIS)

    Ragab, M.A.

    1988-01-01

    Selected seeds of lupin were exposed to Co 60 -source to achieve doses of 2.5, 5, 10, 20, 40, 80, 160, or 320 Grey, beside the control treatment, irradiated and unirradiated seeds were sown and the raised plants were grown under field condition at Agric. Dept. of Soil and Water Res. A.E.A. Representative plant samples were taken at early growth stage 15-days-old seedling at flowering and at harvest. The gained results could be summarized as follows: Plant growth parameters: Plant height, particularly at early stages and at flowering and the produced dry matter were statistically affected by the treatments. Leaf pigment content was intensified by almost 14-28% over control treatment. Total carbohydrates and soluble protein in plant leaves were statistically influenced by the applied irradiation doses. Number of pods was materially affected by the treatments while no remarkable effect was noted as far as a number of seeds/plant and dry weight of seeds/plant were considered: consequently: seed index was not materially affected

  20. Instability of chlorophyll in yellow lupin seedlings grown in soil contaminated with ciprofloxacin and tetracycline.

    Science.gov (United States)

    Rydzyński, Dariusz; Piotrowicz-Cieślak, Agnieszka I; Grajek, Hanna; Michalczyk, Dariusz J

    2017-10-01

    With increasing soil concentrations of ciprofloxacin and tetracycline a decrease of leaf chlorophyll content was observed. Tetracycline was more detrimental than ciprofloxacin. The chlorophyll content in plants growing for ten days on a tetracycline containing soil decreased by 68%. The decrease of chlorophyll concentration was even sharper in new leaves that formed after application of the antibiotic (up to 81% drop). The comparison of absorption spectra of commercial, reagent grade chlorophyll, alone and incubated with antibiotics, has shown that ciprofloxacin and tetracycline can react directly with chlorophyll and decrease its concentration by 47.7% and 48.5%, respectively. The changes in fluorescence spectra confirmed the formation of chlorophyll degradation product. The chlorophyll decay was a second order reaction and depended on antibiotic concentration and duration of exposure. Reaction rate constants differed with antibiotics and their soil concentrations. With increasing contents of antibiotics in soil the constant of chlorophyll degradation rate in lupin plants increased from k = 870 M -1 day -1 for 3 mg ciprofloxacin to k = 2490 M -1 day -1 for 90 mg ciprofloxacin, and in the case of tetracycline the reaction rate constant increased from k = 1330 M -1 day -1 to k = 2910 M -1 day -1 . The sensitivity of chlorophyll to ciprofloxacin and tetracycline was confirmed by determining EC and TU indices. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Histological evaluation of brain damage caused by crude quinolizidine alkaloid extracts from lupines.

    Science.gov (United States)

    Bañuelos Pineda, J; Nolasco Rodríguez, G; Monteon, J A; García López, P M; Ruiz Lopez, M A; García Estrada, J

    2005-10-01

    The effects of the intracerebroventricular (ICV) administration of crude extracts of lupin quinolizidine alkaloids (LQAs) were studied in adult rat brain tissue. Mature L. exaltatus and L. montanus seeds were collected in western Mexico, and the LQAs from these seeds were extracted and analyzed by capillary gas chromatography. This LQA extract was administered to the right lateral ventricle of adult rats through a stainless steel cannula on five consecutive days. While control animals received 10 microl of sesame oil daily (vehicle), the experimental rats (10 per group) received 20 ng of LQA from either L. exaltatus or from L. montanus. All the animals were sacrificed 40 h after receiving the last dose of alkaloids, and their brains were removed, fixed and coronal paraffin sections were stained with haematoxylin and eosin. Immediately after the administration of LQA the animals began grooming and suffered tachycardia, tachypnea, piloerection, tail erection, muscular contractions, loss of equilibrium, excitation, and unsteady walk. In the brains of the animals treated with LQA damaged neurons were identified. The most frequent abnormalities observed in this brain tissue were "red neurons" with shrunken eosinophilic cytoplasm, strongly stained pyknotic nuclei, neuronal swelling, spongiform neuropil, "ghost cells" (hypochromasia), and abundant neuronophagic figures in numerous brain areas. While some alterations in neurons were observed in control tissues, unlike those found in the animals treated with LQA these were not significant. Thus, the histopathological changes observed can be principally attributed to the administration of sparteine and lupanine present in the alkaloid extracts.

  2. Comparing of organic nutrients digestibility in the feed rations containing lupin and peas in horses

    Directory of Open Access Journals (Sweden)

    Pavel Šajdler

    2005-01-01

    Full Text Available The aim of this study was to find out and compare organic nutrients digestibility in feed rations containing different forage legumes in balance trials on horses. The trials were always performed on a group of six sports horses (weight of 495 to 742 kg. Six feed rations were tested, which contained different proportion of certain forage legume in empirical feed mixtures. Three feed mixtures contained white lupine seeds (WLS – Lu 0 (0.01% WLS, Lu 7 (7% WLS, Lu 14 (14% WLS and surplus three feed mixtures contained field pea seeds (FPS – Hr 0 (0.01% FPS, Hr 10 (10% FPS, Hr 20 (20% FPS. Amount of WLS in feed mixtures Lu 0 and Lu 7 was completed with starch to value 14% and amount of FPS in feed mixtures Hr 0 and Hr 10 was completed with starch to value 20%. Indicator method was used to predict dietary nutrients digestibility. Apparent digestibility values of all organic nutrients were higher at the feed rations with the content of FPS. Average values of apparent digestibility coefficient of those feed rations were: dry matter (77.79%; SD = 2.91, organic matter (78.43%; SD = 2.78, crude protein (79.89%; SD = 3.43, fat (66.57%; SD = 2.40, crude fiber (68.97%; SD = 3.21 and nitrogen-free extract (83.30%; SD = 2.71.

  3. Influence of diets to Wistar rats supplemented with soya, flaxseed and lupine products treated by lactofermentation to improve their gut health.

    Science.gov (United States)

    Bartkiene, E; Juodeikiene, G; Vidmantiene, D; Zdunczyk, Z; Zdunczyk, P; Juskiewicz, J; Cizeikiene, D; Matusevicius, P

    2013-09-01

    The present study proposes the contribution of lactic acid bacteria and plants rich in bioactive substances and high-quality proteins as alternative products for human diets in improving the gut environment as potential against pathogenic bacteria. The effect of diets supplemented with soya, flaxseed and lupine flours fermented with a Pediococcus acidilactici KTU05-7 probiotic strain in the gastrointestinal tract (GIT) of Wistar rats were analyzed. In vivo experiments showed a positive effect of long time lactofermentation of plant material on the body weight of rats. Diets with fermented yellow lupine resulted in enhanced activities of α-glucosidase, β-galactosidases, as well as high levels of lactic acid bacteria, bifidobacteria and enterococci in the GIT were determined. Lactofermentation of analyzed plant products had a significantly lowering effect on Escherichia coli compared with the control group. The dominant flora of large intestines like Bifidobacterium and anaerobic cocci were found in high levels after diets with fermented lupine.

  4. Use of lupin, Lupinus perennis, mango, Mangifera indica, and stinging nettle, Urtica dioica, as feed additives to prevent Aeromonas hydrophila infection in rainbow trout, Oncorhynchus mykiss (Walbaum).

    Science.gov (United States)

    Awad, E; Austin, B

    2010-05-01

    Feeding rainbow trout, Oncorhynchus mykiss (Walbaum), with 1% lupin, Lupinus perennis, mango, Mangifera indica, or stinging nettle, Urtica dioica, for 14 days led to reductions in mortality after challenge with Aeromonas hydrophila. In addition, there was significant enhancement in serum bactericidal activity, respiratory burst and lysozyme activity in the treatment groups compared to the controls. Use of lupin and mango led to the highest number of red blood and white blood cells in recipient fish, with use of stinging nettle leading to the highest haematocrit and haemoglobin values; the highest value of mean corpuscular volume and haemoglobin was in the control groups and those fed with stinging nettle.

  5. Putrescine catabolism via DAO contributes to proline and GABA accumulation in roots of lupine seedlings growing under salt stress

    Directory of Open Access Journals (Sweden)

    Jolanta Legocka

    2017-09-01

    Full Text Available The levels of polyamines (PAs, proline (Pro, and γ-aminobutyric acid (GABA as well as the activity of diamine oxidase (DAO; EC 1.4.3.6 were studied in the roots of 2-day-old lupine (Lupinus luteus L. ‘Juno’ seedlings treated with 200 mM NaCl for 24 h. The effect of adding 1 mM aminoguanidine (AG, an inhibitor of DAO activity, was also analyzed. It was found that in roots of lupine seedlings growing under salt stress, a negative correlation between Pro accumulation and putrescine (Put content takes place. Pro level increased in roots by about 160% and, at the same time, Put content decreased by about 60%, as a result of ca. twofold increase of DAO activity. The AG added to the seedlings almost totally inhibited the activity of DAO, increased Put accumulation to control level, decreased Pro content by about 25%, and reduced GABA level by about 22%. Addition of 50 mM GABA to the lupine seedlings growing in the presence of AG and NaCl restored Pro content in roots to its level in NaCl-treated plants. In this research, the clear correlation between Put degradation and GABA and Pro accumulation was shown for the first time in the roots of seedlings growing under salt stress. This could be considered as a short-term response of a plant to high salt concentration. Our findings indicate that during intensive Pro accumulation in roots induced by salt stress, the pool of this amino acid is indirectly supported by GABA production as a result of Put degradation.

  6. Assessment of Bioavailable Concentrations of Germanium and Rare Earth Elements in the Rhizosphere of White Lupin (Lupinus albus L.)

    Science.gov (United States)

    Wiche, Oliver; Fischer, Ronny; Moschner, Christin; Székely, Balázs

    2015-04-01

    Concentrations of Germanium (Ge) and Rare Earth Elements in soils are estimated at 1.5 mg kg -1 (Ge), 25 mg kg -1 (La) and 20 mg kg -1 (Nd), which are only roughly smaller than concentrations of Pb and Zn. Germanium and rare earth elements are thus not rare but widely dispersed in soils and therefore up to date, only a few minable deposits are available. An environmental friendly and cost-effective way for Ge and rare earth element production could be phytomining. However, the most challenging part of a phytomining of these elements is to increase bioavailable concentrations of the elements in soils. Recent studies show, that mixed cultures with white lupine or other species with a high potential to mobilize trace metals in their rhizosphere due to an acidification of the soil and release of organic acids in the root zone could be a promising tool for phytomining. Complexation of Ge and rare earth elements by organic acids might play a key role in controlling bioavailability to plants as re-adsorption on soil particles and precipitation is prevented and thus, concentrations in the root zone of white lupine increase. This may also allow the complexes to diffuse along a concentration gradient to the roots of mixed culture growing species leading to enhanced plant uptake. However, to optimize mixed cultures it would be interesting to know to which extend mobilization of trace metals is dependent from chemical speciation of elements in soil due to the interspecific interaction of roots. A method for the identification of complexes of germanium and rare earth elements with organic acids, predominantly citric acid in the rhizosphere of white lupine was developed and successfully tested. The method is based on coupling of liquid chromatography with ICP-MS using a zic-philic column (SeQuant). As a preliminary result, we were able to show that complexes of germanium with citric acid exist in the rhizosphere of white lupin, what may contribute to the bioavailability of this

  7. European Origin of Bradyrhizobium Populations Infecting Lupins and Serradella in Soils of Western Australia and South Africa† ‡

    OpenAIRE

    Stępkowski, Tomasz; Moulin, Lionel; Krzyżańska, Agnieszka; McInnes, Alison; Law, Ian J.; Howieson, John

    2005-01-01

    We applied a multilocus phylogenetic approach to elucidate the origin of serradella and lupin Bradyrhizobium strains that persist in soils of Western Australia and South Africa. The selected strains belonged to different randomly amplified polymorphic DNA (RAPD)-PCR clusters that were distinct from RAPD clusters of applied inoculant strains. Phylogenetic analyses were performed with nodulation genes (nodA, nodZ, nolL, noeI), housekeeping genes (dnaK, recA, glnII, atpD), and 16S-23S rRNA inter...

  8. Effect of pre-sowing laser biostimulation on seeds on white lupine growth under differentiated temperature conditions

    International Nuclear Information System (INIS)

    Podleśny, J.

    1999-01-01

    The experiment went on over 6 weeks. Plants emergence depended on the temperature and pre-sowing laser irradiation of seeds. White lupine seeds germinated better under normal thermal conditions than in chilling stress. Triple irradiation of seeds showed the best advantageous effect improving the quality of plant emergence, irrespective of thermal conditions. The plants sprouted about 3-4 days earlier in comparison to plants from not irradiated seeds. Laser light positively affected also the height of plants, root length and dry matter yield of roots and aboveground parts

  9. Macromolecular composition of phloem exudate from white lupin (Lupinus albus L.

    Directory of Open Access Journals (Sweden)

    Mann Anthea J

    2011-02-01

    Full Text Available Abstract Background Members of the legume genus Lupinus exude phloem 'spontaneously' from incisions made to the vasculature. This feature was exploited to document macromolecules present in exudate of white lupin (Lupinus albus [L.] cv Kiev mutant, in particular to identify proteins and RNA molecules, including microRNA (miRNA. Results Proteomic analysis tentatively identified 86 proteins from 130 spots collected from 2D gels analysed by partial amino acid sequence determination using MS/MS. Analysis of a cDNA library constructed from exudate identified 609 unique transcripts. Both proteins and transcripts were classified into functional groups. The largest group of proteins comprised those involved in metabolism (24%, followed by protein modification/turnover (9%, redox regulation (8%, cell structural components (6%, stress and defence response (6% with fewer in other groups. More prominent proteins were cyclophilin, ubiquitin, a glycine-rich RNA-binding protein, a group of proteins that comprise a glutathione/ascorbate-based mechanism to scavenge oxygen radicals, enzymes of glycolysis and other metabolism including methionine and ethylene synthesis. Potential signalling macromolecules such as transcripts encoding proteins mediating calcium level and the Flowering locus T (FT protein were also identified. From around 330 small RNA clones (18-25 nt 12 were identified as probable miRNAs by homology with those from other species. miRNA composition of exudate varied with site of collection (e.g. upward versus downward translocation streams and nutrition (e.g. phosphorus level. Conclusions This is the first inventory of macromolecule composition of phloem exudate from a species in the Fabaceae, providing a basis to identify systemic signalling macromolecules with potential roles in regulating development, growth and stress response of legumes.

  10. Influence of organic N Sources on N transformation and uptake by lupine plants using 15N technique

    International Nuclear Information System (INIS)

    Abdel-Salam, A.A.; Gadalla, A.M.; Abdel- Aziz, H.A.; Galal, Y.G.M.; EL-degwy, S.M.

    2008-01-01

    A pot experiment was carried out under greenhouse conditions to evaluate the comparative efficiency and transformation of nitrogen applied either as mineral or organic forms. The obtained data showed that shoot dry weight was enhanced by compost and its mixture with leucaena. When organic sources were combined with 15 N, the leucaena.compost mixture (LC p ) gave the highest yield, and the other two were not significantly different from each other. Reinforcing the organic N with mineral N caused an average greater N.uptake over the non reinforced treatment. Similar trend was noticed with root system. Nitrogen uptake by roots was increased according to the order of LC > L > C. N derived from fertilizer (% Ndff) by lupine shoots was significantly affected by fertilizer addition either alone or reinforced with organic plant residues. Both, the portions (%) or absolute values (mg pot -1 ) of Ndff were increased by adding the organic residues. The highest value of Ndfs was recorded with application of leucaena followed by compost, then Leucaena + compost. Portion Ndfa reflected an effective response of lupines plants to Rhizobium inoculation. Addition of LC mixture combined with 15 N-fertilizer had enhanced the N 2 fixation and increased Ndfa value by about 66.7 % over those recorded with 15 N0 treatment. Organic amendment of leucaena could be an efficient source for N to infertile sandy soils

  11. Testing of Two Varieties of Lupin Seeds as Substitutes for Soya Extracted Meal in Vegetable Diets Designed for Young Broilers

    Directory of Open Access Journals (Sweden)

    P. Suchý

    2006-01-01

    Full Text Available The main aim of this experiment was to verify the suitability of two Polish varieties of dehulled lupin seed (the low-protein SONET variety and the high-protein JUNO variety as protein components to replace 50% of soya extract meal in feeding mixtures designed for the feeding of young broilers. The results of this experiment demonstrate that suitable treatment of lupin seed (dehulling may significantly increase its nutritional value. Dehulling provides a product (core in which the level of nitrogen-containing substances is by 27% higher than that in the original seed, providing an important protein component to be added in feeding mixtures for chickens. The experiment has also shown that production performance depends on the particular Lupinus variety used. Chickens fed on the JUNO variety seed (Group E1 reached a live weight of 2.332 kg on Day 40, which is comparable with the control group of chickens (2.337 kg; Group C. However, chickens in Group E2 fed on the SONET variety seed had a conclusively lower average weight (2.280 kg (P Lupinus genus is a major source of the amino acid arginine, which is often deficient in the feeding mixtures.

  12. Biosynthesis and characterization of ¹⁵N₆-labeled phomopsin A, a lupin associated mycotoxin produced by Diaporthe toxica.

    Science.gov (United States)

    Schloß, Svenja; Wedell, Ines; Koch, Matthias; Rohn, Sascha; Maul, Ronald

    2015-06-15

    The hepatotoxin phomopsin A (PHO-A), a secondary metabolite mainly produced by the fungus Diaporthe toxica, occurs predominantly on sweet lupins. Along with the growing interest in sweet lupins for food and feed commodities, concerns have been raised about fungal infestations, and consequently, about the determination of PHO-A. High performance liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) represents the most suitable analytical technique for sensitive and selective detection of mycotoxins including PHO-A. However, isotopic labeled substances are needed as internal standards for a reliable and convenient quantification. As no isotope standard for PHO-A is currently available, a biosynthesis of fully (15)N6-labeled PHO-A was established by cultivation of D. toxica on defined media containing Na(15)NO3 and (15)N-labeled yeast extract as the only nitrogen sources. The identity of (15)N6-PHO-A was confirmed by high resolution mass spectrometry. The new (15)N6-labeled standard will facilitate the method development for PHO-A including a more accurate quantification by LC-MS/MS. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Haematological indicators in hybrid mallard ducks (Anas platyrhynchos with regard to the use of meal from whole white lupin seeds in their diet

    Directory of Open Access Journals (Sweden)

    David Zapletal

    2017-01-01

    Full Text Available The objective of our study was to assess the effect of replacing soybean meal with the meal from whole white lupin seeds (Lupinus albus of the Zulika variety in diets on selected haematological indicators in 40-day-old fattened hybrid mallard ducks. A total of 180 Cherry Valley ducks were divided into three groups (E1, E2, and control. The control group was fed a diet containing soybean meal. Soybean meal replaced with 50% and 100% meal of white lupin seeds were used in group E1 and group E2, respectively. At the end of the fattening, 12 ducks (6 males and 6 females were randomly selected from each group for a haematological examination. From the result of this study, it is clear that the effect of the diet was found only on the slightly varying number of white blood cells and on the proportion of monocytes. Ducks of group E2 showed a slight increase in the total number of leukocytes which was accompanied by a decrease in the percentage share of monocytes (P < 0.05. Based on the results, it can be claimed that the replacement of soybean meal with meal from the Zulika variety of whole white lupin seeds in the diet did not have a negative effect on the determined blood indicators. Therefore, whole white lupin seeds were successfully used as the important protein component of the diet for fattening hybrid mallard ducks.

  14. Lupin kernel fiber consumption modifies fecal microbiota in healthy men as determined by rRNA gene fluorescent in situ hybridization

    NARCIS (Netherlands)

    Smith, Stuart C.; Choy, Rachel; Johnson, Stuart K.; Hall, Ramon S.; Wildeboer-Veloo, Alida C. M.; Welling, Gjalt W.

    Background: Changes in the composition of gastrointestinal microbiota by dietary interventions using pro- and prebiotics provide opportunity for improving health and preventing disease. However, the capacity of lupin kernel fiber (LKFibre), a novel legume-derived food ingredient, to act as a

  15. The effect of dehulling and a-glactosidase supplementation on the ileal digestibility of lupin based diets in broiler chickens and adult roosters

    NARCIS (Netherlands)

    Mieczkowska, A.; Jansman, A.J.M.; Kwakkel, R.P.; Smulikowski, S.

    2005-01-01

    Two hundred fifty six broiler chickens, 22-days-old, allocated to four groups of four replicate pens with 16 birds each, and six adult ileostomized roosters were used. Four diets containing maize starch and 550 g/kg whole or 458 g/kg dehulled lupin seeds (Lupinus luteus L. cv. Amulet) as the only

  16. The influence of narrow-leafed lupin seed fermentation on their chemical composition and ileal digestibility and microbiota in growing pigs.

    Science.gov (United States)

    Zaworska, Anita; Frankiewicz, Andrzej; Kasprowicz-Potocka, Małgorzata

    2017-08-01

    The aims of this study were to provide a controlled fermentation process of blue lupin seeds (Lupinus angustifolius, cv. Neptun), monitor the changes in seed composition and determine the influence of the fermentation on the apparent ileal digestibility (AID) of crude protein (CP) and amino acids in growing pigs, compared with raw lupin seeds. The fermentation with bacteria and yeast was conducted for 24 h at 25ºC under aerobic conditions. Seed fermentation increased the contents of CP, fibre, fat and ash and most of the analysed amino acids but reduced the levels of the nitrogen-free extractives. Furthermore, fermentation decreased the contents of raffinose family oligosaccharides and phytic acids but increased the alkaloid content. The AID was estimated on three barrows (mean initial body weight 25 kg), surgically fitted with a T-cannula in the distal ileum. The pigs received three diets, each for 6 d, within three experimental periods (3 × 3 Latin Square design). The diets contained soybean meal (Group SBM), raw lupin seeds (Group RL) or fermented lupin seeds (Group FL) as solely protein sources. Fermentation had a positive impact on the AID of CP and methionine, cysteine, isoleucine, leucine, phenylalanine and valine (p fermented lupin seeds did not affect the microbial status of the ileal digesta. Moreover, ammonia content in the caecal digesta did not differ between Groups RL and FL, although it was significantly higher than in Group SBM. It can be concluded that the fermentation process modified the chemical composition of nutrients in seeds, which can influence the digestibility and utilisation of the fermentation product in animal diets compared to raw seeds.

  17. An RNA-Seq Transcriptome Analysis of Orthophosphate-Deficient White Lupin Reveals Novel Insights into Phosphorus Acclimation in Plants1[W][OA

    Science.gov (United States)

    O’Rourke, Jamie A.; Yang, S. Samuel; Miller, Susan S.; Bucciarelli, Bruna; Liu, Junqi; Rydeen, Ariel; Bozsoki, Zoltan; Uhde-Stone, Claudia; Tu, Zheng Jin; Allan, Deborah; Gronwald, John W.; Vance, Carroll P.

    2013-01-01

    Phosphorus, in its orthophosphate form (Pi), is one of the most limiting macronutrients in soils for plant growth and development. However, the whole-genome molecular mechanisms contributing to plant acclimation to Pi deficiency remain largely unknown. White lupin (Lupinus albus) has evolved unique adaptations for growth in Pi-deficient soils, including the development of cluster roots to increase root surface area. In this study, we utilized RNA-Seq technology to assess global gene expression in white lupin cluster roots, normal roots, and leaves in response to Pi supply. We de novo assembled 277,224,180 Illumina reads from 12 complementary DNA libraries to build what is to our knowledge the first white lupin gene index (LAGI 1.0). This index contains 125,821 unique sequences with an average length of 1,155 bp. Of these sequences, 50,734 were transcriptionally active (reads per kilobase per million reads ≥ 3), representing approximately 7.8% of the white lupin genome, using the predicted genome size of Lupinus angustifolius as a reference. We identified a total of 2,128 sequences differentially expressed in response to Pi deficiency with a 2-fold or greater change and P ≤ 0.05. Twelve sequences were consistently differentially expressed due to Pi deficiency stress in three species, Arabidopsis (Arabidopsis thaliana), potato (Solanum tuberosum), and white lupin, making them ideal candidates to monitor the Pi status of plants. Additionally, classic physiological experiments were coupled with RNA-Seq data to examine the role of cytokinin and gibberellic acid in Pi deficiency-induced cluster root development. This global gene expression analysis provides new insights into the biochemical and molecular mechanisms involved in the acclimation to Pi deficiency. PMID:23197803

  18. [Development of a high content protein beverage from Chilean mesquite, lupine and quinoa for the diet of pre-schoolers].

    Science.gov (United States)

    Cerezal Mezquita, P; Acosta Barrientos, E; Rojas Valdivia, G; Romero Palacios, N; Arcos Zavala, R

    2012-01-01

    This research was aimed at developing a high content protein beverage from the mixture of liquid extracts of a pseudocereal, quinoa (Chenopodium quinoa Willd) and two legumes: mesquite (Prosopis chilensis (Mol.) Stunz) and lupine (Lupinus albus L.), native from the Andean highlands of the Chilean northern macro-zone, flavored with raspberry pulp, to help in the feeding of children between 2 and 5 years of lower socioeconomic status with nutritional deficiencies. The formulation was defined by linear programming, its composition was determined by proximate analysis and physical, microbiological and sensory acceptance tests were performed. After 90 days of storage time, the beverage got a protein content of 1.36%, being tryptophan the limiting amino acid; for its part, the chromaticity coordinates of CIEL*a*b* color space showed no statistical significant differences (p < 0.05) maintaining the "dark pink" tonality, the viscosity and the sensory evaluation were acceptable for drinking.

  19. Enrichment of gluten-free cakes with lupin (Lupinus albus L.) or buckwheat (Fagopyrum esculentum M.) flours.

    Science.gov (United States)

    Levent, Hacer; Bilgiçli, Nermin

    2011-11-01

    In the present study, the effect of debittered lupin flour (LF) and whole buckwheat flour (BF) on the nutritional and sensory quality of gluten-free cake was studied. LF (10, 20, 30 and 40%) and BF (5, 10, 15 and 20%) were partially replaced with corn starch and rice flour mixture (1:1 w/w) in the gluten-free cake recipe. LF increased the protein, calcium, iron, manganese, phosphorus and zinc contents of the cakes, while BF caused a significant increase (P cakes. According to the overall acceptability rating, it was concluded that gluten-free cake could be produced with satisfactory results by the addition of LF and BF up to 30% and 10%, respectively.

  20. Response of lupine plants irrigated with saline water to rhizobium inoculation using 15N-isotope dilution

    International Nuclear Information System (INIS)

    Gadalla, A.M.; El-Ghandour, I.A.; Abdel Aziz, H.A.; Hamdy, A.; Aly, M.M.

    2002-01-01

    The lupine Rhizobium symbiosis and contribution of N 2 fixation under different levels of irrigation water salinity were examined. Lysimeter experiment was established under greenhouse conditions during the year 2002-2003. In this experiment, inoculated plants were imposed to different salinity levels of irrigation water and N-fertilizer treatment. Plant height was decreased under different salinity levels, nitrogen treatments and bacterial inoculation. Similar trend was noticed with leaf area. The highest leaf area was recorded with salt tolerant bacterial inoculation (SBI) and splitting N-treatment. Highest values of N-uptake occurred after 100 day intervals under the tested factors. Relative decrease in N-uptake did not exceed 40% of those recorded with the fresh water treatment as affected by experimental factors. Nitrogen uptake by the whole plant reflected an increase at 3 dS/m salinity level of irrigation water. Relative increases were 5% and 15% for normal bacteria inoculation under single dose (NI) and splitting

  1. Effects of feeding finisher pigs with chicory or lupine feed for one week or two weeks before slaughter with respect to levels of Bifidobacteria and Campylobacter

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hansen, L. L.; Baggesen, Dorte Lau

    2013-01-01

    This study aimed to assess whether inclusion of chicory or lupine (prebiotics) in the diet of pre-slaughter pigs for just 1 or 2 weeks could change the composition of their intestinal microbiota, stimulate the growth of bifidobacteria and help to lower the amount of thermoplilic Campylobacter spp...... values >5% relative to the intensity of total abundance differed between the feed treatments (P prebiotics in the diet of pre-slaughter pigs elicited changes in the composition of the intestinal microbiota...

  2. Diverse accumulation of several dehydrin-like proteins in cauliflower (Brassica oleracea var. botrytis), Arabidopsis thaliana and yellow lupin (Lupinus luteus) mitochondria under cold and heat stress.

    Science.gov (United States)

    Rurek, Michal

    2010-08-18

    Dehydrins represent hydrophilic proteins acting mainly during cell dehydration and stress response. Dehydrins are generally thermostable; however, the so-called dehydrin-like (dehydrin-related) proteins show variable thermolability. Both groups immunoreact with antibodies directed against the K-segment of dehydrins. Plant mitochondrial dehydrin-like proteins are poorly characterized. The purpose of this study was to extend previous reports on plant dehydrins by comparing the level of immunoprecipitated dehydrin-like proteins in cauliflower (Brassica oleracea var. botrytis), Arabidopsis thaliana and yellow lupin (Lupinus luteus) mitochondria under cold and heat stress. All the analyzed plant species showed constitutive accumulation of thermostable mitochondrial putative dehydrins ranging from 50 to 70 kDa. The mitochondrial dehydrin-like proteins observed in cauliflower and Arabidopsis ranged from 10 to 100 kDa and in lupin imbibed seeds and hypocotyls--from 20 to 90 kDa. Cold treatment increased mainly the accumulation of 10-100 kDa cauliflower and Arabidopsis dehydrin-like proteins, in the patterns different in cauliflower leaf and inflorescence mitochondria. However, in lupin mitochondria, cold affected mainly 25-50 kDa proteins and seemed to induce the appearance of some novel dehydrin-like proteins. The influence of frost stress on cauliflower leaf mitochondrial dehydrin- like proteins was less significant. The impact of heat stress was less significant in lupin and Arabidopsis than in cauliflower inflorescence mitochondria. Cauliflower mitochondrial dehydrin-like proteins are localized mostly in the mitochondrial matrix; it seems that some of them may interact with mitochondrial membranes. All the results reveal an unexpectedly broad spectrum of dehydrin-like proteins accumulated during some abiotic stress in the mitochondria of the plant species analyzed. They display only limited similarity in size to those reported previously in maize, wheat and rye

  3. Prick by Prick Induced Anaphylaxis in a Patient with Peanuts and Lupine Allergy: Awareness of Risks and Role of Component Resolved Diagnosis

    Science.gov (United States)

    Ciccarelli, Anna; Calabrò, Claudia; Imperatore, Clara; Scala, Guglielmo

    2014-01-01

    A case of anaphylaxis is reported in the course of a prick by prick with Lupinus albus and roasted peanut in a 20-year-old woman. We focused on some main topics. First of all it seems important to underscore the potential risks connected to the practice of the prick-by-prick with fresh foods in allergic patients, especially when testing cross-reactive substances, such as White Lupine, peanuts, or soy. It is important that clinicians who perform prick tests be aware of the risk related with in vivo tests in allergic patients. Second, we discuss the problem of the hidden allergens, such as White Lupine flour, or soy flour which are utilized to improve wheat flour because of their lower cost. Patients with a demonstrated allergy to peanuts should be assessed for lupine allergy and informed about the “hidden allergens” issue. Finally, we believe that component resolved diagnosis, the serum specific IgE against molecular components, that is normally considered a second-level diagnostic step has an important role even as a first line approach at least in some selected cases. PMID:25477973

  4. Internalisation and multiple phosphorylation of γ-Conglutin, the lupin seed glycaemia-lowering protein, in HepG2 cells

    International Nuclear Information System (INIS)

    Capraro, Jessica; Magni, Chiara; Faoro, Franco; Maffi, Dario; Scarafoni, Alessio; Tedeschi, Gabriella; Maffioli, Elisa; Parolari, Anna; Manzoni, Cristina; Lovati, Maria Rosa; Duranti, Marcello

    2013-01-01

    Highlights: •A glycaemia-reducing lupin seed protein is internalized by HepG2 cells. •The protein accumulates in the cytosol in an intact form. •The internalized protein is multiply phosphorylated. -- Abstract: Lupin seed γ-Conglutin is a protein capable of reducing glycaemia in mammalians and increasing glucose uptake by model cells. This work investigated whether γ-Conglutin is internalised into the target cells and undergoes any covalent change during the process, as a first step to understanding its mechanism of action. To this purpose, γ-Conglutin-treated and untreated HepG2 cells were submitted to confocal and transmission electron microscopy. Immune-revelation of γ-Conglutin at various intervals revealed its accumulation inside the cytosol. In parallel, 2D-electrophoresis of the cell lysates and antibody reaction of the blotted maps showed the presence of the protein intact subunits inside the treated cells, whilest no trace of the protein was found in the control cells. However, γ-Conglutin-related spots with an unexpectedly low pI were also observed in the maps. These spots were excised, trypsin-treated and submitted to MS/MS spectrometric analysis. The presence of phosphorylated amino acids was detected. These findings, by showing that γ-Conglutin is internalised by HepG2 cells in an intact form and is modified by multiple phosphorylation, open the way to the understanding of the lupin γ-Conglutin insulin-mimetic activity

  5. FERMENTATION BY Lactobacillus paracasei OF GALACTOOLIGOSACCHARIDES AND LOW-MOLECULAR-WEIGHT CARBOHYDRATES EXTRACTED FROM SQUASH (Curcubita maxima AND LUPIN (Lupinus albus SEEDS

    Directory of Open Access Journals (Sweden)

    María I. Palacio

    2014-02-01

    Full Text Available The in vitro prebiotic activity of galactooligosaccharides (GOS and low-molecular-weight carbohydrates (LMWC extracted from lupin and squash seeds on the growth of Lactobacillus paracasei BGP1 was studied. To this end, the change in cell density after 24 h of L. paracasei growth on 1% (w/v glucose, 1% (w/v raffinose, 1% (w/v commercial inulin GR, 1% (w/v lupin extract, and 1% (w/v squash extract relative to the change in cell density of a mixture of enteric strains under the same culture conditions were evaluated. Additionally, the principal components of GOS and LMWC in the extracts were identified using Thin Layer Chromatography. The highest prebiotic activity score was for L. paracasei grown on squash extract (0.55±0.03, followed by lupin extract (0.49±0.02, inulin (0.38±0.05 and raffinose (0.37±0.05. These results will contribute to selecting plant species as potential sources of prebiotic ingredients for the development of functional foods.

  6. Effect of Enzyme Preparation with Activity Directed Towards Degradation of Non Starch Polysaccharides on Yellow Lupine Seed Based Diet for Young Broilers

    Directory of Open Access Journals (Sweden)

    Bogusław I Olkowski

    2010-01-01

    Full Text Available This work examined the impact of enzyme preparation with specific activity towards non starch polysaccharides on performance, morphological characteristics of gastrointestinal tract organs, microscopic evaluation of jejunal mucosa, and microbial status of ileum, caeca, and excreta in broilers fed a diet containing a high content of lupine meal. One-day-old chickens (Ross 308, mixed sex were randomly divided into control and experimental groups. Each group consisted of 36 birds, with 6 replications,and with 6 chickens per replication. The control group was fed the basal diet (consisting of maize and 40% of lupine, while the experimental treatment group was fed the basal diet supplemented with 0.06% commercial enzyme (Ronozyme VP. Chickens were fed diets in mash form for 4 weeks. Enzyme preparation significantly (P P P Enterobacteriaceae in caeca and excreta, and coliforms in excreta only (P < 0.01. Appropriate combination of enzyme preparations with activity towards degrading carbohydrates may offer a potential to reduce the deleterious impact of lupine in broilers.

  7. In vitro fermentation of lupin seeds (Lupinus albus) and broad beans (Vicia faba): dynamic modulation of the intestinal microbiota and metabolomic output.

    Science.gov (United States)

    Gullón, Patricia; Gullón, Beatriz; Tavaria, Freni; Vasconcelos, Marta; Gomes, Ana Maria

    2015-10-01

    Broad beans (Vicia faba) and lupin seeds (Lupinus albus) are legumes rich in a wide range of compounds, which may represent a useful dietary approach for modulating the human gut microbiome. In this work, after in vitro digestion, legume samples were used as carbon sources in anaerobic batch cultures to evaluate their impact on the intestinal microbiota composition and on their metabolic products. The fermentations were monitored by a decrease in pH, generation of short chain fatty acids (SCFA) and lactate and the changes in the dynamic bacterial populations by fluorescence in situ hybridization (FISH). The total SCFA at the end of fermentation was 81.52 mM for lupin seeds and 78.41 mM for broad beans accompanied by a decrease of the pH for both legumes. The microbial groups that increased significantly (P spp., Lactobacillus-Enterococcus, Atopobium, Bacteroides-Pretovella, Clostridium coccoides-Eubacterium rectale, Faecalibacterium prausnitzii and Roseburia intestinalis. This impact on the intestinal microbiota suggests that lupin seeds and broad beans may be used in the development of novel functional foods, which can be included in dietary strategies for human health promotion.

  8. Effect of food matrix and thermal processing on the performance of a normalised quantitative real-time PCR approach for lupine (Lupinus albus) detection as a potential allergenic food.

    Science.gov (United States)

    Villa, Caterina; Costa, Joana; Gondar, Cristina; Oliveira, M Beatriz P P; Mafra, Isabel

    2018-10-01

    Lupine is widely used as an ingredient in diverse food products, but it is also a source of allergens. This work aimed at proposing a method to detect/quantify lupine as an allergen in processed foods based on a normalised real-time PCR assay targeting the Lup a 4 allergen-encoding gene of Lupinus albus. Sensitivities down to 0.0005%, 0.01% and 0.05% (w/w) of lupine in rice flour, wheat flour and bread, respectively, and 1 pg of L. albus DNA were obtained, with adequate real-time PCR performance parameters using the ΔCt method. Both food matrix and processing affected negatively the quantitative performance of the assay. The method was successfully validated with blind samples and applied to processed foods. Lupine was estimated between 4.12 and 22.9% in foods, with some results suggesting the common practice of precautionary labelling. In this work, useful and effective tools were proposed for the detection/quantification of lupine in food products. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Adaptation of H+-pumping and plasma membrane H+ ATPase activity in proteoid roots of white lupin under phosphate deficiency.

    Science.gov (United States)

    Yan, Feng; Zhu, Yiyong; Müller, Caroline; Zörb, Christian; Schubert, Sven

    2002-05-01

    White lupin (Lupinus albus) is able to adapt to phosphorus deficiency by producing proteoid roots that release a huge amount of organic acids, resulting in mobilization of sparingly soluble soil phosphate in rhizosphere. The mechanisms responsible for the release of organic acids by proteoid root cells, especially the trans-membrane transport processes, have not been elucidated. Because of high cytosolic pH, the release of undissociated organic acids is not probable. In the present study, we focused on H+ export by plasma membrane H+ ATPase in active proteoid roots. In vivo, rhizosphere acidification of active proteoid roots was vanadate sensitive. Plasma membranes were isolated from proteoid roots and lateral roots from P-deficient and -sufficient plants. In vitro, in comparison with two types of lateral roots and proteoid roots of P-sufficient plants, the following increase of the various parameters was induced in active proteoid roots of P-deficient plants: (a) hydrolytic ATPase activity, (b) Vmax and Km, (c) H+ ATPase enzyme concentration of plasma membrane, (d) H+-pumping activity, (e) pH gradient across the membrane of plasmalemma vesicles, and (f) passive H+ permeability of plasma membrane. In addition, lower vanadate sensitivity and more acidic pH optimum were determined for plasma membrane ATPase of active proteoid roots. Our data support the hypothesis that in active proteoid root cells, H+ and organic anions are exported separately, and that modification of plasma membrane H+ ATPase is essential for enhanced rhizosphere acidification by active proteoid roots.

  10. Liking of health-functional foods containing lupin kernel fibre following repeated consumption in a dietary intervention setting.

    Science.gov (United States)

    Hall, Ramon S; Baxter, Amynta L; Fryirs, Cathy; Johnson, Stuart K

    2010-10-01

    Liking of a particular food after repeated consumption may be reduced, limiting the effectiveness of health-functional foods requiring on-going consumption to deliver their benefits. This study examined the effect of repeated consumption of foods containing the novel ingredient, Australian sweet lupin (Lupinus angustifolius) kernel fibre (LKFibre) on sensory acceptability in the dietary intervention setting. In a single-blind randomised crossover 4-week intervention, participants consumed both control and equivalent LKFibre-containing products daily on separate interventions separated by a 4-week period on habitual diet. Seven products: muesli, bread, muffin, chocolate brownie, chocolate milk drink, pasta and instant mashed potato were assessed twice (days 4 and 18 of intervention), by 38 participants for appearance, texture, flavour and general acceptability using a structured graphic hedonic scale. Overall the results showed there was no reduction (P=0.594) in general acceptability of LKFibre foods after repeated consumption, suggesting potential for long-term consumption. The control food products were however generally preferred (P<0.001) over the LKFibre foods; the mean difference for general acceptability between being <6% (0.82cm) of the 15cm hedonic scale used, suggesting LKF addition did not severely affect product palatability.

  11. LegumeDB1 bioinformatics resource: comparative genomic analysis and novel cross-genera marker identification in lupin and pasture legume species.

    Science.gov (United States)

    Moolhuijzen, P; Cakir, M; Hunter, A; Schibeci, D; Macgregor, A; Smith, C; Francki, M; Jones, M G K; Appels, R; Bellgard, M

    2006-06-01

    The identification of markers in legume pasture crops, which can be associated with traits such as protein and lipid production, disease resistance, and reduced pod shattering, is generally accepted as an important strategy for improving the agronomic performance of these crops. It has been demonstrated that many quantitative trait loci (QTLs) identified in one species can be found in other plant species. Detailed legume comparative genomic analyses can characterize the genome organization between model legume species (e.g., Medicago truncatula, Lotus japonicus) and economically important crops such as soybean (Glycine max), pea (Pisum sativum), chickpea (Cicer arietinum), and lupin (Lupinus angustifolius), thereby identifying candidate gene markers that can be used to track QTLs in lupin and pasture legume breeding. LegumeDB is a Web-based bioinformatics resource for legume researchers. LegumeDB analysis of Medicago truncatula expressed sequence tags (ESTs) has identified novel simple sequence repeat (SSR) markers (16 tested), some of which have been putatively linked to symbiosome membrane proteins in root nodules and cell-wall proteins important in plant-pathogen defence mechanisms. These novel markers by preliminary PCR assays have been detected in Medicago truncatula and detected in at least one other legume species, Lotus japonicus, Glycine max, Cicer arietinum, and (or) Lupinus angustifolius (15/16 tested). Ongoing research has validated some of these markers to map them in a range of legume species that can then be used to compile composite genetic and physical maps. In this paper, we outline the features and capabilities of LegumeDB as an interactive application that provides legume genetic and physical comparative maps, and the efficient feature identification and annotation of the vast tracks of model legume sequences for convenient data integration and visualization. LegumeDB has been used to identify potential novel cross-genera polymorphic legume

  12. Structure, expression profile and phylogenetic inference of chalcone isomerase-like genes from the narrow-leafed lupin (Lupinus angustifolius L. genome

    Directory of Open Access Journals (Sweden)

    Łucja ePrzysiecka

    2015-04-01

    Full Text Available Lupins, like other legumes, have a unique biosynthesis scheme of 5-deoxy-type flavonoids and isoflavonoids. A key enzyme in this pathway is chalcone isomerase (CHI, a member of CHI-fold protein family, encompassing subfamilies of CHI1, CHI2, CHI-like (CHIL, and fatty acid-binding (FAP proteins. Here, two Lupinus angustifolius (narrow-leafed lupin CHILs, LangCHIL1 and LangCHIL2, were identified and characterized using DNA fingerprinting, cytogenetic and linkage mapping, sequencing and expression profiling. Clones carrying CHIL sequences were assembled into two contigs. Full gene sequences were obtained from these contigs, and mapped in two L. angustifolius linkage groups by gene-specific markers. Bacterial artificial chromosome fluorescence in situ hybridization approach confirmed the localization of two LangCHIL genes in distinct chromosomes. The expression profiles of both LangCHIL isoforms were very similar. The highest level of transcription was in the roots of the third week of plant growth; thereafter, expression declined. The expression of both LangCHIL genes in leaves and stems was similar and low. Comparative mapping to reference legume genome sequences revealed strong syntenic links; however, LangCHIL2 contig had a much more conserved structure than LangCHIL1. LangCHIL2 is assumed to be an ancestor gene, whereas LangCHIL1 probably appeared as a result of duplication. As both copies are transcriptionally active, questions arise concerning their hypothetical functional divergence. Screening of the narrow-leafed lupin genome and transcriptome with CHI-fold protein sequences, followed by Bayesian inference of phylogeny and cross-genera synteny survey, identified representatives of all but one (CHI1 main subfamilies. They are as follows: two copies of CHI2, FAPa2 and CHIL, and single copies of FAPb and FAPa1. Duplicated genes are remnants of whole genome duplication which is assumed to have occurred after the divergence of Lupinus, Arachis

  13. Morphological aspects of starch and cell wall material mobilization in developing lupine cotyledons and the effect of kinetin on these processes

    Directory of Open Access Journals (Sweden)

    Fortunat Młodzianowski

    2015-01-01

    Full Text Available In the cotyledons of dry lupine seeds the presence of starch was not demonstrated. Its formation during seed imbibition in darkness is accompanied by a reduction in the thickness of cell walls containing hemicelluloses. It is believed that the products of hemicellulose hydrolysis, particullarily in isolated cotyledons, arę the main source of materials for the synthesis of starch, In the process of cell wall decomposition the invaginations of plasmalemma appear to be involved. Kinetin enhance the hydrolysis of cell walls and the mobilization of starch in isolated cotyledons.

  14. Digestion of polysaccharides, protein and lipids by adult cockerels fed on diets containing a pectic cell-wall material from white lupin (Lupinus albus L.) cotyledon.

    Science.gov (United States)

    Carré, B; Leclercq, B

    1985-11-01

    1. The cell-wall material of white lupin (Lupinus albus L.) cotyledon is characterized by low contents of cellulose (47 g/kg) and lignin (17 g/kg) and a high content of pectic substances (710 g/kg). The digestion of lupin cell-wall material by adult cockerels was estimated using gas-liquid chromatographic analyses of alditol acetates derived from polysaccharide sugars. The analyses were performed in the destarched water-insoluble fractions of feed and excreta. Digestibility measurements were carried out using a 3 d balance period including a 2 d feeding period and a 24 h final starvation period. 2. In the first experiment, six animals were given a diet containing 510 g white lupin cotyledon flour/kg which was the only source of protein and cell walls in the diet. The apparent digestibility of cell-wall components was near zero. 3. In the second experiment, three diets were prepared by diluting a fibre-free basal diet (diet A) by a semi-purified cell-wall preparation introduced at two different levels: 100 g/kg (diet B) and 200 g/kg (diet C). The semi-purified cell walls were prepared from the white lupin cotyledon flour used in the first experiment. The true digestibilities of polysaccharides measured in birds given diets B and C were near zero. It is suggested that the measurement of the neutral-detergent fibre (NDF) content according to Van Soest & Wine (1967) is not a suitable procedure for estimating the undigestible fibre content in poultry nutrition as the cell-wall pectic substances are not included in the NDF measurement. 4. Addition of the semi-purified cell-wall preparation (Expt 2) resulted in a slight decrease in the apparent protein digestibility. This decrease might be explained by the addition of undigestible cell-wall protein. 5. Addition of the semi-purified cell-wall preparation (Expt 2) had no effect on the apparent lipid digestibility. 6. The metabolizable energy values of the basal diet fraction of diets B and C were calculated assuming that

  15. CREATION OF MATHEMATICAL MODEL OF EXTRACTION BY CHEESE WHEY FROM A LUPINE IN THE FORM OF A PLATE

    Directory of Open Access Journals (Sweden)

    Y. I. Shishatskii

    2015-01-01

    Full Text Available Prerequisites for creation of model are stated. At a problem definition consideration of a particle of a lupine as unlimited plate is proved. The main assumptions are formulated, regional conditions are written out. Partial solutions of the differential equation, and also the common decision for the current value of a concentration pressure С'(x,у. Distribution of concentration is symmetric concerning ordinate axis. Final expression for a field of concentration at extraction of a flat plate in a dimensionless look is written out. It is shown that distribution of concentration is rather precisely described by the first member of a row. Th e conclusion is drawn that for any timepoint under the set boundary conditions the field of concentration has an appearance of a symmetric curve with a maximum on a plate axis (Х=0. For each subsequent timepoint there will be the curve which is monotonously decreasing to a plate surface. It is proved that it is possible to define nature of change of concentration in a body at a preset value the case when strives for infinity at the set physical parameters, thickness of a plate and the organization of high intensity of branch of extractive substances from a surface Is considered. For this case the equations of rather dimensionless concentration and Fourier's numb er are received. Also the equation for definition of final time of extraction is written out. It is shown that the received solutions of the eq uations of model are found in a good consent with experimental data.

  16. Internalisation and multiple phosphorylation of γ-Conglutin, the lupin seed glycaemia-lowering protein, in HepG2 cells.

    Science.gov (United States)

    Capraro, Jessica; Magni, Chiara; Faoro, Franco; Maffi, Dario; Scarafoni, Alessio; Tedeschi, Gabriella; Maffioli, Elisa; Parolari, Anna; Manzoni, Cristina; Lovati, Maria Rosa; Duranti, Marcello

    2013-08-09

    Lupin seed γ-Conglutin is a protein capable of reducing glycaemia in mammalians and increasing glucose uptake by model cells. This work investigated whether γ-Conglutin is internalised into the target cells and undergoes any covalent change during the process, as a first step to understanding its mechanism of action. To this purpose, γ-Conglutin-treated and untreated HepG2 cells were submitted to confocal and transmission electron microscopy. Immune-revelation of γ-Conglutin at various intervals revealed its accumulation inside the cytosol. In parallel, 2D-electrophoresis of the cell lysates and antibody reaction of the blotted maps showed the presence of the protein intact subunits inside the treated cells, whilest no trace of the protein was found in the control cells. However, γ-Conglutin-related spots with an unexpectedly low pI were also observed in the maps. These spots were excised, trypsin-treated and submitted to MS/MS spectrometric analysis. The presence of phosphorylated amino acids was detected. These findings, by showing that γ-Conglutin is internalised by HepG2 cells in an intact form and is modified by multiple phosphorylation, open the way to the understanding of the lupin γ-Conglutin insulin-mimetic activity. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Identification of a low digestibility δ-Conglutin in yellow lupin (Lupinus luteus L.) seed meal for atlantic salmon (Salmo salar L.) by coupling 2D-PAGE and mass spectrometry.

    Science.gov (United States)

    Ogura, Takahiro; Hernández, Adrián; Aizawa, Tomoko; Ogihara, Jun; Sunairi, Michio; Alcaino, Javier; Salvo-Garrido, Haroldo; Maureira-Butler, Iván J

    2013-01-01

    The need of quality protein in the aquaculture sector has forced the incorporation of alternative plant proteins into feeding diets. However, most plant proteins show lower digestibility levels than fish meal proteins, especially in carnivorous fishes. Manipulation of protein content by plant breeding can improve the digestibility rate of plant proteins in fish, but the identification of low digestibility proteins is essential. A reduction of low digestibility proteins will not only increase feed efficiency, but also reduce water pollution. Little is known about specific digestible protein profiles and/or molecular identification of more bioavailable plant proteins in fish diets. In this study, we identified low digestibility L. luteus seed proteins using Atlantic salmon (Salmo salar) crude digestive enzymes in an in vitro assay. Low digestibility proteins were identified by comparing SDS-PAGE banding profiles of digested and non-digested lupin seed proteins. Gel image analysis detected a major 12 kDa protein band in both lupin meal and protein isolate digested products. The 12 kDa was confirmed by 2D-PAGE gels and the extracted protein was analyzed with an ion trap mass spectrometer in tandem mass mode. The MS/MS data showed that the 12 kDa low digestibility protein was a large chain δconglutin, a common seed storage protein of yellow lupin. Comparison of the protein band profiles between lupin meal and protein isolates showed that the isolatation process did not affect the low digestibility of the 12 kDa protein.

  18. Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L..

    Directory of Open Access Journals (Sweden)

    Candy M Taylor

    Full Text Available Quantitative Reverse Transcription PCR (qRT-PCR is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC, Helicase (HEL, and Polypyrimidine tract-binding protein (PTB] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other

  19. Identification of a Low Digestibility δ-Conglutin in Yellow Lupin (Lupinus luteus L.) Seed Meal for Atlantic Salmon (Salmo salar L.) by Coupling 2D-PAGE and Mass Spectrometry

    Science.gov (United States)

    Ogura, Takahiro; Hernández, Adrián; Aizawa, Tomoko; Ogihara, Jun; Sunairi, Michio; Alcaino, Javier; Salvo-Garrido, Haroldo; Maureira-Butler, Iván J.

    2013-01-01

    The need of quality protein in the aquaculture sector has forced the incorporation of alternative plant proteins into feeding diets. However, most plant proteins show lower digestibility levels than fish meal proteins, especially in carnivorous fishes. Manipulation of protein content by plant breeding can improve the digestibility rate of plant proteins in fish, but the identification of low digestibility proteins is essential. A reduction of low digestibility proteins will not only increase feed efficiency, but also reduce water pollution. Little is known about specific digestible protein profiles and/or molecular identification of more bioavailable plant proteins in fish diets. In this study, we identified low digestibility L. luteus seed proteins using Atlantic salmon (Salmo salar) crude digestive enzymes in an in vitro assay. Low digestibility proteins were identified by comparing SDS-PAGE banding profiles of digested and non-digested lupin seed proteins. Gel image analysis detected a major 12 kDa protein band in both lupin meal and protein isolate digested products. The 12 kDa was confirmed by 2D-PAGE gels and the extracted protein was analyzed with an ion trap mass spectrometer in tandem mass mode. The MS/MS data showed that the 12 kDa low digestibility protein was a large chain δconglutin, a common seed storage protein of yellow lupin. Comparison of the protein band profiles between lupin meal and protein isolates showed that the isolatation process did not affect the low digestibility of the 12 kDa protein. PMID:24278278

  20. Identification of a low digestibility δ-Conglutin in yellow lupin (Lupinus luteus L. seed meal for atlantic salmon (Salmo salar L. by coupling 2D-PAGE and mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Takahiro Ogura

    Full Text Available The need of quality protein in the aquaculture sector has forced the incorporation of alternative plant proteins into feeding diets. However, most plant proteins show lower digestibility levels than fish meal proteins, especially in carnivorous fishes. Manipulation of protein content by plant breeding can improve the digestibility rate of plant proteins in fish, but the identification of low digestibility proteins is essential. A reduction of low digestibility proteins will not only increase feed efficiency, but also reduce water pollution. Little is known about specific digestible protein profiles and/or molecular identification of more bioavailable plant proteins in fish diets. In this study, we identified low digestibility L. luteus seed proteins using Atlantic salmon (Salmo salar crude digestive enzymes in an in vitro assay. Low digestibility proteins were identified by comparing SDS-PAGE banding profiles of digested and non-digested lupin seed proteins. Gel image analysis detected a major 12 kDa protein band in both lupin meal and protein isolate digested products. The 12 kDa was confirmed by 2D-PAGE gels and the extracted protein was analyzed with an ion trap mass spectrometer in tandem mass mode. The MS/MS data showed that the 12 kDa low digestibility protein was a large chain δconglutin, a common seed storage protein of yellow lupin. Comparison of the protein band profiles between lupin meal and protein isolates showed that the isolatation process did not affect the low digestibility of the 12 kDa protein.

