WorldWideScience

Sample records for nonproductive base-pairing interactions

  1. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  2. Accurate interaction energies of base pairing and base stacking. The final chapter

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

    2005-01-01

    Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

  3. Interactions between Cellulolytic Enzymes with Native, Autohydrolysis, and Technical Lignins and the Effect of a Polysorbate Amphiphile in Reducing Nonproductive Binding.

    Science.gov (United States)

    Fritz, Consuelo; Ferrer, Ana; Salas, Carlos; Jameel, Hasan; Rojas, Orlando J

    2015-12-14

    Understanding enzyme-substrate interactions is critical in designing strategies for bioconversion of lignocellulosic biomass. In this study we monitored molecular events, in situ and in real time, including the adsorption and desorption of cellulolytic enzymes on lignins and cellulose, by using quartz crystal microgravimetry and surface plasmon resonance. The effect of a nonionic surface active molecule was also elucidated. Three lignin substrates relevant to the sugar platform in biorefinery efforts were considered, namely, hardwood autohydrolysis cellulolytic (HWAH), hardwood native cellulolytic (MPCEL), and nonwood native cellulolytic (WSCEL) lignin. In addition, Kraft lignins derived from softwoods (SWK) and hardwoods (HWK) were used as references. The results indicated a high affinity between the lignins with both, monocomponent and multicomponent enzymes. More importantly, the addition of nonionic surfactants at concentrations above their critical micelle concentration reduced remarkably (by over 90%) the nonproductive interactions between the cellulolytic enzymes and the lignins. This effect was hypothesized to be a consequence of the balance of hydrophobic and hydrogen bonding interactions. Moreover, the reduction of surface roughness and increased wettability of lignin surfaces upon surfactant treatment contributed to a lower affinity with the enzymes. Conformational changes of cellulases were observed upon their adsorption on lignin carrying preadsorbed surfactant. Weak electrostatic interactions were determined in aqueous media at pH between 4.8 and 5.5 for the native cellulolytic lignins (MPCEL and WSCEL), whereby a ∼20% reduction in the enzyme affinity was observed. This was mainly explained by electrostatic interactions (osmotic pressure effects) between charged lignins and cellulases. Noteworthy, adsorption of nonionic surfactants onto cellulose, in the form cellulose nanofibrils, did not affect its hydrolytic conversion. Overall, our results

  4. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

    2010-01-01

    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  5. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  6. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  7. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  8. Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Tiwari, Gargi, E-mail: gargi.tiwari@rediffmail.com; Sharma, Dipendra, E-mail: d-11sharma@rediffmail.com; Dwivedi, K. K., E-mail: dwivedikarunesh4@gmail.com [Department of Physics, DDU Gorakhpur University, Gorakhpur (India); Dwivedi, M. K., E-mail: dwivedi-ji@rediffmail.com [Department of Physics, Banaras Hindu University, Varanasi (India)

    2016-05-06

    The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.

  9. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

    Science.gov (United States)

    Mondal Roy, Sutapa

    2018-08-01

    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  11. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  12. Interactions between Al₁₂X (X = Al, C, N and P) nanoparticles and DNA nucleobases/base pairs: implications for nanotoxicity.

    Science.gov (United States)

    Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang

    2012-02-01

    The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.

  13. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    International Nuclear Information System (INIS)

    Bricault, Christine A.; Perry, Keith L.

    2013-01-01

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility

  14. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    Energy Technology Data Exchange (ETDEWEB)

    Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: KLP3@cornell.edu [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)

    2013-06-05

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

  15. The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study.

    Science.gov (United States)

    Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo

    2013-02-12

    We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

  16. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  17. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    Science.gov (United States)

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  18. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  19. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  20. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  1. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  2. 29 CFR 778.318 - Productive and nonproductive hours of work.

    Science.gov (United States)

    2010-07-01

    ... Special Problems Effect of Failure to Count Or Pay for Certain Working Hours § 778.318 Productive and... Act; such nonproductive working hours must be counted and paid for. (b) Compensation payable for... which such nonproductive hours are properly counted as working time but no special hourly rate is...

