WorldWideScience

Sample records for nonproductive base-pairing interactions

  1. 29 CFR 778.318 - Productive and nonproductive hours of work.

    Science.gov (United States)

    2010-07-01

    ... Special Problems Effect of Failure to Count Or Pay for Certain Working Hours § 778.318 Productive and... Act; such nonproductive working hours must be counted and paid for. (b) Compensation payable for... which such nonproductive hours are properly counted as working time but no special hourly rate is...

  2. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  3. Interactions between Cellulolytic Enzymes with Native, Autohydrolysis, and Technical Lignins and the Effect of a Polysorbate Amphiphile in Reducing Nonproductive Binding.

    Science.gov (United States)

    Fritz, Consuelo; Ferrer, Ana; Salas, Carlos; Jameel, Hasan; Rojas, Orlando J

    2015-12-14

    Understanding enzyme-substrate interactions is critical in designing strategies for bioconversion of lignocellulosic biomass. In this study we monitored molecular events, in situ and in real time, including the adsorption and desorption of cellulolytic enzymes on lignins and cellulose, by using quartz crystal microgravimetry and surface plasmon resonance. The effect of a nonionic surface active molecule was also elucidated. Three lignin substrates relevant to the sugar platform in biorefinery efforts were considered, namely, hardwood autohydrolysis cellulolytic (HWAH), hardwood native cellulolytic (MPCEL), and nonwood native cellulolytic (WSCEL) lignin. In addition, Kraft lignins derived from softwoods (SWK) and hardwoods (HWK) were used as references. The results indicated a high affinity between the lignins with both, monocomponent and multicomponent enzymes. More importantly, the addition of nonionic surfactants at concentrations above their critical micelle concentration reduced remarkably (by over 90%) the nonproductive interactions between the cellulolytic enzymes and the lignins. This effect was hypothesized to be a consequence of the balance of hydrophobic and hydrogen bonding interactions. Moreover, the reduction of surface roughness and increased wettability of lignin surfaces upon surfactant treatment contributed to a lower affinity with the enzymes. Conformational changes of cellulases were observed upon their adsorption on lignin carrying preadsorbed surfactant. Weak electrostatic interactions were determined in aqueous media at pH between 4.8 and 5.5 for the native cellulolytic lignins (MPCEL and WSCEL), whereby a ∼20% reduction in the enzyme affinity was observed. This was mainly explained by electrostatic interactions (osmotic pressure effects) between charged lignins and cellulases. Noteworthy, adsorption of nonionic surfactants onto cellulose, in the form cellulose nanofibrils, did not affect its hydrolytic conversion. Overall, our results

  4. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  5. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  6. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  7. Molecular electrostatics for probing lone pairinteractions.

    Science.gov (United States)

    Mohan, Neetha; Suresh, Cherumuttathu H; Kumar, Anmol; Gadre, Shridhar R

    2013-11-14

    An electrostatics-based approach has been proposed for probing the weak interactions between lone pair containing molecules and π deficient molecular systems. For electron-rich molecules, the negative minima in molecular electrostatic potential (MESP) topography give the location of electron localization and the MESP value at the minimum (Vmin) quantifies the electron-rich character of that region. Interactive behavior of a lone pair bearing molecule with electron deficient π-systems, such as hexafluorobenzene, 1,3,5-trinitrobenzene, 2,4,6-trifluoro-1,3,5-triazine and 1,2,4,5-tetracyanobenzene explored within DFT brings out good correlation of the lone pairinteraction energy (E(int)) with the Vmin value of the electron-rich system. Such interaction is found to be portrayed well with the Electrostatic Potential for Intermolecular Complexation (EPIC) model. On the basis of the precise location of MESP minimum, a prediction for the orientation of a lone pair bearing molecule with an electron deficient π-system is possible in the majority of the cases studied.

  8. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  9. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  10. Pairing properties of realistic effective interactions

    Directory of Open Access Journals (Sweden)

    Gargano A.

    2016-01-01

    Full Text Available We investigate the pairing properties of an effective shell-model interaction defined within a model space outside 132Sn and derived by means of perturbation theory from the CD-Bonn free nucleon-nucleon potential. It turns out that the neutron pairing component of the effective interaction is significantly weaker than the proton one, which accounts for the large pairing gap difference observed in the two-valence identical particle nuclei 134Sn and 134Te. The role of the contribution arising from one particle-one hole excitations in determining the pairing force is discussed and its microscopic structure is also analyzed in terms of the multipole decomposition.

  11. Kramers Pairs in configuration interaction

    DEFF Research Database (Denmark)

    Avery, John Scales; Avery, James Emil

    2003-01-01

    The theory of symmetry-preserving Kramers pair creation operators is reviewed and formulas for applying these operators to configuration interaction calculations are derived. A new and more general type of symmetry-preserving pair creation operator is proposed and shown to commute with the total ...

  12. Pair Interaction of Catalytical Sphere Dimers in Chemically Active Media

    Directory of Open Access Journals (Sweden)

    Jing-Min Shi

    2018-01-01

    Full Text Available We study the pair dynamics of two self-propelled sphere dimers in the chemically active medium in which a cubic autocatalytic chemical reaction takes place. Concentration gradient around the dimer, created by reactions occurring on the catalytic sphere surface and responsible for the self-propulsion, is greatly influenced by the chemical activities of the environment. Consequently, the pair dynamics of two dimers mediated by the concentration field are affected. In the particle-based mesoscopic simulation, we combine molecular dynamics (MD for potential interactions and reactive multiparticle collision dynamics (RMPC for solvent flow and bulk reactions. Our results indicate three different configurations between a pair of dimers after the collision, i.e., two possible scenarios of bound dimer pairs and one unbound dimer pair. A phase diagram is sketched as a function of the rate coefficients of the environment reactions. Since the pair interactions are the basic elements of larger scale systems, we believe the results may shed light on the understanding of the collective dynamics.

  13. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  14. Spin-Triplet Pairing Induced by Spin-Singlet Interactions in Noncentrosymmetric Superconductors

    Science.gov (United States)

    Matsuzaki, Tomoaki; Shimahara, Hiroshi

    2017-02-01

    In noncentrosymmetric superconductors, we examine the effect of the difference between the intraband and interband interactions, which becomes more important when the band splitting increases. We define the difference ΔVμ between their coupling constants, i.e., that between the intraband and interband hopping energies of intraband Cooper pairs. Here, the subscript μ of ΔVμ indicates that the interactions scatter the spin-singlet and spin-triplet pairs when μ = 0 and μ = 1,2,3, respectively. It is shown that the strong antisymmetric spin-orbit interaction reverses the target spin parity of the interaction: it converts the spin-singlet and spin-triplet interactions represented by ΔV0 and ΔVμ>0 into effective spin-triplet and spin-singlet pairing interactions, respectively. Hence, for example, triplet pairing can be induced solely by the singlet interaction ΔV0. We name the pairing symmetry of the system after that of the intraband Cooper pair wave function, but with an odd-parity phase factor excluded. The pairing symmetry must then be even, even for the triplet component, and the following results are obtained. When ΔVμ is small, the spin-triplet p-wave interactions induce spin-triplet s-wave and spin-triplet d-wave pairings in the regions where the repulsive singlet s-wave interaction is weak and strong, respectively. When ΔV0 is large, a repulsive interband spin-singlet interaction can stabilize spin-triplet pairing. When the Rashba interaction is adopted for the spin-orbit interaction, the spin-triplet pairing interactions mediated by transverse magnetic fluctuations do not contribute to triplet pairing.

  15. Reducing interaction in simultaneous paired stimulation with CI.

    Directory of Open Access Journals (Sweden)

    Dirk Vellinga

    Full Text Available In this study simultaneous paired stimulation of electrodes in cochlear implants is investigated by psychophysical experiments in 8 post-lingually deaf subjects (and one extra subject who only participated in part of the experiments. Simultaneous and sequential monopolar stimulation modes are used as references and are compared to channel interaction compensation, partial tripolar stimulation and a novel sequential stimulation strategy named phased array compensation. Psychophysical experiments are performed to investigate both the loudness integration during paired stimulation at the main electrodes as well as the interaction with the electrode contact located halfway between the stimulating pair. The study shows that simultaneous monopolar stimulation has more loudness integration on the main electrodes and more interaction in between the electrodes than sequential stimulation. Channel interaction compensation works to reduce the loudness integration at the main electrodes, but does not reduce the interaction in between the electrodes caused by paired stimulation. Partial tripolar stimulation uses much more current to reach the needed loudness, but shows the same interaction in between the electrodes as sequential monopolar stimulation. In phased array compensation we have used the individual impedance matrix of each subject to calculate the current needed on each electrode to exactly match the stimulation voltage along the array to that of sequential stimulation. The results show that the interaction in between the electrodes is the same as monopolar stimulation. The strategy uses less current than partial tripolar stimulation, but more than monopolar stimulation. In conclusion, the paper shows that paired stimulation is possible if the interaction is compensated.

  16. Accurate interaction energies of base pairing and base stacking. The final chapter

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

    2005-01-01

    Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

  17. Calculated isotropic Raman spectra from interacting H2-rare-gas pairs

    International Nuclear Information System (INIS)

    Gustafsson, M; Głaz, W; Bancewicz, T; Godet, J-L; Maroulis, G; Haskapoulos, A

    2014-01-01

    We report on a theoretical study of the H 2 -He and H 2 -Ar pair trace-polarizability and the corresponding isotropic Raman spectra. The conventional quantum mechanical approach for calculations of interaction-induced spectra, which is based on an isotropic interaction potential, is employed. This is compared with a close-coupling approach, which allows for inclusion of the full, anisotropic potential. It is established that the anisotropy of the potential plays a minor role for these spectra. The computed isotropic collision-induced Raman intensity, which is due to dissimilar pairs in H 2 -He and H 2 -Ar gas mixtures, is comparable to the intensities due to similar pairs (H 2 -H 2 , He-He, and Ar-Ar), which have been studied previously

  18. Probing the pairing interaction through two-neutron transfer reactions

    Directory of Open Access Journals (Sweden)

    Margueron J.

    2012-12-01

    Full Text Available The treatment of the pairing interaction in mean-field-based models is addressed. In particular, the possibility to use pair transfers as A tool to better constrain this interaction is discussed. First, pairing inter-actions with various density dependencies (surface/volume mixing are used in the microscopic Hartree-Fock-Bogoliubov + quasiparticle random-phase approximation model to generate the form factors to be used in reaction calculations. Cross sections for (p,t two-neutron transfer reactions are calculated in the one-step zero-range distorted-wave Born approximation for some Tin isotopes and for incident proton energies from 15 to 35 MeV. Three different surface/volume mixings of A zero-range density-dependent pairing interaction are employed in the microscopic calculations and the sensitivity of the cross sections to the different mixings is analyzed. Differences among the three different theoretical predictions are found espacially for the nucleus 136Sn and they are more important at the incident proton energy of 15 MeV. We thus indicate (p,t two-neutron transfer reactions with very neutron-rich Sn isotopes and at proton energies around 15 MeV as good experimental cases where the surface/volume mixing of the pairing interaction may be probed. In the second part of the manuscript, ground-state to ground-state transitions are investigated. Approximations made to estimate two-nucleon transfer probabilities in ground-state to ground-state transitions and the physical interpretation of these probabilities are discussed. Probabilities are often calculated by approximating both ground states of the initial nucleus A and of the final nucleus A±2 by the same quasiparticle vacuum. We analyze two improvements of this approach. First, the effect of using two different ground states with average numbers of particles A and A±2 is quantified. Second, by using projection techniques, the role of particle number restoration is analyzed. Our analysis

  19. Paired and interacting galaxies: Conference summary

    International Nuclear Information System (INIS)

    Norman, C.A.

    1990-01-01

    The author gives a summary of the conference proceedings. The conference began with the presentation of the basic data sets on pairs, groups, and interacting galaxies with the latter being further discussed with respect to both global properties and properties of the galactic nuclei. Then followed the theory, modelling and interpretation using analytic techniques, simulations and general modelling for spirals and ellipticals, starbursts and active galactic nuclei. Before the conference the author wrote down the three questions concerning pairs, groups and interacting galaxies that he hoped would be answered at the meeting: (1) How do they form, including the role of initial conditions, the importance of subclustering, the evolution of groups to compact groups, and the fate of compact groups; (2) How do they evolve, including issues such as relevant timescales, the role of halos and the problem of overmerging, the triggering and enhancement of star formation and activity in the galactic nuclei, and the relative importance of dwarf versus giant encounters; and (3) Are they important, including the frequency of pairs and interactions, whether merging and interactions are very important aspects of the life of a normal galaxy at formation, during its evolution, in forming bars, shells, rings, bulges, etc., and in the formation and evolution of active galaxies? Where possible he focuses on these three central issues in the summary

  20. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  1. Pair Interaction of Dislocations in Two-Dimensional Crystals

    Science.gov (United States)

    Eisenmann, C.; Gasser, U.; Keim, P.; Maret, G.; von Grünberg, H. H.

    2005-10-01

    The pair interaction between crystal dislocations is systematically explored by analyzing particle trajectories of two-dimensional colloidal crystals measured by video microscopy. The resulting pair energies are compared to Monte Carlo data and to predictions derived from the standard Hamiltonian of the elastic theory of dislocations. Good agreement is found with respect to the distance and temperature dependence of the interaction potential, but not regarding the angle dependence where discrete lattice effects become important. Our results on the whole confirm that the dislocation Hamiltonian allows a quantitative understanding of the formation and interaction energies of dislocations in two-dimensional crystals.

  2. Study of the pair-interaction function in some normal metals; Etude de l'interaction de paire dans quelques metaux normaux

    Energy Technology Data Exchange (ETDEWEB)

    Pick, R [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1965-06-01

    The pair interaction function has been derived for the following metals: Li, Na, K, Al. It is obtained via a second order perturbation expansion of the wave functions of the conduction electrons using a self-consistent pseudo-potential. Exchange and correlations between those electrons have been ignored. Such an interaction is only valid at constant volume and depends on a single experimental parameter, namely the ionic volume. Its main features are a pronounced minimum in the vicinity of the nearest neighbours, especially marked in alkaline metals, and an asymptotic decrease of the form cos(2k{sub F}r)/r{sup 3}. This interaction gives the correct crystalline structure of these metals at 0 K as well as a good approximation of the phonon spectrum of an alkaline. The validity of the perturbation technique is discussed. We prove that the pair interaction function is correctly given to second order in the pseudo-potential despite the various approximations and errors involved by such a method. (author) [French] L'interaction de paire effective entre ions a ete calculee dans les metaux Li, Na, K et Al. Elle est obtenue par un developpement en serie de perturbation des fonctions d'onde des electrons de conduction. Le developpement est pousse au deuxieme ordre et utilise un pseudo-potentiel self-consistant. Les phenomenes d'echange et de correlations entre ces electrons ont ete negliges. L'interaction calculee n'a de sens qu'a volume constant. Elle depend d'un seul parametre experimental, le volume ionique. Elle se caracterise par un minimum prononce de l'energie de paire pour les proches voisins, surtout marque chez les alcalins. Elle decroit asymptotiquement en cos(2k{sub F}r)/r{sup 3}. Elle permet de predire la structure cristalline la plus stable a 0 K; elle donne le spectre de phonons des alcalins avec une assez bonne precision. Par ailleurs, la validite de la methode de perturbation du deuxieme ordre est discutee. On montre qu'elle donne correctement l'interaction

  3. A flexible algorithm for calculating pair interactions on SIMD architectures

    Science.gov (United States)

    Páll, Szilárd; Hess, Berk

    2013-12-01

    Calculating interactions or correlations between pairs of particles is typically the most time-consuming task in particle simulation or correlation analysis. Straightforward implementations using a double loop over particle pairs have traditionally worked well, especially since compilers usually do a good job of unrolling the inner loop. In order to reach high performance on modern CPU and accelerator architectures, single-instruction multiple-data (SIMD) parallelization has become essential. Avoiding memory bottlenecks is also increasingly important and requires reducing the ratio of memory to arithmetic operations. Moreover, when pairs only interact within a certain cut-off distance, good SIMD utilization can only be achieved by reordering input and output data, which quickly becomes a limiting factor. Here we present an algorithm for SIMD parallelization based on grouping a fixed number of particles, e.g. 2, 4, or 8, into spatial clusters. Calculating all interactions between particles in a pair of such clusters improves data reuse compared to the traditional scheme and results in a more efficient SIMD parallelization. Adjusting the cluster size allows the algorithm to map to SIMD units of various widths. This flexibility not only enables fast and efficient implementation on current CPUs and accelerator architectures like GPUs or Intel MIC, but it also makes the algorithm future-proof. We present the algorithm with an application to molecular dynamics simulations, where we can also make use of the effective buffering the method introduces.

  4. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  5. Interactions in ion pairs of protic ionic liquids: Comparison with aprotic ionic liquids

    International Nuclear Information System (INIS)

    Tsuzuki, Seiji; Shinoda, Wataru; Miran, Md. Shah; Kinoshita, Hiroshi; Yasuda, Tomohiro; Watanabe, Masayoshi

    2013-01-01

    The stabilization energies for the formation (E form ) of 11 ion pairs of protic and aprotic ionic liquids were studied by MP2/6-311G ** level ab initio calculations to elucidate the difference between the interactions of ions in protic ionic liquids and those in aprotic ionic liquids. The interactions in the ion pairs of protic ionic liquids (diethylmethylammonium [dema] and dimethylpropylammonium [dmpa] based ionic liquids) are stronger than those of aprotic ionic liquids (ethyltrimethylammonium [etma] based ionic liquids). The E form for the [dema][CF 3 SO 3 ] and [dmpa][CF 3 SO 3 ] complexes (−95.6 and −96.4 kcal/mol, respectively) are significantly larger (more negative) than that for the [etma][CF 3 SO 3 ] complex (−81.0 kcal/mol). The same trend was observed for the calculations of ion pairs of the three cations with the Cl − , BF 4 − , TFSA − anions. The anion has contact with the N–H bond of the dema + or dmpa + cations in the most stable geometries of the dema + and dmpa + complexes. The optimized geometries, in which the anions locate on the counter side of the cations, are 11.0–18.0 kcal/mol less stable, which shows that the interactions in the ions pairs of protic ionic liquids have strong directionality. The E form for the less stable geometries for the dema + and dmpa + complexes are close to those for the most stable etma + complexes. The electrostatic interaction, which is the major source of the attraction in the ion pairs, is responsible for the directionality of the interactions and determining the magnitude of the interaction energy. Molecular dynamic simulations of the [dema][TFSA] and [dmpa][TFSA] ionic liquids show that the N–H bonds of the cations have contact with the negatively charged (oxygen and nitrogen) atoms of TFSA − anion, while the strong directionality of the interactions was not suggested from the simulation of the [etma][CF 3 SO 3 ] ionic liquid

  6. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  7. Pair interaction of bilayer-coated nanoscopic particles

    International Nuclear Information System (INIS)

    Qi-Yi, Zhang

    2009-01-01

    The pair interaction between bilayer membrane-coated nanosized particles has been explored by using the self-consistent field (SCF) theory. The bilayer membranes are composed of amphiphilic polymers. For different system parameters, the pair-interaction free energies are obtained. Particular emphasis is placed on the analysis of a sequence of structural transformations of bilayers on spherical particles, which occur during their approaching processes. For different head fractions of amphiphiles, the asymmetrical morphologies between bilayers on two particles and the inverted micellar intermediates have been found in the membrane fusion pathway. These results can benefit the fabrication of vesicles as encapsulation vectors for drug and gene delivery. (condensed matter: structure, thermal and mechanical properties)

  8. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  9. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  10. Pairing interaction method in crystal field theory

    International Nuclear Information System (INIS)

    Dushin, R.B.

    1989-01-01

    Expressions, permitting to describe matrix elements of secular equation for metal-ligand pairs via parameters of the method of pairing interactions, genealogical coefficients and Clebsch-Gordan coefficients, are given. The expressions are applicable to any level or term of f n and d n configurations matrix elements for the terms of the maximum multiplicity of f n and d n configurations and also for the main levels of f n configurations are tabulated

  11. Non-Production Benefits of Education: Crime, Health, and Good Citizenship. NBER Working Paper No. 16722

    Science.gov (United States)

    Lochner, Lance

    2011-01-01

    A growing body of work suggests that education offers a wide-range of benefits that extend beyond increases in labor market productivity. Improvements in education can lower crime, improve health, and increase voting and democratic participation. This chapter reviews recent developments on these "non-production" benefits of education with an…

  12. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  13. Scale-free behaviour of amino acid pair interactions in folded proteins

    DEFF Research Database (Denmark)

    Petersen, Steffen B.; Neves-Petersen, Maria Teresa; Mortensen, Rasmus J.

    2012-01-01

    The protein structure is a cumulative result of interactions between amino acid residues interacting with each other through space and/or chemical bonds. Despite the large number of high resolution protein structures, the ‘‘protein structure code’’ has not been fully identified. Our manuscript...... presents a novel approach to protein structure analysis in order to identify rules for spatial packing of amino acid pairs in proteins. We have investigated 8706 high resolution non-redundant protein chains and quantified amino acid pair interactions in terms of solvent accessibility, spatial and sequence...... which amino acid paired residues contributed to the cells with a population above 50, pairs of Ala, Ile, Leu and Val dominate the results. This result is statistically highly significant. We postulate that such pairs form ‘‘structural stability points’’ in the protein structure. Our data shows...

  14. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  15. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi

    2015-01-01

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  16. Interactions between Al₁₂X (X = Al, C, N and P) nanoparticles and DNA nucleobases/base pairs: implications for nanotoxicity.

    Science.gov (United States)

    Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang

    2012-02-01

    The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.

  17. A two-level solvable model involving competing pairing interactions

    International Nuclear Information System (INIS)

    Dussel, G.G.; Maqueda, E.E.; Perazzo, R.P.J.; Evans, J.A.

    1986-01-01

    A model is considered consisting of nucleons moving in two non-degenerate l-shells and interacting through two pairing residual interactions with (S, T) = (1, 0) and (0, 1). These, together with the single particle hamiltonian induce mutually destructive correlations, giving rise to various collective pictures that can be discussed as representing a two-dimensional space of phases. The model is solved exactly using an O(8)xO(8) group theoretical classification scheme. The transfer of correlated pairs and quartets is also discussed. (orig.)

  18. Atom-Pair Kinetics with Strong Electric-Dipole Interactions.

    Science.gov (United States)

    Thaicharoen, N; Gonçalves, L F; Raithel, G

    2016-05-27

    Rydberg-atom ensembles are switched from a weakly to a strongly interacting regime via adiabatic transformation of the atoms from an approximately nonpolar into a highly dipolar quantum state. The resultant electric dipole-dipole forces are probed using a device akin to a field ion microscope. Ion imaging and pair-correlation analysis reveal the kinetics of the interacting atoms. Dumbbell-shaped pair-correlation images demonstrate the anisotropy of the binary dipolar force. The dipolar C_{3} coefficient, derived from the time dependence of the images, agrees with the value calculated from the permanent electric-dipole moment of the atoms. The results indicate many-body dynamics akin to disorder-induced heating in strongly coupled particle systems.

  19. Molecular-Level Thermodynamic Switch Controls Chemical Equilibrium in Sequence-Specific Hydrophobic Interaction of 35 Dipeptide Pairs

    OpenAIRE

    Chun, Paul W.

    2003-01-01

    Applying the Planck-Benzinger methodology, the sequence-specific hydrophobic interactions of 35 dipeptide pairs were examined over a temperature range of 273–333 K, based on data reported by Nemethy and Scheraga in 1962. The hydrophobic interaction in these sequence-specific dipeptide pairs is highly similar in its thermodynamic behavior to that of other biological systems. The results imply that the negative Gibbs free energy change minimum at a well-defined stable temperature, 〈Ts〉, where t...

  20. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2012-01-01

    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  1. Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Thomas

    2016-10-19

    The physics of neutron-rich systems is of great interest in nuclear and astrophysics. Precise knowledge of the properties of neutron-rich nuclei is crucial for understanding the synthesis of heavy elements. Infinite neutron matter determines properties of neutron stars, a final stage of heavy stars after a core-collapse supernova. It also provides a unique theoretical laboratory for nuclear forces. Strong interactions are determined by quantum chromodynamics (QCD). However, QCD is non-perturbative at low energies and one presently cannot directly calculate nuclear forces from it. Chiral effective field theory circumvents these problems and connects the symmetries of QCD to nuclear interactions. It naturally and systematically includes many-nucleon forces and gives access to uncertainty estimates. We use chiral interactions throughout all calculation in this thesis. Neutron stars are very extreme objects. The densities in their interior greatly exceed those in nuclei. The exact composition and properties of neutron stars is still unclear but they consist mainly of neutrons. One can explore neutron stars theoretically with calculations of neutron matter. In the inner core of neutron stars exist very high densities and thus maybe exotic phases of matter. To investigate whether there exists a phase transition to such phases even at moderate densities we study the chiral condensate in neutron matter, the order parameter of chiral symmetry breaking, and find no evidence for a phase transition at nuclear densities. We also calculate the more extreme system of spin-polarised neutron matter. With this we address the question whether there exists such a polarised phase in neutron stars and also provide a benchmark system for lattice QCD. We find spin-polarised neutron matter to be an almost non-interacting Fermi gas. To understand the cooling of neutron stars neutron pairing is of great importance. Due to the high densities especially triplet pairing is of interest. We

  2. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  3. Quasi-planar elemental clusters in pair interactions approximation

    Directory of Open Access Journals (Sweden)

    Chkhartishvili Levan

    2016-01-01

    Full Text Available The pair-interactions approximation, when applied to describe elemental clusters, only takes into account bonding between neighboring atoms. According to this approach, isomers of wrapped forms of 2D clusters – nanotubular and fullerene-like structures – and truly 3D clusters, are generally expected to be more stable than their quasi-planar counterparts. This is because quasi-planar clusters contain more peripheral atoms with dangling bonds and, correspondingly, fewer atoms with saturated bonds. However, the differences in coordination numbers between central and peripheral atoms lead to the polarization of bonds. The related corrections to the molar binding energy can make small, quasi-planar clusters more stable than their 2D wrapped allotropes and 3D isomers. The present work provides a general theoretical frame for studying the relative stability of small elemental clusters within the pair interactions approximation.

  4. Pair correlations in near-magic nuclei and the nucleon--phonon interaction

    International Nuclear Information System (INIS)

    Kadmenskii, S.G.; Luk'yanovich, P.A.; Remesov, Y.I.; Furman, V.I.

    1987-01-01

    It is demonstrated that the nucleon-pairing phenomenon is entirely due to the finiteness of nuclei. A technique for taking account of the phonon-exchange-related retarded interaction in the particle--particle channel is developed for nuclei of the ''mag +- 2'' and ''mag +- 3'' types. It is shown that the nucleon--phonon interaction strength computed with allowance for the most collectivized surface oscillation branches makes it possible to ensure the correct attraction scale necessary for the description of the pairing phenomenon. The existence of a more profound similarity between the phenomena of superconductivity of metals and Cooper pairing of nucleons in nuclei is thus demonstrated

  5. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  6. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  7. Calculation of nuclear moment of inertia with proper treatment of pairing interaction

    International Nuclear Information System (INIS)

    Tazaki, S.; Ando, Y.; Hasegawa, M.

    1997-01-01

    An attempt to calculate nuclear moments of inertia treating the pairing interaction exactly is reported. As usual, hamiltonian is composed of the Nilsson's singleparticle energies and the pairing interaction, but the eigenstates and the eigenvalues are calculated exactly in a realistic, sufficiently large model space. The method of calculating the moment of inertia is presented. (author)

  8. Role of pn-pairs interaction in nuclear structure

    International Nuclear Information System (INIS)

    Nie, G.K.

    2004-01-01

    Full text: The nuclear structure approach is based on theory of interaction of pn-pairs with suggestion that proton and neutron of one pair have the same nuclear potential. In frame of this model nuclei with N=Z were analyzed in [1,2]. In [1] radii of position of last proton were estimated on difference of proton and neutron separation energies. In [2] a phenomenological formula for calculation of binding energy of alpha- cluster nuclei was found. Present work is devoted to developing the nuclear structure model. Coulomb energy of nuclei with N=Z has been found from sum of differences of separation energies of protons and neutrons belonging to one pairs. From analysis of nuclei 12 C and 16 O the value of energy of Coulomb repulsion between 2 α -clusters has been estimated equal to ε C α =1.925 MeV [3], which means that value of nuclear (meson) interaction between 2 α -clusters is expected to be ε m αα = ε cov αα + ε C α =4.350 MeV. From suggestion that energy of long range Coulomb repulsion is compensated by surface tension energy an equation has been found to calculate radius of position of last proton on value of Z. Charge radii of nuclei from 58 Ni to 208 Bi and further have been calculated with difference from experimental ones in several hundredths of fm. In the approach binding energy of excess neutrons stays beyond the consideration. Therefore, in calculation of binding energies of nuclei the experimental values of separation energies of excess neutrons are used. There is a good agreement between calculated values of binding energies of some isotopes of all known elements as well as separation energies of alpha particle and deuteron and experimental data. The difference from experimental binding energy in most of the cases is about 0.5% and less

  9. Radical-pair based avian magnetoreception

    Science.gov (United States)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  10. Quantifying the FIR interaction enhancement in paired galaxies

    International Nuclear Information System (INIS)

    Xu Cong; Sulentic, J.W.

    1990-01-01

    We studied the ''Catalogue of Isolated Pairs of Galaxies in the Northern Hemisphere'' by Karachentsev (1972) and a well matched comparison sample taken from the ''Catalogue of Isolated Galaxies'' by Karachentseva (1973) in order to quantify the enhanced FIR emission properties of interacting galaxies. 8 refs, 6 figs

  11. A number-projected model with generalized pairing interaction in application to rotating nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Satula, W. [Warsaw Univ. (Poland)]|[Joint Institute for Heavy Ion Research, Oak Ridge, TN (United States)]|[Univ. of Tennessee, Knoxville, TN (United States)]|[Royal Institute of Technology, Stockholm (Sweden); Wyss, R. [Royal Institute of Technology, Stockholm (Sweden)

    1996-12-31

    A cranked mean-field model that takes into account both T=1 and T=0 pairing interactions is presented. The like-particle pairing interaction is described by means of a standard seniority force. The neutron-proton channel includes simultaneously correlations among particles moving in time reversed orbits (T=1) and identical orbits (T=0). The coupling between different pairing channels and nuclear rotation is taken into account selfconsistently. Approximate number-projection is included by means of the Lipkin-Nogami method. The transitions between different pairing phases are discussed as a function of neutron/proton excess, T{sub z}, and rotational frequency, {Dirac_h}{omega}.

  12. Sensitivity analysis of physiochemical interaction model: which pair ...

    African Journals Online (AJOL)

    ... of two model parameters at a time on the solution trajectory of physiochemical interaction over a time interval. Our aim is to use this powerful mathematical technique to select the important pair of parameters of this physical process which is cost-effective. Keywords: Passivation Rate, Sensitivity Analysis, ODE23, ODE45 ...

  13. Optimal definition of inter-residual contact in globular proteins based on pairwise interaction energy calculations, its robustness, and applications.

    Science.gov (United States)

    Fačkovec, Boris; Vondrášek, Jiří

    2012-10-25

    Although a contact is an essential measurement for the topology as well as strength of non-covalent interactions in biomolecules and their complexes, there is no general agreement in the definition of this feature. Most of the definitions work with simple geometric criteria which do not fully reflect the energy content or ability of the biomolecular building blocks to arrange their environment. We offer a reasonable solution to this problem by distinguishing between "productive" and "non-productive" contacts based on their interaction energy strength and properties. We have proposed a method which converts the protein topology into a contact map that represents interactions with statistically significant high interaction energies. We do not prove that these contacts are exclusively stabilizing, but they represent a gateway to thermodynamically important rather than geometry-based contacts. The process is based on protein fragmentation and calculation of interaction energies using the OPLS force field and relies on pairwise additivity of amino acid interactions. Our approach integrates the treatment of different types of interactions, avoiding the problems resulting from different contributions to the overall stability and the different effect of the environment. The first applications on a set of homologous proteins have shown the usefulness of this classification for a sound estimate of protein stability.

  14. Reduction of nuclear moment of inertia due to pairing interaction

    International Nuclear Information System (INIS)

    Zeng, J.Y.; Jin, T.H.; Zhao, Z.J.

    1994-01-01

    The BCS theoretical values of the moments of inertia of even-even nuclei are systematically smaller than the experimental ones by a factor of 10--40%. This long-standing discrepancy disappears in the particle-number-conserving treatment for the cranked shell model, in which the blocking effects are taken into account exactly. The calculated moments of inertia satisfactorily reproduce the experimental data covering a large number of rare-earth even-even nuclei, whose deformations and single-particle states are well characterized (Lund systematics). The pairing interaction strength G is unambiguously determined by the even-odd mass difference. The reduction of the moment of inertia due to the antialignment effect of pairing interaction is discussed and no systematic excessive reduction is found

  15. A Survey of Aspartate Phenylalanine and Glutamate Phenylalanine Interactions in the Protein Data Bank: Searching for Anion Pairs

    Energy Technology Data Exchange (ETDEWEB)

    Philip, Vivek M [ORNL; Harris, Jason B [ORNL; Adams, Rachel M [ORNL; Nguyen, Don [University of Tennessee, Knoxville (UTK); Spires, Jeremy [University of Tennessee, Knoxville (UTK); Howell, Elizabeth E. [University of Tennessee, Knoxville (UTK); Hinde, Robert J [ORNL

    2011-01-01

    Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242 8249]. To study the role of anion interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification of Phe Asp or Glu pairs separated by less than 7 in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura Morokuma energy calculations were performed on roughly 19000 benzene formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (2 to 7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion pairs are found throughout protein structures, in helices as well as strands. Numerous pairs also had nearby cation interactions as well as potential stacking. While more than 1000 structures did not contain an anion pair, the 3134 remaining structures contained approximately 2.6 anion pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.

  16. Development of a Model Protein Interaction Pair as a Benchmarking Tool for the Quantitative Analysis of 2-Site Protein-Protein Interactions.

    Science.gov (United States)

    Yamniuk, Aaron P; Newitt, John A; Doyle, Michael L; Arisaka, Fumio; Giannetti, Anthony M; Hensley, Preston; Myszka, David G; Schwarz, Fred P; Thomson, James A; Eisenstein, Edward

    2015-12-01

    A significant challenge in the molecular interaction field is to accurately determine the stoichiometry and stepwise binding affinity constants for macromolecules having >1 binding site. The mission of the Molecular Interactions Research Group (MIRG) of the Association of Biomolecular Resource Facilities (ABRF) is to show how biophysical technologies are used to quantitatively characterize molecular interactions, and to educate the ABRF members and scientific community on the utility and limitations of core technologies [such as biosensor, microcalorimetry, or analytic ultracentrifugation (AUC)]. In the present work, the MIRG has developed a robust model protein interaction pair consisting of a bivalent variant of the Bacillus amyloliquefaciens extracellular RNase barnase and a variant of its natural monovalent intracellular inhibitor protein barstar. It is demonstrated that this system can serve as a benchmarking tool for the quantitative analysis of 2-site protein-protein interactions. The protein interaction pair enables determination of precise binding constants for the barstar protein binding to 2 distinct sites on the bivalent barnase binding partner (termed binase), where the 2 binding sites were engineered to possess affinities that differed by 2 orders of magnitude. Multiple MIRG laboratories characterized the interaction using isothermal titration calorimetry (ITC), AUC, and surface plasmon resonance (SPR) methods to evaluate the feasibility of the system as a benchmarking model. Although general agreement was seen for the binding constants measured using solution-based ITC and AUC approaches, weaker affinity was seen for surface-based method SPR, with protein immobilization likely affecting affinity. An analysis of the results from multiple MIRG laboratories suggests that the bivalent barnase-barstar system is a suitable model for benchmarking new approaches for the quantitative characterization of complex biomolecular interactions.

  17. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  18. Theoretical Probing of Weak Anion-Cation Interactions in Certain Pyridinium-Based Ionic Liquid Ion Pairs and the Application of Molecular Electrostatic Potential in Their Ionic Crystal Density Determination: A Comparative Study Using Density Functional Approach.

    Science.gov (United States)

    Joseph, Aswathy; Thomas, Vibin Ipe; Żyła, Gaweł; Padmanabhan, A S; Mathew, Suresh

    2018-01-11

    A comprehensive study on the structure, nature of interaction, and properties of six ionic pairs of 1-butylpyridinium and 1-butyl-4-methylpyridinium cations in combination with tetrafluoroborate (BF 4 - ), chloride (Cl - ), and bromide (Br - ) anions have been carried out using density functional theory (DFT). The anion-cation interaction energy (ΔE int ), thermochemistry values, theoretical band gap, molecular orbital energy order, DFT-based chemical activity descriptors [chemical potential (μ), chemical hardness (η), and electrophilicity index (ω)], and distribution of density of states (DOS) of these ion pairs were investigated. The ascendancy of the -CH 3 substituent at the fourth position of the 1-butylpyridinium cation ring on the values of ΔE int , theoretical band gap and chemical activity descriptors was evaluated. The ΔE int values were negative for all six ion pairs and were highest for Cl - containing ion pairs. The theoretical band gap value after -CH 3 substitution increased from 3.78 to 3.96 eV (for Cl - ) and from 2.74 to 2.88 eV (for Br - ) and decreased from 4.9 to 4.89 eV (for BF 4 - ). Ion pairs of BF 4 - were more susceptible to charge transfer processes as inferred from their significantly high η values and comparatively small difference in ω value after -CH 3 substitution. The change in η and μ values due to the -CH 3 substituent is negligibly small in all cases except for the ion pairs of Cl - . Critical-point (CP) analyses were carried out to investigate the AIM topological parameters at the interionic bond critical points (BCPs). The RDG isosurface analysis indicated that the anion-cation interaction was dominated by strong H cat ···X ani and C cat ···X ani interactions in ion pairs of Cl - and Br - whereas a weak van der Waal's effect dominated in ion pairs of BF 4 - . The molecular electrostatic potential (MESP)-based parameter ΔΔV min measuring the anion-cation interaction strength showed a good linear correlation with

  19. Feature-Based and String-Based Models for Predicting RNA-Protein Interaction

    Directory of Open Access Journals (Sweden)

    Donald Adjeroh

    2018-03-01

    Full Text Available In this work, we study two approaches for the problem of RNA-Protein Interaction (RPI. In the first approach, we use a feature-based technique by combining extracted features from both sequences and secondary structures. The feature-based approach enhanced the prediction accuracy as it included much more available information about the RNA-protein pairs. In the second approach, we apply search algorithms and data structures to extract effective string patterns for prediction of RPI, using both sequence information (protein and RNA sequences, and structure information (protein and RNA secondary structures. This led to different string-based models for predicting interacting RNA-protein pairs. We show results that demonstrate the effectiveness of the proposed approaches, including comparative results against leading state-of-the-art methods.

  20. Local free energies for the coarse-graining of adsorption phenomena: The interacting pair approximation

    Science.gov (United States)

    Pazzona, Federico G.; Pireddu, Giovanni; Gabrieli, Andrea; Pintus, Alberto M.; Demontis, Pierfranco

    2018-05-01

    We investigate the coarse-graining of host-guest systems under the perspective of the local distribution of pore occupancies, along with the physical meaning and actual computability of the coarse-interaction terms. We show that the widely accepted approach, in which the contributions to the free energy given by the molecules located in two neighboring pores are estimated through Monte Carlo simulations where the two pores are kept separated from the rest of the system, leads to inaccurate results at high sorbate densities. In the coarse-graining strategy that we propose, which is based on the Bethe-Peierls approximation, density-independent interaction terms are instead computed according to local effective potentials that take into account the correlations between the pore pair and its surroundings by means of mean-field correction terms without the need for simulating the pore pair separately. Use of the interaction parameters obtained this way allows the coarse-grained system to reproduce more closely the equilibrium properties of the original one. Results are shown for lattice-gases where the local free energy can be computed exactly and for a system of Lennard-Jones particles under the effect of a static confining field.

  1. Beauty pair production in 600 GeV/c π-emulsion interactions

    International Nuclear Information System (INIS)

    Lipton, R.

    1992-01-01

    Nine beauty pairs have been observed by the E653 experiment in 600 GeV/c π-emulsion interactions. The experiment uses a combination of nuclear emulsion and silicon vertex detectors to unambiguously reconstruct decay vertices. A muon trigger was used to select semi-muonic beauty decays for scanning. Results on production characteristics and lifetimes of beauty pairs are presented, for charged and neutral B lifetimes. (R.P.) 2 figs.; 1 tab

  2. A survey of aspartate-phenylalanine and glutamate-phenylalanine interactions in the protein data bank: searching for anion-π pairs.

    Science.gov (United States)

    Philip, Vivek; Harris, Jason; Adams, Rachel; Nguyen, Don; Spiers, Jeremy; Baudry, Jerome; Howell, Elizabeth E; Hinde, Robert J

    2011-04-12

    Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion-π pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion-quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242-8249]. To study the role of anion-π interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification of Phe-Asp or -Glu pairs separated by less than 7 Å in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura-Morokuma energy calculations were performed on roughly 19000 benzene-formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (-2 to -7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion-π pairs are found throughout protein structures, in helices as well as β strands. Numerous pairs also had nearby cation-π interactions as well as potential π-π stacking. While more than 1000 structures did not contain an anion-π pair, the 3134 remaining structures contained approximately 2.6 anion-π pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.