  1. Raw and extruded pea (Pisum sativum and lupin (Lupinus albusvar. Multitalia seeds as protein sources in weaned piglets’ diets: effect on growth rate and blood parameters

    Directory of Open Access Journals (Sweden)

    Gianfranco Piva

    2010-01-01

    Full Text Available The 42 days trial was carried out using 140 piglets weaned at 28 days of age. The piglets were allocated according to  weight and sex to the 5 dietary treatments with 7 replicates for each treatments (4 pens x 4 castrated males and 3 pens  x 4 females. The piglets were fed according to the following experimental design: 1 control diet (CTR with soybean  meal (SBM 44% c.p. as protein source; 2 CRT diets with 200 g/kg of raw pea (Pisum sativum (RP; 3 CTR diet with  200 g/kg extruded pea (EP; 4 CRT diet with 170 g/kg raw lupin (Lupinus albusvar. Multitalia (RL; 5 CTR diet with  170 g/kg of extruded lupin (EL. During the trial, animals were weighed at 0 - 21 and 42 days from the start of the trial.  Feed intake was monitored and feed conversion ratio was calculated for the periods 0-21 d and 22-42 d. At the end of  the trial, blood samples were taken for 14 animals for each dietary treatment (2 animals per replicate and analysed for  total protein, urea and liver activity (ALT, AST and ALP parameters. Average daily weight gain and feed intake did not  differ according to dietary treatments whereas during the total experimental period (0-42 d, feed conversion ratio was  higher for EP vsCTR diet (2.35 vs2.09, respectively; P   compared with diets containing the raw ingredients did not differ. Feed conversion ratio for the RP was numerically high-  er than for the EP (2.35 vs2.16 and 2.76 vs2.32, respectively during 22-42 d and 0-42 d periods. Blood parameters  did not show significant difference among dietary treatments except for higher total protein for CTR diet vsRL diet, EL  and RP (67.3 vs62.2, 62.8 and 63.6 g/l, respectively; PvsRL  and RL (4.7 vs3.7 and 3.8 mmol/l respectively; P 

  2. Transcriptome sequencing of different narrow-leafed lupin tissue types provides a comprehensive uni-gene assembly and extensive gene-based molecular markers

    Science.gov (United States)

    Kamphuis, Lars G; Hane, James K; Nelson, Matthew N; Gao, Lingling; Atkins, Craig A; Singh, Karam B

    2015-01-01

    Narrow-leafed lupin (NLL; Lupinus angustifolius L.) is an important grain legume crop that is valuable for sustainable farming and is becoming recognized as a human health food. NLL breeding is directed at improving grain production, disease resistance, drought tolerance and health benefits. However, genetic and genomic studies have been hindered by a lack of extensive genomic resources for the species. Here, the generation, de novo assembly and annotation of transcriptome datasets derived from five different NLL tissue types of the reference accession cv. Tanjil are described. The Tanjil transcriptome was compared to transcriptomes of an early domesticated cv. Unicrop, a wild accession P27255, as well as accession 83A:476, together being the founding parents of two recombinant inbred line (RIL) populations. In silico predictions for transcriptome-derived gene-based length and SNP polymorphic markers were conducted and corroborated using a survey assembly sequence for NLL cv. Tanjil. This yielded extensive indel and SNP polymorphic markers for the two RIL populations. A total of 335 transcriptome-derived markers and 66 BAC-end sequence-derived markers were evaluated, and 275 polymorphic markers were selected to genotype the reference NLL 83A:476 × P27255 RIL population. This significantly improved the completeness, marker density and quality of the reference NLL genetic map. PMID:25060816

  3. Linking development and determinacy with organic acid efflux from proteoid roots of white lupin grown with low phosphorus and ambient or elevated atmospheric CO{sub 2} concentration

    Energy Technology Data Exchange (ETDEWEB)

    Watt, M.; Evans, J.R.

    1999-07-01

    White lupin (Lupinus albus L.) was grown in hydroponic culture with 1 {micro}M phosphorus to enable the development of proteoid roots to be observed in conjunction with organic acid exudation. Discrete regions of closely spaced, determinate secondary laterals emerged in near synchrony on the same plant. One day after reaching their final length, citrate exudation occurred over a 3-d pulse. The rate of exudation varied diurnally, with maximal rates during the photoperiod. At the onset of citrate efflux, rootlets had exhausted their apical meristems and had differentiated root hairs and vascular tissues along their lengths. Neither in vitro phosphoenolpyruvate carboxylase nor citrate synthase activity was correlated with the rate of citrate exudation. The authors suggest that an unidentified transport process, presumably at the plasma membrane, regulates citrate efflux. Growth with elevated atmospheric [CO{sub 2}] promoted earlier onset of rootlet determinacy by 1 d, resulting in shorter rootlets and citrate export beginning 1 d earlier as a 2-d diurnal pulse. Citrate was the dominant organic acid exported, and neither the rate of exudation per unit length of root nor the composition of exudate was altered by atmospheric [CO{sub 2}].

  4. The First Genetic and Comparative Map of White Lupin (Lupinus albus L.): Identification of QTLs for Anthracnose Resistance and Flowering Time, and a Locus for Alkaloid Content

    Science.gov (United States)

    Phan, Huyen T. T.; Ellwood, Simon R.; Adhikari, Kedar; Nelson, Matthew N.; Oliver, Richard P.

    2007-01-01

    Abstract We report the first genetic linkage map of white lupin (Lupinus albus L.). An F8 recombinant inbred line population developed from Kiev mutant × P27174 was mapped with 220 amplified fragment length polymorphism and 105 gene-based markers. The genetic map consists of 28 main linkage groups (LGs) that varied in length from 22.7 cM to 246.5 cM and spanned a total length of 2951 cM. There were seven additional pairs and 15 unlinked markers, and 12.8% of markers showed segregation distortion at P anthracnose resistance, flowering time, and alkaloid content allowed loci governing these traits to be defined. Two quantitative trait loci (QTLs) with significant effects were identified for anthracnose resistance on LG4 and LG17, and two QTLs were detected for flowering time on the top of LG1 and LG3. Alkaloid content was mapped as a Mendelian trait to LG11. PMID:17526914

  5. A label-free internal standard method for the differential analysis of bioactive lupin proteins using nano HPLC-Chip coupled with Ion Trap mass spectrometry.

    Science.gov (United States)

    Brambilla, Francesca; Resta, Donatella; Isak, Ilena; Zanotti, Marco; Arnoldi, Anna

    2009-01-01

    Quantitative proteomics based on MS is useful for pointing out the differences in some food proteomes relevant to human nutrition. Stable isotope label-free (SIF) techniques are suitable for comparing an unlimited number of samples by the use of relatively simple experimental workflows. We have developed an internal standard label-free method based on the intensities of peptide precursor ions from MS/MS spectra, collected in data dependent runs, for the simultaneous qualitative characterization and relative quantification of storage proteins of Lupinus albus seeds in protein extracts of four lupin cultivars (cv Adam, Arés, Lucky, Multitalia). The use of an innovative microfluidic system, the HPLC-Chip, coupled with a classical IT mass spectrometer, has allowed a complete qualitative characterization of all proteins. In particular, the homology search mode has permitted to identify single amino acid substitutions in the sequences of vicilins (beta-conglutin precursor and vicilin-like protein). The MS/MS sequencing of substituted peptides confirms the high heterogeneity of vicilins according to the peculiar characteristics of the vicilin-encoding gene family. Two suitable bioinformatics parameters were optimized for the differential analyses of the main bioactive proteins: the "normalized protein average of common reproducible peptides" (N-ACRP) for gamma-conglutin, which is a homogeneous protein, and the "normalized protein mean peptide spectral intensity" (N-MEAN) for the highly heterogenous class of the vicilins.

  6. Pea seeds (Pisum sativum, faba beans (Vicia fabavar. minor and lupin seeds (Lupinus albus var. multitalia as protein sources in broiler diets: effect of extrusion on growth performance

    Directory of Open Access Journals (Sweden)

    Gianfranco Piva

    2010-01-01

    Full Text Available The effect of extrusion of pea seeds (Pisum sativum (PS, faba bean (Vicia faba, variety minor (FB and lupin seeds (Lupinus albus, variety multitalia (LS on broiler performance were evaluated. Four hundred sixty two 1d-old Ross male chicks, Marek vaccinated, were randomly assigned to seven dietary treatments (3 pens per treatment/22 birds per pen. Chicks were floor housed, ad libitum fed isocaloric and isonitrogenous diets and had free access to water. Artificial light was provided 10 h/d. The bulk of the base diet (control diet was corn (48.8%, 53.7% and 57%, solvent-extracted soy- bean meal (42.8%, 37.3% and 33.4%, corn oil (4.4%, 5.2% and 6.3%, plus synthetic amino acids, minerals, trace minerals and vitamins, respectively for the 1-10d-old, 11-28d-old and 29 to 42d-old growing periods. The amounts of PS, FB and LS used on an as fed basis were: PS and extruded PS (EPS: 353 (1-10d-old, 356 (11-28d-old and 350 (29- 42d-old g/kg; FB and extruded FB (EFB: 479 (1-10d-old, 497 (11-28d-old and 500 (29-42d old g/kg; LS and extrud- ed LS (ELS: 360 (1-10d-old and 300 (11-42d-old g/kg. High levels of pea (350 g/kg and faba bean (500 g/kg did not show negative effects on body weight gain (BWG and bird feed intake compared to control. Lupin at the 300 g/kg level reduced (P< 0.05 the BWG during the finishing period (22 to 42 d, however the effect disappeared over the whole experimental period (1-42 d compared to the control group. The ELS group had a lower (P< 0.01 feed intake com- pared to the control group and to the LS group. The feed conversion rate (FCR was similar among groups for the whole experimental period; however during the grower period the FCR was higher (P< 0.05 for the PS, FB and EFB groups com- pared to the control group. Birds consuming the PS diet had a reduced (P< 0.05 eviscerated carcass yield compared to the control group. The breast meat percent yield was higher (P< 0.01 for birds consuming the FB and EFB diets compared to the control

  7. Effects of dehulling, steam-cooking and microwave-irradiation on digestive value of white lupin (Lupinus albus) seed meal for rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar).

    Science.gov (United States)

    Saez, Patricio; Borquez, Aliro; Dantagnan, Patricio; Hernández, Adrián

    2015-01-01

    A digestibility trial was conducted to assess the effect of dehulling, steam-cooking and microwave-irradiation on the apparent digestibility of nutrients in white lupin (Lupinus albus) seed meal when fed to rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Six ingredients, whole lupin seed meal (LSM), dehulled LSM, dehulled LSM steam-cooked for 15 or 45 min (SC15 and SC45, respectively) and LSM microwave-irradiated at 375 or 750 W (MW375 and MW750, respectively), were evaluated for digestibility of dry matter, crude protein (CP), lipids, nitrogen-free extractives (NFE) and gross energy (GE). The diet-substitution approach was used (70% reference diet + 30% test ingredient). Faeces from each tank were collected using a settlement column. Dehulled LSM showed higher levels of proximate components (except for NFE and crude fibre), GE and phosphorus in comparison to whole LSM. Furthermore, SC15, SC45, MW375 and MW750 showed slight variations of chemical composition in comparison to dehulled LSM. Results from the digestibility trial indicated that dehulled LSM, SC15, SC45 and MW375 are suitable processing methods for the improvement of nutrients' apparent digestibility coefficient (ADC) in whole LSM. MW750 showed a lower ADC of nutrients (except for CP and lipids for rainbow trout) in comparison with MW350 for rainbow trout and Atlantic salmon, suggesting a heat damage of the ingredient when microwave-irradiation exceeded 350 W.

  8. Raw Pea (Pisum sativum, raw Faba bean (Vicia faba var. minor and raw Lupin (Lupinus albus var. multitalia as alternative protein sources in broiler diets

    Directory of Open Access Journals (Sweden)

    Gianfranco Piva

    2010-01-01

    Full Text Available The ban of the meat and bone meal for entering animal diets and the concern of transgenic feeds poses a challenge toanimal nutritionists in Europe. The challenge is to find homegrown protein-rich feedstuffs, making sure no antinutritionalfactors are present which could interfere in the animals’ performance. The raw Pea (Pisum sativum (RP, raw Fababean (Vicia faba, variety minor (RFb and raw Lupin (Lupinus albus, variety multitalia (RL were evaluated as alternativeprotein sources into broiler diets. Six hundred thirty 1d-old Ross male chicks, Marek vaccinated, were randomlyassigned to seven dietary treatments (5 pens per treatment/18 birds per pen. Chicks were floor housed, ad libitum fedisocaloric and isonitrogenous diets and had free access to water. Artificial light was provided 10 h/d. The bulk of the basediet (control diet was corn (48.7%, 56.6% and 57%, solvent-extracted soybean meal (42.8%, 37.3% and 33.4%, cornoil (4.4%, 5.2% and 6.3%, plus synthetic amino acids, minerals, trace minerals and vitamins, respectively for the 1-10d-old, 11-28d-old and 29 to 42d-old growing periods. The RP, RFb and RL entered diets in substitution of the soybeanand corn according to the cost optimization (P100, Fb100 and L100, respectively for RP, RFb and RL and at half of theoptimized quantity (RP50, RFb50 and RL50, respectively for RP, RFb and RL. The amount used as fed basis for the higherlevel of inclusion were: P100: 350 g/kg for all diets; Fb100: 480 g/kg (1-10d-old and 500 g/kg (11-42d-old; L100:360 g/kg (1-10d-old and 300 g/kg (11-42d-old. The average daily gain (ADG were lower (P compared to the control group. Over the whole period of growth, the RFb group had similar ADG compared to the controlgroup and for both levels of inclusion, whereas reduced (P (P growth. Birds performance was improved (P and breast and leg quarter cuts. The RFb and RL could represent valuable protein feeds in broilers diet formulation.

  9. Ruminal Degradability of Dry Matter and Crude Protein from Moist Dehulled Lupin and Extruded Rapeseed Meal Degradabilidad Ruminal de la Materia Seca y de la Proteína Cruda de Lupino Descascarado y Torta de Raps Extruidos

    Directory of Open Access Journals (Sweden)

    Claudia Barchiesi-Ferrari

    2011-09-01

    Full Text Available The flow of ruminal undegradable protein (RUP to the small intestine can be increased if ruminal degradation of dietary protein is reduced. The objective of this study was to evaluate the effect of extrusion on ruminal degradability of dry matter (DM and crude protein (CP from dehulled lupin (Lupinus albus L. (DL and rapeseed (Brassica napus L. meal (RM. Unextruded soybean (Glicine max L. meal (SBM was used as a control. The DL was extruded at 130 ºC with 20% moisture and RM was extruded at 120 ºC with 20% moisture. Ruminal degradability was evaluated in situ by incubating feed samples for 2, 4, 8, 12, 24, and 48 h of fermentation in the rumen using three rumen-fistulated dairy cows. Values of CP soluble fraction (“a” in SBM, DL, extruded dehulled lupin (EDL, RM, and extruded rapeseed meal (ERM was lower in the extruded feeds (P El flujo de proteína no degradable en el rumen (RUP hacia el intestino delgado puede ser incrementado si se reduce la degradación ruminal de la proteína dietaria. El objetivo de este trabajo fue evaluar el efecto de la extrusión sobre la degradabilidad ruminal de la materia seca (DM y proteína cruda (CP de lupino (Lupinus albus L. descascarado (DL y torta de raps (Brassica napus L. (RM. Se utilizó afrecho de soya (Glicine max L. sin extruir (SBM como control. El DL fue extruido a 130 ºC con 20% de humedad y la RM fue extruida a 120 ºC con 20% de humedad. La degradabilidad ruminal se evaluó in situ incubando las muestras de alimentos a 2, 4, 8, 12, 24 y 48 h de fermentación en tres vacas lecheras con fístula ruminal. Los valores de la fracción soluble de la CP (“a” en SBM, en DL, lupino descascarado extruido (EDL, RM y torta de raps extruida (ERM fue menor en los extruidos (P < 0.05. La fracción lentamente degradable (“b” de SBM, DL, EDL, RM y de ERM fue 858; 593; 622 y 451 y 457 g kg-1, respectivamente, y se incrementó por extrusión (P < 0.05. La extrusión redujo la degradabilidad efectiva

  10. PR-10 proteins as potential mediators of melatonin-cytokinin cross-talk in plants: crystallographic studies of LlPR-10.2B isoform from yellow lupine.

    Science.gov (United States)

    Sliwiak, Joanna; Sikorski, Michal; Jaskolski, Mariusz

    2018-04-06

    LlPR-10.2B, a Pathogenesis-related class 10 (PR-10) protein from yellow lupine (Lupinus luteus) was crystallized in complex with melatonin, an emerging important plant regulator and antioxidant. The structure reveals two molecules of melatonin bound in the internal cavity of the protein, plus a very well-defined electron density near the cavity entrance, corresponding to an unknown ligand molecule comprised of two flat rings, which is most likely a product of melatonin transformation. In a separate LlPR-10.2B co-crystallization experiment with an equimolar mixture of melatonin and trans-zeatin, which is a cytokinin phytohormone well recognized as a PR-10-binding partner, a quaternary 1 : 1 : 1 : 1 complex was formed, in which one of the melatonin-binding sites has been substituted with trans-zeatin, whereas the binding of melatonin at the second binding site and binding of the unknown ligand are undisturbed. This unusual complex, when compared with the previously described PR-10/trans-zeatin complexes and with the emerging structural information about melatonin binding by PR-10 proteins, provides intriguing insights into the role of PR-10 proteins in phytohormone regulation in plants, especially with the involvement of melatonin, and implicates the PR-10 proteins as low-affinity melatonin binders under the conditions of elevated melatonin concentration. Atomic coordinates and processed structure factors corresponding to the final models of the LlPR-10.2B/melatonin and LlPR-10.2B/melatonin + trans-zeatin complexes have been deposited with the Protein Data Bank (PDB) under the accession codes 5MXB and 5MXW. The corresponding raw X-ray diffraction images have been deposited in the RepOD Repository at the Interdisciplinary Centre for Mathematical and Computational Modelling (ICM) of the University of Warsaw, Poland, and are available for download with the following Digital Object Identifiers (DOI): https://doi.org/10.18150/repod.9923638 and https://doi.org/10

  11. Sweet lupins as a feedstuff for broilers

    African Journals Online (AJOL)

    Iyn is gebruik. Elke groep het bestaan uit 10haantjies of 10hennetjies. Daar was vier herhalings van elke behandeling wat neerkom op 40 kuikens per behandeling. Die resultate het getoon dat die insluiting van soveel as 400 g/kg soet lupiene ( ...

  12. Avaliação das silagens de capim-elefante aditivadas com nabo forrageiro, pinhão manso e tremoço, pela técnica de produção de gases Evaluation of elephant grass silages with forage radish, jatropha and lupine cakes as additives by the gas production technique

    Directory of Open Access Journals (Sweden)

    Arnaldo Prata Neiva Júnior

    2010-08-01

    Full Text Available Objetivou-se, na condução deste trabalho, a avaliação das silagens de capim-elefante aditivadas com tortas de nabo forrageiro, pinhão manso e tremoço pela técnica de produção de gás. O experimento foi desenvolvido no Laboratório de Nutrição Animal do Centro de Energia Nuclear na Agricultura da Universidade de São Paulo (LANA/CENA/USP. Como doadores de líquido de rúmen, foram utilizados 2 ovinos da raça Santa Inês, machos, adultos, castrados e providos de cânula ruminal permanente. A alimentação dos animais doadores foi constituída de forragem de gramínea cultivada e uma suplementação, ao final do dia, com feno de Tifton, concentrado comercial e sal mineral à vontade. Os substratos foram secos a 60ºC, moídos em moinho do tipo Willey, provido de peneira com perfurações de 2 mm. Os gases produzidos durante os diferentes períodos de fermentação (0, 4, 8, 12, 24, 36, 48, 72 e 96 h foram medidos com um transducer - medidor de pressão.O experimento foi instalado segundo um delineamento de blocos ao acaso em que os tratamentos foram arranjados em um esquema de parcelas subdivididas no tempo. Os maiores valores de produção de gás observados para os tratamentos em que adicionou-se torta de tremoço quando comparados com as outras tortas, decorreu do fato da torta de tremoço apresentar menor teor de fibras, propiciando assim, uma maior fermentação ruminal e, consequentemente, maior produção de gás em relação a outros alimentos com maior proporção de carboidratos estruturais (parede celular.As taxas de degradação da fração solúvel da matéria seca foi menor para NF 8% e PM 11% em relação às outras silagens estudadas. Foram encontradas diferenças significativas para as TNF, TPM e TT, nos diferentes níveis, em relação ao volume de gases em 96 h de incubação (PThe objective of this work was to evaluate elephant grass silages with forage radish, Jatropha and lupine cakes as additives by the gas

  13. Isolamento da globulina majoritária, digestibilidade in vivo e in vitro das proteínas do tremoço-doce (Lupinus albus L., var. Multolupa Isolation of major globulin, in vivo and in vitro digestibility of proteins from sweet lupin (Lupinus albus L. var. Multolupa

    Directory of Open Access Journals (Sweden)

    Valdir Augusto Neves

    2006-12-01

    Full Text Available Os objetivos do trabalho foram isolar, purificar e estudar algumas propriedades da fração globulina majoritária de tremoço-doce, var. Multolupa; assim como avaliar as características de digestibilidade da farinha e frações isoladas. As frações protéicas foram separadas por fracionamento diferencial com uso de diferentes solventes. A globulina majoritária de tremoço-doce foi isolada, purificada por cromatografia em Q-Sepharose, revelando um único pico de proteína. Apresentou um peso molecular de 162,5 ± 10,0 kDa, determinado por cromatografia em Sephacryl S-300, e subunidades entre 20-70 kDa em PAGE-SDS. A solubilidade em função do pH e concentrações de NaCl revelaram curva típica dessa fração. A digestibilidade da proteína da farinha e das frações albumina, globulina e glutelina foi avaliada por experimentos in vitro e in vivo e se revelou alta para a fração globulina, seguida pela glutelina, albumina e farinha. A digestibilidade in vivo da fração globulina, tanto aparente quanto verdadeira, não diferiu significativamente daquela determinada para a caseína. Apesar da alta digestibilidade da fração majoritária e frações protéicas, a utilização como única fonte de proteína nas dietas revelou valores baixos de RPLR (razão protéica líquida relativa, indicando ser insuficiente para sustentar o crescimento dos animais, comparativamente à caseína.The aim of the present work was to isolate, purify and study some properties of the major globulin fraction from sweet lupin, var. Multolupa; as well as to evaluate the digestibility features of flour and isolated fractions. The protein fractions were separated by differential fractionation with different solvents. The lupin major globulin was isolated, purified by Q-Sepharose chromatography when it showed only one protein peak. The major protein presented a molecular weight of 162.5 ± 10.0 kDa, determined on Sephacryl S-300 chromatography; and subunits between 20

  14. Avaliação de algumas propriedades funcionais das farinhas de tremoço doce (Lupinus albus e feijão guandu (Cajanus cajan (L Millsp e sua utilização na produção de fiambre Evaluation of some functional properties of lupin sweet flour (Lupinus albus and faba bean flour (Cajanus cajan (L Millsp and their utilization in cooked ham production

    Directory of Open Access Journals (Sweden)

    Fernando Castilho

    2010-03-01

    Full Text Available O aumento na demanda de alimentos no mundo tem motivado pesquisadores a buscarem fontes alternativas a fim de enriquecer nutricionalmente alimentos industrializados e torná-los viáveis economicamente às populações menos favorecidas. O tremoço doce e o feijão guandu são leguminosas com elevado conteúdo proteico e grande potencial de utilização no enriquecimento nutricional de alimentos industrializados, além de desempenharem funcionalidades. Os resultados obtidos neste trabalho permitiram observar que a farinha de tremoço doce é capaz de absorver de 172 a 186% do seu peso em água e de ~62% em óleo, enquanto que a farinha de feijão guandu absorve cerca de 100% de seu peso em água e 50% em óleo. Boa atividade e estabilidade foram observadas para as emulsões obtidas com estas farinhas, indicando potencial de aplicação na produção de embutidos. Objetivou-se neste trabalho, avaliar algumas propriedades funcionais das farinhas de tremoço doce e feijão guandu e sua utilização na fabricação de fiambres. Os fiambres foram elaborados no Laboratório de Controle de Qualidade de Alimentos da Faculdade de Ciências Farmacêuticas da Universidade Estadual Paulista (UNESP, na cidade de Araraquara, com o intuito de oferecer um alimento enriquecido nutricionalmente. Quando comparados ao fiambre elaborado com a adição de concentrado proteico de soja, estes fiambres não apresentaram diferenças significativas nos atributos sensoriais aparência, cor, aroma, textura e impressão global, embora tivessem pouca aceitabilidade sensorial.The increase in food demand worldwide has motivated researchers to seek alternative food crops to nutritionally enrich industrialized foods and make them economically viable to poorer populations. Sweet lupin and faba bean are high protein content legumes of great potential for nutritional enrichment of industrialized foods, besides performing a functional purpose. The results obtained in this work

  15. extent and pattern of genetic diversity in ethiopian white lupin

    African Journals Online (AJOL)

    ACSS

    seventeen clusters of different sizes, of which five were singletons. Some landraces were ... On the other hand, landraces from Awi, South Gondar and West Gojam in. Ethiopia were ... Based on a work ... originated from the Mediterranean, and eastern and northern Africa ... every management strategy directed towards the.

  16. INBREEDING EFFECTS IN WILD LUPINE (FABACEAE): DOES POPULATION SIZE MATTER? (R826596)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  17. The bacterial artificial chromosome (BAC) library of the narrow-leafed lupin (Lupinus angustifolius L.)

    Czech Academy of Sciences Publication Activity Database

    Kasprzak, A.; Šafář, Jan; Janda, Jaroslav; Doležel, Jaroslav; Wolko, B.; Naganowska, B.

    2006-01-01

    Roč. 11, - (2006), s. 396-407 ISSN 1425-8153 R&D Projects: GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50380511 Keywords : BAC * genomic DNA library * Lupinus angustifolius L. Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.238, year: 2006

  18. Effect of Lupine Flour on Baking Characteristics of Gluten Free Cookies

    OpenAIRE

    Sofyan Maghaydah; Selma Abdul-hussain; Radwan Ajo; Yousef Tawalbeh; Noor Elsahoryi

    2013-01-01

    Celiac Disease (CD) is an immune-mediated disease in genetically susceptible individuals caused by intolerance to gluten protein in some cereals, resulting in mucosal inflammation, which causes malabsorption. An effective treatment for CD is a gluten-free diet that excludes cereals containing gluten. One of the most desirable wheat products is the cookie, which is considered suitable for all ages due to its low manufacturing cost, convenience, long shelf life and good eating quality. Therefor...

  19. Apparent competition with an invasive plant hastens the extinction of an endangered lupine.

    Science.gov (United States)

    Dangremond, Emily M; Pardini, Eleanor A; Knight, Tiffany M

    2010-08-01

    Invasive plants may compete with native plants by increasing the pressure of native consumers, a mechanism known as "apparent competition." Apparent competition can be as strong as or stronger than direct competition, but the role of apparent competition has rarely been examined in biological invasions. We used four years of demographic data and seed-removal experiments to determine if introduced grasses caused elevated levels of seed consumption on native plant species in a coastal dune system in California, USA. We show that the endangered, coastal dune plant Lupinus tidestromii experiences high levels of pre-dispersal seed consumption by the native rodent Peromyscus maniculatus due to its proximity to the invasive grass, Ammophila arenaria. We use stage-structured, stochastic population models to project that two of three study populations will decline toward extinction under ambient levels of consumption. For one of these declining populations, a relatively small decrease in consumption pressure should allow for persistence. We show that apparent competition with an invasive species significantly decreases the population growth rate and persistence of a native species. We expect that apparent competition is an important mechanism in other ecosystems because invasive plants often change habitat structure and plant-consumer interactions. Possible implications of the apparent-competition mechanism include selective extinction of species preferred by seed consumers in the presence of an invasive species and biological homogenization of communities toward non-preferred native plant species.

  20. Assessment of Lupin Induced Mutants for Quality Traits and Susceptibility to Callosbruchus chinensis and Heliothis armigera insects

    International Nuclear Information System (INIS)

    Ragab, A.I.; Boshra, S.A.; Mehany, A.L.; Darwish, A.A.; Kharrab, M.M.

    2008-01-01

    This study was conducted to assess 23 induced mutants and two parental varieties Giza1 and Giza2 in the three generations (M3, M4, and M5) for seed quality traits, and susceptibility to two insects i.e C. chinnensis and H.armigera. The obtained results exhibited highly significant decrease for alkaloid content of mutants 20 and 23 as compared with the two local varieties. Most of mutants and Giza 2 showed marked increase for protein content as compared with Giza1, however, the increase did not reach the level of significance for the most mutants as compared with Giza2 in the three generations. Except of M4 generation. marked resistance for infestations with C.chinensis and H.armigera was obtained for mutants 1, 5 and 11 in the three generations. However, for total infestation with the two insects, resistance was obtained in mutants 4 and 10. Except of mutant lines 1, 5 and 11, all mutants showed higher loss percentage than that of the local varieties

  1. Attempt at estimating the rate of symbiotic fixation of nitrogen in the Lupine by natural isotopic tracing (/sup 15/N)

    Energy Technology Data Exchange (ETDEWEB)

    Amarger, Noelle [INRA Centre de Recherches de Dijon, 21 (France). Lab. de Microbiologie des Sols; Mariotti, Andre; Mariotti, Francoise [Paris-6 Univ., 75 (France)

    1977-06-06

    The rate of nitrogen fixation by a Rhizobium-Leguminous plant pair has been determined by natural isotopic tracing (/sup 15/N). After determining the isotopic fractionation coefficients between atmospheric nitrogen and plant nitrogen on the one hand (epsilon=-0.9) and nitrogen of the substrate and plant nitrogen on the other hand (epsilon=-1.1), the rate of nitrogen fixation by way of mixed nutrition cultures was calculated. The method is more accurate than standard methods.

  2. The Coast Artillery Journal. Volume 66, Number 1, January 1927

    Science.gov (United States)

    1927-01-01

    trade and preach at Nootka. Mr. MacInnes spent his hoyhood days at New Westminister and about BOOK REVIEWS 93 Burrard’s Inlet, and knew Canon Good...Standards Council, San Francisco. 1926. 6"x 9". 22 pp. $0.10. The author urges support of the metric legislative proposals now before Con- gress (H. J

  3. Publications - GMC 234 | Alaska Division of Geological & Geophysical

    Science.gov (United States)

    following North Slope wells: Itkillik River Unit #1, Nora Fed #1, Toolik Fed #1, Kemik Unit #1, Lupine Unit following North Slope wells: Itkillik River Unit #1, Nora Fed #1, Toolik Fed #1, Kemik Unit #1, Lupine Unit

  4. Determination of the complete nucleotide sequence of a lupine potyvirus isolate from the Czech Republic reveals that it belongs to a new member of the genus Potyvirus

    Czech Academy of Sciences Publication Activity Database

    Sarkisova, Tatiana; Petrzik, Karel

    2011-01-01

    Roč. 156, č. 1 (2011), s. 167-169 ISSN 0304-8608 R&D Projects: GA MZe QH71145 Institutional research plan: CEZ:AV0Z50510513 Keywords : plants * virus * motif Subject RIV: EE - Microbiology, Virology Impact factor: 2.111, year: 2011

  5. THE EFFECTS OF SELF-POLLINATION AND MATERNAL RESOURCES ON REPRODUCTION AND OFFSPRING PERFORMANCE IN THE WILD LUPINE, LUPINUS PERENNIS (FABACEAE). (R826596)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  6. Increased amount of Bifidobacterium thermacidophilum and Megasphaera elsdenii in the colonic microbiota of pigs fed a swine dysentery preventive diet containing chicory roots and sweet lupine

    DEFF Research Database (Denmark)

    Mølbak, Lars; Thomsen, L.E.; Jensen, Tim Kåre

    2007-01-01

    Aims: To investigate which specific bacterial species that were stimulated or inhibited in the proximal colon of pigs when a fructan-rich diet was compared with a diet that contained resistant carbohydrates. The study focussed especially on Bifidobacterial species by using a noncultureable approa...

  7. Cross-talk interactions of exogenous nitric oxide and sucrose modulates phenylpropanoid metabolism in yellow lupine embryo axes infected with Fusarium oxysporum.

    Science.gov (United States)

    Morkunas, Iwona; Formela, Magda; Floryszak-Wieczorek, Jolanta; Marczak, Łukasz; Narożna, Dorota; Nowak, Witold; Bednarski, Waldemar

    2013-10-01

    The aim of the study was to examine cross-talk of exogenous nitric oxide (NO) and sucrose in the mechanisms of synthesis and accumulation of isoflavonoids in embryo axes of Lupinus luteus L. cv. Juno. It was verified whether the interaction of these molecules can modulate the defense response of axes to infection and development of the pathogenic fungus Fusarium oxysporum f. sp. lupini. Sucrose alone strongly stimulated a high level of genistein glucoside in axes pretreated with exogenous nitric oxide (SNP or GSNO) and non-pretreated axes. As a result of amplification of the signal coming from sucrose and GSNO, high isoflavonoids accumulation was observed (+Sn+GSNO). It needs to be stressed that infection in tissues pretreated with SNP/GSNO and cultured on the medium with sucrose (+Si+SNP/+Si+GSNO) very strongly enhances the accumulation of free isoflavone aglycones. In +Si+SNP axes phenylalanine ammonia-lyase activity was high up to 72h. As early as at 12h in +Si+SNP axes an increase was recorded in gene expression level of the specific isoflavonoid synthesis pathway. At 24h in +Si+SNP axes a very high total antioxidant capacity dependent on the pool of fast antioxidants was noted. Post-infection generation of semiquinone radicals was lower in axes with a high level of sucrose than with a deficit. Copyright © 2013 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  8. Evaluation of Induced Mutants Using Irradiation and Chemical Mutagen in Lupin (Lupinus albus L.) for Earliness and Yield and Its Components

    International Nuclear Information System (INIS)

    Ragsb, A.I.; Boshra, S. A.; Mehany, A. L.; Darwish, A. A.; Khattab, M. M.

    2007-01-01

    This study was conducted in 2001 / 2002, 2002 /2003 and 2003/ 2004 seasons at the Experimental Farm of Nuclear Res. Center, Inshas. The objectives were to evaluate 23 induced mutants with gamma rays and EMS and two local cultivars Giza 1 and Giza 2 in the three generations (M3, M4, and M5) for earliness and seed yield and its components. The results were: It was found that earliness was observed for mutants 5, 11, 17, 21 and 22 as compared with Giza 1 and Giza 2 in the three generations with a maximum value of 19 days earlier than Giza 2. Highly significant increase for number of pods / plant was found for mutants 8, 15 and 19 as compared with the two local cultivars in the three generations. A considerable increase for no of seeds/plant was noticed only for mutant lines 8 and 15 as compared with the two local cultivars. A remarkable increase for seed index was only found for mutant lines 6, 12 and 21 as compared with the two local cultivars in the three generations. A considerable increase for seed yield / plant was revealed for mutant lines 1, 4, 7, 8, 15 and 19 as compared with the two local cultivars in the three generations.

  9. The regulatory network of cluster-root function and development in phosphate-deficient white lupin (Lupinus albus) identified by transcriptome sequencing.

    Science.gov (United States)

    Wang, Zhengrui; Straub, Daniel; Yang, Huaiyu; Kania, Angelika; Shen, Jianbo; Ludewig, Uwe; Neumann, Günter

    2014-07-01

    Lupinus albus serves as model plant for root-induced mobilization of sparingly soluble soil phosphates via the formation of cluster-roots (CRs) that mediate secretion of protons, citrate, phenolics and acid phosphatases (APases). This study employed next-generation sequencing to investigate the molecular mechanisms behind these complex adaptive responses at the transcriptome level. We compared different stages of CR development, including pre-emergent (PE), juvenile (JU) and the mature (MA) stages. The results confirmed that the primary metabolism underwent significant modifications during CR maturation, promoting the biosynthesis of organic acids, as had been deduced from physiological studies. Citrate catabolism was downregulated, associated with citrate accumulation in MA clusters. Upregulation of the phenylpropanoid pathway reflected the accumulation of phenolics. Specific transcript expression of ALMT and MATE transporter genes correlated with the exudation of citrate and flavonoids. The expression of transcripts related to nucleotide degradation and APases in MA clusters coincided with the re-mobilization and hydrolysis of organic phosphate resources. Most interestingly, hormone-related gene expression suggested a central role of ethylene during CR maturation. This was associated with the upregulation of the iron (Fe)-deficiency regulated network that mediates ethylene-induced expression of Fe-deficiency responses in other species. Finally, transcripts related to abscisic acid and jasmonic acid were upregulated in MA clusters, while auxin- and brassinosteroid-related genes and cytokinin receptors were most strongly expressed during CR initiation. Key regulations proposed by the RNA-seq data were confirmed by quantitative real-time polymerase chain reaction (RT-qPCR) and some physiological analyses. A model for the gene network regulating CR development and function is presented. © 2014 Scandinavian Plant Physiology Society.

  10. (Lupinus albus) SEEDS

    African Journals Online (AJOL)

    user

    2010-08-08

    Aug 8, 2010 ... lupin samples indicated that lupins can be used as a raw material for various food ... lupin seeds can be utilized for milk and meat imitation products. ... estimated by multiplying the percentage of crude protein, crude fat and ...

  11. Managing technological aspects of Lupinus mutabilis from a food sovereignty perspective in Ecuador

    NARCIS (Netherlands)

    Carvajal Larenas, F.E.

    2013-01-01

    The present thesis deals with the technological aspects of the debittering process of lupin in a food sovereignty framework. Of all investigated lupin species,Lupinus mutabilishas the best nutritional composition, which is similar to that of soya bean (Glycine max). Lupins can

  12. Identification of a Low Digestibility ?-Conglutin in Yellow Lupin (Lupinus luteus L.) Seed Meal for Atlantic Salmon (Salmo salar L.) by Coupling 2D-PAGE and Mass Spectrometry

    OpenAIRE

    Ogura, Takahiro; Hern?ndez, Adri?n; Aizawa, Tomoko; Ogihara, Jun; Sunairi, Michio; Alcaino, Javier; Salvo-Garrido, Haroldo; Maureira-Butler, Iv?n J.

    2013-01-01

    The need of quality protein in the aquaculture sector has forced the incorporation of alternative plant proteins into feeding diets. However, most plant proteins show lower digestibility levels than fish meal proteins, especially in carnivorous fishes. Manipulation of protein content by plant breeding can improve the digestibility rate of plant proteins in fish, but the identification of low digestibility proteins is essential. A reduction of low digestibility proteins will not only increase ...

  13. Feed preference of grower ostriches consuming diets differing in ...

    African Journals Online (AJOL)

    Feed costs contribute the largest proportion of the input costs of slaughter birds in an intensive ostrich production unit. Alternative, cheaper feedstuffs, such as lupins (sweet and bitter cultivars), were therefore evaluated to determine the optimal lupin inclusion level in ostrich rations without affecting feed preference and ...

  14. Chemical composition, physicochemical and functional properties of ...

    African Journals Online (AJOL)

    The results of chemical composition, physicochemical and functional properties for both lupin samples indicated that lupins can be used as a raw material for various food products manufacturing and provide consistency in food processing, analogous to other food legumes. Therefore, the research findings can be used by ...

  15. Analysis of interspecies physicochemical variation of grain legume seeds

    Science.gov (United States)

    Rybiński, Wojciech; Rusinek, Robert; Szot, Bogusław; Bocianowski, Jan; Starzycki, Michał

    2014-10-01

    The paper presents an attempt to assess the reaction of seeds to mechanical loads taking into account their geometry expressed as seed thickness and 1000 seed weight. The initial material comprised 33 genotypes of grain legume plants and included cultivars registered in the country and breeding lines that are subject to pre-registration trials. The analysis of variance revealed significant diversity of the cultivars and lines of the species studied in terms of each of the analysed trait. The highest weight of 1000 seeds were obtained for white lupine seeds and peas, the lowest for andean lupine seeds. The maximum deformation and energy were obtained for white lupine seeds, the lowest for pea seeds, the maximum force and module the lowest values were determined for narrow-leafed lupine and pea. The highest values of protein were obtained for andean and yellow lupine, a fat content for andean and white lupine. The fatty acid profile as much as 70% or more were linoleic and oleic acids. Against the background of all the species are distinguished by white lupine seeds with a high content of oleic acid and the lowest of linoleic acid, for yellow lupine were obtained the inverse ratio of the two acids.

  16. Effect of processing on the diffusion of alkaloids and quality of lupinus mutabilis sweet

    NARCIS (Netherlands)

    Carvajal Larenas, F.E.; Boekel, van M.A.J.S.; Koziol, M.; Nout, M.J.R.; Linnemann, A.R.

    2014-01-01

    Cold water processing by soaking, cooking and washing has been used for hundreds of years to produce debittered lupine in the Andean region. The process of debittering lupine (Lupinus mutabilis Sweet) was investigated at semi-industrial village-scale and laboratory scale in Ecuador. The process took

  17. 78 FR 17600 - Banda de Lupinus albus doce (BLAD); Exemption From the Requirement of a Tolerance

    Science.gov (United States)

    2013-03-22

    ... lupines. It has a dark brown color with a sweet odor and is 60% biodegradable within 14 days after... of carcinogenicity in lupin-treated animals, and no signs of toxicity or decreases in body weight... (Lupinus angustifolius) by rats for up to 700 days: Effects on body composition and organ weights. British...

  18. Compositional changes in (iso)flavonoids and estrogenic activity of three edible Lupinus species by germination and Rhizopus-elicitation

    NARCIS (Netherlands)

    Aisyah, Siti; Vincken, Jean Paul; Andini, Silvia; Mardiah, Zahara; Gruppen, Harry

    2016-01-01

    The effects of germination and elicitation on (iso)flavonoid composition of extracts from three edible lupine species (Lupinus luteus, Lupinus albus, Lupinus angustifolius) were determined by RP-UHPLC-MS. n The total (iso)flavonoid content of lupine increased over 10-fold upon

  19. Monterey Peninsula Water Supply Project Supplemental Draft Environmental Impact Report/Statement. Appendices. Monterey Peninsula Water Management District

    Science.gov (United States)

    1991-08-01

    device and trapping facility near the face cf the 8 3 88089 A3-7 FIGURE 3-3 -7/ .7-U mv I 1 . - a Cach agua Creek Site Are a V 0 2.5 5 I I 1L KilometersI...succulentus succulent annual lupine Madia gracilis gumweed Madia madioides woodland madia Madia sativa Chile tarweed Marah fabaceus manroot Medicago...Lupinus nanus ssp. nanus sky lupine Lupinus succulentus succulent annual lupine Madia gracilis gumweed Madia sativa Chile tarweed I Marah fabaceus

  20. Citrus tristeza virus: An increasing trend in the virus occurrence and ...

    African Journals Online (AJOL)

    ABC

    2015-07-29

    Jul 29, 2015 ... Citrus tristeza clostervirus (CTV) is one of the most damaging fruit viruses playing havoc in citrus ... diseases of citrus trees reported in Pakistan are tristeza, .... bark. Vein clearing and stem pitting were also observed on sweet orange trees sour ..... disposal of source of inoculum by removing old citrus trees ...

  1. Effect of pea and faba bean fractions on net fluid absorption in ETEC-infected small intestinal segements of weaned piglets

    NARCIS (Netherlands)

    Meulen, van der J.; Jansman, A.J.M.

    2010-01-01

    After weaning piglets frequently have diarrhoea associated with an enterotoxigenic Escherichia coli (ETEC) infection. Alternative plant protein sources such as peas, faba beans and lupins may contribute in preventing gastrointestinal problems. In the small intestinal segment perfusion model, the

  2. 78 FR 48898 - Receipt of Applications for Endangered Species Permits

    Science.gov (United States)

    2013-08-12

    ... Regional Office (see ADDRESSES section) or send them via electronic mail (email) to: [email protected] scrub lupine (Lupinus aridorum) for the purpose of seed harvesting, germ plasm storage, and germination...

  3. A highly sensitive method for detection of molybdenum-containing proteins

    International Nuclear Information System (INIS)

    Kalakutskii, K.L.; Shvetsov, A.A.; Bursakov, S.A.; Letarov, A.V.; Zabolotnyi, A.I.; L'vov, N.P.

    1992-01-01

    A highly sensitive method for detection of molybdenum-containing proteins in gels after electrophoresis has been developed. The method involves in vitro labeling of the proteins with the radioactive isotope 185 W. The method used to detect molybdenum-accumulating proteins in lupine seeds, xanthine dehydrogenase and another molybdenum-containing protein in wheat, barley, and pea seedlings, and nitrate reductase and xanthine dehydrogenase in bacteroides from lupine nodules. Nitrogenase could not be detected by the method. 16 refs., 5 figs

  4. Trophic Interactions during Primary Succession: Herbivores Slow a Plant Reinvasion at Mount St. Helens.

    Science.gov (United States)

    Fagan, William F; Bishop, John G

    2000-02-01

    Lupines (Lupinus lepidus var. lobbii), the earliest plant colonists of primary successional habitats at Mount St. Helens, were expected to strongly affect successional trajectories through facilitative effects. However, their effects remain localized because initially high rates of reinvasive spread were short lived, despite widespread habitat availability. We experimentally tested whether insect herbivores, by reducing plant growth and fecundity at the edge of the expanding lupine population, could curtail the rate of reinvasion and whether those herbivores had comparable impacts in the older, more successionally advanced core region. We found that removing insect herbivores increased both the areal growth of individual lupine plants and the production of new plants in the edge region, thereby accelerating the lupine's intrinsic rate of increase at the front of the lupine reinvasion. We found no such impacts of herbivory in the core region, where low plant quality or a complex of recently arrived natural enemies may hold herbivores in check. In the context of invasion theory, herbivore-mediated decreases in lupine population growth rate in the edge region translate into decreased rates of lupine spread, which we quantify here using diffusion models. In the Mount St. Helens system, decreased rate of lupine reinvasion will result in reductions in rates of soil formation, nitrogen input, and entrapment of seeds and detritus that are likely to postpone or alter trajectories of primary succession. If the type of spatial subtleties in herbivore effects we found here are common, with herbivory focused on the edge of an expanding plant population and suppressed or ineffective in the larger, denser central region (where the plants might be more readily noticed and studied), then insect herbivores may have stronger impacts on the dynamics of primary succession and plant invasions than previously recognized.

  5. The Pharmacognostic Research of L. luteus L.

    Directory of Open Access Journals (Sweden)

    O. V. Grechana

    2014-04-01

    Full Text Available Genus Lupinus (Tourn. L., belonging to the Legume family Fabaceae, has large polymorphism. Currently there are known over 250 species of lupine. Wild lupine species are found in the Apennine, Iberian and Balkan peninsulas in Asia and also in the islands of the Mediterranean Sea and the northern and eastern coasts ofAfrica. Lupine is one of the oldest cultivated plants. More than four thousand years ago inEgypt, there was a highly developed culture of white lupine. The second branch of the ancient cultures was inSouth America, where another kind of lupine was cultivated – a variable one. InCentral Europe, lupine began to grow in the second half of the XIX century culture as a green manure, and then - as the most valuable forage plant. The first written information about lupine appeared in books of ancient physicians: Hippocrates and a botanist Theophrastus. One recalls lupine as a useful edible and medical cosmetic plant in works of prominent scholars of the ancient world, such as Dioscorides, Avicenna, Galen, Pliny, and others. In folk medicine lupine is used to stimulate appetite, used against boils and moles, as a remedy against worms and pain in the abdomen and liver. With cosmetic purposes it is used for hair growth and against wrinkles. Lupine is used as a fodder crop in different forms: green weight is well ensiled, hay and hay meal are prepared from it, lupine crops are used for green fodder and for pasture, and seed is excellent concentrated food. Main areas of crop areUkraine,Belarus,Russia. L. luteus L. - Yellow lupine was input into culture 130 years ago. Its wild forms are found throughout the Mediterranean coast (Western part of North Africa, the Iberian Peninsula, Corsica,Sardinia,Sicily,SouthernItaly,Greece,Asia. Large selection work was carried out with yellow lupine - the protein content in the seeds is 40 % and green mass is 3,5; it has been ranked among the most cultivated species. In addition, its seeds contain up to 5 % of

  6. Grain legume-cereal intercropping: The practical application of diversity, competition and facilitation in arable and organic cropping systems

    DEFF Research Database (Denmark)

    Hauggaard-Nielsen, Henrik; Jørnsgaard, B.; Kinane, J.

    2008-01-01

    . Faba bean and lupin had lower yield stability than pea and fertilized barley. However, the different IC used environmental resources for plant growth up to 50% (LER=0.91-1.51) more effectively as compared to the respective SC, but with considerable variation over location, years and crops. The SC...... in Denmark over three consecutive cropping seasons including dual grain legume (pea, faba bean and lupin)-barley intercropping as compared to the respective sole crops (SC). Yield stability of intercrops (IC) was not greater than that of grain legume SC, with the exception of the IC containing faba bean......-15% compared to the corresponding SC. However, especially lupin was suppressed when intercropping, with a reduced N2-fixation from 15 to 5-6 g N m-2. The IC were particularly effective at suppressing weeds, capturing a greater share of available resources than SC. Weed infestation in the different crops...

  7. Performance of organic grain legumes in Tuscany

    Directory of Open Access Journals (Sweden)

    Valentina Moschini

    2014-03-01

    Full Text Available In 2005-2007 growing season, few varieties of field bean, high protein pea and white lupin were compared in an organic farm of Central Italy (Mugello area, Tuscany, to evaluate their agronomic performance in terms of grain yield, nutritional quality and competitive ability against weeds. The experiment was performed under rain-fed conditions. Furthermore, grain legumes features were compared between two different sowing seasons (autumnal vs late-winter for two years, in order to get information on the best time of sowing of these species, and the stability of yields of different genotypes in those climatic and soil conditions. These legumes could be an alternative protein source to external soybean, a high-risk alimentary source of genetically modified organisms, in the organic livestock sector. The main findings indicate that higher yields in grain and crude protein were obtained with the pea species and in particular with cultivars Hardy (4.0 t/ha grain yield; 626 kg/ha crude protein yield and Classic (3.1 t/ha grain yield; 557 kg/ha crude protein yield; followed by field bean cv. Chiaro di Torre Lama (2.9 t/ha grain yield; 624 kg/ha crude protein yield and cv. Vesuvio (2.5 t/ha grain yield; 549 kg/ha crude protein yield. Furthermore the field bean is interesting for the stability of yield in both years despite climatic conditions rather different. The white lupin has showed the lower yield but the best values of grain quality, with higher values in lupin Multitalia for dry matter, crude protein and ether extract and in lupin Luxe also for crude fibre, respect to the other legumes analysed. Among lupin varieties, lupin Multitalia showed the best yield results for the pedo-climatic conditions of Mugello area (0.9 t/ha lupin Multitalia; 0.2 t/ha lupin Luxe. The total yield of organic grain legumes, in the experimental site, is resulted higher with an autumnal seeding respect to the late-winter seeding (2.8 t/ha vs 1.9 t/ha.

  8. Optimisation of wheat-sprouted soybean flour bread using response ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-11-16

    Nov 16, 2009 ... which may be added include flours of other cereals, fat, malt flour, soya flour, ... but its protein is of lower nutritional quality than milk, soy, pea and lupin proteins as its ... improvers from local raw materials. It is thought that the.

  9. Development of a SIDA-LC-MS/MS Method for the Determination of Phomopsin A in Legumes.

    Science.gov (United States)

    Schloß, Svenja; Koch, Matthias; Rohn, Sascha; Maul, Ronald

    2015-12-09

    A novel method for the determination of phomopsin A (1) in lupin flour, pea flour, and bean flour as well as whole lupin plants was established based on stable isotope dilution assay (SIDA) LC-MS/MS using (15)N6-1 as an isotopically labeled internal standard. Artificially infected samples were used to develop an optimized extraction procedure and sample pretreatment. The limits of detection were 0.5-1 μg/kg for all matrices. The limits of quantitation were 2-4 μg/kg. The method was used to analyze flour samples generated from selected legume seeds and lupin plant samples that had been inoculated with Diaporthe toxica and two further fungal strains. Finally, growing lupin plants infected with D. toxica were investigated to simulate a naturally in-field mycotoxicosis. Toxin levels of up to 10.1 μg/kg of 1 were found in the pods and 7.2 μg/kg in the stems and leaves.

  10. Thick root of cucumber: other susceptible plants and the effect of pH

    NARCIS (Netherlands)

    Gaag, van der D.J.; Paternotte, P.; Hamelink, R.

    2002-01-01

    Thick root is a relatively new disorder of cucumber grown in artificial substrates. Plants of cucumber, tomato, sweet pepper, lupin, anthurium, Cucurbita ficifolia, C. maxima and two lines from crosses between C. maxima and C. moschata were grown in thick root disease (TRD)-infested nutrient

  11. Effect of pea, pea hulls, faba beans and faba bean hulls on the ileal microbial composition in weaned piglets

    NARCIS (Netherlands)

    Meulen, van der J.; Panneman, H.; Jansman, A.J.M.

    2010-01-01

    Grain legumes produced in Europe such as pea, faba beans and lupins are alternative vegetable protein sources for imported soy protein in animal feeds. These legume seeds contain constituents that are not digested and may act as a substrate for microbial fermentation in the gastrointestinal tract,

  12. Egyptian Journal of Biomedical Sciences - Vol 23 (2007)

    African Journals Online (AJOL)

    Effect Of Green Leaves And Germination And Boiling Treatments Of Fenugreek And Lupin Seeds On Chemical Composition, Serum Glucose, Lipid Profile And Hepatic Enzymes Of Rats · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT ... DOWNLOAD FULL TEXT. S A El-Adawy, A A Ramadan, 244-256.

  13. Browse Title Index

    African Journals Online (AJOL)

    Items 1 - 19 of 19 ... Vol 23 (2007), Effect Of Different Degrees Of Hepatic Dysfunction On The Pharmacokinetics Of Telmisartan, Abstract ... Vol 23 (2007), Effect Of Green Leaves And Germination And Boiling Treatments Of Fenugreek And Lupin Seeds On Chemical Composition, Serum Glucose, ... S A El-Adawy, A A Ramadan.

  14. What We Muggles Can Learn about Teaching from Hogwarts

    Science.gov (United States)

    Bixler, Andrea

    2011-01-01

    The Harry Potter series furnishes many instances of both good and bad teaching. From them, we can learn more about three principles outlined in "How People Learn" (National Research Council 2000a). (1) Teachers should question students about their prior knowledge, as Professor Lupin does before his lessons; (2) we should encourage students to…

  15. Phenotypic plasticity in the response of aphids to host plant quality

    Czech Academy of Sciences Publication Activity Database

    Thieme, T.; Truberg, B.; Dixon, Anthony F. G.

    2014-01-01

    Roč. 4, č. 2 (2014), s. 92-96 ISSN 1805-0174 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073 Institutional support: RVO:67179843 Keywords : lupin * alkaloids * aphids * Macrosiphum albifrons * biological performance Subject RIV: EH - Ecology, Behaviour

  16. Towards Sustainable Production of Protein-Rich Foods: Appraisal of Eight Crops for Western Europe. Part II: Analysis of the Technological Aspects of the Production Chain

    NARCIS (Netherlands)

    Swaving Dijkstra, D.; Linnemann, A.R.; Boekel, van M.A.J.S.

    2003-01-01

    Increased production of plant protein is required to support the production of protein-rich foods which can replace meat in the human diet to reduce the strain that intensive animal husbandry poses on the environment. The suitability of lupin (Lupinus spp.), pea (Pisum sativum), quinoa (Chenopodium

  17. Association mapping of aphid resistance in USDA cowpea (Vigna unguiculata L. Walp.) core collection using SNPs

    Science.gov (United States)

    Cowpea aphid (CPA; Aphis craccivora) is a destructive insect pest of cowpea, as well as other legume crops including alfalfa, beans, chickpea, lentils, lupins and peanuts. The utilization of aphid resistance in cowpea breeding is one of the most efficient and environmental friendly methods to contro...

  18. The effect of intermittent dosing of Nicotiana glauca on teratogenesis in goats.

    Science.gov (United States)

    Welch, K D; Panter, K E; Lee, S T; Gardner, D R

    2015-01-01

    Sustained inhibition of fetal movement in livestock species, induced by several poisonous plants, can result in numerous skeletal-contracture malformations. Lupines are responsible for a condition in cattle referred to as "crooked calf syndrome" that occurs when pregnant cattle graze teratogenic lupines. Similar malformations are also seen in animals poisoned by Conium maculatum (coniine) and Nicotiana glauca (anabasine). A proposed management strategy to limit these types of birth defects includes utilizing an intermittent grazing schedule to allow short durations of grazing lupine-infested areas interrupted by movement to a lupine-free pasture. The objective of this study was to use a goat model to determine if an intermittent schedule of five continuous days on treatment followed by two days off treatment would be sufficient to decrease, or prevent, the incidence of anabasine-induced malformations. The data from this study suggest that, for N. glauca in goats, the intermittent grazing program of five days exposure with two days of non-exposure is insufficient to prevent significant skeletal malformations from occurring. However, this study did demonstrate an inverse relationship between the amount of serum anabasine in the dam and the extent of fetal movement. Published by Elsevier Ltd.