  3. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  4. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  5. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi

    2015-01-01

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  6. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  7. Non-Production Benefits of Education: Crime, Health, and Good Citizenship. NBER Working Paper No. 16722

    Science.gov (United States)

    Lochner, Lance

    2011-01-01

    A growing body of work suggests that education offers a wide-range of benefits that extend beyond increases in labor market productivity. Improvements in education can lower crime, improve health, and increase voting and democratic participation. This chapter reviews recent developments on these "non-production" benefits of education with an…

  8. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2012-01-01

    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  9. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-01-01

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  10. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    Science.gov (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  11. Theoretical study of GC+/GC base pair derivatives

    International Nuclear Information System (INIS)

    Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu

    2005-01-01

    The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

  12. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  13. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  14. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  15. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  16. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  18. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

    2005-01-01

    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  19. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  20. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  1. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  2. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  3. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  4. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-01-01

    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  5. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    International Nuclear Information System (INIS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-01-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

  7. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

    International Nuclear Information System (INIS)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-01

    Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

  8. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  9. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  10. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  11. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.

    2001-01-01

    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  12. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  13. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  14. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  15. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  17. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  18. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  19. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  20. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  1. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    Science.gov (United States)

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  2. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  3. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  4. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  5. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

    OpenAIRE

    Lang, Gregory I.; Murray, Andrew W.

    2008-01-01

    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  6. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    Science.gov (United States)

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  8. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  10. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  11. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  12. Lignin from hydrothermally pretreated grass biomass retards enzymatic cellulose degradation by acting as a physical barrier rather than by inducing nonproductive adsorption of enzymes

    DEFF Research Database (Denmark)

    Djajadi, Demi T.; Jensen, Mads M.; Oliveira, Marlene

    2018-01-01

    Lignin is known to hinder efficient enzymatic conversion of lignocellulose in biorefining processes. In particular, nonproductive adsorption of cellulases onto lignin is considered a key mechanism to explain how lignin retards enzymatic cellulose conversion in extended reactions. Lignin-rich resi...

  13. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    Science.gov (United States)

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  15. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  16. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

    2002-01-01

    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  17. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  18. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  19. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  20. Triple helical DNA in a duplex context and base pair opening

    Science.gov (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  1. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  2. Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

    2000-01-01

    Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

  3. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  4. Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

    2012-01-01

    Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

  5. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    Science.gov (United States)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  6. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

    Science.gov (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2017-05-01

    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  7. SIMULATION AS AN APPROPRIATE WAY OF VERIFYING THE EFFICIENCY OF PRODUCTION VARIANTS IN THE DESIGN OF PRODUCTION AND NON-PRODUCTION SYSTEMS

    Directory of Open Access Journals (Sweden)

    Marek Kliment

    2014-12-01

    Full Text Available The paper deals with simulation and her forms of use in designing of production and non-production systems. Points to the possibility of using software can help in planning and subsequently in other phase of the lifecycle production and products. Article informs about some of the advantages of this type of software and his options. Sets out some theoretical knowledge of simulation and in the practical part presents some frequently used simulation software.

  8. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-01-01

    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  9. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  10. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  12. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  13. Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls

    OpenAIRE

    Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David

    2015-01-01

    International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

  14. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

    2008-01-01

    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  15. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  16. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  17. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  18. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  19. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  20. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  1. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  2. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  3. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  4. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  5. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  6. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

    OpenAIRE

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  7. Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

    Science.gov (United States)

    Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

    2018-02-19

    It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

  8. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  9. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    Science.gov (United States)

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  10. Lignin from hydrothermally pretreated grass biomass retards enzymatic cellulose degradation by acting as a physical barrier rather than by inducing nonproductive adsorption of enzymes.

    Science.gov (United States)

    Djajadi, Demi T; Jensen, Mads M; Oliveira, Marlene; Jensen, Anders; Thygesen, Lisbeth G; Pinelo, Manuel; Glasius, Marianne; Jørgensen, Henning; Meyer, Anne S