  3. A Survey of Aspartate-Phenylalanine and Glutamate-Phenylalanine Interactions in the Protein Data Bank: Searching for Anion-pi Pairs

    Energy Technology Data Exchange (ETDEWEB)

    Philip, Vivek M [ORNL; Harris, Jason B [ORNL; Adams, Rachel M [ORNL; Nguyen, Don [University of Tennessee; Spiers, Jeremy D [ORNL; Baudry, Jerome Y [ORNL; Howell, Elizabeth E [ORNL; Hinde, Robert J [ORNL

    2011-01-01

    Protein structures are stabilized using noncovalent interactions. In addition to the traditional noncovalent interactions, newer types of interactions are thought to be present in proteins. One such interaction, an anion-{pi} pair, in which the positively charged edge of an aromatic ring interacts with an anion, forming a favorable anion-quadrupole interaction, has been previously proposed [Jackson, M. R., et al. (2007) J. Phys. Chem. B111, 8242-8249]. To study the role of anion-{pi} interactions in stabilizing protein structure, we analyzed pairwise interactions between phenylalanine (Phe) and the anionic amino acids, aspartate (Asp) and glutamate (Glu). Particular emphasis was focused on identification of Phe-Asp or -Glu pairs separated by less than 7 {angstrom} in the high-resolution, nonredundant Protein Data Bank. Simplifying Phe to benzene and Asp or Glu to formate molecules facilitated in silico analysis of the pairs. Kitaura-Morokuma energy calculations were performed on roughly 19000 benzene-formate pairs and the resulting energies analyzed as a function of distance and angle. Edgewise interactions typically produced strongly stabilizing interaction energies (-2 to -7.3 kcal/mol), while interactions involving the ring face resulted in weakly stabilizing to repulsive interaction energies. The strongest, most stabilizing interactions were identified as preferentially occurring in buried residues. Anion-{pi} pairs are found throughout protein structures, in helices as well as {beta} strands. Numerous pairs also had nearby cation-{pi} interactions as well as potential {pi}-{pi} stacking. While more than 1000 structures did not contain an anion-{pi} pair, the 3134 remaining structures contained approximately 2.6 anion-{pi} pairs per protein, suggesting it is a reasonably common motif that could contribute to the overall structural stability of a protein.

  4. Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin

    2015-01-01

    Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.

  5. Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells

    KAUST Repository

    Wong, Ka-Chun

    2015-09-27

    Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.

  6. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  7. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  8. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  9. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  10. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  11. Lignin from hydrothermally pretreated grass biomass retards enzymatic cellulose degradation by acting as a physical barrier rather than by inducing nonproductive adsorption of enzymes

    DEFF Research Database (Denmark)

    Djajadi, Demi T.; Jensen, Mads M.; Oliveira, Marlene

    2018-01-01

    Lignin is known to hinder efficient enzymatic conversion of lignocellulose in biorefining processes. In particular, nonproductive adsorption of cellulases onto lignin is considered a key mechanism to explain how lignin retards enzymatic cellulose conversion in extended reactions. Lignin-rich resi...

  12. Continuous unitary transformation approach to pairing interactions in statistical physics

    Directory of Open Access Journals (Sweden)

    T.Domański

    2008-06-01

    Full Text Available We apply the flow equation method to the study of the fermion systems with pairing interactions which lead to the BCS instability signalled by the appearance of the off-diagonal order parameter. For this purpose we rederive the continuous Bogoliubov transformation in a fashion of renormalization group procedure where the low and high energy sectors are treated subsequently. We further generalize this procedure to the case of fermions interacting with the discrete boson mode. Andreev-type interactions are responsible for developing a gap in the excitation spectrum. However, the long-range coherence is destroyed due to strong quantum fluctuations.

  13. The interaction of counter-rotating strained vortex pairs with a third vortex

    International Nuclear Information System (INIS)

    Higgins, Keith; Ooi, Andrew; Chong, M S; Ruetten, Markus

    2009-01-01

    The vortex dynamics caused by the interaction of counter-rotating Burgers vortex pairs with a third Burgers vortex in a straining flow is investigated numerically. These interactions blend vortex merging and cancellation effects, and the aim is to investigate how the third vortex might influence the evolution of the vortex pair. Many different choices of initial conditions for the pair and third vortex exist, so attention is restricted to a class of initial conditions in which the vortex pair initially moves in the general direction of vortex 3, and the distance from vortex 3 to the line of free propagation of the vortex pair is the 'offset' parameter δ. A series of calculations with 0≤δ≤4 reveals three types of intermediate-time vortex dynamics that are called merging, swapping and switching. The evolution of the vortex core separation and core vorticity level diagnostics are used to determine the points of transition from merging to swapping and switching. In the longer term, vortex merging, cancellation and straining reduces the three vortices to a single vortex. Other diagnostics of interest are also monitored, including the spatial distributions of the rate of viscous dissipation and terms contributing to the vorticity transport equation. During the merging phase for the case with δ=0, double-peak and double-trough structures are observed in the dissipation-rate contours. In addition, the diffusion of vorticity dominates the vortex-stretching effect near vortex 1 during its absorbtion by vortex 3. Finally, the dynamics of the three vortices are also examined by computing a co-rotating angular velocity and stream function. A series of peaks in the co-rotating angular velocity is found to be associated with the conservation of angular momentum and interactions with a 'ghost' vortex in the co-rotating stream function.

  14. Suitability of the Binaural Interaction Component for Interaural Electrode Pairing of Bilateral Cochlear Implants.

    Science.gov (United States)

    Hu, Hongmei; Kollmeier, Birger; Dietz, Mathias

    2016-01-01

    Although bilateral cochlear implants (BiCIs) have succeeded in improving the spatial hearing performance of bilateral CI users, the overall performance is still not comparable with normal hearing listeners. Limited success can be partially caused by an interaural mismatch of the place-of-stimulation in each cochlea. Pairing matched interaural CI electrodes and stimulating them with the same frequency band is expected to facilitate binaural functions such as binaural fusion, localization, or spatial release from masking. It has been shown in animal experiments that the magnitude of the binaural interaction component (BIC) derived from the wave-eV decreases for increasing interaural place of stimulation mismatch. This motivated the investigation of the suitability of an electroencephalography-based objective electrode-frequency fitting procedure based on the BIC for BiCI users. A 61 channel monaural and binaural electrically evoked auditory brainstem response (eABR) recording was performed in 7 MED-EL BiCI subjects so far. These BiCI subjects were directly stimulated at 60% dynamic range with 19.9 pulses per second via a research platform provided by the University of Innsbruck (RIB II). The BIC was derived for several interaural electrode pairs by subtracting the response from binaural stimulation from their summed monaural responses. The BIC based pairing results are compared with two psychoacoustic pairing methods: interaural pulse time difference sensitivity and interaural pitch matching. The results for all three methods analyzed as a function of probe electrode allow for determining a matched pair in more than half of the subjects, with a typical accuracy of ± 1 electrode. This includes evidence for statistically significant tuning of the BIC as a function of probe electrode in human subjects. However, results across the three conditions were sometimes not consistent. These discrepancies will be discussed in the light of pitch plasticity versus less plastic

  15. Theoretical study of GC+/GC base pair derivatives

    International Nuclear Information System (INIS)

    Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu

    2005-01-01

    The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

  16. Quasiparticles in a diffusive conductor: interaction and pairing

    International Nuclear Information System (INIS)

    Gueron, S.

    1997-01-01

    The interaction between quasi particles is studied both theoretically and experimentally. The first part of this thesis is to provide direct evidence for this interaction by measuring the energy exchange rate between quasi particles in the case of thin metallic diffusive films. The experimental results agree qualitatively with the existing theories but are not explained quantitatively. The second part of this thesis deals with the propagation of correlation of pairs of electrons with opposite spin in a normal metal when it is placed in contact with a superconductor. This proximity effect is studied by measuring the density of states. The aim of the experiments is to specify in what sense a normal metal in proximity with a superconductor develops a superconducting character. (A.C.)

  17. Quasiparticles in a diffusive conductor: interaction and pairing

    Energy Technology Data Exchange (ETDEWEB)

    Gueron, S

    1997-10-17

    The interaction between quasi particles is studied both theoretically and experimentally. The first part of this thesis is to provide direct evidence for this interaction by measuring the energy exchange rate between quasi particles in the case of thin metallic diffusive films. The experimental results agree qualitatively with the existing theories but are not explained quantitatively. The second part of this thesis deals with the propagation of correlation of pairs of electrons with opposite spin in a normal metal when it is placed in contact with a superconductor. This proximity effect is studied by measuring the density of states. The aim of the experiments is to specify in what sense a normal metal in proximity with a superconductor develops a superconducting character. (A.C.) 102 refs.

  18. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

    2010-01-01

    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  19. Yoink: An interaction-based partitioning API.

    Science.gov (United States)

    Zheng, Min; Waller, Mark P

    2018-05-15

    Herein, we describe the implementation details of our interaction-based partitioning API (application programming interface) called Yoink for QM/MM modeling and fragment-based quantum chemistry studies. Interactions are detected by computing density descriptors such as reduced density gradient, density overlap regions indicator, and single exponential decay detector. Only molecules having an interaction with a user-definable QM core are added to the QM region of a hybrid QM/MM calculation. Moreover, a set of molecule pairs having density-based interactions within a molecular system can be computed in Yoink, and an interaction graph can then be constructed. Standard graph clustering methods can then be applied to construct fragments for further quantum chemical calculations. The Yoink API is licensed under Apache 2.0 and can be accessed via yoink.wallerlab.org. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

  20. Non-separable pairing interaction kernels applied to superconducting cuprates

    International Nuclear Information System (INIS)

    Haley, Stephen B.; Fink, Herman J.

    2014-01-01

    Highlights: • Non-separable interaction kernels with weak interactions produces HTS. • A probabilistic approach is used in filling the electronic states in the unit cell. • A set of coupled equations is derived which describes the energy gap. • SC properties of separable with non-separable interactions are compared. • There is agreement with measured properties of the SC and normal states. - Abstract: A pairing Hamiltonian H(Γ) with a non-separable interaction kernel Γ produces HTS for relatively weak interactions. The doping and temperature dependence of Γ(x,T) and the chemical potential μ(x) is determined by a probabilistic filling of the electronic states in the cuprate unit cell. A diverse set of HTS and normal state properties is examined, including the SC phase transition boundary T C (x), SC gap Δ(x,T), entropy S(x,T), specific heat C(x,T), and spin susceptibility χ s (x,T). Detailed x,T agreement with cuprate experiment is obtained for all properties

  1. Soft pair excitations and double-log divergences due to carrier interactions in graphene

    Science.gov (United States)

    Lewandowski, Cyprian; Levitov, L. S.

    2018-03-01

    Interactions between charge carriers in graphene lead to logarithmic renormalization of observables mimicking the behavior known in (3+1)-dimensional quantum electrodynamics (QED). Here we analyze soft electron-hole (e -h ) excitations generated as a result of fast charge dynamics, a direct analog of the signature QED effect—multiple soft photons produced by the QED vacuum shakeup. We show that such excitations are generated in photon absorption, when a photogenerated high-energy e -h pair cascades down in energy and gives rise to multiple soft e -h excitations. This fundamental process is manifested in a double-log divergence in the emission rate of soft pairs and a characteristic power-law divergence in their energy spectrum of the form 1/ω ln(ω/Δ ) . Strong carrier-carrier interactions make pair production a prominent pathway in the photoexcitation cascade.

  2. Paired and Interacting Galaxies: International Astronomical Union Colloquium No. 124

    Science.gov (United States)

    Sulentic, Jack W. (Editor); Keel, William C. (Editor); Telesco, C. M. (Editor)

    1990-01-01

    The proceedings of the International Astronomical Union Colloquium No. 124, held at the University of Alabama at Tuscaloosa, on December 4 to 7, are given. The purpose of the conference was to describe the current state of theoretical and observational knowledge of interacting galaxies, with particular emphasis on galaxies in pairs.

  3. Pair interactions of heavy vortices in quantum fluids

    Science.gov (United States)

    Pshenichnyuk, Ivan A.

    2018-02-01

    The dynamics of quantum vortex pairs carrying heavy doping matter trapped inside their cores is studied. The nonlinear classical matter field formalism is used to build a universal mathematical model of a heavy vortex applicable to different types of quantum mixtures. It is shown how the usual vortex dynamics typical for undoped pairs qualitatively changes when heavy dopants are used: heavy vortices with opposite topological charges (chiralities) attract each other, while vortices with the same charge are repelled. The force responsible for such behavior appears as a result of superposition of vortices velocity fields in the presence of doping substance and can be considered as a special realization of the Magnus effect. The force is evaluated quantitatively and its inverse proportionality to the distance is demonstrated. The mechanism described in this paper gives an example of how a light nonlinear classical field may realize repulsive and attractive interactions between embedded heavy impurities.

  4. The essential role of vibronic interactions in electron pairing in the micro- and macroscopic sized materials

    International Nuclear Information System (INIS)

    Kato, Takashi

    2010-01-01

    Graphical abstract: The electron-phonon interactions destroy the electron pairs formed by Coulomb interactions, and at the same time, form the energy gap by which the electron pairs become stable. - Abstract: In order to discuss how the nondissipative delocalized diamagnetic currents in the microscopic sized materials are closely related to the conventional superconductivity in the macroscopic sized materials, the unified theory, by which various sized superconductivity can be explained, is suggested. It has been believed for a long time that the electron-phonon interactions play an essential role in the attractive electron-electron interactions, as described in the Bardeen-Cooper-Schrieffer (BCS) theory in the conventional superconductivity. However, it is suggested in this paper that the electron-phonon interactions do not play an essential role in the attractive electron-electron interactions but play an essential role in the forming of energy gap by which the electron pairs formed by the attractive Coulomb interactions in the conventional superconducting states become more stable than those in the normal metallic states at low temperatures.

  5. Kπ=1+ pairing interaction and moments of inertia of superdeformed rotational bands in atomic nuclei

    International Nuclear Information System (INIS)

    Hamamoto, I.; Nazarewicz, W.

    1994-01-01

    The effect of the pairing interaction coming from the rotationally induced K π =1 + pair-density on the nuclear moments of inertia is studied. It is pointed out that, contrary to the situation at normal deformations, the inclusion of the K π =1 + pairing may appreciably modify the frequency dependence of the moments of inertia at superdeformed shapes

  6. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  7. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Pair-correlations in swimmer suspensions

    Science.gov (United States)

    Nambiar, Sankalp; Subramanian, Ganesh

    2017-11-01

    Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r > L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.

  9. Measuring pair-wise molecular interactions in a complex mixture

    Science.gov (United States)

    Chakraborty, Krishnendu; Varma, Manoj M.; Venkatapathi, Murugesan

    2016-03-01

    Complex biological samples such as serum contain thousands of proteins and other molecules spanning up to 13 orders of magnitude in concentration. Present measurement techniques do not permit the analysis of all pair-wise interactions between the components of such a complex mixture to a given target molecule. In this work we explore the use of nanoparticle tags which encode the identity of the molecule to obtain the statistical distribution of pair-wise interactions using their Localized Surface Plasmon Resonance (LSPR) signals. The nanoparticle tags are chosen such that the binding between two molecules conjugated to the respective nanoparticle tags can be recognized by the coupling of their LSPR signals. This numerical simulation is done by DDA to investigate this approach using a reduced system consisting of three nanoparticles (a gold ellipsoid with aspect ratio 2.5 and short axis 16 nm, and two silver ellipsoids with aspect ratios 3 and 2 and short axes 8 nm and 10 nm respectively) and the set of all possible dimers formed between them. Incident light was circularly polarized and all possible particle and dimer orientations were considered. We observed that minimum peak separation between two spectra is 5 nm while maximum is 184nm.

  10. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  11. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. PIPE: a protein-protein interaction prediction engine based on the re-occurring short polypeptide sequences between known interacting protein pairs

    Directory of Open Access Journals (Sweden)

    Greenblatt Jack

    2006-07-01

    Full Text Available Abstract Background Identification of protein interaction networks has received considerable attention in the post-genomic era. The currently available biochemical approaches used to detect protein-protein interactions are all time and labour intensive. Consequently there is a growing need for the development of computational tools that are capable of effectively identifying such interactions. Results Here we explain the development and implementation of a novel Protein-Protein Interaction Prediction Engine termed PIPE. This tool is capable of predicting protein-protein interactions for any target pair of the yeast Saccharomyces cerevisiae proteins from their primary structure and without the need for any additional information or predictions about the proteins. PIPE showed a sensitivity of 61% for detecting any yeast protein interaction with 89% specificity and an overall accuracy of 75%. This rate of success is comparable to those associated with the most commonly used biochemical techniques. Using PIPE, we identified a novel interaction between YGL227W (vid30 and YMR135C (gid8 yeast proteins. This lead us to the identification of a novel yeast complex that here we term vid30 complex (vid30c. The observed interaction was confirmed by tandem affinity purification (TAP tag, verifying the ability of PIPE to predict novel protein-protein interactions. We then used PIPE analysis to investigate the internal architecture of vid30c. It appeared from PIPE analysis that vid30c may consist of a core and a secondary component. Generation of yeast gene deletion strains combined with TAP tagging analysis indicated that the deletion of a member of the core component interfered with the formation of vid30c, however, deletion of a member of the secondary component had little effect (if any on the formation of vid30c. Also, PIPE can be used to analyse yeast proteins for which TAP tagging fails, thereby allowing us to predict protein interactions that are not

  13. Pair Interactions and Mode of Communication: Comparing Face-to-Face and Computer Mediated Communication

    Science.gov (United States)

    Tan, Lan Liana; Wigglesworth, Gillian; Storch, Neomy

    2010-01-01

    In today's second language classrooms, students are often asked to work in pairs or small groups. Such collaboration can take place face-to-face, but now more often via computer mediated communication. This paper reports on a study which investigated the effect of the medium of communication on the nature of pair interaction. The study involved…

  14. Lignin from hydrothermally pretreated grass biomass retards enzymatic cellulose degradation by acting as a physical barrier rather than by inducing nonproductive adsorption of enzymes.

    Science.gov (United States)

    Djajadi, Demi T; Jensen, Mads M; Oliveira, Marlene; Jensen, Anders; Thygesen, Lisbeth G; Pinelo, Manuel; Glasius, Marianne; Jørgensen, Henning; Meyer, Anne S

    2018-01-01

    Lignin is known to hinder efficient enzymatic conversion of lignocellulose in biorefining processes. In particular, nonproductive adsorption of cellulases onto lignin is considered a key mechanism to explain how lignin retards enzymatic cellulose conversion in extended reactions. Lignin-rich residues (LRRs) were prepared via extensive enzymatic cellulose degradation of corn stover ( Zea mays subsp. mays L.), Miscanthus  ×  giganteus stalks (MS) and wheat straw ( Triticum aestivum L.) (WS) samples that each had been hydrothermally pretreated at three severity factors (log R 0 ) of 3.65, 3.83 and 3.97. The LRRs had different residual carbohydrate levels-the highest in MS; the lowest in WS. The residual carbohydrate was not traceable at the surface of the LRRs particles by ATR-FTIR analysis. The chemical properties of the lignin in the LRRs varied across the three types of biomass, but monolignols composition was not affected by the severity factor. When pure cellulose was added to a mixture of LRRs and a commercial cellulolytic enzyme preparation, the rate and extent of glucose release were unaffected by the presence of LRRs regardless of biomass type and severity factor, despite adsorption of the enzymes to the LRRs. Since the surface of the LRRs particles were covered by lignin, the data suggest that the retardation of enzymatic cellulose degradation during extended reaction on lignocellulosic substrates is due to physical blockage of the access of enzymes to the cellulose caused by the gradual accumulation of lignin at the surface of the biomass particles rather than by nonproductive enzyme adsorption. The study suggests that lignin from hydrothermally pretreated grass biomass retards enzymatic cellulose degradation by acting as a physical barrier blocking the access of enzymes to cellulose rather than by inducing retardation through nonproductive adsorption of enzymes.

  15. Learning preferences from paired opposite-based semantics

    DEFF Research Database (Denmark)

    Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier

    2017-01-01

    Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...

  16. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  17. Cooperative interactions between paired domain and homeodomain.

    Science.gov (United States)

    Jun, S; Desplan, C

    1996-09-01

    The Pax proteins are a family of transcriptional regulators involved in many developmental processes in all higher eukaryotes. They are characterized by the presence of a paired domain (PD), a bipartite DNA binding domain composed of two helix-turn-helix (HTH) motifs,the PAI and RED domains. The PD is also often associated with a homeodomain (HD) which is itself able to form homo- and hetero-dimers on DNA. Many of these proteins therefore contain three HTH motifs each able to recognize DNA. However, all PDs recognize highly related DNA sequences, and most HDs also recognize almost identical sites. We show here that different Pax proteins use multiple combinations of their HTHs to recognize several types of target sites. For instance, the Drosophila Paired protein can bind, in vitro, exclusively through its PAI domain, or through a dimer of its HD, or through cooperative interaction between PAI domain and HD. However, prd function in vivo requires the synergistic action of both the PAI domain and the HD. Pax proteins with only a PD appear to require both PAI and RED domains, while a Pax-6 isoform and a new Pax protein, Lune, may rely on the RED domain and HD. We propose a model by which Pax proteins recognize different target genes in vivo through various combinations of their DNA binding domains, thus expanding their recognition repertoire.

  18. CONDENSED MATTER: STRUCTURE, THERMAL AND MECHANICAL PROPERTIES: Pair interaction of bilayer-coated nanoscopic particles

    Science.gov (United States)

    Zhang, Qi-Yi

    2009-02-01

    The pair interaction between bilayer membrane-coated nanosized particles has been explored by using the self-consistent field (SCF) theory. The bilayer membranes are composed of amphiphilic polymers. For different system parameters, the pair-interaction free energies are obtained. Particular emphasis is placed on the analysis of a sequence of structural transformations of bilayers on spherical particles, which occur during their approaching processes. For different head fractions of amphiphiles, the asymmetrical morphologies between bilayers on two particles and the inverted micellar intermediates have been found in the membrane fusion pathway. These results can benefit the fabrication of vesicles as encapsulation vectors for drug and gene delivery.

  19. Enhancing the prediction of protein pairings between interacting families using orthology information

    Directory of Open Access Journals (Sweden)

    Pazos Florencio

    2008-01-01

    Full Text Available Abstract Background It has repeatedly been shown that interacting protein families tend to have similar phylogenetic trees. These similarities can be used to predicting the mapping between two families of interacting proteins (i.e. which proteins from one family interact with which members of the other. The correct mapping will be that which maximizes the similarity between the trees. The two families may eventually comprise orthologs and paralogs, if members of the two families are present in more than one organism. This fact can be exploited to restrict the possible mappings, simply by impeding links between proteins of different organisms. We present here an algorithm to predict the mapping between families of interacting proteins which is able to incorporate information regarding orthologues, or any other assignment of proteins to "classes" that may restrict possible mappings. Results For the first time in methods for predicting mappings, we have tested this new approach on a large number of interacting protein domains in order to statistically assess its performance. The method accurately predicts around 80% in the most favourable cases. We also analysed in detail the results of the method for a well defined case of interacting families, the sensor and kinase components of the Ntr-type two-component system, for which up to 98% of the pairings predicted by the method were correct. Conclusion Based on the well established relationship between tree similarity and interactions we developed a method for predicting the mapping between two interacting families using genomic information alone. The program is available through a web interface.

  20. Broken-pair, generalized seniority and interacting boson approximations in a spectroscopic study of Sn nuclei

    International Nuclear Information System (INIS)

    Bonsignori, K.; Allaart, K.; Egmond, A. van

    1983-01-01

    A broken-pair study of Sn nuclei is reported in which the model space includes two broken pair states. It is shown that for even Sn nuclei, with a rather simple Gaussian interaction and with single-particle-energies derived from data on odd nuclei, the main features of the excitation spectra up to about 3.5 MeV may be reproduced in this way. The idea of the generalized seniority scheme, that the composition of S-pair operator and that of the D-pair operator may be independent of the total number of pairs, is confirmed by the pair structures which result from energy minimization and diagonalization for each number of pairs separately. A general procedure is described to derive IBA parameters when the valence orbits are nondegenerate. Numerical results for Sn nuclei are given. (U.K.)

  1. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

    Science.gov (United States)

    Mondal Roy, Sutapa

    2018-08-01

    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  3. Kraus Operators for a Pair of Interacting Qubits: a Case Study

    Science.gov (United States)

    Arsenijević, M.; Jeknić-Dugić, J.; Dugić, M.

    2018-04-01

    The Kraus form of the completely positive dynamical maps is appealing from the mathematical and the point of the diverse applications of the open quantum systems theory. Unfortunately, the Kraus operators are poorly known for the two-qubit processes. In this paper, we derive the Kraus operators for a pair of interacting qubits, while the strength of the interaction is arbitrary. One of the qubits is subjected to the x-projection spin measurement. The obtained results are applied to calculate the dynamics of the entanglement in the qubits system. We obtain the loss of the correlations in the finite time interval; the stronger the inter-qubit interaction, the longer lasting entanglement in the system.

  4. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  5. SIMULATION AS AN APPROPRIATE WAY OF VERIFYING THE EFFICIENCY OF PRODUCTION VARIANTS IN THE DESIGN OF PRODUCTION AND NON-PRODUCTION SYSTEMS

    Directory of Open Access Journals (Sweden)

    Marek Kliment

    2014-12-01

    Full Text Available The paper deals with simulation and her forms of use in designing of production and non-production systems. Points to the possibility of using software can help in planning and subsequently in other phase of the lifecycle production and products. Article informs about some of the advantages of this type of software and his options. Sets out some theoretical knowledge of simulation and in the practical part presents some frequently used simulation software.

  6. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  7. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  8. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  10. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    Science.gov (United States)

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  11. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  12. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  13. Gene-based testing of interactions in association studies of quantitative traits.

    Directory of Open Access Journals (Sweden)

    Li Ma

    Full Text Available Various methods have been developed for identifying gene-gene interactions in genome-wide association studies (GWAS. However, most methods focus on individual markers as the testing unit, and the large number of such tests drastically erodes statistical power. In this study, we propose novel interaction tests of quantitative traits that are gene-based and that confer advantage in both statistical power and biological interpretation. The framework of gene-based gene-gene interaction (GGG tests combine marker-based interaction tests between all pairs of markers in two genes to produce a gene-level test for interaction between the two. The tests are based on an analytical formula we derive for the correlation between marker-based interaction tests due to linkage disequilibrium. We propose four GGG tests that extend the following P value combining methods: minimum P value, extended Simes procedure, truncated tail strength, and truncated P value product. Extensive simulations point to correct type I error rates of all tests and show that the two truncated tests are more powerful than the other tests in cases of markers involved in the underlying interaction not being directly genotyped and in cases of multiple underlying interactions. We applied our tests to pairs of genes that exhibit a protein-protein interaction to test for gene-level interactions underlying lipid levels using genotype data from the Atherosclerosis Risk in Communities study. We identified five novel interactions that are not evident from marker-based interaction testing and successfully replicated one of these interactions, between SMAD3 and NEDD9, in an independent sample from the Multi-Ethnic Study of Atherosclerosis. We conclude that our GGG tests show improved power to identify gene-level interactions in existing, as well as emerging, association studies.

  14. Investigating the role of ion-pair strategy in regulating nicotine release from patch: Mechanistic insights based on intermolecular interaction and mobility of pressure sensitive adhesive.

    Science.gov (United States)

    Li, Qiaoyun; Wan, Xiaocao; Liu, Chao; Fang, Liang

    2018-07-01

    The aim of this study was to prepare a drug-in-adhesive patch of nicotine (NIC) and use ion-pair strategy to regulate drug delivery rate. Moreover, the mechanism of how ion-pair strategy regulated drug release was elucidated at molecular level. Formulation factors including pressure sensitive adhesives (PSAs), drug loading and counter ions (C 4 , C 6 , C 8 , C 10 , and C 12 ) were screened. In vitro release experiment and in vitro transdermal experiment were conducted to determine the rate-limiting step in drug delivery process. FT-IR and molecular modeling were used to characterize the interaction between drug and PSA. Thermal analysis and rheology study were conducted to investigate the mobility variation of PSA. The optimized patch prepared with NIC-C 8 had the transdermal profile fairly close to that of the commercial product (p > 0.05). The release rate constants (k) of NIC, NIC-C 4 and NIC-C 10 were 21.1, 14.4 and 32.4, respectively. Different release rates of NIC ion-pair complexes were attributed to the dual effect of ion-pair strategy on drug release. On one hand, ion-pair strategy enhanced the interaction between drug and PSA, which inhibited drug release. On the other hand, using ion-pair strategy improved the mobility of PSA, which facilitated drug release. Drug release behavior was determined by combined effect of two aspects above. These conclusions provided a new idea for us to regulate drug release behavior from patch. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  16. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  17. Universal Behavior of Pair Correlations in a Strongly Interacting Fermi Gas

    International Nuclear Information System (INIS)

    Kuhnle, E. D.; Hu, H.; Liu, X.-J.; Dyke, P.; Mark, M.; Drummond, P. D.; Hannaford, P.; Vale, C. J.

    2010-01-01

    We show that short-range pair correlations in a strongly interacting Fermi gas follow a simple universal law described by Tan's relations. This is achieved through measurements of the static structure factor which displays a universal scaling proportional to the ratio of Tan's contact to the momentum C/q. Bragg spectroscopy of ultracold 6 Li atoms from a periodic optical potential is used to measure the structure factor for a wide range of momenta and interaction strengths, providing broad confirmation of this universal law. We calibrate our Bragg spectra using the f-sum rule, which is found to improve the accuracy of the structure factor measurement.

  18. Search for pair production of strongly interacting particles decaying to pairs of jets in pp collisions at √s=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Albin, E; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Butti, P; Buzatu, A; Calamba, A; Camarda, S; Campanelli, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Cho, K; Chokheli, D; Ciocci, M A; Clark, A; Clarke, C; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Cremonesi, M; Cruz, D; Cuevas, J; Culbertson, R; d'Ascenzo, N; Datta, M; De Barbaro, P; Demortier, L; Deninno, M; Devoto, F; d'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dorigo, M; Driutti, A; Ebina, K; Edgar, R; Elagin, A; Erbacher, R; Errede, S; Esham, B; Eusebi, R; Farrington, S; Fernández Ramos, J P; Field, R; Flanagan, G; Forrest, R; Franklin, M; Freeman, J C; Frisch, H; Funakoshi, Y; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González López, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gramellini, E; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Han, J Y; Happacher, F; Hara, K; Hare, M; Harr, R F; Harrington-Taber, T; Hatakeyama, K; Hays, C; Heinrich, J; Herndon, M; Hocker, A; Hong, Z; Hopkins, W; Hou, S; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kambeitz, M; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kim, Y J; Kimura, N; Kirby, M; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Kruse, M; Kuhr, T; Kurata, M; Laasanen, A T; Lammel, S; Lancaster, M; Lannon, K; Latino, G; Lee, H S; Lee, J S; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lipeles, E; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, P; Martínez, M; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M J; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Nigmanov, T; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagliarone, C; Palencia, E; Palni, P; Papadimitriou, V; Parker, W; Pauletta, G; Paulini, M; Paus, C; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Prokoshin, F; Pranko, A; Ptohos, F; Punzi, G; Ranjan, N; Redondo Fernández, I; Renton, P; Rescigno, M; Riddick, T; Rimondi, F; Ristori, L; Robson, A; Rodriguez, T; Rolli, S; Ronzani, M; Roser, R; Rosner, J L; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schwarz, T; Scodellaro, L; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sinervo, P; Sliwa, K; Smith, J R; Snider, F D; Sorin, V; Song, H; Stancari, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thomson, E; Thukral, V; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Vázquez, F; Velev, G; Vellidis, C; Vernieri, C; Vidal, M; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wallny, R; Wang, S M; Warburton, A; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wilbur, S; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Zanetti, A M; Zeng, Y; Zhou, C; Zucchelli, S

    2013-07-19

    We present a search for the pair production of a narrow nonstandard-model strongly interacting particle that decays to a pair of quarks or gluons, leading to a final state with four hadronic jets. We consider both nonresonant production via an intermediate gluon as well as resonant production via a distinct nonstandard-model intermediate strongly interacting particle. We use data collected by the CDF experiment in proton-antiproton collisions at √[s]=1.96 TeV corresponding to an integrated luminosity of 6.6 fb(-1). We find the data to be consistent with nonresonant production. We report limits on σ(pp[over ¯]→jjjj) as a function of the masses of the hypothetical intermediate particles. Upper limits on the production cross sections for nonstandard-model particles in several resonant and nonresonant processes are also derived.

  19. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Coherent pair creation from beam-beam interaction

    International Nuclear Information System (INIS)

    Chen, Pisin.

    1989-09-01

    It has recently been recognized that in future linear colliders, there is a finite probability that the beamstrahlung photons will turn into e + e - pairs induced by the same beam-beam field, and this would potentially cause background problems. In this paper, we first review the probability of such a coherent pair creation process. It is seen that the constraint on the beamstrahlung parameter, Υ, is tight of these coherent pairs to be totally suppressed. We then point out that there exists a minimum energy for the pair-created particles, which scales as ∼1/5Υ. When combining this condition with the deflection angle for the low-energy particles, the constraint on the allowable Υ value is much relaxed. Finally, we calculate the effective cross section for producing the weak bosons by the low-energy e + e - pairs. It is shown that these cross sections are substantial for Υ > 1. We suggest that this effect can help to autoscan the particle spectrum in the high energy frontier. 10 refs., 2 figs

  1. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  2. Ionic fluids with r-6 pair interactions have power-law electrostatic screening

    International Nuclear Information System (INIS)

    Kjellander, Roland; Forsberg, Bjoern

    2005-01-01

    The decay behaviour of radial distribution functions for large distances r is investigated for classical Coulomb fluids where the ions interact with an r -6 potential (e.g. a dispersion interaction) in addition to the Coulombic and the short-range repulsive potentials (e.g. a hard core). The pair distributions and the density-density (NN), charge-density (QN) and charge-charge (QQ) correlation functions are investigated analytically and by Monte Carlo simulations. It is found that the NN correlation function ultimately decays like r -6 for large r, just as it does for fluids of electroneutral particles interacting with an r -6 potential. The prefactor is proportional to the squared compressibility in both cases. The QN correlations decay in general like r -8 and the QQ correlations like r -10 in the ionic fluid. The average charge density around an ion decays generally like r -8 and the average electrostatic potential like r -6 . This behaviour is in stark contrast to the decay behaviour for classical Coulomb fluids in the absence of the r -6 potential, where all these functions decay exponentially for large r. The power-law decays are, however, the same as for quantum Coulomb fluids. This indicates that the inclusion of the dispersion interaction as an effective r -6 interaction potential in classical systems yields the same decay behaviour for the pair correlations as in quantum ionic systems. An exceptional case is the completely symmetric binary electrolyte for which only the NN correlation has a power-law decay but not the QQ correlations. These features are shown by an analysis of the bridge function

  3. Anisotropic exchange interaction for magnetic ion pairs in insulators

    International Nuclear Information System (INIS)

    Passeggi, M.C.G.

    1975-12-01

    The sources of possible contributions to the magnetic anisotropy for a pair of orbitally non degenerate magnetic ions are investigated. The problem being formulated with the help of the operator form of perturbation theory and irreducible tensor operators. Apart from the usual dipole-dipole effective interaction, mainly induced by the electronic spin-spin dipole coupling corrected by covalency, other mechanisms mediated by the spin-orbit coupling appear. These are a consequence of an appropriate description of the spin-orbit operators for a system which allows for delocalization of the magnetic electrons. A process similar to that known as pseudodipolar appears from contributions in which spin orbit combined with the Coulomb repulsion and with one-electron interactions (acting analogously as for the ''kinetic exchange'') produce compensating effects in third and fourth order, respectively. However, this effect does not appear to be describable in terms of the phenomenological exchange, as is usually assumed. (Passeggi, M.C.G.)

  4. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  5. Sensory and chemical interactions of food pairings (basmati rice, bacon and extra virgin olive oil) with banana

    OpenAIRE

    Traynor, Mark; Burke, Roisin; O'Sullivan, Maurice G; Hannon, John; Barry-Ryan, Catherine

    2013-01-01

    The aim of this study aimed to investigate food pairings as an important sensory phenomenon in order to determine how different components in the selected food pairings affect and interact with other components. Three novel food pairings (banana and bacon, banana and olive oil, and banana and rice) were selected. A conjoint approach utilising qualitative (organic volatile analysis and descriptive sensory analysis) and quantitative (comparable semi quantitative organic volatile analysis and af...

  6. Even-parity spin-triplet pairing by purely repulsive interactions for orbitally degenerate correlated fermions

    International Nuclear Information System (INIS)

    Zegrodnik, M; Bünemann, J; Spałek, J

    2014-01-01

    We demonstrate the stability of the spin-triplet paired s-wave (with an admixture of extended s-wave) state for the limit of purely repulsive interactions in a degenerate two-band Hubbard model of correlated fermions. The repulsive interactions limit represents an essential extension of our previous analysis (2013 New J. Phys. 15 073050), regarded here as I. We also show that near the half-filling the considered type of superconductivity can coexist with antiferromagnetism. The calculations have been carried out with the use of the so-called statistically consistent Gutzwiller approximation (SGA) for the case of a square lattice. We suggest that the electron correlations in conjunction with the Hund's rule exchange play the crucial role in stabilizing the real-space spin-triplet superconducting state. A sizable hybridization of the bands suppresses the homogeneous paired state. (paper)

  7. Verbal play as a discourse resource in the social interactions of older and younger communication pairs.

    Science.gov (United States)

    Shune, Samantha; Duff, Melissa Collins

    2014-01-01

    Verbal play, or the playful manipulation of elements of language, is a pervasive component of social interaction, serving important interpersonal functions. We analyzed verbal play in the interactional discourse of ten healthy younger pairs and ten healthy older pairs as they completed a collaborative referencing task. A total of 1,893 verbal play episodes were coded. While there were no group differences in verbal play frequency, age-related differences in the quality and function of these episodes emerged. While older participants engaged in more complex, extended, and reciprocal episodes that supported the social nature of communicative interactions (e.g., teasing), younger participants were more likely to engage in verbal play episodes for the purpose of successful task completion. Despite these age-related variations in the deployment of verbal play, verbal play is a robust interactional discourse resource in healthy aging, highlighting an element of human cognition that does not appear to decline with age.

  8. Interaction effects on galaxy pairs with Gemini/GMOS- III: stellar population synthesis

    Science.gov (United States)

    Krabbe, A. C.; Rosa, D. A.; Pastoriza, M. G.; Hägele, G. F.; Cardaci, M. V.; Dors, O. L., Jr.; Winge, C.

    2017-05-01

    We present an observational study of the impacts of interactions on the stellar population in a sample of galaxy pairs. Long-slit spectra in the wavelength range 3440-7300 Å obtained with the Gemini Multi-Object Spectrograph (GMOS) at Gemini South for 15 galaxies in nine close pairs were used. The spatial distributions of the stellar population contributions were obtained using the stellar population synthesis code starlight. Taking into account the different contributions to the emitted light, we found that most of the galaxies in our sample are dominated by young/intermediate stellar populations. This result differs from the one derived for isolated galaxies, where the old stellar population dominates the disc surface brightness. We interpreted such different behaviour as being due to the effect of gas inflows along the discs of interacting galaxies on the star formation over a time-scale of the order of about 2 Gyr. We also found that, in general, the secondary galaxy of a pair has a higher contribution from the young stellar population than the primary one. We compared the estimated values of stellar and nebular extinction derived from the synthesis method and the Hα/Hβ emission-line ratio, finding that nebular extinctions are systematically higher than stellar ones by about a factor of 2. We did not find any correlation between nebular and stellar metallicities. Neither did we find a correlation between stellar metallicities and ages, while a positive correlation between nebular metallicities and stellar ages was obtained, with older regions being the most metal-rich.

  9. Adatom pair distribution up to half coverage: O-Pd(100)

    OpenAIRE

    Kappus, Wolfgang

    2017-01-01

    Using substrate mediated elastic interactions fitted previously to first principles (FP) calculations, adatom pair distributions are derived for O-Pd(100) evaluating a statistical BGY based integral equation. The evaluation method utilizes the superposition approximation, a temperature scaling scheme, and for one variant the particle-hole symmetry of a pair interaction lattice gas Hamiltonian. The elastic Hamiltonian is taken from a previous 3 parameter analytical model. The resulting adatom ...

  10. The empirical form of the effective nucleon-nucleon interaction in a model space with correlated J = O pairs

    International Nuclear Information System (INIS)

    Akkermans, J.N.L.; Allaart, K.

    1982-01-01

    Like in earlier work by Schiffer et al. the effective interaction is derived from experimental two-body multiplets. However, now the assumption is that a multiplet state is formed by two unpaired fermions relative to a core of correlated J = 0 pairs. Then the need for two ranges, as proposed Schiffer, disappears for the force between identical nucleons in a model space which is large enough to include pairing correlations. A form with a single attractive medium range is preferred for the identical nucleon interaction in order to reproduce collective 2 + states in even-even nuclei. In contrast, the proton-neutron force requires a very short range or two ranges to reproduce the empirical values of multipole coefficients, observed in odd-odd nuclei. Therefore we discuss the fact that the effective interaction is not always isospin invariant. As a typical case broken-pair calculations in the N = 50 region are considered. But the conclusions drawn, will also apply to other regions of the periodic table. (orig.)

  11. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    International Nuclear Information System (INIS)

    Bricault, Christine A.; Perry, Keith L.