  19. Uranium speciation in plants

    International Nuclear Information System (INIS)

    Guenther, A.; Bernhard, G.; Geipel, G.; Reich, T.; Rossberg, A.; Nitsche, H.

    2003-01-01

    Detailed knowledge of the nature of uranium complexes formed after the uptake by plants is an essential prerequisite to describe the migration behavior of uranium in the environment. This study focuses on the determination of uranium speciation after uptake of uranium by lupine plants. For the first time, time-resolved laser-induced fluorescence spectroscopy and X-ray absorption spectroscopy were used to determine the chemical speciation of uranium in plants. Differences were detected between the uranium speciation in the initial solution (hydroponic solution and pore water of soil) and inside the lupine plants. The oxidation state of uranium did not change and remained hexavalent after it was taken up by the lupine plants. The chemical speciation of uranium was identical in the roots, shoot axis, and leaves and was independent of the uranium speciation in the uptake solution. The results indicate that the uranium is predominantly bound as uranyl(VI) phosphate to the phosphoryl groups. Dandelions and lamb's lettuce showed uranium speciation identical to lupine plants. (orig.)

  20. 76 FR 30958 - Endangered and Threatened Wildlife and Plants; Permit Applications

    Science.gov (United States)

    2011-05-27

    ...] Endangered and Threatened Wildlife and Plants; Permit Applications AGENCY: Fish and Wildlife Service... Regional Director, Attn: Lisa Mandell, U.S. Fish and Wildlife Service, Ecological Services, 5600 American... Butterfly (Lycaeides melissa samuelis) adults, eggs and larvae to test interactions with wild lupine of...

  1. Modelling of the aqueous debittering process of Lupinus mutabilis Sweet

    NARCIS (Netherlands)

    Carvajal-Larenas, F.E.; Nout, M.J.R.; Boekel, van M.A.J.S.; Linnemann, A.R.

    2013-01-01

    We investigated the process of lupin debittering by soaking, cooking and washing in water using a newly designed hydroagitator. The effect on alkaloids content, solids in the product, final weight, processing time and water and energy consumption were expressed in a mathematical model for

  2. Comparison of metabolisable energy values of different foodstuffs determined in ostriches and poultry

    DEFF Research Database (Denmark)

    Cilliers, S C; Sales, J; Hayes, J P

    1999-01-01

    Apparent (AMEn) and true (TMEn) metabolisable energy values, corrected for nitrogen retention, of wheat bran, saltbush (Atriplex nummularia), common reed (Phragmites australis), lupins, soyabean oil cake meal (SBOCM), sunflower oil cake meal (SFOCM) and fishmeal were compared in 7 successive trials...

  3. Structure and Function of Nucleoside Hydrolases from Physcomitrella patens and Maize Catalyzing the Hydrolysis of Purine, Pyrimidine, and Cytokinin Ribosides

    Czech Academy of Sciences Publication Activity Database

    Kopečná, M.; Blaschke, H.; Kopečný, D.; Vigouroux, A.; Končitíková, R.; Novák, Ondřej; Kotland, Ondřej; Strnad, Miroslav; Moréra, S.; von Schwartzenberg, K.

    2013-01-01

    Roč. 163, č. 4 (2013), s. 1568-1583 ISSN 0032-0889 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511 Keywords : LUPIN LUPINUS-LUTEUS * ADENOSINE NUCLEOSIDASE * CRITHIDIA-FASCICULATA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.394, year: 2013

  4. the bacteriological safety and antimicrobial

    African Journals Online (AJOL)

    GB

    2013-03-01

    Mar 1, 2013 ... across the world, the microbial safety of such food is always uncertain. ... waste disposal and refrigeration facilities are ... Contamination from raw materials and equipment, ... Bahir Dar Town is located at 11038'N, 370 10'E ... white lupin was collected using sterile glass ..... and poor personal hygiene.

  5. Chemical composition, true metabolisable energy content and ...

    African Journals Online (AJOL)

    aneldavh

    116. Chemical composition, true metabolisable energy content and amino acid availability of grain legumes for poultry. T.S. Brand. 1, 2,3#. , D.A. Brandt. 1, 2,4 and C.W. ... alternatives (Wiseman, 1987; Brand et al., 1995). ..... The Ca, P and trace element concentrations for lupins, faba beans and peas recorded in the present.

  6. Inter simple sequence repeat (ISSR) analysis of Ethiopian white ...

    African Journals Online (AJOL)

    Oumer

    2015-05-06

    May 6, 2015 ... flowers are quite distinctive and mainly self-pollinating but can be occasionally ... AFLP, amplified fragment length polymorphism. Author(s) agree that this ... Lupine plants growing on an individual farmers plot of land were considered as ..... PROTA (plant resources of tropical Africa /ressourcesvégétales de.

  7. Influence of nutrition on ovulation rate and testicular growth of Merino sheep

    International Nuclear Information System (INIS)

    Rowe, J.B.

    1988-01-01

    The effect of nutrition on reproductive performance was studied in a series of experiments using two models. Increased supply of nutrients was based on feeding lupin grain as a supplement and measurements of testicular growth or ovulation rates were used to measure reproductive characteristics. Purified sources of protein and energy were provided to determine the macronutrient(s), supplied with lupin feeding, responsible for initiating increases in testicular growth and ovulation rate. Increases in both of these parameters were closely related to the supply of additional energy but not protein. The production of acetate and glucose resulting from supplementary feeding with 750 g lupins/d was measured using infusions of 14 C tracers. Subsequently, infusions of glucose and acetate (individually and in combination) were found to produce similar increases in ovulation rate to those measured in ewes receiving lupins. It was concluded that effects of nutrition on ovulation rate are associated with increased energy intake and may be mediated through pathways linked with the synthesis and/or utilization of glucose. (author). 18 refs, 2 figs, 3 tabs

  8. Production of functional protein hydrolysates from Egyptian breeds ...

    African Journals Online (AJOL)

    Production of functional protein hydrolysates from Egyptian breeds of soybean and lupin seeds. AA khalil, SS Mohamed, FS Taha, EN Karlsson. Abstract. Enzymatic hydrolysis is an agro-processing aid that can be utilized in order to improve nutritional quality of protein extracts from many sources. In this study, protein ...

  9. The effect of intermittent dosing of Nicotiana glauca on teratogenesis in goats

    Science.gov (United States)

    Sustained inhibition of fetal movement in livestock species, induced by several poisonous plants, can result in numerous skeletal-contracture malformations. Lupines are responsible for a condition in cattle referred to as “crooked calf syndrome” that occurs when pregnant cattle graze teratogenic lup...

  10. Fulltext PDF

    Indian Academy of Sciences (India)

    Madhsudhan

    Perlak F J, Deaton R W, Armstrong T A, Fuchs R L, Sims S R,. Greenplate J T and Fishhoff D A 1990 Insect resistant cotton plants; Bio/Technology 8 939–943. Pniewski T, Kapusta J and Pucienniczak A 2006 Agrobacterium- mediated transformation of yellow lupin to generate callus tissue producing HBV surface antigen in ...

  11. 107 Etude des facteurs de variation des prix d'intérêt des matières ...

    African Journals Online (AJOL)

    DELL

    meal, palm meal, fababean, pea, corn distillers (DDGS), corn gluten feed (CGF), white and blue lupin, soya hulls, chickpea and barley, in poultry, rabbits, ovine and bovine concentrates. Predictive minimum price models of the studied substituting raw materials were developed using multiple linear regression models.

  12. Fermentation of the endosperm cell walls of monocotyledon and dicotyledon plant species: The relationship between cell wall characteristics and fermentability

    NARCIS (Netherlands)

    Laar, van H.; Tamminga, S.; Williams, B.A.; Verstegen, M.W.A.

    2000-01-01

    Cell walls from the endosperm of four monocotyledons (maize, wheat, rye, and rice) and four dicotyledons (soya bean, lupin, faba bean, and pea) seeds were studied to relate cell wall composition and structure with fermentation characteristics. Cell wall material was isolated from the endosperm of

  13. Influence of green manure in physical and biological properties of soil and productivity in the culture of soybean

    Directory of Open Access Journals (Sweden)

    Ricardo Alves Cardoso

    2014-12-01

    Full Text Available Green manuring is the practice of using plant species in rotation, succession or intercropped with other crops, aiming improvement, maintenance and recovery of physical, chemical and biological soil properties. The objective was to evaluate the influence of different green manures on soil characteristics and productivity of soybean. The experiment was conducted in Maringá (PR in a randomized block design with six treatments and four replications: T1: oat (Avena Sativa, T2: black oat (Avena strigosa, T3: dwarf pigeon pea (Cajanus cajan, T4: radish (Raphanus sativus L., T5: white lupine (Lupinus albus and T6: control (fallow. At the end of the experiment, relations were established between the green manure used for soybean production, the production of biomass, the development of microorganisms and soil bulk density. The data were analyzed with statistical software and means were compared by Tukey test at 5% probability. The coverages provided higher content of dry matter were lupine, black oat and faba bean. Treatments that most influenced the increase of soil microorganisms were lupine, radish and pigeonpea. Regarding productivity, higher values were obtained in treatments with pigeon pea, lupine and oat. The apparent density of the soil, treatment with turnip showed better results.

  14. Synchrotron-Based Techniques Shed Light on Mechanisms of Plant Sensitivity and Tolerance to High Manganese in the Root Environment

    Science.gov (United States)

    Plant species differ in response to high available manganese (Mn), but the mechanisms of sensitivity and tolerance are poorly understood. In solution culture, greater than or equal to 30 µM Mn decreased the growth of soybean (Glycine max), but white lupin (Lupinus albu...

  15. The bacteriological safety and antimicrobial susceptibility of bacteria ...

    African Journals Online (AJOL)

    In developing countries the major sources of food-borne illnesses are street vended foods. The aim of this study was thus to assess the prevalence and antibiogram of bacteria from white lupin in Bahir Dar Town. METHODS: A total of 40 samples were processed for detection of indicator bacteria and pathogens from ...

  16. Biological and physiological changes in rats fed some raw and irradiated legumes

    International Nuclear Information System (INIS)

    Elwakeil, F.A.; Farag, H.; Sharabash, M.T.M.; Diaa Eldin, M.; Mahrous, S.R.

    1995-01-01

    Body weight of rats fed on raw kidney beans, soybeans, broad beans, chick peas and lupines suftered from poor growth due to the presence of some anti nutritional factors in these pulses. The processed soybeans, kidney beans, bread beans and lupines at 10 KGy could not correct the growth of rats kept on their diets for 8 weeks while irradiated chick beans at 10 KGy indicating some effect of the irradiation in this respect. When extracts of raw legumes were injected by intraperitoneal route, Ld 5 0 were found to be 125, 300, and 1800 mg/kg, for raw kidney beans, raw soybeans, and raw broad beans respectively. However, injecting the extracts of raw chick peas and raw lupines did not kill the rats even at higher concentration levels of 300 mg/kg. Similar results were obtained with irradiated chick peas and lupines (10 KGy). Meanwhile, post irradiation treatment of kidney beans, soybeans, and broad beans caused the Ld 5 0 to be 250,400, and 2000 mg/kg for the above pulses respectively. Both raw and irradiated kidney beans and raw soybeans were most active in stimulating pancreas and liver growth and reducing spleen weight. Irradiated soybeans showed a moderate, but significant, increase in liver weight only. However, rats which received both raw and irradiated broad beans, chick peas and lupins in their diets did not suffer any pancreatic, liver hypertrophy or spleen atrophy. The hematological parameters investigated showed that there was no significant differences between rat groups fed on either the raw or the irradiated legumes. 5 tabs

  17. Peculiarities of pulse crops mineral feeding on sod-podzolic sandy soils contaminated with radionuclides

    International Nuclear Information System (INIS)

    Timofeev, S.F.; Sedukova, G.V.; Demidovich, S.A.

    2010-01-01

    In the conditions of the Republic of Belarus there was analyzed the influence of mineral fertilizers of leguminius crops (blue lupine (Lupinus angustifolius) of Gelena variety and field pea (Pisum arvense) of Alex variety) on yielding capacity, grain and green mass quality, and parameters transit of 137Cs and 90Sr radionuclides into leguminous products. In course of the experiment there were analyzed six variants of mineral fertilizer application P30K30; P30K90; P30K120; P60K60; P60K90; and P60K120. Variant without any fertilizers was as control. Double superphosphate (46% of P2O5) and potash chloride (60% of K2O) were applied as mineral fertilizers. Research results showed that application of phosphate-potassium fertilizers on sod-podzolic sandy soils moderately supplied with phosphate and potassium made it possible to increase pea and lupine yield. The highest efficiency of application of phosphate-potassium fertilizers was in the ratio of 1 (ðá2ð×5) : 2 (ðÜ2ð×) provided. Fertilizer system did not render substantial influence on indexes of nutritive value of green mass of pea and lupine. There was marked a tendency of increasing of phosphorous in lupine grain after its application in dose of P60. Mineral fertilizer application made it possible to lower 137Cs transit from soil into lupine green mass in 2 times and seeds ÔÇô in 1,5 times. Application of potassium fertilizer in dose of 120 kg/ha proved to be the most efficient for the lowering of 137Cs accumulation in products of the analyzed crops

  18. Production of the sesquiterpenoid (+)-nootkatone by metabolic engineering of Pichia pastoris.

    Science.gov (United States)

    Wriessnegger, Tamara; Augustin, Peter; Engleder, Matthias; Leitner, Erich; Müller, Monika; Kaluzna, Iwona; Schürmann, Martin; Mink, Daniel; Zellnig, Günther; Schwab, Helmut; Pichler, Harald

    2014-07-01

    The sesquiterpenoid (+)-nootkatone is a highly demanded and highly valued aroma compound naturally found in grapefruit, pummelo or Nootka cypress tree. Extraction of (+)-nootkatone from plant material or its production by chemical synthesis suffers from low yields and the use of environmentally harmful methods, respectively. Lately, major attention has been paid to biotechnological approaches, using cell extracts or whole-cell systems for the production of (+)-nootkatone. In our study, the yeast Pichia pastoris initially was applied as whole-cell biocatalyst for the production of (+)-nootkatone from (+)-valencene, the abundant aroma compound of oranges. Therefore, we generated a strain co-expressing the premnaspirodiene oxygenase of Hyoscyamus muticus (HPO) and the Arabidopsis thaliana cytochrome P450 reductase (CPR) that hydroxylated extracellularly added (+)-valencene. Intracellular production of (+)-valencene by co-expression of valencene synthase from Callitropsis nootkatensis resolved the phase-transfer issues of (+)-valencene. Bi-phasic cultivations of P. pastoris resulted in the production of trans-nootkatol, which was oxidized to (+)-nootkatone by an intrinsic P. pastoris activity. Additional overexpression of a P. pastoris alcohol dehydrogenase and truncated hydroxy-methylglutaryl-CoA reductase (tHmg1p) significantly enhanced the (+)-nootkatone yield to 208mg L(-1) cell culture in bioreactor cultivations. Thus, metabolically engineered yeast P. pastoris represents a valuable, whole-cell system for high-level production of (+)-nootkatone from simple carbon sources. Copyright © 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  19. The Effect of Lupinus albus and Calcium Chloride on Growth Performance, Body Composition, Plasma Biochemistry and Meat Quality of Male Pigs Immunized Against Gonadotrophin Releasing Factor

    Directory of Open Access Journals (Sweden)

    Karen Moore

    2016-12-01

    Full Text Available Two hundred and ninety-four pigs were used to assess the effect of two ingredients (Lupinus albus (albus lupins or a combination of calcium chloride and sodium tri-polyphosphate (mineral salts on growth performance, body composition and objective meat quality of pigs immunized against gonadotrophin releasing factor (immunocastrates and entire male pigs in the late finishing phase. Pigs fed mineral salts ate less feed than those fed the control diet with no effect on growth rate (p > 0.05, backfat (p > 0.05 or fat deposition (p > 0.05. Pigs fed albus lupins had a reduced feed intake (p < 0.001 for all time periods, lower growth rate (p < 0.001 for all time periods, lower backfat (p < 0.005 and decreased fat deposition (p < 0.001 for all time periods compared to those fed the control diet or mineral salts. From day (d 0–28 pigs fed mineral salts had a better feed conversion ratio (p = 0.001 than those fed albus lupins who in turn had an improved feed conversion compared to the control diet. Immunocastrates had thicker backfat than entire males at the end of the experiment (p < 0.001, however, feeding albus lupins to immunocastrated males reduced backfat thickness to similar to entire males fed the control diet (p = 0.01. With the exception of the increased muscle pH at 45 minutes post-exsanguination in mineral salts and albus lupins compared with the control diet (p = 0.03 there was no effect of diet on objective pork quality. Pork from IC males had a higher ultimate pH (p < 0.001, was lighter (L*; p = 0.003, more yellow (p = 0.008 and had a higher drip loss (p < 0.001 compared to entire males. Albus lupins show potential in reducing the increase in feed intake and backfat associated with immunocastration. Mineral salts may be useful in situations where a reduction in feed intake and an improvement in feed conversion is desired and reducing fat deposition is not the objective.

  20. Invasion of a Legume Ecosystem Engineer in a Cold Biome Alters Plant Biodiversity

    Directory of Open Access Journals (Sweden)

    Vanessa M. S. Vetter

    2018-06-01

    Full Text Available Plant ecosystem engineers are widely used to combat land degradation. However, the ability of those plants to modulate limiting abiotic and biotic resources of other species can cause damage to ecosystems in which they become invasive. Here, we use Lupinus nootkatensis as example to estimate and project the hazardous potential of nitrogen fixing herbaceous plants in a sub-polar oceanic climate. L. nootkatensis was introduced to Iceland in the 1940s to address erosion problems and foster reforestation, but subsequently became a high-latitude invader. In a local field survey, we quantified the impact of L. nootkatensis invasion at three different cover levels (0, 10–50, and 51–100% upon native plant diversity, richness, and community composition of heath-, wood-, and grasslands using a pairwise comparison design and comparisons of means. Afterward, we scaled impacts up to the ecosystem and landscape level by relating occurrences of L. nootkatensis to environmental and human-mediated variables across Iceland using a species distribution model. Plant diversity was significantly deteriorated under high lupine cover levels of the heath- and woodland, but not in the grassland. Plant species richness of the most diverse habitat, the heathland, linearly decreased with lupine cover level. The abundance of small rosettes, cushion plants, orchids, and small woody long-lived plants of the heath declined with invader presence, while the abundance of late successional species and widespread nitrophilous ruderals in wood- and grasslands increased. Distribution modeling revealed 13.3% of Iceland’s land surface area to be suitable lupine habitat. Until 2061–2080, this area will more than double and expand significantly into the Central Highlands due to human mediation and increasingly favorable climatic conditions. Species-rich habitats showed a loss of plant species diversity and richness as well as a change in community composition even in low lupine

  1. Dietary soya saponins increase gut permeability and play a key role in the onset of soyabean-induced enteritis in Atlantic salmon (Salmo salar L.)

    DEFF Research Database (Denmark)

    Knudsen, Sven David Lausten; Jutfelt, Fredrik; Sundh, Henrik

    2008-01-01

    are naturally occurring amphiphilic molecules and have been associated with many biological activities. The aim of the present study was to investigate whether soya saponins trigger the onset of soyabean-induced enteritis in Atlantic salmon (Salmo salar L.), and to examine if dietary soya saponins...... increase the epithelial permeability of the distal intestine in Atlantic salmon. Seven experimental diets containing different levels of soya saponins were fed to seawater-adapted Atlantic salmon for 53 d. The diets included a fishmeal-based control diet, two fishmeal-based diets with different levels...... of added soya saponins, one diet containing 25 % lupin kernel meal, two diets based on 25 % lupin kernel meal with different levels of added soya saponins, and one diet containing 25 % defatted soyabean meal. The effect on intestinal morphology, intestinal epithelial permeability and faecal DM content...

  2. Congenital skeletal malformations and cleft palate induced in goats by ingestion of Lupinus, Conium and Nicotiana species.

    Science.gov (United States)

    Panter, K E; Keeler, R F; Bunch, T D; Callan, R J

    1990-01-01

    Three piperidine alkaloid containing plants, Conium maculatum (poison-hemlock), Nicotiana glauca (tree tobacco) and Lupinus formosus (lunara lupine), induced multiple congenital contractures (MCC) and palatoschisis in goat kids when their dams were gavaged with the plant during gestation days 30-60. The skeletal abnormalities included fixed extension or flexure of the carpal, tarsal, and fetlock joints, scoliosis, lordosis, torticollis and rib cage abnormalities. Clinical signs of toxicity included those reported in sheep, cattle and pigs--ataxia, incoordination, muscular weakness, prostration and death. One quinolizidine alkaloid containing plant, Lupinus caudatus (tailcup lupine), on the other hand, which is also known to cause MCC in cows, caused only slight signs of toxicity in pregnant goats and no teratogenic effects in their offspring.

  3. [Not Available].

    Science.gov (United States)

    Malmgren, Linnea; Rosén, Johan; Dahlman, Disa; von Wowern, Fredrik

    2016-07-28

    In this case report we illustrate how incorrectly prepared and cooked seeds from white lupin - a common snack among people from parts of the Mediterranean and Middle East - caused an anticholinergic syndrome in a previously healthy man. The symptoms subsided without treatment and the patient was discharged from the hospital in good health. Anticholinergic syndrome results from inhibition of the parasympatic nervous system. The symptoms commonly include dry mouth, confusion, hallucinations, fever, tachycardia, and urine retention. The syndrome may most frequently be provoked by overdose of drugs such as prometazin, hyoscyamin, and biperidin or by ingestion of plants such as belladonna, datura and henbane. The aim of this report is to increase clinicians' awareness of white lupin's anticholinergic effects.

  4. Turnover of grain legume N rhizodeposits and effect of rhizodeposition on the turnover of crop residues

    DEFF Research Database (Denmark)

    Mayer, J.; Buegger, F.; Jensen, E.S.

    2004-01-01

    The turnover of N derived from rhizodeposition of faba bean (Vicia faba L.), pea (Pisum sativum L.) and white lupin (Lupinus albus L.) and the effects of the rhizodeposition on the subsequent C and N turnover of its crop residues were investigated in an incubation experiment (168 days, 15 degrees....... In the experiment the turnover of C and N was compared in soils with and without previous growth of three legumes and with and without incorporation of crop residues. After 168 days, 21% (lupin), 26% (faba bean) and 27% (pea) of rhizodeposition N was mineralised in the treatments without crop residues. A smaller...... amount of 15-17% was present as microbial biomass and between 30 and 55% of mineralised rhizodeposition N was present as microbial residue pool, which consists of microbial exoenzymes, mucous substances and dead microbial biomass. The effect of rhizodeposition on the C and N turnover of crop residues...

  5. The role of mycorrhizal fungi and microsites in primary succession on Mount St. Helens.

    Science.gov (United States)

    Titus, J; Del Moral, R

    1998-03-01

    This study was designed to examine the role of vesicular-arbuscular mycorrhizae (VAM) and microsites on the growth of pioneer species. Flat, rill, near-rock, and dead lupine microsites were created in plots in barren areas of the Pumice Plain of Mount St. Helens. VAM propagules were added to the soil in half of the plots. Six pioneer species were planted into both VAM and non-VAM inoculated microsites. Plants in dead lupine microsites were greater in biomass than those in flat, rill, and near-rock microsites. Significant effects of VAM on plant biomass did not occur. Microsites continue to be important to plant colonization on the Pumice Plain, but VAM do not yet appear to play an important role. This may be due to limited nutrient availability and the facultatively mycotrophic nature of the colonizing plant species. It is unlikely that VAM play an important role in successional processes in newly emplaced nutrient-poor surfaces.

  6. Synchronizing legume residue nutrient release with Kale (Brassica oleracea var. acephala) uptake in a Nitrosol of Kabete, Kenya

    DEFF Research Database (Denmark)

    Onwonga, Richard N.; Chepkoech, Caroline; Wahome, R.G.

    fertility improvement for crop production e.g. kales (Brassica oleracea var. acephala) under organic farming systems. Chickpea (Cicer arietinum) and white lupin (Lupinus albus L.) are leguminous crops commonly intercropped with kales (Genga, 2014) and their influence on crop yield and soil nutrient status...... has been widely studied (Nduku 2014, Genga 2014; Onwonga et al., 2015). There is however a dearth of information with respect to synchronization of nutrient released by legume residues with pattern of nutrient uptake by kales to match their demand. The objective of the current study was therefore...... to assess decomposition and nutrient release rates of chickpea and lupin residues and kale nutrient uptake patterns for better synchrony of nutrient supply and demand....

  7. Positive and negative effects of nitrogen compounds on plants in the vicinity of a fertilizer factory

    Energy Technology Data Exchange (ETDEWEB)

    Scholl, G

    1975-05-01

    At a distance of 300 m from a fertilizer plant, various grains and fodder plants, as well as spinach, string beans, and peas, were grown consecutively over a period of several years to determine the effects of various concentrations of nitrogen compounds emitted by a fertilizer plant on the cultivations. Injuries that were similar to those observed in fumigation experiments with nitrogen dioxide were observed in the leaves of the experimental plants. In relatively high concentrations, pollutants containing nitrogen were as toxic as sulfur dioxide. Lower concentrations had a positive stimulatory effect and increased vegetative growth. Legumes were the most sensitive to nitrogen pollutants. Production of chlorophyll was reduced in lupine and Alexandrine clover, although no visible injuries were observed. Nodule development of the lupine was significantly restricted. The contamination of food and fodder plants by nitrates was significant and was found to present a real danger to humans through the food chain.

  8. Biological and physiological changes in raw and radiation-processed legumes

    International Nuclear Information System (INIS)

    El Wakeil, F.A.; Sharabash, M.T.M.; Farag, M. Diaa El-Din H.; Mahrous, S.R.

    1994-01-01

    Body weight of rats fed on raw kidney beans, soybeans, broad beans, chick peas and lupines suffered from poor growth due to some antinutritional factors. When the studied legumes were exposed to 10 kGy, the rats gained more weight than those kept on raw legumes. When extracts of raw legumes were intraperitoneally injected, the LD 50 were found to be 125, 300 and 1800 mg/kg, for raw kidney beans, raw soybeans, and raw broad beans respectively. However, injecting extracts of raw chick peas and raw lupines did not kill the rats even at higher concentration levels of 3000 mg/kg. Similar results were obtained with irradiated chick peas and lupines (10 kGy). Meanwhile, after irradiation treatment of kidney beans, soybeans and broad beans, the LD 50 were found to be 250, 400 and 2000 mg/kg for the above pulses respectively. Both raw and irradiated kidney beans and raw soybeans were most active in stimulating pancreas and liver growth and reducing spleen weight. Irradiated soybeans showed a moderate but significant increase in liver weight only. However, rats fed on both raw and irradiated broad beans, chick peas and lupines in their diets did not suffer any pancreatic and liver hypertrophy or spleen atrophy. The haematological parameters investigated showed that there was no significant differences between rat groups fed on either raw or irradiated legumes. It could be concluded that irradiation offers a good treatment for legumes as it has a beneficial effect to correct the poor growth for rats fed on raw beans during experimental period without any deleterious physiological effects. (author)

  9. Dietary soya saponins increase gut permeability and play a key role in the onset of soyabean-induced enteritis in Atlantic salmon ( Salmo salar L.).

    Science.gov (United States)

    Knudsen, David; Jutfelt, Fredrik; Sundh, Henrik; Sundell, Kristina; Koppe, Wolfgang; Frøkiaer, Hanne

    2008-07-01

    Saponins are naturally occurring amphiphilic molecules and have been associated with many biological activities. The aim of the present study was to investigate whether soya saponins trigger the onset of soyabean-induced enteritis in Atlantic salmon (Salmo salar L.), and to examine if dietary soya saponins increase the epithelial permeability of the distal intestine in Atlantic salmon. Seven experimental diets containing different levels of soya saponins were fed to seawater-adapted Atlantic salmon for 53 d. The diets included a fishmeal-based control diet, two fishmeal-based diets with different levels of added soya saponins, one diet containing 25% lupin kernel meal, two diets based on 25% lupin kernel meal with different levels of added soya saponins, and one diet containing 25% defatted soyabean meal. The effect on intestinal morphology, intestinal epithelial permeability and faecal DM content was examined. Fish fed 25% defatted soyabean meal displayed severe enteritis, whereas fish fed 25% lupin kernel meal had normal intestinal morphology. The combination of soya saponins and fishmeal did not induce morphological changes but fish fed soya saponins in combination with lupin kernel meal displayed significant enteritis. Increased epithelial permeability was observed in fish fed 25% defatted soyabean meal and in fish fed soya saponin concentrate independent of the protein source in the feed. The study demonstrates that soya saponins, in combination with one or several unidentified components present in legumes, induce an inflammatory reaction in the distal intestine of Atlantic salmon. Soya saponins increase the intestinal epithelial permeability but do not, per se, induce enteritis.

  10. Sensory quality of meat from lambs fed on different diets

    Directory of Open Access Journals (Sweden)

    A. Vicenti

    2010-01-01

    Full Text Available The whole seed of sweet lupin var. Multitalia with a protein content higher than 35% and a low content in alkaloids constitutes a good protein source alternative to soybean meal, today deriving for more than 60% from OGM (Genetically Modified Organisms cultivation. Moreover, the poor national production and the cost of feeds for animals forces the livestock compartment to utilize alternative biomasses the availability of which highly depends on from the environment and the season.

  11. 40 CFR 180.589 - Boscalid; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ..., dried shelled, except soybean, subgroup 6C, except cowpea, field pea and grain lupin 2.5 Pea and bean, succulent shelled, subgroup 6B, except cowpea 0.6 Peanut 0.05 Peanut, meal 0.15 Peanut, refined oil 0.15... Cotton, undelinted seed 0.05 Cowpea, seed 0.1 Flax, seed 3.5 Grain, cereal, forage, fodder and straw...

  12. Cytokinins and Expression of SWEET, SUT, CWINV and AAP Genes Increase as Pea Seeds Germinate

    Czech Academy of Sciences Publication Activity Database

    Jameson, P. E.; Dhandapani, P.; Novák, Ondřej; Song, J.

    2016-01-01

    Roč. 17, č. 12 (2016), č. článku 2013. E-ISSN 1422-0067 R&D Projects: GA MŠk(CZ) LO1204; GA MŠk LK21306 Institutional support: RVO:61389030 Keywords : cell-wall invertase * sucrose transporter * amino - acids * lupin seeds * corynebacterium-fascians * endogenous cytokinins * stress tolerance * family-members * arabidopsis * metabolism * cytokinin * germination * Pisum sativum Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.226, year: 2016

  13. Humboldt Bay Wetlands Review and Baylands Analysis. Volume II. Base Information.

    Science.gov (United States)

    1980-08-01

    consists primarily of thimbleberry, salmonberry, blackberry, creek dogwood, fireweed, bracken fern, skunk cabbage, nettle , lupine, salal, and willow...insect populations, and are, at the same time, very suscepti- ble to the toxic effects of insecticides concentrated in th- food chain. Marint Mammals...shrubs, and annuals which do exist are often protected from consumption by fences and insecticides . Insects and rodents are the common primary

  14. The Relationship Between Ants and Lycaeides melissa samuelis (Lepidoptera: Lycaenidae) at Concord Pine Barrens, NH, USA.

    Science.gov (United States)

    Pascale, Elizabeth G; Thiet, Rachel K

    2016-04-22

    The Karner blue butterfly (Lycaeides melissa samuelis Nabokov) (Lepidoptera: Lycaenidae) is a federally listed, endangered species that has experienced dramatic decline over its historic range. In surviving populations, Karner blue butterflies have a facultative mutualism with ants that could be critically important to their survival where their populations are threatened by habitat loss or disturbance. In this study, we investigated the effects of ants, wild blue lupine population status (native or restored), and fire on adult Karner blue butterfly abundance at the Concord Pine Barrens, NH, USA. Ant frequency (the number of times we collected each ant species in our pitfall traps) was higher in restored than native lupine treatments regardless of burn status during both Karner blue butterfly broods, and the trend was statistically significant during the second brood. We observed a positive relationship between adult Karner blue butterfly abundance and ant frequency during the first brood, particularly on native lupine, regardless of burn treatment. During the second brood, adult Karner blue butterfly abundance and ant frequency were not significantly correlated in any treatments or their combinations. Our findings suggest that a combination of native and restored lupine is important for supporting both Karner blue butterflies and ants at the Concord Pine Barrens, and that burning does not affect the mutualism. Thus, scientists and managers at the site may wish to target their habitat management activities to best support both Karner blue butterflies and the particular ant species that provide the greatest benefit to their survival. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Effect of potassium fertilizers on 137Cs transfer from sandy soddy-podzolic soil to plants

    International Nuclear Information System (INIS)

    Belova, N.V.; Sanzharova, N.I.; Shishulina, M.V.; Moiseenko, F.V.; Vorob'eva, L.A.

    2009-01-01

    The purpose of the work is to study the behavior of potassium in sandy soddy podzolic soil and its influence on the availability of 137 Cs to plants of winter rye and lupine when applying various doses of potassium fertilizers (PF) and turf-manure compost (TMC). A many-years stationary experiment was established in the Bryansk region in 1986-1988 on soddy podzolic soil contaminated by the accident at the Chernobyl Power Station. The influence of fertilizer was studied in 4-field crop rotation in an experimental plot: seeded fallow (lupine, bird's-foot) – winter rye – potato – spring grains. Potassium and mineral fertilizers were applied. It was shown that the application of potassium fertilizers (from 0 to 180 kg/ha) increased the content of exchangeable potassium in the soil by 1.7-2-7 times and its mobility by 2.5-4.0 times which resulted in a decrease of 137Cs transfer to plants by 5.8-14 times. The inverse proportional relationship was found between the potassium mobility and the content of its mobile form and the accumulation coefficient of 137Cs by lupine and wheat rye plants. A linear relationship was reveled between the accumulation coefficient of 137Cs and the content of exchangeable radionuclide

  16. Accumulation of 137Cs and 90Sr radionuclides by leguminous plants of various species and varieties

    International Nuclear Information System (INIS)

    Zhdanovich, V.P.; Podolyak, A.G.; Arastovich, T.V.; Demidovich, S.A.; Odintsova, L.E.; Ivashkova, I.I.; Polovkov, N.N.

    2005-01-01

    Decision of protein problem on territories contaminated with radionuclides as a result of the accident at the Chernobyl NPP is not possible without extension of lands under cultivation of leguminous plants (peas, lupine and soybean). All lupine varieties show high indices of radionuclides accumulation and are restrictedly acceptable for production on contaminated territories. The following varieties of yellow forage lupine are the most acceptable for cultivation on the contaminated territories: Zhemchug, Rannij, Adradzhenne, Mitan. Introduction of varieties with the low level of radionuclides accumulation (peas — Aist, Agat, Gomelskaya; soybean — Mageva, Pina, Severnaya zvezda) into agricultural production will make to possible to obtain agricultural products meeting the requirements of the “Republican permissible levels of 137Cs and 90Sr content in agricultural raw materials and forages” on arable lands with the higher density of radioactive contamination: 137Cs — 925—1110 kBq/m2 (25-30 Ci/km2) and 90Sr 15—18 kBq/m2 (0.40-0.50 Ci/km2)

  17. Novel package for inhibition of aluminium corrosion in alkaline solutions

    International Nuclear Information System (INIS)

    Abdel-Gaber, A.M.; Khamis, E.; Abo-Eldahab, H.; Adeel, Sh.

    2010-01-01

    Inhibition of aluminium corrosion in 2 M sodium hydroxide solution by a package composed of the cationic surfactant cetyl trimethyl ammonium bromide (CTAB) and lupine seed extract has been investigated employing different electrochemical techniques and chemical gasometry measurements. Potentiodynamic polarization curve measurements showed that lupine seed extract controls both the anodic dissolution of aluminium and the hydrogen gas evolved at the cathodic sites of aluminium surface. Nyquist plots showed two capacitive semicircles in the high and low frequency regions separated by an inductive loop at intermediate frequencies. The inductive loop may be explained by the occurrence of adsorbed intermediates on the surface. A proposed equivalent circuit was used to analyse the impedance spectra for aluminium in NaOH solutions. The corrosion inhibition data have been analysed using different isotherms. The results showed excellent agreement between the kinetic-thermodynamic model and Flory-Huggins isotherm. Gasometry measurements showed that the Inhibitive effect of the surfactant increases at a composition around its critical micelle concentration (cmc). The presence of both the surfactant and lupine seed extract did not indicate synergistic action between them. The mode of adsorption of the surfactant molecules corresponding to their structure is also discussed.

  18. [Soluble and insoluble dietary fiber in cereals and legumes cultivated in Chile].

    Science.gov (United States)

    Pak, N; Ayala, C; Vera, G; Pennacchiotti, I; Araya, H

    1990-03-01

    Insoluble, soluble and total dietary fiber (DF) were determined in 35 varieties of certified whole seeds (without processing) of cereals (rice, oat, rye, and wheat) and legumes (pea, cowpea, beans, chikpea, lentil and lupine). The enzymatic method of Asp, Johansson and Siljestrom was used, with modifications in relation to time of incubation with alpha amylase, filtration system and volumes of the filtrates. Results were expressed as g/100 g dry weight. Total DF for cereals showed a range from 10.1 (wheat var. Chasqui) to 22.2 (rice var Quella). Rye, var. Tetra Baer and oats var. Pony Baer presented the highest soluble fiber content (3.3 and 3.9, respectively). In legumes, total DF fluctuated between 12.7 (pea, var. yellow) and 36.6 (lupine, var. Multolupa). Bean, var. Pinto INIA and lupine var. Multolupa presented the highest soluble fiber values (5.8 for both). Based on the results of this research work, it might be concluded that great variation exists in regard to the amount of total soluble and insoluble DF in cereals and legumes, a fact which impedes generalization as to its content in each food item.

  19. Food intake, postprandial glucose, insulin and subjective satiety responses to three different bread-based test meals.

    Science.gov (United States)

    Keogh, Jennifer; Atkinson, Fiona; Eisenhauer, Bronwyn; Inamdar, Amar; Brand-Miller, Jennie

    2011-12-01

    The effect of bread consumption on overall food intake is poorly understood. The aim of this study was to measure postprandial food intake after a set breakfast containing three different breads. Ten males and 10 females aged 20.1-44.8 years, BMI 18.4-24.8 kg/m(2), consumed two slices of White Bread, Bürgen Wholemeal and Seeds Bread or Lupin Bread (all 1300 kJ) with 10 g margarine and 30 g strawberry jam. Fullness and hunger responses and were measured before and during the test breakfasts. Glucose and insulin responses (incremental area under each two-hour curve (iAUC)) were calculated. Food intake was measured and energy and nutrient intake determined at a buffet meal two hours later. Subjects consumed significantly less energy after the Bürgen Bread meal compared to the White Bread meal (2548 ± 218 vs. 3040±328kJ, Bürgen Bread vs. White Bread, PBread (PBread (PBread. Lupin Bread and Bürgen Bread produced smaller postprandial glucose responses (79 ± 7, 74 ± 4, 120 ± 10 mmol/L min iAUC, Lupin, Bürgen and White Bread respectively, PBread respectively, Pbreads differed in their short-term satiation capacity. Further studies are needed to demonstrate any potential benefit for weight management. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Novel package for inhibition of aluminium corrosion in alkaline solutions

    Energy Technology Data Exchange (ETDEWEB)

    Abdel-Gaber, A.M., E-mail: ashrafmoustafa@yahoo.com [Chemistry Department, Faculty of Science, Alexandria University, Ibrahimia, P.O. Box 426, Alexandria 21321 (Egypt); Khamis, E.; Abo-Eldahab, H.; Adeel, Sh. [Chemistry Department, Faculty of Science, Alexandria University, Ibrahimia, P.O. Box 426, Alexandria 21321 (Egypt)

    2010-11-01

    Inhibition of aluminium corrosion in 2 M sodium hydroxide solution by a package composed of the cationic surfactant cetyl trimethyl ammonium bromide (CTAB) and lupine seed extract has been investigated employing different electrochemical techniques and chemical gasometry measurements. Potentiodynamic polarization curve measurements showed that lupine seed extract controls both the anodic dissolution of aluminium and the hydrogen gas evolved at the cathodic sites of aluminium surface. Nyquist plots showed two capacitive semicircles in the high and low frequency regions separated by an inductive loop at intermediate frequencies. The inductive loop may be explained by the occurrence of adsorbed intermediates on the surface. A proposed equivalent circuit was used to analyse the impedance spectra for aluminium in NaOH solutions. The corrosion inhibition data have been analysed using different isotherms. The results showed excellent agreement between the kinetic-thermodynamic model and Flory-Huggins isotherm. Gasometry measurements showed that the Inhibitive effect of the surfactant increases at a composition around its critical micelle concentration (cmc). The presence of both the surfactant and lupine seed extract did not indicate synergistic action between them. The mode of adsorption of the surfactant molecules corresponding to their structure is also discussed.

  1. Mesoporous silica nanoparticles as a biomolecule delivery vehicle in plants

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, Hashmath I., E-mail: hashmath.i@deakin.edu.au [Deakin University, Centre for Chemistry and Biotechnology, School of Life and Environmental Sciences (Australia); Yi, Zhifeng [Deakin University, Institute for Frontier Materials (Australia); Rookes, James E. [Deakin University, Centre for Chemistry and Biotechnology, School of Life and Environmental Sciences (Australia); Kong, Lingxue X. [Deakin University, Institute for Frontier Materials (Australia); Cahill, David M. [Deakin University, Centre for Chemistry and Biotechnology, School of Life and Environmental Sciences (Australia)

    2013-06-15

    We report the uptake by wheat, lupin and Arabidopsis of mesoporous silica nanoparticles functionalised with amine cross-linked fluorescein isothiocyanate (MSN-APTES-FITC). The preparation of these particles at room temperature enabled the synthesis of 20 nm particles that contained a network of interconnected pores around 2 nm in diameter. The uptake and distribution of these nanoparticles were examined during seed germination, in roots of plants grown in a hydroponic system and in whole leaves and roots of plants via vacuum infiltration. The nanoparticles did not affect seed germination in lupin and there was no phytotoxicity. Following germination of wheat and lupin grown in a nutrient solution containing nanoparticles, they were found within cells and cell walls of the emerging root and in the vascular transport elements, the xylem, and in other associated cells. In leaves and roots of Arabidopsis the nanoparticles were found, following vacuum infiltration of whole seedlings, to be taken up by the entire leaf and they were principally found in the intercellular spaces of the mesophyll but also throughout much of the root system. We propose that MSNs could be used as a novel delivery system for small molecules in plants.

  2. Influence of the diet on the microbial diversity of faecal and gastrointestinal contents in gilthead sea bream (Sparus aurata) and intestinal contents in goldfish (Carassius auratus).

    Science.gov (United States)

    Silva, Flávia Cristina de Paula; Nicoli, Jacques Robert; Zambonino-Infante, José Luiz; Kaushik, Sadasivam; Gatesoupe, François-Joël

    2011-11-01

    Fish intestinal microbiota changes with the diet and this effect is of particular interest considering the increasing substitution of fish meal by plant protein sources. The objective of this work was to study the effects of partial substitution of fish meal with lupin and rapeseed meals on gut microbiota of the gilthead sea bream (Sparus aurata) and in goldfish (Carassius auratus). Faecal, gastrointestinal and intestinal contents were characterized using culture-based and molecular methods. Vibrionaceae was high in faeces and in the intestine of sea bream, while a more diverse microbiota was retrieved from the stomach, where Bacillales and Flavobacteriaceae appeared to be influenced by the diet. PCR-denaturing gradient gel electrophoresis profiles revealed a high diversity of the microbiota transiting in the sea bream digestive tract, with a shift between gastric and intestinal communities, especially in the group fed with lupin meal. The goldfish was different, with a predominance of Aeromonas spp., Shewanella putrefaciens and Staphylococcus spp. among the aerotolerant-cultivable bacteria. The culture-independent methods revealed the presence of anaerobes like Cetobacterium somerae, and that of Vibrio spp., likely in a viable, but noncultivable state. There was a trend towards decreasing diversity in goldfish microbiota with the partial substitution by lupin, which seemed to inhibit some taxa. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  3. Evaluation of a nutritional strategy to increase ovulation rate in merino ewes mated in late spring-early summer.

    Science.gov (United States)

    Nottle, M B; Kleemann, D O; Grosser, T I; Seamark, R F

    1997-07-01

    A nutritional strategy for increasing ovulation rate in Merino ewes mated in late spring-early summer was evaluated on two commercial farms. The strategy used the 'ram effect' to induce oestrus in seasonally anoestrus ewes and supplementary feeding of lupin grain six days prior to oestrus to increase ovulation rate. Ewes that had been isolated from rams for 6 weeks were exposed to vasectomised rams for 2 weeks and then mated to fertile rams for 6 weeks. Feeding 500 g lupins/head/day for 14 days commencing 12 days after the introduction of vasectomised rams, increased the number of ovulations from 126 to 146 per 100 ewes exposed to rams (P < 0.05). This increase was reflected in an improvement in fecundity (lambs born per ewe lambing; P < 0.05) but not fertility (ewes lambing per ewe mated to rams). Net reproductive performance (the product of fertility, fecundity and lamb survival) was increased by 11 lambs weaned per 100 ewes exposed to rams due to lupin supplementation at mating.

  4. Bioavailable concentrations of germanium and rare earth elements in soil as affected by low molecular weight organic acids and root exudates

    Science.gov (United States)

    Wiche, Oliver; Székely, Balázs; Kummer, Nicolai-Alexeji; Heinemann, Ute; Tesch, Silke; Heilmeier, Hermann

    2014-05-01

    Availability of elements in soil to plant is generally dependent on the solubility and mobility of elements in soil solution which is controlled by soil, elemental properties and plant-soil interactions. Low molecular organic acids or other root exudates may increase mobility and availability of certain elements for plants as an effect of lowering pH in the rhizosphere and complexation. However, these processes take place in a larger volume in soil, therefore to understand their nature, it is also important to know in which layers of the soil what factors modify these processes. In this work the influence of citric acid and root exudates of white lupin (Lupinus albus L.) on bioavailable concentrations of germanium, lanthan, neodymium, gadolinium and erbium in soil solution and uptake in root and shoot of rape (Brassica napus L.), comfrey (Symphytum officinale L.), common millet (Panicum milliaceum L.) and oat (Avena sativa L.) was investigated. Two different pot experiments were conducted: (1) the mentioned plant species were treated with nutrient solutions containing various amount of citric acid; (2) white lupin was cultivated in mixed culture (0 % lupin, 33 % lupin) with oat (Avena sativa L.) and soil solution was obtained by plastic suction cups placed at various depths. As a result, addition of citric acid significantly increased germanium concentrations in plant tissue of comfrey and rape and increased translocation of germanium, lanthan, neodymium, gadolinium and erbium from root to shoot. The cultivation of white lupin in mixed culture with oat led to significantly higher concentrations of germanium and increasing concentrations of lanthan, neodymium, gadolinium and erbium in soil solution and aboveground plant tissue. In these pots concentrations of citric acid in soil solution were significantly higher than in the control. The results show, that low molecular organic acids exuded by plant roots are of great importance for the mobilization of germanium

  5. Comparative evaluation of the effect of rock phosphate and monoammonium phosphate on plant P: Nutrition in Sod-podzolic and peat soils

    International Nuclear Information System (INIS)

    Bogdevitch, I.; Tarasiuk, S.; Putyatin, Yu.; Seraya, T.

    2002-01-01

    The direct application of finely ground rock phosphate (RP) imported from Russia has been suggested as an alternative to the almost twice more expensive water-soluble monoammonium phosphate (MAP) on acid (moderately limed) Sod-podzolic and peat soils. A pot experiment was conducted in 1997-1998 for a comparative evaluation of P availability from RP and MAP using the 32 P isotope dilution technique. The lupine was grown on Sod-podzolic silty clay loam soil with pH 6.0 and a medium level of available P. Ryegrass plants were grown on peat soil with pH 4.9 and a low level of native soil P fertility. Application of RP and MAP at a rate of 40 mg P/kg soil supplied similar moderate mount of P to lupine plants. The Pdff values, i.e. the fractions of P in the plants derived from the applied RP and MAP, were 7.4 and 8.4%, respectively. The application of the same P fertilizers to the peat soil had different effects on P nutrition of ryegrass plants. The Pdff values were 14.9% for RP and 22.1% for MAP. It may be concluded that for most annual crops water-soluble P forms such as MAP should be preferred. Direct application of RP is recommended for plants with an adequate rhizosphere ability to utilize P, such as lupine on acid Sod-podzolic silty clay loam soils (pH 137 Cs on contaminated, moderately limed Sod-podzolic silty clay loam and peat soils. These soils are widely spread in the radioactive contaminated area of Belarus after the Chernobyl accident. Direct application of RP may be one of the effective countermeasures for the decrease of 137 Cs transfer from the contaminated acid soils to crop production. (author)

  6. Production of Lupinus angustifolius protein hydrolysates with improved functional properties

    Directory of Open Access Journals (Sweden)

    Millán, Francisco

    2005-06-01

    Full Text Available Protein hydrolysates wer e obtained from lupin flour and from the purified globulin α -conglutin, and their functional properties were studied. Hydrolysis with alcalase for 60 minutes yielded degrees of hydrolysis ranging from 4 % to 11 % for lupin flour, and from 4 % to 13% for α -conglutin. Protein solubility, oil absorption, foam capacity and stability, emulsifying activity, and emulsion stability of hydrolysates with 6% degree of hydrolysis were determined and compared with the properties of the original flour. The protein hydrolysates showed better functional properties than the original proteins. Most importantly, the solubility of the α -conglutin and L. angustifolius flour hydrolysates was increased by 43 % and 52 %, respectively. Thus, lupin seed protein hydrolysates have improved functional properties and could be used in the elaboration of a variety of products such as breads, cakes, and salad dressings.Se obtuvieron hidrolizados proteicos de la harina del altramuz y de la globulina α - conglutina purificada y se estudiaron sus propiedades funcionales. La hidrólisis con alcalasa durante 60 minutos produjo hidrolizados con grados de hidrólisis entre el 4 % y el 11 % para la harina y entre el 4 % y el 13 % para la α - conglutina. Se estudió en un hidrolizado con un 6 % de grado de hidrólisis la solubilidad proteica, absorción de aceite, capacidad y estabilidad espumante y actividad y estabilidad emulsificante. Los hidrolizados proteicos mostraron mejores propiedades funcionales que las proteínas originales. Más aún, la solubilidad de los hidrolizados de α - conglutina y la harina se incrementó en un 43 % y 52 % respectivamente. Así pues, hidrolizados de proteínas de semilla de lupino presentan mejores propiedades funcionales y podrían usarse en la elaboración de productos como pan, dulces, salsas o cremas.

  7. Capability of selected crop plants for shoot mercury accumulation from polluted soils: phytoremediation perspectives.

    Science.gov (United States)

    Rodriguez, Luis; Rincón, Jesusa; Asencio, Isaac; Rodríguez-Castellanos, Laura

    2007-01-01

    High-biomass crops can be considered as an alternative to hyperaccumulator plants to phytoremediate soils contaminated by heavy metals. In order to assess their practical capability for the absorption and accumulation of Hg in shoots, barley, white lupine, lentil, and chickpea were tested in pot experiments using several growth substrates. In the first experimental series, plants were grown in a mixture of vermiculite and perlite spiked with 8.35 microg g(-1) d.w. of soluble Hg. The mercury concentration of the plants' aerial tissues ranged from 1.51 to 5.13 microg g(-1) d.w. with lentil and lupine showing the highest values. In a second experiment carried out using a Hg-polluted soil (32.16 microg g(-1) d.w.) collected from a historical mining area (Almadén, Spain), the crop plants tested only reached shoot Hg concentration up to 1.13 microg g(-1) d.w. In the third experimental series, the Almadén soil was spiked with 1 microg g(-1) d.w. of soluble Hg; as a result, mercury concentrations in the plant shoots increased approximately 6 times for lupine, 5 times for chickpea, and 3.5 times for barley and lentil, with respect to those obtained with the original soil without Hg added. This marked difference was attributed to the low availability of Hg in the original Almadin soil and its subsequent increase in the Hg-spiked soil. The low mercury accumulation yields obtained for all plants do not make a successful decontamination of the Almadén soils possible byphytoremediation using crop plants. However, since the crops tested can effectively decrease the plant-available Hg level in this soil, their use could, to some extent, reduce the environmental risk of Hg pollution in the area.

  8. Genotyping-by-Sequencing and Its Exploitation for Forage and Cool-Season Grain Legume Breeding

    Science.gov (United States)

    Annicchiarico, Paolo; Nazzicari, Nelson; Wei, Yanling; Pecetti, Luciano; Brummer, Edward C.

    2017-01-01

    Genotyping-by-Sequencing (GBS) may drastically reduce genotyping costs compared with single nucleotide polymorphism (SNP) array platforms. However, it may require optimization for specific crops to maximize the number of available markers. Exploiting GBS-generated markers may require optimization, too (e.g., to cope with missing data). This study aimed (i) to compare elements of GBS protocols on legume species that differ for genome size, ploidy, and breeding system, and (ii) to show successful applications and challenges of GBS data on legume species. Preliminary work on alfalfa and Medicago truncatula suggested the greater interest of ApeKI over PstI:MspI DNA digestion. We compared KAPA and NEB Taq polymerases in combination with primer extensions that were progressively more selective on restriction sites, and found greater number of polymorphic SNP loci in pea, white lupin and diploid alfalfa when adopting KAPA with a non-selective primer. This protocol displayed a slight advantage also for tetraploid alfalfa (where SNP calling requires higher read depth). KAPA offered the further advantage of more uniform amplification than NEB over fragment sizes and GC contents. The number of GBS-generated polymorphic markers exceeded 6,500 in two tetraploid alfalfa reference populations and a world collection of lupin genotypes, and 2,000 in different sets of pea or lupin recombinant inbred lines. The predictive ability of GBS-based genomic selection was influenced by the genotype missing data threshold and imputation, as well as by the genomic selection model, with the best model depending on traits and data sets. We devised a simple method for comparing phenotypic vs. genomic selection in terms of predicted yield gain per year for same evaluation costs, whose application to preliminary data for alfalfa and pea in a hypothetical selection scenario for each crop indicated a distinct advantage of genomic selection. PMID:28536584

  9. Genotyping-by-Sequencing and Its Exploitation for Forage and Cool-Season Grain Legume Breeding

    Directory of Open Access Journals (Sweden)

    Paolo Annicchiarico

    2017-05-01

    Full Text Available Genotyping-by-Sequencing (GBS may drastically reduce genotyping costs compared with single nucleotide polymorphism (SNP array platforms. However, it may require optimization for specific crops to maximize the number of available markers. Exploiting GBS-generated markers may require optimization, too (e.g., to cope with missing data. This study aimed (i to compare elements of GBS protocols on legume species that differ for genome size, ploidy, and breeding system, and (ii to show successful applications and challenges of GBS data on legume species. Preliminary work on alfalfa and Medicago truncatula suggested the greater interest of ApeKI over PstI:MspI DNA digestion. We compared KAPA and NEB Taq polymerases in combination with primer extensions that were progressively more selective on restriction sites, and found greater number of polymorphic SNP loci in pea, white lupin and diploid alfalfa when adopting KAPA with a non-selective primer. This protocol displayed a slight advantage also for tetraploid alfalfa (where SNP calling requires higher read depth. KAPA offered the further advantage of more uniform amplification than NEB over fragment sizes and GC contents. The number of GBS-generated polymorphic markers exceeded 6,500 in two tetraploid alfalfa reference populations and a world collection of lupin genotypes, and 2,000 in different sets of pea or lupin recombinant inbred lines. The predictive ability of GBS-based genomic selection was influenced by the genotype missing data threshold and imputation, as well as by the genomic selection model, with the best model depending on traits and data sets. We devised a simple method for comparing phenotypic vs. genomic selection in terms of predicted yield gain per year for same evaluation costs, whose application to preliminary data for alfalfa and pea in a hypothetical selection scenario for each crop indicated a distinct advantage of genomic selection.

  10. Determination of protein content in some foodstaffs using 14 MeV NAA

    International Nuclear Information System (INIS)

    Abdel Samei, M.B.; Elshafie, M.A.; Hanna, M.; Csikai, J.; Juhasz, M.