    2018-01-01

    Lignin is known to hinder efficient enzymatic conversion of lignocellulose in biorefining processes. In particular, nonproductive adsorption of cellulases onto lignin is considered a key mechanism to explain how lignin retards enzymatic cellulose conversion in extended reactions. Lignin-rich residues (LRRs) were prepared via extensive enzymatic cellulose degradation of corn stover ( Zea mays subsp. mays L.), Miscanthus  ×  giganteus stalks (MS) and wheat straw ( Triticum aestivum L.) (WS) samples that each had been hydrothermally pretreated at three severity factors (log R 0 ) of 3.65, 3.83 and 3.97. The LRRs had different residual carbohydrate levels-the highest in MS; the lowest in WS. The residual carbohydrate was not traceable at the surface of the LRRs particles by ATR-FTIR analysis. The chemical properties of the lignin in the LRRs varied across the three types of biomass, but monolignols composition was not affected by the severity factor. When pure cellulose was added to a mixture of LRRs and a commercial cellulolytic enzyme preparation, the rate and extent of glucose release were unaffected by the presence of LRRs regardless of biomass type and severity factor, despite adsorption of the enzymes to the LRRs. Since the surface of the LRRs particles were covered by lignin, the data suggest that the retardation of enzymatic cellulose degradation during extended reaction on lignocellulosic substrates is due to physical blockage of the access of enzymes to the cellulose caused by the gradual accumulation of lignin at the surface of the biomass particles rather than by nonproductive enzyme adsorption. The study suggests that lignin from hydrothermally pretreated grass biomass retards enzymatic cellulose degradation by acting as a physical barrier blocking the access of enzymes to cellulose rather than by inducing retardation through nonproductive adsorption of enzymes.

  11. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  12. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

  14. NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

    International Nuclear Information System (INIS)

    Li, Ying; Wilson, W.D.; Zon, G.

    1991-01-01

    1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

  15. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  16. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  17. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    Science.gov (United States)

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  18. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  19. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  20. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

    Science.gov (United States)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

    2018-02-01

    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  1. Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

    Directory of Open Access Journals (Sweden)

    Ol'ha O. Brovarets'

    2018-02-01

    Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

  2. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  3. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  4. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  5. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Science.gov (United States)

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  6. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles.

    Science.gov (United States)

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal

    2016-07-14

    Ice nanoparticles (H2O)N, N ≈ 450 generated in a molecular beam experiment pick up individual gas phase molecules of 2-hydroxypyridine and 2-pyridone (HP) evaporated in a pickup cell at temperatures between 298 and 343 K. The mass spectra of the doped nanoparticles show evidence for generation of clusters of adsorbed molecules (HP)n up to n = 8. The clusters are ionized either by 70 eV electrons or by two photons at 315 nm (3.94 eV). The two ionization methods yield different spectra, and their comparison provides an insight into the neutral cluster composition, ionization and intracluster ion-molecule reactions, and cluster fragmentation. Quite a few molecules were reported not to coagulate on ice nanoparticles previously. The (HP)n cluster generation on ice nanoparticles represents the first evidence for coagulating of molecules and cluster formation on free ice nanoparticles. For comparison, we investigate the coagulation of HP molecules picked up on large clusters ArN, N ≈ 205, and also (HP)n clusters generated in supersonic expansions with Ar buffer gas. This comparison points to a propensity for the (HP)2 dimer generation on ice nanoparticles. This shows the feasibility of base pairing for model of biological molecules on free ice nanoparticles. This result is important for hypotheses of the biomolecule synthesis on ice grains in the space. We support our findings by theoretical calculations that show, among others, the HP dimer structures on water clusters.

  7. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  8. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

    2010-01-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  9. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  10. A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

    NARCIS (Netherlands)

    Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.

    2014-01-01

    We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

  11. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  12. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  13. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  14. Identification of the base-pairing requirements for repression of hctA translation by the small RNA IhtA leads to the discovery of a new mRNA target in Chlamydia trachomatis.

    Directory of Open Access Journals (Sweden)