    2013-01-01

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility

  12. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    Energy Technology Data Exchange (ETDEWEB)

    Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: KLP3@cornell.edu [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)

    2013-06-05

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

  13. Automation and decision support in interactive consumer products.

    OpenAIRE

    Sauer, J.; Rüttinger, B.

    2007-01-01

    This article presents two empirical studies (n=30, n=48) that are concerned with different forms of automation in interactive consumer products. The goal of the studies was to evaluate the effectiveness of two types of automation: perceptual augmentation (i.e. supporting users' action selection and implementation). Furthermore, the effectiveness of non-product information (i.e. labels attached to product) in supporting automation design was evaluated. The findings suggested greater benefits f...

  14. Kinetics and fracture resistance of lithiated silicon nanostructure pairs controlled by their mechanical interaction

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Seok Woo; /Stanford U., Geballe Lab.; Lee, Hyun-Wook; /Stanford U., Materials Sci. Dept.; Ryu, Ill; /Brown U.; Nix, William D.; /Stanford U., Materials Sci. Dept.; Gao, Huajian; /Brown U.; Cui, Yi; /Stanford U., Materials Sci. Dept. /SLAC

    2015-06-01

    Following an explosion of studies of silicon as a negative electrode for Li-ion batteries, the anomalous volumetric changes and fracture of lithiated single Si particles have attracted significant attention in various fields, including mechanics. However, in real batteries, lithiation occurs simultaneously in clusters of Si in a confined medium. Hence, understanding how the individual Si structures interact during lithiation in a closed space is necessary. Herein, we demonstrate physical/mechanical interactions of swelling Si structures during lithiation using well-defined Si nanopillar pairs. Ex situ SEM and in situ TEM studies reveal that compressive stresses change the reaction kinetics so that preferential lithiation occurs at free surfaces when the pillars are mechanically clamped. Such mechanical interactions enhance the fracture resistance of This material is based upon work supported by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, Division of Materials Sciences and Engineering, under Contract No. DE-AC02-76SF00515. SLAC-PUB-16300 2 lithiated Si by lessening the tensile stress concentrations in Si structures. This study will contribute to improved design of Si structures at the electrode level for high performance Li-ion batteries.

  15. Superconductivity in a Fermi liquid from repulsive interactions: The role of electron–phonon interaction

    International Nuclear Information System (INIS)

    Fan, J.D.; Malozovsky, Y.M.

    2013-01-01

    Highlights: • The sign reversal of pair interaction in momentum space is proved. • It is also shown that electron-phonon interaction in fact leads to the pairing-break effect. • Transition temperature into superconductivity depends on competition between electron-phonon and Coulomb interactions. • Calculated exponent α of the isotope effect shows the possibility equal to, greater or less than 0.5, and even negative. -- Abstract: Based on our previously proven theorem that the interaction between a pair of quasiparticles in the normal Fermi liquid has an opposite sign to the interaction between particles, we consider pair correlation between a pair of quasiparticles when the interaction between particles is repulsive. For the convenience of statements, we have presented in this article once again the proof of the theorem in terms of an exact equation for the thermodynamic potential due to interaction between particles and based on the Green’s function method. Further, we have derived the Landau expansion of the thermodynamic potentials in terms of the variation of the quasiparticle distribution function. We have also derived the expansion of the thermodynamic potential in terms of the variation of an exact single particle (not quasiparticles), these derivations lead to the relationship between the interaction function for two quasiparticles and the interaction energy between two particles as shown. According to the proven theorem the interaction between a pair of quasiparticles is attractive in this case, the pairing – Cooper’s pairing between a pair of quasiparticles is possible. We solve the Bethe–Salpeter type equation for paring of two quasiparticles when both interactions – the Coulomb repulsive and electron–phonon interaction are present. We show that the electron–phonon interaction, in fact, leads to the pair breaking effect, in contrast to the common belief that electron–phonon interaction is the main mechanism for Cooper’s pair

  16. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  17. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-01-01

    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  18. An interactive data management and analysis system for clinical investigators.

    Science.gov (United States)

    Groner, G F; Hopwood, M D; Palley, N A; Sibley, W L; Baker, W R; Christopher, T G; Thompson, H K

    1978-09-01

    An interactive minicomputer-based system has been developed that enables the clinical research investigator to personally explore and analyze his research data and, as a consequence of these explorations, to acquire more information. This system, which does not require extensive training or computer programming, enables the investigator to describe his data interactively in his own terms, enter data values while having them checked for validity, store time-oriented patient data in a carefully controlled on-line data base, retrieve data by patient, variable, and time, create subsets of patients with common characteristics, perform statistical analyses, and produce tables and graphs. It also permits data to be transferred to and from other computers. The system is well accepted and is being used by a variety of medical specialists at the three clinical research centers where it is operational. Reported benefits include less elapsed and nonproductive time, more thorough analysis of more data, greater and earlier insight into the meaning of research data, and increased publishable results.

  19. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    Science.gov (United States)

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  20. Transverse Momentum Distributions for Heavy Quark Pairs

    OpenAIRE

    Berger, Edmond L.; Meng, Ruibin

    1993-01-01

    We study the transverse momentum distribution for a $pair$ of heavy quarks produced in hadron-hadron interactions. Predictions for the large transverse momentum region are based on exact order $\\alpha_s^3$ QCD perturbation theory. For the small transverse momentum region, we use techniques for all orders resummation of leading logarithmic contributions associated with initial state soft gluon radiation. The combination provides the transverse momentum distribution of heavy quark pairs for all...

  1. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  2. Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

    Directory of Open Access Journals (Sweden)

    Sergei Kuchin

    2011-03-01

    Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

  3. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

    International Nuclear Information System (INIS)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-01

    Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

  4. Mesoscopic pairing without superconductivity

    Science.gov (United States)

    Hofmann, Johannes

    2017-12-01

    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  5. Topological background on charmed and beauty particle pairs produced in high energy hadron interactions in nuclear emulsions

    International Nuclear Information System (INIS)

    Romano, G.

    1984-01-01

    This chapter demonstrates that by making use of the fact that new flavors must be produced in pairs in strong interactions and that beauty particles are expected to decay often into charmed particles, the contribution of background simulating decays can be computed from a pure topological point of view. Topics covered include the emulsion data, the search for charmed particles, the search for beauty particles, detection efficiency, and the evaluation of mean life-time. It is assumed that in the interaction of (350-400) GeV hadrons in emulsion the production rate of charmed particle pairs is 5X10 -3 /interaction. The corresponding figures for BB production are estimated to be 10 3 times smaller. It is noted that some neutral decay topology, like 4 or more charged prongs, are much less affected by background

  6. A domain-based approach to predict protein-protein interactions

    Directory of Open Access Journals (Sweden)

    Resat Haluk

    2007-06-01

    Full Text Available Abstract Background Knowing which proteins exist in a certain organism or cell type and how these proteins interact with each other are necessary for the understanding of biological processes at the whole cell level. The determination of the protein-protein interaction (PPI networks has been the subject of extensive research. Despite the development of reasonably successful methods, serious technical difficulties still exist. In this paper we present DomainGA, a quantitative computational approach that uses the information about the domain-domain interactions to predict the interactions between proteins. Results DomainGA is a multi-parameter optimization method in which the available PPI information is used to derive a quantitative scoring scheme for the domain-domain pairs. Obtained domain interaction scores are then used to predict whether a pair of proteins interacts. Using the yeast PPI data and a series of tests, we show the robustness and insensitivity of the DomainGA method to the selection of the parameter sets, score ranges, and detection rules. Our DomainGA method achieves very high explanation ratios for the positive and negative PPIs in yeast. Based on our cross-verification tests on human PPIs, comparison of the optimized scores with the structurally observed domain interactions obtained from the iPFAM database, and sensitivity and specificity analysis; we conclude that our DomainGA method shows great promise to be applicable across multiple organisms. Conclusion We envision the DomainGA as a first step of a multiple tier approach to constructing organism specific PPIs. As it is based on fundamental structural information, the DomainGA approach can be used to create potential PPIs and the accuracy of the constructed interaction template can be further improved using complementary methods. Explanation ratios obtained in the reported test case studies clearly show that the false prediction rates of the template networks constructed

  7. UV-inactivation of Epstein-Barr virus: differences in early antigen expression in two different non-productive cell lines and influence of caffeine

    International Nuclear Information System (INIS)

    Suchankova, A.; Vonka, V.

    1978-01-01

    Two non-productive Epstein-Barr (EB) virus genome-carrying lymphoblastoid cell lines, namely Raji and NC37, were used for studying the effect of UV irradiation on the ability of P3HR-1 EB virus to induce early antigen (EA) formation. In NC37 cells infected with UV-irradiated virus the formation of EA was delayed; thus the slope of inactivation curve based on the early (24 hr) reading was steeper than that based on the late (72 hr) reading. This was not observed in Raji cells. Caffeine did not influence the percentage of EA positive cells in cultures infected with untreated virus; however, the drug exhibited a marked inhibitory effect on EA production after infection with UV-irradiated virus. The sensitivity to caffeine decreased more rapidly with time after infection of Raji than of NC37 cells, suggesting a higher degree of readiness of the host cell repair system in the former than in the latter cells. The caffeine effect was merely directed against the synthesis of R (restricted) component of EA; its influence on the D (diffuse) component formation was negligible. (author)

  8. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  9. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

    Science.gov (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2017-05-01

    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  10. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Pulsational Pair-instability Model for Superluminous Supernova PTF12dam:Interaction and Radioactive Decay

    Energy Technology Data Exchange (ETDEWEB)

    Tolstov, Alexey; Nomoto, Ken’ichi; Blinnikov, Sergei; Quimby, Robert [Kavli Institute for the Physics and Mathematics of the Universe (WPI), The University of Tokyo Institutes for Advanced Study, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583 (Japan); Sorokina, Elena [Sternberg Astronomical Institute, M.V.Lomonosov Moscow State University, 119991 Moscow (Russian Federation); Baklanov, Petr, E-mail: alexey.tolstov@ipmu.jp [Institute for Theoretical and Experimental Physics (ITEP), 117218 Moscow (Russian Federation)

    2017-02-01

    Being a superluminous supernova, PTF12dam can be explained by a {sup 56}Ni-powered model, a magnetar-powered model, or an interaction model. We propose that PTF12dam is a pulsational pair-instability supernova, where the outer envelope of a progenitor is ejected during the pulsations. Thus, it is powered by a double energy source: radioactive decay of {sup 56}Ni and a radiative shock in a dense circumstellar medium. To describe multicolor light curves and spectra, we use radiation-hydrodynamics calculations of the STELLA code. We found that light curves are well described in the model with 40 M {sub ⊙} ejecta and 20–40 M {sub ⊙} circumstellar medium. The ejected {sup 56}Ni mass is about 6 M {sub ⊙}, which results from explosive nucleosynthesis with large explosion energy (2–3)×10{sup 52} erg. In comparison with alternative scenarios of pair-instability supernova and magnetar-powered supernova, in the interaction model, all the observed main photometric characteristics are well reproduced: multicolor light curves, color temperatures, and photospheric velocities.

  12. The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study.

    Science.gov (United States)

    Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo

    2013-02-12

    We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

  13. Signature scheme based on bilinear pairs

    Science.gov (United States)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  14. Aerodynamic Interactions between Pairs of Vertical-Axis Wind Turbines

    Science.gov (United States)

    Brownstein, Ian; Dabiri, John

    2017-11-01

    Increased power production has been observed in downstream vertical-axis wind turbines (VAWTs) when positioned offset from the wake of upstream turbines. This effect was found to exist in both laboratory and field environments with pairs of co- and counter-rotating turbines. It is hypothesized that the observed power production enhancement is due to flow acceleration adjacent to the upstream turbine caused by bluff body blockage, which increases the incident freestream velocity on appropriately positioned downstream turbines. This type of flow acceleration has been observed in computational and laboratory studies of VAWTs and will be further investigated here using 3D-PTV measurements around pairs of laboratory-scale VAWTs. These measurements will be used to understand the mechanisms behind the performance enhancement effect and seek to determine optimal separation distances and angles between turbines based on turbine design parameters. These results will lead to recommendations for optimizing the power production of VAWT wind farms which utilize this effect.

  15. Triple helical DNA in a duplex context and base pair opening

    Science.gov (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  16. Importance of the ion-pair interactions in the OPEP coarse-grained force field: parametrization and validation.

    Science.gov (United States)

    Sterpone, Fabio; Nguyen, Phuong H; Kalimeri, Maria; Derreumaux, Philippe

    2013-10-08

    We have derived new effective interactions that improve the description of ion-pairs in the OPEP coarse-grained force field without introducing explicit electrostatic terms. The iterative Boltzmann inversion method was used to extract these potentials from all atom simulations by targeting the radial distribution function of the distance between the center of mass of the side-chains. The new potentials have been tested on several systems that differ in structural properties, thermodynamic stabilities and number of ion-pairs. Our modeling, by refining the packing of the charged amino-acids, impacts the stability of secondary structure motifs and the population of intermediate states during temperature folding/unfolding; it also improves the aggregation propensity of peptides. The new version of the OPEP force field has the potentiality to describe more realistically a large spectrum of situations where salt-bridges are key interactions.

  17. QED peripheral mechanism of pair production at colliders

    International Nuclear Information System (INIS)

    Ahmadov, A. I.; Galynskii, M. V.; Bystritskiy, Yu. M.; Kuraev, E. A.; Shatnev, M. G.

    2008-01-01

    Cross sections of the processes of production of neutral pions and pairs of charged fermions and bosons in peripheral interaction of leptons and photons are calculated in the main logarithmic approximation. We investigate the phase volumes and differential cross sections. The differential cross sections of production of a few neutral pions and a few pairs are written down explicitly. Considering the academic problem of summation over a number of pairs for massless particles we reproduce the known results obtained in the 1970s. The possibility of constructing the generator for Monte Carlo modeling of these processes based on these results is discussed.

  18. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

    OpenAIRE

    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

    2016-01-01

    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

  19. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    Science.gov (United States)

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Baryonic 3P2-dominant superfluidity under combined pion condensation with Δ isobar. II). Properties of pairing interaction and numerical results

    International Nuclear Information System (INIS)

    Tamagaki, Ryozo

    2007-01-01

    According to the formulation developed in I, we calculate energy gaps of the baryonic 3 P 2 -dominant superfluidity under the combined pion condensation with Δ-mixing at moderately high density in neutron star interior. Adopting a baryon-baryon potential extended from a 'root' NN potential to be workable in the N+Δ space, we obtain the concrete form of the pairing interaction matrix elements between the quasi-baryon pairs, which constitute a two-dimensional angular-momentum stretched state and a charge triplet. With use of OPEG-B as a 'root' NN potential and an available set of the parameters representing the combined pion condensation, we study the properties of two-dimensional pairing potentials and the matrix elements of pairing interaction. We find that the strong attraction of pairing interaction for the quasi-neutron pairs is brought about by the spin-orbit potential and the spin- and isospin-dependent core terms of the central potential, whose effects are enhanced due to the pion condensation. The quasi-neutron pair plays a decisive role to bring about meaningful energy gaps, while the coupling between different quasi-baryon pairs plays no important role, as a consequence of a unique feature of the combined pion condensation we adopt. We numerically solve the energy gap equation for baryon density of (2-6) times the nuclear density and clarify substantial aspects of resulting superfluid energy gaps, and discuss related problems by taking into account possible change in the factors affecting the energy gaps, such as baryon-baryon potentials, some of the pion condensation parameters and an effective mass of the quasi-particle. Standing on these results, we can say that the 3 P 2 -dominant superfluid is realized with the critical temperatures T c of the order of 10 9 K, equivalent to the energy gaps of the order of 0.1 MeV, under the combined pion condensation in neutron star matter. The key point of the recognition lies in the aspects that the

  1. Baryonic 3 P2-Dominant Superfluidity under Combined Pion Condensation with Δ Isobar. II --- Properties of Pairing Interaction and Numerical Results ---

    Science.gov (United States)

    Tamagaki, R.; Takatsuka, T.

    2007-05-01

    According to the formulation developed in I, we calculate energy gaps of the baryonic (3) P_2-dominant superfluidity under the combined pion condensation with Delta-mixing at moderately high density in neutron star interior. Adopting a baryon-baryon potential extended from a ``root" NN potential to be workable in the N + Delta space, we obtain the concrete form of the pairing interaction matrix elements between the quasi-baryon pairs, which constitute a two-dimensional angular-momentum stretched state and a charge triplet. With use of OPEG-B as a ``root" NN potential and an available set of the parameters representing the combined pion condensation, we study the properties of two-dimensional pairing potentials and the matrix elements of pairing interaction. We find that the strong attraction of pairing interaction for the quasi-neutron pairs is brought about by the spin-orbit potential and the spin- and isospin-dependent core terms of the central potential, whose effects are enhanced due to the pion condensation. The quasi-neutron pair plays a decisive role to bring about meaningful energy gaps, while the coupling between different quasi-baryon pairs plays no important role, as a consequence of a unique feature of the combined pion condensation we adopt. We numerically solve the energy gap equation for baryon density of (2-6) times the nuclear density and clarify substantial aspects of resulting superfluid energy gaps, and discuss related problems by taking into account possible change in the factors affecting the energy gaps, such as baryon-baryon potentials, some of the pion condensation parameters and an effective mass of the quasi-particle. Standing on these results, we can say that the (3) P_2-dominant superfluid is realized with the critical temperatures T_c of the order of 10(9) K, equivalent to the energy gaps of the order of 0.1 MeV, under the combined pion condensation in neutron star matter. The key point of the recognition lies in the aspects that the

  2. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  3. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  4. Drug-target interaction prediction from PSSM based evolutionary information.

    Science.gov (United States)

    Mousavian, Zaynab; Khakabimamaghani, Sahand; Kavousi, Kaveh; Masoudi-Nejad, Ali

    2016-01-01

    The labor-intensive and expensive experimental process of drug-target interaction prediction has motivated many researchers to focus on in silico prediction, which leads to the helpful information in supporting the experimental interaction data. Therefore, they have proposed several computational approaches for discovering new drug-target interactions. Several learning-based methods have been increasingly developed which can be categorized into two main groups: similarity-based and feature-based. In this paper, we firstly use the bi-gram features extracted from the Position Specific Scoring Matrix (PSSM) of proteins in predicting drug-target interactions. Our results demonstrate the high-confidence prediction ability of the Bigram-PSSM model in terms of several performance indicators specifically for enzymes and ion channels. Moreover, we investigate the impact of negative selection strategy on the performance of the prediction, which is not widely taken into account in the other relevant studies. This is important, as the number of non-interacting drug-target pairs are usually extremely large in comparison with the number of interacting ones in existing drug-target interaction data. An interesting observation is that different levels of performance reduction have been attained for four datasets when we change the sampling method from the random sampling to the balanced sampling. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Isovectorial pairing in solvable and algebraic models

    International Nuclear Information System (INIS)

    Lerma, Sergio; Vargas, Carlos E; Hirsch, Jorge G

    2011-01-01

    Schematic interactions are useful to gain some insight in the behavior of very complicated systems such as the atomic nuclei. Prototypical examples are, in this context, the pairing interaction and the quadrupole interaction of the Elliot model. In this contribution the interplay between isovectorial pairing, spin-orbit, and quadrupole terms in a harmonic oscillator shell (the so-called pairing-plus-quadrupole model) is studied by algebraic methods. The ability of this model to provide a realistic description of N = Z even-even nuclei in the fp-shell is illustrated with 44 Ti. Our calculations which derive from schematic and simple terms confirm earlier conclusions obtained by using realistic interactions: the SU(3) symmetry of the quadrupole term is broken mainly by the spin-orbit term, but the energies depends strongly on pairing.

  6. Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation

    Science.gov (United States)

    Moktan, Hem; Pezza, Roberto; Zhou, Donghua

    2015-03-01

    The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.

  7. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    Science.gov (United States)

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  8. Effects of interlayer Sn-Sn lone pair interaction on the band gap of bulk and nanosheet SnO

    Science.gov (United States)

    Umezawa, Naoto; Zhou, Wei

    2015-03-01

    Effects of interlayer lone-pair interactions on the electronic structure of SnO are firstly explored by the density-functional theory. Our comprehensive study reveals that the band gap of SnO opens as increase in the interlayer Sn-Sn distance. The effect is rationalized by the character of band edges which consists of bonding and anti-bonding states from interlayer lone pair interactions. The band edges for several nanosheets and strained double-layer SnO are estimated. We conclude that the double-layer SnO is a promising material for visible-light driven photocatalyst for hydrogen evolution. This work is supported by the Japan Science and Technology Agency (JST) Precursory Research for Embryonic Science and Technology (PRESTO) program.

  9. Deep-Learning-Based Drug-Target Interaction Prediction.

    Science.gov (United States)

    Wen, Ming; Zhang, Zhimin; Niu, Shaoyu; Sha, Haozhi; Yang, Ruihan; Yun, Yonghuan; Lu, Hongmei

    2017-04-07

    Identifying interactions between known drugs and targets is a major challenge in drug repositioning. In silico prediction of drug-target interaction (DTI) can speed up the expensive and time-consuming experimental work by providing the most potent DTIs. In silico prediction of DTI can also provide insights about the potential drug-drug interaction and promote the exploration of drug side effects. Traditionally, the performance of DTI prediction depends heavily on the descriptors used to represent the drugs and the target proteins. In this paper, to accurately predict new DTIs between approved drugs and targets without separating the targets into different classes, we developed a deep-learning-based algorithmic framework named DeepDTIs. It first abstracts representations from raw input descriptors using unsupervised pretraining and then applies known label pairs of interaction to build a classification model. Compared with other methods, it is found that DeepDTIs reaches or outperforms other state-of-the-art methods. The DeepDTIs can be further used to predict whether a new drug targets to some existing targets or whether a new target interacts with some existing drugs.

  10. A computational approach for the annotation of hydrogen-bonded base interactions in crystallographic structures of the ribozymes

    Energy Technology Data Exchange (ETDEWEB)

    Hamdani, Hazrina Yusof, E-mail: hazrina@mfrlab.org [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi (Malaysia); Advanced Medical and Dental Institute, Universiti Sains Malaysia, Bertam, Kepala Batas (Malaysia); Artymiuk, Peter J., E-mail: p.artymiuk@sheffield.ac.uk [Dept. of Molecular Biology and Biotechnology, Firth Court, University of Sheffield, S10 T2N Sheffield (United Kingdom); Firdaus-Raih, Mohd, E-mail: firdaus@mfrlab.org [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi (Malaysia)

    2015-09-25

    A fundamental understanding of the atomic level interactions in ribonucleic acid (RNA) and how they contribute towards RNA architecture is an important knowledge platform to develop through the discovery of motifs from simple arrangements base pairs, to more complex arrangements such as triples and larger patterns involving non-standard interactions. The network of hydrogen bond interactions is important in connecting bases to form potential tertiary motifs. Therefore, there is an urgent need for the development of automated methods for annotating RNA 3D structures based on hydrogen bond interactions. COnnection tables Graphs for Nucleic ACids (COGNAC) is automated annotation system using graph theoretical approaches that has been developed for the identification of RNA 3D motifs. This program searches for patterns in the unbroken networks of hydrogen bonds for RNA structures and capable of annotating base pairs and higher-order base interactions, which ranges from triples to sextuples. COGNAC was able to discover 22 out of 32 quadruples occurrences of the Haloarcula marismortui large ribosomal subunit (PDB ID: 1FFK) and two out of three occurrences of quintuple interaction reported by the non-canonical interactions in RNA (NCIR) database. These and several other interactions of interest will be discussed in this paper. These examples demonstrate that the COGNAC program can serve as an automated annotation system that can be used to annotate conserved base-base interactions and could be added as additional information to established RNA secondary structure prediction methods.

  11. A computational approach for the annotation of hydrogen-bonded base interactions in crystallographic structures of the ribozymes

    International Nuclear Information System (INIS)

    Hamdani, Hazrina Yusof; Artymiuk, Peter J.; Firdaus-Raih, Mohd

    2015-01-01

    A fundamental understanding of the atomic level interactions in ribonucleic acid (RNA) and how they contribute towards RNA architecture is an important knowledge platform to develop through the discovery of motifs from simple arrangements base pairs, to more complex arrangements such as triples and larger patterns involving non-standard interactions. The network of hydrogen bond interactions is important in connecting bases to form potential tertiary motifs. Therefore, there is an urgent need for the development of automated methods for annotating RNA 3D structures based on hydrogen bond interactions. COnnection tables Graphs for Nucleic ACids (COGNAC) is automated annotation system using graph theoretical approaches that has been developed for the identification of RNA 3D motifs. This program searches for patterns in the unbroken networks of hydrogen bonds for RNA structures and capable of annotating base pairs and higher-order base interactions, which ranges from triples to sextuples. COGNAC was able to discover 22 out of 32 quadruples occurrences of the Haloarcula marismortui large ribosomal subunit (PDB ID: 1FFK) and two out of three occurrences of quintuple interaction reported by the non-canonical interactions in RNA (NCIR) database. These and several other interactions of interest will be discussed in this paper. These examples demonstrate that the COGNAC program can serve as an automated annotation system that can be used to annotate conserved base-base interactions and could be added as additional information to established RNA secondary structure prediction methods

  12. Dual origin of pairing in nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Idini, A. [University of Jyvaskyla, Department of Physics (Finland); Potel, G. [Michigan State University, National Superconducting Cyclotron Laboratory (United States); Barranco, F. [Escuela Superior de Ingenieros, Universidad de Sevilla, Departamento de Fìsica Aplicada III (Spain); Vigezzi, E., E-mail: enrico.vigezzi@mi.infn.it [INFN Sezione di Milano (Italy); Broglia, R. A. [Università di Milano, Dipartimento di Fisica (Italy)

    2016-11-15

    The pairing correlations of the nucleus {sup 120}Sn are calculated by solving the Nambu–Gor’kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong {sup 1}S{sub 0} short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- (v{sub p}{sup bare}) and long-range (v{sub p}{sup ind}) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

  13. Dual origin of pairing in nuclei

    Science.gov (United States)

    Idini, A.; Potel, G.; Barranco, F.; Vigezzi, E.; Broglia, R. A.

    2016-11-01

    The pairing correlations of the nucleus 120Sn are calculated by solving the Nambu-Gor'kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong 1 S 0 short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- ( v p bare) and long-range ( v p ind) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

  14. Drell-Yan lepton pair photoproduction

    International Nuclear Information System (INIS)

    Badalyan, R.G.; Grabskij, V.O.; Matinyan, S.G.

    1989-01-01

    The study of photon structure functions by spectra of massive lepton pairs (M l + l - ≥ 2 GeV) in photon fragmentation region in γp-interactions at high energies is suggested. In calculations of Drell-Yan lepton pair inclusive spectra in γp-interactions for photon structure functions there are used results obtained within QCD, data on γγ-interactions in e + e - → e + e - X on colliders as well as results from the analysis of vector meson non-diffractive photoproduction at high energies. It is shown that there exists a sufficienly wide kinematic region over variables X l + l - and M l + l - , wherein photon structure functions can be studied by spectra of Grell-Yan lepton pairs in the processes of their photoproduction. 31 refs.; 6 figs.; 1 tab

  15. Phenomena, dynamics and instabilities of vortex pairs

    International Nuclear Information System (INIS)

    Williamson, C H K; Asselin, D J; Leweke, T; Harris, D M

    2014-01-01

    Our motivation for studying the dynamics of vortex pairs stems initially from an interest in the trailing wake vortices from aircraft and the dynamics of longitudinal vortices close to a vehicle surface. However, our motivation also comes from the fact that vortex–vortex interactions and vortex–wall interactions are fundamental to many turbulent flows. The intent of the paper is to present an overview of some of our recent work concerning the formation and structure of counter-rotating vortex pairs. We are interested in the long-wave and short-wave three-dimensional instabilities that evolve for an isolated vortex pair, but also we would like to know how vortex pairs interact with a wall, including both two-dimensional interactions, and also the influence of the surface on the three-dimensional instabilities. The emphasis of this presentation is on physical mechanisms by which vortices interact with each other and with surfaces, principally from an experimental approach, but also coupled with analytical studies. (paper)

  16. Two-Way Gene Interaction From Microarray Data Based on Correlation Methods.

    Science.gov (United States)

    Alavi Majd, Hamid; Talebi, Atefeh; Gilany, Kambiz; Khayyer, Nasibeh

    2016-06-01

    Gene networks have generated a massive explosion in the development of high-throughput techniques for monitoring various aspects of gene activity. Networks offer a natural way to model interactions between genes, and extracting gene network information from high-throughput genomic data is an important and difficult task. The purpose of this study is to construct a two-way gene network based on parametric and nonparametric correlation coefficients. The first step in constructing a Gene Co-expression Network is to score all pairs of gene vectors. The second step is to select a score threshold and connect all gene pairs whose scores exceed this value. In the foundation-application study, we constructed two-way gene networks using nonparametric methods, such as Spearman's rank correlation coefficient and Blomqvist's measure, and compared them with Pearson's correlation coefficient. We surveyed six genes of venous thrombosis disease, made a matrix entry representing the score for the corresponding gene pair, and obtained two-way interactions using Pearson's correlation, Spearman's rank correlation, and Blomqvist's coefficient. Finally, these methods were compared with Cytoscape, based on BIND, and Gene Ontology, based on molecular function visual methods; R software version 3.2 and Bioconductor were used to perform these methods. Based on the Pearson and Spearman correlations, the results were the same and were confirmed by Cytoscape and GO visual methods; however, Blomqvist's coefficient was not confirmed by visual methods. Some results of the correlation coefficients are not the same with visualization. The reason may be due to the small number of data.

  17. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  18. Resonance energy transfer (RET)-Induced intermolecular pairing force: a tunable weak interaction and its application in SWNT separation.

    Science.gov (United States)

    Pan, Xiaoyong; Chen, Hui; Wang, Wei Zhi; Ng, Siu Choon; Chan-Park, Mary B

    2011-07-21

    This paper explores evidence of an optically mediated interaction that is active in the separation mechanism of certain selective agents through consideration of the contrasting selective behaviors of two conjugated polymers with distinct optical properties. The involvement of a RET-induced intermolecular pairing force is implied by the different illumination response behaviors. The magnitude of this interaction scales with the external stimulus parameter, the illumination irradiance (I), and thus is tunable. This suggests a facile technique to modify the selectivity of polymers toward specific SWNT species by altering the polymer structure to adjust the corresponding intermolecular interaction. This is the first experimental verification and application of a RET-induced intermolecular pairing force to SWNT separation. With this kind of interaction taken into account, reasonable interpretation of some conflicting data, especially PLE maps, can be easily made. The above conclusion can be applied to other substances as long as they are electrically neutral and there is photon-induced RET between them. The significant magnitude of this interaction makes direct manipulation of molecules/particles possible and is expected to have applications in molecular engineering. © 2011 American Chemical Society

  19. Leptoquark pair production in hadronic interactions

    International Nuclear Information System (INIS)

    Bluemlein, J.; Boos, E.; Moskovskij Gosudarstvennyj Univ., Moscow; Kryukov, A.; Moskovskij Gosudarstvennyj Univ., Moscow

    1996-10-01

    The scalar and vector leptoquark pair production cross sections in hadronic collisions are calculated. In a model independent analysis we consider the most general C and P conserving couplings of gluons to both scalar and vector leptoquarks described by an effective low-energy Lagangian which obeys SU(3) c invariance. Analytrical expressions are derived for the differential and integral scattering cross sections including the case of anomalous vector leptoquark couplings, κ G and λ G , to the gluon field. Numerical predictions are given for the kinematic range of the TEVATRON and LHC. The pair production cross sections are also calculated for the resolved photon contributions to ep → e anti ΦΦX at HERA and LEP x LHC, and for the process γγ → Φ anti ΦX at possible future e + e - linear colliders and γγ colliders. Estimates of the search potential for scalar and vector leptoquarks at present and future high energy colliders are given. (orig.)

  20. Predicting co-complexed protein pairs using genomic and proteomic data integration

    Directory of Open Access Journals (Sweden)

    King Oliver D

    2004-04-01

    Full Text Available Abstract Background Identifying all protein-protein interactions in an organism is a major objective of proteomics. A related goal is to know which protein pairs are present in the same protein complex. High-throughput methods such as yeast two-hybrid (Y2H and affinity purification coupled with mass spectrometry (APMS have been used to detect interacting proteins on a genomic scale. However, both Y2H and APMS methods have substantial false-positive rates. Aside from high-throughput interaction screens, other gene- or protein-pair characteristics may also be informative of physical interaction. Therefore it is desirable to integrate multiple datasets and utilize their different predictive value for more accurate prediction of co-complexed relationship. Results Using a supervised machine learning approach – probabilistic decision tree, we integrated high-throughput protein interaction datasets and other gene- and protein-pair characteristics to predict co-complexed pairs (CCP of proteins. Our predictions proved more sensitive and specific than predictions based on Y2H or APMS methods alone or in combination. Among the top predictions not annotated as CCPs in our reference set (obtained from the MIPS complex catalogue, a significant fraction was found to physically interact according to a separate database (YPD, Yeast Proteome Database, and the remaining predictions may potentially represent unknown CCPs. Conclusions We demonstrated that the probabilistic decision tree approach can be successfully used to predict co-complexed protein (CCP pairs from other characteristics. Our top-scoring CCP predictions provide testable hypotheses for experimental validation.

  1. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1988-01-01

    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  2. An interaction scenario of the galaxy pair NGC 3893/96 (KPG 302): A single passage?

    Energy Technology Data Exchange (ETDEWEB)

    Gabbasov, R. F.; Rosado, M. [Instituto de Astronomía, Universidad Nacional Autónoma de Mexico (UNAM), A.P. 70-264,04510 México D.F. (Mexico); Klapp, J., E-mail: ruslan.gabb@gmail.com [Instituto Nacional de Investigaciones Nucleares, Carretera México-Toluca S/N, La Marquesa, Ocoyoacac, 52750 Estado de México (Mexico)

    2014-05-20

    Using the data obtained previously from Fabry-Perot interferometry, we study the orbital characteristics of the interacting pair of galaxies KPG 302 with the aim to estimate a possible interaction history, the conditions necessary for the spiral arm formation, and initial satellite mass. We found by performing N-body/smoothed particle hydrodynamics simulations of the interaction that a single passage can produce a grand design spiral pattern in less than 1 Gyr. Although we reproduce most of the features with the single passage, the required satellite to host mass ratio should be ∼1:5, which is not confirmed by the dynamical mass estimate made from the measured rotation curve. We conclude that a more realistic interaction scenario would require several passages in order to explain the mass ratio discrepancy.

  3. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  4. Embodied social interaction constitutes social cognition in pairs of humans: a minimalist virtual reality experiment.

    Science.gov (United States)

    Froese, Tom; Iizuka, Hiroyuki; Ikegami, Takashi

    2014-01-14

    Scientists have traditionally limited the mechanisms of social cognition to one brain, but recent approaches claim that interaction also realizes cognitive work. Experiments under constrained virtual settings revealed that interaction dynamics implicitly guide social cognition. Here we show that embodied social interaction can be constitutive of agency detection and of experiencing another's presence. Pairs of participants moved their "avatars" along an invisible virtual line and could make haptic contact with three identical objects, two of which embodied the other's motions, but only one, the other's avatar, also embodied the other's contact sensor and thereby enabled responsive interaction. Co-regulated interactions were significantly correlated with identifications of the other's avatar and reports of the clearest awareness of the other's presence. These results challenge folk psychological notions about the boundaries of mind, but make sense from evolutionary and developmental perspectives: an extendible mind can offload cognitive work into its environment.

  5. NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT

    Directory of Open Access Journals (Sweden)

    Testiana Deni Wijayatiningsih

    2017-04-01

    Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

  6. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    Science.gov (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  7. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-01-01

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  8. Single-flavour and two-flavour pairing in three-flavour quark matter

    International Nuclear Information System (INIS)

    Alford, Mark G; Cowan, Greig A

    2006-01-01

    We study single-flavour quark pairing ('self-pairing') in colour-superconducting phases of quark matter, paying particular attention to the difference between scenarios where all three flavours undergo single-flavour pairing, and scenarios where two flavours pair with each other ('2SC' pairing) and the remaining flavour self-pairs. We perform our calculations in the mean-field approximation using a pointlike four-fermion interaction based on single gluon exchange. We confirm the result from previous weakly-coupled-QCD calculations that when all three flavours self-pair the favoured channel for each is colour-spin-locked (CSL) pseudoisotropic pairing. However, we find that when the up and down quarks undergo 2SC pairing, they induce a colour chemical potential that disfavours the CSL phase. The strange quarks then self-pair in a 'polar' channel that breaks rotational invariance, although the CSL phase may survive in a narrow range of densities

  9. Tunneling couplings in discrete lattices, single-particle band structure, and eigenstates of interacting atom pairs

    International Nuclear Information System (INIS)

    Piil, Rune; Moelmer, Klaus

    2007-01-01

    By adjusting the tunneling couplings over longer than nearest-neighbor distances, it is possible in discrete lattice models to reproduce the properties of the lowest energy band of a real, continuous periodic potential. We propose to include such terms in problems with interacting particles, and we show that they have significant consequences for scattering and bound states of atom pairs in periodic potentials

  10. Majorana edge States in atomic wires coupled by pair hopping.

    Science.gov (United States)

    Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

    2013-10-25

    We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

  11. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    Science.gov (United States)

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  12. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

    OpenAIRE

    Lang, Gregory I.; Murray, Andrew W.

    2008-01-01

    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  13. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  14. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  15. Relativistic quasiparticle random phase approximation with a separable pairing force

    International Nuclear Information System (INIS)

    Tian Yuan; Ma Zhongyu; Ring Peter

    2009-01-01

    In our previous work, we introduced a separable pairing force for relativistic Hartree-Bogoliubov calculations. This force was adjusted to reproduce the pairing properties of the Gogny force in nuclear matter. By using the well known techniques of Talmi and Moshinsky it can be expanded in a series of separable terms and converges quickly after a few terms. It was found that the pairing properties can be depicted on almost the same footing as the original pairing interaction, not only in nuclear matter, but also in finite nuclei. In this study, we construct a relativistic quasiparticle random phase approximation (RQRPA) with this separable pairing interaction and calculate the excitation energies of the first excited 2 + states and reduced B(E2; 0 + →2 + ) transition rates for a chain of Sn isotopes in RQRPA. Compared with the results of the full Gogny force, we find that this simple separable pairing interaction can describe the pairing properties of the excited vibrational states as well as the original pairing interaction. (authors)

  16. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    Science.gov (United States)

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  17. Pair correlation function decay in models of simple fluids that contain dispersion interactions.

    Science.gov (United States)

    Evans, R; Henderson, J R

    2009-11-25

    We investigate the intermediate-and longest-range decay of the total pair correlation function h(r) in model fluids where the inter-particle potential decays as -r(-6), as is appropriate to real fluids in which dispersion forces govern the attraction between particles. It is well-known that such interactions give rise to a term in q(3) in the expansion of [Formula: see text], the Fourier transform of the direct correlation function. Here we show that the presence of the r(-6) tail changes significantly the analytic structure of [Formula: see text] from that found in models where the inter-particle potential is short ranged. In particular the pure imaginary pole at q = iα(0), which generates monotonic-exponential decay of rh(r) in the short-ranged case, is replaced by a complex (pseudo-exponential) pole at q = iα(0)+α(1) whose real part α(1) is negative and generally very small in magnitude. Near the critical point α(1)∼-α(0)(2) and we show how classical Ornstein-Zernike behaviour of the pair correlation function is recovered on approaching the mean-field critical point. Explicit calculations, based on the random phase approximation, enable us to demonstrate the accuracy of asymptotic formulae for h(r) in all regions of the phase diagram and to determine a pseudo-Fisher-Widom (pFW) line. On the high density side of this line, intermediate-range decay of rh(r) is exponentially damped-oscillatory and the ultimate long-range decay is power-law, proportional to r(-6), whereas on the low density side this damped-oscillatory decay is sub-dominant to both monotonic-exponential and power-law decay. Earlier analyses did not identify the pseudo-exponential pole and therefore the existence of the pFW line. Our results enable us to write down the generic wetting potential for a 'real' fluid exhibiting both short-ranged and dispersion interactions. The monotonic-exponential decay of correlations associated with the pseudo-exponential pole introduces additional terms into

  18. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  19. Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

    KAUST Repository

    Zhang, Yuetao

    2012-01-01

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

  20. The predator-prey models for the mechanism of autocatalysis, pair wise interactions and movements to free places

    Directory of Open Access Journals (Sweden)

    Muhammad Shakil

    2015-12-01

    Full Text Available In this paper we aim to develop the modeled equations for different types of mechanism of the predator-prey interactions with the help of a quasi chemical approach while taking a special study case of foxes and rabbits, these mechanisms include autocatalysis mechanism, pair wise interactions and the mechanism of their movements to some free places. The chemical reactions representing the interactions obey the mass action law. The territorial animal like fox is assigned a simple cell as its territory. Under the proper relations between coefficients, this system may demonstrate globally stable dynamics.

  1. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  2. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    Science.gov (United States)

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  3. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  4. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  5. Direct observation of charmed-particle pairs produced in 340 GeV/c negative-pion interactions in an emulsion chamber

    International Nuclear Information System (INIS)

    Fuchi, H.; Hoshino, K.; Miyanishi, M.; Niu, K.; Niwa, K.; Shibuya, H.; Yanagisawa, Y.; Tasaka, S.; Maeda, Y.; Kimura, H.