    1986-01-01

    The protein content of meals of various seeds (rice, lupine, sorghum, pumpkin, linseed, water melon, tomato) collected from Egypt and the USA was determined by 14 MeV neutron activation analysis via sup(14)N(n,2n)sup(13)N reaction. Non-conventional sources like tea and coffee residues are also investigated. The concentrations of trace elements determined by the x-ray fluorescence technique show definite differences even for a given type of seed produced in different geographical regions. (author)

  11. Composting of solids separated from anaerobically digested animal manure

    DEFF Research Database (Denmark)

    Chowdhury, Md Albarune; de Neergaard, Andreas; Jensen, Lars Stoumann

    2014-01-01

    ), woodchips (WC), bio-char (BC), barley straw (BS) and lupin residues (LR) and were included at a DS:BA of 3:1 or 6:1, resulting in nine treatments: CTDS (control, DS only), PT3:1, PT6:1, WC3:1, WC6:1, BC3:1, BC6:1, BS3:1 and LR3:1. Depending on treatment, C losses via CO2 and CH4 emissions accounted for 41...

  12. Interaction of factors modifying the radiosensitivity of dormant seeds. A review

    Energy Technology Data Exchange (ETDEWEB)

    Atayan, R.R.

    1987-12-01

    A review is presented on modification of radiation-induced effects in dormant plant seeds. Possible sources of discrepancy of data in the earlier literature are analysed. Approaches to the correct experimental study of mechanisms of interaction of environmental factors (water content, temperature, storage conditions) in the modification of radiobiological reactions are discussed. Progress in the radiation biology of plant seeds, achieved by precise control of experimental conditions, is considered. Plant genera used were barley, rice, maize, wheat, lupins, cotton, oats, pine, pea, crepis, brassica, lactuca, lycopersicon, trifohum, festuca, hibiscus.

  13. Interaction of factors modifying the radiosensitivity of dormant seeds

    International Nuclear Information System (INIS)

    Atayan, R.R.

    1987-01-01

    A review is presented on modification of radiation-induced effects in dormant plant seeds. Possible sources of discrepancy of data in the earlier literature are analysed. Approaches to the correct experimental study of mechanisms of interaction of environmental factors (water content, temperature, storage conditions) in the modification of radiobiological reactions are discussed. Progress in the radiation biology of plant seeds, achieved by precise control of experimental conditions, is considered. Plant genera used were barley, rice, maize, wheat, lupins, cotton, oats, pine, pea, crepis, brassica, lactuca, lycopersicon, trifohum, festuca, hibiscus. (author)

  14. Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA

    International Nuclear Information System (INIS)

    Barciszewska, M.Z.

    1994-01-01

    In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab

  15. Die Beifuß-Ambrosie auf Ackerflächen - ein Problem?

    Directory of Open Access Journals (Sweden)

    Verschwele, Arnd

    2014-07-01

    Full Text Available Common ragweed (Ambrosia artemisiifolia is spreading on agricultural fields in Germany, mainly in Brandenburg and Bayern. Competitive crops like winter cereals and oilseed-rape can reduce growth of this plant better than spring crops. In maize or cereals a chemical control is possible, but problems may arise because of the late emergence of ragweed and its high ability to regrowth. In crops like sunflower or lupines herbicide choice is limited and thus preventive control measures are crucial. An integrated approach is needed in order to avoid yield losses and to stop the spreading of ragweed in Germany.

  16. Grass-clover undersowing affects nitrogen dynamics in a grain legume–cereal arable cropping system

    DEFF Research Database (Denmark)

    Hauggaard-Nielsen, Henrik; Mundus, Simon; Jensen, Erik Steen

    2012-01-01

    A field experiment was carried out in an arable organic cropping system and included a sequence with sole cropped fababean (Vicia faba L.), lupin (Lupinus angustifolius L.), pea (Pisum sativum L.), oat (Avena sativa L.) and pea–oat intercropping with or without an undersown perennial ryegrass...... N2 fixation and 15N labeling technique to determine the fate of pea and oat residue N recovery in the subsequent crop. The subsequent spring wheat and winter triticale crop yields were not significantly affected by the previous main crop, but a significant effect of catch crop undersowing...

  17. Final Environmental Assessment for Test Area D-84 Waterside Redevelopment

    Science.gov (United States)

    2012-09-01

    button Lachnocaulon digynum ST Seepage slopes, wet flatwoods, bogs Low Gulf Coast lupine Lupinus westianus ST Dunes , scrub, sandhills Low Hummingbird...planned monitoring and rrUtigstion measures 3$ described in the toe reques~ and Ibis leau arc: impleme.ntoi Dtscriplion of the Action The purpose of...8217.miliprojfuct.cfin?Id- 13&Code=Pn=ams. Information acressed on NO\\~I I I , 2010. U.S. Anny Cc!]>S of Engineers (L"SACE). 2009. Standard ~ toe Conditions

  18. Feeding weaned piglets and growing-finishing pigs with diets based on mainly home-grown organic feedstuffs

    Directory of Open Access Journals (Sweden)

    K. PARTANEN

    2008-12-01

    Full Text Available In 2000, EU regulations for organic animal production set new guidelines for organic pig feeding requiring that this be based on mainly home-grown organic feedstuffs. Doubts were however raised whether these feeding regimes can maintain good growth performance and carcass quality of pigs. Three experiments were carried out to study different organic feeding regimes in weaned piglets and fattening pigs. In Experiment 1, we evaluated the use of peas and faba beans (0, 120, or 240 g kg-1 in diets for weaned piglets. Piglets fed pea diets performed as well as those fed the control diet, whereas the highest faba bean level resulted in reduced feed intake and growth performance. In Experiment 2, we studied the replacement (0, 33, or 67% of rapeseed cake with blue lupins in fattening pig diets. The dietary lupin level had a quadratic effect on the weight gain of growing pigs, the best performance being observed at the 33% replacement level. However, dietary lupin level did not influence weight gain during the finishing period and total fattening. Back fat became softer with increasing dietary lupin levels. In Experiment 3, different protein supplements were compared in organic diets from weaning to slaughter. In two-phase feeding, the best performance was observed when whey protein was used as the protein supplement, followed by soya bean cake + whey protein and rapeseed cake + fish meal. The effects of a one-phase organic feeding regime with cold-pressed rapeseed cake + whey protein did not differ from those of the two-phase organic feeding regimes. Fattening pigs fed organic diets required from two to seven days longer to reach slaughter weight than those fed conventional diets. Pigs fed organic diets had fatter carcasses, but the eating quality of organic pork did not differ from that of pork from pigs fed conventional diets. Feed costs and the circulation rate of pigs, weaners in particular, were greater and carcass prices lower in the organic

  19. Rumen degradability of some feed legume seeds

    OpenAIRE

    González , Javier; Andrés , Santiago

    2003-01-01

    International audience; The aim of this work was to determine the effective degradability (ED) of CP for different feed legume seeds and the possible relationship with their physical and chemical characteristics. The ED was measured using nylon bags and rumen outflow rate techniques on three rumen cannulated wethers fed at 40 g DM$\\cdot$kg$^{-0.75}$, with a 2:1 (on DM basis) hay to concentrate diet. Nine seed samples of the following legume species were tested: lupin (Lupinus albus L., cultiv...

  20. The structurally effect of surface coated rhamnogalacturonan I on response of the osteoblast-like cell line SaOS-2

    DEFF Research Database (Denmark)

    Svava, Rikke; Gurzawska, Katarzyna; Yihau, Yu

    2014-01-01

    Osseointegration is important when implants are inserted into the bone and can be improved by biochemical surface coating of the implant. In this paper enzymatically modified rhamnogalacturonan I (RG-I) from apple and lupin was used for biochemical coating of aminated surfaces and the importance...... remove small fragments of galacturonic acid (GalA) and binding studies showed that the purity of the RG-I molecules was important for the quality of the coating. The structure of RG-I and osteoblast-like cells' viability were positively correlated so that high content of 1,4-linked galactose (Gal...

  1. Upgrading of shamy wheat bread quality through supplement with flour of certain gamma irradiated legumes

    International Nuclear Information System (INIS)

    Nassef, A.E.

    1997-01-01

    Soybean flour,chick peas flour and lupines were irradiated at 0,5 and 10 kGy and individually used to replace 5,10 or 15% of wheat flour in shamy bread. The effect of supplementation of wheat flour with these legume flours on the major, chemical composition and nutritional quality of bread was studied. Results indicated that protein, ash and fiber contents of supplemented shamy bread were higher than the control. On the other hand, the amino acids of the shamy wheat bread supplemented irradiated legumes flour, improved the quality (water retention capacity, stailing rate and bread freshness) of bread

  2. Effect of nanocoating with rhamnogalacturonan-I on surface properties and osteoblasts response

    DEFF Research Database (Denmark)

    Gurzawska, Katarzyna Aleksandra; Svava, Rikke; Syberg, Susanne

    2012-01-01

    -I) on surface properties and osteoblasts response. Three different RG-Is from apple and lupin pectins were modified and coated on amino-functionalized tissue culture polystyrene plates (aminated TCPS). Surface properties were evaluated by scanning electron microscopy, contact angle measurement, atomic force...... microscopy, and X-ray photoelectron spectroscopy. The effects of nanocoating on proliferation, matrix formation and mineralization, and expression of genes (real-time PCR) related to osteoblast differentiation and activity were tested using human osteoblast-like SaOS-2 cells. It was shown that RG-I coatings...

  3. Differences between Angus and Holstein cattle in the Lupinus leucophyllus induced inhibition of fetal activity.

    Science.gov (United States)

    Green, Benedict T; Panter, Kip E; Lee, Stephen T; Welch, Kevin D; Pfister, James A; Gardner, Dale R; Stegelmeier, Bryan L; Davis, T Zane

    2015-11-01

    Calves with congenital defects born to cows that have grazed teratogenic Lupinus spp. during pregnancy can suffer from what is termed crooked calf syndrome. Crooked calf syndrome defects include cleft palate, spinal column defects and limb malformations formed by alkaloid-induced inhibition of fetal movement. In this study, we tested the hypothesis that there are differences in fetal activity of fetuses carried by Holstein verses Angus heifers orally dosed with 1.1 g/kg dried ground Lupinus leucophyllus. Fetal activity was monitored via transrectal ultrasonography and maternal serum was analyzed for specific lupine alkaloids. There were more (P Angus heifers at eight and 12 h after oral dosing. In addition to serum alkaloid toxicokinetic differences, the Holstein heifers had significantly lower serum concentrations of anagyrine at 2, 4, and 8 h after oral dosing than Angus heifers. Holstein heifers also had significantly greater serum concentrations of lupanine at 12, 18 and 24 h after dosing than the Angus heifers. These results suggest that there are breed differences in susceptibility to lupine-induced crooked calf syndrome. These differences may also be used to discover genetic markers that identify resistant animals, thus facilitating selective breeding of resistant herds. Published by Elsevier Ltd.

  4. Correlation analysis of protein quality characteristics with gluten-free bread properties.

    Science.gov (United States)

    Horstmann, S W; Foschia, M; Arendt, E K

    2017-07-19

    The interest in gluten-free cereal products has increased significantly over the last number of years and there is still a high demand for high quality products. This study aims to establish possible connections between protein properties and dough and bread quality which could advance the knowledge for gluten-free product development. The objective of the present study was to correlate protein properties with bread characteristics. Therefore, a wide range of tests (solubility, emulsifying, foaming, water hydration properties) was performed to characterize a range of food proteins (potato, pea, carob, lupin and soy). Furthermore, the performance of these proteins in a dough matrix (pasting, rheology) and bread formulation (volume, structure, and texture) was analysed. Statistical analysis showed significant (p bread characteristics. The addition of the proteins to the gluten-free bread formulation affected pasting rheological and bread characteristics such as crumb density, crumb hardness and specific volume. The addition of potato and soy protein resulted in the lowest volume with a dense crumb structure and a low consumer acceptance score. However, lupin, pea and carob containing gluten-free breads had a higher specific volume and softer and less dense crumb structure. The protein solubility (r, 0.89; p bread quality.

  5. Comparison of the performance of different instruments in the stray neutron field around the CERN Proton Synchrotron.

    Science.gov (United States)

    Aza, Eleni; Caresana, Marco; Cassell, Christopher; Colombo, Valeria; Damjanovic, Sanja; Gilardoni, Simone; Manessi, Giacomo Paolo; Pangallo, Michel; Perrin, Daniel; Silari, Marco

    2014-10-01

    This paper discusses an intercomparison campaign carried out in several locations around the CERN Proton Synchrotron. The locations were selected in order to perform the measurements in different stray field conditions. Various neutron detectors were employed: ionisation chambers, conventional and extended range rem counters, both commercial and prototype ones, including a novel instrument called LUPIN, specifically conceived to work in pulsed fields. The attention was focused on the potential differences in the instrument readings due to dead-time losses that are expected to affect most commercial units. The results show that the ionisation chambers and LUPIN agree well with the expected H*(10) values, as derived from FLUKA simulations, showing no relevant underestimations even in strongly pulsed fields. On the contrary, the dead-time losses of the other rem counters induced an underestimation in pulsed fields that was more important for instruments characterised by a higher dead time. © The Author 2013. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Content of Minerals and Fatty Acids and Their Correlation with Phytochemical Compounds and Antioxidant Activity of Leguminous Seeds.

    Science.gov (United States)

    Grela, Eugeniusz R; Samolińska, Wioletta; Kiczorowska, Bożena; Klebaniuk, Renata; Kiczorowski, Piotr

    2017-12-01

    The aim of the study was to determine the mineral composition and fatty acid profile in the seeds of selected Fabaceae species and cultivars and to assess their correlations with phytochemicals and antioxidant activity. The Andean lupine was characterised by a particularly high level of Mg and K as well as Cu, Zn, and Fe (P < 0.05). There were various correlations (P < 0.05) between the total phenols and tannins and these elements. The highest contribution of α-linolenic acid (ALA, 18:3, n-3) in total fatty acids was noted in the lentil (13.8 in 100 g -1 fat), common bean (11.9 in 100 g -1 fat), and pea seeds (10.4 in 100 g -1 fat) (P = 0.028). In turn, the white lupine contained the highest content of ALA-0.67 g 100 g -1 seeds; its lowest level was determined in the broad bean-0.03 g 100 g -1 seeds. The seeds exhibited a high proportion of hypocholesterolemic fatty acids (on average 86%). The 2,2-diphenyl-1-picrylhydrazyl antiradical activity was positively correlated with UFA and PUFA (P < 0.05). This indicates great protective potential of legume seeds for prevention and treatment of diet-dependent diseases.

  7. Nitrogen metabolism in plants using 15N as tracer. Part of a coordinated programme on the use of isotopes in fertilizer efficiency studies on grain legumes

    International Nuclear Information System (INIS)

    Pate, J.; Atkins, C.

    1978-01-01

    Techniques are described for studying the economy of carbon and nitrogen in annual nodulated legumes. Budgets for utilization of net photosynthate are constructed for cowpea (Vigna unguiculata (L) Walp.) and white lupin (Lupinus albus L.), including expenditure in respiration and dry matter accumulation of plant parts, carbon consumption in growth, respiration and export of fixed nitrogen by nodules, and the provision of recent photosynthate and earlier-fixed carbon to fruits. Sources of nitrogen to fruits are defined, and efficiencies of conversion of net photosynthate to protein of above-ground vegetative parts and of seeds are computed. Consideration is given to the timing of events associated with loss of symbiotic activity after flowering. Literature giving estimates of the respiratory requirements of nitrogen fixation by nodules is reviewed. Rates of respiration of nodules of cowpea, white lupin and pea (Pisum sativum L.) are assessed from a theoretical viewpoint, basing the estimates on ATP requirements for assimilation of N 2 into nitrogenous solutes, and published values for respiration costs in plant tissues. Expressed as CO 2 output per unit of nitrogen assimilated, these estimates greatly exceed the experimentally-observed CO 2 efflux of nodules of the species. This discrepancy is examined in relation to the capacity of nodules to fix CO 2 and the uncertainty of the in vivo requirement of nitrogenase for ATP

  8. Iron plaque formed under aerobic conditions efficiently immobilizes arsenic in Lupinus albus L roots.

    Science.gov (United States)

    Fresno, Teresa; Peñalosa, Jesús M; Santner, Jakob; Puschenreiter, Markus; Prohaska, Thomas; Moreno-Jiménez, Eduardo

    2016-09-01

    Arsenic is a non-threshold carcinogenic metalloid. Thus, human exposure should be minimised, e.g. by chemically stabilizing As in soil. Since iron is a potential As immobiliser, it was investigated whether root iron plaque, formed under aerobic conditions, affects As uptake, metabolism and distribution in Lupinus albus plants. White lupin plants were cultivated in a continuously aerated hydroponic culture containing Fe/EDDHA or FeSO4 and exposed to arsenate (5 or 20 μM). Only FeSO4 induced surficial iron plaque in roots. LA-ICP-MS analysis accomplished on root sections corroborated the association of As to this surficial Fe. Additionally, As(V) was the predominant species in FeSO4-treated roots, suggesting less efficient As uptake in the presence of iron plaque. Fe/EDDHA-exposed roots neither showed such surficial FeAs co-localisation nor As(V) accumulation; in contrast As(III) was the predominant species in root tissue. Furthermore, FeSO4-treated plants showed reduced shoot-to-root As ratios, which were >10-fold lower compared to Fe/EDDHA treatment. Our results highlight the role of an iron plaque formed in roots of white lupin under aerobic conditions on As immobilisation. These findings, to our knowledge, have not been addressed before for this plant and have potential implications on soil remediation (phytostabilisation) and food security (minimising As in crops). Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Early life exposure to bisphenol A investigated in mouse models of airway allergy, food allergy and oral tolerance.

    Science.gov (United States)

    Nygaard, Unni Cecilie; Vinje, Nina Eriksen; Samuelsen, Mari; Andreassen, Monica; Groeng, Else-Carin; Bølling, Anette Kocbach; Becher, Rune; Lovik, Martinus; Bodin, Johanna

    2015-09-01

    The impact of early life exposure to bisphenol A (BPA) through drinking water was investigated in mouse models of respiratory allergy, food allergy and oral tolerance. Balb/c mice were exposed to BPA (0, 10 or 100 μg/ml), and the offspring were intranasally exposed to the allergen ovalbumin (OVA). C3H/HeJ offspring were sensitized with the food allergen lupin by intragastric gavage, after exposure to BPA (0, 1, 10 or 100 μg/ml). In separate offspring, oral tolerance was induced by gavage of 5 mg lupin one week before entering the protocol for the food allergy induction. In the airway allergy model, BPA (100 μg/ml) caused increased eosinophil numbers in bronchoalveolar lavage fluid (BALF) and a trend of increased OVA-specific IgE levels. In the food allergy and tolerance models, BPA did not alter the clinical anaphylaxis or antibody responses, but induced alterations in splenocyte cytokines and decreased mouse mast cell protease (MMCP)-1 serum levels. In conclusion, early life exposure to BPA through drinking water modestly augmented allergic responses in a mouse model of airway allergy only at high doses, and not in mouse models for food allergy and tolerance. Thus, our data do not support that BPA promotes allergy development at exposure levels relevant for humans. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. New ways in enhancing the vital activity of plants in order to increase crop yields and to suppress radionuclide accumulation

    International Nuclear Information System (INIS)

    Goncharova, N.; Kislushko, P.; Znebrakova, I.; Matsko, V.

    1994-01-01

    Soil contamination with long-lived isotopes as a result of Chernobyl nuclear accident necessitates substantially of crop raising procedures. It is found that by optimizing the vital activity processes in plants, is possible to reduce radionuclide uptake. In particular application of Fisher's mineral mix in concentration of 100, 200, 300, g/m 2 to soil decreased the 137 Cs accumulation in green material of lupine (Lupinus luteus L.) 1.1:1.3 and 2.2 times respectively and 1.2:1.1 and 1.1 times, respectively in green material of barley (Hordeum Vulgaris L.). The decrease of 90 Sr accumulation in green material of barley and lupine was similar. On the other hand chloroplasts isolated from showed higher activities of photochemical reactions and the light-dependent ATP enzyme. During the whole growing period of such plants the chlorophyll and protein concentration per wet unit mass were higher than those in control, therefore the high vital activity period in the former case was substantially extended. It has been also found that application of biologically active compounds and trace elements enhances photosynthetic and production activities of plants, reducing level radionuclide accumulation in the harvest. It is found that application of protectants and growth regulators to rye crops also reduces 137 Cs accumulation in green material in booting and earing phases. This finding suggests that this compounds activate the photosynthetic apparatus, reducing level radionuclide accumulation. (author)

  11. [Product development on the basis of cereal and leguminous flours to coeliac disease in children between 6-24 months; I: formulation and acceptability].

    Science.gov (United States)

    Cerezal Mezquita, P; Urtuvia Gatica, V; Ramírez Quintanilla, V; Romero Palacios, N; Arcos Zavala, R

    2011-01-01

    The revaluation of the Andean cultivations, quinua (Chenopodium quinua Willd) and lupin (Lupinus albus L.), to be used in nutritional mixtures, with traditional cereals like corn (Zea mays L.) and rice (Oryza sativa L.), originate mixtures without gluten which constitute a good alternative for the nutrition of children under 24 months that suffer from celiac disease, since they improve the quality of the protein, by essential amino acids compensation, and also impacts in the product's diversification strategy. In the present work, the percentage composition of each flour in the mixture was determined by means of Linear Programming by means of the Solver form from the Excel spreadsheet. Prolamines were determined in the quinua and lupin flours by the ELISA test and the HPLC technique was used in both products obtained called "sweet mix" and "dessert mix", to define the quantity of amino acids with the purpose of providing around the 15% of the proteins required in the day. The flour mixtures selected as optimum, sweet mix, suitable for the preparation of sweet pancakes, as well as for the dessert mix, that by addition of water or milk produce a semi solid dessert, were evaluated after three months of storage, being acceptable their microbiological, bromatological and sensorial requirements, corroborating the results with the good acceptance of the products, prepared from the formulated mixtures, by the children of two Day Care centers of the City of Antofagasta-Chile.

  12. Biological and microbiological attributes in Oxisol managed with cover crops

    Directory of Open Access Journals (Sweden)

    Rodrigo Ferreira da Silva

    2017-05-01

    Full Text Available The inclusion of winter cover crops and fertilization with nitrogen to the soil can have an effect on their biological and microbiological attributes. The aim of this study was to evaluate biological and microbiological attributes in soil under different winter cover crops and nitrogen doses. The experiment was conducted at the Frederico Westphalen-RS campus of the Federal University of Santa Maria (UFSM in a Rhodic Hapludox soil. The experimental design was a randomized block in factorial arrangement (2 x 10: 10 winter cover crops systems (Fallow [control], black oats, white oats, ryegrass, forage turnip, vetch, white lupine; black oat + forage turnip; black oat + vetch and black oat + vetch + fodder turnip, and two nitrogen rates in the form of urea applied in successive crops of beans common and maize, with four replications. We assessed the biological attributes (Margalef’s richness, Simpson’s dominance, Shannon’s diversity and abundance of organisms and microbiological (carbon and nitrogen microbial biomass, basal respiration, metabolic quotient and microbial quotient of the soil. The fallow with wild species and white lupine showed greater Simpson’s dominance and abundance of organisms due to the increase in the number of individuals of the order Collembola. Vetch improved the biological attributes of the soil with increase in Collembola abundance and diversity of organisms of soil fauna. The application of nitrogen favored the microbial biomass carbon and reduced the metabolic quotient.

  13. Qualitative attributes and postharvest conservation of green ears of maize grown on different cover crops in organic no-till system

    Directory of Open Access Journals (Sweden)

    Luiz Fernando Favarato

    Full Text Available ABSTRACT Postharvest quality of sweet maize varies depending on the type of seed, soil, quality of fertilizer, climatic conditions, and stage of maturation. This study aimed to evaluate the post-harvest quality and shelf life of green ears of maize grown on three soil covers in organic no-till sytem. The study was conducted in the municipality of Domingos Martins, ES (20° 22'16.91" S and 41° 03' 41.83" W. The experiment was arranged in a randomized block design with six replications and five treatments, consisting of three cover crops in organic no-till system: black-oat straw, white lupin, oat/lupin intercrop and two systems, organic and conventional, without straw. Maize double hybrid AG-1051 was sown in a spacing of 1.00 x 0.20 m. The variables evaluated included relative percentage of grain, straw and cob, pH, titratable acidity, soluble solids, grain moisture and shelf life. The use of different straws in the organic no-till system does not influence the postharvest quality of green ears. Ears packed in polystyrene trays with plastic film are suitable for marketing until the fifth day of storage at room temperature.

  14. Effect of winter cover crops on nematode population levels in north Florida.

    Science.gov (United States)

    Wang, K-H; McSorley, R; Gallaher, R N

    2004-12-01

    Two experiments were conducted in north-central Florida to examine the effects of various winter cover crops on plant-parasitic nematode populations through time. In the first experiment, six winter cover crops were rotated with summer corn (Zea mays), arranged in a randomized complete block design. The cover crops evaluated were wheat (Triticum aestivum), rye (Secale cereale), oat (Avena sativa), lupine (Lupinus angustifolius), hairy vetch (Vicia villosa), and crimson clover (Trifolium incarnatum). At the end of the corn crop in year 1, population densities of Meloidogyne incognita were lowest on corn following rye or oat (P rye or lupine was planted into field plots with histories of five tropical cover crops: soybean (Glycine max), cowpea (Vigna unguiculata), sorghum-sudangrass (Sorghum bicolor x S. sudanense), sunn hemp (Crotalaria juncea), and corn. Population densities of M. incognita and Helicotylenchus dihystera were affected by previous tropical cover crops (P cover crops present at the time of sampling. Plots planted to sunn hemp in the fall maintained the lowest M. incognita and H. dihystera numbers. Results suggest that winter cover crops tested did not suppress plant-parasitic nematodes effectively. Planting tropical cover crops such as sunn hemp after corn in a triple-cropping system with winter cover crops may provide more versatile nematode management strategies in northern Florida.

  15. Enhanced phytoextraction of germanium and rare earth elements - a rhizosphere-based approach

    Science.gov (United States)

    Wiche, Oliver

    2016-04-01

    Germanium (Ge) and rare earth elements (REEs) are economically valuable raw materials that have become an integral part of our modern high tech society. While most of these elements are not actually rare in terms of general amounts in the earth's crust, they are rarely found in sufficient abundances in single locations for their mining to be economically viable. The average concentration of Ge in soils is estimated at 1.6 μg g-1. The REEs comprise a group of 16 elements including La, the group of lanthanides and Y that are abundant in the earth crust with concentrations varying from 35 μg g-1 (La), 40 μg g-1 (Nd), 6 μg g-1 (Gd) and 3.5 μg g-1 (Er) to 0.5 μg g-1 in Tm. Thus, a promising chance to improve supply of these elements could be phytomining. Unfortunately, bioavailability of Ge and REEs in soils appears to be low, in particular in neutral or alkaline soils. A sequential dissolution analysis of 120 soil samples taken from the A-horizons of soils in the area of Freiberg (Saxony, Germany) revealed that only 0.2% of total Ge and about 0.5% of La, Nd, Gd and Er of bulk concentrations were easily accessible by leaching with NH4-acetate (pH 7). Most of the investigated elements were bound to Fe-/Mn-oxides and silicates and were therefore only poorly available for plant uptake. Here we report an environmentally friendly approach for enhanced phytoextraction of Ge and REEs from soils using mixed cultures of plant species with efficient mechanisms for the acquisition of nutrients in the rhizosphere. The rhizosphere is characterized as the zone in soil sourrounding a plant root that consists of a gradient in chemical, physical and biological soil properties driven by rhizodeposits like carboxylates and protons. Some species like white lupin (Lupinus albus) are able to excrete large amounts of organic acid anions(predominantly citrate and malate) and show a particularly high potential for the acidification of the rhizosphere. In our experiments, mixed cultures

  16. An investigation of deformation and fluid flow at subduction zones using newly developed instrumentation and finite element modeling

    Science.gov (United States)

    Labonte, Alison Louise

    electronic flow meter that can measure flow rates of 0.1 to >500 m/yr at a temporal resolution of 30 minutes to 0.5 minutes, respectively. Test deployments of the OTIS at cold seeps in the transpressional Monterey Bay demonstrated the OTIS functionality over this range of flow environments. Although no deformation events were detected during these test deployments, the OTIS's temporally accurate measurements at the vigorously flowing Monterey Bay cold seep rendered valuable insight into the plumbing of the seep system. In addition to the capability to detect transient flow events, a primary functional requirement of the OTIS was the ability to communicate and transfer data for long-term real-time monitoring deployments. Real-time data transfer from the OTIS to the desktop was successful during a test deployment of the Nootka Observatory, an acoustically-linked moored-buoy system. A small array of CAT meters was also deployed at the Nootka transform-Cascadia subduction zone triple junction. Four anomalous flow rate events were observed across all four meters during the yearlong deployment. Although the records have low temporal accuracy, a preliminary explanation for the regional changes in flow rate is made through comparison between flow rate records and seismic records. The flow events are thought to be a result of a tectonic deformation event, possibly with an aseismic component. Further constraints are not feasible given the unknown structure of faulting near the triple junction. In a final proof of concept study, I find that use these hydrologic instruments, which capture unique aseismic flow rate patterns, is a valuable method for extracting information about deformation events on the decollement in the offshore subduction zone margin. Transient flow events observed in the frontal prism during a 1999--2000 deployment of CAT meters on the Costa Rica Pacific margin suggest episodic slow-slip deformation events may be occurring in the shallow subduction zone. The FEM

  17. Determination of some trace elements in edible crops grown in Jebel Merra area

    International Nuclear Information System (INIS)

    Mohamed, Abdelmoneim Adam

    2001-11-01

    This preliminary study was conducted in the area of Jebel Merra in South Darfour State, Western Sudan, With the aim of establishing a base-line data on trace element levels in foodstuffs cultivated in the region. 19 samples of vegetables, cereal grains, spices and fruits were collected from farms in Nyala, Derbat, Sunie and Gawa. With the exception of Nyala, the sampling farms were located on hill slopes using turus system as a means for water harvesting. Samples were analyzed for six trace elements, viz., Fe, Mn, Zn, Cu, Co and Cr using Atomic Absorption Spectroscopy (Aas). Comparison of the results with similar data from different parts of Sudan and from some other countries reveals that the foodstuffs grown in this high latitude region are relatively deficient in their elemental content. This salient feature conforms with well-known fact that, the soil in high latitude regions depleted in nutritional plant elements due to the leaching caused by runoff water hence the corresponding concentrations in plants are quite low indicative of state of malnutrition. Categorically speaking, among the vegetables analyzed, okra has shown a high affinity in accumulating Fe (187.49 ppm), Mn (80.31ppm), Cu (7.43 ppm) and Zn (12.74 ppm) comparative to other species. On the other hand, opposite trend was observed with sorghum as the poorest one with respect to its ability in concentrating Fe (55.57 ppm), Mn (4.19 ppm), Zn (5.25 ppm) and Cu (1.26 ppm) relative to millet, Wheat, Lupins and broad beans. With regard to spices covered in this investigation, garlic contains the lowest concentrations of all the elements analyzed and agree well with those found in onion the poorest of all the vegetables. Concentrations obtained were 108.78 ppm (Fe), 3.6 ppm (Mn), 4.6 ppm (Zn), 1.73 ppm (Cu) and 0.1 ppm (Cr) and 0.16 ppm (Co). On individual basis, the highest concentration of Mn was measured in lupins at 143.18 ppm. Cr content in all spices was found to be less than 1 ppm, whereas for Co

  18. PRACTICAL PROPOSALS AS A RESULT OF THEORETICAL AND EXPERIMENTAL STUDIES OF THE PROCESS OF EXTRACTION FROM RAW MATERIALS OF PLANT ORIGIN

    Directory of Open Access Journals (Sweden)

    I. I. Shishatskii

    2014-01-01

    Full Text Available Summary. Theoretical and experimental researches of extraction processes from plant origin raw materials: barley, acorns and chicory with liquid carbon dioxide, as well as lupin with cheese whey were carried out. Quality indicators of extracts and secondary raw materials are defined. It is established that they are perspective raw sources for the enriched and functional products as they contain amino acids, vitamins and microelements. The dairy-vegetative lupine extract, for example, contains 17 amino acids, including the essential as well as vitamins and minerals. The studies of secondary raw materials, barley, acorns, chicory and lupine quality showed the expediency of their use for foods enrichment. Quality indicators of secondary raw materials are presented in the tables form in the given work. It formed the basis for the development of hardware-technological schemes of obtaining СО2-extracts and their use. The hardware-technological scheme of obtaining СО2-extracts from barley, acorns and chicory includes a number of equipment units: motor transport for raw materials delivery to the enterprise, the scraper hydroconveyor, the jet washer, a photoseparator for of poor-quality raw materials and impurities removal, a blowing machine for removing surface moisture from the raw materials, a jet washer for peeling, a cutter, drying and frying device, a crusher, a roller machine tool and an extracting unit. Hardware providing for yoghurt technology enriched with amino acids, microelements and vitamins which are present in a dairy-plant extract differs from the mentioned above one in the following. The extract used is a cheese whey, and the extraction of a target component is carried out in a vibrating extractor. The hardwaretechnological scheme is made according to Russian technology of yoghurt and furnished with the equipment for dairy-vegetative extract feeding into a product. It includes the following: a vibrating extractor (not shown in fig

  19. Identification and characterisation of seed storage protein transcripts from Lupinus angustifolius

    Directory of Open Access Journals (Sweden)

    Goggin Danica E

    2011-04-01

    Full Text Available Abstract Background In legumes, seed storage proteins are important for the developing seedling and are an important source of protein for humans and animals. Lupinus angustifolius (L., also known as narrow-leaf lupin (NLL is a grain legume crop that is gaining recognition as a potential human health food as the grain is high in protein and dietary fibre, gluten-free and low in fat and starch. Results Genes encoding the seed storage proteins of NLL were characterised by sequencing cDNA clones derived from developing seeds. Four families of seed storage proteins were identified and comprised three unique α, seven β, two γ and four δ conglutins. This study added eleven new expressed storage protein genes for the species. A comparison of the deduced amino acid sequences of NLL conglutins with those available for the storage proteins of Lupinus albus (L., Pisum sativum (L., Medicago truncatula (L., Arachis hypogaea (L. and Glycine max (L. permitted the analysis of a phylogenetic relationships between proteins and demonstrated, in general, that the strongest conservation occurred within species. In the case of 7S globulin (β conglutins and 2S sulphur-rich albumin (δ conglutins, the analysis suggests that gene duplication occurred after legume speciation. This contrasted with 11S globulin (α conglutin and basic 7S (γ conglutin sequences where some of these sequences appear to have diverged prior to speciation. The most abundant NLL conglutin family was β (56%, followed by α (24%, δ (15% and γ (6% and the transcript levels of these genes increased 103 to 106 fold during seed development. We used the 16 NLL conglutin sequences identified here to determine that for individuals specifically allergic to lupin, all seven members of the β conglutin family were potential allergens. Conclusion This study has characterised 16 seed storage protein genes in NLL including 11 newly-identified members. It has helped lay the foundation for efforts to use

  20. Determinate growth in Pisum: 'det' a new mutant gene on chromosome 7

    International Nuclear Information System (INIS)

    Swiecicki, W.K.

    1988-01-01

    Full text: A characteristic feature of the growth of legume plants is the absence of a clear border between vegetative and generative phase. By contrast in cereals, the growth of the vegetative mass ceases with flowering and assimilates are destined for filling grains. With regard to this feature in breeding of legume crops the ideotype of 'the self-completion variety' has been conceived. In the broad sense, this term means a plant with a clear end of vegetative growth, after which assimilates should be transported to seeds resulting in more uniform maturity and higher seed yield. Such self-completion can be achieved in different ways, even in the same species. In white lupin, e.g. the cultivar 'Wat' drops its leaves in the stage of pod filling. Moreover, in white lupin as well as in yellow and narrow-leaved lupins unbranched genotypes have been selected in which only one, the main stem develops with the inflorescence on top. Additional nodes with a single flower appear instead of branches. The field bean Vicia faba similar to the pea produces inflorescence on nodes and consecutive nodes develop continuously from the apical meristem. But in the mutation type 'determinate growth', controlled by a single gene, the stem is ended by the inflorescence. A comparable gene was found in pea in 1980 as an effect of seed treatment of the line Wt 3527 by the combined dose 200r Nf+0.014% NEU. Plants are characterized by inflorescence on the top of the stem and smaller number of flowering nodes. Sometimes apical flowers are abnormal, open, but fertile. The mutant was included in the gene bank under number Wt 16100. A phenotypically similar line was found at the John Innes Institute, Norwich (UK). According to the locus allelism test (Wt 16100 x Jl 1358) both mutants are controlled by the same gene. The suggested symbol for this monogenic inherited character is det determinated growth. For the linkage test, the tester line Wl 1238 was crossed with the mutant Wt 16100. The

  1. Occurrence of H2-Uptake Hydrogenases in Bradyrhizobium sp. (Lupinus) and Their Expression in Nodules of Lupinus spp. and Ornithopus compressus1

    Science.gov (United States)

    Murillo, Jesús; Villa, Ana; Chamber, Manuel; Ruiz-Argüeso, Tomás

    1989-01-01

    Fifty-four strains of Bradyrhizobium sp. (Lupinus) from worldwide collections were screened by a colony hybridization method for the presence of DNA sequences homologous to the structural genes of the Bradyrhizobium japonicum hydrogenase. Twelve strains exhibited strong colony hybridization signals, and subsequent Southern blot hybridization experiments showed that they fell into two different groups on the basis of the pattern of EcoRI fragments containing the homology to the hup probe. All strains in the first group (UPM860, UPM861, and 750) expressed uptake hydrogenase activity in symbiosis with Lupinus albus, Lupinus angustifolius, Lupinus luteus, and Ornithopus compressus, but both the rate of H2 uptake by bacteroids and the relative efficiency of N2 fixation (RE = 1 - [H2 evolved in air/acetylene reduced]) by nodules were markedly affected by the legume host. L. angustifolius was the less permissive host for hydrogenase expression in symbiosis with the three strains (average RE = 0.76), and O. compressus was the more permissive (average RE = 1.0). None of the strains in the second group expressed hydrogenase activity in lupine nodules, and only one exhibited low H2-uptake activity in symbiosis with O. compressus. The inability of these putative Hup+ strains to induce hydrogenase activity in lupine nodules is discussed on the basis of the legume host effect. Among the 42 strains showing no homology to the B. japonicum hup-specific probe in the colony hybridization assay, 10 were examined in symbiosis with L. angustifolius. The average RE for these strains was 0.51. However, one strain, IM43B, exhibited high RE values (higher than 0.80) and high levels of hydrogenase activity in symbiosis with L. angustifolius, L. albus, and L. luteus. In Southern blot hybridization experiments, no homology was detected between the B. japonicum hup-specific DNA probe and total DNA from vegetative cells or bacteroids from strain IM43B even under low stringency hybridization

  2. Determinate growth in Pisum: 'det' a new mutant gene on chromosome 7

    Energy Technology Data Exchange (ETDEWEB)

    Swiecicki, W K [Plant Breeding Station, Wiatrowo (Poland)

    1988-07-01

    Full text: A characteristic feature of the growth of legume plants is the absence of a clear border between vegetative and generative phase. By contrast in cereals, the growth of the vegetative mass ceases with flowering and assimilates are destined for filling grains. With regard to this feature in breeding of legume crops the ideotype of 'the self-completion variety' has been conceived. In the broad sense, this term means a plant with a clear end of vegetative growth, after which assimilates should be transported to seeds resulting in more uniform maturity and higher seed yield. Such self-completion can be achieved in different ways, even in the same species. In white lupin, e.g. the cultivar 'Wat' drops its leaves in the stage of pod filling. Moreover, in white lupin as well as in yellow and narrow-leaved lupins unbranched genotypes have been selected in which only one, the main stem develops with the inflorescence on top. Additional nodes with a single flower appear instead of branches. The field bean Vicia faba similar to the pea produces inflorescence on nodes and consecutive nodes develop continuously from the apical meristem. But in the mutation type 'determinate growth', controlled by a single gene, the stem is ended by the inflorescence. A comparable gene was found in pea in 1980 as an effect of seed treatment of the line Wt 3527 by the combined dose 200r Nf+0.014% NEU. Plants are characterized by inflorescence on the top of the stem and smaller number of flowering nodes. Sometimes apical flowers are abnormal, open, but fertile. The mutant was included in the gene bank under number Wt 16100. A phenotypically similar line was found at the John Innes Institute, Norwich (UK). According to the locus allelism test (Wt 16100 x Jl 1358) both mutants are controlled by the same gene. The suggested symbol for this monogenic inherited character is det determinated growth. For the linkage test, the tester line Wl 1238 was crossed with the mutant Wt 16100. The

  3. Transcriptome analysis of Nicotiana tabacum infected by Cucumber mosaic virus during systemic symptom development.

    Directory of Open Access Journals (Sweden)

    Jie Lu

    Full Text Available Virus infection of plants may induce a variety of disease symptoms. However, little is known about the molecular mechanism of systemic symptom development in infected plants. Here we performed the first next-generation sequencing study to identify gene expression changes associated with disease development in tobacco plants (Nicotiana tabacum cv. Xanthi nc induced by infection with the M strain of Cucumber mosaic virus (M-CMV. Analysis of the tobacco transcriptome by RNA-Seq identified 95,916 unigenes, 34,408 of which were new transcripts by database searches. Deep sequencing was subsequently used to compare the digital gene expression (DGE profiles of the healthy plants with the infected plants at six sequential disease development stages, including vein clearing, mosaic, severe chlorosis, partial and complete recovery, and secondary mosaic. Thousands of differentially expressed genes were identified, and KEGG pathway analysis of these genes suggested that many biological processes, such as photosynthesis, pigment metabolism and plant-pathogen interaction, were involved in systemic symptom development. Our systematic analysis provides comprehensive transcriptomic information regarding systemic symptom development in virus-infected plants. This information will help further our understanding of the detailed mechanisms of plant responses to viral infection.

  4. Coilin, the signature protein of Cajal bodies, differentially modulates the interactions of plants with viruses in widely different taxa.

    Science.gov (United States)

    Shaw, Jane; Love, Andrew J; Makarova, Svetlana S; Kalinina, Natalia O; Harrison, Bryan D; Taliansky, Michael E

    2014-01-01

    Cajal bodies (CBs) are distinct nuclear bodies physically and functionally associated with the nucleolus. In addition to their traditional function in coordinating maturation of certain nuclear RNAs, CBs participate in cell cycle regulation, development, and regulation of stress responses. A key "signature" component of CBs is coilin, the scaffolding protein essential for CB formation and function. Using an RNA silencing (loss-of-function) approach, we describe here new phenomena whereby coilin also affects, directly or indirectly, a variety of interactions between host plants and viruses that have RNA or DNA genomes. Moreover, the effects of coilin on these interactions are manifested differently: coilin contributes to plant defense against tobacco rattle virus (tobravirus), tomato black ring virus (nepovirus), barley stripe mosaic virus (hordeivirus), and tomato golden mosaic virus (begomovirus). In contrast, with potato virus Y (potyvirus) and turnip vein clearing virus (tobamovirus), coilin serves to increase virus pathogenicity. These findings show that interactions with coilin (or CBs) may involve diverse mechanisms with different viruses and that these mechanisms act at different phases of virus infection. Thus, coilin (CBs) has novel, unexpected natural functions that may be recruited or subverted by plant viruses for their own needs or, in contrast, are involved in plant defense mechanisms that suppress host susceptibility to the viruses.

  5. Molecular characterization of a divergent strain of calla lily chlorotic spot virus infecting celtuce (Lactuca sativa var. augustana) in China.

    Science.gov (United States)

    Wu, Xiaodong; Wu, Xiaoyun; Li, Wenbin; Cheng, Xiaofei

    2018-05-01

    Through sequencing and assembly of small RNAs, an orthotospovirus was identified from a celtuce plant (Lactuca sativa var. augustana) showing vein clearing and chlorotic spots in the Zhejiang province of China. The S, M, and L RNAs of this orthotospovirus were determined to be 3146, 4734, and 8934 nt, respectively, and shared 30.4-72.5%, 43.4-80.8%, and 29.84-82.9% nucleotide sequence identities with that of known orthotospoviruses. The full length nucleoprotein (N) of this orthotospovirus shared highest amino acid sequence identity (90.25%) with that of calla lily chlorotic spot virus isolated from calla lily (CCSV-calla) [China: Taiwan: 2001] and tobacco (CCSV-LJ1) [China: Lijiang: 2014]. Phylogenetic analyses showed that this orthotospovirus is phylogenetically associated with CCSV isolates and clustered with CCSV, tomato zonate spot virus (TZSV), and tomato necrotic spot-associated virus (TNSaV) in a separate sub-branch. These results suggest that this orthotospovirus is a divergent isolate of CCSV and was thus named CCSV-Cel [China: Zhejiang: 2017].

  6. Kisaran Inang dan Keragaman Gejala Infeksi Turnip Mosaic Virus

    Directory of Open Access Journals (Sweden)

    Eliza Suryati Rusli

    2007-07-01

    Full Text Available The incidence of mosaic disease on vegetable crops in Indonesia has been reported recently. The disease is caused by TuMV which is considered as a new and important virus on caisin and turnip in Indonesia. Field survey has been conducted to determine disease incidence in vegetable growing areas. Symptom variability and host range of TuMV was further studied through mechanical inoculation to cruciferae and solanaceae plants. Observation during field survey has proved that TuMV has infected caisin and turnip in Java and Bali. The highest intensity of mosaic disease i.e. 63,3% occurs in Tumpangan-Malang, followed by Denpasar Selatan and Bandungan-Semarang with the intensity of 30,5% and 19,0% respectively. TuMV infection causes different types of symptoms, such as: wrinkled leaf, blistered leaf, vein banding, vein clearing, leaf distortion and proliferation. The host range of TuMV involves those plants belong to cruciferae (cabbage, broccoli, caisin, turnip, cauliflower, chinese cabbage, pak coy; solanaceae (N. tabacum, N. benthamiana, N. glutinosa; and chenopodiaceae (C. amaranticolor. Furthermore, N. glutinosa can be used as differential host for TuMV isolates.

  7. Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry

    Directory of Open Access Journals (Sweden)

    Javier Villacreses

    2015-04-01

    Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.

  8. Potato virus Y (PVY) Isolates from Physalis peruviana are Unable to Systemically Infect Potato or Pepper and Form a Distinct New Lineage Within the PVYC Strain Group.

    Science.gov (United States)

    Green, Kelsie J; Chikh-Ali, Mohamad; Hamasaki, Randall T; Melzer, Michael J; Karasev, Alexander V

    2017-11-01

    Poha, or cape gooseberry (Physalis peruviana L.), is a plant species cultivated in Hawaii for fresh fruit production. In 2015, an outbreak of virus symptoms occurred on poha farms in the South Kohala District of the island of Hawaii. The plants displayed mosaic, stunting, and leaf deformation, and produced poor fruit. Initial testing found the problem associated with Potato virus Y (PVY) infection. Six individual PVY isolates, named Poha1 to Poha6, were collected from field-grown poha plants and subjected to biological and molecular characterization. All six isolates induced mosaic and vein clearing in tobacco, and three of them exhibited O-serotype while the other three reacted only with polyclonal antibodies and had no identifiable serotype. Until now, PVY isolates have been broadly divided into pepper or potato adapted; however, these six PVY isolates from poha were unable to establish systemic infection in pepper and in four tested potato cultivars. Whole-genome sequences for the six isolates were determined, and no evidence of recombination was found in any of them. Phylogenetic analysis placed poha PVY isolates in a distinct, monophyletic "Poha" clade within the PVY C lineage, suggesting that they represented a novel, biologically and evolutionarily unique group. The genetic diversity within this poha PVY C clade was unusually high, suggesting a long association of PVY C with this solanaceous host or a prolonged geographical separation of PVY C in poha in Hawaii.

  9. Nitrate leaching and residual effect in dairy crop rotations with grass-clover leys as influenced by sward age, grazing, cutting and fertilizer regimes

    DEFF Research Database (Denmark)

    Eriksen, Jørgen; Askegaard, Margrethe; Rasmussen, Jim

    2015-01-01

    Intensive dairy farming, with grass-arable crop rotations is challenged by low N use efficiency that may have adverse environmental consequences. We investigated nitrate leaching and N fertility effects of grass–clover leys for five years in two organic crop rotations with different grassland...... with the 2-yr-old leaching the most (36–46 kg N ha−1), and (4) high leaching (>50 kg N ha−1) with lupin and maize, where especially maize was consistently high in all five years (average 81 kg N ha−1). Great care should be taken during all phases of the dairy crop rotation where grasslands cause considerable...... build-up of fertility. With due care and the best management practice, nitrate leaching losses may be reduced to low levels....

  10. On the use of low radiation doses in agriculture

    International Nuclear Information System (INIS)

    Berezina, N.M.; Vaninskaya, Yu.M.; Sushko, S.N.

    1978-01-01

    Different periods of the presowing gamma-irradiation of seeds of agricultural crops have been considered. The theore--tical prerequisits and the data on practical introduction of this agricultural method at the farms of various regions of the country have been given. The tests performed lately in BSSR on a number of agricultural crops also confirm the availability of the radiation stimulation effect. Radiation treatment of seeds of flax, barley, rye, lupine and potato tubers allows a gain in crops on an average by 10 - 15%. The results of industrial tests and an introduction of the method into the agricultural practice of BSSR have been presented. An economic estimation of the results obtained on presowing irradiation of the flax seeds has been given

  11. Endophytic bacteria improve phytoremediation of Ni and TCE co-contamination.

    Science.gov (United States)

    Weyens, Nele; Croes, Sarah; Dupae, Joke; Newman, Lee; van der Lelie, Daniel; Carleer, Robert; Vangronsveld, Jaco

    2010-07-01

    The aim of this work was to investigate if engineered endophytes can improve phytoremediation of co-contaminations by organic pollutants and toxic metals. As a model system, yellow lupine was inoculated with the endophyte Burkholderia cepacia VM1468 possessing (a) the pTOM-Bu61 plasmid, coding for constitutive trichloroethylene (TCE) degradation, and (b) the ncc-nre Ni resistance/sequestration system. Plants were exposed to Ni and TCE and (a) Ni and TCE phytotoxicity, (b) TCE degradation and evapotranspiration, and (c) Ni concentrations in the roots and shoots were determined. Inoculation with B. cepacia VM1468 resulted in decreased Ni and TCE phytotoxicity, as measured by 30% increased root biomass and up to 50% decreased activities of enzymes involved in anti-oxidative defence in the roots. In addition, TCE evapotranspiration showed a decreasing trend and a 5 times higher Ni uptake was observed after inoculation. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  12. Soya Saponins Induce Enteritis in Atlantic Salmon (Salmo salar L.).

    Science.gov (United States)

    Krogdahl, Åshild; Gajardo, Karina; Kortner, Trond M; Penn, Michael; Gu, Min; Berge, Gerd Marit; Bakke, Anne Marie

    2015-04-22

    Soybean meal-induced enteritis (SBMIE) is a well-described condition in the distal intestine of salmonids, and saponins have been implicated as the causal agent. However, the question remains whether saponins alone cause SBMIE. Moreover, the dose-response relationship has not been described. In a 10 week feeding trial with Atlantic salmon, a highly purified (95%) soya saponin preparation was supplemented (0, 2, 4, 6, or 10 g/kg) to two basal diets, one containing fishmeal as the major protein source (FM) and the other 25% lupin meal (LP). Saponins caused dose-dependent increases in the severity of inflammation independent of the basal diet, with concomitant alterations in digestive functions and immunological marker expression. Thus, saponins induced inflammation whether the diet contained other legume components or not. However, responses were often the same or stronger in fish fed the corresponding saponin-supplemented LP diets despite lower saponin exposure, suggesting potentiation by other legume component(s).

  13. Leghemoglobin-derived radicals. Evidence for multiple protein-derived radicals and the initiation of peribacteroid membrane damage

    DEFF Research Database (Denmark)

    Moreau, S; Davies, Michael Jonathan; Mathieu, C

    1996-01-01

    , with the consequent generation of lipid-derived radicals. The formation of such radicals may result in the depletion of membrane antioxidants and the initiation of lipid peroxidation. This transfer of damage from the heme center via the protein surface to neighboring membranes may be of considerable biological......-derived phenoxyl radical present at Tyr-133 in the soybean protein and Tyr-138 in the lupin protein. To obtain further information on these protein radicals and their potential interaction with the physiologically important peribacteroid membrane (which surrounds the microsymbiont in vivo), EPR spin trapping......); these radicals may be side chain- or alpha-carbon-derived, their exact sites have not been determined. Some of these radicals are on the protein surface and may be key intermediates in the formation of protein dimers. These radicals have been shown to be capable of reacting with peribacteroid membrane fractions...

  14. The effect of fermentable carbohydrates on experimental swine dysentery and whip worm infections in pigs

    DEFF Research Database (Denmark)

    Thomsen, Lisbeth E.; Knudsen, Knud Erik Bach; Jensen, Tim Kåre

    2007-01-01

    ingredients were composed. Both diets were based on triticale and barley and supplemented with either rape seed cake (Diet 1) or dried chicory root and sweet lupins (Diet 2). The study had a three-factorial design, with eight groups of pigs receiving Diet I or Diet 2, +/- B. hyodysenteriae, and +/- T suis......An experiment was conducted to study the effect of diets with contrasting fermentability in the large intestine on experimental infections with Brachyspira hyodysenteriae, the causative agent of swine dysentery, and the whip worm, Trichuris suis, in pigs. Two diets with organically grown....... Pigs fed Diet 2 and challenged with B. hyodysenteriae did not develop swine dysentery and B. hyodysenteriae was not demonstrated in any of the pigs during the study. In contrast, 94% of the B. hyodysenteriae challenged pigs fed Diet I showed clinical symptoms of swine dysentery and all the pigs were...

  15. Potential Uses of Wild Germplasms of Grain Legumes for Crop Improvement

    Science.gov (United States)

    Muñoz, Nacira; Liu, Ailin; Kan, Leo; Li, Man-Wah; Lam, Hon-Ming

    2017-01-01

    Challenged by population increase, climatic change, and soil deterioration, crop improvement is always a priority in securing food supplies. Although the production of grain legumes is in general lower than that of cereals, the nutritional value of grain legumes make them important components of food security. Nevertheless, limited by severe genetic bottlenecks during domestication and human selection, grain legumes, like other crops, have suffered from a loss of genetic diversity which is essential for providing genetic materials for crop improvement programs. Illustrated by whole-genome-sequencing, wild relatives of crops adapted to various environments were shown to maintain high genetic diversity. In this review, we focused on nine important grain legumes (soybean, peanut, pea, chickpea, common bean, lentil, cowpea, lupin, and pigeonpea) to discuss the potential uses of their wild relatives as genetic resources for crop breeding and improvement, and summarized the various genetic/genomic approaches adopted for these purposes. PMID:28165413

  16. Instrument intercomparison in the high-energy mixed field at the CERN-EU reference field (CERF) facility

    CERN Document Server

    Caresana, Marco; Manessi, Giacomo; Ott, Klaus; Scherpelz, Robert; Silari, Marco

    2014-01-01

    This paper discusses an intercomparison campaign performed in the mixed radiation field at the CERN-EU (CERF) reference field facility. Various instruments were employed: conventional and extended-range rem counters including a novel instrument called LUPIN, a bubble detector using an active counting system (ABC 1260) and two tissue-equivalent proportional counters (TEPCs). The results show that the extended range instruments agree well within their uncertainties and within 1σ with the H*(10) FLUKA value. The conventional rem counters are in good agreement within their uncertainties and underestimate H*(10) as measured by the extended range instruments and as predicted by FLUKA. The TEPCs slightly overestimate the FLUKA value but they are anyhow consistent with it when taking the comparatively large total uncertainties into account, and indicate that the non-neutron part of the stray field accounts for ∼30 % of the total H*(10).

  17. Piperidine alkaloids: human and food animal teratogens.

    Science.gov (United States)

    Green, Benedict T; Lee, Stephen T; Panter, Kip E; Brown, David R

    2012-06-01

    Piperidine alkaloids are acutely toxic to adult livestock species and produce musculoskeletal deformities in neonatal animals. These teratogenic effects include multiple congenital contracture (MCC) deformities and cleft palate in cattle, pigs, sheep, and goats. Poisonous plants containing teratogenic piperidine alkaloids include poison hemlock (Conium maculatum), lupine (Lupinus spp.), and tobacco (Nicotiana tabacum) [including wild tree tobacco (Nicotiana glauca)]. There is abundant epidemiological evidence in humans that link maternal tobacco use with a high incidence of oral clefting in newborns; this association may be partly attributable to the presence of piperidine alkaloids in tobacco products. In this review, we summarize the evidence for piperidine alkaloids that act as teratogens in livestock, piperidine alkaloid structure-activity relationships and their potential implications for human health. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Nanostructured liquid crystalline particles as an alternative delivery vehicle for plant agrochemicals.