    Nicole A Grieshaber

    Full Text Available The non-coding small RNA, IhtA expressed by the obligate intracellular human pathogen Chlamydia trachomatis modulates the translation of HctA, a key protein involved in replicative to infectious cell type differentiation. Using a combination of bioinformatics and mutagenesis we sought to identify the base pairing requirement for functional repression of HctA protein expression, with an eye to applying our findings towards the identification of additional targets. IhtA is predicted to fold into a three stem:loop structure. We found that loop 1 occludes the initiation codon of hctA, while loop 2 and 3 are not required for function. This 7 nucleotide region forms G/C rich interactions surrounding the AUG of hctA. Two additional genes in the chlamydial genome, CTL0322 and CTL0097, contained some elements of the hctA:IhtA recognition sequence. The mRNA of both CTL0322and CTL0097 interacted with IhtA in vitro as measured by biolayer interferometry. However, using a CheZ reporter expression system, IhtA only inhibited the translation of CTL0322. The proposed IhtA recognition site in the CTL0322 message contains significant G/C base pairing on either side of the initiation codon while CTL0097 only contains G/C base pairing 3' to the AUG initiation codon. These data suggest that as the functional interacting region is only 6-7nt in length that full translation repression is dependent on the degree of G/C base pairing. Additionally our results indicate that IhtA may regulate multiple mRNAs involved in the chlamydial infectious cycle.

  15. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  16. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  18. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    Science.gov (United States)

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  19. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-01-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  20. Spliceosomal small nuclear RNAs of Tetrahymena thermophila and some possible snRNA-snRNA base-pairing interactions

    DEFF Research Database (Denmark)

    Orum, H; Nielsen, Henrik; Engberg, J

    1991-01-01

    We have identified and characterized the full set of spliceosomal small nuclear RNAs (snRNAs; U1, U2, U4, U5 and U6) from the ciliated protozoan Tetrahymena thermophila. With the exception of U4 snRNA, the sizes of the T. thermophila snRNAs are closely similar to their metazoan homologues. The T....... thermophila snRNAs all have unique 5' ends, which start with an adenine residue. In contrast, with the exception of U6, their 3' ends show some size heterogeneity. The primary sequences of the T. thermophila snRNAs contain the sequence motifs shown, or proposed, to be of functional importance in other...

  1. Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code

    Science.gov (United States)

    Rozov, Alexey; Demeshkina, Natalia; Khusainov, Iskander; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara

    2016-01-01

    Posttranscriptional modifications at the wobble position of transfer RNAs play a substantial role in deciphering the degenerate genetic code on the ribosome. The number and variety of modifications suggest different mechanisms of action during messenger RNA decoding, of which only a few were described so far. Here, on the basis of several 70S ribosome complex X-ray structures, we demonstrate how Escherichia coli tRNALysUUU with hypermodified 5-methylaminomethyl-2-thiouridine (mnm5s2U) at the wobble position discriminates between cognate codons AAA and AAG, and near-cognate stop codon UAA or isoleucine codon AUA, with which it forms pyrimidine-pyrimidine mismatches. We show that mnm5s2U forms an unusual pair with guanosine at the wobble position that expands general knowledge on the degeneracy of the genetic code and specifies a powerful role of tRNA modifications in translation. Our models consolidate the translational fidelity mechanism proposed previously where the steric complementarity and shape acceptance dominate the decoding mechanism.

  2. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  3. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    Science.gov (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  7. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  8. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

  9. UV-inactivation of Epstein-Barr virus: differences in early antigen expression in two different non-productive cell lines and influence of caffeine

    International Nuclear Information System (INIS)

    Suchankova, A.; Vonka, V.

    1978-01-01

    Two non-productive Epstein-Barr (EB) virus genome-carrying lymphoblastoid cell lines, namely Raji and NC37, were used for studying the effect of UV irradiation on the ability of P3HR-1 EB virus to induce early antigen (EA) formation. In NC37 cells infected with UV-irradiated virus the formation of EA was delayed; thus the slope of inactivation curve based on the early (24 hr) reading was steeper than that based on the late (72 hr) reading. This was not observed in Raji cells. Caffeine did not influence the percentage of EA positive cells in cultures infected with untreated virus; however, the drug exhibited a marked inhibitory effect on EA production after infection with UV-irradiated virus. The sensitivity to caffeine decreased more rapidly with time after infection of Raji than of NC37 cells, suggesting a higher degree of readiness of the host cell repair system in the former than in the latter cells. The caffeine effect was merely directed against the synthesis of R (restricted) component of EA; its influence on the D (diffuse) component formation was negligible. (author)

  10. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  11. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  12. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

    OpenAIRE

    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

    2012-01-01

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  13. Generation and characterization of an anti-delta like ligand-4 Nanobody to induce non-productive angiogenesis.