    1981-01-01

    Among secondaries of 4323 interactions produced in an emulsion chamber exposed to a 340 GeV/c negative ion beam of CERN-SPS, 4 pairs of charmed particles were detected. The mean lifetime of D 0 (D 0 -bar) and the inclusive production cross-section of a charmed particle pair by 340 GeV/c pions were evaluated as (3.1sub(-1.6)sup(+ 2.0)) x 10 - 13 sec and 44 +- 22 μb. (author)

  6. Direct observation of charmed-particle pairs produced in 340 GeV/c negative-pion interactions in an emulsion chamber

    Energy Technology Data Exchange (ETDEWEB)

    Fuchi, H; Hoshino, K; Miyanishi, M; Niu, K; Niwa, K; Shibuya, H; Yanagisawa, Y [Nagoya Univ. (Japan). Dept. of Physics; Ushida, N [Faculty of Education, Aichi University of Education, Kariya, Aichi (Japan); Tasaka, S [Tokyo Univ., Tanashi (Japan). Inst. for Cosmic Ray Research; Maeda, Y

    1981-06-06

    Among secondaries of 4323 interactions produced in an emulsion chamber exposed to a 340 GeV/c negative ion beam of CERN-SPS, 4 pairs of charmed particles were detected. The mean lifetime of D/sup 0/(D/sup 0/-bar) and the inclusive production cross-section of a charmed particle pair by 340 GeV/c pions were evaluated as (3.1sub(-1.6)sup(+ 2.0)) x 10/sup -13/ sec and 44 +- 22 ..mu..b.

  7. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  8. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA.

    Science.gov (United States)

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R

    2009-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure.

  9. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  10. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

    2005-01-01

    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  11. Pair creation at large inherent angles

    International Nuclear Information System (INIS)

    Chen, P.; Tauchi, T.; Schroeder, D.V.

    1992-01-01

    In the next-generation linear colliders, the low-energy e + e - pairs created during the collision of high-energy e + e - beams would cause potential deleterious background problems to the detectors. At low collider energies, the pairs are made essentially by the incoherent process, where the pair is created by the interaction of beamstrahlung photons on the individual particles in the oncoming beam. This problem was first identified by Zolotarev, et al. At energies where the beamstrahlung parameter Υ lies approximately in the range 0.6 approx-lt Υ approx-lt 100, pair creation from the beamstrahlung photons is dominated by a coherent process, first noted by Chen. The seriousness of this pair creation problem lies in the transverse momenta that the pair particles carry when leaving the interaction point (IP) with large angles. Since the central issue is the transverse momentum for particles with large angles, the authors notice that there is another source for it. Namely, when the pair particles are created at low energies, the intrinsic angles of these pairs when produced may already be large. In this paper they reinvestigate the problem, following essentially the same equivalent photon approach, but with changes in specific details including the virtual photon spectrum. In addition, various assumptions are made more explicit. The formulas derived are then applied to the collider parameters designed by Palmer

  12. A special type of neutron-proton pairing interaction and the moments of inertia of some deformed even-even nuclei in the rare earth region

    International Nuclear Information System (INIS)

    Meftunoglu, E.; Gerceklioglu, M.; Erbil, H.H.; Kuliev, A.A.

    1998-01-01

    In this work, the effect of a special type of neutron-proton pairing interaction on the moments of inertia of some deformed nuclei in the rare earth region is investigated. First, making a perturbative approximation, we assume that the form of the equations of the BCS theory and usual Bogolyubov transformations are unchanged. Second, we use a phenomenological method for the strength of this neutron-proton pairing interaction introducing a parameter. Calculations show that this interaction is important for the ground-state moments of inertia and that it could be effectual in other nuclear phenomena. (author)

  13. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  14. Transition from Sign-Reversed to Sign-Preserved Cooper-Pairing Symmetry in Sulfur-Doped Iron Selenide Superconductors.

    Science.gov (United States)

    Wang, Qisi; Park, J T; Feng, Yu; Shen, Yao; Hao, Yiqing; Pan, Bingying; Lynn, J W; Ivanov, A; Chi, Songxue; Matsuda, M; Cao, Huibo; Birgeneau, R J; Efremov, D V; Zhao, Jun

    2016-05-13

    An essential step toward elucidating the mechanism of superconductivity is to determine the sign or phase of the superconducting order parameter, as it is closely related to the pairing interaction. In conventional superconductors, the electron-phonon interaction induces attraction between electrons near the Fermi energy and results in a sign-preserved s-wave pairing. For high-temperature superconductors, including cuprates and iron-based superconductors, prevalent weak coupling theories suggest that the electron pairing is mediated by spin fluctuations which lead to repulsive interactions, and therefore that a sign-reversed pairing with an s_{±} or d-wave symmetry is favored. Here, by using magnetic neutron scattering, a phase sensitive probe of the superconducting gap, we report the observation of a transition from the sign-reversed to sign-preserved Cooper-pairing symmetry with insignificant changes in T_{c} in the S-doped iron selenide superconductors K_{x}Fe_{2-y}(Se_{1-z}S_{z})_{2}. We show that a rather sharp magnetic resonant mode well below the superconducting gap (2Δ) in the undoped sample (z=0) is replaced by a broad hump structure above 2Δ under 50% S doping. These results cannot be readily explained by simple spin fluctuation-exchange pairing theories and, therefore, multiple pairing channels are required to describe superconductivity in this system. Our findings may also yield a simple explanation for the sometimes contradictory data on the sign of the superconducting order parameter in iron-based materials.

  15. Pair potentials in liquid metals

    International Nuclear Information System (INIS)

    Faber, T.E.

    1980-01-01

    The argument which justifies the use of a pair potential to describe the structure-dependent term in the energy of liquid metals is briefly reviewed. Because there is an additional term in the energy which depends upon volume rather than structure, and because the pair potential itself is volume-dependent, the relationship between pair potential and observable properties such as pressure, bulk modulus and pair distribution function is more complicated for liquid metals than it is for molecular liquids. Perhaps for this reason, the agreement between pair potentials inferred from observable properties and pair potentials calculated by means of pseudo-potential theory is still far from complete. The pair potential concept is applicable only to simple liquid metals, in which the electron-ion interaction is weak. No attempt is made to discuss liquid transition and rare-earth metals, which are not simple in this sense. (author)

  16. Tyrosine Kinase Ligand-Receptor Pair Prediction by Using Support Vector Machine

    Directory of Open Access Journals (Sweden)

    Masayuki Yarimizu

    2015-01-01

    Full Text Available Receptor tyrosine kinases are essential proteins involved in cellular differentiation and proliferation in vivo and are heavily involved in allergic diseases, diabetes, and onset/proliferation of cancerous cells. Identifying the interacting partner of this protein, a growth factor ligand, will provide a deeper understanding of cellular proliferation/differentiation and other cell processes. In this study, we developed a method for predicting tyrosine kinase ligand-receptor pairs from their amino acid sequences. We collected tyrosine kinase ligand-receptor pairs from the Database of Interacting Proteins (DIP and UniProtKB, filtered them by removing sequence redundancy, and used them as a dataset for machine learning and assessment of predictive performance. Our prediction method is based on support vector machines (SVMs, and we evaluated several input features suitable for tyrosine kinase for machine learning and compared and analyzed the results. Using sequence pattern information and domain information extracted from sequences as input features, we obtained 0.996 of the area under the receiver operating characteristic curve. This accuracy is higher than that obtained from general protein-protein interaction pair predictions.

  17. Awakened Oscillations in Coupled Consumer-Resource Pairs

    Directory of Open Access Journals (Sweden)

    Almaz Mustafin

    2014-01-01

    Full Text Available The paper concerns two interacting consumer-resource pairs based on chemostat-like equations under the assumption that the dynamics of the resource is considerably slower than that of the consumer. The presence of two different time scales enables to carry out a fairly complete analysis of the problem. This is done by treating consumers and resources in the coupled system as fast-scale and slow-scale variables, respectively, and subsequently considering developments in phase planes of these variables, fast and slow, as if they are independent. When uncoupled, each pair has unique asymptotically stable steady state and no self-sustained oscillatory behavior (although damped oscillations about the equilibrium are admitted. When the consumer-resource pairs are weakly coupled through direct reciprocal inhibition of consumers, the whole system exhibits self-sustained relaxation oscillations with a period that can be significantly longer than intrinsic relaxation time of either pair. It is shown that the model equations adequately describe locally linked consumer-resource systems of quite different nature: living populations under interspecific interference competition and lasers coupled via their cavity losses.

  18. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  19. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  20. Intermolecular interactions of trifluorohalomethanes with Lewis bases in the gas phase: an ab initio study.

    Science.gov (United States)

    Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D

    2014-10-07

    We perform an ab initio computational study of molecular complexes with the general formula CF3X-B that involve one trifluorohalomethane CF3X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH3 and PH3), two n-pairs (H2O and H2S), two n-pairs with an unsaturated bond (H2CO and H2CS), and a single π-pair (C2H4) and two π-pairs (C2H2). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C-X bond lengths shorten, while the C-X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.

  1. Simple concentration-dependent pair interaction model for large-scale simulations of Fe-Cr alloys

    International Nuclear Information System (INIS)

    Levesque, Maximilien; Martinez, Enrique; Fu, Chu-Chun; Nastar, Maylise; Soisson, Frederic

    2011-01-01

    This work is motivated by the need for large-scale simulations to extract physical information on the iron-chromium system that is a binary model alloy for ferritic steels used or proposed in many nuclear applications. From first-principles calculations and the experimental critical temperature we build a new energetic rigid lattice model based on pair interactions with concentration and temperature dependence. Density functional theory calculations in both norm-conserving and projector augmented-wave approaches have been performed. A thorough comparison of these two different ab initio techniques leads to a robust parametrization of the Fe-Cr Hamiltonian. Mean-field approximations and Monte Carlo calculations are then used to account for temperature effects. The predictions of the model are in agreement with the most recent phase diagram at all temperatures and compositions. The solubility of Cr in Fe below 700 K remains in the range of about 6 to 12%. It reproduces the transition between the ordering and demixing tendency and the spinodal decomposition limits are also in agreement with the values given in the literature.

  2. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  3. Associated heavy quarks pair production with Higgs as a tool for a search for non-perturbative effects of the electroweak interaction at the LHC

    Directory of Open Access Journals (Sweden)

    B.A. Arbuzov

    2017-09-01

    Full Text Available Assuming an existence of the anomalous triple electro-weak bosons interaction being defined by coupling constant λ we calculate its contribution to interactions of the Higgs with pairs of heavy particles. Bearing in mind experimental restrictions −0.011<λ<0.011 we present results for possible effects in processes pp→W+W−H,pp→W+ZH,pp→W−ZH,pp→t¯tH, pp→b¯bH. Effects could be significant with negative sign of λ in associated heavy quarks t,b pairs production with the Higgs. In calculations we rely on results of the non-perturbative approach to a spontaneous generation of effective interactions, which defines the form-factor of the three-boson anomalous interaction.

  4. Controlling the transmitted information of a multi-photon interacting with a single-Cooper pair box

    International Nuclear Information System (INIS)

    Kadry, Heba; Abdel-Aty, Abdel-Haleem; Zakaria, Nordin; Cheong, Lee Yen

    2014-01-01

    We study a model of a multi-photon interaction of a single Cooper pair box with a cavity field. The exchange of the information using this system is studied. We quantify the fidelity of the transmitted information. The effect of the system parameters (detuning parameter, field photons, state density and mean photon number) in the fidelity of the transmitted information is investigated. We found that the fidelity of the transmitted information can be controlled using the system parameters

  5. Controlling the transmitted information of a multi-photon interacting with a single-Cooper pair box

    Energy Technology Data Exchange (ETDEWEB)

    Kadry, Heba, E-mail: hkadry1@yahoo.com; Abdel-Aty, Abdel-Haleem, E-mail: hkadry1@yahoo.com; Zakaria, Nordin, E-mail: hkadry1@yahoo.com [Computer and Information Science Department, Universiti Teknologi Petronas, Seri Iskandar, 31750 Tronoh, Perak (Malaysia); Cheong, Lee Yen [Fundamental and Applied Science Department, Universiti Teknologi Petronas, Seri Iskandar, 31750 Tronoh, Perak (Malaysia)

    2014-10-24

    We study a model of a multi-photon interaction of a single Cooper pair box with a cavity field. The exchange of the information using this system is studied. We quantify the fidelity of the transmitted information. The effect of the system parameters (detuning parameter, field photons, state density and mean photon number) in the fidelity of the transmitted information is investigated. We found that the fidelity of the transmitted information can be controlled using the system parameters.

  6. Pairing gaps from nuclear mean-field models

    International Nuclear Information System (INIS)

    Bender, M.; Rutz, K.; Maruhn, J.A.

    2000-01-01

    We discuss the pairing gap, a measure for nuclear pairing correlations, in chains of spherical, semi-magic nuclei in the framework of self-consistent nuclear mean-field models. The equations for the conventional BCS model and the approximate projection-before-variation Lipkin-Nogami method are formulated in terms of local density functionals for the effective interaction. We calculate the Lipkin-Nogami corrections of both the mean-field energy and the pairing energy. Various definitions of the pairing gap are discussed as three-point, four-point and five-point mass-difference formulae, averaged matrix elements of the pairing potential, and single-quasiparticle energies. Experimental values for the pairing gap are compared with calculations employing both a delta pairing force and a density-dependent delta interaction in the BCS and Lipkin-Nogami model. Odd-mass nuclei are calculated in the spherical blocking approximation which neglects part of the the core polarization in the odd nucleus. We find that the five-point mass difference formula gives a very robust description of the odd-even staggering, other approximations for the gap may differ from that up to 30% for certain nuclei. (orig.)

  7. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    Science.gov (United States)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  8. e+e- Pair production from 10 GeV to 10 ZeV

    International Nuclear Information System (INIS)

    Klein, Spencer R.

    2006-01-01

    At very high energies, pair production (γ->e + e - ) exhibits many interesting features. The momentum transfer from the target is very small, so the reaction probes the macroscopic properties of the target, rather than individual nuclei. Interference between interactions with different atoms reduces the pair production cross section considerably below the Bethe-Heitler values. At very high energies, photonuclear interactions may outnumber pair production. In contrast, in crystals, the interaction amplitudes may add coherently, greatly increasing the cross sections. Pair production in matter-free magnetic fields is also possible. The highest energy pair production occurs at high-energy particle colliders. This article will compare pair production in these very different regimes

  9. γ-rays from pair recombination in a travelling wave structure

    International Nuclear Information System (INIS)

    Bertolotti, M.; Sibilla, C.

    1978-01-01

    To obtain stimulated annihilation of pairs, two photon beams arriving from opposite directions are made to impinge with a region where e - - e + pairs are interacting, thus stimulating their recombination. At the exit of the interaction region photons are amplified by a factor β. The change in photon density is studied as a function of the length of the interaction region. The pair density needed to have a given gain is calculated and results to be proportional to log β 2 /(1+β)

  10. Seniority zero pair coupled cluster doubles theory

    International Nuclear Information System (INIS)

    Stein, Tamar; Henderson, Thomas M.; Scuseria, Gustavo E.

    2014-01-01

    Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems

  11. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    Science.gov (United States)

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Theory of antiferromagnetic pairing in cuprate superconductors

    International Nuclear Information System (INIS)

    Plakida, N.M.

    2006-01-01

    A review of the antiferromagnetic exchange and spin-fluctuation pairing theory in the cuprate superconductors is given. We briefly discuss a phenomenological approach and a theory in the limit of weak Coulomb correlations. A microscopic theory in the strong correlation limit is presented in more detail. In particular, results of our recently developed theory for the effective p-d Hubbard model and the reduced t-J model are given. We have proved that retardation effects for the antiferromagnetic exchange interaction are unimportant that results in pairing of all charge carriers in the conduction band and high Tc proportional to the Fermi energy. The spin-fluctuation interaction caused by kinematic interaction gives an additional contribution to the d-wave pairing. Dependence of Tc on the hole concentration and the lattice constant (or pressure) and an oxygen isotope shift are discussed

  13. Particle-antiparticle pair production in four body reactions in Π+p interaction at 16 GeV/C

    International Nuclear Information System (INIS)

    Amato, S.F.

    1987-01-01

    In this thesis, it was studied experimentally, particle-Antiparticle pair formation, taking into account the partonic Structure of the hadrons. Pair formation such as K + K - , p p - , and Π + Π - at 16 GeV/C was studied using the models based on parton concept. (A.C.A.C.) [pt

  14. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

  15. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

    Science.gov (United States)

    Allan, Milan P.

    2013-03-01

    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

  16. Investigation of the interaction dynamics of a pair of laser-induced bubbles generated at the same time through double-exposure strobe method and numerical simulations

    Science.gov (United States)

    Han, Bing; Liu, Liu; Ni, Xiao-Wu

    2017-08-01

    In order to understand the interaction dynamics of a pair of laser-induced bubbles, a double-exposure strobe photography experimental setup is build up to study the temporal evolution of the bubble pairs and to measure the transient bubble-interface moving speed. The interaction mechanisms of the bubble pairs are discussed together with the numerical results obtained through OpenFOAM. It is shown that the direction and the velocity of the jetting could be controlled by the relative size and the relative initiation distance of the bubble pair, when the bubbles are generated at the same time, i.e., in-phase. The liquid jet is considered to be a penetrating jet. The jet is originated from the smaller bubble and clearly protruding outside of the bigger bubble. The parameter space of the relative size and the initiation distance of the bubble pair allowing the formation of the penetrating jet are very narrow. It is concluded that the liquid jet induced by the bubble interactions resulted from the collapse and the rebound of the smaller bubble nearby the bigger bubble. This is defined as the "catapult effect." Such a directional liquid transportation is a promising tool as a micro-injector or a micro-pump. The investigation results could be also supplementary to the understandings of the bubble dynamics.

  17. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  18. Conditions for formation of electron pairs in a metal

    Energy Technology Data Exchange (ETDEWEB)

    Shekhtman, A.Z., E-mail: shekhtmanalexander@gmail.com

    2015-04-15

    Highlights: • A new approach has been developed for consideration of electron pairing in metals. • Binding energy of a single pair induced by electron-phonon interaction is very small. • A new mechanism for electron pairing in metals has been considered. • Conditions for feasibility of the mechanism give conditions for electron pairing. • The mechanism gives wide opportunities to study new conditions for electron pairing. - Abstract: In an isotropic model of the electron system of metal that is presented by the Fröhlich’s initial Hamiltonian, in the approximation of a weak electron–phonon interaction at T = 0, first time, we show that the ground state of the system is the state with pairing correlations of electrons (the pair correlations of occupied electron states). In contrast to the BCS approach, the initial point in our approach is not electron pairing but is the maximum reduction of the energy of the considered system due to virtual processes of the electron–phonon interaction and to the exchange effect for the indirect electron–electron interaction (which is induced by certain phonon modes separately from others). In contrast to the BCS approach, we take into account the portion of the energy of the electron system that is connected with the above exchange effect. In the BCS approach, the corresponding portion is missed, and its role is prescribed to the portion that does not relate to the electron pairing. We show that expectation values of the above Hamiltonian for different wave functions for two interacting electrons above the Fermi sea of the non-interacting system (with interaction between the electrons that is induced by different phonon modes separately from others) are minimum for a certain structure of these functions and simultaneously for phonon modes that can induce the transitions of the interacting electrons between electron states in which they are (without violation of the Pauli exclusion principle and at everything else

  19. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Collective neutrino-pair emission due to Cooper pairing of protons in superconducting neutron stars

    International Nuclear Information System (INIS)

    Leinson, L.B.

    2001-01-01

    The neutrino emission due to formation and breaking of Cooper pairs of protons in superconducting cores of neutron stars is considered with taking into account the electromagnetic coupling of protons to ambient electrons. It is shown that collective response of electrons to the proton quantum transition contributes coherently to the complete interaction with a neutrino field and enhances the neutrino-pair production. Our calculation shows that the contribution of the vector weak current to the ννbar emissivity of protons is much larger than that calculated by different authors without taking into account the plasma effects. Partial contribution of the pairing protons to the total neutrino radiation from the neutron star core is very sensitive to the critical temperatures for the proton and neutron pairing. We show domains of these parameters where the neutrino radiation, caused by a singlet-state pairing of protons is dominating

  1. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    Science.gov (United States)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  2. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  3. Observing Pair-Work Task in an English Speaking Class

    Directory of Open Access Journals (Sweden)

    Diana Achmad

    2014-01-01

    Full Text Available This paper reports on students’ pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger with the less competent ones (hereafter, weaker; therefore, eight pairs were observed during the lesson. The task given to the students was to express ‘Agree and Disagree’ in the context of giving opinions related to social life. Based on the observations, the task was successfully implemented by six pairs; thus, the two others faced some problems. From the first pair, it was seen that the stronger student had intimated the weaker one into speaking during the task. The other pair, who was both of the same native, did not converse in English as expected and mostly used their native language to speak with one another presumably due to respect from the stronger student towards the weaker one. In situations like this, when pair-work becomes unproductive, rotating pairs is recommended to strengthen information sharing and assigning roles to avoid a student from taking over the activity from his or her pair. In conclusion, pairing international learners with mixed speaking proficiency by teachers must be conducted as effectively as possible by initially identifying their ability and learning culture to profoundly expand the students’ language resources.

  4. Separable pairing force for relativistic quasiparticle random-phase approximation

    International Nuclear Information System (INIS)

    Tian Yuan; Ma Zhongyu; Ring, Peter

    2009-01-01

    We have introduced a separable pairing force, which was adjusted to reproduce the pairing properties of the Gogny force in nuclear matter. This separable pairing force is able to describe in relativistic Hartree-Bogoliubov (RHB) calculations the pairing properties in the ground state of finite nuclei on almost the same footing as the original Gogny interaction. In this work we investigate excited states using the Relativistic Quasiparticle Random-Phase Approximation (RQRPA) with the same separable pairing force. For consistency the Goldstone modes and the convergence with various cutoff parameters in this version of RQRPA are studied. The first excited 2 + states for the chain of Sn isotopes with Z=50 and the chain of isotones with N=82 isotones are calculated in RQRPA together with the 3 - states of Sn isotopes. By comparing our results with experimental data and with the results of the original Gogny force we find that this simple separable pairing interaction is very successful in depicting the pairing properties of vibrational excitations.

  5. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    Science.gov (United States)

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  6. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  7. DIMA 3.0: Domain Interaction Map.

    Science.gov (United States)

    Luo, Qibin; Pagel, Philipp; Vilne, Baiba; Frishman, Dmitrij

    2011-01-01

    Domain Interaction MAp (DIMA, available at http://webclu.bio.wzw.tum.de/dima) is a database of predicted and known interactions between protein domains. It integrates 5807 structurally known interactions imported from the iPfam and 3did databases and 46,900 domain interactions predicted by four computational methods: domain phylogenetic profiling, domain pair exclusion algorithm correlated mutations and domain interaction prediction in a discriminative way. Additionally predictions are filtered to exclude those domain pairs that are reported as non-interacting by the Negatome database. The DIMA Web site allows to calculate domain interaction networks either for a domain of interest or for entire organisms, and to explore them interactively using the Flash-based Cytoscape Web software.

  8. Identification of the base-pairing requirements for repression of hctA translation by the small RNA IhtA leads to the discovery of a new mRNA target in Chlamydia trachomatis.

    Directory of Open Access Journals (Sweden)

    Nicole A Grieshaber

    Full Text Available The non-coding small RNA, IhtA expressed by the obligate intracellular human pathogen Chlamydia trachomatis modulates the translation of HctA, a key protein involved in replicative to infectious cell type differentiation. Using a combination of bioinformatics and mutagenesis we sought to identify the base pairing requirement for functional repression of HctA protein expression, with an eye to applying our findings towards the identification of additional targets. IhtA is predicted to fold into a three stem:loop structure. We found that loop 1 occludes the initiation codon of hctA, while loop 2 and 3 are not required for function. This 7 nucleotide region forms G/C rich interactions surrounding the AUG of hctA. Two additional genes in the chlamydial genome, CTL0322 and CTL0097, contained some elements of the hctA:IhtA recognition sequence. The mRNA of both CTL0322and CTL0097 interacted with IhtA in vitro as measured by biolayer interferometry. However, using a CheZ reporter expression system, IhtA only inhibited the translation of CTL0322. The proposed IhtA recognition site in the CTL0322 message contains significant G/C base pairing on either side of the initiation codon while CTL0097 only contains G/C base pairing 3' to the AUG initiation codon. These data suggest that as the functional interacting region is only 6-7nt in length that full translation repression is dependent on the degree of G/C base pairing. Additionally our results indicate that IhtA may regulate multiple mRNAs involved in the chlamydial infectious cycle.

  9. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-01-01

    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  10. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls

    OpenAIRE

    Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David

    2015-01-01

    International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

  12. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  13. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  14. Nucleon-pair approximation to the nuclear shell model

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Y.M., E-mail: ymzhao@sjtu.edu.cn [Department of Physics and Astronomy, Shanghai Jiao Tong University, Shanghai 200240 (China); Arima, A. [Department of Physics and Astronomy, Shanghai Jiao Tong University, Shanghai 200240 (China); Musashi Gakuen, 1-26-1 Toyotamakami Nerima-ku, Tokyo 176-8533 (Japan)

    2014-12-01

    Atomic nuclei are complex systems of nucleons–protons and neutrons. Nucleons interact with each other via an attractive and short-range force. This feature of the interaction leads to a pattern of dominantly monopole and quadrupole correlations between like particles (i.e., proton–proton and neutron–neutron correlations) in low-lying states of atomic nuclei. As a consequence, among dozens or even hundreds of possible types of nucleon pairs, very few nucleon pairs such as proton and neutron pairs with spin zero, two (in some cases spin four), and occasionally isoscalar spin-aligned proton–neutron pairs, play important roles in low-energy nuclear structure. The nucleon-pair approximation therefore provides us with an efficient truncation scheme of the full shell model configurations which are otherwise too large to handle for medium and heavy nuclei in foreseeable future. Furthermore, the nucleon-pair approximation leads to simple pictures in physics, as the dimension of nucleon-pair subspace is always small. The present paper aims at a sound review of its history, formulation, validity, applications, as well as its link to previous approaches, with the focus on the new developments in the last two decades. The applicability of the nucleon-pair approximation and numerical calculations of low-lying states for realistic atomic nuclei are demonstrated with examples. Applications of pair approximations to other problems are also discussed.

  15. BPhyOG: An interactive server for genome-wide inference of bacterial phylogenies based on overlapping genes

    Directory of Open Access Journals (Sweden)

    Lin Kui

    2007-07-01

    Full Text Available Abstract Background Overlapping genes (OGs in bacterial genomes are pairs of adjacent genes of which the coding sequences overlap partly or entirely. With the rapid accumulation of sequence data, many OGs in bacterial genomes have now been identified. Indeed, these might prove a consistent feature across all microbial genomes. Our previous work suggests that OGs can be considered as robust markers at the whole genome level for the construction of phylogenies. An online, interactive web server for inferring phylogenies is needed for biologists to analyze phylogenetic relationships among a set of bacterial genomes of interest. Description BPhyOG is an online interactive server for reconstructing the phylogenies of completely sequenced bacterial genomes on the basis of their shared overlapping genes. It provides two tree-reconstruction methods: Neighbor Joining (NJ and Unweighted Pair-Group Method using Arithmetic averages (UPGMA. Users can apply the desired method to generate phylogenetic trees, which are based on an evolutionary distance matrix for the selected genomes. The distance between two genomes is defined by the normalized number of their shared OG pairs. BPhyOG also allows users to browse the OGs that were used to infer the phylogenetic relationships. It provides detailed annotation for each OG pair and the features of the component genes through hyperlinks. Users can also retrieve each of the homologous OG pairs that have been determined among 177 genomes. It is a useful tool for analyzing the tree of life and overlapping genes from a genomic standpoint. Conclusion BPhyOG is a useful interactive web server for genome-wide inference of any potential evolutionary relationship among the genomes selected by users. It currently includes 177 completely sequenced bacterial genomes containing 79,855 OG pairs, the annotation and homologous OG pairs of which are integrated comprehensively. The reliability of phylogenies complemented by

  16. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  18. Time series regression-based pairs trading in the Korean equities market

    Science.gov (United States)

    Kim, Saejoon; Heo, Jun

    2017-07-01

    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  19. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  20. The coevolution of long-term pair bonds and cooperation.

    Science.gov (United States)

    Song, Z; Feldman, M W

    2013-05-01

    The evolution of social traits may not only depend on but also change the social structure of the population. In particular, the evolution of pairwise cooperation, such as biparental care, depends on the pair-matching distribution of the population, and the latter often emerges as a collective outcome of individual pair-bonding traits, which are also under selection. Here, we develop an analytical model and individual-based simulations to study the coevolution of long-term pair bonds and cooperation in parental care, where partners play a Snowdrift game in each breeding season. We illustrate that long-term pair bonds may coevolve with cooperation when bonding cost is below a threshold. As long-term pair bonds lead to assortative interactions through pair-matching dynamics, they may promote the prevalence of cooperation. In addition to the pay-off matrix of a single game, the evolutionarily stable equilibrium also depends on bonding cost and accidental divorce rate, and it is determined by a form of balancing selection because the benefit from pair-bond maintenance diminishes as the frequency of cooperators increases. Our findings highlight the importance of ecological factors affecting social bonding cost and stability in understanding the coevolution of social behaviour and social structures, which may lead to the diversity of biological social systems. © 2013 The Authors. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.

  1. Na Cl ion pair association in water-DMSO mixtures: Effect of ion pair ...

    Indian Academy of Sciences (India)

    The 12-6-1 potential model predicts running coordination numbers closest to experimental data. Keywords. ... value of interaction energy minimum between the Na. + and Cl. − ..... ion pair mostly remains as a CIP, a fair amount of SAIP is also ...

  2. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Directory of Open Access Journals (Sweden)

    Noman Nasimul

    2011-06-01

    Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

  3. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    Science.gov (United States)

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  4. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  5. Detection of Gene Interactions Based on Syntactic Relations

    Directory of Open Access Journals (Sweden)

    Mi-Young Kim

    2008-01-01

    Full Text Available Interactions between proteins and genes are considered essential in the description of biomolecular phenomena, and networks of interactions are applied in a system's biology approach. Recently, many studies have sought to extract information from biomolecular text using natural language processing technology. Previous studies have asserted that linguistic information is useful for improving the detection of gene interactions. In particular, syntactic relations among linguistic information are good for detecting gene interactions. However, previous systems give a reasonably good precision but poor recall. To improve recall without sacrificing precision, this paper proposes a three-phase method for detecting gene interactions based on syntactic relations. In the first phase, we retrieve syntactic encapsulation categories for each candidate agent and target. In the second phase, we construct a verb list that indicates the nature of the interaction between pairs of genes. In the last phase, we determine direction rules to detect which of two genes is the agent or target. Even without biomolecular knowledge, our method performs reasonably well using a small training dataset. While the first phase contributes to improve recall, the second and third phases contribute to improve precision. In the experimental results using ICML 05 Workshop on Learning Language in Logic (LLL05 data, our proposed method gave an F-measure of 67.2% for the test data, significantly outperforming previous methods. We also describe the contribution of each phase to the performance.

  6. Gaussian interaction profile kernels for predicting drug-target interaction.

    Science.gov (United States)

    van Laarhoven, Twan; Nabuurs, Sander B; Marchiori, Elena

    2011-11-01

    The in silico prediction of potential interactions between drugs and target proteins is of core importance for the identification of new drugs or novel targets for existing drugs. However, only a tiny portion of all drug-target pairs in current datasets are experimentally validated interactions. This motivates the need for developing computational methods that predict true interaction pairs with high accuracy. We show that a simple machine learning method that uses the drug-target network as the only source of information is capable of predicting true interaction pairs with high accuracy. Specifically, we introduce interaction profiles of drugs (and of targets) in a network, which are binary vectors specifying the presence or absence of interaction with every target (drug) in that network. We define a kernel on these profiles, called the Gaussian Interaction Profile (GIP) kernel, and use a simple classifier, (kernel) Regularized Least Squares (RLS), for prediction drug-target interactions. We test comparatively the effectiveness of RLS with the GIP kernel on four drug-target interaction networks used in previous studies. The proposed algorithm achieves area under the precision-recall curve (AUPR) up to 92.7, significantly improving over results of state-of-the-art methods. Moreover, we show that using also kernels based on chemical and genomic information further increases accuracy, with a neat improvement on small datasets. These results substantiate the relevance of the network topology (in the form of interaction profiles) as source of information for predicting drug-target interactions. Software and Supplementary Material are available at http://cs.ru.nl/~tvanlaarhoven/drugtarget2011/. tvanlaarhoven@cs.ru.nl; elenam@cs.ru.nl. Supplementary data are available at Bioinformatics online.

  7. Monitoring Flower Visitation Networks and Interactions between Pairs of Bumble Bees in a Large Outdoor Flight Cage.

    Science.gov (United States)

    Lihoreau, Mathieu; Chittka, Lars; Raine, Nigel E

    2016-01-01

    Pollinators, such as bees, often develop multi-location routes (traplines) to exploit subsets of flower patches within larger plant populations. How individuals establish such foraging areas in the presence of other foragers is poorly explored. Here we investigated the foraging patterns of pairs of bumble bees (Bombus terrestris) released sequentially into an 880m2 outdoor flight cage containing 10 feeding stations (artificial flowers). Using motion-sensitive video cameras mounted on flowers, we mapped the flower visitation networks of both foragers, quantified their interactions and compared their foraging success over an entire day. Overall, bees that were released first (residents) travelled 37% faster and collected 77% more nectar, thereby reaching a net energy intake rate 64% higher than bees released second (newcomers). However, this prior-experience advantage decreased as newcomers became familiar with the spatial configuration of the flower array. When both bees visited the same flower simultaneously, the most frequent outcome was for the resident to evict the newcomer. On the rare occasions when newcomers evicted residents, the two bees increased their frequency of return visits to that flower. These competitive interactions led to a significant (if only partial) spatial overlap between the foraging patterns of pairs of bees. While newcomers may initially use social cues (such as olfactory footprints) to exploit flowers used by residents, either because such cues indicate higher rewards and/or safety from predation, residents may attempt to preserve their monopoly over familiar resources through exploitation and interference. We discuss how these interactions may favour spatial partitioning, thereby maximising the foraging efficiency of individuals and colonies.

  8. A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

    NARCIS (Netherlands)

    Moddemeijer, R

    In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

  9. NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

    International Nuclear Information System (INIS)

    Li, Ying; Wilson, W.D.; Zon, G.

    1991-01-01

    1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

  10. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    Directory of Open Access Journals (Sweden)

    Ji-Jian Chin

    2014-01-01

    Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  11. Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

    Science.gov (United States)

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  12. Nuclear scissors mode with pairing

    International Nuclear Information System (INIS)

    Balbutsev, E. B.; Malov, L. A.; Schuck, P.; Urban, M.; Vinas, X.

    2008-01-01

    The coupled dynamics of the scissors mode and the isovector giant quadrupole resonance are studied using a generalized Wigner function moments method, taking into account pair correlations. Equations of motion for angular momentum, quadrupole moment, and other relevant collective variables are derived on the basis of the time-dependent Hartree-Fock-Bogolyubov equations. Analytical expressions for energy centroids and transition probabilities are found for the harmonic-oscillator model with the quadrupole-quadrupole residual interaction and monopole pairing force. Deformation dependences of energies and B(M1) values are correctly reproduced. The inclusion of pair correlations leads to a drastic improvement in the description of qualitative and quantitative characteristics of the scissors mode.

  13. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.

    2001-01-01

    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  14. The rotationally induced quadrupole pair field in the particle-rotor model

    International Nuclear Information System (INIS)

    Almberger, J.

    1980-04-01

    A formalism is developed which makes it possible to consider the influence of the rotationally induced quadrupole pair field and corresponding quasi-particle residual interactions within the particle-rotor model. The Y 21 pair field renormalizes both the Coriolis and the recoil interactions. (Auth.)

  15. Cooper-pair size and binding energy for unconventional superconducting systems

    Science.gov (United States)

    Dinóla Neto, F.; Neto, Minos A.; Salmon, Octavio D. Rodriguez

    2018-06-01

    The main proposal of this paper is to analyze the size of the Cooper pairs composed by unbalanced mass fermions from different electronic bands along the BCS-BEC crossover and study the binding energy of the pairs. We are considering an interaction between fermions with different masses leading to an inter-band pairing. In addiction to the attractive interaction we have an hybridization term to couple both bands, which in general acts unfavorable for the pairing between the electrons. We get first order phase transitions as the hybridization breaks the Cooper pairs for the s-wave symmetry of the gap amplitude. The results show the dependence of the Cooper-pair size as a function of the hybridization for T = 0 . We also propose the structure of the binding energy of the inter-band system as a function of the two-bands quasi-particle energies.

  16. Negligible Electronic Interaction between Photoexcited Electron-Hole Pairs and Free Electrons in Phosphorus-Boron Co-Doped Silicon Nanocrystals

    Energy Technology Data Exchange (ETDEWEB)

    Limpens, Rens [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Neale, Nathan R [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Fujii, Minoru [Kobe University; Gregorkiewicz, Tom [University of Amsterdam

    2018-03-05

    Phosphorus (P) and boron (B) co-doped Si nanocrystals (NCs) have raised interest in the optoelectronic industry due to their electronic tunability, optimal carrier multiplication properties, and straightforward dispersibility in polar solvents. Yet a basic understanding of the interaction of photoexcited electron-hole (e-h) pairs with new physical features that are introduced by the co-doping process (free carriers, defect states, and surface chemistry) is missing. Here, we present the first study of the ultrafast carrier dynamics in SiO2-embedded P-B co-doped Si NC ensembles using induced absorption spectroscopy through a two-step approach. First, the induced absorption data show that the large fraction of the dopants residing on the NC surface slows down carrier relaxation dynamics within the first 20 ps relative to intrinsic (undoped) Si NCs, which we interpret as enhanced surface passivation. On longer time-scales (picosecond to nanosecond regime), we observe a speeding up of the carrier relaxation dynamics and ascribe it to doping-induced trap states. This argument is deduced from the second part of the study, where we investigate multiexciton interactions. From a stochastic modeling approach we show that localized carriers, which are introduced by the P or B dopants, have minor electronic interactions with the photoexcited e-h pairs. This is understood in light of the strong localization of the introduced carriers on their original P- or B-dopant atoms, due to the strong quantum confinement regime in these relatively small NCs (<6 nm).

  17. J/psi-> gamma B anti B decays and the quark-pair creation model

    CERN Document Server

    Ping Rong Gang; Shen Peng Nian; Zou Bing Song

    2002-01-01

    The authors generalize the quark-pair creation model to a study of the radiative decays J/psi-> gamma B anti B by assuming that the u, d or s quark pairs are created with the same interaction strength. From the calculation of the ratio of the decay widths GAMMA(J/psi-> gamma p anti B)/GAMMA(J/psi->p anti p), the authors extract the quark-pair creation strength gI=15.40 GeV. Based on the SU(6) spin-flavour basis and the 'uds' basis, the radiative decay branching ratios containing strange baryons are evaluated. Measurements for these decay widths from the BESII data are suggested

  18. Skew Information for a Single Cooper Pair Box Interacting with a Single Cavity Field

    International Nuclear Information System (INIS)

    Metwally, N.; Al-Mannai, A.; Abdel-Aty, M.

    2013-01-01

    The dynamics of the skew information (SI) is investigated for a single Cooper Pair Box (CPB) interacting with a single cavity field. By suitably choosing the system parameters and precisely controlling the dynamics, novel connection is found between the SI and entanglement generation. It is shown that SI can be increased and reach its maximum value either by increasing the number of photons inside the cavity or considering the far off-resonant case. The number of oscillations of SI is increased by decreasing this ratio between the Josephson junction capacity and the gate capacity. This leads to significant improvement of the travelling time between the maximum and minimum values. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  19. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  20. Inferring domain-domain interactions from protein-protein interactions with formal concept analysis.

    Directory of Open Access Journals (Sweden)

    Susan Khor

    Full Text Available Identifying reliable domain-domain interactions will increase our ability to predict novel protein-protein interactions, to unravel interactions in protein complexes, and thus gain more information about the function and behavior of genes. One of the challenges of identifying reliable domain-domain interactions is domain promiscuity. Promiscuous domains are domains that can occur in many domain architectures and are therefore found in many proteins. This becomes a problem for a method where the score of a domain-pair is the ratio between observed and expected frequencies because the protein-protein interaction network is sparse. As such, many protein-pairs will be non-interacting and domain-pairs with promiscuous domains will be penalized. This domain promiscuity challenge to the problem of inferring reliable domain-domain interactions from protein-protein interactions has been recognized, and a number of work-arounds have been proposed. This paper reports on an application of Formal Concept Analysis to this problem. It is found that the relationship between formal concepts provides a natural way for rare domains to elevate the rank of promiscuous domain-pairs and enrich highly ranked domain-pairs with reliable domain-domain interactions. This piggybacking of promiscuous domain-pairs onto less promiscuous domain-pairs is possible only with concept lattices whose attribute-labels are not reduced and is enhanced by the presence of proteins that comprise both promiscuous and rare domains.