    Science.gov (United States)

    Nadiminti, Pavani P; Dong, Yao D; Sayer, Chad; Hay, Phillip; Rookes, James E; Boyd, Ben J; Cahill, David M

    2013-03-13

    Agrochemical spray formulations applied to plants are often mixed with surfactants that facilitate delivery of the active ingredient. However, surfactants cause phytotoxicity and off-target effects in the environment. We propose the use of nanostructured liquid crystalline particles (NLCP) as an alternative to surfactant-based agrochemical delivery. For this, we have compared the application of commercial surfactants, di (2-ethylhexyl) sulfosuccinate and alkyl dimethyl betaine, with NLCP made from phytantriol, at concentrations of 0.1%, 1% and 5% on the adaxial surface of leaves of four plant species Ttriticum aestivum (wheat), Zea mays (maize), Lupinus angustifolius (lupin), and Arabidopsis thaliana. In comparison with the application of surfactants there was less phytotoxicity on leaves of each species following treatment with NLCP. Following treatment of leaves with NLCP analysis of cuticular wax micromorphology revealed less wax solubilization in the monocot species. The results clearly show that there are advantages in the use of NLCP rather than surfactants for agrochemical delivery.

  19. Stimulation treatments of large-seed leguminous plants Pt. 1

    International Nuclear Information System (INIS)

    Nagy, Istvan; Borbely, Ferenc; Nagy, Janos; Dezsi, Zoltan

    1983-01-01

    The effect of low dose X-ray irradiation on the sprouting and initial growth of some leguminous plants was studied. After having the seeds of peas, beans, lupines and horse beans irradiated, the sprouting rate, the amount of sprouting plants, the length of the roots, the sprouts and the sprouting plants, the electrolyte conductivity and the water uptake were determined. The height and the amount of the plants were measured after a period of 6 weeks. According to the sprout-length values, an increased variation in the plant features can be observed as a result of irradiation treatment: both stimulation and inhibition of plant growth occured, depending on the variety of the leguminosae. The indices of sprouting and initial growth agree well with each other. (V.N.)

  20. Development of advanced radiation monitors for pulsed neutron fields

    CERN Document Server

    AUTHOR|(CDS)2081895

    The need of radiation detectors capable of efficiently measuring in pulsed neutron fields is attracting widespread interest since the 60s. The efforts of the scientific community substantially increased in the last decade due to the increasing number of applications in which this radiation field is encountered. This is a major issue especially at particle accelerator facilities, where pulsed neutron fields are present because of beam losses at targets, collimators and beam dumps, and where the correct assessment of the intensity of the neutron fields is fundamental for radiation protection monitoring. LUPIN is a neutron detector that combines an innovative acquisition electronics based on logarithmic amplification of the collected current signal and a special technique used to derive the total number of detected neutron interactions, which has been specifically conceived to work in pulsed neutron fields. Due to its special working principle, it is capable of overcoming the typical saturation issues encountere...

  1. Potential Uses of Wild Germplasms of Grain Legumes for Crop Improvement

    Directory of Open Access Journals (Sweden)

    Nacira Muñoz

    2017-02-01

    Full Text Available Challenged by population increase, climatic change, and soil deterioration, crop improvement is always a priority in securing food supplies. Although the production of grain legumes is in general lower than that of cereals, the nutritional value of grain legumes make them important components of food security. Nevertheless, limited by severe genetic bottlenecks during domestication and human selection, grain legumes, like other crops, have suffered from a loss of genetic diversity which is essential for providing genetic materials for crop improvement programs. Illustrated by whole-genome-sequencing, wild relatives of crops adapted to various environments were shown to maintain high genetic diversity. In this review, we focused on nine important grain legumes (soybean, peanut, pea, chickpea, common bean, lentil, cowpea, lupin, and pigeonpea to discuss the potential uses of their wild relatives as genetic resources for crop breeding and improvement, and summarized the various genetic/genomic approaches adopted for these purposes.

  2. Methane and organic fertilizers from wood waste and manure fermentations

    Energy Technology Data Exchange (ETDEWEB)

    Romashkevich, I F; Karelina, G N

    1961-01-01

    Fermentation of sawdust of foliate trees by mesophyllic microflora is feasible, producing CH/sub 4/; the yield of gas is 500 cu m/ton, which surpasses that from manure and other agricultural wastes. Preliminary acid hydrolysis is unnecessary. At 5% organic matter, sawdust fermentation proceeds normally and with good yield, but 10% initial concentration of organic matter results in poor performance. Fermentation of common manure, that of sawdust and manure, or that of sawdust alone yields essentially the same gases. Fir sawdust does not ferment, but it does not stop manure or ash sawdust from fermenting if mixed with these. Fermented sawdust behaves like a fertilizer; it is beneficial to plants and crops. Nonfermented sawdust does not. Lupine N content is increased by both fermented and nonfermented sawdusts.

  3. Biological nitrogen fixation in relation to energy forest production. Progress report, 1978-1980

    Energy Technology Data Exchange (ETDEWEB)

    Clarholm, M; Granhall, U

    1981-01-01

    Different pasture legumes, Alnus incana and Myrica gale have been tested in pot experiments and field trials with respect to their use as biological N-fertilizers in relation to energy forest production. So far experiments have been mainly concerned with their establishemnts as on intercrop with Galix at a mire site with ombrotrophic peat and in two clayish arable soils. Laboratory experiments have been made to determine optimal conditions for growth and nitrogen fixation of wild and Alaska lupines in relation to varous soil amendments in the form of lime, ash, NPKMo, and Fe. A pilot experiment of the terrelations between willows and grey alder growing together in peat has been started at Uppsala.

  4. Risk assessment of clinical reactions to legumes in peanut-allergic children

    DEFF Research Database (Denmark)

    Jensen, Louise Bjerremann; Andersen, Milene; Skov, Per Stahl

    2008-01-01

    Peanut-allergic children might be at risk for reactions to other legumes. However, it is not always possible to perform multiple oral food challenges in children. On the basis of patient case history, in vitro diagnostic tests, and eventually food challenges, we aimed at developing an algorithm...... for risk assessment of possible clinical reactions to other legumes (soybean, lupine, fresh, and blanched green pea). Seventy-five consecutive patients with a positive oral food challenge to peanut were included in the study. All tests were run as part of the routine allergy examination. A high proportion...... of patients and/or caretakers refused the administered legume oral food challenges. Obtained diagnoses from histamine release did not correlate significantly to the outcome of the algorithm. Interestingly, threshold from peanut challenges did not correlate with the risk assessment.The algorithm presented...

  5. Simultaneous multi-element analysis of some edible pulses using neutron activation analysis

    International Nuclear Information System (INIS)

    El-Sweify, F.H.; Metwally, E.; Abdel-Khalik, H.

    2007-01-01

    This paper comprises the application of instrumental neutron activation analysis (INAA) for multi-element determination in some edible pulse samples. These edible pulses are usually daily used in the Egyptian kitchen. These were: anise, cumin, coriander, caraway, black cumin, white kidney bean, lupine, lentil, chickpea, broad bean, peanut, almond, and fenugreek. The pulses have been analyzed as dehulled pulses, in the case of legume and oil pulses with simultaneous analysis of their respective skins. The determined elements were: Ce, Co, Cr, Cs, Eu, Fe, Hf, Rb, Sb, Sc, Sr, Th and Zn. The element content in the dehulled pulses and their respective skins has been compared. Some elements were major or minor elements where others were trace elements. Standard reference materials were used to assure quality control, accuracy and precision of the technique. (author)

  6. Pertes alimentaires dans la filière protéagineuse

    OpenAIRE

    Duc, Gérard; Anton, Marc; Baranger, Alain; Biarnes, Véronique; Buitink, Julia; Carrouée, B.; Georget, Martine; Jeuffroy, Marie-Helene; Lessire, Michel; Magrini, Marie-Benoît; Pinochet, Xavier; Walrand, Stéphane

    2015-01-01

    La filière française des protéagineux (espèces pois, féverole et lupins), développée dans les années 1980 à 1990, avait pour premier objectif de répondre aux besoins de l’alimentation animale. A partir des années 2000, un marché significatif vers l’alimentation humaine s’est aussi développé. Sur la base d’une estimation à 370 000 t de protéagineux actuellement destinées à l’alimentation humaine (export + marché intérieur), les pertes sont surtout situées à la récolte et représenteraient 22 00...

  7. Using stable isotope analysis to determine the contribution of naturally occurring pond biota and supplementary feed to the diet of farmed Australian freshwater crayfish, redclaw (Cherax quadricarinatus

    Directory of Open Access Journals (Sweden)

    Melissa K. Joyce

    2015-12-01

    Full Text Available Abstract Nutritional requirements of redclaw (Cherax quadricarinatus farmed in Australia are poorly understood and little is known on what is actively being consumed in semi-intensive pond culture. In this study the isotopic signatures of δ13C and δ15N of potential food sources were analysed with a multi-source mixing model to determine the extent of their contribution to the diet of farmed redclaw. Four commercial redclaw farms in North Queensland, Australia (Mareeba, Biboorha, Wondecla and Topaz were sampled for naturally occurring pond organisms and commonly used supplemental feed such as raw corn, soybean, lupin, commercial redclaw, and chicken feed. Both naturally occurring pond biota and supplemental feed contribute to the tissue composition of redclaw to some degree. However, the contribution varies with the type of feed and availability of natural sources, for example plant material at Topaz Farm was a greater contributor with 43.9 ± 19.5 % compared to supplementary sources raw corn 8.20 ± 3.10 and lupin 1.60 ± 1.70 %. Moreover, some supplemental feeds provided a direct nutrient source for primary pond productivity; contribution of the redclaw pellet to zoo- and phytoplankton at Wondecla Farm was 83.1 ± 6.50 and 50.0 ± 9.50 %, respectively, with similarly high values for chicken feed at Biboorha Farm of 72.6 ± 4.70 and 83.4 ± 6.90 %. The cost effectiveness of such feeds needs to be questioned if these are not being consumed and utilised directly. Providing a species-specific formulated feed with improved water stability would enhance production reliability and facilitate growth within the industry.

  8. Conservation of Endangered Lupinus mariae-josephae in Its Natural Habitat by Inoculation with Selected, Native Bradyrhizobium Strains

    Science.gov (United States)

    Navarro, Albert; Fos, Simón; Laguna, Emilio; Durán, David; Rey, Luis; Rubio-Sanz, Laura; Imperial, Juan; Ruiz-Argüeso, Tomás

    2014-01-01

    Lupinus mariae-josephae is a recently discovered endemism that is only found in alkaline-limed soils, a unique habitat for lupines, from a small area in Valencia region (Spain). In these soils, L. mariae-josephae grows in just a few defined patches, and previous conservation efforts directed towards controlled plant reproduction have been unsuccessful. We have previously shown that L. mariae-josephae plants establish a specific root nodule symbiosis with bradyrhizobia present in those soils, and we reasoned that the paucity of these bacteria in soils might contribute to the lack of success in reproducing plants for conservation purposes. Greenhouse experiments using L. mariae-josephae trap-plants showed the absence or near absence of L. mariae-josephae-nodulating bacteria in “terra rossa” soils of Valencia outside of L. mariae-josephae plant patches, and in other “terra rossa” or alkaline red soils of the Iberian Peninsula and Balearic Islands outside of the Valencia L. mariae-josephae endemism region. Among the bradyrhizobia able to establish an efficient symbiosis with L. mariae-josephae plants, two strains, LmjC and LmjM3 were selected as inoculum for seed coating. Two planting experiments were carried out in consecutive years under natural conditions in areas with edapho-climatic characteristics identical to those sustaining natural L. mariae-josephae populations, and successful reproduction of the plant was achieved. Interestingly, the successful reproductive cycle was absolutely dependent on seedling inoculation with effective bradyrhizobia, and optimal performance was observed in plants inoculated with LmjC, a strain that had previously shown the most efficient behavior under controlled conditions. Our results define conditions for L. mariae-josephae conservation and for extension to alkaline-limed soil habitats, where no other known lupine can thrive. PMID:25019379

  9. Selective splitting of 3'-adenylated dinucleoside polyphosphates by specific enzymes degrading dinucleoside polyphosphates.

    Science.gov (United States)

    Guranowski, Andrzej; Sillero, Antonio; Günther Sillero, María Antonia

    2003-01-01

    Several 3'-[(32)P]adenylated dinucleoside polyphosphates (Np(n)N'p*As) were synthesized by the use of poly(A) polymerase (Sillero MAG et al., 2001, Eur J Biochem.; 268: 3605-11) and three of them, ApppA[(32)P]A or ApppAp*A, AppppAp*A and GppppGp*A, were tested as potential substrates of different dinucleoside polyphosphate degrading enzymes. Human (asymmetrical) dinucleoside tetraphosphatase (EC 3.6.1.17) acted almost randomly on both AppppAp*A, yielding approximately equal amounts of pppA + pAp*A and pA + pppAp*A, and GppppGp*, yielding pppG + pGp*A and pG + pppGp*A. Narrow-leafed lupin (Lupinus angustifolius) tetraphosphatase acted preferentially on the dinucleotide unmodified end of both AppppAp*A (yielding 90% of pppA + pAp*A and 10 % of pA + pppAp*A) and GppppGp*A (yielding 89% pppG + pGp*A and 11% of pG + pppGp*A). (Symmetrical) dinucleoside tetraphosphatase (EC 3.6.1.41) from Escherichia coli hydrolyzed AppppAp*A and GppppGp*A producing equal amounts of ppA + ppAp*A and ppG + ppGp*A, respectively, and, to a lesser extent, ApppAp*A producing pA + ppAp*A. Two dinucleoside triphosphatases (EC 3.6.1.29) (the human Fhit protein and the enzyme from yellow lupin (Lupinus luteus)) and dinucleoside tetraphosphate phosphorylase (EC 2.7.7.53) from Saccharomyces cerevisiae did not degrade the three 3'-adenylated dinucleoside polyphosphates tested.

  10. Population structure and linkage disequilibrium in Lupinus albus L. germplasm and its implication for association mapping.

    Science.gov (United States)

    Iqbal, Muhammad Javed; Mamidi, Sujan; Ahsan, Rubina; Kianian, Shahryar F; Coyne, Clarice J; Hamama, Anwar A; Narina, Satya S; Bhardwaj, Harbans L

    2012-08-01

    White lupin (Lupinus albus L.) has been around since 300 B.C. and is recognized for its ability to grow on poor soils and application as green manure in addition to seed harvest. The seed has very high levels of protein (33-47 %) and oil (6-13 %). It also has many secondary metabolites that are potentially of nutraceutical value to animals and humans. Despite such a great potential, lupins role in modern agriculture began only in the twentieth century. Although a large collection of Lupinus germplasm accessions is available worldwide, rarely have they been genetically characterized. Additionally, scarce genomic resources in terms of recombinant populations and genome information have been generated for L. albus. With the advancement in association mapping methods, the natural populations have the potential to replace the recombinant populations in gene mapping and marker-trait associations. Therefore, we studied the genetic similarity, population structure and marker-trait association in a USDA germplasm collection for their current and future application in this crop improvement. A total of 122 PI (Plant Inventory) lines were screened with 18 AFLP primer pairs that generated 2,277 fragments. A subset of 892 polymorphic markers with MAF >0.05 (minor allele frequency) were used for association mapping. The cluster analysis failed to group accessions on the basis of their passport information, and a weak structure and low linkage disequilibrium (LD) were observed indicating the usefulness of the collection for association mapping. Moreover, we were also able to identify two markers (a p value of 1.53 × 10(-4) and 2.3 × 10(-4)) that explained 22.69 and 20.5 % of seed weight variation determined using R (LR) (2) . The implications of lack of geographic clustering, population structure, low LD and the ability of AFLP to map seed weight trait using association mapping and the usefulness of the PI collections in breeding programs are discussed.

  11. DNA aptamers against the Lup an 1 food allergen.

    Directory of Open Access Journals (Sweden)

    Pedro Nadal

    Full Text Available Using in vitro selection, high affinity DNA aptamers to the food allergen Lup an 1, ß-conglutin, were selected from a pool of DNA, 93 bases in length, containing a randomised sequence of 49 bases. ß-conglutin was purified from lupin flour and chemically crosslinked to carboxylated magnetic beads. Peptide mass fingerprinting was used to confirm the presence of the ß-conglutin. Single stranded DNA was generated from the randomised pool using T7 Gene 6 Exonuclease and was subsequently incubated with the magnetic beads and the captured DNA was released and amplified prior to a further round of Systematic Evolution of Ligands by Exponential Enrichment (SELEX. Evolution was monitored using enzyme linked oligonucleotide assay and surface plasmon resonance. Once a plateau in evolution was reached, the isolated DNA sequences were cloned and sequenced. The consensus motif was identified via alignment of the sequences and the affinities of these sequences for immobilised ß-conglutin were determined using surface plasmon resonance. The selected aptamer was demonstrated to be highly specific, showing no cross-reactivity with other flour ingredients or with other conglutin fractions of lupin. The secondary structures of the selected aptamers were predicted using m-fold. Finally, the functionality of the selected aptamers was demonstrated using a competitive assay for the quantitative detection of ß-conglutin. . Future work will focus on structure elucidation and truncation of the selected sequences to generate a smaller aptamer for application to the analysis of the Lup an 1 allergen in foodstuffs.

  12. Yield and yield structure of spring barley (Hodeum vulgare L. grown in monoculture after different stubble crops

    Directory of Open Access Journals (Sweden)

    Dorota Gawęda

    2012-12-01

    Full Text Available A field experiment was conducted in the period 2006- 2008 in the Uhrusk Experimental Farm belonging to the University of Life Sciences in Lublin. The experimental factor was the type of stubble crop ploughed in each year after harvest of spring barley: white mustard, lacy phacelia, winter rape, and a mixture of narrow-leaf lupin with field pea. In the experiment, successive spring barley crops were grown one after the other (in continuous monoculture. The aim of the experiment was to evaluate the effect of stubble crops used on the size and structure of barley yield. The three-year study showed an increasing trend in grain yield of spring barley grown after the mixture of legumes, lacy phacelia, and white mustard compared to its size in the treatment with no cover crop. Straw yield was significantly higher when barley was grown after the mixture of narrowleaf lupin with field pea than in the other treatments of the experiment. The type of ploughed-in stubble crop did not modify significantly plant height, ear length, and grain weight per ear. Growing the mixture of leguminous plants as a cover crop resulted in a significant increase in the density of ears per unit area in barley by an average of 14.7% relative to the treatment with winter rape. The experiment also showed the beneficial effect of the winter rape cover crop on 1000-grain weight of spring barley compared to that obtained in the treatments with white mustard and the mixture of legumes. All the cover crops caused an increase in the number of grains per ear of barley relative to that found in the control treatment. However, this increase was statistically proven only for the barley crops grown after lacy phacelia and the mixture of legumes.

  13. Economy of Photosynthate Use in Nitrogen-fixing Legume Nodules: Observations on Two Contrasting Symbioses.

    Science.gov (United States)

    Layzell, D B; Rainbird, R M; Atkins, C A; Pate, J S

    1979-11-01

    The economy of C use by root nodules was examined in two symbioses, Vigna unguiculata (L.) Walp. (cv. Caloona):Rhizobium CB756 and Lupinus albus L. (cv. Ultra):Rhizobium WU425 over a 2-week period in early vegetative growth. Plants were grown in minus N water culture with cuvettes attached to the nodulated zone of their primary roots for collection of evolved CO(2) and H(2). Increments in total plant N and in C and N of nodules, and C:N weight ratios of xylem and phloem exudates were studied by periodic sampling from the plant populations. Itemized budgets were constructed for the partitioning and utilization of C in the two species. For each milligram N fixed and assimilated by the cowpea association, 1.54 +/- 0.26 (standard error) milligrams C as CO(2) and negligible H(2) were evolved and 3.11 milligrams of translocated C utilized by the nodules. Comparable values for nodules of the lupin association were 3.64 +/- 0.28 milligrams C as CO(2), 0.22 +/- 0.05 milligrams H(2), and 6.58 milligrams C. More efficient use of C by cowpea nodules was due to a lesser requirement of C for synthesis of exported N compounds, a smaller allocation of C to nodule dry matter, and a lower evolution of CO(2). The activity of phosphoenolpyruvate carboxylase in nodule extracts and the rate of (14)CO(2) fixation by detached nodules were greater for the cowpea symbiosis (0.56 +/- 0.06 and 0.22 milligrams C as CO(2) fixed per gram fresh weight per hour, respectively) than for the lupin 0.06 +/- 0.02 and 0.01 milligrams C as CO(2) fixed per gram fresh weight per hour. The significance of the data was discussed in relation to current information on theoretical costs of nitrogenase functioning and associated nodule processes.

  14. Metabolism of poly-β-hydroxybutyric acid in bacteroids of Rhizobium lupini in connection with nitrogen fixation and photosynthesis

    International Nuclear Information System (INIS)

    Romanov, V.I.; Fedulova, N.G.; Tchermenskaya, I.E.; Shramko, V.I.; Molchanov, M.I.; Kretovich, W.L.

    1980-01-01

    The darkening of lupin plants grown in a sand culture on a nitrogen-free medium at a stage of initial flowering led to a sharply decreased nitrogen fixation intensity which eventually ceased. Decreased intensity of nitrogen fixation in bacteroids was accompanied by an accumulation of poly-β-hydroxybutyric acid (PHB): in the course of 10-20 h (depending upon temperature) its content increased by 2.5-3.0 times. If, following darkening, the plants were once again exposed to light, an abrupt increase of nitrogen fixation intensity was observed and a simultaneous decrease of PHB content. It has been shown that lupin's exposure to light in 14 CO 2 atmosphere lasting 19 h resulted in the latter's incorporation into PHB, bacteroids and into the entire nodule; these processes developed almost in parallel. During the early period of vegetation growth prior to flowering, the PHB content of bacteroids decreased from 13 14 to 3.4% of dry weight, whereas the intensity of nitrogen fixation was raised. Concurrently increase of the activity of some enzymes connected with the PHB metabolism (aceto-acetyl-CoA-reductase, acetyl-CoA acetyl transferase PHB-depolymerase, (CoA-transferase, of 3-ketoacids) occured. The plants' subsequent ageing and reduction of nitrogen fixation intensity led to a noticeable increase of PHB content and a decrease of the above mentioned enzymes' activity. The specific activity of β-hydroxybutyric dehydrogenase involved with PHB catabolism was high and was maintained at a constant level throughout the entire vegetative period. (orig.)

  15. Investigations of immunogenic, allergenic and adjuvant properties of Cry1Ab protein after intragastric exposure in a food allergy model in mice.

    Science.gov (United States)

    Andreassen, Monica; Bøhn, Thomas; Wikmark, Odd-Gunnar; Bodin, Johanna; Traavik, Terje; Løvik, Martinus; Nygaard, Unni Cecilie

    2016-05-04

    In genetically modified (GM) crops there is a risk that the inserted genes may introduce new allergens and/or adjuvants into the food and feed chain. The MON810 maize, expressing the insecticidal Cry1Ab toxin, is grown in many countries worldwide. In animal models, intranasal and intraperitoneal immunisations with the purified Cry1Ab proteins have induced immune responses, and feeding trials with Cry1Ab-containing feed have revealed some altered immune responses. Previous investigations have primarily measured antibody responses to the protein, while investigations of clinical food allergy symptoms, or allergy promotion (adjuvant effect) associated with the Cry1Ab protein are largely missing. We aimed to investigate immunogenic, allergenic and adjuvant properties of purified Cry1Ab toxin (trypCry1Ab, i.e., trypsin activated Cry1Ab) in a mouse model of food allergy. Female C3H/HeJ mice were immunized by intragastric gavage of 10 μg purified, trypsin activated Cry1Ab toxin (trypCry1Ab) alone or together with the food allergen lupin. Cholera toxin was added as a positive control for adjuvant effect to break oral tolerance. Clinical symptoms (anaphylaxis) as well as humoral and cellular responses were assessed. In contrast to results from previous airway investigations, we observed no indication of immunogenic properties of trypCry1Ab protein after repeated intragastric exposures to one dose, with or without CT as adjuvant. Moreover, the results indicated that trypCry1Ab given by the intragastric route was not able to promote allergic responses or anaphylactic reactions against the co-administered allergen lupin at the given dose. The study suggests no immunogenic, allergenic or adjuvant capacity of the given dose of trypCry1Ab protein after intragastric exposure of prime aged mice.

  16. Role of Translocted Signals in Regulating Root Development and Nutrient Uptake in Legumes

    Energy Technology Data Exchange (ETDEWEB)

    Atkins, C. A. [School of Plant Biology, University of Western Australia, Crawley, WA (Australia)

    2013-11-15

    Uptake of nutrients is achieved through the expression and activity of specific carrier/transporter mechanisms localized in the root system and distributed as a consequence of the development of the architecture of the system. Both root system development and the nutrient transport mechanisms are responsive to environmental factors that include nutrient supply and availability, water supply, salinity, soil acidity and compaction together with a wide range of biotic stresses. The response to each may be regulated at the molecular level by both local and systemic signals. These signals include the classical plant growth regulators but also low molecular weight compounds such as sugars and amino acids as well as macromolecules, including peptides, proteins and nucleic acids. Among the latter, recent research has shown that small RNA species and especially small interfering RNAs (siRNA) and microRNAs (miRNA) are potent and effective regulators of gene expression which, in the context of root development as well as nutrient uptake, have central and critical roles. Systemic (translocated) signals that specifically regulate root development and function are less well defined but analyses of phloem exudate in species of lupin (Lupinus albus and L. angustifolius) and species of Brassica and cucurbits have demonstrated that a wide range of macromolecules, including miRNAs, are present and potentially translocated from source organs (principally leaves) to sinks (shoot apical meristems, developing fruits and seeds, roots and nodules). While specific signaling roles for many of these macromolecules are yet to be discovered there are some that have been documented and their regulatory activity in organ development and functioning, as well as in nutrition, confirmed. The following article provides an up to date review and presents the results of recent research using lupin with emphasis on the analysis of small RNAs and their likely role(s) in regulation of root development and

  17. Comparison of the method of diffusive gels in thin films with conventional extraction techniques for evaluating zinc accumulation in plants and isopods

    International Nuclear Information System (INIS)

    Koster, Marijke; Reijnders, Lucas; Oost, Nathalie R. van; Peijnenburg, Willie J.G.M.

    2005-01-01

    The measurement of diffusive gels in thin films (DGT) has recently been developed to assess metal bioavailability in soils. The DGT-method is based on diffusion in a porous matrix. To test the predictive capabilities of the method with regard to metal bioavailability, a study was set up with 28 soils having a variety of textures and amounts of zinc salts added. Correlation and regression analyses were performed to compare DGT-extracted zinc levels to zinc concentrations obtained by extraction with 0.01 M CaCl 2 and 0.43 M HNO 3 , digestion with aqua regia and the zinc concentration in pore water. The amount of zinc extracted with CaCl 2 correlated well with DGT-extracted zinc levels in all soils spiked with different amounts of ZnCl 2 . A similar correlation was not found for zinc concentrations in soil samples collected in the field. Experiments were performed to compare zinc content in organisms and in soils. The organisms tested were plants (grass, lettuce and lupine) and the hard bodied soil dwelling isopod Oniscus asellus. Good correlations were found between zinc accumulation in grass and lettuce and the C E (effective concentration) measured by a DGT-device, CaCl 2 extracted zinc and the zinc content in the pore water of all soils. The correlation with C E was not significant for lupine, neither for spiked soils, nor for field soils (p ≤ 0.001). Zinc levels in the isopods were not significantly related to any set of zinc measurements. From a synthesis of all results obtained it is concluded that the DGT-methodology does not have an additional value in predicting bioavailability of zinc in terrestrial ecosystems as compared to conventional extraction methods. - Capsule: The newly developed method of diffusive gels in Thin films (DGT) does not have an added value over conventional extraction techniques in predicting zinc uptake by plants and isopods

  18. How to objectively assess jugular primary venous obstruction

    Directory of Open Access Journals (Sweden)

    Paolo Zamboni

    2014-12-01

    Full Text Available Last January The Lancet published the article by Traboulsee et al. Prevalence of extracranial venous narrowing on catheter venography in people with multiple sclerosis, their sibilings, and unrelated healthy controls: a blinded, case control study. These Authors confirmed the presence of chronic cerebrospinal venous insufficiency with a high prevalence of about 70% in the Canadian population, but without significant differences between patients and healthy controls, yet. However, they used a criterion never published to assess stenosis, in alternative to the classic measurement of the diameter in the segment immediately preceding the narrowest point. Traboulsee et al. measure the stenosis along the entire length of the internal jugular vein, by comparing the maximum diameter with the narrowest point. It has been demonstrated, from normal anatomy findings, how the jugular bulb diameter normally exceeds 50% of the minimum diameter of the internal jugular vein, clearly showing the reason why Traboulsee et al. did not find significant differences between people with multiple sclerosis, their sibilings, and unrelated healthy controls. Furthermore, as the outcome measure of Traboulsee et al., wall stenosis is a neglected part of primary venous obstruction, because in the majority of cases obstruction is the consequence of intraluminal obstacles, as a considerable part of truncular venous malformations, and/or compression; rarely of external hypoplasia. Finally, several recently published methods can be adopted for objective assessment of restricted jugular flow in course of chronic cerebrospinal venous insufficiency, by the means of non invasive magnetic resonance imaging, ultrasound and plethysmography. This may help us in improving the assessment of cerebral venous return in the near future.

  19. Couinaud's classification v.s. Cho's classification. Their feasibility in the right hepatic lobe

    International Nuclear Information System (INIS)

    Shioyama, Yasukazu; Ikeda, Hiroaki; Sato, Motohito; Yoshimi, Fuyo; Kishi, Kazushi; Sato, Morio; Kimura, Masashi

    2008-01-01

    The objective of this study was to investigate if the new classification system proposed by Cho is feasible to clinical usage comparing with the classical Couinaud's one. One hundred consecutive cases of abdominal CT were studied using a 64 or an 8 slice multislice CT and created three dimensional portal vein images for analysis by the Workstation. We applied both Cho's classification and the classical Couinaud's one for each cases according to their definitions. Three diagnostic radiologists assessed their feasibility as category one (unable to classify) to five (clear to classify with total suit with the original classification criteria). And in each cases, we tried to judge whether Cho's or the classical Couinaud' classification could more easily transmit anatomical information. Analyzers could classified portal veins clearly (category 5) in 77 to 80% of cases and clearly (category 5) or almost clearly (category 4) in 86-93% along with both classifications. In the feasibility of classification, there was no statistically significant difference between two classifications. In 15 cases we felt that using Couinaud's classification is more convenient for us to transmit anatomical information to physicians than using Cho's one, because in these cases we noticed two large portal veins ramify from right main portal vein cranialy and caudaly and then we could not classify P5 as a branch of antero-ventral segment (AVS). Conversely in 17 cases we felt Cho's classification is more convenient because we could not divide right posterior branch as P6 and P7 and in these cases the right posterior portal vein ramified to several small branches. The anterior fissure vein was clearly noticed in only 60 cases. Comparing the classical Couinaud's classification and Cho's one in feasility of classification, there was no statistically significant difference. We propose we routinely report hepatic anatomy with the classical Couinauds classification and in the preoperative cases we

  20. The Arabidopsis synaptotagmin SYTA regulates the cell-to-cell movement of diverse plant viruses

    Directory of Open Access Journals (Sweden)

    Asako eUchiyama

    2014-11-01

    Full Text Available Synaptotagmins are a large gene family in animals that have been extensively characterized due to their role as calcium sensors to regulate synaptic vesicle exocytosis and endocytosis in neurons, and dense core vesicle exocytosis for hormone secretion from neuroendocrine cells. Thought to be exclusive to animals, synaptotagmins have recently been characterized in Arabidopsis thaliana, in which they comprise a five gene family. Using infectivity and leaf-based functional assays, we have shown that Arabidopsis SYTA regulates endocytosis and marks an endosomal vesicle recycling pathway to regulate movement protein-mediated trafficking of the Begomovirus Cabbage leaf curl virus (CaLCuV and the Tobamovirus Tobacco mosaic virus (TMV through plasmodesmata (Lewis and Lazarowitz, 2010. To determine whether SYTA has a central role in regulating the cell-to-cell trafficking of a wider range of diverse plant viruses, we extended our studies here to examine the role of SYTA in the cell-to-cell movement of additional plant viruses that employ different modes of movement, namely the Potyvirus Turnip mosaic virus (TuMV, the Caulimovirus Cauliflower mosaic virus (CaMV and the Tobamovirus Turnip vein clearing virus (TVCV, which in contrast to TMV does efficiently infect Arabidopsis. We found that both TuMV and TVCV systemic infection, and the cell-to-cell trafficking of the their movement proteins, were delayed in the Arabidopsis Col-0 syta-1 knockdown mutant. In contrast, CaMV systemic infection was not inhibited in syta-1. Our studies show that SYTA is a key regulator of plant virus intercellular movement, being necessary for the ability of diverse cell-to-cell movement proteins encoded by Begomoviruses (CaLCuV MP, Tobamoviruses (TVCV and TMV 30K protein and Potyviruses (TuMV P3N-PIPO to alter PD and thereby mediate virus cell-to-cell spread.

  1. Quantitative imaging of water flow in soil and roots using neutron radiography and deuterated water

    Energy Technology Data Exchange (ETDEWEB)

    Zarebanadkouki, Mohsen

    2013-05-08

    Where and how fast do roots take up water? Despite its importance in plant and soil sciences, there is limited experimental information on the location of water uptake along the roots of transpiring plants growing in soil. The answer to this question requires direct and in-situ measurement of the local flow of water into the roots. The aim of this study was to develop and apply a new method to quantify the local fluxes of water into different segments of the roots of intact plants. To this end, neutron radiography was used to trace the transport of deuterated water (D{sub 2}O) into the roots of lupines. Lupines were grown in aluminum containers filled with sandy soil. The soil was partitioned into different compartments using 1 cm-thick layers of coarse sand as capillary barriers. These barriers limited the diffusion of D{sub 2}O within the soil compartments. D{sub 2}O was locally injected into the selected soil compartments during the day (transpiring plants) and night (non-transpiring plants). Transport of D{sub 2}O into roots was then monitored by neutron radiography with spatial resolution of 100 μm and time intervals of 10 seconds. Neutron radiographs showed that: i) transport of D{sub 2}O into roots was faster during the day than during the night; 2) D{sub 2}O quickly moved along the roots towards the shoots during the day, while at night this axial transport was negligible. The differences between day and night measurements were explained by convective transport of D{sub 2}O into the roots. To quantify the net flow of water into roots, a simple convection-diffusion model was developed, where the increase rate of D{sub 2}O concentration in roots depended on the convective transport (net root water uptake) and the diffusion of D{sub 2}O into roots. The results showed that water uptake was not uniform along the roots. Water uptake was higher in the upper soil layers than in the deeper ones. Along an individual roots, the water uptake rate was higher in the

  2. Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

    Directory of Open Access Journals (Sweden)

    Yang Huaan

    2012-07-01

    Full Text Available Abstract Background In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Results Twenty informative plants from a cross of RxS (disease resistant x susceptible in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM, and are now replacing the markers previously developed by a traditional DNA

  3. Quantitative imaging of water flow in soil and roots using neutron radiography and deuterated water

    International Nuclear Information System (INIS)

    Zarebanadkouki, Mohsen

    2013-01-01

    Where and how fast do roots take up water? Despite its importance in plant and soil sciences, there is limited experimental information on the location of water uptake along the roots of transpiring plants growing in soil. The answer to this question requires direct and in-situ measurement of the local flow of water into the roots. The aim of this study was to develop and apply a new method to quantify the local fluxes of water into different segments of the roots of intact plants. To this end, neutron radiography was used to trace the transport of deuterated water (D 2 O) into the roots of lupines. Lupines were grown in aluminum containers filled with sandy soil. The soil was partitioned into different compartments using 1 cm-thick layers of coarse sand as capillary barriers. These barriers limited the diffusion of D 2 O within the soil compartments. D 2 O was locally injected into the selected soil compartments during the day (transpiring plants) and night (non-transpiring plants). Transport of D 2 O into roots was then monitored by neutron radiography with spatial resolution of 100 μm and time intervals of 10 seconds. Neutron radiographs showed that: i) transport of D 2 O into roots was faster during the day than during the night; 2) D 2 O quickly moved along the roots towards the shoots during the day, while at night this axial transport was negligible. The differences between day and night measurements were explained by convective transport of D 2 O into the roots. To quantify the net flow of water into roots, a simple convection-diffusion model was developed, where the increase rate of D 2 O concentration in roots depended on the convective transport (net root water uptake) and the diffusion of D 2 O into roots. The results showed that water uptake was not uniform along the roots. Water uptake was higher in the upper soil layers than in the deeper ones. Along an individual roots, the water uptake rate was higher in the proximal segments than in the distal

  4. Effect of cellulase producing fungi on plant residues degradation used as organic fertilizer

    International Nuclear Information System (INIS)

    Ibrahim, R.M.M

    2009-01-01

    Series of laboratory and field experiments were conducted at Soil microbiology Unit and Farm of soil and Water research department, Nuclear Research Center, Atomic Energy Authority, Egypt. Laboratory experiments revealed that between nine fungal strain, A. niger was the most potent cellulolytic fungus able to degrade many cellulosic sources (CP, CMC, and FP). Study the effect of cellulolytic fungi on degradation of plant residues used as organic fertilizer in addition to nitrogen fixing bacteria (symbiotically) on lupine growth, yield and nutrients uptake (Field experiment) had been carried out. This objective aims to recycling different plant residues in soil which is consistent with (sustainable development) and utilization of these organic residues as a single carbon source for cellulolytic fungi.Application of 15 N- tracer technique gave us the chance and opportunity to quantify the exact amounts of N derived from the different sources of nitrogen available to lupine plant under the effect of cellulolytic fungi on different plant residues.The obtained results could be summarized as following:I.Laboratory Technique Selection of the most potent cellulolytic fungi 1-Nine fungal strains of Aspergillus niger; Penicillium oxalicum; Trichoderma longibranchiatum; Aspergillus terreus; Aspergillus flavus; Alterrnaria sp.; Trichderma harzianum ; Rhizopus sp. and Syncephalastrum sp. obtained from different sources and tested for their cellulolytic activity. 2-Aspergillus niger and Pencillium oxalicum exhibited the highest cellulase productivity followed by Trichoderma longibranchiatum and Aspergillus terreus.3- fungal mixtures of the most potent four genera Aspergillus niger; Penicillium oxalicum; Trichoderma longibranchiatum and Aspergillus terreus found to have a lower cellulolytic activities for all substrates compared with single inoculation with A. niger.4-Highest FPase activities were exhibited by A. niger when filter paper (FP) used as a carbon source.5-A. niger is

  5. Evaluation of fresh and preserved herbaceous field crops for biogas and ethanol production

    Energy Technology Data Exchange (ETDEWEB)

    Pakarinen, A

    2012-07-01

    In the future, various forms of bioenergy will be increasingly required to replace fossil energy. Globally, transportation uses almost one third of fossil energy resources, and it is thus of great importance to find ethically, economically, and environmentally viable biofuels in near future. Fieldgrown biomass, including energy crops and crop residues, are alternatives to supplement other non-food biofuel raw materials. The aim of this work was to evaluate the potential of five crops, maize (Zea mays L.), fiber hemp (Cannabis sativa L.), faba bean (Vicia faba L.), white lupin (Lupinus albus L.), and Jerusalem artichoke (Heliantus tuborosus L.) cultivated in boreal conditions as raw materials for methane and ethanol. Climate, cultivation requirements, chemical composition, and recalcitrance are some of the parameters to be considered when choosing energy crops for cultivation and for efficient conversion into biofuels. Among the studied crops, protein-rich legumes (faba bean and white lupin) were attractive options for methane, while hemp and Jerusalem artichoke had high theoretical potential for ethanol. Maize was, however, equally suitable for production of both energy carriers. Preservation of crop materials is essential to preserve and supply biomass material throughout the year. Preservation can be also considered as a mild pretreatment prior to biofuel production. Ensiling was conducted on maize, hemp, and faba bean in this work and additionally hemp was preserved in alkali conditions. Ensiling was found to be most beneficial for hemp when converted to methane, increasing the methane yield by more than 50%, whereas preservation with urea increased the energy yield of hemp as ethanol by 39%. Maize, with a high content of water-soluble carbohydrates (20% of DM), required an acid additive in order to preserve the sugars. Interestingly, hydrothermal pretreatment for maize and hemp prior to methane production was less efficient than ensiling. Enzymatic hydrolysis

  6. Alleviating soil acidity through plant organic compounds

    Directory of Open Access Journals (Sweden)

    Anderson R. Meda

    2001-06-01

    Full Text Available A laboratory experiment was conducted to evaluate the effects of water soluble plant extracts on soil acidity. The plant materials were: black oat, oil seed radish, white and blue lupin, gray and dwarf mucuna, Crotalaria spectabilis and C. breviflora, millet, pigeon pea, star grass, mato grosso grass, coffee leaves, sugar cane leaves, rice straw, and wheat straw. Plant extracts were added on soil surface in a PVC soil column at a rate of 1.0 ml min-1. Both soil and drainage water were analyzed for pH, Ca, Al, and K. Plant extracts applied on the soil surface increased soil pH, exchangeable Ca ex and Kex and decreased Al ex. Oil seed radish, black oat, and blue lupin were the best and millet the worst materials to alleviate soil acidity. Oil seed radish markedly increased Al in the drainage water. Chemical changes were associated with the concentrations of basic cations in the plant extract: the higher the concentration the greater the effects in alleviating soil acidity.Foram conduzidos experimentos de laboratórios para avaliar os efeitos de extratos de plantas solúveis em água na acidez do solo. Os materiais de plantas foram: aveia preta, nabo, tremoço branco e azul, mucuna cinza e anã, Crotalaria spectabilis e C. breviflora, milheto, guandu, grama estrela, grama mato grosso, folhas de café, folhas de cana-de-açúcar, palhada de arroz e palhada de trigo. Foi utilizado o seguinte procedimento para o extrato da planta solúvel em água: pesar 3g de material de planta, adicionar 150 ml de água, agitar por 8h e filtrar. Os extratos de plantas foram adicionados na superfície do solo em uma coluna de PVC (1 ml min-1. Após, adicionou-se água deionizada em quantidade equivalente a três volumes de poros. Os extratos de plantas aumentaram o pH, Ca e K trocável e diminuíram Al. Nabo, aveia preta e tremoço azul foram os melhores e milheto o pior material para amenizar a acidez do solo. Nabo aumentou Al na água de drenagem. As altera

  7. Comparison of the method of diffusive gels in thin films with conventional extraction techniques for evaluating zinc accumulation in plants and isopods

    Energy Technology Data Exchange (ETDEWEB)

    Koster, Marijke [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Open University Netherlands, Heerlen (Netherlands); Reijnders, Lucas [Open University Netherlands, Heerlen (Netherlands); Oost, Nathalie R. van [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Peijnenburg, Willie J.G.M. [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands)]. E-mail: wjgm.peijnenburg@rivm.nl

    2005-01-01

    The measurement of diffusive gels in thin films (DGT) has recently been developed to assess metal bioavailability in soils. The DGT-method is based on diffusion in a porous matrix. To test the predictive capabilities of the method with regard to metal bioavailability, a study was set up with 28 soils having a variety of textures and amounts of zinc salts added. Correlation and regression analyses were performed to compare DGT-extracted zinc levels to zinc concentrations obtained by extraction with 0.01 M CaCl{sub 2} and 0.43 M HNO{sub 3}, digestion with aqua regia and the zinc concentration in pore water. The amount of zinc extracted with CaCl{sub 2} correlated well with DGT-extracted zinc levels in all soils spiked with different amounts of ZnCl{sub 2}. A similar correlation was not found for zinc concentrations in soil samples collected in the field. Experiments were performed to compare zinc content in organisms and in soils. The organisms tested were plants (grass, lettuce and lupine) and the hard bodied soil dwelling isopod Oniscus asellus. Good correlations were found between zinc accumulation in grass and lettuce and the C{sub E} (effective concentration) measured by a DGT-device, CaCl{sub 2} extracted zinc and the zinc content in the pore water of all soils. The correlation with C{sub E} was not significant for lupine, neither for spiked soils, nor for field soils (p {<=} 0.001). Zinc levels in the isopods were not significantly related to any set of zinc measurements. From a synthesis of all results obtained it is concluded that the DGT-methodology does not have an additional value in predicting bioavailability of zinc in terrestrial ecosystems as compared to conventional extraction methods. - Capsule: The newly developed method of diffusive gels in Thin films (DGT) does not have an added value over conventional extraction techniques in predicting zinc uptake by plants and isopods.

  8. Influencia de la relación proteína de altramuz/tensioactivo en las propiedades de flujo y texturales de emulsiones aceite en agua

    Directory of Open Access Journals (Sweden)

    Franco, J. Mª.

    2001-08-01

    Full Text Available The influence of different surfactant/lupin protein ratio on the shear-flow and texture properties of oil-in-water emulsions was investigated in this work in order to find a synergistic effect between both types of emulsifiers. With this aim, texture, steady-shear flow and droplet size measurements were carried out. Different surfactants (Tween 20 and three sucrose esters showing different phase behaviour in water solution were studied. From the experimental results it can be concluded that emulsions stabilised by mixtures of both, low- and high-molecular-weight emulsifiers, show lower values of steady-state viscosity and textural parameters than those found when lupin protein was the only emulsifier used, in spite of a higher average droplet size. The evolution of emulsion textural and flow parameters with the composition of the mixture used as emulsifier can be explained on the basis of the phase behaviour of the low-molecular-weight emulsifier, modifications on the composition at the interface and hydrophobic interactions between both type of emulsifiers.En el presente trabajo se ha estudiado la influencia que ejerce la proporción proteína de altramuz/emulsionante de bajo peso molecular en el comportamiento viscoso y en las propiedades texturales de emulsiones alimentarias aceite en agua con el fin de investigar un posible efecto sinérgico entre ambos tipos de emulsionantes. Con este propósito, se efectuaron medidas de tamaño de gota, flujo viscoso y propiedades texturales en emulsiones estabilizadas por proteína de altramuz y tensioactivos de diferente HLB (Tween 20 y tres estearatos de sacarosa. De los resultados experimentales, se concluye que las emulsiones estabilizadas por ambos tipos de emulsionantes muestran valores de la viscosidad en estado estacionario y de las propiedades texturales estudiadas inferiores a los encontrados en la emulsión estabilizada únicamente con proteína de altramuz, a pesar de poseer esta última un

  9. Cranes and Crops: Investigating Farmer Tolerances toward Crop Damage by Threatened Blue Cranes ( Anthropoides paradiseus) in the Western Cape, South Africa

    Science.gov (United States)

    van Velden, Julia L.; Smith, Tanya; Ryan, Peter G.

    2016-12-01

    The Western Cape population of Blue Cranes ( Anthropoides paradiseus) in South Africa is of great importance as the largest population throughout its range. However, Blue Cranes are strongly associated with agricultural lands in the Western Cape, and therefore may come into conflict with farmers who perceive them as damaging to crops. We investigated the viability of this population by exploring farmer attitudes toward crane damage in two regions of the Western Cape, the Swartland and Overberg, using semi-structured interviews. Perceptions of cranes differed widely between regions: farmers in the Swartland perceived crane flocks to be particularly damaging to the feed crop sweet lupin (65 % of farmers reported some level of damage by cranes), and 40 % of these farmers perceived cranes as more problematic than other common bird pests. Farmers in the Overberg did not perceive cranes as highly damaging, although there was concern about cranes eating feed at sheep troughs. Farmers who had experienced large flocks on their farms and farmers who ranked cranes as more problematic than other bird pests more often perceived cranes to be damaging to their livelihoods. Biographical variables and crop profiles could not be related to the perception of damage, indicating the complexity of this human-wildlife conflict. Farmers' need for management alternatives was related to the perceived severity of damage. These results highlight the need for location-specific management solutions to crop damage by cranes, and contribute to the management of this vulnerable species.

  10. ASSESSMENT OF THE BIODIVERSITY OF SAMPLES USED FOR ISOLATION OF MICROBIAL STRAINS CAPABLE OF CONVERTING STRAW DESTINED AS A SUBSTRATE FOR BIOGAS PLANT

    Directory of Open Access Journals (Sweden)

    Krystyna Cybulska

    2016-01-01

    Full Text Available In biogas plants, almost any type of organic matter can be used as a substrate to produce biogas. To make the process of methane fermentation more effective, these materials are pretreated. This applies in particular to a group of difficult substrates. Straw, due to its hemicellulose structure and saturation, is hardly fermented by biogas reactor microorganisms. The methods of post-harvest residue preparation for anaerobic digestion being applied so far are expensive, while their application has a negative effect on methanoegenic bacteria. Therefore, the microorganisms being able to degrade straw hemicellulose structure, utilisation of which could precede the proper fermentation process, have been searched for. This paper presents the results of microbial biodiversity analysis in the environmental samples being lupin, cereal, rape and maize straw as well as hay and haylage at different degradation stages. The analysis of biodiversity will help at a further stage of study to isolate active microbial strains showing cellulolytic, hemicellulolytic or ligninolytic activity which are desirable in the process of straw biodegradation. Analysis of the microbial count was performed by the method of deep inoculation on different microbiological culture media. The conducted tests include determination of the number of fungi, bacteria and actinomycetes. The results obtained confirm the usefulness of the analysed samples for isolation of microbial strains capable of converting straw preceding the biogas production.

  11. Purification, crystallization and preliminary crystallographic studies of plant S-adenosyl-l-homocysteine hydrolase (Lupinus luteus)

    International Nuclear Information System (INIS)

    Brzezinski, Krzysztof; Bujacz, Grzegorz; Jaskolski, Mariusz

    2008-01-01

    Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4 3 2 1 2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified. Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4 3 2 1 2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation

  12. Lost crops of the Incas: Origins of domestication of the Andean pulse crop tarwi, Lupinus mutabilis.

    Science.gov (United States)

    Atchison, Guy W; Nevado, Bruno; Eastwood, Ruth J; Contreras-Ortiz, Natalia; Reynel, Carlos; Madriñán, Santiago; Filatov, Dmitry A; Hughes, Colin E

    2016-09-01

    The Andean highlands are a hotspot of domestication, yet our understanding of the origins of early Andean agriculture remains fragmentary. Key questions of where, when, how many times, and from what progenitors many Andean crops were domesticated remain unanswered. The Andean lupine crop tarwi (Lupinus mutabilis) is a regionally important pulse crop with exceptionally high seed protein and oil content and is the focus of modern breeding efforts, but its origins remain obscure. A large genome-wide DNA polymorphism data set was generated using nextRADseq to infer relationships among more than 200 accessions of Andean Lupinus species, including 24 accessions of L. mutabilis and close relatives. Phylogenetic and demographic analyses were used to identify the likely progenitor of tarwi and elucidate the area and timing of domestication in combination with archaeological evidence. We infer that tarwi was domesticated once in northern Peru, most likely in the Cajamarca region within, or adjacent to the extant distribution of L. piurensis, which is the most likely wild progenitor. Demographic analyses suggest that tarwi split from L. piurensis around 2600 BP and suffered a classical domestication bottleneck. The earliest unequivocal archaeological evidence of domesticated tarwi seeds is from the Mantaro Valley, central Peru ca. 1800 BP. A single origin of tarwi from L. piurensis in northern Peru provides a robust working hypothesis for the domestication of this regionally important crop and is one of the first clear-cut examples of a crop originating in the highlands of northern Peru. © 2016 Botanical Society of America.

  13. Instrument intercomparison in the high-energy mixed field at the CERN-EU reference field (CERF) facility.

    Science.gov (United States)

    Caresana, Marco; Helmecke, Manuela; Kubancak, Jan; Manessi, Giacomo Paolo; Ott, Klaus; Scherpelz, Robert; Silari, Marco

    2014-10-01

    This paper discusses an intercomparison campaign performed in the mixed radiation field at the CERN-EU (CERF) reference field facility. Various instruments were employed: conventional and extended-range rem counters including a novel instrument called LUPIN, a bubble detector using an active counting system (ABC 1260) and two tissue-equivalent proportional counters (TEPCs). The results show that the extended range instruments agree well within their uncertainties and within 1σ with the H*(10) FLUKA value. The conventional rem counters are in good agreement within their uncertainties and underestimate H*(10) as measured by the extended range instruments and as predicted by FLUKA. The TEPCs slightly overestimate the FLUKA value but they are anyhow consistent with it when taking the comparatively large total uncertainties into account, and indicate that the non-neutron part of the stray field accounts for ∼30 % of the total H*(10). © The Author 2013. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Real-time PCR assays for the quantitation of rDNA from apricot and other plant species in marzipan.

    Science.gov (United States)

    Haase, Ilka; Brüning, Philipp; Matissek, Reinhard; Fischer, Markus

    2013-04-10

    Marzipan or marzipan raw paste is a typical German sweet which is consumed directly or is used as an ingredient in the bakery industry/confectionery (e.g., in stollen) and as filling for chocolate candies. Almonds (blanched and pealed) and sugar are the only ingredients for marzipan production according to German food guidelines. Especially for the confectionery industry, the use of persipan, which contains apricot or peach kernels instead of almonds, is preferred due to its stronger aroma. In most of the companies, both raw pastes are produced, in most cases on the same production line, running the risk of an unintended cross contamination. Additionally, due to high almond market values, dilutions of marzipan with cheaper seeds may occur. Especially in the case of apricot and almond, the close relationship of both species is a challenge for the analysis. DNA based methods for the qualitative detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea in marzipan have recently been published. In this study, different quantitation strategies on the basis of real-time PCR have been evaluated and a relative quantitation method with a reference amplification product was shown to give the best results. As the real-time PCR is based on the high copy rDNA-cluster, even contaminations <1% can be reliably quantitated.

  15. Effects of chemical composition and baking on in vitro digestibility of proteins in breads made from selected gluten-containing and gluten-free flours.

    Science.gov (United States)

    Wu, Tong; Taylor, Cheryl; Nebl, Thomas; Ng, Ken; Bennett, Louise E

    2017-10-15

    Breads prepared from cereal grains are a dietary staple, providing a significant proportion of daily energy, but not necessarily of dietary protein. However, good digestibility of proteins in bread is important to avoid potential immunogenic effects of undigested peptides, including for those gluten-intolerant. Four gluten-containing (white wheat, wholemeal wheat, spelt and rye) and four gluten-free (chick pea, lupin, buckwheat, amaranth) flours were used to make yeast-leavened breads standardized for protein. In vitro gastro-intestinal digestion of pre-mixes, doughs and breads baked for 20 and 35min was conducted followed by correlation analysis between fitted parameters of digestion profiles, chemical composition (protein, non-fibre carbohydrates, fibre, ash and total polyphenolics) and amino acid profiles. The results indicated that digestibility generally increased during proofing and decreased during baking. Relatively higher protein digestibility was correlated with ratio of non-fibre carbohydrate to protein and lower digestibility with increasing contents of fibre and total polyphenolics in pre-mixes. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  16. Endophytic bacteria improve phytoremediation of Ni and TCE co-contamination

    International Nuclear Information System (INIS)

    Weyens, Nele; Croes, Sarah; Dupae, Joke; Newman, Lee; Lelie, Daniel van der; Carleer, Robert; Vangronsveld, Jaco

    2010-01-01

    The aim of this work was to investigate if engineered endophytes can improve phytoremediation of co-contaminations by organic pollutants and toxic metals. As a model system, yellow lupine was inoculated with the endophyte Burkholderia cepacia VM1468 possessing (a) the pTOM-Bu61 plasmid, coding for constitutive trichloroethylene (TCE) degradation, and (b) the ncc-nre Ni resistance/sequestration system. Plants were exposed to Ni and TCE and (a) Ni and TCE phytotoxicity, (b) TCE degradation and evapotranspiration, and (c) Ni concentrations in the roots and shoots were determined. Inoculation with B. cepacia VM1468 resulted in decreased Ni and TCE phytotoxicity, as measured by 30% increased root biomass and up to 50% decreased activities of enzymes involved in anti-oxidative defence in the roots. In addition, TCE evapotranspiration showed a decreasing trend and a 5 times higher Ni uptake was observed after inoculation. - Engineered endophytes can improve phytoremediation of mixed contaminations via enhanced degradation of organic contaminants and improved metal uptake and translocation.