    Science.gov (United States)

    Baharlou, Rasoul; Tajik, Nader; Habibi-Anbouhi, Mahdi; Shokrgozar, Mohammad Ali; Zarnani, Amir-Hassan; Shahhosseini, Fatemeh; Behdani, Mahdi

    2018-03-01

    Antibody-based targeting of angiogenesis is a key approach for cancer treatment. Delta-like ligand 4 (DLL4) plays a pivotal role in tumor neovascular development and angiogenesis during tumor progression. It forecasts the prognosis of human malignancies and blocking its signaling can help to inhibit neovascularization and tumor metastasis. Nanobodies are the smallest antigen-binding domains of heavy chain antibodies in camelidae. The aim of this study was to develop a Nanobody against DLL4 and apply binding and functional approaches to target it. In this work, a Nanobody library against human recombinant DLL4 was developed. After panning, the periplasmic-extract (PE) of individual colonies were screened through ELISA. The interactions between Nanobody and DLL4 were assessed using immunohistochemistry and FACS. The functional assessment was carried out via tube formation assay. We selected a Nanobody (3Nb3) with a high binding signal to DLL4, associated with a binding affinity of 3.6 nM. It was demonstrated that 3Nb3 binds to native DLL4 on the surface of MKN cells and gastric carcinoma tissue, and also inhibits the maturation of capillary-like structures in HUVECs. The results were indicative of the potential of Nanobody for DLL4 identification and can broaden the scope for development of cancer diagnosis and treatment techniques. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

    Science.gov (United States)

    Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

    1984-06-19

    The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

    Directory of Open Access Journals (Sweden)

    Sergei Kuchin

    2011-03-01

    Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

  16. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  17. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    Energy Technology Data Exchange (ETDEWEB)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

    2016-02-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  18. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-01-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  19. Effect of protonation on the electronic properties of DNA base pairs: applications for molecular electronics.

    Science.gov (United States)

    Mallajosyula, Sairam S; Pati, Swapan K

    2007-10-11

    Protonation of DNA basepairs is a reversible phenomenon that can be controlled by tuning the pH of the system. Under mild acidic conditions, the hydrogen-bonding pattern of the DNA basepairs undergoes a change. We study the effect of protonation on the electronic properties of the DNA basepairs to probe for possible molecular electronics applications. We find that, under mild acidic pH conditions, the A:T basepair shows excellent rectification behavior that is, however, absent in the G:C basepair. The mechanism of rectification has been discussed using a simple chemical potential model. We also consider the noncanonical A:A basepair and find that it can be used as efficient pH dependent molecular switch. The switching action in the A:A basepair is explained in the light of pi-pi interactions, which lead to efficient delocalization over the entire basepair.

  20. Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

    International Nuclear Information System (INIS)

    Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

    2003-01-01

    Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

  1. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  2. A naproxen complex of dysprosium intercalates into calf thymus DNA base pairs

    International Nuclear Information System (INIS)

    Yang, Mengsi; Jin, Jianhua; Xu, Guiqing; Cui, Fengling; Luo, Hongxia

    2014-01-01

    Highlights: • Binding mode to ctDNA was studied by various methods. • Intercalation is the most possible binding mode. • Dynamic and static quenching occurred simultaneously. • Hydrophobic force played a major role. • Binding characteristic of rare earth complexes to DNA are dependent on the element. - Abstract: The binding mode and mechanism of dysprosium–naproxen complex (Dy–NAP) with calf thymus deoxyribonucleic acid (ctDNA) were studied using UV–vis and fluorescence spectra in physiological buffer (pH 7.4). The results showed that more than one type of quenching process occurred and the binding mode between Dy–NAP with ctDNA might be intercalation. In addition, ionic strength, iodide quenching and fluorescence polarization experiments corroborated the intercalation binding mode between Dy–NAP and ctDNA. The calculated thermodynamic parameters ΔG, ΔH and ΔS at different temperature demonstrated that hydrophobic interaction force played a major role in the binding process

  3. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  4. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    Science.gov (United States)

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  5. Theoretical study on the structure, stability, and electronic properties of the guanine-Zn-cytosine base pair in M-DNA

    International Nuclear Information System (INIS)

    Fuentes-Cabrera, Miguel A.; Sumpter, Bobby G.; Sponer, Judit; Sponer, Jiri; Petit, Leon; Wells, Jack C.