  1. Inferring Domain-Domain Interactions from Protein-Protein Interactions with Formal Concept Analysis

    Science.gov (United States)

    Khor, Susan

    2014-01-01

    Identifying reliable domain-domain interactions will increase our ability to predict novel protein-protein interactions, to unravel interactions in protein complexes, and thus gain more information about the function and behavior of genes. One of the challenges of identifying reliable domain-domain interactions is domain promiscuity. Promiscuous domains are domains that can occur in many domain architectures and are therefore found in many proteins. This becomes a problem for a method where the score of a domain-pair is the ratio between observed and expected frequencies because the protein-protein interaction network is sparse. As such, many protein-pairs will be non-interacting and domain-pairs with promiscuous domains will be penalized. This domain promiscuity challenge to the problem of inferring reliable domain-domain interactions from protein-protein interactions has been recognized, and a number of work-arounds have been proposed. This paper reports on an application of Formal Concept Analysis to this problem. It is found that the relationship between formal concepts provides a natural way for rare domains to elevate the rank of promiscuous domain-pairs and enrich highly ranked domain-pairs with reliable domain-domain interactions. This piggybacking of promiscuous domain-pairs onto less promiscuous domain-pairs is possible only with concept lattices whose attribute-labels are not reduced and is enhanced by the presence of proteins that comprise both promiscuous and rare domains. PMID:24586450

  2. Existence and consequences of Coulomb pairing of electrons in a solid

    International Nuclear Information System (INIS)

    Mahajan, S.M.; Thyagaraja, A.

    1996-11-01

    It is shown from first principles that, in the periodic potential of a crystalline solid, short-range (i.e., screened) binary Coulomb interactions can lead to a two-electron bound state. It is further suggested that these composite bosonic states (charge -2e, and typically spin zero) could mediate an effectively attractive interaction between pairs of conduction electrons close to the Fermi level. This necessarily short range attractive interaction, which is crucially dependent on the band structure of the solid, and is complementary to the phonon-mediated one, may provide a source for the existence and properties of short correlation-length electron pairs (analogous to but distinct from Cooper pairs) needed to understand high temperature superconductivity. Several distinctive and observable characteristics of the proposed pairing scheme are discussed

  3. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    DEFF Research Database (Denmark)

    Carli, Lorenzo; Genta, G; Cantatore, Angela

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

  4. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

  5. Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

    2000-01-01

    Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

  6. Hole pairing induced by antiferromagnetic spin fluctuations

    International Nuclear Information System (INIS)

    Su, Z.B.; Yu Lu; Dong, J.M.; Tosatti, E.

    1987-08-01

    The effective interaction induced by antiferromagnetic spin fluctuations is considered in the random phase approximation in the context of the recently discovered high T c oxide superconductors. This effective attraction favours a triplet pairing of holes. The implications of such pairing mechanism are discussed in connection with the current experimental observations. (author). 30 refs, 2 figs

  7. Effects of disorder on the electron pairing

    International Nuclear Information System (INIS)

    Oviedo-Roa, R.; Wang, C.; Navarro, O.

    1996-01-01

    The electron pairing in randomly disordered lattices is studied by using an attractive Hubbard model, and by mapping the many-body problem onto a tight-binding one in a higher dimensional space, where a diagonal disorder is considered within the coherent-potential approximation. The results show an enhancement of the pair-binding energy as the self-energy difference increases in a binary alloy A x B 1-x . This fact suggests that the pairing process is highly sensitive to the one-particle localization condition. A ground-state phase diagram for on-site interaction disorder shows regions where pairing is avoided for ordered diatomic systems but not for disordered case

  8. Identification of residue pairing in interacting β-strands from a predicted residue contact map.

    Science.gov (United States)

    Mao, Wenzhi; Wang, Tong; Zhang, Wenxuan; Gong, Haipeng

    2018-04-19

    Despite the rapid progress of protein residue contact prediction, predicted residue contact maps frequently contain many errors. However, information of residue pairing in β strands could be extracted from a noisy contact map, due to the presence of characteristic contact patterns in β-β interactions. This information may benefit the tertiary structure prediction of mainly β proteins. In this work, we propose a novel ridge-detection-based β-β contact predictor to identify residue pairing in β strands from any predicted residue contact map. Our algorithm RDb 2 C adopts ridge detection, a well-developed technique in computer image processing, to capture consecutive residue contacts, and then utilizes a novel multi-stage random forest framework to integrate the ridge information and additional features for prediction. Starting from the predicted contact map of CCMpred, RDb 2 C remarkably outperforms all state-of-the-art methods on two conventional test sets of β proteins (BetaSheet916 and BetaSheet1452), and achieves F1-scores of ~ 62% and ~ 76% at the residue level and strand level, respectively. Taking the prediction of the more advanced RaptorX-Contact as input, RDb 2 C achieves impressively higher performance, with F1-scores reaching ~ 76% and ~ 86% at the residue level and strand level, respectively. In a test of structural modeling using the top 1 L predicted contacts as constraints, for 61 mainly β proteins, the average TM-score achieves 0.442 when using the raw RaptorX-Contact prediction, but increases to 0.506 when using the improved prediction by RDb 2 C. Our method can significantly improve the prediction of β-β contacts from any predicted residue contact maps. Prediction results of our algorithm could be directly applied to effectively facilitate the practical structure prediction of mainly β proteins. All source data and codes are available at http://166.111.152.91/Downloads.html or the GitHub address of https://github.com/wzmao/RDb2C .

  9. Development and application of an interaction network ontology for literature mining of vaccine-associated gene-gene interactions.

    Science.gov (United States)

    Hur, Junguk; Özgür, Arzucan; Xiang, Zuoshuang; He, Yongqun

    2015-01-01

    Literature mining of gene-gene interactions has been enhanced by ontology-based name classifications. However, in biomedical literature mining, interaction keywords have not been carefully studied and used beyond a collection of keywords. In this study, we report the development of a new Interaction Network Ontology (INO) that classifies >800 interaction keywords and incorporates interaction terms from the PSI Molecular Interactions (PSI-MI) and Gene Ontology (GO). Using INO-based literature mining results, a modified Fisher's exact test was established to analyze significantly over- and under-represented enriched gene-gene interaction types within a specific area. Such a strategy was applied to study the vaccine-mediated gene-gene interactions using all PubMed abstracts. The Vaccine Ontology (VO) and INO were used to support the retrieval of vaccine terms and interaction keywords from the literature. INO is aligned with the Basic Formal Ontology (BFO) and imports terms from 10 other existing ontologies. Current INO includes 540 terms. In terms of interaction-related terms, INO imports and aligns PSI-MI and GO interaction terms and includes over 100 newly generated ontology terms with 'INO_' prefix. A new annotation property, 'has literature mining keywords', was generated to allow the listing of different keywords mapping to the interaction types in INO. Using all PubMed documents published as of 12/31/2013, approximately 266,000 vaccine-associated documents were identified, and a total of 6,116 gene-pairs were associated with at least one INO term. Out of 78 INO interaction terms associated with at least five gene-pairs of the vaccine-associated sub-network, 14 terms were significantly over-represented (i.e., more frequently used) and 17 under-represented based on our modified Fisher's exact test. These over-represented and under-represented terms share some common top-level terms but are distinct at the bottom levels of the INO hierarchy. The analysis of these

  10. ΛΛ pairing in NΛ composite matter

    International Nuclear Information System (INIS)

    Tanigawa, Tomonori; Matsuzaki, Masayuki; Chiba, Satoshi

    2003-01-01

    ΛΛ pairing correlation in binary mixed matter of nucleons and lambdas is studied within the relativistic Hartree-Bogoliubov model. Λ hyperons to be paired up are immersed in background nucleons in normal state. A phenomenological ΛΛ interaction, which is derived relativistically from the Lagrangian of the system, is adopted to the gap equation. It is found that increasing the nucleon density makes the ΛΛ pairing gap suppressed. This result suggests a mechanism, specific to relativistic models, of its dependence on the nucleon density. (author)

  11. ΛΛ pairing in NΛ composite matter

    International Nuclear Information System (INIS)

    Tanigawa, Tomonori; Matsuzaki, Masayuki; Chiba, Satoshi

    2002-01-01

    ΛΛ pairing correlation in binary mixed matter of nucleons and lambdas is studied within the relativistic Hartree-Bogoliubov model. Λ hyperons to be paired up are immersed in background nucleons in normal state. A phenomenological ΛΛ interaction, which is derived relativistically from the Lagrangian of the system, is adopted to the gap equation. It is found that increasing the nucleon density makes the ΛΛ pairing gap suppressed. This result suggests a mechanism, specific to relativistic models, of its dependence on the nucleon density. (author)

  12. Monitoring Flower Visitation Networks and Interactions between Pairs of Bumble Bees in a Large Outdoor Flight Cage.

    Directory of Open Access Journals (Sweden)

    Mathieu Lihoreau

    Full Text Available Pollinators, such as bees, often develop multi-location routes (traplines to exploit subsets of flower patches within larger plant populations. How individuals establish such foraging areas in the presence of other foragers is poorly explored. Here we investigated the foraging patterns of pairs of bumble bees (Bombus terrestris released sequentially into an 880m2 outdoor flight cage containing 10 feeding stations (artificial flowers. Using motion-sensitive video cameras mounted on flowers, we mapped the flower visitation networks of both foragers, quantified their interactions and compared their foraging success over an entire day. Overall, bees that were released first (residents travelled 37% faster and collected 77% more nectar, thereby reaching a net energy intake rate 64% higher than bees released second (newcomers. However, this prior-experience advantage decreased as newcomers became familiar with the spatial configuration of the flower array. When both bees visited the same flower simultaneously, the most frequent outcome was for the resident to evict the newcomer. On the rare occasions when newcomers evicted residents, the two bees increased their frequency of return visits to that flower. These competitive interactions led to a significant (if only partial spatial overlap between the foraging patterns of pairs of bees. While newcomers may initially use social cues (such as olfactory footprints to exploit flowers used by residents, either because such cues indicate higher rewards and/or safety from predation, residents may attempt to preserve their monopoly over familiar resources through exploitation and interference. We discuss how these interactions may favour spatial partitioning, thereby maximising the foraging efficiency of individuals and colonies.

  13. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  14. Pair shell model description of collective motions

    International Nuclear Information System (INIS)

    Chen Hsitseng; Feng Dahsuan

    1996-01-01

    The shell model in the pair basis has been reviewed with a case study of four particles in a spherical single-j shell. By analyzing the wave functions according to their pair components, the novel concept of the optimum pairs was developed which led to the proposal of a generalized pair mean-field method to solve the many-body problem. The salient feature of the method is its ability to handle within the framework of the spherical shell model a rotational system where the usual strong configuration mixing complexity is so simplified that it is now possible to obtain analytically the band head energies and the moments of inertia. We have also examined the effects of pair truncation on rotation and found the slow convergence of adding higher spin pairs. Finally, we found that when the SDI and Q .Q interactions are of equal strengths, the optimum pair approximation is still valid. (orig.)

  15. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    Energy Technology Data Exchange (ETDEWEB)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

    2016-02-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  16. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-01-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  17. Cell pairing ratio controlled micro-environment with valve-less electrolytic isolation

    KAUST Repository

    Chen, Yu-Chih

    2012-01-01

    We present a ratio controlled cell-to-cell interaction chip using valve-less isolation. We incorporated electrolysis in a microfluidic channel. In each microfluidic chamber, we loaded two types of different cells at various pairing ratios. More than 80% of the microchambers were successfully loaded with a specific target pairing ratio. For the proof of concept, we have demonstrated the cell-to-cell interaction between prostate cancer cells and muscle stem cells can be controlled by cell pairing ratios through growth factor secretion. The experimental data shows that sealing of microenvironment by air generated from electrolysis does not affect cell viability and cell interaction assay results. © 2012 IEEE.

  18. Universal spectral signatures in pnictides and cuprates: the role of quasiparticle-pair coupling.

    Science.gov (United States)

    Sacks, William; Mauger, Alain; Noat, Yves

    2017-11-08

    Understanding the physical properties of a large variety of high-T c superconductors (SC), the cuprate family as well as the more recent iron-based superconductors, is still a major challenge. In particular, these materials exhibit the 'peak-dip-hump' structure in the quasiparticle density of states (DOS). The origin of this structure is explained within our pair-pair interaction (PPI) model: The non-superconducting state consists of incoherent pairs, a 'Cooper-pair glass' which, due to the PPI, undergoes a Bose-like condensation below T c to the coherent SC state. We derive the equations of motion for the quasiparticle operators showing that the DOS 'peak-dip-hump' is caused by the coupling between quasiparticles and excited pair states, or 'super-quasiparticles'. The renormalized SC gap function becomes energy-dependent and non retarded, reproducing accurately the experimental spectra of both pnictides and cuprates, despite the large difference in gap value.

  19. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  20. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  1. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  2. Nonlinear interaction between a pair of oblique modes in a supersonic mixing layer: Long-wave limit

    Science.gov (United States)

    Balsa, Thomas F.; Gartside, James

    1995-01-01

    The nonlinear interaction between a pair of symmetric, oblique, and spatial instability modes is studied in the long-wave limit using asymptotic methods. The base flow is taken to be a supersonic mixing layer whose Mach number is such that the corresponding vortex sheet is marginally stable according to Miles' criterion. It is shown that the amplitude of the mode obeys a nonlinear integro-differential equation. Numerical solutions of this equation show that, when the obliqueness angle is less than pi/4, the effect of the nonlinearity is to enhance the growth rate of the instability. The solution terminates in a singularity at a finite streamwise location. This result is reminiscent of that obtained in the vicinity of the neutral point by other authors in several different types of flows. On the other hand, when the obliqueness angle is more than pi/4, the streamwise development of the amplitude is characterized by a series of modulations. This arises from the fact that the nonlinear term in the amplitude equation may be either stabilizing or destabilizing, depending on the value of the streamwise coordinate. However, even in this case the amplitude of the disturbance increases, though not as rapidly as in the case for which the angle is less than pi/4. Quite generally then, the nonlinear interaction between two oblique modes in a supersonic mixing layer enhances the growth of the disturbance.

  3. Dye-sensitized solar cell with a pair of carbon-based electrodes

    International Nuclear Information System (INIS)

    Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun

    2012-01-01

    We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

  4. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  5. PandA : pairings and arithmetic

    NARCIS (Netherlands)

    Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.

    2014-01-01

    This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give

  6. Intermittent pair-housing, pair relationship qualities, and HPA activity in adult female rhesus macaques.

    Science.gov (United States)

    Hannibal, Darcy L; Cassidy, Lauren C; Vandeleest, Jessica; Semple, Stuart; Barnard, Allison; Chun, Katie; Winkler, Sasha; McCowan, Brenda

    2018-05-02

    Laboratory rhesus macaques are often housed in pairs and may be temporarily or permanently separated for research, health, or management reasons. While both long-term social separations and introductions can stimulate a stress response that impacts inflammation and immune function, the effects of short-term overnight separations and whether qualities of the pair relationship mediate these effects are unknown. In this study, we investigated the effects of overnight separations on the urinary cortisol concentration of 20 differentially paired adult female rhesus macaques (Macaca mulatta) at the California National Primate Research Center. These females were initially kept in either continuous (no overnight separation) or intermittent (with overnight separation) pair-housing and then switched to the alternate pair-housing condition part way through the study. Each study subject was observed for 5 weeks, during which we collected measures of affiliative, aggressive, anxious, abnormal, and activity-state behaviors in both pair-housing conditions. Additionally, up to three urine samples were collected from each subject per week and assayed for urinary free cortisol and creatinine. Lastly, the behavioral observer scored each pair on four relationship quality attributes ("Anxious," "Tense," "Well-meshed," and "Friendly") using a seven-point scale. Data were analyzed using a generalized linear model with gamma distribution and an information theoretic approach to determine the best model set. An interaction between the intermittent pairing condition and tense pair adjective rating was in the top three models of the best model set. Dominance and rates of affiliation were also important for explaining urinary cortisol variation. Our results suggest that to prevent significant changes in HPA-axis activation in rhesus macaque females, which could have unintended effects on research outcomes, pairs with "Tense" relationships and overnight separations preventing tactile contact

  7. Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

    Science.gov (United States)

    Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

    2018-02-19

    It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

  8. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  9. Deformed nuclear state as a quasiparticle-pair

    International Nuclear Information System (INIS)

    Dobaczewski, J.; Skalski, J.

    1988-01-01

    The deformed nuclear states, obtained in terms of the Hartree-Fock plus BCS method with the Skyrme SIII interaction, are approximated by condensates of the low-angular-momentum quasiparticle and particle pairs. The optimal pairs are determined by the variation after truncation method. The influence of the truncation on the deformation energy and the importance of the core-polarization effects are investigated

  10. Multi-photon creation and single-photon annihilation of electron-positron pairs

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Huayu

    2011-04-27

    In this thesis we study multi-photon e{sup +}e{sup -} pair production in a trident process, and singlephoton e{sup +}e{sup -} pair annihilation in a triple interaction. The pair production is considered in the collision of a relativistic electron with a strong laser beam, and calculated within the theory of laser-dressed quantum electrodynamics. A regularization method is developed systematically for the resonance problem arising in the multi-photon process. Total production rates, positron spectra, and relative contributions of different reaction channels are obtained in various interaction regimes. Our calculation shows good agreement with existing experimental data from SLAC, and adds further insights into the experimental findings. Besides, we study the process in a manifestly nonperturbative domain, whose accessibility to future all-optical experiments based on laser acceleration is shown. In the single-photon e{sup +}e{sup -} pair annihilation, the recoil momentum is absorbed by a spectator particle. Various kinematic configurations of the three incoming particles are examined. Under certain conditions, the emitted photon exhibits distinct angular and polarization distributions which could facilitate the detection of the process. Considering an equilibrium relativistic e{sup +}e{sup -} plasma, it is found that the single-photon process becomes the dominant annihilation channel for plasma temperatures above 3 MeV. Multi-particle correlation effects are therefore essential for the e{sup +}e{sup -} dynamics at very high density. (orig.)

  11. Multi-photon creation and single-photon annihilation of electron-positron pairs

    International Nuclear Information System (INIS)

    Hu, Huayu

    2011-01-01

    In this thesis we study multi-photon e + e - pair production in a trident process, and singlephoton e + e - pair annihilation in a triple interaction. The pair production is considered in the collision of a relativistic electron with a strong laser beam, and calculated within the theory of laser-dressed quantum electrodynamics. A regularization method is developed systematically for the resonance problem arising in the multi-photon process. Total production rates, positron spectra, and relative contributions of different reaction channels are obtained in various interaction regimes. Our calculation shows good agreement with existing experimental data from SLAC, and adds further insights into the experimental findings. Besides, we study the process in a manifestly nonperturbative domain, whose accessibility to future all-optical experiments based on laser acceleration is shown. In the single-photon e + e - pair annihilation, the recoil momentum is absorbed by a spectator particle. Various kinematic configurations of the three incoming particles are examined. Under certain conditions, the emitted photon exhibits distinct angular and polarization distributions which could facilitate the detection of the process. Considering an equilibrium relativistic e + e - plasma, it is found that the single-photon process becomes the dominant annihilation channel for plasma temperatures above 3 MeV. Multi-particle correlation effects are therefore essential for the e + e - dynamics at very high density. (orig.)

  12. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  13. J/ψ→γB anti B decays and the quark-pair creation model

    International Nuclear Information System (INIS)

    Ping Ronggang; Jiang Huanqing; Shen Pengnian; Zou Bingsong

    2002-01-01

    The authors generalize the quark-pair creation model to a study of the radiative decays J/ψ→γB anti B by assuming that the u, d or s quark pairs are created with the same interaction strength. From the calculation of the ratio of the decay widths Γ(J/ψ→γp anti B)/Γ(J/ψ→p anti p), the authors extract the quark-pair creation strength gI=15.40 GeV. Based on the SU(6) spin-flavour basis and the 'uds' basis, the radiative decay branching ratios containing strange baryons are evaluated. Measurements for these decay widths from the BESII data are suggested

  14. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  15. Use of Nucleic Acid Analogs for the Study of Nucleic Acid Interactions

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2011-01-01

    Full Text Available Unnatural nucleosides have been explored to expand the properties and the applications of oligonucleotides. This paper briefly summarizes nucleic acid analogs in which the base is modified or replaced by an unnatural stacking group for the study of nucleic acid interactions. We also describe the nucleoside analogs of a base pair-mimic structure that we have examined. Although the base pair-mimic nucleosides possess a simplified stacking moiety of a phenyl or naphthyl group, they can be used as a structural analog of Watson-Crick base pairs. Remarkably, they can adopt two different conformations responding to their interaction energies, and one of them is the stacking conformation of the nonpolar aromatic group causing the site-selective flipping of the opposite base in a DNA double helix. The base pair-mimic nucleosides can be used to study the mechanism responsible for the base stacking and the flipping of bases out of a nucleic acid duplex.

  16. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  17. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. High spin exotic states and new method for pairing energy

    International Nuclear Information System (INIS)

    Molique, H.

    1996-01-01

    We present a new method called 'PSY-MB', initially developed in the framework of abstract group theory for the solution of the problem of strongly interacting multi-fermionic systems with particular to systems in an external rotating field. The validity of the new method (PSY-MB) is tested on model Hamiltonians. A detailed comparison between the obtained solutions and the exact ones is performed. The new method is used in the study of realistic nuclear Hamiltonians based on the Woods-Saxon potential within the cranking approximation to study the influence of residual monopole pairing interactions in the rare-earth mass region. In parallel with this new technique we present original results obtained with the Woods-Saxon mean-field and the self-consistent Hartree-Fock approximation in order to investigate such exotic effects as octupole deformations and hexadecapole C 4 -polarizing deformations in the framework of high-spin physics. By developing these three approaches in one single work we prepare the ground for the nuclear structure calculations of the new generation - where the residual two-body interactions are taken into account also in the weak pairing limit. (author)

  19. Protein-protein interaction site prediction in Homo sapiens and E. coli using an interaction-affinity based membership function in fuzzy SVM.

    Science.gov (United States)

    Sriwastava, Brijesh Kumar; Basu, Subhadip; Maulik, Ujjwal

    2015-10-01

    Protein-protein interaction (PPI) site prediction aids to ascertain the interface residues that participate in interaction processes. Fuzzy support vector machine (F-SVM) is proposed as an effective method to solve this problem, and we have shown that the performance of the classical SVM can be enhanced with the help of an interaction-affinity based fuzzy membership function. The performances of both SVM and F-SVM on the PPI databases of the Homo sapiens and E. coli organisms are evaluated and estimated the statistical significance of the developed method over classical SVM and other fuzzy membership-based SVM methods available in the literature. Our membership function uses the residue-level interaction affinity scores for each pair of positive and negative sequence fragments. The average AUC scores in the 10-fold cross-validation experiments are measured as 79.94% and 80.48% for the Homo sapiens and E. coli organisms respectively. On the independent test datasets, AUC scores are obtained as 76.59% and 80.17% respectively for the two organisms. In almost all cases, the developed F-SVM method improves the performances obtained by the corresponding classical SVM and the other classifiers, available in the literature.

  20. Equilibrium cluster fluids: Pair interactions via inverse design

    OpenAIRE

    Jadrich, Ryan B.; Bollinger, Jonathan A.; Lindquist, Beth A.; Truskett, Thomas M.

    2015-01-01

    Inverse methods of statistical mechanics are becoming productive tools in the design of materials with specific microstructures or properties. While initial studies have focused on solid-state design targets (e.g, assembly of colloidal superlattices), one can alternatively design fluid states with desired morphologies. This work addresses the latter and demonstrates how a simple iterative Boltzmann inversion strategy can be used to determine the isotropic pair potential that reproduces the ra...

  1. Topological Nodal Cooper Pairing in Doped Weyl Metals

    Science.gov (United States)

    Li, Yi; Haldane, F. D. M.

    2018-02-01

    We generalize the concept of Berry connection of the single-electron band structure to that of a two-particle Cooper pairing state between two Fermi surfaces with opposite Chern numbers. Because of underlying Fermi surface topology, the pairing Berry phase acquires nontrivial monopole structure. Consequently, pairing gap functions have topologically protected nodal structure as vortices in the momentum space with the total vorticity solely determined by the pair monopole charge qp. The nodes of gap function behave as the Weyl-Majorana points of the Bogoliubov-de Gennes pairing Hamiltonian. Their relation with the connection patterns of the surface modes from the Weyl band structure and the Majorana surface modes inside the pairing gap is also discussed. Under the approximation of spherical Fermi surfaces, the pairing symmetry are represented by monopole harmonic functions. The lowest possible pairing channel carries angular momentum number j =|qp|, and the corresponding gap functions are holomorphic or antiholomorphic functions on Fermi surfaces. After projected on the Fermi surfaces with nontrivial topology, all the partial-wave channels of pairing interactions acquire the monopole charge qp independent of concrete pairing mechanism.

  2. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  3. The Atomic Mass Dependence of Massive Muon Pair Production in 225 GeV/c $\\pi$ - Nucleus Interactions

    Energy Technology Data Exchange (ETDEWEB)

    Swartz, Morris L. [Chicago U.

    1984-03-01

    The production of massive muon pairs in 225 GeV/c $\\pi^-$-nucleus interactions has been studied for four nuclear targets. The dependence of the integrated cross section on atomic mass A was measured by comparing the relative cross sections for the targets. If one assumes that the cross section is proportional to $A^{\\alpha}$, a value of a= 1.00±0.06 for muon pair masses between 4.0 GeV/$c^2$ and 8.5 GeV/$c^2$ was obtained. The Drell-Yan model predicts an additional dependence of the cross section on the proton fraction Z/A. If one parametizes the integrated cross I section as a(Z/A)$A^{\\alpha}$ where $\\sigma$(Z/A) is a function of the proton fraction that includes the effects of the Drell-Yan model, Fermi Motion, and secondary pion production, a value of $\\alpha$ = 0.97±0.06 was obtained. The dependence of the muon pair transverse momentum distribution on nuclear size was also investigated. The second moment of the distribution <$P^2_T$> was found to be consistent with being independent of nuclear size. If the dependence of <$P^2_T$> on nuclear size is parametized as <$P^2_T$> = a + b $A^{1/3}$ the coefficient b was found to be less than 0.015 $GeV^2$/$c^2$ with 90% confidence.

  4. False positive reduction in protein-protein interaction predictions using gene ontology annotations

    Directory of Open Access Journals (Sweden)

    Lin Yen-Han

    2007-07-01

    Full Text Available Abstract Background Many crucial cellular operations such as metabolism, signalling, and regulations are based on protein-protein interactions. However, the lack of robust protein-protein interaction information is a challenge. One reason for the lack of solid protein-protein interaction information is poor agreement between experimental findings and computational sets that, in turn, comes from huge false positive predictions in computational approaches. Reduction of false positive predictions and enhancing true positive fraction of computationally predicted protein-protein interaction datasets based on highly confident experimental results has not been adequately investigated. Results Gene Ontology (GO annotations were used to reduce false positive protein-protein interactions (PPI pairs resulting from computational predictions. Using experimentally obtained PPI pairs as a training dataset, eight top-ranking keywords were extracted from GO molecular function annotations. The sensitivity of these keywords is 64.21% in the yeast experimental dataset and 80.83% in the worm experimental dataset. The specificities, a measure of recovery power, of these keywords applied to four predicted PPI datasets for each studied organisms, are 48.32% and 46.49% (by average of four datasets in yeast and worm, respectively. Based on eight top-ranking keywords and co-localization of interacting proteins a set of two knowledge rules were deduced and applied to remove false positive protein pairs. The 'strength', a measure of improvement provided by the rules was defined based on the signal-to-noise ratio and implemented to measure the applicability of knowledge rules applying to the predicted PPI datasets. Depending on the employed PPI-predicting methods, the strength varies between two and ten-fold of randomly removing protein pairs from the datasets. Conclusion Gene Ontology annotations along with the deduced knowledge rules could be implemented to partially

  5. Maximizing Impact: Pairing interactive web visualizations with traditional print media

    Science.gov (United States)

    Read, E. K.; Appling, A.; Carr, L.; De Cicco, L.; Read, J. S.; Walker, J. I.; Winslow, L. A.

    2016-12-01

    Our Nation's rapidly growing store of environmental data makes new demands on researchers: to take on increasingly broad-scale, societally relevant analyses and to rapidly communicate findings to the public. Interactive web-based data visualizations now commonly supplement or comprise journalism, and science journalism has followed suit. To maximize the impact of US Geological Survey (USGS) science, the USGS Office of Water Information Data Science team builds tools and products that combine traditional static research products (e.g., print journal articles) with web-based, interactive data visualizations that target non-scientific audiences. We developed a lightweight, open-source framework for web visualizations to reduce time to production. The framework provides templates for a data visualization workflow and the packaging of text, interactive figures, and images into an appealing web interface with standardized look and feel, usage tracking, and responsiveness. By partnering with subject matter experts to focus on timely, societally relevant issues, we use these tools to produce appealing visual stories targeting specific audiences, including managers, the general public, and scientists, on diverse topics including drought, microplastic pollution, and fisheries response to climate change. We will describe the collaborative and technical methodologies used; describe some examples of how it's worked; and challenges and opportunities for the future.

  6. SHEETSPAIR: A Database of Amino Acid Pairs in Protein Sheet Structures

    Directory of Open Access Journals (Sweden)

    Ning Zhang

    2007-10-01

    Full Text Available Within folded strands of a protein, amino acids (AAs on every adjacent two strands form a pair of AAs. To explore the interactions between strands in a protein sheet structure, we have established an Internet-accessible relational database named SheetsPairs based on SQL Server 2000. The database has collected AAs pairs in proteins with detailed information. Furthermore, it utilizes a non-freetext database structure to store protein sequences and a specific database table with a unique number to store strands, which provides more searching options and rapid and accurate access to data queries. An IIS web server has been set up for data retrieval through a custom web interface, which enables complex data queries. Also searchable are parallel or anti-parallel folded strands and the list of strands in a specified protein.

  7. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

    2015-01-01

    , that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...

  8. Augmenting Think-Pair-Share with Simulations

    Science.gov (United States)

    Lee, Kevin M.; Siedell, C. M.; Prather, E. E.; CATS

    2009-01-01

    Computer simulations are valuable tools for the teaching and learning of introductory astronomy. They enable students to link together small pieces of information into mental models of complex physical systems that are far beyond their everyday experience. They can also be used to authentically test a student's conceptual understanding of a physical system by asking the student to make predictions regarding its behavior. Students receive formative feedback by testing their predictions in simulations. Think-Pair-Share - the posing of conceptual questions to students and having them vote on the answer before and after discussion with their peers - can benefit considerably from the incorporation of simulations. Simulations can be used for delivering content that precedes Think-Pair-Share, as the prompt the questions is based upon, or as a feedback tool to illustrate the answer to a question. These techniques are utilized in ClassAction - a collection of materials designed to enhance the metacognitive skills of Astro 101 students by promoting interactive engagement and providing rapid feedback. The main focus is dynamic conceptual questions largely based upon graphics that can be projected in the classroom. Many questions are available in a Flash computer database and instructors have the capability to recast these questions into alternate permutations based on their own preferences and student responses. Outlines, graphics, and simulations are included which instructors can use to provide feedback. This poster provides examples of simulation usage in Think-Pair-Share related to sky motions, lunar phases, and stellar properties. A multi-institutional classroom validation study of ClassAction is currently underway as a Collaboration of Astronomy Teaching Scholars (CATS) research project. All materials are publicly available at http://astro.unl.edu. We would like to thank the NSF for funding under Grant Nos. 0404988 and 0715517, a CCLI Phase III Grant for the

  9. Multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Luo-Luo, E-mail: jiangluoluo@gmail.com [College of Physics and Electronic Information Engineering, Wenzhou University, Wenzhou 325035 (China); College of Physics and Technology, Guangxi Normal University, Guilin, Guangxi 541004 (China); Wang, Wen-Xu [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, AZ 85287 (United States); Department of Physics, Beijing Normal University, Beijing 100875 (China); Lai, Ying-Cheng [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, AZ 85287 (United States); Department of Physics, Arizona State University, Tempe, AZ 85287 (United States); Ni, Xuan [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, AZ 85287 (United States)

    2012-07-09

    We study the formation of multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games with mobile individuals. We discover a set of seed distributions of species, which is able to produce multi-armed spirals and multi-pairs antispirals with a finite number of arms and pairs based on stochastic processes. The joint spiral waves are also predicted by a theoretical model based on partial differential equations associated with specific initial conditions. The spatial entropy of patterns is introduced to differentiate the multi-armed spirals and multi-pairs antispirals. For the given mobility, the spatial entropy of multi-armed spirals is higher than that of single armed spirals. The stability of the waves is explored with respect to individual mobility. Particularly, we find that both two armed spirals and one pair antispirals transform to the single armed spirals. Furthermore, multi-armed spirals and multi-pairs antispirals are relatively stable for intermediate mobility. The joint spirals with lower numbers of arms and pairs are relatively more stable than those with higher numbers of arms and pairs. In addition, comparing to large amount of previous work, we employ the no flux boundary conditions which enables quantitative studies of pattern formation and stability in the system of stochastic interactions in the absence of excitable media. -- Highlights: ► Multi-armed spirals and multi-pairs antispirals are observed. ► Patterns are predicted by computer simulations and partial differential equations. ► The spatial entropy of patterns is introduced. ► Patterns are relatively stable for intermediate mobility. ► The joint spirals with lower numbers of arms and pairs are relatively more stable.

  10. Multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games

    International Nuclear Information System (INIS)

    Jiang, Luo-Luo; Wang, Wen-Xu; Lai, Ying-Cheng; Ni, Xuan

    2012-01-01

    We study the formation of multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games with mobile individuals. We discover a set of seed distributions of species, which is able to produce multi-armed spirals and multi-pairs antispirals with a finite number of arms and pairs based on stochastic processes. The joint spiral waves are also predicted by a theoretical model based on partial differential equations associated with specific initial conditions. The spatial entropy of patterns is introduced to differentiate the multi-armed spirals and multi-pairs antispirals. For the given mobility, the spatial entropy of multi-armed spirals is higher than that of single armed spirals. The stability of the waves is explored with respect to individual mobility. Particularly, we find that both two armed spirals and one pair antispirals transform to the single armed spirals. Furthermore, multi-armed spirals and multi-pairs antispirals are relatively stable for intermediate mobility. The joint spirals with lower numbers of arms and pairs are relatively more stable than those with higher numbers of arms and pairs. In addition, comparing to large amount of previous work, we employ the no flux boundary conditions which enables quantitative studies of pattern formation and stability in the system of stochastic interactions in the absence of excitable media. -- Highlights: ► Multi-armed spirals and multi-pairs antispirals are observed. ► Patterns are predicted by computer simulations and partial differential equations. ► The spatial entropy of patterns is introduced. ► Patterns are relatively stable for intermediate mobility. ► The joint spirals with lower numbers of arms and pairs are relatively more stable.

  11. Diffusion, Ion Pairing and Aggregation in 1-Ethyl-3-Methylimidazolium-Based Ionic Liquids Studied by 1 H and 19 F PFG NMR: Effect of Temperature, Anion and Glucose Dissolution.

    Science.gov (United States)

    D'Agostino, Carmine; Mantle, Mick D; Mullan, Claire L; Hardacre, Christopher; Gladden, Lynn F

    2018-01-31

    In this work, using 1 H and 19 F PFG NMR, we probe the effect of temperature, ion size/type and glucose dissolution on the rate of transport in 1-ethyl-3-methylimidazolium ([EMIM] + )-based ionic liquids by measuring self-diffusion coefficients. Using such data, we are able to establish the degree of ion pairing and quantify the extent of ionic aggregation during diffusion. For the neat 1-ethyl-3-methylimidazolium acetate ([EMIM][OAc]) a strong degree of ion pairing is observed. The substitution of the [OAc] - anion with the bis{(trifluoromethyl)sulfonyl}imide ([TFSI] - ) anion reduces the pairing between the ions, which is attributed to a lower electric charge density on the [TFSI] - anion, hence a weaker electric interaction with the [EMIM] + cation. The effect of glucose, important for applications of ionic liquids as extracting media, on the strongly paired [EMIM][OAc] sample was also investigated and it is observed that the carbohydrate decreases the degree of ion pairing, which is attributed to the ability of glucose to disrupt inter-ionic interactions by forming hydrogen bonding, particularly with the [OAc] - anion. Calculations of aggregation number from diffusion data show that the [OAc] - anion diffuses as a part of larger aggregates compared to the [EMIM] + cation. The results and analysis presented here show the usefulness of PFG NMR in studies of ionic liquids, giving new insights into ion pairing and aggregation and the factors affecting these parameters. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  13. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  14. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

    Science.gov (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

    2012-09-12

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  15. Enhanced stability of bound pairs at nonzero lattice momenta

    International Nuclear Information System (INIS)

    Kornilovitch, Pavel

    2004-01-01

    A two-body problem on the square lattice is analyzed. The interaction potential consists of strong on-site repulsion and nearest-neighbor attraction. The exact pairing conditions are derived for s-, p-, and d-symmetric bound states. The pairing conditions are strong functions of the total pair momentum K. It is found that the stability of pairs increases with K. At weak attraction, the pairs do not form at the Γ point but stabilize at lattice momenta close to the Brillouin zone boundary. The phase boundaries in the momentum space, which separate stable and unstable pairs, are calculated. It is found that the pairs are formed easier along the (π,0) direction than along the (π,π) direction. This might lead to the appearance of 'hot pairing spots' on the K x and K y axes

  16. Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

    Directory of Open Access Journals (Sweden)

    Das Tanmoy

    2012-03-01

    Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

  17. On e(+)e(-) pair production by colliding electromagnetic pulses

    NARCIS (Netherlands)

    Narozhny, NB; Bulanov, SS; Mur, VD; Popov, VS

    2004-01-01

    Electron-positron pair production from vacuum in an electromagnetic field created by two counterpropagating focused laser pulses interacting with each other is analyzed. The dependence of the number of produced pairs on the intensity of a laser pulse and the focusing parameter is studied with a

  18. Rotationally adiabatic pair interactions of para- and ortho-hydrogen with the halogen molecules F2, Cl2, and Br2.

    Science.gov (United States)

    Berg, Matthias; Accardi, Antonio; Paulus, Beate; Schmidt, Burkhard

    2014-08-21

    The present work is concerned with the weak interactions between hydrogen and halogen molecules, i.e., the interactions of pairs H2-X2 with X = F, Cl, Br, which are dominated by dispersion and quadrupole-quadrupole forces. The global minimum of the four-dimensional (4D) coupled cluster with singles and doubles and perturbative triples (CCSD(T)) pair potentials is always a T shaped structure where H2 acts as the hat of the T, with well depths (De) of 1.3, 2.4, and 3.1 kJ/mol for F2, Cl2, and Br2, respectively. MP2/AVQZ results, in reasonable agreement with CCSD(T) results extrapolated to the basis set limit, are used for detailed scans of the potentials. Due to the large difference in the rotational constants of the monomers, in the adiabatic approximation, one can solve the rotational Schrödinger equation for H2 in the potential of the X2 molecule. This yields effective two-dimensional rotationally adiabatic potential energy surfaces where pH2 and oH2 are point-like particles. These potentials for the H2-X2 complexes have global and local minima for effective linear and T-shaped complexes, respectively, which are separated by 0.4-1.0 kJ/mol, where oH2 binds stronger than pH2 to X2, due to higher alignment to minima structures of the 4D-pair potential. Further, we provide fits of an analytical function to the rotationally adiabatic potentials.

  19. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

    2008-01-01

    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  20. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  1. {lambda}{lambda} pairing in N{lambda} composite matter

    Energy Technology Data Exchange (ETDEWEB)

    Tanigawa, Tomonori [Japan Society for the Promotion of Science, Tokyo (Japan); Matsuzaki, Masayuki [Japan Atomic Energy Research Inst., Tokyo (Japan); Chiba, Satoshi [Fukuoka Univ. of Education, Dept. of Physics, Munakata, Fukuoka (Japan)

    2002-09-01

    {lambda}{lambda} pairing correlation in binary mixed matter of nucleons and lambdas is studied within the relativistic Hartree-Bogoliubov model. {lambda} hyperons to be paired up are immersed in background nucleons in normal state. A phenomenological {lambda}{lambda} interaction, which is derived relativistically from the Lagrangian of the system, is adopted to the gap equation. It is found that increasing the nucleon density makes the {lambda}{lambda} pairing gap suppressed. This result suggests a mechanism, specific to relativistic models, of its dependence on the nucleon density. (author)

  2. Critical Discourse Analysis of Advertising: Implications for Language Teacher Education

    Science.gov (United States)

    Turhan, Burcu; Okan, Zuhal

    2017-01-01

    Advertising is a prominent discourse type which is inevitably linked to a range of disciplines. This study examines the language of a non-product advertisement, not isolating it from its interaction with other texts that surrounds it. It is based on Norman Fairclough's Critical Discourse Analysis (CDA) framework in which there are three levels of…

  3. Exactly solvable model of transitional nuclei based on dual algebraic structure for the three level pairing model in the framework of sdg interacting boson model

    Science.gov (United States)

    Jafarizadeh, M. A.; Ranjbar, Z.; Fouladi, N.; Ghapanvari, M.

    2018-01-01

    In this paper, a successful algebraic method based on the dual algebraic structure for three level pairing model in the framework of sdg IBM is proposed for transitional nuclei which show transitional behavior from spherical to gamma-unstable quantum shape phase transition. In this method complicated sdg Hamiltonian, which is a three level pairing Hamiltonian is determined easily via the exactly solvable method. This description provides a better interpretation of some observables such as BE (4) in nuclei which exhibits the necessity of inclusion of g boson in the sd IBM, while BE (4) cannot be explained in the sd boson model. Some observables such as Energy levels, BE (2), BE (4), the two neutron separation energies signature splitting of the γ-vibrational band and expectation values of the g-boson number operator are calculated and examined for 46 104 - 110Pd isotopes.

  4. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.

    1985-01-01

    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  5. Efficient and accurate local approximations to coupled-electron pair approaches: An attempt to revive the pair natural orbital method.