  17. Plant prebiotics and human health: Biotechnology to breed prebiotic-rich nutritious food crops

    Directory of Open Access Journals (Sweden)

    Sangam Dwivedi

    2014-09-01

    Full Text Available Microbiota in the gut play essential roles in human health. Prebiotics are non-digestible complex carbohydrates that are fermented in the colon, yielding energy and short chain fatty acids, and selectively promote the growth of Bifidobacteria and Lactobacillae in the gastro-intestinal tract. Fructans and inulin are the best-characterized plant prebiotics. Many vegetable, root and tuber crops as well as some fruit crops are the best-known sources of prebiotic carbohydrates, while the prebiotic-rich grain crops include barley, chickpea, lentil, lupin, and wheat. Some prebiotic-rich crop germplasm have been reported in barley, chickpea, lentil, wheat, yacon, and Jerusalem artichoke. A few major quantitative trait loci and gene-based markers associated with high fructan are known in wheat. More targeted search in genebanks using reduced subsets (representing diversity in germplasm is needed to identify accessions with prebiotic carbohydrates. Transgenic maize, potato and sugarcane with high fructan, with no adverse effects on plant development, have been bred, which suggests that it is feasible to introduce fructan biosynthesis pathways in crops to produce health-imparting prebiotics. Developing prebiotic-rich and super nutritious crops will alleviate the widespread malnutrition and promote human health. A paradigm shift in breeding program is needed to achieve this goal and to ensure that newly-bred crop cultivars are nutritious, safe and health promoting.

  18. Iron bioavailability of Lupinus rotundiflorus seeds and roots in low-iron-diet treated rats

    Directory of Open Access Journals (Sweden)

    Elia Herminia VALDÉS MIRAMONTES

    Full Text Available ABSTRACT Objective To evaluate iron bioavailability of roots and cooked seeds of Lupinus rotundiflorus for human consumption using a low-iron-diet rat model. Methods A hemoglobin depletion–repletion test was performed using rats. A standard diet containing 8mg kg-1 of iron was used. Three experimental diets were prepared based on the standard diet: 2.3g of root flour added to D1, 21.5g cooked seed flour added to D2, and 0.03g of ferrous sulfate added to D3 (control diet, adjusting iron concentration of the diets to 24mg kg-1. Hemoglobin regeneration efficiency was used to measure iron bioavailability. Results Hemoglobin regeneration efficiency showed values of 13.80+2.49%, 13.70+1.60% and 18.38+1.56 in D1, D2 and D3 respectively, and biological relative values of 72.8, 75.08, and 100.00% (.<0.05. Conclusion Roots and cooked seeds of Lupinus rotundiflorus showed potential iron bioavailability, despite being a vegetal source, which could also encourage the study of other species of lupin as a source of iron.

  19. Contributions of roots and rootstocks to sustainable, intensified crop production.

    Science.gov (United States)

    Gregory, Peter J; Atkinson, Christopher J; Bengough, A Glyn; Else, Mark A; Fernández-Fernández, Felicidad; Harrison, Richard J; Schmidt, Sonja

    2013-03-01

    Sustainable intensification is seen as the main route for meeting the world's increasing demands for food and fibre. As demands mount for greater efficiency in the use of resources to achieve this goal, so the focus on roots and rootstocks and their role in acquiring water and nutrients, and overcoming pests and pathogens, is increasing. The purpose of this review is to explore some of the ways in which understanding root systems and their interactions with soils could contribute to the development of more sustainable systems of intensive production. Physical interactions with soil particles limit root growth if soils are dense, but root-soil contact is essential for optimal growth and uptake of water and nutrients. X-ray microtomography demonstrated that maize roots elongated more rapidly with increasing root-soil contact, as long as mechanical impedance was not limiting root elongation, while lupin was less sensitive to changes in root-soil contact. In addition to selecting for root architecture and rhizosphere properties, the growth of many plants in cultivated systems is profoundly affected by selection of an appropriate rootstock. Several mechanisms for scion control by rootstocks have been suggested, but the causal signals are still uncertain and may differ between crop species. Linkage map locations for quantitative trait loci for disease resistance and other traits of interest in rootstock breeding are becoming available. Designing root systems and rootstocks for specific environments is becoming a feasible target.

  20. Feed legumes for truly sustainable crop-animal systems

    Directory of Open Access Journals (Sweden)

    Paolo Annicchiarico

    2017-06-01

    Full Text Available Legume cultivation has sharply decreased in Italy during the last 50 years. Lucerne remains widely grown (with about 12% of its area devoted to dehydration, whereas soybean is definitely the most-grown grain legume. Poor legume cropping is mainly due to the gap in yielding ability with major cereals, which has widened up in time according to statistical data. Lucerne displays definitely higher crude protein yield and somewhat lower economic gap with benchmark cereals than feed grain legumes. Pea because of high feed energy production per unit area and rate of genetic progress, and white lupin because of high protein yield per unit area, are particularly interesting for Italian rain-fed environments. Greater legume cultivation in Europe is urged by the need for reducing energy and green-house gas emissions and excessive and unbalanced global N flows through greater symbiotic N fixation and more integrated crop-animal production, as well as to cope with ongoing and perspective raising prices of feed proteins and N fertilisers and insecurity of feed protein supplies. The transition towards greater legume cultivation requires focused research effort, comprehensive stakeholder cooperation and fair economic compensation for legume environmental services, with a key role for genetic improvement dragged by public breeding or pre-breeding. New opportunities for yield improvement arise from the ongoing development of cost-efficient genome-enabled selection procedures, enhanced adaptation to specific cropping conditions via ecophysiological and evolutionary-based approaches, and more thorough exploitation of global genetic resources.

  1. Reducing GHG emissions in agricultural production process for production of biofuels by growing legumes and production-technical measures; Senkung der THG-Emissionen in landwirtschaftlichen Produktionsverfahren zur Erzeugung von Biokraftstoffen durch Leguminosenanbau und produktionstechnische Massnahmen

    Energy Technology Data Exchange (ETDEWEB)

    Gurgel, Andreas [Landesforschungsanstalt fuer Landwirtschaft und Fischerei Mecklenburg-Vorpommern, Guelzow-Pruezen (Germany). Sachgebiet Nachwachsende Rohstoffe; Schiemenz, Katja

    2017-08-01

    The reduction of greenhouse gases (GHG) emissions in the supply chain for biofuels is a big challenge especially for the German and European cultivation of energy crops. The production of nitrogen fertilizers and field emissions are the main factors of GHG emissions. The amount of field emissions depends very strongly on the nitrogen effort and the intensity of tillage. The main objective is to reduce GHG emissions in field cropping systems within the biofuel production chains. An inclusion of legumes into crop rotations is particularly important because their cultivation does not require nitrogen fertilizer. Data base for the project is a complex field experiment with the biofuel crops winter rape and winter wheat. Previous crops are winter wheat, peas and lupins. ln each case tilling systems are compared with non-tilling. The first results of the field experiments are nitrogen functions depending on previous crops, sites and tilling system. Calculation models for GHG reduction models were developed on the bases of these results. By growing legumes as previous crops before wheat and rape it is possible to reduce GHG emissions from 2 to 10 g CO{sub 2eq} per MJ. The best reduction of GHG emissions is possible by combining legumes as previous crops with a reduced nitrogen effort.

  2. Carbon and Nitrogen Isotopic Survey of Northern Peruvian Plants: Baselines for Paleodietary and Paleoecological Studies

    Science.gov (United States)

    Szpak, Paul; White, Christine D.; Longstaffe, Fred J.; Millaire, Jean-François; Vásquez Sánchez, Víctor F.

    2013-01-01

    The development of isotopic baselines for comparison with paleodietary data is crucial, but often overlooked. We review the factors affecting the carbon (δ13C) and nitrogen (δ15N) isotopic compositions of plants, with a special focus on the carbon and nitrogen isotopic compositions of twelve different species of cultivated plants (n = 91) and 139 wild plant species collected in northern Peru. The cultivated plants were collected from nineteen local markets. The mean δ13C value for maize (grain) was −11.8±0.4 ‰ (n = 27). Leguminous cultigens (beans, Andean lupin) were characterized by significantly lower δ15N values and significantly higher %N than non-leguminous cultigens. Wild plants from thirteen sites were collected in the Moche River Valley area between sea level and ∼4,000 meters above sea level (masl). These sites were associated with mean annual precipitation ranging from 0 to 710 mm. Plants growing at low altitude sites receiving low amounts of precipitation were characterized by higher δ15N values than plants growing at higher altitudes and receiving higher amounts of precipitation, although this trend dissipated when altitude was >2,000 masl and MAP was >400 mm. For C3 plants, foliar δ13C was positively correlated with altitude and precipitation. This suggests that the influence of altitude may overshadow the influence of water availability on foliar δ13C values at this scale. PMID:23341996

  3. Nitrogen Released From Organic Residues Using 15N

    International Nuclear Information System (INIS)

    Galal, Y.G.M.; Gadalla, A.M.; Abdel Aziz, H.A.; Abdel Salam, A.A.; El-Degwy, S.M.A.

    2008-01-01

    Incubation technique was followed under laboratory condition to evaluate and determine the rate of organic residues decomposition as well as N released in media. Rice straw, soybean straw, and leuceana cutting residue were used. These materials were incubated on virgin sandy soil up to 90 days intervals. Cups with mixture of sand and organic residues were inoculated with fungi, bacteria and mixture of them. Un inoculated treatment was also included. Results showed that N released from the different organic materials was significant at 30 days of incubation. It seems that presence of Azotobacter was associated with enhanced demand on soluble N at this stage. Superiority of leucaena over the other two sources of rice straw and soybean straw occurred particularly during the 15 to 30.day period. In greenhouse experiment, the results indicated that N derived from organic materials was high and easily released from compost as mediated materials comparing to leucaena as undigested raw materials. In the same time, barley had more benefits from organic residues than lupine crop

  4. Seed Hydropriming and Smoke Water Significantly Improve Low-Temperature Germination of Lupinus angustifolius L.

    Directory of Open Access Journals (Sweden)

    Agnieszka Płażek

    2018-03-01

    Full Text Available Seed imbibition under cold temperature is dangerous when dry seeds have relatively low water content. The aim of this study was to investigate germination of 20 lines/cultivars of narrow-leaf lupine at 7 °C (cold and 13 °C (control under the influence of smoke water and following seed hydropriming for 3 h at 20 °C. The efficacy of individual treatments was examined with regard to seed protection during low-temperature germination. Based on seed germination, vigour at cold was evaluated four days after sowing by means of hypocotyl length, the studied lines/cultivars were divided into three groups with low, high and very high germination rates. Germination vigour correlated with cell membrane permeability, dehydrogenase activity and abscisic acid (ABA content and was analysed in the seeds one day after sowing. Gibberellin content did not correlate with germination vigour. The seeds of weakly germinating lines/cultivars had the highest cell permeability and ABA content as well as the lowest amylolytic activity at both studied temperatures. Additionally, the vigour of weakly germinating seeds at 7 °C correlated with dehydrogenase activity. Three-hour hydropriming was the most effective for seed germination under cold due to reduced cell membrane permeability and ABA level. Stimulating effects of smoke water on germination under cold could be explained by enhanced dehydrogenase activity.

  5. Fluridone: a combination germination stimulant and herbicide for problem fields?

    Science.gov (United States)

    Goggin, Danica E; Powles, Stephen B

    2014-09-01

    Problem weeds in agriculture, such as Lolium rigidum Gaud., owe some of their success to their large and dormant seed banks, which permit germination throughout a crop-growing season. Dormant weed seed banks could be greatly depleted by application of a chemical that stimulates early-season germination and then kills the young seedlings. Fluridone, a phytoene desaturase-inhibiting herbicide that can also break seed dormancy, was assessed for its efficacy in this regard. The germination of fluridone-treated Lolium rigidum seeds was stimulated on soils with low organic matter, and almost 100% seedling mortality was observed, while the treatment was only moderately effective on a high-organic-matter potting mix. Seedlings from wheat, canola, common bean and chickpea seeds sown on fluridone-treated sandy loam were bleached and did not survive, but lupins and field peas grew normally. This proof-of-concept study with fluridone suggests that it may be possible to design safe and effective molecules that act as germination stimulants plus herbicides in a range of crop and soil types: a potentially novel way of utilising herbicides to stimulate seed bank germination and a valuable addition to an integrated weed management system. © 2014 Society of Chemical Industry.

  6. Utilization of induced mutations in improving legumes in Egypt

    International Nuclear Information System (INIS)

    Abo-Hegazi, A. M. T.

    1993-01-01

    More than one hundred articles published by Egyptian research workers dealing with the improvement of some seed-legumes through radiation, radioisotopes, chemical mutagens and induced mutations are briefly summarized and discussed from the point of view of a mutation breeder working in this field since 1961. Articles on faba bean (Vicia faba L.), soybean (Glycine Max L.), lentils (Lens culinaris), chick-pea (Cicer arietinum L.), lupin (Lupinus termis), peas=pea (Pisum sativum L.), cowpea (Vigna sinensis, savi), and fenugreek-helba (Trigonella foenum gracum L.) are reviewed. A very few number of promising mutations have been induced. However, none of them are utilized neither in conventional breeding programs nor as cultivars. This may be due to the lack of central plans and organization between efforts or research work being carried in various institutions. Joint plants and cooperation between research institutions, not only in Egypt but also among the Arab countries, are required in this field which may help in closing the wide gab between production and consumption os seed legumes. (author)

  7. Purification, crystallization and preliminary crystallographic studies of plant S-adenosyl-l-homocysteine hydrolase (Lupinus luteus)

    Energy Technology Data Exchange (ETDEWEB)

    Brzezinski, Krzysztof [Center for Biocrystallographic Research, Institute of Bioorganic Chemistry, Polish Academy of Sciences, Poznan (Poland); Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan (Poland); Bujacz, Grzegorz [Center for Biocrystallographic Research, Institute of Bioorganic Chemistry, Polish Academy of Sciences, Poznan (Poland); Faculty of Food Chemistry and Biotechnology, Technical University of Lodz (Poland); Jaskolski, Mariusz, E-mail: mariuszj@amu.edu.pl [Center for Biocrystallographic Research, Institute of Bioorganic Chemistry, Polish Academy of Sciences, Poznan (Poland); Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan (Poland)

    2008-07-01

    Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4{sub 3}2{sub 1}2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified. Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation.

  8. [Chemical-nutritional characterization of the moss Spagnum magellanicum].

    Science.gov (United States)

    Villarroel, Mario; Biolley, Edith; Yáñez, Enrique; Peralta, Rosario

    2002-12-01

    The goal of the present study was to know the chemical characteristics of the moss Sphagnum magellanicum (S.M.) growing in the southern part of Chile, spreading approximately. in a geographic area of 500.000 Has. Very few antecedents are reported in the literature concerning the functional properties of this resource, with the exception of the water absorption and holding capacity. Many of the industrial or agricultural uses of this moss are strongly related with this characteristic. Looking for other alternatives of utilization, it has been planned its incorporation to staple foods as a source of dietary fiber. But first it is necessary to know its chemical characteristics Representative samples of this material were submitted to different chemical analysis such as proximal analysis, fractional fiber analysis and anti nutrient factors.. Results of those analysis show the high amount of dietary fiber founded in this resource (77%), higher than reported data for other traditional fiber sources such as lupin bran, rice hull, barley hull, oat bran, etc. Finally it is important emphasize the absence of antinutrient factor in this moss, that could make feasible its use for human nutrition.

  9. Ultrasound studies of the effects of certain poisonous plants on uterine function and fetal development in livestock.

    Science.gov (United States)

    Bunch, T D; Panter, K E; James, L F

    1992-05-01

    Ingestion of locoweed (Astragalus spp. and Oxytropis spp.) by pregnant livestock may result in fetal malformations, delayed placentation, reduced placental and uterine vascular development, hydrops amnii, hydrops allantois, abnormal cotyledonary development, interruption of fetal fluid balance, and abortion. Ultrasonography of pregnant sheep fed locoweed demonstrated that abortion was first preceded by changes in fetal heart rate and strength of contraction and structural changes of the cotyledons, followed by increased accumulation of fetal fluid within the placental membranes and death of the fetus. During pregnancy the toxic agent in locoweed (swainsonine) apparently passes through the placental barrier to the fetus and during lactation through the milk to the neonate. Poison-hemlock (Conium maculatum), wild tree tobacco (Nicotiana glauca), and lunara lupine (Lupinus formosus) all contain piperidine alkaloids and induce fetal malformations, including multiple congenital contractures and cleft palate in livestock. Ultrasonography studies of pregnant sheep and goats gavaged with these plants during 30 to 60 d of gestation suggests that the primary cause of multiple congenital contractures and cleft palate is the degree and the duration of the alkaloid-induced fetal immobilization.

  10. Volatile organo-selenium speciation in biological matter by solid phase microextraction-moderate temperature multicapillary gas chromatography with microwave induced plasma atomic emission spectrometry detection

    Energy Technology Data Exchange (ETDEWEB)

    Dietz, C.; Sanz Landaluze, J.; Ximenez-Embun, P.; Madrid-Albarran, Y.; Camara, C

    2004-01-16

    Microwave induced plasma atomic emission spectrometry (MIP-AES) in combination with multicapillary (MC) gas chromatography could be proven to be useful for element specific detection of volatile species. Solid phase microextraction (SPME) was used for preconcentration and sample-matrix separation. The fiber desorption unit as well as the heating control for the MC column were in-house developed and multicapillary column was operated at moderate temperatures (30-100 deg. C). The method was optimized for organo-selenium species (dimethylselenide (DMSe), diethylselenide (DEtSe) and dimethyldiselenide (DMDSe)), using a chemometric approach. Stationary phases for the separation column were optimized using a conventional GC and contrasted with the results obtained with the MC. Application was focussed on selenium accumulating biological matter, such as lupine, yeast, Indian mustard and garlic. These samples were grown in hydroponic solution containing inorganic selenium (Na{sub 2}SeO{sub 3} and Na{sub 2}SeO{sub 4}). SPME sampling was carried out in fixed volume flow boxes in headspace above the living plants and in vials using treated samples. Results demonstrate inorganic selenium transformation into volatile organic species during metabolism. Separation is fast, a chromatogram can be obtained in less than 3 min and detection limits were at sub-ppb level for all investigated species. The system is independent from the use of a conventional gas chromatographic oven and can be used as a versatile alternative to highly cost intensive methods such as GC-ICP-MS.

  11. FERMENTABLE SUGARS FROM Lupinus rotundiflorus BIOMASS BY HYDROCHLORIC ACID HYDROLYSIS

    Directory of Open Access Journals (Sweden)

    Mario A. Ruiz-López

    2011-02-01

    Full Text Available It is of general interest to produce fermentable carbohydrates from plant biomass. However, obtaining monosaccharides requires some effort, due to the intricate structure of the cell wall lignocellulosic complex. The aim of this study was to apply a simple two-stage hydrolysis process, using only concentrated hydrochloric acid, to generate fermentable carbohydrates from L. rotundiflorus biomass. First and second stage acid concentrations were 32% and 42.6%. Total monosaccharide yields with respect to dry matter after the first stage, second stage, and the overall process, were 27.5%, 21.0% and 48.4%, respectively. Xylose was the main first stage carbohydrate in the hydrolysate, followed by glucose, arabinose, and galactose. After the second stage only glucose and a small amount of xylose were detected. The polysaccharide hydrolysis was eased by overall low lignin content. Some advantages of this method were the use of a single hydrolyzing agent and that most of the polysaccharides were hydrolyzed in reasonably high yields. The acceptable yield, relative simplicity, the use of most of the biomass along with the wide availability, low cost of the chemicals, and the ample supply of lupines, would facilitate the scaling of these laboratory studies to pilot and industrial levels.

  12. Quantification of (1→4-β-d-Galactans in Compression Wood Using an Immuno-Dot Assay

    Directory of Open Access Journals (Sweden)

    Ramesh R. Chavan

    2015-01-01

    Full Text Available Compression wood is a type of reaction wood formed on the underside of softwood stems when they are tilted from the vertical and on the underside of branches. Its quantification is still a matter of some scientific debate. We developed a new technique that has the potential to do this based on the higher proportions of (1→4-β-d-galactans that occur in tracheid cell walls of compression wood. Wood was milled, partially delignified, and the non-cellulosic polysaccharides, including the (1→4-β-d-galactans, extracted with 6 M sodium hydroxide. After neutralizing, the solution was serially diluted, and the (1→4-β-d-galactans determined by an immuno-dot assay using the monoclonal antibody LM5, which specifically recognizes this polysaccharide. Spots were quantified using a dilution series of a commercially available (1→4-β-d-galactan from lupin seeds. Using this method, compression and opposite woods from radiata pine (Pinus radiata were easily distinguished based on the amounts of (1→4-β-d-galactans extracted. The non-cellulosic polysaccharides in the milled wood samples were also hydrolysed using 2 M trifluoroacetic acid followed by the separation and quantification of the released neutral monosaccharides by high performance anion exchange chromatography. This confirmed that the compression woods contained higher proportions of galactose-containing polysaccharides than the opposite woods.

  13. Probabilistic estimates of drought impacts on agricultural production

    Science.gov (United States)

    Madadgar, Shahrbanou; AghaKouchak, Amir; Farahmand, Alireza; Davis, Steven J.

    2017-08-01

    Increases in the severity and frequency of drought in a warming climate may negatively impact agricultural production and food security. Unlike previous studies that have estimated agricultural impacts of climate condition using single-crop yield distributions, we develop a multivariate probabilistic model that uses projected climatic conditions (e.g., precipitation amount or soil moisture) throughout a growing season to estimate the probability distribution of crop yields. We demonstrate the model by an analysis of the historical period 1980-2012, including the Millennium Drought in Australia (2001-2009). We find that precipitation and soil moisture deficit in dry growing seasons reduced the average annual yield of the five largest crops in Australia (wheat, broad beans, canola, lupine, and barley) by 25-45% relative to the wet growing seasons. Our model can thus produce region- and crop-specific agricultural sensitivities to climate conditions and variability. Probabilistic estimates of yield may help decision-makers in government and business to quantitatively assess the vulnerability of agriculture to climate variations. We develop a multivariate probabilistic model that uses precipitation to estimate the probability distribution of crop yields. The proposed model shows how the probability distribution of crop yield changes in response to droughts. During Australia's Millennium Drought precipitation and soil moisture deficit reduced the average annual yield of the five largest crops.

  14. Reclamation of lands transformed by mining activities as an important aspect of environmental protection of the Upper Silesian Coal Basin

    Energy Technology Data Exchange (ETDEWEB)

    Chudek, M; Duchowski, S; Czuber, W

    1976-01-01

    Surface area of lands transformed by coal mining in the basin are analyzed. In 1975 there were 3,110.9 ha of waste lands. Of this, spoil banks dumped on the surface covered 1,019.5 ha, spoil banks located in the cuts of surface mines (e.g. where sand is removed for stowing) or in other subsided places covered 1,064.5 ha, and water reservoirs covered 665.6 ha. Composition of spoil banks produced by black coal mines is analyzed from the point of view of land reclamation. A scheme of reclamation of spoil banks used in the Upper Silesian black coal basin is given. Reclamation of 5 large spoil banks is described. The land reclamation procedure consists in: leveling the spoil bank slopes so that their inclination is 1:10 instead of 1:4. When afforestation is used relatively steep slopes (1:4) are not leveled, centers of endogenic fires are extinguished by packing using rollers, the top layer of a spoil bank is mixed with calcium carbonate (3 to 10 kg/ha), then the top layer of waste fertilized by calcium carbonate is covered with soil (in some cases with fertile soil), soil cover ranges from 15 to 30 cm, the top soil cover is fertilized (dose ranges from 300 to 500 kg/ha). Later lupine is planted and ploughed as additional fertilizer. At a later stage trees and bushes are planted. (10 refs.) (In Polish)

  15. Bioavailability of radiostrontium in soil: Experimental study and modeling

    Energy Technology Data Exchange (ETDEWEB)

    Sysoeva, A.A. [Russian Institute of Agricultural Radiology and Agroecology, 249032 Obninsk (Russian Federation)]. E-mail: lab22@riarae.obninsk.org; Konopleva, I.V. [Russian Institute of Agricultural Radiology and Agroecology, 249032 Obninsk (Russian Federation); Sanzharova, N.I. [Russian Institute of Agricultural Radiology and Agroecology, 249032 Obninsk (Russian Federation)

    2005-07-01

    Parameters related to {sup 90}Sr mobility in the soil-plant system are reported: exchangeable content, selectivity coefficient, and transfer factor. Large mobility of {sup 90}Sr in different soil types was shown. The fraction of exchangeable {sup 90}Sr varied between 70 and 90%. The selectivity coefficient K {sub C}({sup 90}Sr/Ca) values were in the range 1.3-2.5. The radionuclide transfer factors (TF) varied by a factor of 9.6 for barley seedlings and by a factor of 6.6 for lupine seedlings. The exchangeable Ca content was the determinant soil parameter responsible for differences in {sup 90}Sr biological availability. A static model was devised that describes {sup 90}Sr sorption from soil solution by soil and on the root surface. The parameter of {sup 90}Sr bioavailability (A) has been suggested. Parameter A was calculated from data on soil exchangeable Ca content and {sup 90}Sr mobility indicators - exchangeable fraction of the radionuclide and the selectivity coefficient K {sub C}({sup 90}Sr/Ca). A correlation was found between TF and parameter A.

  16. Nutritive evaluation of legume seeds for ruminant feeding.

    Science.gov (United States)

    Ramos-Morales, E; Sanz-Sampelayo, M R; Molina-Alcaide, E

    2010-02-01

    Chemical composition, rumen degradability and the effect of particle losses, and intestinal digestibility of protein by using in situ-in vitro and in vitro techniques were stated for beans (Vicia faba), lupin (Lupinus albus), vetch (Vicia sativa) and bitter vetch (Vicia ervilia) and four diets including those legume seeds. In addition, the apparent digestibility of experimental diets was determined in goats. The legume seeds showed high protein content (206-319 g/kg dry matter). Effective degradability of protein for legumes and diets varied from 0.80 to 0.87 and 0.76 to 0.82, respectively, decreasing to 0.53-0.76 and 0.61-0.67, respectively, when particle loss was taken into account. Different intestinal digestibility values were obtained with both methodologies without significant relationship between them (y = 1.058-0.463x; R(2)=0.068; RSD = 0.140; p = 0.53). There were no differences in the apparent nutrients and energy digestibility among diets (p > 0.05). These legumes can supply rapidly degradable protein for microbial protein synthesis and contribute to the pool of amino acids available for the synthesis of milk protein and for retention in the body.

  17. Pasta quality as impacted by the type of flour and starch and the level of egg addition.

    Science.gov (United States)

    Saleh, Mohammed; Al-Ismail, Khalid; Ajo, Radwan

    2017-10-01

    This study investigated the effects of substituting wheat flour with fractions of different starch types and egg levels on pasta quality. First order mixture response surface model was used where the effects of various starch types and egg levels on pasta quality were evaluated. Coefficients of estimation were determined and fractional contribution of wheat, starch type and egg levels were evaluated. Egg levels negatively (p egg level from 33 to 0%. Flow behavior index of treatments solution with various fractions of starch types and egg level ranged from 0.34 to 1.42 and was significantly (p cooked pasta quality including firmness, stickiness, cooking loss, and water uptake, keeping with consumer acceptability through varying starch type and egg level. Results show that flour and starch type and egg level interaction play significant role in pasta blends formulation. Moreover, substitution of wheat flour with acorn, native or modified corn and potato starches fractions, as well as with lupine, rice, tapioca, and stabilized rice bran flours would have significant effects on the physical properties and acceptability of various cereal products. For instance, the use of rice bran in potentially developed products would enhance the consumption of whole grain foods, resulting in improved intake of fiber and other healthy components. © 2016 Wiley Periodicals, Inc.

  18. Diversity and numbers of root-nodule bacteria (rhizobia in Polish soils

    Directory of Open Access Journals (Sweden)

    Stefan Martyniuk

    2011-01-01

    Full Text Available Using a sand pouch-plant infection method, populations of several species of root-nodule bacteria (rhizobia were enumerated in eighty soils collected throughout Poland. Rhizobium leguminosarum bv. viciae (symbionts of pea, faba bean, vetch and R. leguminosarum bv. trifolii (symbionts of clover were detected in 77 and 76 soils, respectively. Most of these soils contained moderate and high numbers of these species of the rhizobia. Symbionts of beans, R. leguminosarum bv. phaseoli, were assessed in 76 soils; of this number 15 soils had no detectable populations of bean rhizobia and in 40 soils high or moderate numbers of these bacteria were found. Bradyrhizobium sp. (Lupinus, root-nodule bacteria of lupine and serradella, were absent in 19 soils, out of 80 tested, and 34 soils were colonised by high or moderate populations of bradyrhizobia. Sinorhizobium meliloti, rhizobia nodulating alfalfa, were sparse in the examined soils; with 56 soil containing no detectable numbers of S. meliloti and only 6 soils harbouring high or moderate populations of this species. The estimated numbers of the rhizobia in the studied soils were also related to some physical and chemical properties of these soils.

  19. Differential response to an algae supplement high in DHA mediated by maternal periconceptional diet: intergenerational effects of n-6 fatty acids.

    Science.gov (United States)

    Clayton, Edward H; Lamb, Tracy A; Refshauge, Gordon; Kerr, Matthew J; Bailes, Kristy L; Ponnampalam, Eric N; Friend, Michael A; Hopkins, David L

    2014-08-01

    Algae high in docosahexaenoic acid (DHA) may provide a source of long-chain omega-3 polyunsaturated fatty acids (LCn-3PUFA) for inclusion in the diet of lambs to improve the LCn-3PUFA status of meat. The effect of background LCn-3PUFA status on the metabolism of high DHA algae is, however, unknown. The aim of the current study was to determine whether the response to a high in DHA algae supplement fed to lambs for six weeks prior to slaughter was mediated by a maternal periconceptional diet. Forty Poll Dorset × Border Leicester × Merino weaner lambs were allocated to receive either a ration based on oat grain, lupin grain, and chopped lucerne (control) or the control ration with DHA-Gold™ algae included at 1.92 % DM (Algae) based on whether the dams of lambs had previously been fed a diet high in n-3 or n-6 around conception. LCn-3PUFA concentration was determined in plasma and red blood cells (RBC) prior to and following feeding. The concentrations of EPA and DHA in the plasma and RBC of lambs receiving the control ration were significantly (p DHA were also significantly (p DHA was, however, significantly (p DHA.

  20. New arylsparteine derivatives as positive inotropic drugs.

    Science.gov (United States)

    Boido, Vito; Ercoli, Marcella; Tonelli, Michele; Novelli, Federica; Tasso, Bruno; Sparatore, Fabio; Cichero, Elena; Fossa, Paola; Dorigo, Paola; Froldi, Guglielmina

    2017-12-01

    Positive inotropic agents are fundamental in the treatment of heart failure; however, their arrhythmogenic liability and the increased myocardial oxygen demand strongly limit their therapeutic utility. Pursuing our study on cardiovascular activities of lupin alkaloid derivatives, several 2-(4-substituted-phenyl)-2-dehydrosparteines and 2-(4-substituted-phenyl)sparteines were prepared and tested for inotropic and chronotropic activities on isolated guinea pig atria. Four compounds (6b, 6e, 7b, and 7f) exhibited significant inotropism that, at the higher concentrations, was followed by negative inotropism or toxicity. Compound 7e (2-(4-tolyl)sparteine) exhibited a steep dose-depending inotropic activity up to the highest concentration tested (300 µM) with an E max of 116.5 ± 3.4% of basal force, proving less potent but much more active in comparison to the highest concentrations tested of digoxin and milrinone having E max of 87.5 ± 3.1% and 52.2 ± 1.1%, respectively. Finally, docking studies suggested that the relevant sparteine derivatives could target the sigma-1 receptor, whose involvement in cardiac activity is well documented.

  1. Bioavailability of radiostrontium in soil: Experimental study and modeling

    International Nuclear Information System (INIS)

    Sysoeva, A.A.; Konopleva, I.V.; Sanzharova, N.I.

    2005-01-01

    Parameters related to 90 Sr mobility in the soil-plant system are reported: exchangeable content, selectivity coefficient, and transfer factor. Large mobility of 90 Sr in different soil types was shown. The fraction of exchangeable 90 Sr varied between 70 and 90%. The selectivity coefficient K C ( 90 Sr/Ca) values were in the range 1.3-2.5. The radionuclide transfer factors (TF) varied by a factor of 9.6 for barley seedlings and by a factor of 6.6 for lupine seedlings. The exchangeable Ca content was the determinant soil parameter responsible for differences in 90 Sr biological availability. A static model was devised that describes 90 Sr sorption from soil solution by soil and on the root surface. The parameter of 90 Sr bioavailability (A) has been suggested. Parameter A was calculated from data on soil exchangeable Ca content and 90 Sr mobility indicators - exchangeable fraction of the radionuclide and the selectivity coefficient K C ( 90 Sr/Ca). A correlation was found between TF and parameter A

  2. Effect of tillage and crop residue management on nematode densities on corn.

    Science.gov (United States)

    McSorley, R; Gallaher, R N

    1994-12-01

    Effects of winter cover crop management on nematode densities associated with a subsequent corn (Zea mays) crop were examined in five sites in north Florida. Two sites had received winter cover crops of lupine (Lupinus angustifolius), and one site each had rye (Secale cereale), hairy vetch (Vicia villosa), and crimson clover (Trifolium incarnatum). In each site, five different management regimes were compared: 1) conventional tillage after the cover crop was removed for forage; 2) conventional tillage with the cover crop retained as green manure; 3) no-till with the cover crop mowed and used as a mulch; 4) no-till with the cover crop removed as forage; and 5) fallow. Sites were sampled at corn planting and harvest for estimates of initial (Pi) and final (Pf) nematode population densities, respectively. Whether the cover crop was removed as forage or retained as green manure or mulch had no effect (P > 0.10) on population densities of any plant-parasitic nematode before or after corn at any site. Differences between conventional-till and no-till treatments were significant (P cover crop residues had little consistent effect on nematodes, and these practices should be considered based on agronomic benefits rather than for nematode management.

  3. Weed infestation of spring common wheat (Triticum aestivum L. grown in monoculture depending on the cover crop and weed control method

    Directory of Open Access Journals (Sweden)

    Dorota Gawęda

    2012-10-01

    Full Text Available The aim of this 3-year field study was to evaluate the effect of some stubble crops and in-crop weed control methods on the species composition, number and air-dry weight of weeds in a wheat crop grown in short-term monoculture. The study was conducted in the period 2009-2011 in the Uhrusk Experimental Farm on mixed rendzina soil classified as very good rye soil complex. It included various types of stubble crops ploughed in each year (control treatment without cover crop, white mustard, lacy phacelia, a mixture of legumes – narrow-leaf lupin + field pea and methods of weed control in spring wheat (mechanical, mechanical and chemical, chemical weed control. On average during the study period, all stubble crops used reduced the air-dry weight of weds in the treatments with mechanical weed management relative to the control treatment. Irrespective of the weed control method, the number of weeds in the wheat crop was significantly lower only after the ploughing in of white mustard. Mechanical weed management proved to be less effective in reducing the number and dry weight of weeds compared to other weed control methods. The white mustard and legume mixture cover crops had a reducing effect on the number of weed species in relation to the treatment without cover crops. The highest floristic diversity of weed communities was found in the spring wheat crop in which only mechanical weeding alone was used.

  4. Severe Allergic Reactions to Food in Norway: A Ten Year Survey of Cases Reported to the Food Allergy Register

    Directory of Open Access Journals (Sweden)

    Eliann Egaas

    2011-07-01

    Full Text Available The Norwegian Food Allergy Register was established at the Norwegian Institute of Public Health in 2000. The purpose of the register is to gain information about severe allergic reactions to food in Norway and to survey food products in relation to allergen labelling and contamination. Cases are reported on a voluntary basis by first line doctors, and submitted together with a serum sample for specific IgE analysis. The register has received a total of 877 reports from 1 July, 2000 to 31 December, 2010. Two age groups, small children and young adults are over-represented, and the overall gender distribution is 40:60 males-females. The legumes lupine and fenugreek have been identified as two “new” allergens in processed foods and cases of contamination and faults in production of processed foods have been revealed. The highest frequency of food specific IgE is to hazelnuts and peanuts, with a marked increase in reactions to hazelnuts during the last three years. The Food Allergy Register has improved our knowledge about causes and severity of food allergic reactions in Norway. The results show the usefulness of population based national food allergy registers in providing information for health authorities and to secure safe food for individuals with food allergies.

  5. Alkaloid profile, antibacterial and allelopathic activities of Lupinus jaimehintoniana B.L. Turner (Fabaceae

    Directory of Open Access Journals (Sweden)

    Ruiz-González Nancy

    2012-01-01

    Full Text Available Herein we describe some aspects of the ethnobotanical use and the first alkaloid profile of Lupinus jaimehintoniana, the 5 to 8 m high arboreous lupine. Five quinolizidine alkaloids identified as sparteine, 5,6-dehydrolupanine, lupanine, nuttalline, and d-thermopsine, were characterized by the respective elution order according to their electronic impact spectra, lupanine being the most abundant in the four different tissues analyzed. Simultaneously, an antibacterial assessment of the four corresponding crude methanolic extracts, as well as the four semi-purified alkaloids was performed on specific Escherichia coli and Agrobacterium tumefaciens strains. These experiments resulted in MIC ranges of 37-61 µg mL-1 and 130-146 µg mL-1, respectively. for both bacterial species. Finally, the allelopathic activity of these extracts on the germination of Lactuca sativa seeds was demonstrated to be in the range of 50-300 µg mL-1 for both semi-purified alkaloid and methanolic extracts.

  6. Instrument intercomparison in the pulsed neutron fieldsat the CERN HiRadMat facility

    CERN Document Server

    Aza, E; Cassell, C; Charitonidis, N; Harrouch, E; Manessi, G P; Pangallo, M; Perrin, D; Samara, E; Silari, M

    2014-01-01

    An intercomparison of the performances of active neutron detectors was carried out in pulsed neutron fi elds in the new HiRadMat facility at CERN. Five detectors were employed: four of them (two ionization chambers and two rem counters) are routinely employed in the CERN radiation monitoring system, while the fi fth is a novel instrument, called LUPIN, speci fi cally conceived for applications in pulsed neutron fi elds. The measurements were performed in the stray fi eld generated by a proton beam of very short duration with momentum of 440 GeV/c impinging on a dump. The beam intensity was steadily increased during the experiment by more than three orders of magnitude, with an H*(10) due to neutrons at the detector reference positions varying between a few nSv per burst and a few m Sv per burst, whereas the gamma contribution to the total H*(10) was negligible. The aim of the experiment was to evaluate the linearity of the detector response in extreme pulsed conditions as a function of the neutron burst in- t...

  7. Carbon and nitrogen isotopic survey of northern peruvian plants: baselines for paleodietary and paleoecological studies.

    Directory of Open Access Journals (Sweden)

    Paul Szpak

    Full Text Available The development of isotopic baselines for comparison with paleodietary data is crucial, but often overlooked. We review the factors affecting the carbon (δ(13C and nitrogen (δ(15N isotopic compositions of plants, with a special focus on the carbon and nitrogen isotopic compositions of twelve different species of cultivated plants (n = 91 and 139 wild plant species collected in northern Peru. The cultivated plants were collected from nineteen local markets. The mean δ(13C value for maize (grain was -11.8±0.4 ‰ (n = 27. Leguminous cultigens (beans, Andean lupin were characterized by significantly lower δ(15N values and significantly higher %N than non-leguminous cultigens. Wild plants from thirteen sites were collected in the Moche River Valley area between sea level and ∼4,000 meters above sea level (masl. These sites were associated with mean annual precipitation ranging from 0 to 710 mm. Plants growing at low altitude sites receiving low amounts of precipitation were characterized by higher δ(15N values than plants growing at higher altitudes and receiving higher amounts of precipitation, although this trend dissipated when altitude was >2,000 masl and MAP was >400 mm. For C(3 plants, foliar δ(13C was positively correlated with altitude and precipitation. This suggests that the influence of altitude may overshadow the influence of water availability on foliar δ(13C values at this scale.

  8. Reducing GHG emissions in agricultural production process for production of biofuels by growing legumes and production-technical measures

    International Nuclear Information System (INIS)

    Gurgel, Andreas; Schiemenz, Katja

    2017-01-01

    The reduction of greenhouse gases (GHG) emissions in the supply chain for biofuels is a big challenge especially for the German and European cultivation of energy crops. The production of nitrogen fertilizers and field emissions are the main factors of GHG emissions. The amount of field emissions depends very strongly on the nitrogen effort and the intensity of tillage. The main objective is to reduce GHG emissions in field cropping systems within the biofuel production chains. An inclusion of legumes into crop rotations is particularly important because their cultivation does not require nitrogen fertilizer. Data base for the project is a complex field experiment with the biofuel crops winter rape and winter wheat. Previous crops are winter wheat, peas and lupins. ln each case tilling systems are compared with non-tilling. The first results of the field experiments are nitrogen functions depending on previous crops, sites and tilling system. Calculation models for GHG reduction models were developed on the bases of these results. By growing legumes as previous crops before wheat and rape it is possible to reduce GHG emissions from 2 to 10 g CO_2_e_q per MJ. The best reduction of GHG emissions is possible by combining legumes as previous crops with a reduced nitrogen effort.

  9. The relationships between morphological features and social signalling behaviours in juvenile dogs: the effect of early experience with dogs of different morphotypes.

    Science.gov (United States)

    Kerswell, Keven J; Butler, Kym L; Bennett, Pauleen; Hemsworth, Paul H

    2010-09-01

    Research on dog communication has tended to focus on breed differences and the use of lupine signals by the domestic dog. However, the relationship between morphological change and communication has received little empirical study. The link between morphology and behavioural selection in a canid undergoing domestication, the silver fox (Vulpes vulpes), has been well documented. Therefore, it is reasonable to propose a similar link may be present in another canid species that has undergone domestication, namely the domestic dog (Canis familiaris). Inter-morphotype interactions (587 interactions) of 115 juvenile dogs aged 8-20 weeks from over 30 breeds and various hybrids, enrolled in veterinary "Puppy Socialisation Classes", were video taped. Each signal that could be sent, was recorded, and the sending and the intended receiving dog identified. The frequencies with which a dog sent each category of signal, and the frequency with which each category of signal was directed at the dog (elicited), were calculated. The relationship between these frequencies and the morphology of the dog was then studied using generalized linear models. Overall morphology of the dog was not related to either the sending or eliciting of any social signaling behaviours (social signals). However, snout length was related to both the signals sent by a dog, and especially the signals that were directed to a dog (elicited). Relationships to eye cover and coat length were also found. Possible explanations for the results are discussed, and avenues for further research are indicated. Copyright 2010 Elsevier B.V. All rights reserved.

  10. Severe allergic reactions to food in Norway: a ten year survey of cases reported to the food allergy register.

    Science.gov (United States)

    Namork, Ellen; Fæste, Christiane K; Stensby, Berit A; Egaas, Eliann; Løvik, Martinus

    2011-08-01

    The Norwegian Food Allergy Register was established at the Norwegian Institute of Public Health in 2000. The purpose of the register is to gain information about severe allergic reactions to food in Norway and to survey food products in relation to allergen labelling and contamination. Cases are reported on a voluntary basis by first line doctors, and submitted together with a serum sample for specific IgE analysis. The register has received a total of 877 reports from 1 July, 2000 to 31 December, 2010. Two age groups, small children and young adults are over-represented, and the overall gender distribution is 40:60 males-females. The legumes lupine and fenugreek have been identified as two "new" allergens in processed foods and cases of contamination and faults in production of processed foods have been revealed. The highest frequency of food specific IgE is to hazelnuts and peanuts, with a marked increase in reactions to hazelnuts during the last three years. The Food Allergy Register has improved our knowledge about causes and severity of food allergic reactions in Norway. The results show the usefulness of population based national food allergy registers in providing information for health authorities and to secure safe food for individuals with food allergies.

  11. Genetic and environmental factors contribute to variation in cell wall composition in mature desi chickpea (Cicer arietinum L.) cotyledons.

    Science.gov (United States)

    Wood, Jennifer A; Tan, Hwei-Ting; Collins, Helen M; Yap, Kuok; Khor, Shi Fang; Lim, Wai Li; Xing, Xiaohui; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B; Tucker, Matthew R

    2018-03-13

    Chickpea (Cicer arietinum L.) is an important nutritionally rich legume crop that is consumed worldwide. Prior to cooking, desi chickpea seeds are most often dehulled and cleaved to release the split cotyledons, referred to as dhal. Compositional variation between desi genotypes has a significant impact on nutritional quality and downstream processing, and this has been investigated mainly in terms of starch and protein content. Studies in pulses such as bean and lupin have also implicated cell wall polysaccharides in cooking time variation, but the underlying relationship between desi chickpea cotyledon composition and cooking performance remains unclear. Here, we utilized a variety of chemical and immunohistological assays to examine details of polysaccharide composition, structure, abundance, and location within the desi chickpea cotyledon. Pectic polysaccharides were the most abundant cell wall components, and differences in monosaccharide and glycosidic linkage content suggest both environmental and genetic factors contribute to cotyledon composition. Genotype-specific differences were identified in arabinan structure, pectin methylesterification, and calcium-mediated pectin dimerization. These differences were replicated in distinct field sites and suggest a potentially important role for cell wall polysaccharides and their underlying regulatory machinery in the control of cooking time in chickpea. © 2018 The Authors. Plant, Cell & Environment Published by John Wiley & Sons Ltd.

  12. Optimization of the cropping pattern in Egypt

    Directory of Open Access Journals (Sweden)

    Sara Osama

    2017-12-01

    Full Text Available Continuous increase of population in Egypt, limited fresh water, poor maintenance and low efficiency of irrigation systems lead to a real burden on the Egyptian natural water resources. Accordingly, for Egypt, land and water resources management is considered an absolutely strategic priority. In this study, a linear optimization model is developed to maximize the net annual return from the three old regions of Egypt. Data for 28 crops in five years from 2008 to 2012 are being analyzed. The spatial variations of crops, irrigation water needs, crop yields and food requirements are incorporated in the model. The results show that there is a significant reduction in the allocated areas for onion, garlic, barley, flax, fenugreek, chickpeas, lentil and lupine since they are considered as non-strategic crops. On the other side, the allocated areas for strategic crops such as wheat, maize, clover, rice, sugar products and cotton remained almost the same to satisfy their actual food requirements. However, crops with high net returns such as tomatoes have increased substantially. The trend for the gross net benefit is decreasing and is expected to reach a lower value in year 2017. Different approaches and scenarios are analyzed. The developed model proposes a change in the cropping pattern in the old lands of Egypt to increase the gross net return without adding further any other expenses. Keywords: Cropping pattern, Linear programming, Net return, Optimization

  13. Protein concentrate production from the biomass contaminated with radionuclides

    International Nuclear Information System (INIS)

    Nizhko, V.F.; Shinkarenko, M.P.; Polozhaj, V.V.; Krivchik, O.V.

    1992-01-01

    Coefficients of radionuclides accumulation are determined for traditional and rare forage crops grown on contaminated soils. It is shown that with low concentration of radionuclides in soil minimal level of contamination were found in the biomass of lupine (Lupinus luteus L.) and sainfoin (Onobrychis hybridus L.). Relatively high levels of contamination were found in comfrey (Symphytum asperum Lepech.) and bistort (Polygonum divaricatum L.). Comparatively low accumulation coefficients in case of higher density of soil contamination were observed for white and yellow sweetclovers (Melilotus albus Medik. and M. officinalis (L.) Desr.), while higher values of coefficients were found for bird's-foot trefoil (Lotus corniculatus L.), white clover (Trifolium repens L.) and alsike clover (t. hybridum L.). Biomass of white sweet-clover and alsike clover has been processed to produce leaf protein concentrate. It is shown that with biomass contamination of 1 kBq/kg and above conventional technology based on thermal precipitation of the protein does not provide production of pure product. More purified protein concentrates are obtained after two-stage processing of the biomass

  14. Screening for sweet potato (Ipomoea batatas (L.)) viruses and their elimination using thermotheraphy-meristem tip culture technique

    International Nuclear Information System (INIS)

    Arkorful, E.

    2012-11-01

    Despite its high potential for food security, production of sweet potato is constrained by viruses which reduce yield by 90%. It is therefore essential to screen for, identify and eliminate these viruses in elite clones before dissemination to farmers. In this study, visual symptomatology and PCR-based techniques were used to identify sweet potato viruses. Visual symptomatology revealed virus associated symptoms ranging from vein clearing, interveinal chlorosis, chlorotic spots, upward curling on leaf edges, leaf narrowing and distortion, purpling, blistering, reduction of the leaf blades and general leaf yellowing in all 22 accessions grown on the field. Disease Incidence (DI) significantly (p≤0.05) varied between accessions with US003 having the lowest (20%) while ten accessions had 90% DI at the end of the study. Index of symptom severity of all plants (ISSap) ranged from 1.08±0.09 to 3.67 ±0.11 with VOTCR003 having the lowest suggesting that it is a moderately susceptible accession while VOTCR002 had the highest suggesting that it is susceptible to viral diseases. Contrarily, index of symptom severity of diseased plants (ISSdp) ranged from 2.00±0.25 to 3.75±0.32. The accession VOTCR002 had the highest ISSdp. Visual symptomatology showed that VOTCR002 had the highest DI, ISSap and ISSdp suggesting that it is highly susceptible to viral diseases. Ten severely infected accessions were tested for Sweet Potato leaf curl virus (SPLCV), Sweet Potato chlorotic stunt virus (SPCSV), Sweet potato feathery mottle virus (SPFMV) and Sweet Potato mild mottle virus (SPMMV) using PCR and RT-PCR techniques. RT-PCR did not amplify any of the virus genomes due to prolonged storage enzymes, In contrast, PCR detected SPLCV in 30% of the accessions. Plants infected with SPLCV were grown in the chamber at 35 degrees celsius for 4 weeks followed by meristem top culture. The regenerants were indexed after ten weeks for SPLCV. Fifty two percent (52.385 od the regenerants were

  15. Characterisation and performance evaluation of twenty accessions of sweet potato (Ipomoea batatas (L.) Lam.) in the coastal savannah agro-ecological zone of Ghana

    International Nuclear Information System (INIS)

    Sossah, F.L.

    2012-01-01

    This study assessed the genetic diversity, using morphological and protein markers, as well as incidence of viral diseases among 20 accessions of sweet potato. Morphological analysis was carried out using 47 traits while protein analysis was performed with sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Sample plants collected from the field were tested for viruses using nitrocellulose membrane enzyme-linked immuno-sorbent assay (NCM-ELISA) and PCR for a DNA virus (Sweet potato Leaf curl virus). Scions from symptomatic plants were grafted onto Ipomoea setosa, a nearly universal indicator plant for sweet potato viruses, and leaves were tested using NCM-ELISA. From the cluster analysis, the accessions were grouped into two clusters at a genetic similarity index of 61.6%. The accessions ER001 and HMA2 were shown to be possible duplicates. Accession US 020 recorded the highest total root yield and harvest index of 56.32 t/ha and 57.11% respectively. Similarly, two pairs of accession SA/BNARI and UE 007 as well as HMA I and US 029 were identified as duplicates based on their protein banding patterns. While, three entries, LOCAL I, US 004 and UK/BNARI were also identified as a single entity based on their banding patterns for leaf and tuber proteins. Symptoms observed in the field varied from vein clearing, chlorosis, leaf reduction to stunting and the highest index of symptom severity for only diseased plants (ISSdp) was 3.63 recorded for US 029. The highest disease incidence (100%) was recorded at 11 WAP and 12 WAP. NCM-ELISA test detected eight viruses out of ten, with SA/BNARI exhibiting all the eight viruses. Mixed infections ranged from duplet to octaplet. The indicator plant I. setosa grafted with scions from sweet potato showed clear symptoms similar to those observed on the field. PCR test using SPG3/SPG4 primers detected SPLCV in the UK/BNARI accessions. Based on the morphological characters as well as response to virus infection, two

  16. Fault rocks and veins formation in the crystalline Palaeozoic basement of the N margin of the Littoral Chain (Catalan Coastal Ranges, NE Spain)

    Science.gov (United States)

    Alías, Gemma; Belmonte, Alba; Cantarero, Irene; Inglés, Montserrat; Travé, Anna

    2013-04-01

    of Mesozoic age, they commonly display a fan-like geometry. Though present, rarely Neogene fractures dip towards the SE in this area. Neogene faults form discrete planes or develop a greyish fault gouge constituted by quartz - muscovite - chlorite - albite, the same mineral paragenesis than the wall rock. Millimetric width calcite veins clearly cut the Mesozoic fractures but the relation with Neogene fractures are still unclear.

  17. Detection of new viruses in alfalfa, weeds and cultivated plants growing adjacent to alfalfa fields in Saudi Arabia.

    Science.gov (United States)

    Al-Shahwan, I M; Abdalla, O A; Al-Saleh, M A; Amer, M A

    2017-09-01

    A total of 1368 symptomatic plant samples showing different virus-like symptoms such as mottling, chlorosis, mosaic, yellow mosaic, vein clearing and stunting were collected from alfalfa, weed and cultivated plant species growing in vicinity of alfalfa fields in five principal regions of alfalfa production in Saudi Arabia. DAS-ELISA test indicated occurrence of 11 different viruses in these samples, 10 of which were detected for the first time in Saudi Arabia. Eighty percent of the alfalfa samples and 97.5% of the weed and cultivated plants samples were found to be infected with one or more of these viruses. Nine weed plant species were found to harbor these viruses namely, Sonchus oleraceus, Chenopodium spp., Hibiscus spp., Cichorium intybus , Convolvulus arvensis , Malva parviflora , Rubus fruticosus , Hippuris vulgaris , and Flaveria trinervia . These viruses were also detected in seven cultivated crop plants growing adjacent to the alfalfa fields including Vigna unguiculata , Solanum tuberosum , Solanum melongena , Phaseolus vulgaris , Cucurbita maxima , Capsicum annuum , and Vicia faba . The newly reported viruses together with their respective percent of detection in alfalfa, and in both weeds and cultivated crop plant species together were as follows: Bean leaf roll virus (BLRV) {12.5 and 4.5%}, Lucerne transient streak virus (LTSV) {2.9 and 3.5%}, Bean yellow mosaic virus (BYMV) {1.4 and 4.5%}, Bean common mosaic virus (BCMV) {1.2 and 4.5%}, Red clover vein mosaic virus (RCVMV) {1.2 and 4%}, White clover mosaic virus (WCIMV) {1.0 and 5%}, Cucumber mosaic virus (CMV) {0.8 and 3%}, Pea streak virus (PeSV) {0.4 and 4.5%} and Tobacco streak virus (TSV) {0.3 and 2.5%}. Alfalfa mosaic virus (AMV), the previously reported virus in alfalfa, had the highest percentage of detection in alfalfa accounting for 58.4% and 62.8% in the weeds and cultivated plants. Peanut stunt virus (PSV) was also detected for the first time in Saudi Arabia with a 66.7% of infection in 90

  18. Detection of new viruses in alfalfa, weeds and cultivated plants growing adjacent to alfalfa fields in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    I.M. Al-Shahwan

    2017-09-01

    Full Text Available A total of 1368 symptomatic plant samples showing different virus-like symptoms such as mottling, chlorosis, mosaic, yellow mosaic, vein clearing and stunting were collected from alfalfa, weed and cultivated plant species growing in vicinity of alfalfa fields in five principal regions of alfalfa production in Saudi Arabia. DAS-ELISA test indicated occurrence of 11 different viruses in these samples, 10 of which were detected for the first time in Saudi Arabia. Eighty percent of the alfalfa samples and 97.5% of the weed and cultivated plants samples were found to be infected with one or more of these viruses. Nine weed plant species were found to harbor these viruses namely, Sonchus oleraceus, Chenopodium spp., Hibiscus spp., Cichorium intybus, Convolvulus arvensis, Malva parviflora, Rubus fruticosus, Hippuris vulgaris, and Flaveria trinervia. These viruses were also detected in seven cultivated crop plants growing adjacent to the alfalfa fields including Vigna unguiculata, Solanum tuberosum, Solanum melongena, Phaseolus vulgaris, Cucurbita maxima, Capsicum annuum, and Vicia faba. The newly reported viruses together with their respective percent of detection in alfalfa, and in both weeds and cultivated crop plant species together were as follows: Bean leaf roll virus (BLRV {12.5 and 4.5%}, Lucerne transient streak virus (LTSV {2.9 and 3.5%}, Bean yellow mosaic virus (BYMV {1.4 and 4.5%}, Bean common mosaic virus (BCMV {1.2 and 4.5%}, Red clover vein mosaic virus (RCVMV {1.2 and 4%}, White clover mosaic virus (WCIMV {1.0 and 5%}, Cucumber mosaic virus (CMV {0.8 and 3%}, Pea streak virus (PeSV {0.4 and 4.5%} and Tobacco streak virus (TSV {0.3 and 2.5%}. Alfalfa mosaic virus (AMV, the previously reported virus in alfalfa, had the highest percentage of detection in alfalfa accounting for 58.4% and 62.8% in the weeds and cultivated plants. Peanut stunt virus (PSV was also detected for the first time in Saudi Arabia with a 66.7% of infection in 90

  19. Twenty-three years of vegetation change in a fly-ash leachate impacted meadow

    Science.gov (United States)

    Pavlovic, Noel B.; Leicht-Young, Stacey A.; Wilcox, Douglas; Hiebert, Ron; Murphy, Marilyn K.; Mason, Daniel; Frohnapple, Krystal

    2009-01-01

    species. Known toxicity effects of aluminum suggest that plants with vein clearing may be experiencing toxic effects of aluminum despite leaf concentrations 58 to 193 ppm. 9. In a greenhouse experiment, rye (Secale cereale) and radish (Raphanus sativus) germinated poorly in the sediments from Blag Slough having high concentrations of heavy metals (ZN, Mn, B, and NH4+) compared to potting soil. However, rye and radish plants grown in Blag Slough soil had shorter shoots and roots, lower root and shoot mass, and lower root to shoot mass ratios compared to plants grown in potting soil. These results suggest some effect of the soil constituents on rye and radish growth. 10. Positive signs in the recovery of Blag Slough include the increase in soil pH, the increasing dominance of late successional grasses, and the establishment of wetland zonation relative to seasonal water depth. Some areas of Blag Slough near the fly-ash ponds that continue to have high concentrations of heavy metals continue to be devoid of vegetation or are dominated by early successional species such as green spikerush. Localized heavy metal concentrations, evidence for zinc and boron bioaccumulation in 1984, vein clearing that persists today, effects of soil on rye and racish growth, and slow succession in the southern portion of Blag Slough suggest further toxicity study is necessary to better assess the impacts on this wetland ecosystem and identify restoration actions.