    2007-01-01

    M-DNA is a type of metalated DNA that forms at high pH and in the presence of Zn, Ni, and Co, with the metals placed in between each base pair, as in G-Zn-C. Experiments have found that M-DNA could be a promising candidate for a variety of nanotechnological applications, as it is speculated that the metal d-states enhance the conductivity, but controversy still clouds these findings. In this paper, we carry out a comprehensive ab initio study of eight G-Zn-C models in the gas phase to help discern the structure and electronic properties of Zn-DNA. Specifically, we study whether a model prefers to be planar and has electronic properties that correlate with Zn-DNA having a metallic-like conductivity. Out of all the studied models, there is only one which preserves its planarity upon full geometry optimization. Nevertheless, starting from this model, one can deduce a parallel Zn-DNA architecture only. This duplex would contain the imino proton, in contrast to what has been proposed experimentally. Among the nonplanar models, there is one that requires less than 8 kcal/mol to flatten (both in gas and solvent conditions), and we propose that it is a plausible model for building an antiparallel duplex. In this duplex, the imino proton would be replaced by Zn, in accordance with experimental models. Neither planar nor nonplanar models have electronic properties that correlate with Zn-DNA having a metallic-like conductivity due to Zn d-states. To understand whether density functional theory (DFT) can describe appropriately the electronic properties of M-DNAs, we have investigated the electronic properties of G-Co-C base pairs. We have found that when self-interaction corrections (SIC) are not included the HOMO state contains Co d-levels, whereas these levels are moved below the HOMO state when SIC are considered. This result indicates that caution should be exercised when studying the electronic properties of M-DNAs with functionals that do not account for strong

  6. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  7. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu

    2012-08-01

    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  8. Automation and decision support in interactive consumer products.

    OpenAIRE

    Sauer, J.; Rüttinger, B.

    2007-01-01

    This article presents two empirical studies (n=30, n=48) that are concerned with different forms of automation in interactive consumer products. The goal of the studies was to evaluate the effectiveness of two types of automation: perceptual augmentation (i.e. supporting users' action selection and implementation). Furthermore, the effectiveness of non-product information (i.e. labels attached to product) in supporting automation design was evaluated. The findings suggested greater benefits f...

  9. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  10. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

    Science.gov (United States)

    Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

    1998-01-01

    This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

  12. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

    Science.gov (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  13. A Novel Mechanism of High-Level, Broad-Spectrum Antibiotic Resistance Caused by a Single Base Pair Change in Neisseria gonorrhoeae

    Science.gov (United States)

    2011-09-20

    respect, Eisenstein and Sparling noted that a single base pair deletion in the inverted repeat in the mtrR promoter, a mutation which also confers high...Regulation of the MtrC-MtrD-MtrE efflux-pump system modulates the in vivo fitness of Neisseria gonorrhoeae. J. Infect. Dis. 196:1804 –1812. 21. Eisenstein BI

  14. High-Resolution Nuclear Magnetic Resonance Determination of Transfer RNA Tertiary Base Pairs in Solution. 2. Species Containing a Large Variable Loop

    NARCIS (Netherlands)

    HURD, RE; ROBILLARD, GT; REID, BR

    1977-01-01

    The number of base pairs in the solution structure of several class III D3VN tRNA species from E. coli has been determined by analyzing the number of low-field (-15 to -11 ppm) proton resonances in their nuclear magnetic resonance spectra at 360 MHz. Contrary to previous reports indicating the

  15. Structures, physicochemical properties, and applications of T-Hg-II-T, C-Ag-I-C, and other metallo-base-pairs

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.

    2015-01-01

    Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015

  16. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

    2016-01-01

    Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  18. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    Science.gov (United States)

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  19. Deficient incorporation of spike protein into virions contributes to the lack of infectivity following establishment of a persistent, non-productive infection in oligodendroglial cell culture by murine coronavirus

    International Nuclear Information System (INIS)