    Science.gov (United States)

    Neese, Frank; Wennmohs, Frank; Hansen, Andreas

    2009-03-21

    Coupled-electron pair approximations (CEPAs) and coupled-pair functionals (CPFs) have been popular in the 1970s and 1980s and have yielded excellent results for small molecules. Recently, interest in CEPA and CPF methods has been renewed. It has been shown that these methods lead to competitive thermochemical, kinetic, and structural predictions. They greatly surpass second order Moller-Plesset and popular density functional theory based approaches in accuracy and are intermediate in quality between CCSD and CCSD(T) in extended benchmark studies. In this work an efficient production level implementation of the closed shell CEPA and CPF methods is reported that can be applied to medium sized molecules in the range of 50-100 atoms and up to about 2000 basis functions. The internal space is spanned by localized internal orbitals. The external space is greatly compressed through the method of pair natural orbitals (PNOs) that was also introduced by the pioneers of the CEPA approaches. Our implementation also makes extended use of density fitting (or resolution of the identity) techniques in order to speed up the laborious integral transformations. The method is called local pair natural orbital CEPA (LPNO-CEPA) (LPNO-CPF). The implementation is centered around the concepts of electron pairs and matrix operations. Altogether three cutoff parameters are introduced that control the size of the significant pair list, the average number of PNOs per electron pair, and the number of contributing basis functions per PNO. With the conservatively chosen default values of these thresholds, the method recovers about 99.8% of the canonical correlation energy. This translates to absolute deviations from the canonical result of only a few kcal mol(-1). Extended numerical test calculations demonstrate that LPNO-CEPA (LPNO-CPF) has essentially the same accuracy as parent CEPA (CPF) methods for thermochemistry, kinetics, weak interactions, and potential energy surfaces but is up to 500

  6. Proton-neutron correlations in a broken-pair model

    International Nuclear Information System (INIS)

    Akkermans, J.N.L.

    1981-01-01

    In this thesis nuclear-structure calculations are reported which were performed with the broken-pair model. The model which is developed, is an extension of existing broken-pair models in so far that it includes both proton and neutron valence pairs. The relevant formalisms are presented. In contrast to the number-non-conserving model, a proton-neutron broken-pair model is well suited to study the correlations which are produced by the proton-neutron interaction. It is shown that the proton-neutron force has large matrix elements which mix the proton- with neutron broken-pair configurations. This occurs especially for Jsup(PI)=2 + and 3 - pairs. This property of the proton-neutron force is used to improve the spectra of single-closed shell nuclei, where particle-hole excitations of the closed shell are a special case of broken-pair configurations. Using Kr and Te isotopes it is demonstrated that the proton-neutron force gives rise to correlated pair structures, which remain remarkably constant with varying nucleon numbers. (Auth.)

  7. Unconventional Cooper pairing results in a pseudogap-like phase in s-wave superconductors

    International Nuclear Information System (INIS)

    Springer, Daniel; Cheong, Siew Ann

    2015-01-01

    The impact of disorder on the superconducting (SC) pairing mechanism is the centre of much debate. Some evidence suggests a loss of phase coherence of pairs while others point towards the formation of a competing phase. In our work we show that the two perspectives may be different sides of the same coin. Using an extension of the perturbative renormalization group approach we compare the impact of different disorder-induced interactions on a SC ground state. We find that in the strongly disordered regime an interaction between paired fermions and their respective disordered environment replaces conventional Cooper pairing. For these unconventional Cooper pairs the phase coherence condition, required for the formation of a SC condensate, is not satisfied. (paper)

  8. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

    2001-02-01

    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  9. Can we beat the biotin-avidin pair?: cucurbit[7]uril-based ultrahigh affinity host-guest complexes and their applications.

    Science.gov (United States)

    Shetty, Dinesh; Khedkar, Jayshree K; Park, Kyeng Min; Kim, Kimoon

    2015-12-07

    The design of synthetic, monovalent host-guest molecular recognition pairs is still challenging and of particular interest to inquire into the limits of the affinity that can be achieved with designed systems. In this regard, cucurbit[7]uril (CB[7]), an important member of the host family cucurbit[n]uril (CB[n], n = 5-8, 10, 14), has attracted much attention because of its ability to form ultra-stable complexes with multiple guests. The strong hydrophobic effect between the host cavity and guests, ion-dipole and dipole-dipole interactions of guests with CB portals helps in cooperative and multiple noncovalent interactions that are essential for realizing such strong complexations. These highly selective, strong yet dynamic interactions can be exploited in many applications including affinity chromatography, biomolecule immobilization, protein isolation, biological catalysis, and sensor technologies. In this review, we summarize the progress in the development of high affinity guests for CB[7], factors affecting the stability of complexes, theoretical insights, and the utility of these high affinity pairs in different challenging applications.

  10. Magnetically-enhanced open string pair production

    Science.gov (United States)

    Lu, J. X.

    2017-12-01

    We consider the stringy interaction between two parallel stacks of D3 branes placed at a separation. Each stack of D3 branes in a similar fashion carry an electric flux and a magnetic flux with the two sharing no common field strength index. The interaction amplitude has an imaginary part, giving rise to the Schwinger-like pair production of open strings. We find a significantly enhanced rate of this production when the two electric fluxes are almost identical and the brane separation is on the order of string scale. This enhancement will be largest if the two magnetic fluxes are opposite in direction. This novel enhancement results from the interplay of the non-perturbative Schwinger-type pair production due to the electric flux and the stringy tachyon due to the magnetic flux, and may have realistic physical applications.

  11. Effective pair potentials for spherical nanoparticles

    International Nuclear Information System (INIS)

    Van Zon, Ramses

    2009-01-01

    An effective description for rigid spherical nanoparticles in a fluid of point particles is presented. The points inside the nanoparticles and the point particles are assumed to interact via spherically symmetric additive pair potentials, while the distribution of points inside the nanoparticles is taken to be spherically symmetric and smooth. The resulting effective pair interactions between a nanoparticle and a point particle, as well as between two nanoparticles, are then given by spherically symmetric potentials. If overlap between particles is allowed, as can occur for some forms of the pair potentials, the effective potential generally has non-analytic points. It is shown that for each effective potential the expressions for different overlapping cases can be written in terms of one analytic auxiliary potential. Even when only non-overlapping situations are possible, the auxiliary potentials facilitate the formulation of the effective potentials. Effective potentials for hollow nanoparticles (appropriate e.g. for buckyballs) are also considered and shown to be related to those for solid nanoparticles. For hollow nanoparticles overlap is more physical, since this covers the case of a smaller particle embedded in a larger, hollow nanoparticle. Finally, explicit expressions are given for the effective potentials derived from basic pair potentials of power law and exponential form, as well as from the commonly used London–van der Waals, Morse, Buckingham, and Lennard-Jones potentials. The applicability of the latter is demonstrated by comparison with an atomic description of nanoparticles with an internal face centered cubic structure

  12. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

    2010-01-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  13. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Pairing from strong repulsion in triangular lattice Hubbard model

    Science.gov (United States)

    Zhang, Shang-Shun; Zhu, Wei; Batista, Cristian D.

    2018-04-01

    We propose a pairing mechanism between holes in the dilute limit of doped frustrated Mott insulators. Hole pairing arises from a hole-hole-magnon three-body bound state. This pairing mechanism has its roots on single-hole kinetic energy frustration, which favors antiferromagnetic (AFM) correlations around the hole. We demonstrate that the AFM polaron (hole-magnon bound state) produced by a single hole propagating on a field-induced polarized background is strong enough to bind a second hole. The effective interaction between these three-body bound states is repulsive, implying that this pairing mechanism is relevant for superconductivity.

  15. An interactive FORTRAN program for the evaluation of structure factors and pair distribution functions from neutron diffraction experiments

    International Nuclear Information System (INIS)

    Abel, W.

    1985-02-01

    This report describes an interactive program to evaluate neutron diffraction data using the Graphic System (GS) under MVS (TSO). Different evaluation steps may be directed by a CLIST. The present program is limited to cylindrical sample geometry. From the fully corrected static structure factor the pair correlation function g(r) and the radial density function may be calculated from which the mean coordination number can be obtained by numerical integration over the main peak. Producing a hardcopy output on a mechanical plotter is provided. (orig.) [de

  16. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

    Science.gov (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  17. Modeling the Electrostatics of Hollow Shell Suspensions: Ion Distribution, Pair Interactions, and Many-Body Effects.

    Science.gov (United States)

    Hallez, Yannick; Meireles, Martine

    2016-10-11

    Electrostatic interactions play a key role in hollow shell suspensions as they determine their structure, stability, thermodynamics, and rheology and also the loading capacity of small charged species for nanoreservoir applications. In this work, fast, reliable modeling strategies aimed at predicting the electrostatics of hollow shells for one, two, and many colloids are proposed and validated. The electrostatic potential inside and outside a hollow shell with a finite thickness and a specific permittivity is determined analytically in the Debye-Hückel (DH) limit. An expression for the interaction potential between two such hollow shells is then derived and validated numerically. It follows a classical Yukawa form with an effective charge depending on the shell geometry, permittivity, and inner and outer surface charge densities. The predictions of the Ornstein-Zernike (OZ) equation with this pair potential to determine equations of state are then evaluated by comparison to results obtained with a Brownian dynamics algorithm coupled to the resolution of the linearized Poisson-Boltzmann and Laplace equations (PB-BD simulations). The OZ equation based on the DLVO-like potential performs very well in the dilute regime as expected, but also quite well, and more surprisingly, in the concentrated regime in which full spheres exhibit significant many-body effects. These effects are shown to vanish for shells with small thickness and high permittivity. For highly charged hollow shells, we propose and validate a charge renormalization procedure. Finally, using PB-BD simulations, we show that the cell model predicts the ion distribution inside and outside hollow shells accurately in both electrostatically dilute and concentrated suspensions. We then determine the shell loading capacity as a function of salt concentration, volume fraction, and surface charge density for nanoreservoir applications such as drug delivery, sensing, or smart coatings.

  18. Investigation of interactions in a biological membrane using structure factor/pair correlation function approach: a first communication on nerve myelin

    International Nuclear Information System (INIS)

    Gbordzoe, M.K.

    1984-09-01

    Interactions in biological and artificial membranes have been studied by applying mostly the methods of biochemical analysis and determination of thermodynamic parameters related to phase transition phenomena. Structure factor, obtained by measuring scattered intensity from small-angle X-ray or neutron scattering experiments, has been used mainly for determining electron density distribution. Drawing upon the experience of the theory of liquids, where Johnson and March (1963) and Johnson, Hutchinson and March (1964) first established the possibility of deriving interparticle potential from experimental measurement of structure factor, it is suggested that structure factor/distance correlation function approach, can be a useful method for studying interactions between various membrane components. Preliminary experimental data presented for nerve myelin are to demonstrate the possibility of studying interactions from the distance correlation function of a membrane pair. (author)

  19. Efficient Implementation of the Pairing on Mobilephones Using BREW

    Science.gov (United States)

    Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

    Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

  20. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

    Science.gov (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

    2012-01-01

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  1. The Nature of the Interactions in Triethanolammonium-Based Ionic Liquids. A Quantum Chemical Study.

    Science.gov (United States)

    Fedorova, Irina V; Safonova, Lyubov P

    2018-05-10

    Structural features and interionic interactions play a crucial role in determining the overall stability of ionic liquids and their physicochemical properties. Therefore, we performed high-level quantum-chemical study of different cation-anion pairs representing the building units of protic ionic liquids based on triethanolammonium cation and anions of sulfuric, nitric, phosphoric, and phosphorus acids to provide essential insight into these phenomena at the molecular level. It was shown that every structure is stabilized through multiple H bonds between the protons in the N-H and O-H groups of the cation and different oxygen atoms of the anion acid. Using atoms in molecules topological parameters and natural bond orbital analysis, we determined the nature and strength of these interactions. Our calculations suggest that the N-H group of the cation has more proton donor-like character than the O-H group that makes the N-H···O hydrogen bonds stronger. A close relation between the binding energies of these ion pairs and experimental melting points was established: the smaller the absolute value of the binding energy between ions, the lower is the melting point.

  2. PDB-Explorer: a web-based interactive map of the protein data bank in shape space.

    Science.gov (United States)

    Jin, Xian; Awale, Mahendra; Zasso, Michaël; Kostro, Daniel; Patiny, Luc; Reymond, Jean-Louis

    2015-10-23

    The RCSB Protein Data Bank (PDB) provides public access to experimentally determined 3D-structures of biological macromolecules (proteins, peptides and nucleic acids). While various tools are available to explore the PDB, options to access the global structural diversity of the entire PDB and to perceive relationships between PDB structures remain very limited. A 136-dimensional atom pair 3D-fingerprint for proteins (3DP) counting categorized atom pairs at increasing through-space distances was designed to represent the molecular shape of PDB-entries. Nearest neighbor searches examples were reported exemplifying the ability of 3DP-similarity to identify closely related biomolecules from small peptides to enzyme and large multiprotein complexes such as virus particles. The principle component analysis was used to obtain the visualization of PDB in 3DP-space. The 3DP property space groups proteins and protein assemblies according to their 3D-shape similarity, yet shows exquisite ability to distinguish between closely related structures. An interactive website called PDB-Explorer is presented featuring a color-coded interactive map of PDB in 3DP-space. Each pixel of the map contains one or more PDB-entries which are directly visualized as ribbon diagrams when the pixel is selected. The PDB-Explorer website allows performing 3DP-nearest neighbor searches of any PDB-entry or of any structure uploaded as protein-type PDB file. All functionalities on the website are implemented in JavaScript in a platform-independent manner and draw data from a server that is updated daily with the latest PDB additions, ensuring complete and up-to-date coverage. The essentially instantaneous 3DP-similarity search with the PDB-Explorer provides results comparable to those of much slower 3D-alignment algorithms, and automatically clusters proteins from the same superfamilies in tight groups. A chemical space classification of PDB based on molecular shape was obtained using a new atom-pair 3

  3. On magnon mediated Cooper pair formation in ferromagnetic superconductors

    Directory of Open Access Journals (Sweden)

    Rakesh Kar

    2014-08-01

    Full Text Available Identification of pairing mechanism leading to ferromagnetic superconductivity is one of the most challenging issues in condensed matter physics. Although different models have been proposed to explain this phenomenon, a quantitative understanding about this pairing is yet to be achieved. Using the localized-itinerant model, we find that in ferromagnetic superconducting materials both triplet pairing and singlet pairing of electrons are possible through magnon exchange depending upon whether the Debye cut off frequency of magnons is greater or lesser than the Hund's coupling (J multiplied by average spin (S per site. Taking into account the repulsive interaction due to the existence of paramagnons, we also find an expression for effective interaction potential between a pair of electrons with opposite spins. We apply the developed formalism in case of UGe2 and URhGe. The condition of singlet pairing is found to be fulfilled in these cases, as was previously envisaged by Suhl [Suhl, Phys. Rev. Lett. 87, 167007 (2001]. We compute the critical temperatures of URhGe at ambient pressure and of UGe2 under different pressures for the first time through BCS equation. Thus, this work outlines a very simple way to evaluate critical temperature in case of a superconducting system. A close match with the available experimental results strongly supports our theoretical treatment.

  4. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    Science.gov (United States)

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  5. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    Science.gov (United States)

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  6. Dual door entry to exciplex emission in a chimeric DNA duplex containing non-nucleoside-nucleoside pair.

    Science.gov (United States)

    Bag, Subhendu Sekhar; Talukdar, Sangita; Kundu, Rajen; Saito, Isao; Jana, Subhashis

    2014-01-25

    Dual door entry to exciplex formation was established in a chimeric DNA duplex wherein a fluorescent non-nucleosidic base surrogate () is paired against a fluorescent nucleosidic base surrogate (). Packing of the nucleobases via intercalative stacking interactions led to an exciplex emission either via FRET from the donor or direct excitation of the FRET acceptor .

  7. Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

    2012-01-01

    Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

  8. Three-Nucleon Forces and Triplet Pairing in Neutron Matter

    Science.gov (United States)

    Papakonstantinou, P.; Clark, J. W.

    2017-12-01

    The existence of superfluidity of the neutron component in the core of a neutron star, associated specifically with triplet P-wave pairing, is currently an open question that is central to interpretation of the observed cooling curves and other neutron-star observables. Ab initio theoretical calculations aimed at resolving this issue face unique challenges in the relevant high-density domain, which reaches beyond the saturation density of symmetrical nuclear matter. These issues include uncertainties in the three-nucleon (3N) interaction and in the effects of strong short-range correlations—and more generally of in-medium modification of nucleonic self-energies and interactions. A survey of existing solutions of the gap equations in the triplet channel demonstrates that the net impact on the gap magnitude of 3N forces, coupled channels, and mass renormalization shows extreme variation dependent on specific theoretical inputs, in some cases even pointing to the absence of a triplet gap, thus motivating a detailed analysis of competing effects within a well-controlled model. In the present study, we track the effects of the 3N force and in-medium modifications in the representative case of the ^3P_2 channel, based on the Argonne v_{18} two-nucleon (2N) interaction supplemented by 3N interactions of the Urbana IX family. Sensitivity of the results to the input interaction is clearly demonstrated. We point out consistency issues with respect to the simultaneous treatment of 3N forces and in-medium effects, which warrant further investigation. We consider this pilot study as the first step toward a systematic and comprehensive exploration of coupled-channel ^3P F_2 pairing using a broad range of 2N and 3N interactions from the current generation of refined semi-phenomenological models and models derived from chiral effective field theory.

  9. Investigation of the spatial structure and interactions of the genome at sub-kilobase-pair resolution using T2C.

    Science.gov (United States)

    Kolovos, Petros; Brouwer, Rutger W W; Kockx, Christel E M; Lesnussa, Michael; Kepper, Nick; Zuin, Jessica; Imam, A M Ali; van de Werken, Harmen J G; Wendt, Kerstin S; Knoch, Tobias A; van IJcken, Wilfred F J; Grosveld, Frank

    2018-03-01

    Chromosome conformation capture (3C) and its derivatives (e.g., 4C, 5C and Hi-C) are used to analyze the 3D organization of genomes. We recently developed targeted chromatin capture (T2C), an inexpensive method for studying the 3D organization of genomes, interactomes and structural changes associated with gene regulation, the cell cycle, and cell survival and development. Here, we present the protocol for T2C based on capture, describing all experimental steps and bio-informatic tools in full detail. T2C offers high resolution, a large dynamic interaction frequency range and a high signal-to-noise ratio. Its resolution is determined by the resulting fragment size of the chosen restriction enzyme, which can lead to sub-kilobase-pair resolution. T2C's high coverage allows the identification of the interactome of each individual DNA fragment, which makes binning of reads (often used in other methods) basically unnecessary. Notably, T2C requires low sequencing efforts. T2C also allows multiplexing of samples for the direct comparison of multiple samples. It can be used to study topologically associating domains (TADs), determining their position, shape, boundaries, and intra- and inter-domain interactions, as well as the composition of aggregated loops, interactions between nucleosomes, individual transcription factor binding sites, and promoters and enhancers. T2C can be performed by any investigator with basic skills in molecular biology techniques in ∼7-8 d. Data analysis requires basic expertise in bioinformatics and in Linux and Python environments.

  10. A nucleon-pair and boson coexistent description of nuclei

    Science.gov (United States)

    Dai, Lianrong; Pan, Feng; Draayer, J. P.

    2017-07-01

    We study a mixture of s-bosons and like-nucleon pairs with the standard pairing interaction outside an inert core. Competition between the nucleon-pairs and s-bosons is investigated in this scenario. The robustness of the BCS-BEC coexistence and crossover phenomena are examined through an analysis of pf-shell nuclei with realistic single-particle energies, in which two configurations with Pauli blocking of nucleon-pair orbits due to the formation of the s-bosons is taken into account. When the nucleon-pair orbits are considered to be independent of the s-bosons, the BCS-BEC crossover becomes smooth, with the number of the s-bosons noticeably more than that of the nucleon-pairs near the half-shell point, a feature that is demonstrated in the pf-shell for several values of the standard pairing interaction strength. As a further test of the robustness of the BCS-BEC coexistence and crossover phenomena in nuclei, results are given for values of even-even 102-130Sn with 100Sn taken as a core and valence neutron pairs confined within the 1d 5/2, 0g 7/2, 1d 3/2, 2s 1/2, 1h 11/2 orbits in the nucleon-pair orbit and the s-boson independent approximation. The results indicate that the B(E2) values are reproduced well. Supported by National Natural Science Foundation of China (11375080, 11675071), the U.S. National Science Foundation (OCI-0904874 and ACI-1516338), U. S. Department of Energy (DE-SC0005248), the Southeastern Universities Research Association, the China-U. S. Theory Institute for Physics with Exotic Nuclei (CUSTIPEN) (DE-SC0009971), and the LSU-LNNU joint research program (9961) is acknowledged

  11. Pair production of intermediate vector bosons

    International Nuclear Information System (INIS)

    Mikaelian, K.O.

    1979-01-01

    The production of intermediate vector boson pairs W + W - , Z 0 Z 0 , W +- Z 0 and W +- γ in pp and p anti p collisions is discussed. The motivation is to detect the self-interactions among the four intermediate vector bosons

  12. Computational prediction of drug-drug interactions based on drugs functional similarities.

    Science.gov (United States)

    Ferdousi, Reza; Safdari, Reza; Omidi, Yadollah

    2017-06-01

    Therapeutic activities of drugs are often influenced by co-administration of drugs that may cause inevitable drug-drug interactions (DDIs) and inadvertent side effects. Prediction and identification of DDIs are extremely vital for the patient safety and success of treatment modalities. A number of computational methods have been employed for the prediction of DDIs based on drugs structures and/or functions. Here, we report on a computational method for DDIs prediction based on functional similarity of drugs. The model was set based on key biological elements including carriers, transporters, enzymes and targets (CTET). The model was applied for 2189 approved drugs. For each drug, all the associated CTETs were collected, and the corresponding binary vectors were constructed to determine the DDIs. Various similarity measures were conducted to detect DDIs. Of the examined similarity methods, the inner product-based similarity measures (IPSMs) were found to provide improved prediction values. Altogether, 2,394,766 potential drug pairs interactions were studied. The model was able to predict over 250,000 unknown potential DDIs. Upon our findings, we propose the current method as a robust, yet simple and fast, universal in silico approach for identification of DDIs. We envision that this proposed method can be used as a practical technique for the detection of possible DDIs based on the functional similarities of drugs. Copyright © 2017. Published by Elsevier Inc.

  13. Relativistic mean field theory for deformed nuclei with pairing correlations

    International Nuclear Information System (INIS)

    Geng, Lisheng; Toki, Hiroshi; Sugimoto, Satoru; Meng, Jie

    2003-01-01

    We develop a relativistic mean field (RMF) description of deformed nuclei with pairing correlations in the BCS approximation. The treatment of the pairing correlations for nuclei whose Fermi surfaces are close to the threshold of unbound states needs special attention. With this in mind, we use a delta function interaction for the pairing interaction to pick up those states whose wave functions are concentrated in the nuclear region and employ the standard BCS approximation for the single-particle states obtained from the BMF theory with deformation. We apply the RMF + BCS method to the Zr isotopes and obtain a good description of the binding energies and the nuclear radii of nuclei from the proton drip line to the neutron drip line. (author)

  14. Dynamics and Instabilities of Vortex Pairs

    Science.gov (United States)

    Leweke, Thomas; Le Dizès, Stéphane; Williamson, Charles H. K.

    2016-01-01

    This article reviews the characteristics and behavior of counter-rotating and corotating vortex pairs, which are seemingly simple flow configurations yet immensely rich in phenomena. Since the reviews in this journal by Widnall (1975) and Spalart (1998) , who studied the fundamental structure and dynamics of vortices and airplane trailing vortices, respectively, there have been many analytical, computational, and experimental studies of vortex pair flows. We discuss two-dimensional dynamics, including the merging of same-sign vortices and the interaction with the mutually induced strain, as well as three-dimensional displacement and core instabilities resulting from this interaction. Flows subject to combined instabilities are also considered, in particular the impingement of opposite-sign vortices on a ground plane. We emphasize the physical mechanisms responsible for the flow phenomena and clearly present the key results that are useful to the reader for predicting the dynamics and instabilities of parallel vortices.

  15. RETIRED A STARS AND THEIR COMPANIONS. VI. A PAIR OF INTERACTING EXOPLANET PAIRS AROUND THE SUBGIANTS 24 SEXTANIS AND HD 200964

    International Nuclear Information System (INIS)

    Johnson, John Asher; Payne, Matthew; Ford, Eric B.; Howard, Andrew W.; Marcy, Geoffrey W.; Clubb, Kelsey I.; Bowler, Brendan P.; Henry, Gregory W.; Fischer, Debra A.; Brewer, John M.; Schwab, Christian; Reffert, Sabine; Lowe, Thomas B.

    2011-01-01

    We report radial velocity (RV) measurements of the G-type subgiants 24 Sextanis (= HD 90043) and HD 200964. Both are massive, evolved stars that exhibit periodic variations due to the presence of a pair of Jovian planets. Photometric monitoring with the T12 0.80 m APT at Fairborn Observatory demonstrates both stars to be constant in brightness to ≤0.002 mag, thus strengthening the planetary interpretation of the RV variations. Based on our dynamical analysis of the RV time series, 24 Sex b, c have orbital periods of 452.8 days and 883.0 days, corresponding to semimajor axes 1.333 AU and 2.08 AU, and minimum masses 1.99 M Jup and 0.86 M Jup , assuming a stellar mass M * = 1.54 M sun . HD 200964 b, c have orbital periods of 613.8 days and 825.0 days, corresponding to semimajor axes 1.601 AU and 1.95 AU, and minimum masses 1.99 M Jup and 0.90 M Jup , assuming M * = 1.44 M sun . We also carry out dynamical simulations to properly account for gravitational interactions between the planets. Most, if not all, of the dynamically stable solutions include crossing orbits, suggesting that each system is locked in a mean-motion resonance that prevents close encounters and provides long-term stability. The planets in the 24 Sex system likely have a period ratio near 2:1, while the HD 200964 system is even more tightly packed with a period ratio close to 4:3. However, we caution that further RV observations and more detailed dynamical modeling will be required to provide definitive and unique orbital solutions for both cases, and to determine whether the two systems are truly resonant.

  16. Coherent lepton pair production in hadronic heavy ion collisions

    Science.gov (United States)

    Zha, W.; Ruan, L.; Tang, Z.; Xu, Z.; Yang, S.

    2018-06-01

    Recently, significant enhancements of e+e- pair production at very low transverse momentum (pT < 0.15 GeV/c) were observed by the STAR collaboration in peripheral hadronic A+A collisions. This excesses can not be described by the QGP thermal radiation and ρ in-medium broadening calculations. This is a sign of coherent photon-photon interactions, which were conventionally studied only in ultra-peripheral collisions. In this article, we present calculations of lepton pair (e+e- and μ+μ-) production from coherent photon-photon interactions in hadronic A+A collisions at RHIC and LHC energies within the STAR and ALICE acceptance.

  17. Observing Pair-Work Task in an English Speaking Class

    Science.gov (United States)

    Achmad, Diana; Yusuf, Yunisrina Qismullah

    2014-01-01

    This paper reports on students' pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger)…

  18. Protein-protein interaction inference based on semantic similarity of Gene Ontology terms.

    Science.gov (United States)

    Zhang, Shu-Bo; Tang, Qiang-Rong

    2016-07-21

    Identifying protein-protein interactions is important in molecular biology. Experimental methods to this issue have their limitations, and computational approaches have attracted more and more attentions from the biological community. The semantic similarity derived from the Gene Ontology (GO) annotation has been regarded as one of the most powerful indicators for protein interaction. However, conventional methods based on GO similarity fail to take advantage of the specificity of GO terms in the ontology graph. We proposed a GO-based method to predict protein-protein interaction by integrating different kinds of similarity measures derived from the intrinsic structure of GO graph. We extended five existing methods to derive the semantic similarity measures from the descending part of two GO terms in the GO graph, then adopted a feature integration strategy to combines both the ascending and the descending similarity scores derived from the three sub-ontologies to construct various kinds of features to characterize each protein pair. Support vector machines (SVM) were employed as discriminate classifiers, and five-fold cross validation experiments were conducted on both human and yeast protein-protein interaction datasets to evaluate the performance of different kinds of integrated features, the experimental results suggest the best performance of the feature that combines information from both the ascending and the descending parts of the three ontologies. Our method is appealing for effective prediction of protein-protein interaction. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  20. An exact fermion-pair to boson mapping

    International Nuclear Information System (INIS)

    Johnson, C.W.

    1993-01-01

    I derive in a novel fashion exact formulas for the calculation of general matrix elements, including the overlap (norm) matrix, between states constructed from fermion pairs. Mapping the fermion pairs to bosons, I show how to construct finite and exact (in the sense of preserving matrix elements) boson representations of the norm operator and one- and two-fermion operators. This may lead to a microscopic basis for the Interacting Boson Model, as well as new truncation schemes for the nuclear shell model

  1. Molecular structure and interactions of nucleic acid components in nanoparticles: ab initio calculations

    International Nuclear Information System (INIS)

    Rubin, Yu.V.; Belous, L.F.

    2012-01-01

    Self-associates of nucleic acid components (stacking trimers and tetramers of the base pairs of nucleic acids) and short fragments of nucleic acids are nanoparticles (linear sizes of these particles are more than 10 A). Modern quantum-mechanical methods and softwares allow one to perform ab initio calculations of the systems consisting of 150-200 atoms with enough large basis sets (for example, 6-31G * ). The aim of this work is to reveal the peculiarities of molecular and electronic structures, as well as the energy features of nanoparticles of nucleic acid components. We had carried out ab initio calculations of the molecular structure and interactions in the stacking dimer, trimer, and tetramer of nucleic base pairs and in the stacking (TpG)(ApC) dimer and (TpGpC) (ApCpG) trimer of nucleotides, which are small DNA fragments. The performed calculations of molecular structures of dimers and trimers of nucleotide pairs showed that the interplanar distance in the structures studied is equal to 3.2 A on average, and the helical angle in a trimer is approximately equal to 30 o : The distance between phosphor atoms in neighboring chains is 13.1 A. For dimers and trimers under study, we calculated the horizontal interaction energies. The analysis of interplanar distances and angles between nucleic bases and their pairs in the calculated short oligomers of nucleic acid base pairs (stacking dimer, trimer, and tetramer) has been carried out. Studies of interactions in the calculated short oligomers showed a considerable role of the cross interaction in the stabilization of the structures. The contribution of cross interactions to the horizontal interactions grows with the length of an oligomer. Nanoparticle components get electric charges in nanoparticles. Longwave low-intensity bands can appear in the electron spectra of nanoparticles.

  2. Pair correlation of particles in strongly nonideal systems

    International Nuclear Information System (INIS)

    Vaulina, O. S.

    2012-01-01

    A new semiempirical model is proposed for describing the spatial correlation between interacting particles in nonideal systems. The developed model describes the main features in the behavior of the pair correlation function for crystalline structures and can also be used for qualitative and quantitative description of the spatial correlation of particles in strongly nonideal liquid systems. The proposed model is compared with the results of simulation of the pair correlation function.

  3. Some advances in pairing theory

    International Nuclear Information System (INIS)

    Rowe, D.J.

    2001-01-01

    Two advances are reviewed in the application of pairing-force theory in the nuclear shell model. The first exploits a discovery that a wide range of two-nucleon interactions conserve seniority as a good quantum number. As a consequence, the eigenstates of a Hamiltonian with such an interaction belong to irreducible representations of a compact unitary-symplectic group. This makes it possible to extend the simply-solvable models with J=0 pairing forces to a much richer set of models and still obtain states uniquely classified by their seniority and angular momentum quantum numbers. Moreover, many of the low-lying energy levels of such models can be obtained algebraically; in technical terms, the models are in some cases completely solvable and in other cases partially solvable by algebraic methods. The second advance exploits the discovery that, in a coherent state representation, states of good nucleon number can be projected analytically from BCS vacuum and excited quasiparticle states. This makes it possible to perform calculations in a number-projected BCS basis without losing much of the advantage of working of the quasiparticle scheme. (Author)

  4. Multi-pair states in electron–positron pair creation

    Directory of Open Access Journals (Sweden)

    Anton Wöllert

    2016-09-01

    Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  5. Multi-pair states in electron–positron pair creation

    Energy Technology Data Exchange (ETDEWEB)

    Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.

    2016-09-10

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  6. Multi-pair states in electron–positron pair creation

    International Nuclear Information System (INIS)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-01-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  7. Sordaria, a model system to uncover links between meiotic pairing and recombination.

    Science.gov (United States)

    Zickler, Denise; Espagne, Eric

    2016-06-01

    The mycelial fungus Sordaria macrospora was first used as experimental system for meiotic recombination. This review shows that it provides also a powerful cytological system for dissecting chromosome dynamics in wild-type and mutant meioses. Fundamental cytogenetic findings include: (1) the identification of presynaptic alignment as a key step in pairing of homologous chromosomes. (2) The discovery that biochemical complexes that mediate recombination at the DNA level concomitantly mediate pairing of homologs. (3) This pairing process involves not only resolution but also avoidance of chromosomal entanglements and the resolution system includes dissolution of constraining DNA recombination interactions, achieved by a unique role of Mlh1. (4) Discovery that the central components of the synaptonemal complex directly mediate the re-localization of the recombination proteins from on-axis to in-between homologue axis positions. (5) Identification of putative STUbL protein Hei10 as a structure-based signal transduction molecule that coordinates progression and differentiation of recombinational interactions at multiple stages. (6) Discovery that a single interference process mediates both nucleation of the SC and designation of crossover sites, thereby ensuring even spacing of both features. (7) Discovery of local modulation of sister-chromatid cohesion at sites of crossover recombination. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  9. Off-shell pairing correlations from meson-exchange theory of nuclear forces

    International Nuclear Information System (INIS)

    Sedrakian, Armen

    2003-01-01

    We develop a model of off-mass-shell pairing correlations in nuclear systems, which is based on the meson-exchange picture of nuclear interactions. The temporal retardations in the model are generated by the Fock-exchange diagrams. The kernel of the complex gap equation for baryons is related to the in-medium spectral function of mesons, which is evaluated nonperturbatively in the random phase approximation. The model is applied to the low-density neutron matter in neutron star crusts by separating the interaction into a long-range one-pion-exchange component and a short-range component parametrized in terms of Landau Fermi liquid parameters. The resulting Eliashberg-type coupled nonlinear integral equations are solved by an iterative procedure. We find that the self-energies extend to off-shell energies of the order of several tens of MeV. At low energies the damping of the neutron pair correlations due to the coupling to the pionic modes is small, but becomes increasingly important as the energy is increased. We discuss an improved quasiclassical approximation under which the numerical solutions are obtained

  10. Development, Validation and Summative Evaluation of Card Pairing Games for Selected Math 8 Topics

    Directory of Open Access Journals (Sweden)

    Ronald O. Ocampo

    2015-12-01

    Full Text Available Traditional classroom situation where students are taught predominantly of lecture-discussion method put the classroom in a mathophobic atmosphere. Oftentimes, students exposed to this classroom atmosphere lead to math anxiety and eventually hate the subject and the teacher. Addressing this, varied interactive strategies to create an atmosphere of discourse has been developed and promoted. The use of instructional games has been viewed as one strategy that promotes active learning inside the classroom. Instructional games support constructivist learning and social learning. This study is aimed at developing, validating and evaluating card pairing games for specific topics in Math 8. The Research and Development model ( R& D was used. The card pairing games was validated by subject experts and experts in developing games. In evaluating the card pairing games, the Quasi-Experimental Pretest-Posttest design was used. There are six card pairing games developed for specific topics in Math 8; the card pairing game is highly valid based on the result of the validation; Students exposed to card pairing game become more intact (homogeneous; Students exposed to card games enhance academic performance. It is recommended to test the effectiveness of card pairing games to other group of students; Encourage math teachers to use the developed math card pairing games for classroom instruction; Develop other card pairing game for specific topics in math.

  11. Mathematical analysis of endothelial sibling pair cell-cell interactions using time-lapse cinematography data.

    Science.gov (United States)

    Brown, L M; Ryan, U S; Absher, M; Olazabal, B M

    1982-01-01

    The sibling pairs from two different endothelial cell cultures were analysed by time-lapse cinematography. It was shown that wounded and regular (low density seeded) cultures differed in the behaviour patterns of their siblings. The cultures differed most significantly in the minimum interdivision time (IDT) which was 27% lower for the wounded culture. In the wounded culture there was a greater correlation of IDT values between sibling pairs. IDT values recorded both for paired and for unpaired cells were shorter for the wounded than for the regular culture. The mean IDT for unpaired cells was longer than the mean IDT for paired cells in the regular culture. Thus paired cells in the regular culture, had shorter IDTs, but not as short as in the wounded culture. It was significant that in the wounded culture the first generation of siblings were very close (less than 150 microns apart) at division. Overall the behaviour differences between the two cultures resulted in a higher rate of increase in cell numbers, and thus faster repair, of the wounded monolayer.

  12. Personality Traits and Performance in Listening for Minimal Pairs

    Directory of Open Access Journals (Sweden)

    Saemeh Askani

    2017-12-01

    Full Text Available The aim of this study was to compare the performances of EFL learners belonging to various personality groups in listening tests. A group of 30 high school EFL learners were selected for this study. All of them were at low-intermediate level of general English proficiency. Based on Myers-Briggs Type Indicator (MBTI personality questionnaire (2017, these participants were classified into four pairs of contrasting personality groups. The analysis of the participants‟ personality types was conducted online and took about twenty minutes. Then, they took a test of listening for minimal pairs. Scores of contrasting personality groups were compared with each other by running four paired t-tests. Results obtained by these t-tests showed that intuitive participants outperformed sensing ones, and perceiving participants outperformed judging ones in the listening test. No significant difference was found between the performances of contrasting personality groups in the two pairs of extrovert/introvert and thinking/feeling. Flexibility, adaptability, and being open to a larger set of options are suggested to be possible reasons behind the success of these groups. However, the influence of large set of interacting factors that might have a significant impact on the performance of people in listening test cannot be denied. Depending on the type of listening test, some of these factors might play a more significant role compared to other competing factors.

  13. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    Science.gov (United States)

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

  14. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    Science.gov (United States)

    2011-01-01

    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  15. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

  16. Using full configuration interaction quantum Monte Carlo in a seniority zero space to investigate the correlation energy equivalence of pair coupled cluster doubles and doubly occupied configuration interaction

    International Nuclear Information System (INIS)

    Shepherd, James J.; Henderson, Thomas M.; Scuseria, Gustavo E.

    2016-01-01

    Over the past few years, pair coupled cluster doubles (pCCD) has shown promise for the description of strong correlation. This promise is related to its apparent ability to match results from doubly occupied configuration interaction (DOCI), even though the latter method has exponential computational cost. Here, by modifying the full configuration interaction quantum Monte Carlo algorithm to sample only the seniority zero sector of Hilbert space, we show that the DOCI and pCCD energies are in agreement for a variety of 2D Hubbard models, including for systems well out of reach for conventional configuration interaction algorithms. Our calculations are aided by the sign problem being much reduced in the seniority zero space compared with the full space. We present evidence for this and then discuss the sign problem in terms of the wave function of the system which appears to have a simplified sign structure.

  17. Formation of Singlet Fermion Pairs in the Dilute Gas of Boson-Fermion Mixture

    Directory of Open Access Journals (Sweden)

    Minasyan V.

    2010-10-01

    Full Text Available We argue the formation of a free neutron spinless pairs in a liquid helium -dilute neutron gas mixture. We show that the term, of the interaction between the excitations of the Bose gas and the density modes of the neutron, meditate an attractive interaction via the neutron modes, which in turn leads to a bound state on a spinless neutron pair. Due to presented theoretical approach, we prove that the electron pairs in superconductivity could be discovered by Frölich earlier then it was made by the Cooper.

  18. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    International Nuclear Information System (INIS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-01-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

  19. Suppression of bremsstrahlung and pair production due to environmental factors

    International Nuclear Information System (INIS)

    Klein, Spencer

    1999-01-01

    The environment in which bremsstrahlung and pair creation occurs can strongly affect cross sections for these processes. Because ultrarelativistic electromagnetic interactions involve very small longitudinal momentum transfers, the reactions occur gradually, spread over long distances. During this time, even relatively weak factors can accumulate enough to disrupt the interaction. In the Landau-Pomeranchuk-Migdal effect, multiple scattering reduces the bremsstrahlung and pair production cross section. This review will discuss this and a variety of other factors that can suppress bremsstrahlung and pair production, as well as related effects involving beamstrahlung and QCD processes. After surveying different theoretical approaches, experimental measurements will be covered. Recent accurate measurements by the SLAC E-146 Collaboration will be highlighted, along with several recent theoretical works relating to the experiment. (c) 1999 The American Physical Society

  20. A finite range pairing force for density functional theory in superfluid nuclei

    International Nuclear Information System (INIS)

    Tian, Y.; Ma, Z.Y.; Ring, P.

    2009-01-01

    The problem of pairing in the 1 S 0 channel of finite nuclei is revisited. In nuclear matter forces of separable form can be adjusted to the bare nuclear force, to any phenomenological pairing interaction such as the Gogny force or to exact solutions of the gap equation. In finite nuclei, because of translational invariance, such forces are no longer separable. Using well-known techniques of Talmi and Moshinsky we expand the matrix elements in a series of separable terms, which converges quickly preserving translational invariance and finite range. In this way the complicated problem of a cut-off at large momenta or energies inherent in other separable or zero range pairing forces is avoided. Applications in the framework of the relativistic Hartree-Bogoliubov approach show that the pairing properties are depicted on almost the same footing as by the original pairing interaction not only in nuclear matter, but also in finite nuclei. This simple separable force can be easily applied for the investigation of pairing properties in nuclei far from stability as well as for further investigations going beyond mean field theory.