  20. Applications of 15N-isotopic dilution techniques to study the recovery of nitrogen fertilizer in the soil and plant uptake in wheat cropping system

    International Nuclear Information System (INIS)

    Rouanet, Juan Luis; Godoy, Alejandra; Montenegro, Adolfo; Mera, Mario; Uribe, Hamil; Pino, Ines; Parada, Ana Maria; Nario, Adriana

    1999-01-01

    Soil erosion is a major concern of the Chilean Ministry of Agriculture, which supports actions to develop new approaches in order to decrease the loss of this fragile natural resource and to promote sustainable production systems. This study, based on the management of biological, chemical and physical characteristics of the soil, was aimed to save nitrogen fertilizer. Nitrogen fertilization is the most costly production factor in wheat cropping systems on Ultisols, one of the most eroded soil types in southern Chile. A field experiment was undertaken on a Ultisol (''Buenos Aires'' Farm) at Imperial, IX Region, during 1997 and 1998, in order to assess the nitrogen and water use efficiency by a wheat crop (cv. Dalcahue-INIA) under alternative soil tillage systems. 15 N-isotopic dilution techniques allowed determining aspects of plant nutrition, nitrogen and water movement in the soil, processes not evaluated so far under these conditions. A strip-plot field layout with four replications was used , with soil tillage systems (traditional, burning/no-till, and no burning/no-till) as the main plots and crop successions (wheat-lupin-wheat and lupin-wheat-oat) as the subplots (30 m-2). In each subplot, a microplot (1m-2 ) was delimited. N fertilizer in the form of urea was added on subplots, except the microplot, at the rate of 150 kg N ha-1. 15N-labelled urea at c. 10 atom % excess, at the rate of 150 kg N ha-1, was added to the microplots. The fertilizer was split three times, 10% at planting, 45% at tillering and 45% jointing stage. No significant differences were found for wheat grain yield among tillage treatments. N fertilizer recovery by the wheat crop was 43%, and 56% on the nitrogen found in plants was derived from soil. No significant differences for these proportions were found among treatments. Although the wheat crop did not respond to tillage treatments in terms of 15N recovery, the physiological nitrogen use efficiency, or grain production per unit of

  1. Radioprotective effect of microelements at the territories contaminated by radionuclides

    International Nuclear Information System (INIS)

    Gudkov, I.N.

    2007-01-01

    The most radioactively contaminated region of Ukrainian and Byelorussian Palesse belongs to a biogeochemical province where soils, plants, and, accordingly, forage for animals and food stuffs are poor with biologically important microelements - iodine, zinc, copper, cobalt, fluorine, manganese, lithium, boron. It is a cause of specific diseases of plants, animals and people known as hypomicroelementhoses. Carrying out the radioprotective measures (countermeasures), particularly liming of soils and applying the heightened doses of phosphoric fertilizers, reduces transfer of radionuclides from soil to plants and also elements of mineral nutrition included the microelements. It aggravates the deficiency of microelements following the decrease of productivity and quality of production in plant and animal breeding and exacerbation of the mentioned diseases. It is known, that many microelements have radioprotective properties, and same of them can influence on uptake of other elements in plants. Therefore, considering the situation with microelements, we can expect of their role in radiation protection of living organisms in a zone affected by accident in Chernobyl NPP. It was shown the applying (root injection) of zinc, manganese, cobalt, copper in the sulfates and chlorides (4-6 kg of metal per hectare) on soddy-podsolic soil, reduced the Sr 90 and Cs 137 transfer factor. Zinc was the most effective: the content of both radionuclides in grain of oats and lupine decreased in 1,5-2 times. Lesser efficiency was observed with manganese and cobalt, much less - with copper. Moreover, in some cases the increase of Sr 90 accumulation was observed. Influence of microelements was stronger in variants without fertilizers, than with their heightened doses. It happened because, firstly, fertilizers contain some various microelements. And, secondly, in favorable conditions for growth and development of plants provided by fertilizers, the action of both factors, positive, and

  2. Fitomassa e relação C/N em consórcios de sorgo e milho com espécies de cobertura Biomass and C/N ratio in intercrops of sorghum and maize with cover crops

    Directory of Open Access Journals (Sweden)

    Paulo Claudeir Gomes da Silva

    2009-11-01

    Full Text Available O objetivo deste trabalho foi quantificar a produtividade de fitomassa, o teor e acúmulo de nitrogênio (N, e a relação carbono/nitrogênio (C/N de monocultivos de sorgo (Sorghum bicolor e milho (Zea mays e de seus consórcios com guandu-anão (Cajanus cajan, crotalária (Crotalaria juncea, tremoço branco (Lupinus albus, girassol (Helianthus annuus e nabo-forrageiro (Raphanus sativus, manejados em diferentes estádios. O experimento foi conduzido de março a julho de 2008, em Argissolo Vermelho distroférrico de textura média, no sistema plantio direto. O delineamento experimental foi o de blocos completos ao acaso, com quatro repetições, e parcelas subdivididas, constituído pelos tratamentos: monocultivos de sorgo e milho e seus respectivos consórcios com guandu-anão, crotalária, girassol, nabo-forrageiro e tremoço branco, nas parcelas; e épocas de corte, aos 60, 90 e 120 dias após a semeadura nas subparcelas. Consórcios de sorgo e milho com outras espécies superaram expressivamente a produtividade de fitomassa de seus monocultivos que ainda acumularam menos N e apresentaram maiores relações C/N na fitomassa. Para aumentar a produtividade de fitomassa, a melhor época de corte é aos 120 dias após a semeadura das culturas de cobertura. O corte aos 90 dias após a semeadura propicia o maior acúmulo de N e as menores relações C/N.The objective of this work was to quantify the biomass production, the content and accumulation of nitrogen (N and the carbon/nitrogen (C/N relation in monocultures of sorghum (Sorghum bicolor and corn (Zea mays, and intercrops with pigeon pea (Cajanus cajan, sun hemp (Crotalaria juncea, white lupine (Lupinus albus, sunflower (Helianthus annuus and turnip forage (Raphanus sativus, managed in different stages. The experiment was carried out from March to July 2008, in a Haplic Acrisol, medium texture, under no-tillage. A randomized complete block design, with four replicates and split plots with the

  3. Evaluating agronomic effectiveness of phosphate rocks using nuclear and related techniques: Results from an FAO/IAEA co-ordinated research project

    International Nuclear Information System (INIS)

    Zapata, F.

    2000-01-01

    An FAO/IAEA Co-ordinated Research Project, 'The use of nuclear and related techniques for evaluating the agronomic effectiveness of phosphatic fertilisers, in particular rock phosphates', was in operation during the period 1993-98. The research network comprised twenty-three scientists, of whom seventeen were in developing countries, with six in industrialized nations. Conventional and 32 P-isotope techniques were utilized to assess the bioavailability of P in soils amended with phosphate rock (PR) and water-soluble fertilisers, and to evaluate the agronomic effectiveness of PR products. No single chemical extraction method was found to be suitable for all soils and fertilisers. The Pi strip method showed promising results, but more testing is needed with tropical acid soils. The 32 P-phosphate-exchange kinetics method allowed a complete characterization of P dynamics, and provided basic information for estimating the kinetic pools of soil P. The agronomic effectiveness (AE) of PRs depends on their solubility (reactivity), which is related to the degree of carbonate substitution for phosphate in the apatite structure. Rock phosphates of low reactivity were unsuitable for direct application to annual crops. Research in Venezuela, China, Cuba, Brazil, and Thailand demonstrated that AE can be increased by partial acidulation, or by mixing with organic materials or a water-soluble source. The AE can be enhanced also through inoculation with mycorrhizal fungi and rhizobacteria. The AE, which depends on species, is particularly high in crops such as canola and lupin that exude organic acids from the roots. Agronomic effectiveness of PR is higher on soils with low pH, low available P, low exchangeable Ca, high cation exchange capacity and high organic-matter content. The 32 P-techniques are powerful tools for studying the factors that affect AE. Information from field trials was used to create a database for validating a model for providing recommendations for PR

  4. Evaluating agronomic effectiveness of phosphate rocks using nuclear and related techniques: Results from an FAO/IAEA co-ordinated research project

    Energy Technology Data Exchange (ETDEWEB)

    Zapata, F [International Atomic Energy Agency, Vienna (Austria)

    2000-06-01

    An FAO/IAEA Co-ordinated Research Project, 'The use of nuclear and related techniques for evaluating the agronomic effectiveness of phosphatic fertilisers, in particular rock phosphates', was in operation during the period 1993-98. The research network comprised twenty-three scientists, of whom seventeen were in developing countries, with six in industrialized nations. Conventional and {sup 32}P-isotope techniques were utilized to assess the bioavailability of P in soils amended with phosphate rock (PR) and water-soluble fertilisers, and to evaluate the agronomic effectiveness of PR products. No single chemical extraction method was found to be suitable for all soils and fertilisers. The Pi strip method showed promising results, but more testing is needed with tropical acid soils. The {sup 32}P-phosphate-exchange kinetics method allowed a complete characterization of P dynamics, and provided basic information for estimating the kinetic pools of soil P. The agronomic effectiveness (AE) of PRs depends on their solubility (reactivity), which is related to the degree of carbonate substitution for phosphate in the apatite structure. Rock phosphates of low reactivity were unsuitable for direct application to annual crops. Research in Venezuela, China, Cuba, Brazil, and Thailand demonstrated that AE can be increased by partial acidulation, or by mixing with organic materials or a water-soluble source. The AE can be enhanced also through inoculation with mycorrhizal fungi and rhizobacteria. The AE, which depends on species, is particularly high in crops such as canola and lupin that exude organic acids from the roots. Agronomic effectiveness of PR is higher on soils with low pH, low available P, low exchangeable Ca, high cation exchange capacity and high organic-matter content. The {sup 32}P-techniques are powerful tools for studying the factors that affect AE. Information from field trials was used to create a database for validating a model for providing recommendations

  5. Cloning, expression, purification, crystallization and preliminary X-ray analysis of NodS N-methyltransferase from Bradyrhizobium japonicum WM9

    International Nuclear Information System (INIS)

    Cakici, Ozgur; Sikorski, Michal; Stepkowski, Tomasz; Bujacz, Grzegorz; Jaskolski, Mariusz

    2008-01-01

    The NodS N-methyltransferase, an enzyme participating in the biosynthesis of the bacterial nodulation (Nod) factor necessary to establish symbiotic nitrogen fixation with a legume plant host, has been crystallized in the apo form as well as in complex with SAH. SAH is a byproduct of SAM degradation during the SAM-dependent methylation reaction. The Nod factor (NF) is a rhizobial signal molecule that is involved in recognition of a legume host and the formation of root and stem nodules. Some unique enzymes are involved in the biosynthesis of NF, which is a variously but specifically substituted lipochitooligosaccharide. One of these enzymes is NodS, an N-methyltransferase that methylates end-deacetylated chitooligosaccharide substrates. In the methylation reaction, NodS uses S-adenosyl-l-methionine (SAM) as a methyl donor. To date, no structural information is available about NodS from any rhizobium. X-ray crystallographic studies of the NodS protein from Bradyrhizobium japonicum WM9, which infects the legumes lupin and serradella, have been undertaken. The nodS gene was cloned and the recombinant protein was expressed in Escherichia coli cells using natural amino acids and as an SeMet derivative. NodS without ligands was crystallized in the presence of PEG 3350 and MgCl 2 . The protein was also crystallized in complex with S-adenosyl-l-homocysteine (SAH) in the presence of PEG 8000 and MgCl 2 . SAH is produced from SAM as a byproduct of the methylation reaction. The crystals of apo NodS are tetragonal and diffracted X-rays to 2.42 Å resolution. The NodS–SAH complex crystallizes in an orthorhombic space group and the crystals diffracted X-rays to 1.85 Å resolution

  6. Characteristics of starch breads enriched with red potatoes

    Directory of Open Access Journals (Sweden)

    Dorota Gumul

    2017-01-01

    Full Text Available Starch breads may often be low in nutritional value, in comparison to traditional products, as they contain less dietary fibre, protein and micro and macro elements. As an effect a risk of mineral deficiencies and digestive problems caused by lack of dietary fibre could be expected in persons adhering to gluten free diet. To eliminate such problems, a continuous research on gluten-free bread nutritional enrichment, has been done in recent years. Raw material used to enrich gluten free products should include: inulin, lupine, radish, soy, lucerne sprouts, oilseeds, different type of dried fruits. Among the most commonly used raw materials, there are flours from gluten free cereals and pseudocereals such as buckwheat, amaranth and maize are very popular. It seem that valuable alternative could be considered a red, purple or pink potatoes as starch breads additives. The aim of this work was to investigate the effect addition of freeze-dried color potatoes on crude fiber, polyphenols, anthocyanins and flavonoids and nutritional value of gluten free breads. It could be concluded, that freeze-dried color (red, purple, pink potatoes enriched the gluten free breads (starch breads with health promoting bioactive components, like polyphenols, and highly valuable protein. The most promising additive was Magenta Love red potato variety lyophilisates, because gluten free breads enriched with this component were characterized by high protein content and the highest content of free and bound polyphenols, flavonoids, anthocyanins. The presence of all these components increased the nutritional and pro-health value of gluten free product as starch bread.

  7. Side-effects of domestication: cultivated legume seeds contain similar tocopherols and fatty acids but less carotenoids than their wild counterparts.

    Science.gov (United States)

    Fernández-Marín, Beatriz; Milla, Rubén; Martín-Robles, Nieves; Arc, Erwann; Kranner, Ilse; Becerril, José María; García-Plazaola, José Ignacio

    2014-12-20

    Lipophilic antioxidants play dual key roles in edible seeds (i) as preservatives of cell integrity and seed viability by preventing the oxidation of fats, and (ii) as essential nutrients for human and animal life stock. It has been well documented that plant domestication and post-domestication evolution frequently resulted in increased seed size and palatability, and reduced seed dormancy. Nevertheless, and surprisingly, it is poorly understood how agricultural selection and cultivation affected the physiological fitness and the nutritional quality of seeds. Fabaceae have the greatest number of crop species of all plant families, and most of them are cultivated for their highly nutritious edible seeds. Here, we evaluate whether evolution of plants under cultivation has altered the integrated system formed by membranes (fatty acids) and lipophilic antioxidants (carotenoids and tocopherols), in the ten most economically important grain legumes and their closest wild relatives, i.e.: Arachis (peanut), Cicer (chickpea), Glycine (soybean), Lathyrus(vetch), Lens (lentil), Lupinus (lupin), Phaseolus (bean), Pisum (pea), Vicia (faba bean) and Vigna (cowpea). Unexpectedly, we found that following domestication, the contents of carotenoids, including lutein and zeaxanthin, decreased in all ten species (total carotenoid content decreased 48% in average). Furthermore, the composition of carotenoids changed, whereby some carotenoids were lost in most of the crops. An undirected change in the contents of tocopherols and fatty acids was found, with contents increasing in some species and decreasing in others, independently of the changes in carotenoids. In some species, polyunsaturated fatty acids (linolenic acid especially), α-tocopherol and γ-tocopherol decreased following domestication. The changes in carotenoids, tocopherols and fatty acids are likely side-effects of the selection for other desired traits such as the loss of seed dormancy and dispersal mechanisms, and

  8. The evolving role of hyaluronic acid fillers for facial volume restoration and contouring: a Canadian overview

    Directory of Open Access Journals (Sweden)

    Muhn C

    2012-10-01

    Full Text Available Channy Muhn,1 Nathan Rosen,1 Nowell Solish,2 Vince Bertucci,2 Mark Lupin,3 Alain Dansereau,4 Fred Weksberg,5 B Kent Remington,6 Arthur Swift71Division of Dermatology, McMaster University, Hamilton, Ontario, 2Division of Dermatology, New Women's College Hospital, Toronto, Ontario, 3Department of Dermatology and Skin Science, University of British Columbia, Vancouver, British Columbia, 4Private Practice, Repentigny, Québec, 5Department of Medicine, University of Toronto, Toronto, Ontario, 6Private Practice, Calgary, Alberta, Canada; 7St Mary's Hospital, McGill University, Montréal, Québec, CanadaAbstract: Recent advancements, including more versatile facial fillers, refined injection techniques and the adoption of a global facial approach, have contributed to improved patient outcome and increased patient satisfaction. Nine Canadian specialists (eight dermatologists, one plastic surgeon collaborated to develop an overview on volume restoration and contouring based on published literature and their collective clinical experience. The specialists concurred that optimal results in volume restoration and contouring depend on correcting deficiencies at various layers of the facial envelope. This includes creating a foundation for deep structural support in the supraperiosteal or submuscular plane; volume repletion of subcutaneous fat compartments; and the reestablishment of dermal and subdermal support to minimize cutaneous rhytids, grooves and furrows. It was also agreed that volume restoration and contouring using a global facial approach is essential to create a natural, youthful appearance in facial aesthetics. A comprehensive non-surgical approach should therefore incorporate combining fillers such as high-viscosity, low-molecular-weight hyaluronic acid (LMWHA for structural support and hyaluronic acid (HA for lines, grooves and furrows with neuromodulators, lasers and energy devices.Keywords: hyaluronic acid filler, volumizing, facial

  9. The incidence and features of systemic reactions to skin prick tests.

    Science.gov (United States)

    Sellaturay, Priya; Nasser, Shuaib; Ewan, Pamela

    2015-09-01

    Skin prick testing (SPT) has been regarded as a safe procedure with few systemic reactions. To evaluate the rate of systemic reactions and their associations after SPT in the largest population to date. In this study reactions were recorded prospectively in a specialist UK allergy clinic for 6 years (2007-2013). An estimated 31,000 patients underwent SPT. Twenty-four patients (age range 7 months to 56 years, mean 23.5 years, 17 female patients, 12 with asthma) had systemic reactions. The rate of systemic reactions to SPT was 0.077%. The likely allergens causing the reaction were foods (18; peanut, 7; walnut, 1; Brazil nut, 2; pistachio, 1; lupin, 1; cow's milk, 2; shrimp, 1; spinach, 1; legume, 1; soy, 1), aeroallergens (4; rabbit, 1; rat, 1; ragwort, 1; grass pollen, 1), wasp venom (1), and Tazocin (1). The causative SPT wheal was larger than 8 mm in 75%. The reaction to Tazocin was severe, with anaphylaxis occurring minutes after SPT. Reactions were treated immediately in the clinic and did not require further medical care. In this largest single-center study, the rate of systemic reactions after SPT was 77 per 100,000 patients. It is the first study to identify foods as a common and important cause (75%), with nuts posing the highest risk. This study reports the first systemic reaction to venom SPT and the first anaphylactic reaction after drug SPT. There was an association with a history of severe reactions and large skin test reaction. There are risks, albeit small, when undertaking SPT. Copyright © 2015 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  10. The Norwegian National Reporting System and Register of Severe Allergic Reactions to Food

    Directory of Open Access Journals (Sweden)

    Martinus Løvik

    2009-10-01

    Full Text Available The Norwegian National Reporting System and Register of Severe Allergic Reactions to Food, or the Food Allergy Register, is a nation-wide, government-funded permanent reporting and registration system for severe allergic reactions to food. The Food Allergy Register collects information based on a one-page reporting form, serum samples for specific IgE analysis, and food samples for food allergen analysis. Reporting physicians receive in return an extensive commentary on the reported case and the relevant allergies, and results of the specific IgE analysis and food allergen analysis.The Food Allergy Register has, after being active for a little more than four years, given valuable information about several important aspects of food allergy in Norway. The Food Allergy Register has revealed food safety problems in relation to allergy that probably could be discovered only with the help of a systematic, nation-wide registration of cases. The reactions of peanut allergic individuals to lupine flour in bakery products is an example of how the Food Allergy Register is able to reveal potentially serious problems that would otherwise probably have gone unnoticed and certainly unexplained. The amount and the value of the information from the Food Allergy Register are increasing as new reports of more cases are added. The typical Norwegian patient with a severe allergic reaction to food appears to be a young adult, female rather than male. The offending meal is consumed at a restaurant or fast-food stand or in a private party away from home, and peanuts, nuts and shellfish are among the most common offending foods, while fish allergy appears to be rather rare.

  11. Effects of seed density and proximity to refuge habitat on seed predation rates for a rare and a common Lupinus species.

    Science.gov (United States)

    Pardini, Eleanor A; Patten, Melissa V; Knight, Tiffany M

    2017-03-01

    Biotic interactions such as seed predation can play a role in explaining patterns of abundance among plant species. The effect of seed predation will depend on how the strength of predation differs across species and environments, and on the degree to which seed loss at one life-cycle phase increases fitness at another phase. Few studies have simultaneously quantified predispersal and postdispersal predation in co-occurring rare and common congeners, despite the value of estimating both for understanding causes of rarity. We quantified predispersal seed predation on the rare, herbaceous species Lupinus tidestromii (Fabaceae) and its common, shrubby congener L. chamissonis across multiple years in the same community. We experimentally measured postdispersal seed predation at two seed densities and locations near or far from an exotic grass housing high densities of deer mice ( Peromyscus maniculatus ), their primary, native seed predator. The common L. chamissonis had the lowest predispersal seed predation of the two lupine species, potentially because of its height: its high racemes received less predation than those low to the ground. By contrast, the same species experienced higher postdispersal seed predation, and at predators traveled long distances away from refuge habitat to consume their seeds. Across both plant species, mice preferentially predated high-density seed sources. Our results show differences in the magnitude and direction of seed predation between the species across different life-cycle phases. We demonstrated possible roles of proximity to refuge habitat, seed density, and seed size in these patterns. Congeneric comparisons would benefit from a comprehensive framework that considers seed predation across different life-cycle phases and the environmental context of predation. © 2017 Botanical Society of America.

  12. Evaluation of water, sucrose and minerals effective diffusivities during osmotic treatment of pork in sugar beet molasses

    Directory of Open Access Journals (Sweden)

    Nićetin Milica R.

    2015-01-01

    Full Text Available Effective diffusivities of water, sucrose and minerals in osmotic treatment of pork cubes (M. triceps brachii were calculated using Response Surface Methodology (RSM, with respect to temperature (20, 35 and 50oC and concentration of sugar beet molasses, (60, 70 and 80% w/w. The numerical solution of Fick's' law for unsteady-state mass transfer in a perfect cube configuration was used to calculate the effective diffusivities of water, sucrose and minerals (Na, K, Ca and Mg. Zugarramurdi and Lupin's model was used to predict the equilibrium condition, which was shown to be appropriate for water loss and solute uptake during osmotic treatment. Effective diffusivity of water was found to be in the range of 6.95×10-10 - 8.03×10-10 m2s-1, the sucrose effective diffusivity was between 6.39×10-10 and 8.25×10-10 m2s-1, while diffusivities for minerals were in the range 6.34×10-10 - 8.82×10-10 m2s-1, for Na, 6.27×10-10 - 7.43×10-10 m2s-1, for K, 6.44×10-10 - 8.94×10-10 m2s-1, for Ca and 3.47×10-10 - 5.66×10-10 m2s-1, for Mg. [Projekat Ministarstva nauke Republike Srbije, br. TR 31055

  13. The Effect of pH and High-Pressure Homogenization on Droplet Size

    Directory of Open Access Journals (Sweden)

    Ah Pis Yong

    2017-12-01

    Full Text Available The aims of this study are to revisit the effect of high pressure on homogenization and the influence of pH on the emulsion droplet sizes. The high-pressure homogenization (HPH involves two stages of processing, where the first stage involves in blending the coarse emulsion by a blender, and the second stage requires disruption of the coarse emulsion into smaller droplets by a high-pressure homogenizer. The pressure range in this review is in between 10-500 MPa. The homogenised droplet sizes can be reduced by increasing the homogenization recirculation, and there is a threshold point beyond that by applying pressure only, the size cannot be further reduced. Normally, homogenised emulsions are classified by their degree of kinetic stability. Dispersed phase present in the form of droplets while continuous phase also known as suspended droplets. With a proper homogenization recirculation and pressure, a more kinetically stable emulsion can be produced. The side effects of increasing homogenization pressure are that it can cause overprocessing of the emulsion droplets where the droplet sizes become larger rather than the expected smaller size. This can cause kinetic instability in the emulsion. The droplet size is usually measured by dynamic light scattering or by laser light scattering technique. The type of samples used in this reviews are such as chocolate and vanilla based powders; mean droplet sizes samples; basil oil; tomato; lupin protein; oil; skim milk, soymilk; coconut milk; tomato homogenate; corn; egg-yolk, rapeseed and sunflower; Poly(4-vinylpyridine/silica; and Complex 1 until complex 4 approaches from author case study. A relationship is developed between emulsion size and pH. Results clearly show that lower pH offers smaller droplet of emulsion and the opposite occurs when the pH is increased.

  14. A Systematic Review of the Effects of Plant Compared with Animal Protein Sources on Features of Metabolic Syndrome.

    Science.gov (United States)

    Chalvon-Demersay, Tristan; Azzout-Marniche, Dalila; Arfsten, Judith; Egli, Léonie; Gaudichon, Claire; Karagounis, Leonidas G; Tomé, Daniel

    2017-03-01

    Dietary protein may play an important role in the prevention of metabolic dysfunctions. However, the way in which the protein source affects these dysfunctions has not been clearly established. The aim of the current systematic review was to compare the impact of plant- and animal-sourced dietary proteins on several features of metabolic syndrome in humans. The PubMed database was searched for both chronic and acute interventional studies, as well as observational studies, in healthy humans or those with metabolic dysfunctions, in which the impact of animal and plant protein intake was compared while using the following variables: cholesterolemia and triglyceridemia, blood pressure, glucose homeostasis, and body composition. Based on data extraction, we observed that soy protein consumption (with isoflavones), but not soy protein alone (without isoflavones) or other plant proteins (pea and lupine proteins, wheat gluten), leads to a 3% greater decrease in both total and LDL cholesterol compared with animal-sourced protein ingestion, especially in individuals with high fasting cholesterol concentrations. This observation was made when animal proteins were provided as a whole diet rather than given supplementally. Some observational studies reported an inverse association between plant protein intake and systolic and diastolic blood pressure, but this was not confirmed by intervention studies. Moreover, plant protein (wheat gluten, soy protein) intake as part of a mixed meal resulted in a lower postprandial insulin response than did whey. This systematic review provides some evidence that the intake of soy protein associated with isoflavones may prevent the onset of risk factors associated with cardiovascular disease, i.e., hypercholesterolemia and hypertension, in humans. However, we were not able to draw any further conclusions from the present work on the positive effects of plant proteins relating to glucose homeostasis and body composition. © 2017 American

  15. Fungal pathogens and antagonists in root-soil zone in organic and integrated systems of potato production

    Directory of Open Access Journals (Sweden)

    Lenc Leszek

    2016-04-01

    Full Text Available Occurrence of culturable Fungi and Oomycota in root-soil habitat of potato cv. Owacja in organic and integrated production systems at Osiny (northern Poland was compared in 2008-2010. The densities of both pathogens were significantly greater in the organic system. The eudominant fungal taxa (with frequency > 10% in at least one habitat included species of Fusarium + Gibberella + Haematonectria, Penicillium, Phoma and Trichoderma. The dominant taxa (with frequency 5-10% included species from 13 genera. In the rhizoplane, rhizosphere and non-rhizosphere soil, the total density of potential pathogens was greater in the integrated system, and of potential antagonists in the organic system. Among eudominant and dominant pathogens, Fusarium oxysporum and Gibellulopsis nigrescens occurred at greater density in the integrated system and Haematonectria haematococca and Phoma spp. in the organic system. Among eudominant antagonists, Trichoderma species occurred at greater density in the organic system. The organic system provided more disease suppressive habitat than the integrated system. The occurrence of brown leaf spot and potato blight was however similar in both systems. The mean yield of organic potatoes (24.9 t · ha-1 was higher than the mean organic potato yield in Poland (21.0 t · ha-1 and similar to the mean in other European countries (Germany 25.1 t · ha-1, Great Britain 25.0 t · ha-1. The organic system, based on a 5-year rotation, with narrow-leafed lupin, white mustard and buckwheat as a cover crop, inorganic fertilization based on ground rock phosphate + potassium sulphate, and biological and chemical control of insects and diseases (Bacillus thuringiensis ssp. tenebrionis + copper hydroxide + copper oxychloride, may be recommended for use in central Europe.

  16. Waffle production: influence of batter ingredients on sticking of fresh egg waffles at baking plates-Part I: effect of starch and sugar components.

    Science.gov (United States)

    Huber, Regina; Schoenlechner, Regine

    2017-05-01

    Fresh egg waffles are a sweet convenience product typically baked from eggs, water, sugar, flour, fat, leavening agents, emulsifiers, preservatives, and flavors. In industrial production, waffles are baked continuously in high amounts of up to 200 kg raw material per hour. Therefore, it is important that the waffles do not stick onto the baking plates, which can cause significant product loss and increased costs due to interruption of the baking process, required cleaning procedures, and restarting of the energy-consuming start-up phase. Sticking of waffles is greatly influenced not only by baking plate material, release agent, baking temperature, and time, but also by the batter ingredients. In this study, effects of different starches and sugar components were investigated. Within the selected starches, potato starch demonstrated the highest effects on increasing waffle stability and releasing properties compared to wheat and lupine flour (less than 7% sticking waffles). Rice flour performed worst, with almost 50% of sticking waffles. Most of these waffles were broken during take-off, due to their crumbly texture. Within the sugar components, glycerine was better suitable than sorbitol and crystal sugar was superior compared to powdered sugar. They required less take-off force. It could be demonstrated that waffles with increased stability and texture were those that showed the least number of sticking waffles, thus the main aim of batter ingredients was to improve waffle quality. Waffle quality was influenced by batter parameters, significant correlations could be found, for example, a positive correlation between pH- and L-value, negative correlations between pH- and a-value, or density and aw-value. This resulted in significant correlations with take-off-force, which was correlated with L*- and b*-value (negative) and positive to a*-value. Sticking behavior was strongly associated with b*-value (positive) and to a*-value (negative).

  17. The effects of rapeseed meal and legume seeds as substitutes for soybean meal on productivity and gastrointestinal function in rabbits.

    Science.gov (United States)

    Gugołek, Andrzej; Juśkiewicz, Jerzy; Strychalski, Janusz; Zwoliński, Cezary; Żary-Sikorska, Ewa; Konstantynowicz, Małgorzata

    2017-08-01

    The aim of this study was to determine the effects of soybean meal (SBM) substitution by a mixture of rapeseed meal (RSM), white lupine seeds (WLS) and pea seeds (PS) on productivity, nutrient digestibility, nitrogen retention and gastrointestinal function in Hyplus rabbits. The Control diet (SBM 15 ) contained 15% SBM, whereas Diet SBM 7.5 contained 7.5% SBM, 5% RSM, 4% WLS and 3% PS. In Diet SBM 0, SBM was completely replaced by RSM, WLS and PS (10%, 8% and 6%, respectively). A production trial was performed on 90 Hyplus rabbits aged from 35 to 84 d (45 each sex; 953 ± 4.6 g). A digestion and balance trial was conducted on 30 rabbits. Additionally, several parameters of the gastrointestinal tracts from eight animals from each group were analysed, where special attention was paid to the enzymatic activity of microbiota and the short-chain fatty acids concentration in caecum and colon. The experimental diets did not cause significant differences regarding performance parameters evaluated in vivo and post-mortem, and in the nutrient and energy digestibility or nitrogen retention. The observed changes in the enzymatic activity of large gut microbiota, including the selective increase in secretion of glycoside hydrolases by bacterial cells, seem to be responsible for the unchanged growth performance of rabbits fed diets where SBM was substituted by a mixture of RSM, WLS and PS. The obtained results indicate that in rabbit diets SBM may be, partially or completely, successfully replaced by a feed mixture of RSM, WLS and PS.

  18. Lupanine Improves Glucose Homeostasis by Influencing KATP Channels and Insulin Gene Expression

    Directory of Open Access Journals (Sweden)

    Mats Wiedemann

    2015-10-01

    Full Text Available The glucose-lowering effects of lupin seeds involve the combined action of several components. The present study investigates the influence of one of the main quinolizidine alkaloids, lupanine, on pancreatic beta cells and in an animal model of type-2 diabetes mellitus. In vitro studies were performed with insulin-secreting INS-1E cells or islets of C57BL/6 mice. In the in vivo experiments, hyperglycemia was induced in rats by injecting streptozotocin (65 mg/kg body weight. In the presence of 15 mmol/L glucose, insulin secretion was significantly elevated by 0.5 mmol/L lupanine, whereas the alkaloid did not stimulate insulin release with lower glucose concentrations. In islets treated with l-arginine, the potentiating effect of lupanine already occurred at 8 mmol/L glucose. Lupanine increased the expression of the Ins-1 gene. The potentiating effect on secretion was correlated to membrane depolarization and an increase in the frequency of Ca2+ action potentials. Determination of the current through ATP-dependent K+ channels (KATP channels revealed that lupanine directly inhibited the channel. The effect was dose-dependent but, even with a high lupanine concentration of 1 mmol/L or after a prolonged exposure time (12 h, the KATP channel block was incomplete. Oral administration of lupanine did not induce hypoglycemia. By contrast, lupanine improved glycemic control in response to an oral glucose tolerance test in streptozotocin-diabetic rats. In summary, lupanine acts as a positive modulator of insulin release obviously without a risk for hypoglycemic episodes.

  19. Propiedades mecánicas de aceites y grasas vegetales

    Directory of Open Access Journals (Sweden)

    de Dios Alvarado, Juan

    1995-10-01

    Full Text Available Data of mechanical properties are presented for crude oils from avocado pulp, lupin grain, peanuts, soybean, sesame, cotton, castor-oil, linseed and passion fruit seeds; refined oils from sunflower, corn, peanut, olive and soybean; and cocoa, coconut, palm-oil and kernel palm-oil fats.
    Correlation equations which describe the effect of temperature on the refractive index, density, viscosity and surface tension are obtained, and values of coefficient of expansion and activation energy for flow are calculated.

    Se presentan los valores de las principales propiedades mecánicas determinadas en aceites crudos extraídos de pulpa de aguacate, granos o semillas de sésamo, algodón, altramuz o chocho, ricino, linaza, maní o cacahuete, maracuyá y soja; aceites refinados provenientes de semillas de girasol, germen de maíz, maní, oliva y soja; grasas extraídas de cacao, copra de coco, pulpa de palma africana y almendras de palma africana.
    Con los datos experimentales se establecen ecuaciones de correlación que describen el efecto de la temperatura sobre el índice de refracción, la densidad, la viscosidad y la tensión superficial. En cada producto, con los datos de la densidad se calcula el coeficiente volumétrico de expansión térmica y con los de la viscosidad la energía de activación.

  20. The structure of a purple acid phosphatase involved in plant growth and pathogen defence exhibits a novel immunoglobulin-like fold

    Directory of Open Access Journals (Sweden)

    Svetlana Vladimirovna Antonyuk

    2014-03-01

    Full Text Available Phosphatases function in the production, transport and recycling of inorganic phosphorus, which is crucial for cellular metabolism and bioenergetics, as well as in bacterial killing, since they are able to generate reactive oxygen species via Fenton chemistry. Diphosphonucleotide phosphatase/phosphodiesterase (PPD1, a glycoprotein plant purple acid phosphatase (PAP from yellow lupin seeds, contains a bimetallic Fe–Mn catalytic site which is most active at acidic pH. Unlike other plant PAPs, PPD1 cleaves the pyrophosphate bond in diphosphonucleotides and the phosphodiester bond in various phosphodiesters. The homohexameric organization of PPD1, as revealed by a 1.65 Å resolution crystal structure and confirmed by solution X-ray scattering, is unique among plant PAPs, for which only homodimers have previously been reported. A phosphate anion is bound in a bidentate fashion at the active site, bridging the Fe and Mn atoms in a binding mode similar to that previously reported for sweet potato PAP, which suggests that common features occur in their catalytic mechanisms. The N-terminal domain of PPD1 has an unexpected and unique fibronectin type III-like fold that is absent in other plant PAPs. Here, the in vitro DNA-cleavage activity of PPD1 is demonstrated and it is proposed that the fibronectin III-like domain, which `overhangs' the active site, is involved in DNA selectivity, binding and activation. The degradation of DNA by PPD1 implies a role for PPD1 in plant growth and repair and in pathogen defence.

  1. Transferability of molecular markers from major legumes to Lathyrus spp. for their application in mapping and diversity studies.

    Science.gov (United States)

    Almeida, Nuno Felipe; Trindade Leitão, Susana; Caminero, Constantino; Torres, Ana Maria; Rubiales, Diego; Vaz Patto, Maria Carlota

    2014-01-01

    Lathyrus cicera L. (chickling pea) and L. sativus L. (grass pea) have great potential among grain legumes due to their adaptability to inauspicious environments, high protein content and resistance to serious diseases. Nevertheless, due to its past underused, further activities are required to exploit this potential and to capitalise on the advances in molecular biology that enable improved Lathyrus spp. breeding programmes. In this study we evaluated the transferability of molecular markers developed for closely related legume species to Lathyrus spp. (Medicago truncatula, pea, lentil, faba bean and lupin) and tested the application of those new molecular tools on Lathyrus mapping and diversity studies. Genomic and expressed sequence tag microsatellite, intron-targeted amplified polymorphic, resistance gene analogue and defence-related gene markers were tested. In total 128 (27.7 %) and 132 (28.6 %) molecular markers were successfully cross-amplified, respectively in L. cicera and L. sativus. In total, the efficiency of transferability from genomic microsatellites was 5 %, and from gene-based markers, 55 %. For L. cicera, three cleaved amplified polymorphic sequence markers and one derived cleaved amplified polymorphic sequence marker based on the cross-amplified markers were also developed. Nine of those molecular markers were suitable for mapping in a L. cicera recombinant inbred line population. From the 17 molecular markers tested for diversity analysis, six (35 %) in L. cicera and seven (41 %) in L. sativus were polymorphic and discriminate well all the L. sativus accessions. Additionally, L. cicera accessions were clearly distinguished from L. sativus accessions. This work revealed a high number of transferable molecular markers to be used in current genomic studies in Lathyrus spp. Although their usefulness was higher on diversity studies, they represent the first steps for future comparative mapping involving these species.

  2. Food legume production in China

    Directory of Open Access Journals (Sweden)

    Ling Li

    2017-04-01

    Full Text Available Food legumes comprise all legumes grown for human food in China as either dry grains or vegetables, except for soybean and groundnut. China has a vast territory with complex ecological conditions. Rotation, intercropping, and mixed cropping involving pulses are normal cropping systems in China. Whether indigenous or introduced crops, pulses have played an important role in Chinese cropping systems and made an important contribution to food resources for humans since ancient times. The six major food legume species (pea, faba bean, common bean, mung bean, adzuki bean, and cowpea are the most well-known pulses in China, as well as those with more local distributions; runner bean, lima bean, chickpea, lentil, grass pea, lupine, rice bean, black gram, hyacinth bean, pigeon pea, velvet bean, winged bean, guar bean, sword bean, and jack bean. China has remained the world's leading producer of peas, faba beans, mung beans, and adzuki beans in recent decades, as documented by FAO statistics and China Agriculture Statistical Reports. The demand for food legumes as a healthy food will markedly increase with the improvement of living standards in China. Since China officially joined the World Trade Organization (WTO in 2001, imports of pea from Canada and Australia have rapidly increased, resulting in reduced prices for dry pea and other food legumes. With reduced profits for food legume crops, their sowing area and total production has decreased within China. At the same time, the rising consumer demand for vegetable food legumes as a healthy food has led to attractive market prices and sharp production increases in China. Vegetable food legumes have reduced growing duration and enable flexibility in cropping systems. In the future, production of dry food legumes will range from stable to slowly decreasing, while production of vegetable food legumes will continue to increase.

  3. Approaches to the production and use of microbial transglutaminase in emulsified meat and vegetable systems

    Directory of Open Access Journals (Sweden)

    I. A. Glotova

    2017-01-01

    Full Text Available In the technology of traditional and new forms of food, the modification of structure of proteins is carry out in two opposite directions: the hydrolytic destruction of high-molecular polymers and the artificial creation of polymeric structures of high molecular mass. The transglutaminase preparations (protein-glutamine (-glutamyltransferase, EC 2.3.2.13, TG are used in practical work for realization of the second direction. The main mechanisms of action are polymerization reactions, which lead to a change in the hydrophobicity of protein molecules. The main catalyzed reactions are acyl transfer, binding between glutamine and lysine residues of proteins and deamination. The authors analyzed the approaches to the preparation, properties and studied the joint effect of temperature and pH on the activity of the commercial preparation Revada TG 11 with the application of an enzymatic colorimetric test. The authors studied combined stuffing systems based on beef, pork, poultry mechanical deboning, as well as replacing part of the raw material with protein-carbohydrate compositions with Revada TG 11. The results were used to develop simulated meat systems of biopolymer compositions (SMSBC, approximate in structure and properties to the gels formed by actin and myosin during extraction from myofibrils under the traditional technological processes of meat products production - maturation, salt curing, fine meat grinding. SMSBC includes lupine flour bio-activated by germination, a preparations of dietary fiber as well as a preparation of transglutaminase Revada TG 11. The protein components of the secondary raw materials during the processing of milk such as sodium caseinate, and also whey were used to balance the amino acid composition of the food systems. For practical use, the following options for SMSBC introducing into the composition of minced meat emulsions were recommended by the authors: in the form of hydrated biopolymer dispersion at cutting

  4. [Establishment of optimun conditions in order to obtain a protein isolate from Chilean Hazelnut].

    Science.gov (United States)

    Villarroel, Mario; Zapata, Constanza; Pino, Leonardo; Rubilar, Mónica

    2012-03-01

    An alternative to solve the problem of the overall deficit of proteins has been the use ofdefatted cakes generated by the extraction of oil from vegetable sources such as rapeseed, soybean, lupin, etc. This process at the same time increases the protein content, making this feasible to be used to enrich some types of food. This is the case of the chilean hazelnut (Gevuina avellana, Mol), monotypic species characterized by their high percentage of oil (50%) and whose defatted cake isolated protein could be used to obtain an isolated protein. For this purpose optimized conditions of extraction of protein were carried out using the surface response methodology (SRM) and a central composite design with three independent variables: time of contact of the cake with the solvent, sample/solvent ratio and pH was used. All variables were controlled at five different levels. The data were subjected to an analysis of regression and ANOVA, the first to determine the polynomial equation and the second to select the control factors with significant effect on the extraction of the protein. The best combination of factors turned out to be: time between 30 and 40 minutes, pH between 9 and 9.5 and a relationship sample/solvent between 1/15 to 1/16 with a final yield of 76%. The physical characteristics were: density 0,504 g/cm3, compaction 43, 34% apparent and pale yellow. Proximal analysis showed a concentration of protein of 76%, 13%, raw fiber carbohydrate 0.68% and oil 1.29%. With regard to the functional properties emphasized water absorption (320 g/100 g), absorption of oil (410 g/100 g) and foaming capacity (221%).

  5. Detection of some safe plant-derived foods for LTP-allergic patients.

    Science.gov (United States)

    Asero, Riccardo; Mistrello, Gianni; Roncarolo, Daniela; Amato, Stefano

    2007-01-01

    Lipid transfer protein (LTP) is a widely cross-reacting plant pan-allergen. Adverse reactions to Rosaceae, tree nuts, peanut, beer, maize, mustard, asparagus, grapes, mulberry, cabbage, dates, orange, fig, kiwi, lupine, fennel, celery, tomato, eggplant, lettuce, chestnut and pineapple have been recorded. To detect vegetable foods to be regarded as safe for LTP-allergic patients. Tolerance/intolerance to a large spectrum of vegetable foods other than Rosaceae, tree nuts and peanut was assessed by interview in 49 subjects monosensitized to LTP and in three distinct groups of controls monosensitized to Bet v 1 (n = 24) or Bet v 2 (n = 18), or sensitized to both LTP and birch pollen (n = 16), all with a history of vegetable food allergy. Patients and controls underwent skin prick test (SPT) with a large spectrum of vegetable foods. The absence of IgE reactivity to foods that were negative in both clinical history and SPT was confirmed by immunoblot analysis and their clinical tolerance was finally assessed by open oral challenge (50 g per food). All patients reported tolerance and showed negative SPT to carrot, potato, banana and melon; these foods scored positive in SPT and elicited clinical symptoms in a significant proportion of patients from all three control groups. All patients tolerated these four foods on oral challenge. Immunoblot analysis confirmed the lack of IgE reactivity to these foods by LTP-allergic patients. Carrot, potato, banana and melon seem safe for LTP-allergic patients. This finding may be helpful for a better management of allergy to LTP.

  6. The pattern of LH secretion and the ovarian response to the 'ram effect' in the anoestrous ewe is influenced by body condition but not by short-term nutritional supplementation.

    Science.gov (United States)

    Scaramuzzi, R J; Oujagir, L; Menassol, J-B; Freret, S; Piezel, A; Brown, H M; Cognié, J; Fabre Nys, C

    2014-10-01

    In sheep, the 'ram effect' induces out-of-season fertility and good nutrition increases prolificacy. This experiment determined if fatness or short-term nutritional supplementation modified the response to the 'ram effect'. A group of 48 Île-de-France ewes were fed diets that produced groups with body-condition scores (BCS) of >3.0 and <2.0. Within each BCS group animals were supplemented daily with 500g of lupins from Day -5 to Day 0 (ram introduction) resulting in four groups: low BCS, supplemented (n=7) and non-supplemented (n=8) and high BCS, supplemented (n=12) and non-supplemented (n=11). The blood concentrations of glucose and insulin and the LH response to gonadotrophin-releasing hormone (GnRH) were determined. After the 'ram effect' the pattern of LH pulsatility, the LH surge and ovarian responses were analysed. Low BCS ewes had lower glucose and insulin (P<0.001) and supplementation increased both (P≤0.001). The increase in LH induced by GnRH was reduced in low BCS ewes (P=0.015) but it was not affected by supplementation. Similarly, LH pulsatility was reduced in low BCS ewes (P<0.05). The LH surge and ovarian cyclicity were not affected but the follow-up cycle was delayed (P=0.034) and progesterone was reduced (P=0.029) in low BCS ewes. There was an effect of BCS on ovulation rate (P<0.05). These results show that the BCS can modify the response to the 'ram effect' and that supplementation has little effect on this response.

  7. Identification and characterisation of the IgE-binding proteins 2S albumin and conglutin gamma in almond (Prunus dulcis) seeds.

    Science.gov (United States)

    Poltronieri, P; Cappello, M S; Dohmae, N; Conti, A; Fortunato, D; Pastorello, E A; Ortolani, C; Zacheo, G

    2002-06-01

    Almond proteins can cause severe anaphylactic reactions in susceptible individuals. The aim of this study was the identification of IgE-binding proteins in almonds and the characterisation of these proteins by N-terminal sequencing. Five sera were selected from individuals with a positive reaction to food challenge. Sodium dodecylsulphate-polyacrylamide gel electrophoresis and immunoblotting were performed on almond seed proteins. Purified IgE-binding proteins were tested for immunoblot inhibition with sera pre-incubated with extracts of hazelnut and walnut. N-terminal sequences of the 12-, 30- and 45-kD proteins were obtained. The 45- and 30-kD proteins shared the same N terminus, with 60% homology to the conglutin gamma heavy chain from lupine seed (Lupinus albus) and to basic 7S globulin from soybean (Glycine max). The sequences of the N-terminal 12-kD protein and of an internal peptide obtained by endoproteinase digestion showed good homology to 2S albumin from English walnut (Jug r 1). Immunoblot inhibition experiments were performed and IgE binding to almond 2S albumin and conglutin gamma was detected in the presence of cross-reacting walnut or hazelnut antigens. Two IgE-binding almond proteins were N-terminally sequenced and identified as almond 2S albumin and conglutin gamma. Localisation and conservation of IgE binding in a 6-kD peptide obtained by endoproteinase digestion of 2S albumin was shown. Copyright 2002 S. Karger AG, Basel

  8. Lumichrome and riboflavin are two novel symbiotic signals eliciting developmental changes in both monocot and dicot plant species

    Directory of Open Access Journals (Sweden)

    Felix Dapare Dakora

    2015-09-01

    Full Text Available Lumichrome and riboflavin are novel molecules from rhizobial exudates that stimulate plant growth. Developmental changes elicited by lumichrome at very low nanomolar concentrations (5 nM include early initiation of trifoliate leaves, expansion of unifoliate and trifoliate leaves, increased stem elongation and leaf area, and consequently greater biomass accumulation in monocots and dicots. However, higher lumichrome concentration (50 nM depressed root development and reduced growth of unifoliate and second trifoliate leaves. Applying either 10 nM lumichrome, 10 nM ABA, or 10 ml of infective rhizobial cells (0.2 OD600 to roots of monocots and dicots for 44 h produced identical effects, which included decreased stomatal conductance and leaf transpiration in Bambara groundnut, soybean and maize, increased stomatal conductance and transpiration in cowpea and lupin, and elevated root respiration in maize (19% by rhizobia and 20% by lumichrome. Extracellular exudation of lumichrome, riboflavin and IAA was greater in N2-fixing rhizobia than non-fixing bacteria, indicating their role as symbiotic signals. Xylem concentration of lumichrome in cowpea and soybean was greater in plants inoculated with infective rhizobia and treated with lumichrome (61.2 µmol lumichrome.ml-1 sap, followed by uninoculated plants receiving lumichrome (41.12 µmol lumichrome.ml-1 sap, and lowest in uninoculated, lumichrome-free plants (26.8 µmol lumichrome.ml-1 sap. Overall, soybean showed greater xylem concentration of lumichrome and a correspondingly increased accumulation in leaves relative to cowpea. As a result, soybean exhibited dramatic developmental changes than cowpea. Taken together, lumichrome and riboflavin secreted by soil rhizobia function as environmental cues for sensing stress. The fact that exogenous application of ABA to plant roots caused the same effect as lumichrome on stomatal functioning suggests molecular cross-talk in plant response to environmental

  9. In-depth glycoproteomic characterization of γ-conglutin by high-resolution accurate mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Silvia Schiarea

    Full Text Available The molecular characterization of bioactive food components is necessary for understanding the mechanisms of their beneficial or detrimental effects on human health. This study focused on γ-conglutin, a well-known lupin seed N-glycoprotein with health-promoting properties and controversial allergenic potential. Given the importance of N-glycosylation for the functional and structural characteristics of proteins, we studied the purified protein by a mass spectrometry-based glycoproteomic approach able to identify the structure, micro-heterogeneity and attachment site of the bound N-glycan(s, and to provide extensive coverage of the protein sequence. The peptide/N-glycopeptide mixtures generated by enzymatic digestion (with or without N-deglycosylation were analyzed by high-resolution accurate mass liquid chromatography-multi-stage mass spectrometry. The four main micro-heterogeneous variants of the single N-glycan bound to γ-conglutin were identified as Man2(Xyl (Fuc GlcNAc2, Man3(Xyl (Fuc GlcNAc2, GlcNAcMan3(Xyl (Fuc GlcNAc2 and GlcNAc 2Man3(Xyl (Fuc GlcNAc2. These carry both core β1,2-xylose and core α1-3-fucose (well known Cross-Reactive Carbohydrate Determinants, but corresponding fucose-free variants were also identified as minor components. The N-glycan was proven to reside on Asn131, one of the two potential N-glycosylation sites. The extensive coverage of the γ-conglutin amino acid sequence suggested three alternative N-termini of the small subunit, that were later confirmed by direct-infusion Orbitrap mass spectrometry analysis of the intact subunit.

  10. Are Isolated and Complex Fiber Supplements Good Choices for Weight Management? A Systematic Review.

    Science.gov (United States)

    Namazi, Nazli; Larijani, Bagher; Azadbakht, Leila

    2017-11-01

    Previous trials have reported beneficial effects of isolated and complex fiber supplements in obesity treatment. However, recommending fiber supplements in obese subjects remains controversial. To the best of our knowledge, no systematic review has updated the data on the effects of fiber supplements on obesity since 2010 and the need exists for a systematic review on this topic. Accordingly, a systematic review was undertaken to summarize the efficacy of different types of fiber supplements as a complementary treatment for weight management. We searched PubMed, Scopus, Cochrane Library and Google Scholar between January 2010 to August 2016 with no language restriction. Considering the inclusion/exclusion criteria and quality assessment score, finally 17 clinical trials met the eligibility criteria and were included. The present study indicated that the efficacy of various fiber supplements on losing weight is variable. Several mechanisms related to physicochemical properties of fibers such as solubility, fermentability and viscosity rates can be involved in their anti-obesity effects. Dextrin, Mannan (gum Arabic) and pectin-rich fiber (lupin kernel) with no dietary interventions indicated a reduction in body weight and energy intake, while from clinical point of view, their effects were not considerable. Overall, findings indicated that the efficacy of fiber supplements on obesity management is dependent on their contents and physicochemical properties. It seems that fiber supplements with no weight-loss interventions did not have considerable antiobesity effects. However, due to limited studies on each type of fiber, findings should be declared by caution. Additional research is needed on comparison of different fiber supplements in similar conditions to clarify the best type and dosage of fiber supplement as a complementary therapy in obesity management.

  11. Numerical approaches to expansion process modeling

    Directory of Open Access Journals (Sweden)

    G. V. Alekseev

    2017-01-01

    Full Text Available Forage production is currently undergoing a period of intensive renovation and introduction of the most advanced technologies and equipment. More and more often such methods as barley toasting, grain extrusion, steaming and grain flattening, boiling bed explosion, infrared ray treatment of cereals and legumes, followed by flattening, and one-time or two-time granulation of the purified whole grain without humidification in matrix presses By grinding the granules. These methods require special apparatuses, machines, auxiliary equipment, created on the basis of different methods of compiled mathematical models. When roasting, simulating the heat fields arising in the working chamber, provide such conditions, the decomposition of a portion of the starch to monosaccharides, which makes the grain sweetish, but due to protein denaturation the digestibility of the protein and the availability of amino acids decrease somewhat. Grain is roasted mainly for young animals in order to teach them to eat food at an early age, stimulate the secretory activity of digestion, better development of the masticatory muscles. In addition, the high temperature is detrimental to bacterial contamination and various types of fungi, which largely avoids possible diseases of the gastrointestinal tract. This method has found wide application directly on the farms. Apply when used in feeding animals and legumes: peas, soy, lupine and lentils. These feeds are preliminarily ground, and then cooked or steamed for 1 hour for 30–40 minutes. In the feed mill. Such processing of feeds allows inactivating the anti-nutrients in them, which reduce the effectiveness of their use. After processing, legumes are used as protein supplements in an amount of 25–30% of the total nutritional value of the diet. But it is recommended to cook and steal a grain of good quality. A poor-quality grain that has been stored for a long time and damaged by pathogenic micro flora is subject to

  12. Rapid and recent world-wide diversification of bluegrasses (Poa, Poaceae and related genera.

    Directory of Open Access Journals (Sweden)

    Matthias H Hoffmann

    Full Text Available Rapid species diversifications provide fascinating insight into the development of biodiversity in time and space. Most biological radiations studied to date, for example that of cichlid fishes or Andean lupines, are confined to isolated geographical areas like lakes, islands or island-like regions. Using DNA sequence data of the ribosomal internal transcribed spacer (ITS for many species of the Poa alliance, a group comprising about 775 C3 grass species, revealed rapid and parallel diversifications in various parts of the world. Some of these radiations are restricted to isolated areas like the Andes, whereas others are typical of the lowlands of mainly the northern hemisphere. These radiations thus are not restricted to island-like areas and are seemingly actively ongoing. The ages of the diversifying clades are estimated to be 2.5-0.23 million years (Myr. Conservative diversification rates in the Poa alliance amount to 0.89-3.14 species per Myr, thus are in the order of, or even exceeding, other instances of well-known radiations. The grass radiations of the mainly cold-adapted Poa alliance coincide with the Late Tertiary global cooling, which resulted in the retreat of forests and the subsequent formation of cold-adapted grasslands especially in the northern, but also in parts of the southern hemisphere. The cold tolerance, suggested to be one of the ecological key innovations, may have been acquired during the early diversification of the subfamily Pooideae, but became significant millions of years later during the Pliocene/Pleistocene radiation of the Poa alliance.

  13. Survival and Competitiveness of Bradyrhizobium japonicum Strains 20 Years after Introduction into Field Locations in Poland.

    Science.gov (United States)

    Narożna, Dorota; Pudełko, Krzysztof; Króliczak, Joanna; Golińska, Barbara; Sugawara, Masayuki; Mądrzak, Cezary J; Sadowsky, Michael J

    2015-08-15

    It was previously demonstrated that there are no indigenous strains of Bradyrhizobium japonicum forming nitrogen-fixing root nodule symbioses with soybean plants in arable field soils in Poland. However, bacteria currently classified within this species are present (together with Bradyrhizobium canariense) as indigenous populations of strains specific for nodulation of legumes in the Genisteae tribe. These rhizobia, infecting legumes such as lupins, are well established in Polish soils. The studies described here were based on soybean nodulation field experiments, established at the Poznań University of Life Sciences Experiment Station in Gorzyń, Poland, and initiated in the spring of 1994. Long-term research was then conducted in order to study the relation between B. japonicum USDA 110 and USDA 123, introduced together into the same location, where no soybean rhizobia were earlier detected, and nodulation and competitive success were followed over time. Here we report the extra-long-term saprophytic survival of B. japonicum strains nodulating soybeans that were introduced as inoculants 20 years earlier and where soybeans were not grown for the next 17 years. The strains remained viable and symbiotically competent, and molecular and immunochemical methods showed that the strains were undistinguishable from the original inoculum strains USDA 110 and USDA 123. We also show that the strains had balanced numbers and their mobility in soil was low. To our knowledge, this is the first report showing the extra-long-term persistence of soybean-nodulating strains introduced into Polish soils and the first analyzing the long-term competitive relations of USDA 110 and USDA 123 after the two strains, neither of which was native, were introduced into the environment almost 2 decades ago. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Strategies for ruminant nutrition during a harsh and extended dry season

    International Nuclear Information System (INIS)

    Rowe, J.B.

    1991-01-01

    The strategies for improving ruminant nutrition during dry summer periods include: development of pasture species, the use of deep rooting shrubs and legumes which provide green foliage throughout the year, and supplementary feeding. Of these strategies, supplementary feeding offers an immediate means of improving the nutrition of grazing animals. A series of experiments is described which were designed to investigate appropriate methods of supplementary feeding and the possibility of using feed additives to control acidosis when starch rich grains are fed. The results show that although mineral supplements, licks and blocks, appear to provide a convenient and economic method of feeding grazing animals it is the macronutrients (energy and protein) that are the primary limiting nutrients when feed on offer is scarce and of a low nutritional value. Cereal grains are often the most widely available source of supplementary feed in countries such as Australia. The level of starch in these grains disrupts rumen fermentation to the extent that their use as supplements is inefficient and may not be cost effective. On the other hand, legume seeds (e.g. lupins), known to be low in starch, are very effective sources of supplementary nutrients. Feed additives may be used to control lactic acidosis when starch rich grain is fed and further work is needed to determine other ways of improving the efficiency with which cereal grains are utilized. The paper focuses on supplementary feeding, but it is concluded that the development of improved pasture species and systems for utilizing shrubs and trees should remain long term objectives for any animal production system in which protracted dry periods are expected. (author). 18 refs, 6 figs, 6 tabs

  15. Weed infestation of spring barley (Hordeum vulgare L. depending on the cover crop and weed control method

    Directory of Open Access Journals (Sweden)

    Dorota Gawęda

    2014-04-01

    Full Text Available The aim of this 3-year field study was to evaluate the effect of some stubble crops and weed control methods on the species composition, number and air-dry weight of weeds in a spring barley crop grown in short-term monoculture. The study was conducted in the period 2009–2011 at the Uhrusk Experimental Farm, on mixed rendzina soil classified as very good rye soil complex. It included stubble crops which were ploughed under in each year (control treatment without cover crop, white mustard, lacy phacelia, a mixture of legumes – narrow-leaf lupin + field pea and 3 weed control methods used in spring barley crops (mechanical, mechanical and chemical, chemical weed control. Veronica persica was the weed species that occurred in greatest numbers in the spring barley crop sown after stubble crops. All cover crops reduced the numbers of Avena fatua which was the dominant species in the control treatment. Chemical as well as chemical and mechanical weed control significantly reduced the numbers of Avena fatua compared to the treatment where only double harrowing was used for weed control. The stubble crops did not reduce weed infestation of spring barley. Compared to the control treatment, the ploughing-in of white mustard and the mixture of legumes reduced the dry weight of weeds by 49.1 and 22.7%, respectively. Mechanical weed management proved to be less effective in reducing the number and dry weight of weeds compared to the other weed control methods. A significant negative correlation was found between the dry weight of weeds in the spring barley crop and the dry weight of the ploughed-in white mustard cover crop under the conditions of chemical weed control as well as in the case of the mixture of legumes when complete mechanical and chemical weed control was used.

  16. Comparison between Laying Hen Performance in the Cage System and the Deep Litter System on a Diet Free from Animal Protein

    Directory of Open Access Journals (Sweden)

    E. Voslářová

    2006-01-01

    Full Text Available Battery cage systems for housing laying hens are being replaced by alternative systems including the deep litter system. At the same time, the substitution of meat and bone meal by vegetable matter in poultry feed mixtures is sought in the nutrition of laying hens. In the experiment, we compared the performance of laying hens of the ISA BROWN hybrid in both the cage system and the deep litter system, on a diet with the meat and bone meal content replaced by vegetable feeds (based on lupin. In the first group, 36 laying hens were kept in the deep litter system; in the second group, 36 laying hens were kept in cages. Over the period of nine months, the number of eggs laid, their weight, shell quality, the clinical state of the laying hens and incidence of their mortality were monitored daily. We found that in the cage system a higher number of eggs was obtained; a lower mean egg weight (p p p p p > 0.05, and the number of laying hens which died was lower (p < 0.05 in comparison with the deep litter system. The results of the experiment demonstrate that, with the substitution of meat and bone meal by vegetable matter in the feed mixtures for laying hens, there are differences between the performance of laying hens from the deep litter system as compared to the laying hens from the cage system. The deep litter system better meets the requirements for the welfare of laying hens; however, it provides a lower yield.

  17. Visualization of root water uptake: quantification of deuterated water transport in roots using neutron radiography and numerical modeling.

    Science.gov (United States)

    Zarebanadkouki, Mohsen; Kroener, Eva; Kaestner, Anders; Carminati, Andrea

    2014-10-01

    Our understanding of soil and plant water relations is limited by the lack of experimental methods to measure water fluxes in soil and plants. Here, we describe a new method to noninvasively quantify water fluxes in roots. To this end, neutron radiography was used to trace the transport of deuterated water (D2O) into roots. The results showed that (1) the radial transport of D2O from soil to the roots depended similarly on diffusive and convective transport and (2) the axial transport of D2O along the root xylem was largely dominated by convection. To quantify the convective fluxes from the radiographs, we introduced a convection-diffusion model to simulate the D2O transport in roots. The model takes into account different pathways of water across the root tissue, the endodermis as a layer with distinct transport properties, and the axial transport of D2O in the xylem. The diffusion coefficients of the root tissues were inversely estimated by simulating the experiments at night under the assumption that the convective fluxes were negligible. Inverse modeling of the experiment at day gave the profile of water fluxes into the roots. For a 24-d-old lupine (Lupinus albus) grown in a soil with uniform water content, root water uptake was higher in the proximal parts of lateral roots and decreased toward the distal parts. The method allows the quantification of the root properties and the regions of root water uptake along the root systems. © 2014 American Society of Plant Biologists. All Rights Reserved.

  18. Where the wild things are: Seasonal variation in caribou distribution in relation to climate change

    Directory of Open Access Journals (Sweden)

    Philippa McNeil

    2005-05-01

    Full Text Available In this study, we develop a method to analyse the relationships between seasonal caribou distribution and climate, to estimate how climatic conditions affect interactions between humans and caribou, and ultimately to predict patterns of distribution relative to climate change. Satellite locations for the Porcupine (Rangifer tarandus granti and Bathurst (R. t. groenlandicus caribou herds were analysed for eight ecologically-defined seasons. For each season, two levels of a key environmental factor influencing caribou distribution were identified, as well as the best climate data available to indicate the factor's annual state. Satellite locations were grouped according to the relevant combination of season and environmental factor. Caribou distributions were compared for opposing environmental factors; this comparison was undertaken relative to hunting access for the Porcupine Herd and relative to exposure to mining activity for the Bathurst Herd. Expected climate trends suggest an overall increase in access to Porcupine caribou for Aklavik (NWT hunters during the winter and rut seasons, for Venetie (Alaska hunters during midsummer and fall migration and for Arctic Village (Alaska during midsummer. Arctic Village may experience reduced availability with early snowfalls in the fall, but we expect there to be little directional shift in the spring migration patterns. For the Bathurst Herd, we expect that fewer caribou would be exposed to the mines during the winter, while more caribou would be exposed to the combined Ekati and Diavik mining zone in the early summer and to the Lupin-Jericho mining zone during the fall migration. If changes in climate cause an increased presence of caribou in the mining sites, monitoring and mitigation measures may need to be intensified.

  19. A structural analysis of the Minas da Panasqueira vein network and related fracture generations

    Science.gov (United States)

    Jacques, Dominique; Vieira, Romeu; Muchez, Philippe; Sintubin, Manuel

    2014-05-01

    The Minas da Panasqueira is a world-class W-Cu-Sn vein-type deposit, situated within the Central Iberian Zone of the Palaeozoic Iberian Massif (Portugal). The deposit consists of a network of subhorizontal, sill-like massive quartz veins situated above the southwestern extremity of a greisen cupola, within regionally metamorphosed, isoclinally folded, lower-greenschist slates and greywackes. The greisen cupola is part of a larger intrusive complex, emplaced during the late- to post-tectonic stage of the Variscan orogeny. The late-Variscan granitoid(s) underlying the Panasqueira deposit is considered to have served as a major metal source. The structure of the network of subhorizontal extension veins, consists of numerous planar vein lobes that are separated by host-rock bridges and merge at branch-points. A structural analysis demonstrates that not only within the Panasqueira mine, but also on a more regional scale, one or more generations of flat-lying fractures are present. The veins clearly exploited these pre-existing discontinuities, as confirmed by (1) the vein geometry being directly influenced by variations in the orientation of the initial fracture sets and (2) the geometry of the rock bridges and overlapping vein morphologies, consistently showing straight-line propagating crack tips. If veining is governed by a preferential, strongly developed anisotropy in the host rock, the hypothesis of vein lobes and rock bridges forming during propagation of the parent crack by tip-line bifurcation and confinement processes (Foxford et al., 2000) does not seem plausible. Instead, we propose that the rock bridges formed from several, initially separate and small veinlets that eventually overlapped in an en echelon arrangement during progressive propagation and inflation. Bending of the rock bridges and incipient vein rotation indicate that veining occurred near the brittle-ductile transition. Using a quantitative analysis of bridge orientations, vein aspect ratios

  20. Do rhizospheric processes linked to P nutrition participate in U absorption by Lupinus albus grown in hydroponics?

    International Nuclear Information System (INIS)

    Tailliez, Antoine; Pierrisnard, Sylvie; Camilleri, Virginie; Keller, Catherine; Henner, Pascale

    2013-01-01

    Phosphate (P) is an essential element for plant development but is generally present in limiting amount in the soil solution. Plant species have developed different mechanisms promoting the solubilization of this element in soils to ensure a sufficient supply for their growth. One of these mechanisms is based on the ability of certain species such as L. albus to exude large amounts of citrate through specific tertiary roots called cluster-roots. Uranium (U) is an ubiquitous contaminant known firstly for its chemical toxicity and secondly for its high affinity for P with which it forms low-soluble complexes in soils. We highlight the effects of P–U interaction on the physiology of L. albus and particularly on citrate exudation, and the impact of this root process on the phytoavailability of U and its accumulation in plants in a hydroponic study. Different levels of P (1 and 100 μM) and U (0 and 20 μM) have been tested. Our results show no toxicity of U on the development of L. albus with an adequate P supply, whereas the effects of P starvation are amplified by the presence of U in the growth medium, except for the production of cluster-roots. Citrate exudation is totally inhibited by U in a low-P environment whereas it increases in the presence of U when its toxicity is lowered by the addition of P. The differences observed in terms of toxicity and accumulation are partly explained by the microphotographs obtained by electron microscopy (TEM-EDX): in the absence of P, U penetrates deep into the roots and causes lethal damages, whereas in presence of P, we observe the formation of U–P complexes which limit the internalization of the pollutant and so its toxicity. -- Highlights: • The behavior of white lupine ±P and ±U exposure is studied in hydroponics. • The toxicity of 20 μM U is the strongest under low-P-condition. • P starvation induces citrate exudation only in P deficient plant not exposed to U. • U promotes exudation of citrate in P

  1. Effect of the imposition of low-frequency mechanical oscillations on the extraction efficiency

    Directory of Open Access Journals (Sweden)

    Ju. I. Shitshatskij

    2018-01-01

    Full Text Available It was shown that the effective transfer of the target component from the raw material occurs under a turbulent regime conditions provided by applying mechanical oscillations to a two-phase system: solid-liquid. Due to this hydrodynamic situation, not only external but also internal diffusion is intensified in the extractor. The method for intensifying the extraction process using low-frequency mechanical oscillations in the case when the vibrational motion is performed by a device with a cheese whey containing suspended porous particles was studied in the work. The experiments were carried out on the laboratory equipment with a supply to a two-phase energy system from the outside, the source of which in the first case was an electromagnet, in the second - a mechanical drive with an eccentric device. Schemes of equipment were also presented in the work. The regime parameters varied in the following ranges: temperature - 40-60 оС, oscillation frequency - 30 - 40 osc / s, amplitude - 1 - 6.5 mm. In the extraction process, the current concentration of extractive substances was obtained from the material balance equation. Extraction curves obtained from experimental data were presented. Increasing extraction of extractive substances in time was observed, it being more intense with the increasing frequency of oscillations. It was found that the growth of the amplitude does not have a significant influence on the change of these indices. The intensity of oscillations was up to 260 mm / s. At the same time, the yield of extractive substances in particular from lupine in the form of grits was 25%, and the duration of the process was 18 min. The experiments showed that the application of the chosen extraction method results into a significant acceleration of the process (up to 2.5 times as compared to extraction in a dense layer. It is concluded that due to the imposition of mechanical oscillations on the surface and in the pores of the solid phase

  2. Replacing wheat with canola meal and maize grain in the diet of lactating dairy cows: Feed intake, milk production and cow condition responses.

    Science.gov (United States)

    McDonnell, Ruairi P; Staines, Martin vH

    2017-08-01

    This research paper describes the effect of partially replacing wheat with maize grain and canola meal on milk production and body condition changes in early lactation Holstein-Friesian dairy cows consuming a grass silage-based diet over an 83-d period. Two groups of 39 cows were stratified for age, parity, historical milk yield and days in milk (DIM), and offered one of two treatment diets. The first treatment (CON) reflected a typical diet used by Western Australian dairy producers in summer and comprised (kg DM/cow per d); 8 kg of annual ryegrass silage, 6 kg of crushed wheat (provided once daily in a mixed ration), 3·6 kg of crushed lupins (provided in the milking parlour in two daily portions) and ad libitum lucerne haylage. The second treatment diet (COMP) was identical except the 6 kg of crushed wheat was replaced by 6 kg of a more complex concentrate mix (27% crushed wheat, 34% maize grain and 37% canola meal). Lucerne haylage was provided independently in the paddock to all cows, and no pasture was available throughout the experiment. The COMP group had a greater mean overall daily intake (22·5 vs 20·4 kg DM/cow) and a higher energy corrected milk (ECM) yield (29·2 vs 27·1 kg/cow; P = 0·047) than the CON cows. The difference in overall intake was caused by a higher daily intake of lucerne haylage in COMP cows (4·5 vs 2·3 kg DM/cow). The CON group had a higher concentration of milk fat (42·1 vs 39·3 g/kg; P = 0·029) than COMP cows. Milk protein yield was greater in COMP cows (P < 0·021); however, milk fat yield was unaffected by treatment. It is concluded that partially replacing wheat with canola meal and maize grain in a grass silage-based diet increases voluntary DMI of conserved forage and consequently yields of ECM and milk protein.

  3. Factors affecting 137Cs bio- availability under the application of different fertilizing systems

    Science.gov (United States)

    Fedorkova, M. V.; Belova, N. I.

    2012-04-01

    Although it has been 25 years since the Chernobyl accident, it was generally found that radiocaesium remained bio-availability in some regions. Plant uptake of 137Cs is depended from quantity of exchangeable radionuclide and strongly influenced by soil properties. The addition of fertilizers to soil induces chemical and biological changes that influence the distribution of free ions the different phases (soil and soil solution). In this study we try to estimate influence of different soil conditions affecting the 137Cs bio-availability under the application of manure and inorganic fertilizers. Our research carried out in 2001-2008 years on contaminated after Chernobyl accident sod-podzolic soil during of prolonged field experiment. The experimental site was located in south-west of Bryansk region, Russia. Contamination density by 137Cs in the sampling point was equal to 475±30 kBq/m2. The sequence of crops in rotation was: 1) potato; 2) oats 3) lupine 4) winter rye. Three fertilizing systems were compared: organic - 80 tons per hectare of cow manure; inorganic fertilizing system - different rates of NPK (low, temperate and high) and mixed - 40 tons per hectare of cow manure + NPK. Main soil properties and chemical form of 137Cs and K (potassium) were detected. Radiocaesium activity was determined in soil and plant samples by gamma spectrometry, using a high purity Ge detectors. Overall efficiency was known to an accuracy of about 10-12%. Obtained results shows, that various fertilizing systems influence soil properties, chemical forms of 137Cs and K in soil and radionuclide soil-to-plant transfer in different ways. The highest reduction of exchangeable 137Cs in soil was found in case with application of organic fertilizers and also - temperate NPK rates. Part of exchangeable 137Cs is equal 6.8% (from total activity) in case of manure, 7.8% in case of inorganic fertilizers with control value - 10.2%. Caesium mobility in soil is affected by such soil properties as

  4. Influence of nitrogen and phosphorus sources on mycorrhizal lettuces under organic farming

    Science.gov (United States)

    Scotti, Riccardo; Seguel, Alex; Cornejo, Pablo; Rao, Maria A.; Borie, Fernando

    2010-05-01

    Arbuscular mycorrhizal fungi (AMF) develop symbiotic associations with plants roots. These associations are very common in the natural environment and can provide a range of benefits to the host plant. AMF improve nutrition, enhance resistance to soil-borne pests and disease, increase resistance to drought and tolerance to heavy metals, and contribute to a better soil structure. However, agricultural intensive managements, such as the use of mineral fertilizes, pesticides, mouldboard tillage, monocultures and use of non-mycorrhizal crops, are detrimental to AMF. As a consequence, agroecosystems are impoverished in AMF and may not provide the full range of benefits to the crop. Organic farming systems may be less unfavourable to AMF because they exclude the use of water-soluble fertilisers and most pesticides, and generally they plan diverse crop rotations. The AMF develop the most common type of symbiosis in nature: about 90% of the plants are mycorrhizal and many agricultural crops are mycorrhizal. One of more mycorrhizal crops is lettuce, that is very widespread in intensive agricultural under greenhouse. Therefore, cultivated lettuce is know to be responsive to mycorrhizal colonization which can reach 80% of root length and contribute to phosphorus and nitrogen absorption by this plant specie. For this work four different lettuce cultivars (Romana, Milanesa, Grande Lagos and Escarola) were used to study mycorrhization under organic agricultural system, supplying compost from agricultural waste (1 kg m-2) as background fertilization for all plots, red guano as phosphorus source (75 U ha-1 and 150 U ha-1 of P2O5), lupine flour as nitrogen source (75 and 150 U/ha of N) and a combination of both. Lettuce plants were cultivated under greenhouse and after two months of growing, plants were harvested and dried and fresh weight of lettuce roots and shoots were evaluated. The number of spores, percentage of colonization, total mycelium and glomalin content were also

  5. Qualidade industrial do trigo em resposta à adubação verde e doses de nitrogênio Baking quality of wheat in response to green manure and nitrogen rates

    Directory of Open Access Journals (Sweden)

    Cilas Pinnow

    2013-01-01

    Full Text Available O objetivo deste estudo foi avaliar os efeitos de adubos verdes cultivados entre a cultura do milho e a do trigo e da adubação nitrogenada sobre a qualidade industrial do trigo. Os tratamentos consistiram de quatro níveis de adubação nitrogenada: sem adição de nitrogênio, 40, 80 e 120 kg ha-1 e seis manejos outonais: quatro com o cultivo de espécies de cobertura (ervilha forrageira, ervilhaca comum, nabo forrageiro e tremoço, um cultivo de feijoeiro com fins comerciais e outro com a permanência em pousio no período compreendido entre a colheita do milho e a semeadura do trigo. O delineamento experimental foi o de blocos ao acaso em esquema fatorial, com três repetições. O rendimento de proteína aumentou linearmente com a aplicação de nitrogênio mineral. As doses de 80 e 120 kg ha-1 de nitrogênio afetaram positivamente o desempenho dos parâmetros indicativos da qualidade industrial. A ervilha forrageira, o nabo forrageiro e a ervilhaca comum permitem combinar indíces de qualidade tecnológica ideais para panificação e satisfatórios patamares de produtividade de grãos, reduzindo a demanda de adubação nitrogenada mineral.The objective this study was to investigate the effects of green manures cultivated between the maize and wheat crop and nitrogen rates on baking quality of spring wheat. Treatments consisted of four nitrogen fertilization rates: without N addition, 40, 80 and 120 kg ha-1 using the amidic form, and six managements before wheat crop: four green manures forage pea, common pea, oilseed radish and lupine, common bean grown for commercial purposes, and the fallow between the corn harvest and wheat cropping. The experimental design was in randomized blocks and factorial scheme, with three replicates. The protein yield increased linearly with the application of mineral N rates. The nitrogen rates of 80 and 120 kg ha-1 improved the baking wheat quality. The forage pea, oilseed radish and common pea allowed ideal

  6. Phytotoxity of herbicides and their impact on productivity and quality of carrots

    International Nuclear Information System (INIS)

    Bogdevich, I.M.; Podolyak, A.G.; Zhdanovich, V.P.

    2006-01-01

    The decision of protein problem on contaminated by radionuclides territories as a result of the accident on Chernobyl NPP is not possible without increase of the sowing areas legumes crops (peas, lupine, vetch and soybean). Introduction in agricultural production of contaminated regions of republic high yielding crops with a low level of accumulation radionuclides 137Cs and 90Sr (pisum sativum L. - Aist, Polesskij, Gomelskaya, Agat – green mass: coefficient of radionuclides entering from soil to plants Cp137Cs 0,05-0.07, Cp90Sr 5,10-7,08; grain: Cp137Cs 0,07-0,10, CpSr90 1,24-1,37) lupinus luteus - Zhemchug, Adradzhennya, Vyatich, Rannij - green mass: Cp137Cs-0,19-0,35, Cp 90Sr-3,57-5,31; grain: Cp137Cs-0,60-0,90, Cp90Sr-3,06-3,68) will allow to obtain agricultural production (grain and gren mass) being up to the requirements of the Republican allowable levels of the contents of cesium-137 and strontium -90 in agricultural raw material and forages on arable lands at their higher density of radioactive contamination: 137Cs - 925-1480 kBq/square m (25-40 Ci/square km); 90Sr- 11,1-37,0 kBq/square m (0,30-1,0 Ci/square km). The increase in gathering of digesting protein up to 2010 should be reached due to perfection of structure of areas under crops (increase in their share in structure of a grain wedge up to 10-15%) and increase of their productivity (up to 25-30 c/ha of grain and 300-350 c/ha of green mass) due to perfection of technologies of cultivation. High-quality distinctions on accumulation 137Cs make at lupinus angustifolius - up to 3 times, at peas sowing and lupinus luteus - up to 2 times, on accumulation 90Sr at lupinus angustifolius - up to 3,5 times, at pisum sativum L. and lupinus luteus - up to 2 times

  7. Qualidade industrial do trigo em resposta à adubação verde e doses de nitrogênio Baking quality of wheat in response to green manure and nitrogen rates

    Directory of Open Access Journals (Sweden)

    Cilas Pinnow

    2013-03-01

    Full Text Available O objetivo deste estudo foi avaliar os efeitos de adubos verdes cultivados entre a cultura do milho e a do trigo e da adubação nitrogenada sobre a qualidade industrial do trigo. Os tratamentos consistiram de quatro níveis de adubação nitrogenada: sem adição de nitrogênio, 40, 80 e 120 kg ha-1 e seis manejos outonais: quatro com o cultivo de espécies de cobertura (ervilha forrageira, ervilhaca comum, nabo forrageiro e tremoço, um cultivo de feijoeiro com fins comerciais e outro com a permanência em pousio no período compreendido entre a colheita do milho e a semeadura do trigo. O delineamento experimental foi o de blocos ao acaso em esquema fatorial, com três repetições. O rendimento de proteína aumentou linearmente com a aplicação de nitrogênio mineral. As doses de 80 e 120 kg ha-1 de nitrogênio afetaram positivamente o desempenho dos parâmetros indicativos da qualidade industrial. A ervilha forrageira, o nabo forrageiro e a ervilhaca comum permitem combinar indíces de qualidade tecnológica ideais para panificação e satisfatórios patamares de produtividade de grãos, reduzindo a demanda de adubação nitrogenada mineral.The objective this study was to investigate the effects of green manures cultivated between the maize and wheat crop and nitrogen rates on baking quality of spring wheat. Treatments consisted of four nitrogen fertilization rates: without N addition, 40, 80 and 120 kg ha-1 using the amidic form, and six managements before wheat crop: four green manures forage pea, common pea, oilseed radish and lupine, common bean grown for commercial purposes, and the fallow between the corn harvest and wheat cropping. The experimental design was in randomized blocks and factorial scheme, with three replicates. The protein yield increased linearly with the application of mineral N rates. The nitrogen rates of 80 and 120 kg ha-1 improved the baking wheat quality. The forage pea, oilseed radish and common pea allowed ideal

  8. As leguminosas como alimentos funcionais: o caso das dislipidémias e das doenças cardiovasculares Legumes as functional foods: the case of dyslipidemia and cardiovascular diseases

    Directory of Open Access Journals (Sweden)

    J.M. Martins

    2007-01-01

    Full Text Available A dieta mediterrânica é rica em alimentos funcionais. As leguminosas, um dos alimentos-chave desta dieta, têm visto o seu papel na prevenção de dislipidémias, diabetes e cancro do cólon mencionado por muitos autores. O efeito do consumo de leguminosas na redução da colesterolémia deve-se a diferentes nutrientes e fitoquímicos, tais como: i proteína; ii lípidos, particularmente a componente polinsaturada e monoinsaturada; iii fibra, especialmente a fracção solúvel; iv saponinas; e v fitosteróis. O consumo da soja tem sido relacionado com tais efeitos benéficos, mas dados recentes obtidos na Universidade de Évora demonstraram que leguminosas como a ervilha e o tremoço de folhas estreitas também apresentam elevado potencial funcional na regulação do colesterol sanguíneo. O seu consumo levou a reduções de 30% na colesterolémia de animais experimentais, via redução do colesterol das LDL. A utilização destas leguminosas como alimentos funcionais e/ou como fornecedoras de fitoquímicos com potencial preventivo e terapêutico é promissora e poderá constituir uma maisvalia e uma fonte extra de rendimento para os agricultores que se dediquem ao cultivo destas espécies.The Mediterranean diet is rich in functional foods. Legumes are one of the key-foods of this diet and many authors mention their role in the prevention of dyslipidemias, diabetes and colon cancer. The hypocholesterolemic effect of legumes is related to several nutrients and phytochemicals. Among them: i protein; ii lipids, especially polyunsaturated and monounsaturated ones; iii dietary fibre, especially soluble fibre; iv saponins; and v phytosterols. Soybean consumption has been related with these benefic effects. However, recent data obtained at the University of Évora have demonstrated that other legumes, such as peas and blue lupin, can also present a high hypocholesterolemic potential. In fact, the consumption of these legumes led to a 30% reduction in

  9. Suppression of the auxin response pathway enhances susceptibility to Phytophthora cinnamomi while phosphite-mediated resistance stimulates the auxin signalling pathway

    Science.gov (United States)

    2014-01-01

    Background Phytophthora cinnamomi is a devastating pathogen worldwide and phosphite (Phi), an analogue of phosphate (Pi) is highly effective in the control of this pathogen. Phi also interferes with Pi starvation responses (PSR), of which auxin signalling is an integral component. In the current study, the involvement of Pi and the auxin signalling pathways in host and Phi-mediated resistance to P. cinnamomi was investigated by screening the Arabidopsis thaliana ecotype Col-0 and several mutants defective in PSR and the auxin response pathway for their susceptibility to this pathogen. The response to Phi treatment was also studied by monitoring its effect on Pi- and the auxin response pathways. Results Here we demonstrate that phr1-1 (phosphate starvation response 1), a mutant defective in response to Pi starvation was highly susceptible to P. cinnamomi compared to the parental background Col-0. Furthermore, the analysis of the Arabidopsis tir1-1 (transport inhibitor response 1) mutant, deficient in the auxin-stimulated SCF (Skp1 − Cullin − F-Box) ubiquitination pathway was also highly susceptible to P. cinnamomi and the susceptibility of the mutants rpn10 and pbe1 further supported a role for the 26S proteasome in resistance to P. cinnamomi. The role of auxin was also supported by a significant (P < 0.001) increase in susceptibility of blue lupin (Lupinus angustifolius) to P. cinnamomi following treatment with the inhibitor of auxin transport, TIBA (2,3,5-triiodobenzoic acid). Given the apparent involvement of auxin and PSR signalling in the resistance to P. cinnamomi, the possible involvement of these pathways in Phi mediated resistance was also investigated. Phi (especially at high concentrations) attenuates the response of some Pi starvation inducible genes such as AT4, AtACP5 and AtPT2 in Pi starved plants. However, Phi enhanced the transcript levels of PHR1 and the auxin responsive genes (AUX1, AXR1and AXR2), suppressed the primary root

  10. Miserere. Aesthetics of Terror

    Directory of Open Access Journals (Sweden)

    Antonio Incampo

    2011-10-01

    Full Text Available I say: “Oh, what a beautiful surrealist picture!” With quite precise awareness: this páthos, these emotions of mine do not stem from our common sense. An aesthetic judgment is founded on an immediate subjective intuition: an emotion or a free feeling of a single subject towards an object. A universal sense, possibly. Some judgments of ours in ethics and in law are no different from our perceptions in front of art. It would be the same for a hypothetical sentence of the judge that concluded with these words: “I acquit Arsenio Lupin because of his magnificent handlebar moustache like that of Guy de Maupassant”. Everyone would think intuitively that it is an unfair sentence. Is there aesthetics of terror? The case that the article intends to examine is that of the famous kidnapping and murder of the Italian statesman Aldo Moro by the “Brigate Rosse” [Red Brigades] (1978. The method used here consists in studying the image of the kidnapping as iconic documentation of reality, and, above all, as an ethical-legal judgment about the terrorist crime. Moro was photographed during his kidnapping. There are at least two pictures. Both constitute an extraordinary source for a judgment on the basis of an image. In both of them, Aldo Moro is pictured in front of a Red Brigades banner during the captivity. In what sense do these pictures document an aesthetic judgment concerning the “case Moro”? The answer can be found in a remarkable iconic coincidence of these pictures with a masterpiece by Georges Rouault (Paris 1871-1958 devoted to the theme of the “Ecce Homo”. The Gospel in the “Ecce Homo” scene (John: 19, 4-5 narrates how Pontius Pilate wanted to arouse the compassion of the people with a scourging and the exposure of Jesus to the crowd. The plate under consideration is entitled “Qui ne se grime pas?” [Who does not have a painted face?] and is a key work in Rouault’s suite of prints Miserere, dated for 1923.

  11. Comparative evaluation of Bacillus licheniformis 5A5 and Aloe variegata milk-clotting enzymes

    Directory of Open Access Journals (Sweden)

    S. A. Ahmed

    2012-03-01

    Full Text Available The properties of a milk clotting enzyme (MCE produced by bacteria (Bacillus licheniformis 5A5 were investigated and compared to those of rennet extracted from a plant (Aloe variegata. Production of MCE by B. licheniformis 5A5 was better in static than in shaken cultures. Maximum activity (98.3 and 160.3 U/ml of clotting was obtained at 75ºC and 80ºC with bacterial and plant rennet, respectively. In the absence of substrate, the clotting activity of Aloe MCE was found to be less sensitive to heat inactivation up to 80ºC for 75 min, retaining 63.8% of its activity, while bacterial MCE was completely inhibited. CaCl2 stimulated milk clotting activity (MCA up to 2% and 1.5% for bacterial and plant enzymes. NaCl inhibited MCA for both enzymes, even at low concentration (1%. Plant MCE was more sensitive to NaCl at 3% concentration it retained 30.2% of its activity, whereas bacterial MCE retained 64.1%. Increasing skim milk concentration caused a significant increase in MCA up to 6% for both enzymes. Mn2+ stimulated the activity of bacterial and plant enzymes to 158.6 and 177.9%, respectively. EDTA and PMSF increased the activity of plant MCE by 34.4 and 41.1%, respectively, which is higher than those for the bacterial MCE (19.1 and 20.9%. Some natural materials activated MCE, the highest activation of bacterial MCE (128.1% was obtained in the presence of Fenugreek (with acid extraction. However Lupine Giza 1 (with neutral extraction gave the highest activation of plant MCE (137.9%. All extracts from Neem plant increased MCA at range from 105.6% to 136.4%. Plant MCE exhibited much better stability when stored at room temperature (25-30ºC for 30 days, retaining 51.2% of its activity. Bacterial MCE was highly stabile when stored under freezing (-18ºC, retaining 100% of its activity after 30 days. Moreover, bacterial MCE was highly tolerant to repeated freezing and thawing without loss of activity for 8 months.

  12. Phytoremediation of soils co-contaminated by organic compounds and heavy metals: bioassays with Lupinus luteus L. and associated endophytic bacteria.

    Science.gov (United States)

    Gutiérrez-Ginés, M J; Hernández, A J; Pérez-Leblic, M I; Pastor, J; Vangronsveld, J

    2014-10-01

    In the central part of the Iberian Peninsula there are old sealed landfills containing soils co-contaminated by several heavy metals (Cu, Zn, Pb, Cd, Ni, As, Cr, Fe, Al, Mn) and organic pollutants of different families (hydrocarbons, polycyclic aromatic hydrocarbons, polychlorinated biphenyls, pesticides and other organochlorinated compounds, phenols and volatile compounds), which this work will address. We have focused on phytoremedial plants that are able to deal with this type of complex pollution, not only species that tolerate the joint effect of heavy metals in the soil, but also those that can take advantage of associated bacteria to efficiently break down organic compounds. This study was carried out with Lupinus luteus and its endophytes in two greenhouse experiments: A) growing in a substrate artificially contaminated with benzo(a)pyrene (BaP), and B) using real co-contaminated landfill soils. Endophytes of roots and shoots were isolated in both bioassays. Plant growth-promotion tests and organic pollutant tolerance and degradation tests were conducted on all strains isolated in bioassay A), and on those proving to be pure cultures from bioassay B). The selected landfill is described as are isolation and test procedures. Results indicate that plants did not show toxicity symptoms when exposed to BaP but did when grown in landfill soil. Some endophytes demonstrated plant growth-promotion capacity and tolerance to BaP and other organic compounds (diesel and PCB commercial mixtures). A few strains may even have the capacity to metabolize those organic pollutants. The overall decline in plant growth-promotion capacity in those strains isolated from the landfill soil experiment, compared with those from the bioassay with BaP, may indicate that lupin endophytes are not adapted to metal concentration in roots and shoots and fail to grow. As a result, most isolated root endophytes must have colonized root tissues from the soil. While preliminary degradation tests

  13. Aspectos de las legumbres nutricionales y beneficiosos para la salud humana

    Directory of Open Access Journals (Sweden)

    Delgado-Andrade, Cristina

    2016-06-01

    Full Text Available The Leguminosae is one of the most important botanical families from a nutritional perspective, constituting one of the main ingredients in the Mediterranean diet and an essential food in developing countries. Grain legumes like chickpea, lentil, lupin, pea and beans are well known sources of proteins, starch, fiber, vitamins and minerals. In this paper, scientific evidence for the role of legumes in human nutrition, as well as the preventive properties of some of their bioactive components in diseases like type-2 diabetes, hypercholesterolemia, hypertension, obesity, inflammatory diseases and cancer, are considered. Finally, data of consumption in Spanish households was analyzed, where a 60% decrease has been observed over the last decades. This trend must be reversed by implementing policies to promote healthy diet and by adapting to a new market by means of developing novel products oriented to consumer preferences.Las leguminosas constituyen una de las familias botánicas más importantes desde el punto de vista nutricional, siendo un componente importante de la dieta mediterránea y esencial en la de numerosos países en desarrollo. Legumbres tales como garbanzo, lenteja, altramuz, guisante y habas son reconocidas como fuentes de proteínas, almidón, fibra, vitaminas y minerales. En este trabajo, quedan incluidas las evidencias científicas relativas al papel que juegan las legumbres en la nutrición humana así como las propiedades preventivas que ejercen algunos de sus componentes bioactivos en enfermedades tales como la diabetes tipo-2, hipercolesterolemia, hipertensión, obesidad, enfermedades inflamatorias y cáncer. Por último, se analiza los datos de consumo de legumbres en los hogares españoles, los cuales demuestran un descenso superior al 60 % en las últimas décadas. Esto debe ser corregido con políticas de promoción de dieta saludable así como por medidas de adaptación al nuevo mercado con la aparición de nuevos

  14. Herbal drug patenting in India: IP potential.

    Science.gov (United States)

    Sahoo, Niharika; Manchikanti, Padmavati; Dey, Satya Hari

    2011-09-01

    organizations and herbal companies are on development of new processes for active compound isolation and standardization of such components in addition to new compositions for therapeutic use. Pharmaceutical companies such as Ranbaxy, Lupin and Panacea Biotec are increasingly patenting on herbal drugs. There is increased patenting activity related to diabetes, cancer, cardiovascular diseases, asthma and arthritis in India and abroad. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  15. Ocorrência do vírus do mosqueado do morangueiro no estado de São Paulo Occurrence of the strawberry mottle virus in São Paulo

    Directory of Open Access Journals (Sweden)

    Ana Maria B. Carvalho

    1961-01-01

    tornou-se vírulífero quando alimentado em planta infetada por 30 minutos. Com o aumento no período de alimentação na fonte de vírus aumentou a eficiência de transmissão. Insetos virulíferos foram capazes de infetar plantas sadias quando alimentados sôbre elas por 15 minutos. Insetos virulíferos alimentados por 1 hora em planta sadia ainda retinham o vírus. Após 6 horas de alimentação já não mais o retinham.The ocurrence of virus strains similar to those of the strawberry mottle virus has been recorded in several strawberry plantings in the state of São Paulo. Old, standard varieties are symptomless carriers and are usually 100 per cent infected. Some new clones, representing various crosses, were partly infected after a Few plantings in the field. The symptoms induced by die virus on Fragaria uesca seedlings were vein clearing, crinkling, and stunting. Most of the virus isolates seemed to resemble curly dwarf. Studies on host range carried out by means of the vector gave mostly negative results, but symptoms were obtained on Cassia occidentalis, Chenopodium quinoa, Leonotis nepaetifolia, and Leonorus sibiricus Although this happened when inoculations were made with different sources of the strawberry mottle virus, it cannot be stated with certainty that the symptoms obtained on these four species were really caused by the mottle virus, since it was possible that the original sources contained another virus. The strawberry mottle virus was transmitted efficiently by Pentatrichopus fragaefolii and only occasionally by Aphis gossypii. Seed transmission was negative. Tests on mechanical inoculation were also negative. However, the virus obtained on Chenopodium quinoa plants by means of the vector could be transmitted mechanically to seedlings of the same species, but not to Fragaria vesca. A local species of Cuscuta did not transmit the mottle virus and transmission with leaf scions grafted on leaves was generally low because of poor take. Pentatrichopus

  16. Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

    Directory of Open Access Journals (Sweden)

    Z. Gholampour

    2016-02-01

    phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously

  17. Crescimento radicular de soja em razão da sucessão de cultivos e da compactação do solo Soybean root growth as affected by previous crop and soil compaction

    Directory of Open Access Journals (Sweden)

    Rosemeire Helena da Silva

    2002-06-01

    Full Text Available O objetivo do experimento foi avaliar o crescimento radicular e produção de matéria seca da parte aérea da soja (Glycine max (L. Merrill cultivada após diversas espécies vegetais, em solo com diferentes níveis de compactação. O trabalho foi realizado em vasos contendo amostras de um Latossolo Vermelho, textura franco arenosa, com camada de 3,5 cm (profundidade de 15 a 18,5 cm compactada até as densidades 1,12, 1,36 e 1,60 Mg m-3, onde cultivaram-se anteriormente aveia-preta, guandu, milheto, mucuna-preta, soja, sorgo granífero e tremoço-azul, e um tratamento sem planta (pousio. Essas espécies se desenvolveram por 37 a 39 dias, foram cortadas ao nível do solo, picadas em partes de aproximadamente 3 cm e deixadas sobre a superfície do vaso por 40 dias. Após esse período, cultivou-se a soja até 28 dias após a emergência, quando, então, as plantas foram colhidas. Foram avaliados produção de matéria seca da parte aérea e de raízes, e comprimento e diâmetro radicular da soja. O cultivo anterior com aveia-preta, guandu e milheto favoreceu o crescimento radicular da soja abaixo de camadas compactadas do solo. Independentemente do nível de compactação, o cultivo anterior com qualquer das espécies estudadas beneficiou a produção de matéria seca da parte aérea da soja.This study aimed at evaluating root growth and shoot dry matter production of soybean (Glycine max (L. Merrill cropped after different vegetal species, in a soil with different compaction levels. The experiment was conducted in pots containing a Dark-Red Latosol (Acrortox, loamy sand, and the pots had a layer 3.5 cm (15 to 18.5 cm thick and 15 cm deep compacted to 1.12, 1.36 and 1.60 Mg m-3. Before soybean, the pots were cropped with black oat, pigeon pea, pearl millet, black mucuna, soybean, grain sorghum and lupin, plus a treatment without plants. These species were grown for 37 to 39 days, when they were cut at soil level, prick in particles of

  18. Quid de l’utilisation des protéines d’origine végétale en aquaculture ?

    Directory of Open Access Journals (Sweden)

    Burel Christine

    2014-07-01

    Full Text Available Au cours des 30 dernières années, l’aquaculture mondiale n’a cessé de croître pour répondre à la demande croissante de poisson pour la consommation humaine qui ne peut plus être satisfaite par les seules captures de pêche. En conséquence, la demande de matières premières pour les aliments aquacoles augmente, tandis que le volume disponible de farine de poisson, ingrédient traditionnellement majoritaire dans ces aliments, reste stable. Cela a conduit à une substitution des ressources marines par des produits végétaux comme ingrédients pour les aliments pour poissons. La proportion de farine de poisson dans les aliments piscicoles a été réduite d’un tiers et est remplacée par une combinaison de sources protéiques végétales qui fournissent les acides aminés indispensables en quantité suffisante pour répondre aux besoins des poissons. Une large gamme de produits végétaux a été prospectée pour remplacer la farine de poisson. Sur la base de leur composition et de leur disponibilité sur le marché, les produits végétaux les plus utilisés en Europe sont des graines d’oléagineux (soja, colza, tournesol sous forme de tourteaux ou de concentrés protéiques, des protéagineux (lupin, féverole, pois, des céréales (maïs, blé ou des extraits de protéines obtenus à partir de céréales, comme par exemple les glutens. Néanmoins, les études ayant porté sur des taux de substitution très élevés (peu ou pas de farine de poisson ont mis en évidence des verrous physiologiques bien que les régimes contenaient tous les nutriments nécessaires : une baisse de la consommation alimentaire, de l’efficacité alimentaire et du taux de croissance des poissons, ainsi que des modifications métaboliques. Les travaux de recherche doivent être poursuivis afin d’améliorer l’efficacité nutritionnelle des produits végétaux via une réduction de leurs facteurs antinutritionnels et des toxines qu’ils contiennent

  19. SECAGEM INTERMITENTE E SEUS EFEITOS NA QUALIDADE FISIOLÓGICA DE SEMENTES DE TREMOÇO AZUL

    Directory of Open Access Journals (Sweden)

    D.C. AHRENS

    1996-05-01

    C intermittent dryers and for shade drying, respectively. The drying speed of the rapid (50oC and slow (65oC - 60oC intermittent dryers were 1.1, 2.3 and 2.7 percentage points per hour. It was conclude that: a the slow drier is more efficient in drying than the rapid drier; b the lupine seed physiological quality is not affected by the tested dryers.

  20. Measuring and modeling of a three-dimensional tracer transport in a planted soil column

    Science.gov (United States)

    Schroeder, N.; Javaux, M.; Haber-Pohlmeier, S.; Pohlmeier, A. J.; Huber, K.; Vereecken, H.; Vanderborght, J.

    2013-12-01

    Water flow from soil to root is driven by the plant transpiration and an important component of the hydrological cycle. The model R-SWMS combines three-dimensional (3D) water flow and solute transport in soil with a detailed description of root structure in three dimensions [1,2]. This model offers the possibility to calculate root water and solute uptake and flow within the roots, which enables explicit studies with respect to the distribution of water and solutes around the roots as well as local processes at the root-soil interface. In this study, we compared measured data from a tracer experiment using Magnetic Resonance Imaging (MRI) with simulations in order to assess the distribution and magnitude of the water uptake of a young lupine plant. An aqueous solution of the Gadolinium-complex (Gd-DTPA2-) was chosen as a tracer, as it behaves conservatively and is ideally suited for MRI. Water flow in the soil towards the roots can thus be visualized by following the change in tracer concentrations over time. The data were obtained by MRI, providing high resolution 3D images of the tracer distribution and root architecture structures by using a spin echo pulse sequence, which is strongly T1- weighted to be tracer sensitive [3], and T2 -weighted for root imaging [4]. This experimental setup was simulated using the 3D high-resolution numerical model R-SWMS. The comparison between MRI data and the simulations showed extensive effects of root architecture parameters on solute spreading. Although the results of our study showed the strength of combining non-invasive measurements and 3D modeling of solute and water flow in soil-root systems, where the derivation of plant hydraulic parameters such as axial and radial root conductivities is possible, current limitations were found with respect to MRI measurements and process description. [1] Javaux, M., T. Schröder, J. Vanderborght, and H. Vereecken (2008), Use of a Three-Dimensional Detailed Modeling Approach for

  1. Changes in vegetation and biological soil crust communities on sand dunes stabilizing after a century of grazing on San Miguel Island, Channel Island National Park, California

    Science.gov (United States)

    Zellman, Kristine L.

    2014-01-01

    San Miguel Island is the westernmost of the California Channel Islands and one of the windiest areas on the west coast of North America. The majority of the island is covered by coastal sand dunes, which were stripped of vegetation and subsequently mobilized due to droughts and sheep ranching during the late 19th century and early 20th century. Since the removal of grazing animals, vegetation and biological soil crusts have once again stabilized many of the island's dunes. In this study, historical aerial photographs and field surveys were used to develop a chronosequence of the pattern of change in vegetation communities and biological soil crust levels of development (LOD) along a gradient of dune stabilization. Historical aerial photographs from 1929, 1954, 1977, and 2009 were georeferenced and used to delineate changes in vegetation canopy cover and active (unvegetated) dune extent among 5 historical periods (pre-1929, 1929–1954, 1954–1977, 1977–2009, and 2009–2011). During fieldwork, vegetation and biological soil crust communities were mapped along transects distributed throughout San Miguel Island's central dune field on land forms that had stabilized during the 5 time periods of interest. Analyses in a geographic information system (GIS) quantified the pattern of changes that vegetation and biological soil crust communities have exhibited on the San Miguel Island dunes over the past 80 years. Results revealed that a continuing increase in total vegetation cover and a complex pattern of change in vegetation communities have taken place on the San Miguel Island dunes since the removal of grazing animals. The highly specialized native vascular vegetation (sea rocket, dunedelion, beach-bur, and locoweed) are the pioneer stabilizers of the dunes. This pioneer community is replaced in later stages by communities that are dominated by native shrubs (coastal goldenbush, silver lupine, coyote-brush, and giant coreopsis), with apparently overlapping or

  2. In situ Rumen Degradation Kinetics of High-Protein Forage Crops in Temperate Climates Cinética de Degradación Ruminal in situ en Forrajes de Alto Contenido Proteico en Clima Templado

    Directory of Open Access Journals (Sweden)

    Ximena Valderrama L.

    2011-12-01

    Full Text Available The present study was conducted to evaluate the nutritional value and in situ degradation kinetics of eight high protein forage crops: alfalfa (Medicago sativa L., forage oat (Avena sativa L., mixed pasture, and ryegrass (Lolium multiflorum Lam. pasture in early vegetative stages, two forage lupins (Lupinus albus L. in early bloom stages, sugar beet (Beta vulgaris L. and kale (Brassica napus var. pabularia (DC. Rchb. leaves at root maturity. Dry matter (DM and crude protein (CP degradation kinetics were evaluated by the nylon bag technique through the in situ procedure described by 0rskov and MacDonald (1979 using three ruminally cannulated sheep. Chemical composition of the forage crops showed on average 13.7% DM; 21.4% CP; 31.5% neutral detergent fiber (NDF; 17.7% crude fiber (CF, 80.6% digestibility of organic matter (DOMD and 12.13 MJ kg-1 metabolizable energy (ME. The high total degradability of forage crops reported here (> 87% DM; > 93% CP can be associated with the presence of large quantities of fraction a (> 34% DMa; > 29% CPa and high degradability of fraction b, resulting in low amounts of undegradable fraction (U (7.02% DM and 3.55% CP. Correlations between CPb and DMb degradability (r = 0.79 and CPc and DMc degradation rates (r = 0.78 were high, however differences in c were not explained by differences in CP or NDF contents, nor by the amounts of a or b fractions. Degradation for DM and CP during the first 6 h of incubation was strongly and inversely correlated to b (36 h (r = 0.93 (P El presente estudio se desarrolló con el objetivo de evaluar el valor nutricional y la cinética de degradación in situ de ocho forrajes de alto valor proteico: alfalfa (Medicago sativa L., avena (Avena sativa L., pastos mixtos y pastos de ballica (Lolium multiflorum Lam., en las primeras etapas vegetativas, dos lupinos forrajeros (Lupinus albus L. en etapas inicio de la floración, hojas de remolacha azucarera (Beta vulgaris L. y de col (Brassica

  3. Variações qualitativas e quantitativas na microbiota do solo e na fixação biológica do nitrogênio sob diferentes manejos com soja Qualitative and quantitative changes in soil microbiota and biological nitrogen fixation under different soybean managements

    Directory of Open Access Journals (Sweden)

    Alan Alves Pereira

    2007-12-01

    Eutrudox, in Londrina, PR, Brazil. Treatments were a combination of a crop sequence (S (soybean/wheat and a crop rotation (R (lupin/maize/black oat/soybean/wheat/soybean/wheat/soybean, either under conventional tillage (CT or no-tillage (NT. Evaluations were performed when all systems were under the soybean cropping season, at full flowering. Amounts of microbial biomass carbon and nitrogen (MB-C and MB-N, respectively were 114 and 157 % higher in NT than in CT. Furthermore, the metabolic quotient (qCO2 was lower under NT, indicating higher metabolic efficiency of the soil microbes. These parameters were not affected by the crop sequence/rotation. Genetic diversity of the total soil bacterial community was higher under NT and lower in the CT system with crop sequence. Regarding the biological N2 fixation, it was found that plant biomass, total N and fraction of N-ureides in shoots, as well as nodule efficiency, were higher under NT. Genetic diversity of rhizobia was affected mainly by crop management and was higher under crop rotation, probably due to the greater number of plant species. However, crop rotation decreased the efficiency of the biological N2 fixation process, which may be related to more abundant N in the soil or to a lower selection pressure for efficient rhizobia. For soil microbes with specific functions, e.g., rhizobia, genetic diversity may therefore differ from functionality.

  4. Las leguminosas en alimentación animal

    Directory of Open Access Journals (Sweden)

    Rubio, Luis A.

    2016-06-01

    Full Text Available From an animal nutrition point of view, legumes can be divided into two groups: fodder legumes (e. g. lucerne mainly utilized in ruminant nutrition, and grain legumes (e. g. faba beans, peas, lupins mainly used in bird and swine nutrition and, to a lesser extent, in ruminants. Grain legumes can partially or even totally replace traditional protein sources of animal origin such as meat, bone and fish meals. Moreover, they represent an alternative protein-rich feed ingredient for soybean meal and other oilseed meals. Their average protein content is variable but high (25-45 g / 100 g dry matter. However, the presence of secondary plant metabolites such as protease inhibitors, saponins, lectins, glycosides, tannins, and alkaloids, and their high levels of fiber (non- starch-polysaccharides have restricted the use of legume-grains in monogastric (poultry and pigs and ruminant feeding. In spite of this, the interest in, and the number of studies on, these resources as functional food products, especially in human, but also in animal, nutrition, are still on the increase. The ban on the use of animal proteins such as meat and bone meals, which took place in the EU as a consequence of the BSE crisis, has boosted the interest for the use of vegetable proteins, preferentially of local origin, in animal feeds. In order to establish the nutritional value of legumes, particular attention must be paid to their nutritional composition, energy content and amino acid digestibility. In ruminants, the degradability in the rumen of the protein, individual amino acids and carbohydrates are not well known and must be established. Approaches into the presence of tannins in ruminant feeds are currently changing due to their potential beneficial effects on nutrient degradation in the rumen, and on product quality or methane mitigation. Soybean is the raw material preferentially utilized as a protein source in animal feeds, but the great dependency on imported soybean