  1. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang

    2011-08-01

    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  2. Ferromagnetic pairing states on two-coupled chains

    International Nuclear Information System (INIS)

    Tanaka, Akinori

    2008-01-01

    We propose a concrete model which exhibits ferromagnetism and electron-pair condensation simultaneously. The model is defined on two chains and consists of the electron hopping term, the on-site Coulomb repulsion and a ferromagnetic interaction which describes ferromagnetic coupling between two electrons, one on a bond in a chain and the other on a site in the other chain. It is rigorously shown that the model has fully-polarized ferromagnetic pairing ground states. The higher dimensional version of the model is also presented

  3. Vision-based interaction

    CERN Document Server

    Turk, Matthew

    2013-01-01

    In its early years, the field of computer vision was largely motivated by researchers seeking computational models of biological vision and solutions to practical problems in manufacturing, defense, and medicine. For the past two decades or so, there has been an increasing interest in computer vision as an input modality in the context of human-computer interaction. Such vision-based interaction can endow interactive systems with visual capabilities similar to those important to human-human interaction, in order to perceive non-verbal cues and incorporate this information in applications such

  4. Probing the Selectivity and Protein•Protein Interactions of a Non-Reducing Fungal Polyketide Synthase Using Mechanism-Based Crosslinkers

    Science.gov (United States)

    Bruegger, Joel; Haushalter, Bob; Vagstad, Anna; Shakya, Gaurav; Mih, Nathan; Townsend, Craig A.; Burkart, Michael D.; Tsai, Shiou-Chuan

    2013-01-01

    SUMMARY Protein•protein interactions, which often involve interactions between an acyl carrier protein (ACP) and its partner enzymes, are important for coordinating polyketide biosynthesis. However, the nature of such interactions is not well understood, especially in the fungal non-reducing polyketide synthases (NR-PKSs) that biosynthesize toxic and pharmaceutically important polyketides. Here, we employ a mechanism-based crosslinker to successfully probe ACP and ketosynthase (KS) domain interactions in NR-PKSs. We found that crosslinking efficiency is closely correlated with the strength of ACP•KS interactions, and that KS demonstrates strong starter unit selectivity. We further identified positively charged surface residues by KS mutagenesis, which mediate key interactions with the negatively-charged ACP surface. Such complementary/matching contact pairs can serve as “adapter surfaces” for future efforts to generate new polyketides using NR-PKSs. PMID:23993461

  5. Pair interactions in polyelectrolyte-nanoparticle systems: Influence of dielectric inhomogeneities and the partial dissociation of polymers and nanoparticles

    International Nuclear Information System (INIS)

    Pryamitsyn, Victor; Ganesan, Venkat

    2015-01-01

    We study the effective pair interactions between two charged spherical particles in polyelectrolyte solutions using polymer self-consistent field theory. In a recent study [V. Pryamitsyn and V. Ganesan, Macromolecules 47, 6095 (2015)], we considered a model in which the particles possess fixed charge density, the polymers contain a prespecified amount of dissociated charges and, the dielectric constant of the solution was assumed to be homogeneous in space and independent of the polymer concentration. In this article, we present results extending our earlier model to study situations in which either or both the particle and the polymers possess partially dissociable groups. Additionally, we also consider the case when the dielectric constant of the solution depends on the local concentration of the polymers and when the particle’s dielectric constant is lower than that of the solvent. For each case, we quantify the polymer-mediated interactions between the particles as a function of the polymer concentrations and the degree of dissociation of the polymer and particles. Consistent with the results of our previous study, we observe that the polymer-mediated interparticle interactions consist of a short-range attraction and a long-range repulsion. The partial dissociablity of the polymer and particles was seen to have a strong influence on the strength of the repulsive portion of the interactions. Rendering the dielectric permittivity to be inhomogeneous has an even stronger effect on the repulsive interactions and results in changes to the qualitative nature of interactions in some parametric ranges

  6. Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

    International Nuclear Information System (INIS)

    Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia

    2014-01-01

    The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

  7. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  8. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    Science.gov (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. The Radical Pair Mechanism and the Avian Chemical Compass: Quantum Coherence and Entanglement

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yiteng [Purdue Univ., West Lafayette, IN (United States); Kais, Sabre [Purdue Univ., West Lafayette, IN (United States); Berman, Gennady Petrovich [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-02-02

    We review the spin radical pair mechanism which is a promising explanation of avian navigation. This mechanism is based on the dependence of product yields on 1) the hyperfine interaction involving electron spins and neighboring nuclear spins and 2) the intensity and orientation of the geomagnetic field. One surprising result is that even at ambient conditions quantum entanglement of electron spins can play an important role in avian magnetoreception. This review describes the general scheme of chemical reactions involving radical pairs generated from singlet and triplet precursors; the spin dynamics of the radical pairs; and the magnetic field dependence of product yields caused by the radical pair mechanism. The main part of the review includes a description of the chemical compass in birds. We review: the general properties of the avian compass; the basic scheme of the radical pair mechanism; the reaction kinetics in cryptochrome; quantum coherence and entanglement in the avian compass; and the effects of noise. We believe that the quantum avian compass can play an important role in avian navigation and can also provide the foundation for a new generation of sensitive and selective magnetic-sensing nano-devices.

  10. Construction of high-dimensional neural network potentials using environment-dependent atom pairs.

    Science.gov (United States)

    Jose, K V Jovan; Artrith, Nongnuch; Behler, Jörg

    2012-05-21

    An accurate determination of the potential energy is the crucial step in computer simulations of chemical processes, but using electronic structure methods on-the-fly in molecular dynamics (MD) is computationally too demanding for many systems. Constructing more efficient interatomic potentials becomes intricate with increasing dimensionality of the potential-energy surface (PES), and for numerous systems the accuracy that can be achieved is still not satisfying and far from the reliability of first-principles calculations. Feed-forward neural networks (NNs) have a very flexible functional form, and in recent years they have been shown to be an accurate tool to construct efficient PESs. High-dimensional NN potentials based on environment-dependent atomic energy contributions have been presented for a number of materials. Still, these potentials may be improved by a more detailed structural description, e.g., in form of atom pairs, which directly reflect the atomic interactions and take the chemical environment into account. We present an implementation of an NN method based on atom pairs, and its accuracy and performance are compared to the atom-based NN approach using two very different systems, the methanol molecule and metallic copper. We find that both types of NN potentials provide an excellent description of both PESs, with the pair-based method yielding a slightly higher accuracy making it a competitive alternative for addressing complex systems in MD simulations.

  11. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

    Science.gov (United States)

    Mokhtari, D.; Fellah, M.; Allal, N. H.

    2016-05-01

    A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

  13. Quantum fluctuations in the competition among spin glass, antiferromagnetism and local pairing superconductivity

    International Nuclear Information System (INIS)

    Magalhaes, S.G.; Zimmer, F.M.; Kipper, C.J.; Calegari, E.J.

    2007-01-01

    The competition among spin glass (SG), antiferromagnetism (AF) and local pairing superconductivity (PAIR) is studied in a two-sublattice fermionic Ising SG model with a local BCS pairing interaction in the presence of a transverse magnetic field Γ. The spins in different sublattices interact with Gaussian random couplings with an antiferromagnetic mean. The problem is formulated in a Grassmann path integral formalism. The static ansatz and the replica symmetry are used to obtain the half-filling thermodynamic potential. The results are shown in phase diagrams that exhibit a complex transition line separating the PAIR phase from the others. This line is second order at high temperature which ends in a tricritical point. The presence of Γ affects deeply the transition lines

  14. Superconducting properties of the η-pairing state in the Penson-Kolb-Hubbard model

    International Nuclear Information System (INIS)

    Czart, W.R.; Robaszkiewicz, S.

    2004-01-01

    The Penson-Kolb-Hubbard model, i.e. the Hubbard model with the pair-hopping interaction J is studied. We focus on the properties of the superconducting state with the Cooper-pair center-of mass momentum q Q(η-phase). The transition into the η-phase, which is favorized by the repulsive J (J c |, dependent on band filling, on-site interaction U and band structure, and the system never exhibits standard BCS-like features. This is in obvious contrast with the properties of the isotropic s-wave state, stabilized by the attractive J and attractive U, which exhibit at T = 0 a smooth crossover from the BCS-like limit to that of tightly bound pairs with increasing pairing strength. (author)

  15. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  16. Enhanced pairing susceptibility in a photodoped two-orbital Hubbard model

    Science.gov (United States)

    Werner, Philipp; Strand, Hugo U. R.; Hoshino, Shintaro; Murakami, Yuta; Eckstein, Martin

    2018-04-01

    Local spin fluctuations provide the glue for orbital-singlet spin-triplet pairing in the doped Mott insulating regime of multiorbital Hubbard models. At large Hubbard repulsion U , the pairing susceptibility is nevertheless tiny because the pairing interaction cannot overcome the suppression of charge fluctuations. Using nonequilibrium dynamical mean field simulations of the two-orbital Hubbard model, we show that out of equilibrium the pairing susceptibility in this large-U regime can be strongly enhanced by creating a photoinduced population of the relevant charge states. This enhancement is supported by the long lifetime of photodoped charge carriers and a built-in cooling mechanism in multiorbital Hubbard systems.

  17. Question presentation methods for paired-associate learning

    NARCIS (Netherlands)

    Engel, F.L.; Geerings, M.P.W.

    1988-01-01

    Four different methods of question presentation, in interactive computeraided learning of Dutch-English word pairs are evaluated experimentally. These methods are: 1) the 'open-question method', 2) the 'multiple-choice method', 3) the 'sequential method' and 4) the 'true/ false method'. When

  18. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Ab initio O(N) elongation-counterpoise method for BSSE-corrected interaction energy analyses in biosystems

    Energy Technology Data Exchange (ETDEWEB)

    Orimoto, Yuuichi; Xie, Peng; Liu, Kai [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Yamamoto, Ryohei [Department of Molecular and Material Sciences, Interdisciplinary Graduate School of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Imamura, Akira [Hiroshima Kokusai Gakuin University, 6-20-1 Nakano, Aki-ku, Hiroshima 739-0321 (Japan); Aoki, Yuriko, E-mail: aoki.yuriko.397@m.kyushu-u.ac.jp [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012 (Japan)

    2015-03-14

    An Elongation-counterpoise (ELG-CP) method was developed for performing accurate and efficient interaction energy analysis and correcting the basis set superposition error (BSSE) in biosystems. The method was achieved by combining our developed ab initio O(N) elongation method with the conventional counterpoise method proposed for solving the BSSE problem. As a test, the ELG-CP method was applied to the analysis of the DNAs’ inter-strands interaction energies with respect to the alkylation-induced base pair mismatch phenomenon that causes a transition from G⋯C to A⋯T. It was found that the ELG-CP method showed high efficiency (nearly linear-scaling) and high accuracy with a negligibly small energy error in the total energy calculations (in the order of 10{sup −7}–10{sup −8} hartree/atom) as compared with the conventional method during the counterpoise treatment. Furthermore, the magnitude of the BSSE was found to be ca. −290 kcal/mol for the calculation of a DNA model with 21 base pairs. This emphasizes the importance of BSSE correction when a limited size basis set is used to study the DNA models and compare small energy differences between them. In this work, we quantitatively estimated the inter-strands interaction energy for each possible step in the transition process from G⋯C to A⋯T by the ELG-CP method. It was found that the base pair replacement in the process only affects the interaction energy for a limited area around the mismatch position with a few adjacent base pairs. From the interaction energy point of view, our results showed that a base pair sliding mechanism possibly occurs after the alkylation of guanine to gain the maximum possible number of hydrogen bonds between the bases. In addition, the steps leading to the A⋯T replacement accompanied with replications were found to be unfavorable processes corresponding to ca. 10 kcal/mol loss in stabilization energy. The present study indicated that the ELG-CP method is promising for

  20. 3D2 pairing in asymmetric nuclear matter

    International Nuclear Information System (INIS)

    Alm, T.

    1996-01-01

    The superfluid 3 D 2 pairing instability in isospin-asymmetric nuclear matter is studied, using the Paris nucleon-nucleon interaction as an input. It is found that the critical temperature associated with the transition to the superfluid phase becomes strongly suppressed with increasing isospin asymmetry, and vanishes for asymmetry parameter values α (≡(n n -n p )/(n n +n p )) that are larger than several percent. It is shown that for neutron star models based on relativistic, field-theoretical equations of state, a large fraction of their interior may exist in a 3 D 2 -paired superfluid phase. The implications of such a 3 D 2 superfluid in massive neutron stars is discussed with respect to observable pulsar phenomena. Another interesting phenomenon, discussed in the paper, concerns the numerical finding of two critical superfluid temperatures for a given density in the case of isospin-asymmetric matter. Using the BCS cut-off ansatz, a mathematical expression for the critical temperature is derived which confirms this finding analytically. (orig.)

  1. Binding of the biogenic polyamines to deoxyribonucleic acids of varying base composition: base specificity and the associated energetics of the interaction.

    Science.gov (United States)

    Kabir, Ayesha; Suresh Kumar, Gopinatha

    2013-01-01

    The thermodynamics of the base pair specificity of the binding of the polyamines spermine, spermidine, putrescine, and cadaverine with three genomic DNAs Clostridium perfringens, 27% GC, Escherichia coli, 50% GC and Micrococcus lysodeikticus, 72% GC have been studied using titration calorimetry and the data supplemented with melting studies, ethidium displacement and circular dichroism spectroscopy results. Isothermal titration calorimetry, differential scanning calorimetry, optical melting studies, ethidium displacement, circular dichroism spectroscopy are the various techniques employed to characterize the interaction of four polyamines, spermine, spermidine, putersine and cadaverine with the DNAs. Polyamines bound stronger with AT rich DNA compared to the GC rich DNA and the binding varied depending on the charge on the polyamine as spermine>spermidine >putrescine>cadaverine. Thermodynamics of the interaction revealed that the binding was entropy driven with small enthalpy contribution. The binding was influenced by salt concentration suggesting the contribution from electrostatic forces to the Gibbs energy of binding to be the dominant contributor. Each system studied exhibited enthalpy-entropy compensation. The negative heat capacity changes suggested a role for hydrophobic interactions which may arise due to the non polar interactions between DNA and polyamines. From a thermodynamic analysis, the AT base specificity of polyamines to DNAs has been elucidated for the first time and supplemented by structural studies.

  2. Pair truncation for rotational nuclei: j=17/2 model

    International Nuclear Information System (INIS)

    Halse, P.; Jaqua, L.; Barrett, B.R.

    1989-01-01

    The suitability of the pair condensate approach for rotational states is studied in a single j=17/2 shell of identical nucleons interacting through a quadrupole-quadrupole Hamiltonian. The ground band and a K=2 excited band are both studied in detail. A direct comparison of the exact states with those constituting the SD and SDG subspaces is used to identify the important degrees of freedom for these levels. The range of pairs necessary for a good description is found to be highly state dependent; S and D pairs are the major constituents of the low-spin ground-band levels, while G pairs are needed for those in the γ band. Energy spectra are obtained for each truncated subspace. SDG pairs allow accurate reproduction of the binding energy and K=2 excitation energy, but still give a moment of inertia which is about 30% too small even for the lowest levels

  3. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.

    2006-01-01

    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  4. Determination of constants of factorized pairing force from conservation laws

    International Nuclear Information System (INIS)

    Voronkov, Yu.P.; Mikhajlov, V.M.

    1975-01-01

    The constants of a factorized interaction in the particle-particle channel are evaluated on the basis of average field parameters and Cooper pairing. The relations between the constants of multipole particle-particle forces are derived for the spherical nuclei. The constants of the quadrupole pairing are obtained for deformed nuclei from the angular momentum conservation law. The calculated constants are compared with empiricalones

  5. Fermion pair physics at LEP2

    International Nuclear Information System (INIS)

    Georgios, Anagnostou

    2004-01-01

    Combined measurements of the 4 LEP collaborations for the fermion pair processes e + e - →f anti f are presented. The results show no significant deviations when compared with the Standard Model predictions and are used to set limits on contact interactions, Z' gauge bosons and low scale gravity models with large extra dimensions. (orig.)

  6. Matched molecular pair-based data sets for computer-aided medicinal chemistry

    Science.gov (United States)

    Bajorath, Jürgen

    2014-01-01

    Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

  7. Inhomogeneous ensembles of radical pairs in chemical compasses

    Science.gov (United States)

    Procopio, Maria; Ritz, Thorsten

    2016-11-01

    The biophysical basis for the ability of animals to detect the geomagnetic field and to use it for finding directions remains a mystery of sensory biology. One much debated hypothesis suggests that an ensemble of specialized light-induced radical pair reactions can provide the primary signal for a magnetic compass sensor. The question arises what features of such a radical pair ensemble could be optimized by evolution so as to improve the detection of the direction of weak magnetic fields. Here, we focus on the overlooked aspect of the noise arising from inhomogeneity of copies of biomolecules in a realistic biological environment. Such inhomogeneity leads to variations of the radical pair parameters, thereby deteriorating the signal arising from an ensemble and providing a source of noise. We investigate the effect of variations in hyperfine interactions between different copies of simple radical pairs on the directional response of a compass system. We find that the choice of radical pair parameters greatly influences how strongly the directional response of an ensemble is affected by inhomogeneity.

  8. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  9. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  11. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

    Science.gov (United States)

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

    2017-09-01

    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Modification of the isotope effect due to pair breaking

    International Nuclear Information System (INIS)

    Carbotte, J.P.; Greeson, M.; Perez-Gonzalez, A.

    1991-01-01

    We have calculated the effect of pair breaking on the isotope-effect coefficient (β) of a superconductor. We find that, as the pair-breaking scattering rate is increased, β also increases in absolute value. Values of β much larger than the canonical value of 1/2 can easily be achieved even in models where the electron-phonon interaction contributes only a very small amount to the value of the intrinsic critical temperature

  13. Prediction and characterization of protein-protein interaction networks in swine

    Directory of Open Access Journals (Sweden)

    Wang Fen

    2012-01-01

    Full Text Available Abstract Background Studying the large-scale protein-protein interaction (PPI network is important in understanding biological processes. The current research presents the first PPI map of swine, which aims to give new insights into understanding their biological processes. Results We used three methods, Interolog-based prediction of porcine PPI network, domain-motif interactions from structural topology-based prediction of porcine PPI network and motif-motif interactions from structural topology-based prediction of porcine PPI network, to predict porcine protein interactions among 25,767 porcine proteins. We predicted 20,213, 331,484, and 218,705 porcine PPIs respectively, merged the three results into 567,441 PPIs, constructed four PPI networks, and analyzed the topological properties of the porcine PPI networks. Our predictions were validated with Pfam domain annotations and GO annotations. Averages of 70, 10,495, and 863 interactions were related to the Pfam domain-interacting pairs in iPfam database. For comparison, randomized networks were generated, and averages of only 4.24, 66.79, and 44.26 interactions were associated with Pfam domain-interacting pairs in iPfam database. In GO annotations, we found 52.68%, 75.54%, 27.20% of the predicted PPIs sharing GO terms respectively. However, the number of PPI pairs sharing GO terms in the 10,000 randomized networks reached 52.68%, 75.54%, 27.20% is 0. Finally, we determined the accuracy and precision of the methods. The methods yielded accuracies of 0.92, 0.53, and 0.50 at precisions of about 0.93, 0.74, and 0.75, respectively. Conclusion The results reveal that the predicted PPI networks are considerably reliable. The present research is an important pioneering work on protein function research. The porcine PPI data set, the confidence score of each interaction and a list of related data are available at (http://pppid.biositemap.com/.

  14. DTFP-Growth: Dynamic Threshold-Based FP-Growth Rule Mining Algorithm Through Integrating Gene Expression, Methylation, and Protein-Protein Interaction Profiles.

    Science.gov (United States)

    Mallik, Saurav; Bhadra, Tapas; Mukherji, Ayan; Mallik, Saurav; Bhadra, Tapas; Mukherji, Ayan; Mallik, Saurav; Bhadra, Tapas; Mukherji, Ayan

    2018-04-01

    Association rule mining is an important technique for identifying interesting relationships between gene pairs in a biological data set. Earlier methods basically work for a single biological data set, and, in maximum cases, a single minimum support cutoff can be applied globally, i.e., across all genesets/itemsets. To overcome this limitation, in this paper, we propose dynamic threshold-based FP-growth rule mining algorithm that integrates gene expression, methylation and protein-protein interaction profiles based on weighted shortest distance to find the novel associations among different pairs of genes in multi-view data sets. For this purpose, we introduce three new thresholds, namely, Distance-based Variable/Dynamic Supports (DVS), Distance-based Variable Confidences (DVC), and Distance-based Variable Lifts (DVL) for each rule by integrating co-expression, co-methylation, and protein-protein interactions existed in the multi-omics data set. We develop the proposed algorithm utilizing these three novel multiple threshold measures. In the proposed algorithm, the values of , , and are computed for each rule separately, and subsequently it is verified whether the support, confidence, and lift of each evolved rule are greater than or equal to the corresponding individual , , and values, respectively, or not. If all these three conditions for a rule are found to be true, the rule is treated as a resultant rule. One of the major advantages of the proposed method compared with other related state-of-the-art methods is that it considers both the quantitative and interactive significance among all pairwise genes belonging to each rule. Moreover, the proposed method generates fewer rules, takes less running time, and provides greater biological significance for the resultant top-ranking rules compared to previous methods.

  15. The social-devaluation effect: Interactive evaluation deteriorates likeability of objects based on daily relationship

    Directory of Open Access Journals (Sweden)

    Atsunori eAriga

    2015-01-01

    Full Text Available Although previous research has explored the effects of discussion on optimal and collective group outcomes, it is unclear how an individual's preference for an object is modulated by discussion with others. This study investigated the determinants of likeability ratings under two conditions. In Experiment 1, pairs of participants consisting of friends evaluated various photographic images. Under the interactive condition, the participants discussed their impressions of each image for 30 seconds and then independently rated how much they liked it. Under the non-interactive condition, the participants did not interact with each other but instead only thought about their impressions of each image for 30 seconds before rating its likeability. The results indicate that the exchange of impressions between the participants affected the individual likeability ratings of objects. More specifically, the interactive participants generally rated the images as less likeable than did the non-interactive participants (social-devaluation effect. However, in Experiment 2, the effect was eliminated when the pairs consisted of strangers. These findings suggest that shared information modulates individual preferences but only when a daily relationship exists within a group.

  16. It's not just lunch: extra-pair commensality can trigger sexual jealousy.

    Directory of Open Access Journals (Sweden)

    Kevin M Kniffin

    Full Text Available Do people believe that sharing food might involve sharing more than just food? To investigate this, participants were asked to rate how jealous they (Study 1--or their best friend (Study 2--would be if their current romantic partner were contacted by an ex-romantic partner and subsequently engaged in an array of food- and drink-based activities. We consistently find--across both men and women--that meals elicit more jealousy than face-to-face interactions that do not involve eating, such as having coffee. These findings suggest that people generally presume that sharing a meal enhances cooperation. In the context of romantic pairs, we find that participants are attuned to relationship risks that extra-pair commensality can present. For romantic partners left out of a meal, we find a common view that lunch, for example, is not "just lunch."

  17. It's not just lunch: extra-pair commensality can trigger sexual jealousy.

    Science.gov (United States)

    Kniffin, Kevin M; Wansink, Brian

    2012-01-01

    Do people believe that sharing food might involve sharing more than just food? To investigate this, participants were asked to rate how jealous they (Study 1)--or their best friend (Study 2)--would be if their current romantic partner were contacted by an ex-romantic partner and subsequently engaged in an array of food- and drink-based activities. We consistently find--across both men and women--that meals elicit more jealousy than face-to-face interactions that do not involve eating, such as having coffee. These findings suggest that people generally presume that sharing a meal enhances cooperation. In the context of romantic pairs, we find that participants are attuned to relationship risks that extra-pair commensality can present. For romantic partners left out of a meal, we find a common view that lunch, for example, is not "just lunch."

  18. Cytoplasmic and Genomic Effects on Meiotic Pairing in Brassica Hybrids and Allotetraploids from Pair Crosses of Three Cultivated Diploids

    Science.gov (United States)

    Cui, Cheng; Ge, Xianhong; Gautam, Mayank; Kang, Lei; Li, Zaiyun

    2012-01-01

    Interspecific hybridization and allopolyploidization contribute to the origin of many important crops. Synthetic Brassica is a widely used model for the study of genetic recombination and “fixed heterosis” in allopolyploids. To investigate the effects of the cytoplasm and genome combinations on meiotic recombination, we produced digenomic diploid and triploid hybrids and trigenomic triploid hybrids from the reciprocal crosses of three Brassica diploids (B. rapa, AA; B. nigra, BB; B. oleracea, CC). The chromosomes in the resultant hybrids were doubled to obtain three allotetraploids (B. juncea, AA.BB; B. napus, AA.CC; B. carinata, BB.CC). Intra- and intergenomic chromosome pairings in these hybrids were quantified using genomic in situ hybridization and BAC-FISH. The level of intra- and intergenomic pairings varied significantly, depending on the genome combinations and the cytoplasmic background and/or their interaction. The extent of intragenomic pairing was less than that of intergenomic pairing within each genome. The extent of pairing variations within the B genome was less than that within the A and C genomes, each of which had a similar extent of pairing. Synthetic allotetraploids exhibited nondiploidized meiotic behavior, and their chromosomal instabilities were correlated with the relationship of the genomes and cytoplasmic background. Our results highlight the specific roles of the cytoplasm and genome to the chromosomal behaviors of hybrids and allopolyploids. PMID:22505621

  19. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

    2013-01-01

    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  20. Rootletin interacts with C-Nap1 and may function as a physical linker between the pair of centrioles/basal bodies in cells.

    Science.gov (United States)

    Yang, Jun; Adamian, Michael; Li, Tiansen

    2006-02-01

    Rootletin, a major structural component of the ciliary rootlet, is located at the basal bodies and centrosomes in ciliated and nonciliated cells, respectively. Here we investigated its potential role in the linkage of basal bodies/centrioles and the mechanism involved in such linkages. We show that rootletin interacts with C-Nap1, a protein restricted at the ends of centrioles and functioning in centrosome cohesion in interphase cells. Their interaction in vivo is supported by their colocalization at the basal bodies/centrioles and coordinated association with the centrioles during the cell cycle. Ultrastructural examinations demonstrate that rootletin fibers connect the basal bodies in ciliated cells and are present both at the ends of and in between the pair of centrioles in nonciliated cells. The latter finding stands in contrast with C-Nap1, which is present only at the ends of the centrioles. Transient expression of C-Nap1 fragments dissociated rootletin fibers from the centrioles, resulting in centrosome separation in interphase. Overexpression of rootletin in cells caused multinucleation, micronucleation, and irregularity of nuclear shape and size, indicative of defects in chromosome separation. These data suggest that rootletin may function as a physical linker between the pair of basal bodies/centrioles by binding to C-Nap1.

  1. Cation-π interactions in structural biology

    OpenAIRE

    Gallivan, Justin P.; Dougherty, Dennis A.

    1999-01-01

    Cation-pi interactions in protein structures are identified and evaluated by using an energy-based criterion for selecting significant sidechain pairs. Cation-pi interactions are found to be common among structures in the Protein Data Bank, and it is clearly demonstrated that, when a cationic sidechain (Lys or Arg) is near an aromatic sidechain (Phe, Tyr, or Trp), the geometry is biased toward one that would experience a favorable cation-pi interaction. The sidechain of Arg is more likely tha...

  2. Evaluation of several two-step scoring functions based on linear interaction energy, effective ligand size, and empirical pair potentials for prediction of protein-ligand binding geometry and free energy.

    Science.gov (United States)

    Rahaman, Obaidur; Estrada, Trilce P; Doren, Douglas J; Taufer, Michela; Brooks, Charles L; Armen, Roger S

    2011-09-26

    The performances of several two-step scoring approaches for molecular docking were assessed for their ability to predict binding geometries and free energies. Two new scoring functions designed for "step 2 discrimination" were proposed and compared to our CHARMM implementation of the linear interaction energy (LIE) approach using the Generalized-Born with Molecular Volume (GBMV) implicit solvation model. A scoring function S1 was proposed by considering only "interacting" ligand atoms as the "effective size" of the ligand and extended to an empirical regression-based pair potential S2. The S1 and S2 scoring schemes were trained and 5-fold cross-validated on a diverse set of 259 protein-ligand complexes from the Ligand Protein Database (LPDB). The regression-based parameters for S1 and S2 also demonstrated reasonable transferability in the CSARdock 2010 benchmark using a new data set (NRC HiQ) of diverse protein-ligand complexes. The ability of the scoring functions to accurately predict ligand geometry was evaluated by calculating the discriminative power (DP) of the scoring functions to identify native poses. The parameters for the LIE scoring function with the optimal discriminative power (DP) for geometry (step 1 discrimination) were found to be very similar to the best-fit parameters for binding free energy over a large number of protein-ligand complexes (step 2 discrimination). Reasonable performance of the scoring functions in enrichment of active compounds in four different protein target classes established that the parameters for S1 and S2 provided reasonable accuracy and transferability. Additional analysis was performed to definitively separate scoring function performance from molecular weight effects. This analysis included the prediction of ligand binding efficiencies for a subset of the CSARdock NRC HiQ data set where the number of ligand heavy atoms ranged from 17 to 35. This range of ligand heavy atoms is where improved accuracy of predicted ligand

  3. EM Transition Sum Rules Within the Framework of sdg Proton-Neutron Interacting Boson Model, Nuclear Pair Shell Model and Fermion Dynamical Symmetry Model

    Science.gov (United States)

    Zhao, Yumin

    1997-07-01

    By the techniques of the Wick theorem for coupled clusters, the no-energy-weighted electromagnetic sum-rule calculations are presented in the sdg neutron-proton interacting boson model, the nuclear pair shell model and the fermion-dynamical symmetry model. The project supported by Development Project Foundation of China, National Natural Science Foundation of China, Doctoral Education Fund of National Education Committee, Fundamental Research Fund of Southeast University

  4. Presenting using Two-Handed Interaction in Open Space

    NARCIS (Netherlands)

    Vlaming, Luc; Smit, Jasper; Isenberg, Tobias

    2008-01-01

    Based on recent demonstrations of low-cost, infrared-based point tracking, we explore two-handed, surface-less interaction for presentation. On both hands, thumb and index finger are equipped with retro-reflective markers which are tracked by a Wiimote. We contribute a robust finger pairing and

  5. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    International Nuclear Information System (INIS)

    Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R

    2011-01-01

    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively

  6. Utilizing knowledge base of amino acids structural neighborhoods to predict protein-protein interaction sites.

    Science.gov (United States)

    Jelínek, Jan; Škoda, Petr; Hoksza, David

    2017-12-06

    Protein-protein interactions (PPI) play a key role in an investigation of various biochemical processes, and their identification is thus of great importance. Although computational prediction of which amino acids take part in a PPI has been an active field of research for some time, the quality of in-silico methods is still far from perfect. We have developed a novel prediction method called INSPiRE which benefits from a knowledge base built from data available in Protein Data Bank. All proteins involved in PPIs were converted into labeled graphs with nodes corresponding to amino acids and edges to pairs of neighboring amino acids. A structural neighborhood of each node was then encoded into a bit string and stored in the knowledge base. When predicting PPIs, INSPiRE labels amino acids of unknown proteins as interface or non-interface based on how often their structural neighborhood appears as interface or non-interface in the knowledge base. We evaluated INSPiRE's behavior with respect to different types and sizes of the structural neighborhood. Furthermore, we examined the suitability of several different features for labeling the nodes. Our evaluations showed that INSPiRE clearly outperforms existing methods with respect to Matthews correlation coefficient. In this paper we introduce a new knowledge-based method for identification of protein-protein interaction sites called INSPiRE. Its knowledge base utilizes structural patterns of known interaction sites in the Protein Data Bank which are then used for PPI prediction. Extensive experiments on several well-established datasets show that INSPiRE significantly surpasses existing PPI approaches.

  7. Interplay of quasiparticle-vibration coupling and pairing correlations on β-decay half-lives

    Science.gov (United States)

    Niu, Y. F.; Niu, Z. M.; Colò, G.; Vigezzi, E.

    2018-05-01

    The nuclear β-decay half-lives of Ni and Sn isotopes, around the closed shell nuclei 78Ni and 132Sn, are investigated by computing the distribution of the Gamow-Teller strength using the Quasiparticle Random Phase Approximation (QRPA) with quasiparticle-vibration coupling (QPVC), based on ground-state properties obtained by Hartree-Fock-Bogoliubov (HFB) calculations. We employ the effective interaction SkM* and a zero-range effective pairing force. The half-lives are strongly reduced by including the QPVC. We study in detail the effects of isovector (IV) and isoscalar (IS) pairing. Increasing the IV strength tends to increase the lifetime for nuclei in the proximity of, but lighter than, the closed-shell ones in QRPA calculations, while the effect is significantly reduced by taking into account the QPVC. On the contrary, the IS pairing mainly plays a role for nuclei after the shell closure. Increasing its strength decreases the half-lives, and the effect at QRPA and QRPA+QPVC level is comparable. The effect of IS pairing is particularly pronounced in the case of the Sn isotopes, where it turns out to be instrumental to obtain good agreement with experimental data.

  8. Pair plasma relaxation time scales.

    Science.gov (United States)

    Aksenov, A G; Ruffini, R; Vereshchagin, G V

    2010-04-01

    By numerically solving the relativistic Boltzmann equations, we compute the time scale for relaxation to thermal equilibrium for an optically thick electron-positron plasma with baryon loading. We focus on the time scales of electromagnetic interactions. The collisional integrals are obtained directly from the corresponding QED matrix elements. Thermalization time scales are computed for a wide range of values of both the total-energy density (over 10 orders of magnitude) and of the baryonic loading parameter (over 6 orders of magnitude). This also allows us to study such interesting limiting cases as the almost purely electron-positron plasma or electron-proton plasma as well as intermediate cases. These results appear to be important both for laboratory experiments aimed at generating optically thick pair plasmas as well as for astrophysical models in which electron-positron pair plasmas play a relevant role.

  9. Deficient incorporation of spike protein into virions contributes to the lack of infectivity following establishment of a persistent, non-productive infection in oligodendroglial cell culture by murine coronavirus

    International Nuclear Information System (INIS)

    Liu Yin; Herbst, Werner; Cao Jianzhong; Zhang Xuming

    2011-01-01

    Infection of mouse oligodendrocytes with a recombinant mouse hepatitis virus (MHV) expressing a green fluorescence protein facilitated specific selection of virus-infected cells and subsequent establishment of persistence. Interestingly, while viral genomic RNAs persisted in infected cells over 14 subsequent passages with concomitant synthesis of viral subgenomic mRNAs and structural proteins, no infectious virus was isolated beyond passage 2. Further biochemical and electron microscopic analyses revealed that virions, while assembled, contained little spike in the envelope, indicating that lack of infectivity during persistence was likely due to deficiency in spike incorporation. This type of non-lytic, non-productive persistence in oligodendrocytes is unique among animal viruses and resembles MHV persistence previously observed in the mouse central nervous system. Thus, establishment of such a culture system that can recapitulate the in vivo phenomenon will provide a powerful approach for elucidating the mechanisms of coronavirus persistence in glial cells at the cellular and molecular levels.

  10. Exotic superfluidity and pairing phenomena in atomic Fermi gases in mixed dimensions.

    Science.gov (United States)

    Zhang, Leifeng; Che, Yanming; Wang, Jibiao; Chen, Qijin

    2017-10-11

    Atomic Fermi gases have been an ideal platform for simulating conventional and engineering exotic physical systems owing to their multiple tunable control parameters. Here we investigate the effects of mixed dimensionality on the superfluid and pairing phenomena of a two-component ultracold atomic Fermi gas with a short-range pairing interaction, while one component is confined on a one-dimensional (1D) optical lattice whereas the other is in a homogeneous 3D continuum. We study the phase diagram and the pseudogap phenomena throughout the entire BCS-BEC crossover, using a pairing fluctuation theory. We find that the effective dimensionality of the non-interacting lattice component can evolve from quasi-3D to quasi-1D, leading to strong Fermi surface mismatch. Upon pairing, the system becomes effectively quasi-two dimensional in the BEC regime. The behavior of T c bears similarity to that of a regular 3D population imbalanced Fermi gas, but with a more drastic departure from the regular 3D balanced case, featuring both intermediate temperature superfluidity and possible pair density wave ground state. Unlike a simple 1D optical lattice case, T c in the mixed dimensions has a constant BEC asymptote.

  11. Ion pairs in non-redundant protein structures

    Indian Academy of Sciences (India)

    Ion pairs contribute to several functions including the activity of catalytic triads, fusion of viral membranes, stability in thermophilic proteins and solvent–protein interactions. Furthermore, they have the ability to affect the stability of protein structures and are also a part of the forces that act to hold monomers together.

  12. Sexually dimorphic activation of dopaminergic areas depends on affiliation during courtship and pair formation

    Directory of Open Access Journals (Sweden)

    Mai eIwasaki

    2014-06-01

    Full Text Available For many species, dyadic interaction during courtship and pair bonding engage intense emotional states that control approach or avoidance behavior. Previous studies have shown that one component of a common social brain network (SBN, dopaminergic areas, are highly engaged during male songbird courtship of females. We tested whether the level of activity in dopaminergic systems of both females and males during courtship is related to their level of affiliation. In order to objectively quantify affiliative behaviors, we developed a system for tracking the position of both birds during free interaction sessions. During a third successive daily interaction session, there was a range of levels of affiliation among bird pairs, as quantified by several position and movement parameters. Because both positive and negative social interactions were present, we chose to characterize affiliation strength by pair valence. As a potential neural system involved in regulating pair valence, the level of activity of the dopaminergic group A11 (within the central gray was selectively reduced in females of positive valence pairs. Further, activation of non-dopaminergic neurons in VTA was negatively related to valence, with this relationship strongest in ventral VTA of females. Together, these results suggest that inhibition of fear or avoidance networks may be associated with development of close affiliation, and highlight the importance of negative as well as positive emotional states in the process of courtship, and in development of long-lasting social bonds.

  13. Evolutionary games combining two or three pair coordinations on a square lattice

    Science.gov (United States)

    Király, Balázs; Szabó, György

    2017-10-01

    We study multiagent logit-rule-driven evolutionary games on a square lattice whose pair interactions are composed of a maximal number of nonoverlapping elementary coordination games describing Ising-type interactions between just two of the available strategies. Using Monte Carlo simulations we investigate the macroscopic noise-level-dependent behavior of the two- and three-pair games and the critical properties of the continuous phase transtitions these systems exhibit. The four-strategy game is shown to be equivalent to a system that consists of two independent and identical Ising models.

  14. Nuclear level densities with pairing and self-consistent ground-state shell effects

    CERN Document Server

    Arnould, M

    1981-01-01

    Nuclear level density calculations are performed using a model of fermions interacting via the pairing force, and a realistic single particle potential. The pairing interaction is treated within the BCS approximation with different pairing strength values. The single particle potentials are derived in the framework of an energy-density formalism which describes self-consistently the ground states of spherical nuclei. These calculations are extended to statistically deformed nuclei, whose estimated level densities include rotational band contributions. The theoretical results are compared with various experimental data. In addition, the level densities for several nuclei far from stability are compared with the predictions of a back-shifted Fermi gas model. Such a comparison emphasizes the possible danger of extrapolating to unknown nuclei classical level density formulae whose parameter values are tailored for known nuclei. (41 refs).

  15. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  16. Structural Analysis of ‘key’ Interactions in Functional RNA Molecules

    KAUST Repository

    Chawla, Mohit

    2018-04-01

    The main objective of the thesis is to carry out structural bioinformatics study along with usage of advanced quantum chemical methods to look at the structural stability and energetics of RNA building blocks. The main focus of the work described here lies on understanding the reasons behind the intrinsic stability of key interactions in nucleic acids. Crystal structures of RNA molecules exhibit fascinating variety of non-covalent interactions, which play an important role in maintaining the three dimensional structures. An accurate atomic level description of these interactions in the structural building blocks of RNA is a key to understand the structure-function relationship in these molecules. An effort has been made to link the conclusions drawn from quantum chemical computations on RNA base pairs in wide biochemical context of their occurrence in RNA structures. The initial attention was on the impact of natural and non-natural modifications of the nucleic acid bases on the structure and stability of base pairs that they are involved in. In the remaining sections we cover other molecular interactions shaping nucleic acids, as the interaction between ribose and the bases, and the fluoride sensing riboswitch system in order to investigate structure and dynamics of nucleic acids at the atomic level and to gain insight into the physical chemistry behind.

  17. Structural Analysis of ‘key’ Interactions in Functional RNA Molecules

    KAUST Repository

    Chawla, Mohit

    2018-01-01

    The main objective of the thesis is to carry out structural bioinformatics study along with usage of advanced quantum chemical methods to look at the structural stability and energetics of RNA building blocks. The main focus of the work described here lies on understanding the reasons behind the intrinsic stability of key interactions in nucleic acids. Crystal structures of RNA molecules exhibit fascinating variety of non-covalent interactions, which play an important role in maintaining the three dimensional structures. An accurate atomic level description of these interactions in the structural building blocks of RNA is a key to understand the structure-function relationship in these molecules. An effort has been made to link the conclusions drawn from quantum chemical computations on RNA base pairs in wide biochemical context of their occurrence in RNA structures. The initial attention was on the impact of natural and non-natural modifications of the nucleic acid bases on the structure and stability of base pairs that they are involved in. In the remaining sections we cover other molecular interactions shaping nucleic acids, as the interaction between ribose and the bases, and the fluoride sensing riboswitch system in order to investigate structure and dynamics of nucleic acids at the atomic level and to gain insight into the physical chemistry behind.

  18. Binding of the biogenic polyamines to deoxyribonucleic acids of varying base composition: base specificity and the associated energetics of the interaction.

    Directory of Open Access Journals (Sweden)

    Ayesha Kabir

    Full Text Available BACKGROUND: The thermodynamics of the base pair specificity of the binding of the polyamines spermine, spermidine, putrescine, and cadaverine with three genomic DNAs Clostridium perfringens, 27% GC, Escherichia coli, 50% GC and Micrococcus lysodeikticus, 72% GC have been studied using titration calorimetry and the data supplemented with melting studies, ethidium displacement and circular dichroism spectroscopy results. METHODOLOGY/PRINCIPAL FINDINGS: Isothermal titration calorimetry, differential scanning calorimetry, optical melting studies, ethidium displacement, circular dichroism spectroscopy are the various techniques employed to characterize the interaction of four polyamines, spermine, spermidine, putersine and cadaverine with the DNAs. Polyamines bound stronger with AT rich DNA compared to the GC rich DNA and the binding varied depending on the charge on the polyamine as spermine>spermidine >putrescine>cadaverine. Thermodynamics of the interaction revealed that the binding was entropy driven with small enthalpy contribution. The binding was influenced by salt concentration suggesting the contribution from electrostatic forces to the Gibbs energy of binding to be the dominant contributor. Each system studied exhibited enthalpy-entropy compensation. The negative heat capacity changes suggested a role for hydrophobic interactions which may arise due to the non polar interactions between DNA and polyamines. CONCLUSION/SIGNIFICANCE: From a thermodynamic analysis, the AT base specificity of polyamines to DNAs has been elucidated for the first time and supplemented by structural studies.

  19. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    Science.gov (United States)

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  20. Model for an RNA tertiary interaction from the structure of an intermolecular complex between a GAAA tetraloop and an RNA helix.

    Science.gov (United States)

    Pley, H W; Flaherty, K M; McKay, D B

    1994-11-03

    In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.

  1. Dependence of two-proton radioactivity on nuclear pairing models

    Science.gov (United States)

    Oishi, Tomohiro; Kortelainen, Markus; Pastore, Alessandro

    2017-10-01

    Sensitivity of two-proton emitting decay to nuclear pairing correlation is discussed within a time-dependent three-body model. We focus on the 6Be nucleus assuming α +p +p configuration, and its decay process is described as a time evolution of the three-body resonance state. For a proton-proton subsystem, a schematic density-dependent contact (SDDC) pairing model is employed. From the time-dependent calculation, we observed the exponential decay rule of a two-proton emission. It is shown that the density dependence does not play a major role in determining the decay width, which can be controlled only by the asymptotic strength of the pairing interaction. This asymptotic pairing sensitivity can be understood in terms of the dynamics of the wave function driven by the three-body Hamiltonian, by monitoring the time-dependent density distribution. With this simple SDDC pairing model, there remains an impossible trinity problem: it cannot simultaneously reproduce the empirical Q value, decay width, and the nucleon-nucleon scattering length. This problem suggests that a further sophistication of the theoretical pairing model is necessary, utilizing the two-proton radioactivity data as the reference quantities.

  2. Effects of anomalous magnetic moment and temperature on pair production in an external magnetic field

    International Nuclear Information System (INIS)

    Dittrich, W.; Bauhoff, W.

    1981-01-01

    It is re-examined the problem of spontaneous pair creation in an external magnetic field. In contrast to earlier findings, it is shown that pair production does not occur due to the anomalous magnetic moment interaction. However, pairs may be observed in a situation of thermodynamic equilibrium at finite temperatures. (author)

  3. Study of intrinsic anchoring in nematic liquid crystals based on modified Gruhn-Hess pair potential

    International Nuclear Information System (INIS)

    Zhang Zhidong; Zhang Yanjun

    2008-01-01

    A nematic liquid crystal slab composed of N molecular layers is investigated using a simple cubic lattice model, based upon the molecular pair potential which is spatially anisotropic and dependent on elastic constants of liquid crystals. A perfect nematic order is assumed in the theoretical treatment, which means the orientation of the molecular long axis coincides with the director of liquid crystal and the total free energy equals to the total interaction energy. We present a modified Gruhn-Hess model, which is relative to the splay-bend elastic constant K 13 . Furthermore, we have studied the free nematic interfacial behavior (intrinsic anchoring) by this model in the assumption of the perfect nematic order. We find that the preferred orientation at the free interface and the intrinsic anchoring strength change with the value of modification, and that the director profile can be determined by the competition of the intrinsic anchoring with external forces present in the system. Also we simulate the intrinsic anchoring at different temperatures using Monte Carlo method and the simulation results show that the intrinsic anchoring favors planar alignment and the free interface is more disordered than the bulk

  4. Galactic Pairs in the Early Universe

    Science.gov (United States)

    Kohler, Susanna

    2018-02-01

    In the spirit of Valentines Day, today well be exploring apparent pairs of galaxies in the distant, early universe. How can we tell whether these duos are actually paired galaxies, as opposed to disguised singles?Real Pair, or Trick of the Light?In the schematic timeline of the universe, the epoch of reionization is when the first galaxies and quasars began to form and evolve. [NASA]The statistics of merging galaxies throughout the universe reveal not only direct information about how galaxies interact, but also cosmological information about the structure of the universe. While weve observed many merging galaxy pairs at low redshift, however, its much more challenging to identify these duos in the early universe.A merging pair of galaxies at high redshift appears to us as a pair of unresolved blobs that lie close to each other in the sky. But spotting such a set of objects doesnt necessarily mean were looking at a merger! There are three possible scenarios to explain an observed apparent duo:Its a pair of galaxies in a stage of merger.Its a projection coincidence; the two galaxies arent truly near each other.Its a single galaxy being gravitationally lensed by a foreground object. This strong lensing produces the appearance of multiple galaxies.Hubble photometry of one of the three galaxy groups identified at z 8, with the galaxies in the image labeled with their corresponding approximate photometric redshifts. [Adapted from Chaikin et al. 2018]Hunting for Distant DuosIn a recent study led by Evgenii Chaikin (Peter the Great St. Petersburg Polytechnic University, Russia), a team of scientists has explored the Hubble Ultra Deep Field in search ofhigh-redshift galaxies merging during the epoch of reionization, when the first galaxies formed and evolved.Using an approach called the dropout technique, which leverages the visibility of the galaxies in different wavelength filters, Chaikin and collaborators obtain approximate redshifts for an initial sample of 7

  5. The Potts model and flows. 1. The pair correlation function

    International Nuclear Information System (INIS)

    Essam, J.W.; Tsallis, C.

    1985-01-01

    It is shown that the partition function for the lambda-state Potts model with pair-interactions is related to the expected number of integer mod-lambda flows in a percolation model. The relation is generalised to the pair correlation function. The resulting high temperature expansion coefficients are shown to be the flow polynomials of graph theory. An observation of Tsallis and Levy concerning the equivalent transmissivity of a cluster is also proved. (Author) [pt

  6. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  7. Protein-protein interactions in paralogues: Electrostatics modulates specificity on a conserved steric scaffold.

    Directory of Open Access Journals (Sweden)

    Stefan M Ivanov

    Full Text Available An improved knowledge of protein-protein interactions is essential for better understanding of metabolic and signaling networks, and cellular function. Progress tends to be based on structure determination and predictions using known structures, along with computational methods based on evolutionary information or detailed atomistic descriptions. We hypothesized that for the case of interactions across a common interface, between proteins from a pair of paralogue families or within a family of paralogues, a relatively simple interface description could distinguish between binding and non-binding pairs. Using binding data for several systems, and large-scale comparative modeling based on known template complex structures, it is found that charge-charge interactions (for groups bearing net charge are generally a better discriminant than buried non-polar surface. This is particularly the case for paralogue families that are less divergent, with more reliable comparative modeling. We suggest that electrostatic interactions are major determinants of specificity in such systems, an observation that could be used to predict binding partners.

  8. Protein-protein interactions in paralogues: Electrostatics modulates specificity on a conserved steric scaffold.

    Science.gov (United States)

    Ivanov, Stefan M; Cawley, Andrew; Huber, Roland G; Bond, Peter J; Warwicker, Jim

    2017-01-01

    An improved knowledge of protein-protein interactions is essential for better understanding of metabolic and signaling networks, and cellular function. Progress tends to be based on structure determination and predictions using known structures, along with computational methods based on evolutionary information or detailed atomistic descriptions. We hypothesized that for the case of interactions across a common interface, between proteins from a pair of paralogue families or within a family of paralogues, a relatively simple interface description could distinguish between binding and non-binding pairs. Using binding data for several systems, and large-scale comparative modeling based on known template complex structures, it is found that charge-charge interactions (for groups bearing net charge) are generally a better discriminant than buried non-polar surface. This is particularly the case for paralogue families that are less divergent, with more reliable comparative modeling. We suggest that electrostatic interactions are major determinants of specificity in such systems, an observation that could be used to predict binding partners.

  9. NLO-QCD corrections to Higgs pair production in the MSSM

    Energy Technology Data Exchange (ETDEWEB)

    Agostini, A.; Degrassi, G. [Dipartimento di Matematica e Fisica, Università di Roma Tre, Via della Vasca Navale 84, I-00146 Rome (Italy); INFN, Sezione di Roma Tre, Via della Vasca Navale 84, I-00146 Rome (Italy); Gröber, R. [INFN, Sezione di Roma Tre, Via della Vasca Navale 84, I-00146 Rome (Italy); Slavich, P. [LPTHE, UPMC University Paris 06, Sorbonne Universités, 4 Place Jussieu, F-75252 Paris (France); LPTHE, CNRS, 4 Place Jussieu, F-75252 Paris (France)

    2016-04-18

    We take a step towards a complete NLO-QCD determination of the production of a pair of Higgs scalars in the MSSM. Exploiting a low-energy theorem that connects the Higgs-gluon interactions to the derivatives of the gluon self-energy, we obtain analytic results for the one- and two-loop squark contributions to Higgs pair production in the limit of vanishing external momenta. We find that the two-loop squark contributions can have non-negligible effects in MSSM scenarios with stop masses below the TeV scale. We also show how our results can be adapted to the case of Higgs pair production in the NMSSM.

  10. Immersion in Movement-Based Interaction

    Science.gov (United States)

    Pasch, Marco; Bianchi-Berthouze, Nadia; van Dijk, Betsy; Nijholt, Anton

    The phenomenon of immersing oneself into virtual environments has been established widely. Yet to date (to our best knowledge) the physical dimension has been neglected in studies investigating immersion in Human-Computer Interaction (HCI). In movement-based interaction the user controls the interface via body movements, e.g. direct manipulation of screen objects via gestures or using a handheld controller as a virtual tennis racket. It has been shown that physical activity affects arousal and that movement-based controllers can facilitate engagement in the context of video games. This paper aims at identifying movement features that influence immersion. We first give a brief survey on immersion and movement-based interfaces. Then, we report results from an interview study that investigates how users experience their body movements when interacting with movement-based interfaces. Based on the interviews, we identify four movement-specific features. We recommend them as candidates for further investigation.

  11. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  12. An Intelligent Model for Pairs Trading Using Genetic Algorithms.

    Science.gov (United States)

    Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An

    2015-01-01

    Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.

  13. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  14. Recollections on the establishment of the weak interaction notion

    International Nuclear Information System (INIS)

    Pontecorvo, B.

    1985-01-01

    The generalization of conception of weak interaction to the processes where strange particles discovered is given. Indepene dently of Pais, the author came to an idea of pair production of new (strange) particles. In Dubna the experiments have been performed on the search for processes of production of the same pair of Λ-particles in nucleon-nucleon collisions. To interprete negative results of these experiments the author suggested a scheme based on an assumption that the isotopic spin is conserved in strong interaction and is not conserved in the weak one. It followed from this scheme, in particularly, that K 0 and anti K 0 - different particles

  15. Pair production from nuclear collisions and cosmic ray transport

    International Nuclear Information System (INIS)

    Norbury, John W

    2006-01-01

    Modern cosmic ray transport codes, that are capable of use for a variety of applications, need to include all significant atomic, nuclear and particle reactions at a variety of energies. Lepton pair production from nucleus-nucleus collisions has not been included in transport codes to date. Using the methods of Baur, Bertulani and Baron, the present report provides estimates of electron-positron pair production cross sections for nuclei and energies relevant to cosmic ray transport. It is shown that the cross sections are large compared to other typical processes such as single neutron removal due to strong or electromagnetic interactions. Therefore, lepton pair production may need to be included in some transport code applications involving MeV electrons. (brief report)

  16. Temperature dependence of pair correlations in nuclei in the iron region

    International Nuclear Information System (INIS)

    Langanke, K.; Dean, D.J.; Oak Ridge National Lab., TN; Radha, P.B.; Koonin, S.E.

    1996-01-01

    We use the shell-model Monte Carlo approach to study thermal properties and pair correlations in 54,56,58 Fe and in 56 Cr. The calculations are performed with the modified Kuo-Brown interaction in the complete 1p0f model space. We find generally that the proton-proton and neutron-neutron J=0 pairing correlations, which dominate the ground-state properties of even-even nuclei, vanish at temperatures around 1 MeV. This pairing phase transition is accompanied by a rapid increase in the moment of inertia and a partial unquenching of the M1 strength. We find that the M1 strength totally unquenches at higher temperatures, related to the vanishing of isoscalar proton-neutron correlations, which persist to higher temperatures than the pairing between like nucleons. The Gamow-Teller strength is also correlated to the isoscalar proton-neutron pairing and hence also unquenches at a temperature larger than that of the pairing phase transition. (orig.)

  17. Observation of water separated ion-pairs between cations and phospholipid headgroups.

    Science.gov (United States)

    van der Post, Sietse T; Hunger, Johannes; Bonn, Mischa; Bakker, Huib J

    2014-04-24

    In this work, we present evidence for ion pair formation of cations with a high surface charge density (Na(+) and Ca(2+)) and phosphate groups of phospholipids. We used femto-second infrared pump-probe and dielectric spectroscopy to probe the dynamics of water molecules in solutions of phosphorylethanolamine and different types of cations. We find that sodium and calcium cooperatively retard the dynamics of water in solutions of phosphorylethanolamine, implying the formation of solvent separated ion pairs. This ion-specific interaction is absent for potassium, cesium and ammonium. We compare our results to dielectric spectroscopy experiments, which probes the rotation of all dipolar molecules and ions in solution. The rotation of the dipolar phosphorylethanolamine ion shows that long-lived ion-pairs are only formed with calcium and not with ammonium, cesium, potassium, and sodium. This finding implies that the association between calcium and the phosphate is strong with lifetimes exceeding 200 ps, while the interaction with sodium is relatively short-lived (∼20-100 ps).

  18. On friction of Nb-Nb pair in He1 and He2

    International Nuclear Information System (INIS)

    Zinenko, S.A.; Karapetyan, S.S.; Silin, A.A.

    1990-01-01

    Peculiarities of manifestation of the effect of anomalous friction of superconductors (AFS) in He1 and He2 are studied. Helium thermodynamic state effect on the character of friction interaction of Nb-Nb pair velocity and reduction ratio for friction coefficient is studied. The intensity of heat removal released from friction contact region is estimated, the necessary and sufficient conditions for AFC effect manifestation are ascertained using characteristic relaxation time concept. Dependences for Nb-Nb pair friction coefficient in a superconducting state on the time of friction interaction in gaseous helium, He1, He2 are presented

  19. X-ray flares from runaway pair production in active galactic nuclei

    Science.gov (United States)

    Kirk, J. G.; Mastichiadis, A.

    1992-01-01

    The hard X-ray spectrum of AGNs is nonthermal, probably arising from an electron-positron pair cascade, with some emission reflected off relatively cold matter. There has been interest in models on which protons are accelerated and create relativistic electrons on interaction with a local radiation field. It is shown here that a sufficient column density of protons can lead to runaway pair production: photons generated by the relativistic pairs are the targets for the protons to produce more pairs. This can produce X-ray fluxes with the characteristics observed in AGN. The model predicts the maximum ratio of luminosity to source size as well as their spectrum in the early phases. The same mechanism may also be able to create the knots of synchrotron-radiating pair plasma seen in sources such as 3C273.

  20. Bodystorming for Movement-Based Interaction Design

    Directory of Open Access Journals (Sweden)

    Elena Márquez Segura

    2016-11-01

    Full Text Available After a decade of movement-based interaction in human–computer interaction, designing for the moving body still remains a challenge. Research in this field requires methods to help access, articulate, and harness embodied experiences in ways that can inform the design process. To address this challenge, this article appropriates bodystorming, an embodied ideation method for movement-based interaction design. The proposed method allows for early consideration of the physical, collocated, and social aspects of a designed activity as illustrated with two explorative workshops in different application domains: interactive body games and interactive performances. Using a qualitative methods approach, we used video material from the workshops, feedback from participants, and our own experience as participants and facilitators to outline important characteristics of the bodystorming method in the domain of movement-based interaction. The proposed method is compared with previous ones and application implications are discussed.

  1. Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

    International Nuclear Information System (INIS)

    Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

    2003-01-01

    Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

  2. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  3. 2,6-di-tert-butylphenylvinyl ether: effect of the unshared oxygen electron pair on the /sup 13/C-/sup 13/C spin-spin interaction constant

    Energy Technology Data Exchange (ETDEWEB)

    Krivdin, L.B.; Shcherbakov, V.V.; Glukhikh, N.G.; Sigalov, V.M.; Kalabin, G.A.

    1987-07-10

    Vinyl ethers were prepared by the well-known Favorskii-Shostakovskii method. The purity of the compounds was controlled by GLC and by the PMR and /sup 13/C NMR spectra. The proximity of sp/sup 7/-hybridized unshared pair of oxygen atoms result in a secondary, positive contribution in the constant of spin-spin interaction between neighboring carbon nuclei in the aromatic ring.

  4. Aqua-vanadyl ion interaction with Nafion® membranes

    Directory of Open Access Journals (Sweden)

    Vijayakumar eMurugesan

    2015-03-01

    Full Text Available Lack of comprehensive understanding about the interactions between Nafion membrane and battery electrolytes prevents the straightforward tailoring of optimal materials for redox flow battery applications. In this work, we analyzed the interaction between aqua-vanadyl cation and sulfonic sites within the pores of Nafion membranes using combined theoretical and experimental X-ray spectroscopic methods. Molecular level interactions namely solvent share and contact pair mechanisms are discussed based on Vanadium and Sulfur K-edge spectroscopic analysis.

  5. Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data.

    Science.gov (United States)

    Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C

    2014-07-30

    Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

  6. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    Science.gov (United States)

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  7. Electron-positron pairs creation in the field of two strong counterpropagating laser beams and the nonlocality of the photon-photon interaction

    International Nuclear Information System (INIS)

    Gainutdinov, R.Kh.; Khamadeev, M.A.; Mutygullina, A.A.

    2010-01-01

    Complete text of publication follows. We discuss various approaches to problem of the electron-positron pair creation in the strong external field. Special interest presents the circuit, in which the interaction of two strong counterpropagating laser beams in vacuum is considered. For the calculation of the probability of the creation the following formula is usually applied: W = 2Im(L (E-H) (ρ L )) = 2m 4 /(2π) 3 ρ L 2 Σ n=1 -∞ 1/n 2 e -nπ /ρ L where ρ L = E L / E cr and E cr = m 2 /e = 1.3 x 10 16 V/cm is the Schwinger field limit. However this expression was obtained even in pioneer works dedicated to vacuum nonlinearity and it based on some approximations. Attempt of the strict analysis has been made in work by introducing the nonlocal form-factor into the Lagrangian. But, as it is well known, such procedure leads to the loss of Lorenz invariance or unitarity. We show that the formalism of generalized quantum dynamic (GQD) opens new opportunities to solve such problems. We show also how it can be made proceeding from nonlocal interaction operator obtained earlier within the framework of the formalism of GQD. Acknowledgements. This work was supported by the Grant of Federal Agency on Education, Russia (Contract number 02.740.11.0428) and by the Grant of Russian President No. NSh 2965.2008.2.

  8. Ion pair reinforced semi-interpenetrating polymer network for direct methanol fuel cell applications.

    Science.gov (United States)

    Fang, Chunliu; Julius, David; Tay, Siok Wei; Hong, Liang; Lee, Jim Yang

    2012-06-07

    This paper describes the synthesis of ion-pair-reinforced semi-interpenetrating polymer networks (SIPNs) as proton exchange membranes (PEMs) for the direct methanol fuel cells (DMFCs). Specifically, sulfonated poly(2,6-dimethyl-1,4-phenylene oxide) (SPPO), a linear polymer proton source, was immobilized in a brominated PPO (BPPO) network covalently cross-linked by ethylenediamine (EDA). The immobilization of SPPO in the SIPN network was accomplished not only by the usual means of mechanical interlocking but also by ion pair formation between the sulfonic acid groups of SPPO and the amine moieties formed during the cross-linking reaction of BPPO with EDA. Through the ion pair interactions, the immobilization of SPPO polymer in the BPPO network was made more effective, resulting in a greater uniformity of sulfonic acid cluster distribution in the membrane. The hydrophilic amine-containing cross-links also compensated for some of the decrease in proton conductivity caused by ion pair formation. The SIPN membranes prepared as such showed good proton conductivity, low methanol permeability, good mechanical properties, and dimensional stability. Consequently, the PPO based SIPN membranes were able to deliver a higher maximum power density than Nafion, demonstrating the potential of the SIPN structure for PEM designs.

  9. Boosting compound-protein interaction prediction by deep learning.

    Science.gov (United States)

    Tian, Kai; Shao, Mingyu; Wang, Yang; Guan, Jihong; Zhou, Shuigeng

    2016-11-01

    The identification of interactions between compounds and proteins plays an important role in network pharmacology and drug discovery. However, experimentally identifying compound-protein interactions (CPIs) is generally expensive and time-consuming, computational approaches are thus introduced. Among these, machine-learning based methods have achieved a considerable success. However, due to the nonlinear and imbalanced nature of biological data, many machine learning approaches have their own limitations. Recently, deep learning techniques show advantages over many state-of-the-art machine learning methods in some applications. In this study, we aim at improving the performance of CPI prediction based on deep learning, and propose a method called DL-CPI (the abbreviation of Deep Learning for Compound-Protein Interactions prediction), which employs deep neural network (DNN) to effectively learn the representations of compound-protein pairs. Extensive experiments show that DL-CPI can learn useful features of compound-protein pairs by a layerwise abstraction, and thus achieves better prediction performance than existing methods on both balanced and imbalanced datasets. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Cross-impact balances. Applying pair interaction systems and multi-value Kauffman nets to multidisciplinary systems analysis

    Science.gov (United States)

    Weimer-Jehle, Wolfgang

    2008-06-01

    Cross-impact analysis is the name for a familiar method for multidisciplinary systems analysis in social sciences and management sciences, especially in technology foresight, technology assessment and scenario planning. A recently proposed form of cross-impact analysis, CIB, may be of interest for physicists, sociophysicists and complex network researchers because the CIB concept reveals considerable relations to some concepts of these research fields. This article describes the basics of CIB analysis framework, its applications in the social sciences, and its relations to the equilibrium points of pair interaction systems, random graphs, and generalized Kauffman nets. Therefore CIB can be seen as a merger of concepts originating in utterly different scientific fields. This may prove to be fruitful for both sides: For sociophysicists as an example of the application of complex network concepts in the social sciences and for cross-impact practitioners as a source of theoretical insights in the background of their tool.

  11. Gravitational potential energy of a disk-sphere pair of galaxies

    International Nuclear Information System (INIS)

    Ballabh, G.M.

    1975-01-01

    Algebraic expressions are obtained for the interaction potential energy of a pair of galaxies in which one is disk shaped and the other spherical. The density distribution in the disk galaxy is represented by a polynomial in ascending powers of the distance from the centre of the disk while the density distribution in the spherical galaxy is represented by the superposition of spherical polytropes of integral indices. The basic functions required for obtaining the interaction potential energy of a coplanar disk-sphere pair of galaxies are tabulated. The forces of attraction between a coplanar disk-sphere pair of galaxies are shown graphically for two density models of disk and spherical galaxies. An overlapping coplanar disk-sphere pair of galaxies attract just like two mass-points at a certain separation, rsub(c), of their centres. The force of attraction is less than that of two mass-points having masses equal to the masses of the two galaxies, if the separation of the centres is less than rsub(c), and greater if the separation is greater than rsub(c). For a typical coplanar disk-sphere pair of galaxies (the density of the disk is represented by Model II and of the sphere by a polytropic index n=4) of equal radii, the following is noted. At a separation of 0.79 R, R being the common radius of the two galaxies, the force of attraction between the pair is the same as if the entire mass of each galaxy is concentrated at its centre. The mass-point model for the two galaxies will overestimate the force of attraction by more than a factor of 10 if the separation is less than 0.36 R. For separation greater than the radii of the galaxies the mass-point model will underestimate the force but the departure in this case is less than 33%. (Auth.)

  12. Evidence-Based Interactive Management of Change

    Directory of Open Access Journals (Sweden)

    Albert Fleischmann

    2011-06-01

    Full Text Available Evidence-based interactive management of change means hands-on experience of modified work processes, given evidence of change. For this kind of pro-active organizational development support we use an organisational process memory and a communication-based representation technique for role-specific and task-oriented process execution. Both are effective means for organizations becoming agile through interactively modelling the business at the process level and re-constructing or re-arranging process representations according to various needs. The tool allows experiencing role-specific workflows, as the communication-based refinement of work models allows for executable process specifications. When presenting the interactive processes to individuals involved in the business processes, changes can be explored interactively in a context-sensitive way before re-implementing business processes and information systems. The tool is based on a service-oriented architecture and a flexible representation scheme comprising the exchange of message between actors, business objects and actors (roles. The interactive execution of workflows does not only enable the individual reorganization of work but also changes at the level of the entire organization due to the represented interactions.

  13. Pair-Production of W Bosons in $e^+ e^-$ Interactions at $\\sqrt{s}$ = 161 GeV

    CERN Document Server

    Acciarri, M; Aguilar-Benítez, M; Ahlen, S P; Alpat, B; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alverson, G; Alviggi, M G; Ambrosi, G; Anderhub, H; Andreev, V P; Angelescu, T; Anselmo, F; Antreasyan, D; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Baksay, L; Banerjee, S; Banicz, K; Barillère, R; Barone, L; Bartalini, P; Baschirotto, A; Basile, M; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Bhattacharya, S; Biasini, M; Biland, A; Bilei, G M; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böck, R K; Böhm, A; Borgia, B; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brigljevic, V; Brock, I C; Buffini, A; Buijs, A; Burger, J D; Burger, W J; Busenitz, J K; Button, A M; Cai, X D; Campanelli, M; Capell, M; Cara Romeo, G; Caria, M; Carlino, G; Cartacci, A M; Casaus, J; Castellini, G; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada-Canales, M; Cesaroni, F; Chamizo-Llatas, M; Chan, A; Chang, Y H; Chaturvedi, U K; Chekanov, S V; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chéreau, X J; Chiefari, G; Chien, C Y; Choi, M T; Cifarelli, Luisa; Cindolo, F; Civinini, C; Clare, I; Clare, R; Cohn, H O; Coignet, G; Colijn, A P; Colino, N; Commichau, V; Costantini, S; Cotorobai, F; de la Cruz, B; Csilling, Akos; Dai, T S; D'Alessandro, R; De Asmundis, R; Degré, A; Deiters, K; Della Volpe, D; Denes, P; De Notaristefani, F; DiBitonto, Daryl; Diemoz, M; Van Dierendonck, D N; Di Lodovico, F; Dionisi, C; Dittmar, Michael; Dominguez, A; Doria, A; Dova, M T; Drago, E; Duchesneau, D; Duinker, P; Durán, I; Dutta, S; Easo, S; Efremenko, Yu V; El-Mamouni, H; Engler, A; Eppling, F J; Erné, F C; Ernenwein, J P; Extermann, Pierre; Fabre, M; Faccini, R; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, Marta; Fenyi, B; Ferguson, T; Fernández, D; Ferroni, F; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Forconi, G; Fredj, L; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gau, S S; Gentile, S; Gheordanescu, N; Giagu, S; Goldfarb, S; Goldstein, J; Gong, Z F; Gougas, Andreas; Gratta, Giorgio; Grünewald, M W; Gupta, V K; Gurtu, A; Gutay, L J; Hartmann, B; Hasan, A; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Van Hoek, W C; Hofer, H; Hoorani, H; Hou, S R; Hu, G; Innocente, Vincenzo; Jenkes, K; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Kasser, A; Khan, R A; Kamrad, D; Kamyshkov, Yu A; Kapustinsky, J S; Karyotakis, Yu; Kaur, M; Kienzle-Focacci, M N; Kim, D; Kim, J K; Kim, S C; Kim, Y G; Kinnison, W W; Kirkby, A; Kirkby, D; Kirkby, Jasper; Kiss, D; Kittel, E W; Klimentov, A; König, A C; Korolko, I; Koutsenko, V F; Krämer, R W; Krenz, W; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Lapoint, C; Lassila-Perini, K M; Laurikainen, P; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Lee Jae Sik; Lee, K Y; Le Goff, J M; Leiste, R; Leonardi, E; Levchenko, P M; Li Chuan; Lieb, E H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lu, W; Lü, Y S; Lübelsmeyer, K; Luci, C; Luckey, D; Luminari, L; Lustermann, W; Ma Wen Gan; Maity, M; Majumder, G; Malgeri, L; Malinin, A; Maña, C; Mangeol, D J J; Mangla, S; Marchesini, P A; Marin, A; Martin, J P; Marzano, F; Massaro, G G G; McNally, D; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Von der Mey, M; Mi, Y; Mihul, A; Van Mil, A J W; Mirabelli, G; Mnich, J; Molnár, P; Monteleoni, B; Moore, R; Morganti, S; Moulik, T; Mount, R; Müller, S; Muheim, F; Muijs, A J M; Nagy, E; Nahn, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Niessen, T; Nippe, A; Nisati, A; Nowak, H; Opitz, H; Organtini, G; Ostonen, R; Pandoulas, D; Paoletti, S; Paolucci, P; Park, H K; Pascale, G; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Peach, D; Pei, Y J; Pensotti, S; Perret-Gallix, D; Petersen, B; Petrak, S; Pevsner, A; Piccolo, D; Pieri, M; Pinto, J C; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Postema, H; Produit, N; Prokofev, D; Prokofiev, D O; Rahal-Callot, G; Rancoita, P G; Rattaggi, M; Raven, G; Razis, P A; Read, K; Ren, D; Rescigno, M; Reucroft, S; Van Rhee, T; Riemann, S; Riles, K; Ro, S; Robohm, A; Rodin, J; Rodríguez-Calonge, F J; Roe, B P; Romero, L; Rosier-Lees, S; Rosselet, P; Van Rossum, W; Roth, S; Rubio, Juan Antonio; Rykaczewski, H; Salicio, J; Sánchez, E; Sanders, M P; Santocchia, A; Sarakinos, M E; Sarkar, S; Sassowsky, M; Schäfer, C; Shchegelskii, V; Schmidt-Kärst, S; Schmitz, D; Schmitz, P; Scholz, N; Schopper, Herwig Franz; Schotanus, D J; Schwenke, J; Schwering, G; Sciacca, C; Sciarrino, D; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shukla, J; Shumilov, E; Shvorob, A V; Siedenburg, T; Son, D; Sopczak, André; Smith, B; Spillantini, P; Steuer, M; Stickland, D P; Stone, H; Stoyanov, B; Strässner, A; Strauch, K; Sudhakar, K; Sultanov, G G; Sun, L Z; Susinno, G F; Suter, H; Swain, J D; Tang, X W; Tauscher, Ludwig; Taylor, L; Ting, Samuel C C; Ting, S M; Tonutti, M; Tonwar, S C; Tóth, J; Tully, C; Tuchscherer, H; Tung, K L; Uchida, Y; Ulbricht, J; Uwer, U; Valente, E; Van de Walle, R T; Vesztergombi, G; Vetlitskii, I; Viertel, Gert M; Vivargent, M; Völkert, R; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Vorvolakos, A; Wadhwa, M; Wallraff, W; Wang, J C; Wang, X L; Wang, Z M; Weber, A; Wittgenstein, F; Wu, S X; Wynhoff, S; Xu, J; Xu, Z Z; Yang, B Z; Yang, C G; Yao, X Y; Ye, J B; Yeh, S C; You, J M; Zalite, A; Zalite, Yu; Zemp, P; Zeng, Y; Zhang, Z; Zhang, Z P; Zhou, B; Zhu, G Y; Zhu, R Y; Zichichi, Antonino; Ziegler, F

    1997-01-01

    We report on the measurement of W-boson pair-production with the L3 detector at LEP at a centre-of-mass energy of 161.34~\\GeV. In a data sample corresponding to a total luminosity of 11~pb$^{-1}$, we select four-fermion events with high invariant masses of pairs of hadronic jets or leptons. Combining all final states, the measured total cross section for W-pair production is: $\\SWW = 2.89^{+0.81}_{-0.70}~(stat.)\\pm0.14~(syst.)$~pb. Within the Standard Model, this corresponds to a mass of the W boson of: $\\MW = 80.80^{+0.48}_{-0.42}~(exp.)\\pm 0.03$~(LEP)~\\GeV. Limits on anomalous triple-vector-boson couplings are derived. \\end{abstract}

  14. Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Tiwari, Gargi, E-mail: gargi.tiwari@rediffmail.com; Sharma, Dipendra, E-mail: d-11sharma@rediffmail.com; Dwivedi, K. K., E-mail: dwivedikarunesh4@gmail.com [Department of Physics, DDU Gorakhpur University, Gorakhpur (India); Dwivedi, M. K., E-mail: dwivedi-ji@rediffmail.com [Department of Physics, Banaras Hindu University, Varanasi (India)

    2016-05-06

    The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.

  15. Theory of superconductivity. II. Excited Cooper pairs. Why does sodium remain normal down to 0 K?

    International Nuclear Information System (INIS)

    Fujita, S.

    1992-01-01

    Based on a generalized BCS Hamiltonian in which the interaction strengths (V 11 , V 22 , V 12 ) among and between electron (12) and hole (2) Cooper pairs are differentiated, the thermodynamic properties of a type-I superconductor below the critical temperature T c are investigated. An expression for the ground-state energy, W - W 0 , relative to the unperturbed Block system is obtained. The usual BCS formulas are obtained in the limits: (all) V jl = V 0 , N 1 (0) = N 2 (0). Any excitations generated through the BCS interaction Hamiltonian containing V jl must involve Cooper pairs of antiparallel spins and nearly opposite momenta. The nonzero momentum or excited Cooper pairs below T c are shown to have an excitation energy band minimum lower than the quasi-electrons, which were regarded as the elementary excitations in the original BCS theory. The energy gap var-epsilon g (T) defined relative to excited and zero-momentum Copper pairs (when V jl > 0) decreases from var-epsilon g (0) to 0 as the temperature T is raised from 0 to T c . If electrons only are available as in a monovalent metal like sodium (V 12 = 0), the energy constant Δ 1 is finite but the energy gap vanishes identically for all T. In agreement with the BCS theory, the present theory predicts that a pure nonmagnetic metal in any dimensions should have a Cooper-pair ground state whose energy is lower than that of the Bloch ground state. Additionally it predicts that a monovalent metal should remain normal down to 0 K, and that there should be no strictly one-dimensional superconductor

  16. It’s Not Just Lunch: Extra-Pair Commensality Can Trigger Sexual Jealousy

    Science.gov (United States)

    Kniffin, Kevin M.; Wansink, Brian

    2012-01-01

    Do people believe that sharing food might involve sharing more than just food? To investigate this, participants were asked to rate how jealous they (Study 1) – or their best friend (Study 2) – would be if their current romantic partner were contacted by an ex-romantic partner and subsequently engaged in an array of food- and drink-based activities. We consistently find – across both men and women – that meals elicit more jealousy than face-to-face interactions that do not involve eating, such as having coffee. These findings suggest that people generally presume that sharing a meal enhances cooperation. In the context of romantic pairs, we find that participants are attuned to relationship risks that extra-pair commensality can present. For romantic partners left out of a meal, we find a common view that lunch, for example, is not “just lunch.” PMID:22792327

  17. Pairing and deformation effects in nuclear excitation spectra

    Energy Technology Data Exchange (ETDEWEB)

    Repko, A. [Slovak Academy of Sciences, Institute of Physics, Bratislava (Slovakia); Kvasil, J. [Charles University, Institute of Particle and Nuclear Physics, Prague (Czech Republic); Nesterenko, V.O. [Joint Institute for Nuclear Research, Laboratory of Theoretical Physics, Dubna (Russian Federation); State University ' ' Dubna' ' , Dubna (Russian Federation); Reinhard, P.G. [Universitaet Erlangen, Institut fuer Theoretische Physik II, Erlangen (Germany)

    2017-11-15

    We investigate effects of pairing and of quadrupole deformation on two sorts of nuclear excitations, γ-vibrational K{sup π} = 2{sup +} states and dipole resonances (isovector dipole, pygmy, compression, toroidal). The analysis is performed within the quasiparticle random phase approximation (QRPA) based on the Skyrme energy functional using the Skyrme parametrization SLy6. Particular attention is paid to i) the role of the particle-particle (pp) channel in the residual interaction of QRPA, ii) comparison of volume pairing (VP) and surface pairing (SP), iii) peculiarities of deformation splitting in the various resonances. We find that the impact of the pp-channel on the considered excitations is negligible. This conclusion applies also to any other excitation except for the K{sup π} = 0{sup +} states. Furthermore, the difference between VP and SP is found small (with exception of peak height in the toroidal mode). In the low-energy isovector dipole (pygmy) and isoscalar toroidal modes, the branch K{sup π} = 1{sup -} is shown to dominate over the K{sup π} = 0{sup -} one in the range of excitation energy E < 8-10 MeV. The effect becomes impressive for the toroidal resonance whose low-energy part is concentrated in a high peak of almost pure K{sup π} = 1{sup -} nature. This peculiarity may be used as a fingerprint of the toroidal mode in future experiments. The interplay between pygmy, toroidal and compression resonances is discussed, the interpretation of the observed isoscalar giant dipole resonance is partly revised. (orig.)

  18. Enthalpic pair wise self-interactions of four deoxynucleosides (dU, dC, dG, dT) in (dimethylsulfoxide + water) mixtures at T = 298.15 K

    International Nuclear Information System (INIS)

    Jia, Zhao-Peng; Chen, Nan; Wang, Hua-Qin; Zhu, Li-Yuan; Hu, Xin-Gen

    2014-01-01

    Graphical abstract: Enthalpic pairwise self-interaction coefficients (h xx ) of the four 2′-deoxynucleosides are of uneven increasing magnitudes (■, 2′-deoxyuridine; ▪, 2′-deoxycytidine; ▪, 2′-deoxyguanosine; ▪, 2′-deoxythymidine). - Highlights: • Dilution enthalpies of 2′-deoxynucleosides in (DMSO + water) mixtures were determined. • Enthalpic coefficients (h xx ) were calculated based on McMillan–Mayer’ theory. • The values of h xx are large negative cross the studied range of mixed solvents. • Hydrophilic interactions are proved to be prevailing in the ternary solutions. • The trends of h xx depend on the (hydrophobic / hydrophilic) equilibrium of solutes. - Abstract: The dilution enthalpies of four 2′-deoxynucleosides, namely 2′-deoxyuridine (dU), 2′-deoxycytidine (dC), 2′-deoxyguanosine (dG) and 2′-deoxythymidine (dT), in (dimethylsulfoxide (DMSO) + water) mixtures of various mass fractions (w DMSO = 0 to 0.30) have been determined at T = 298.15 K, respectively, using an isothermal titration calorimeter (ITC200 MicroCal). On the basis of McMillan–Mayer’ theory, enthalpic pair wise self-interaction coefficients (h xx ) of each compound at different values of w DMSO have been evaluated from successive dilution enthalpies. It was found that the values of h xx are all large negative and increase gradually with w DMSO across the whole composition range of the mixed solvent studied, though the degree of variation among them is somewhat different. The results indicate that (hydrophilic + hydrophilic) interactions are prevailing over (hydrophobic + hydrophobic) and (hydrophobic + hydrophilic) interactions in the ternary aqueous solutions under study

  19. Use of discriminant analysis to determine black shales of the Lesser Carpathian crystal field

    Energy Technology Data Exchange (ETDEWEB)

    Khun, M.

    1980-01-01

    Discriminant analysis of results from geochemical testing was used to separate black shales of the ore level from the nonproductive deposits. Based on a large number of experiments, the accuracy of isolating the black shales according to content of vandium, copper and nickel reached 78%. These elements have basic importance for separation of productive shales from nonproductive.

  20. Crossover from phonon-mediated to repulsion-induced superconducting pairing with large momentum

    International Nuclear Information System (INIS)

    Belyavsky, V.I.; Kopaev, Yu.V.; Nguyen, N.T.; Togushova, Yu.N.

    2005-01-01

    There are asymmetric and symmetric solutions of the self-consistency equation which takes into account both phonon-mediated and Coulomb pairing interactions. The first of them leads to the order parameter with a nodal line and, in the case of pairing with large momentum, exists at any repulsive and attractive strengths. The second one arises if the attraction exceeds a level depending on the repulsion strength and dominates the pairing in the strong attraction limit. The competition of attraction and repulsion results in unusual isotope-effect exponent observed in the cuprates