    Liu Yin; Herbst, Werner; Cao Jianzhong; Zhang Xuming

    2011-01-01

    Infection of mouse oligodendrocytes with a recombinant mouse hepatitis virus (MHV) expressing a green fluorescence protein facilitated specific selection of virus-infected cells and subsequent establishment of persistence. Interestingly, while viral genomic RNAs persisted in infected cells over 14 subsequent passages with concomitant synthesis of viral subgenomic mRNAs and structural proteins, no infectious virus was isolated beyond passage 2. Further biochemical and electron microscopic analyses revealed that virions, while assembled, contained little spike in the envelope, indicating that lack of infectivity during persistence was likely due to deficiency in spike incorporation. This type of non-lytic, non-productive persistence in oligodendrocytes is unique among animal viruses and resembles MHV persistence previously observed in the mouse central nervous system. Thus, establishment of such a culture system that can recapitulate the in vivo phenomenon will provide a powerful approach for elucidating the mechanisms of coronavirus persistence in glial cells at the cellular and molecular levels.

  20. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

    Science.gov (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

    2012-09-12

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  1. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

    Science.gov (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

    2012-01-01

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  2. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs

    DEFF Research Database (Denmark)

    van Beest, M; Dooijes, D; van De Wetering, M

    2000-01-01

    Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment...

  3. The base pairing RNA Spot 42 participates in a multi-output feedforward loop to help enact catabolite repression in Escherichia coli

    Science.gov (United States)

    Beisel, Chase L.; Storz, Gisela

    2011-01-01

    SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161

  4. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    Science.gov (United States)

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet

    Czech Academy of Sciences Publication Activity Database

    Dhami, K.; Malyshev, D. A.; Ordoukhanian, P.; Kubelka, Tomáš; Hocek, Michal; Romesberg, F. E.

    2014-01-01

    Roč. 42, č. 16 (2014), s. 10235-10244 ISSN 0305-1048 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : unnatural base pairs * DNA * dTPT3-dNaM Subject RIV: CE - Biochemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/16/10235

  6. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    Energy Technology Data Exchange (ETDEWEB)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

    2016-04-19

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  7. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    Science.gov (United States)

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  8. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  10. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  11. Effect of the sulphur atom on geometry and spectra of the biomolecule 2-thiouracil and in the WC base pair 2-thiouridine-adenosine. Influence of water in the first hydration shell.

    Science.gov (United States)

    Alcolea Palafox, M; Rastogi, V K; Singh, S P

    2018-04-01

    The effect of the sulphur atom on 2-thiouracil (2TU) and 2-thiouridine molecules, as compared with uracil and uridine molecules, respectively, was carried out in several environments. The predicted IR spectrum of 2TU in the isolated state was compared with that obtained for uracil molecule and with those reported experimentally in matrix isolation. Its crystal unit cell in the solid state was simulated through a tetramer form using DFT methods for the first time. The calculated Raman spectrum was compared to the experimental ones in the solid state. A linear scaling procedure was used for this task. The first hydration shell was simulated by explicit number of water molecules surrounding 2TU up to 30 and was compared with that obtained in uracil molecule. Water molecules 'distributed' around 2TU was preferred over that 'clustering', because it can better reproduce the hydration and their effects on different parameters of the molecular structure of 2TU and uracil. The total atomic charges and several calculated thermodynamic parameters were discussed. The effect of the sulphur atom on the Watson-Crick (WC) and reverse WC base pair uridine-adenosine was estimated, and the CP corrected interaction energies were calculated. 2-thiouridine has a weaker WC pair than that with uridine, although its slight higher dipole moment (μ) facilitates the interaction with the water molecules. Several helical parameters were determined.

  12. Electron attachment to the guanine-cytosine nucleic acid base pair and the effects of monohydration and proton transfer.

    Science.gov (United States)

    Gupta, Ashutosh; Jaeger, Heather M; Compaan, Katherine R; Schaefer, Henry F

    2012-05-17

    The guanine-cytosine (GC) radical anion and its interaction with a single water molecule is studied using ab initio and density functional methods. Z-averaged second-order perturbation theory (ZAPT2) was applied to GC radical anion for the first time. Predicted spin densities show that the radical character is localized on cytosine. The Watson-Crick monohydrated GC anion is compared to neutral GC·H2O, as well as to the proton-transferred analogue on the basis of structural and energetic properties. In all three systems, local minima are identified that correspond to water positioned in the major and minor grooves of macromolecular DNA. On the anionic surface, two novel structures have water positioned above or below the GC plane. On the neutral and anionic surfaces, the global minimum can be described as water interacting with the minor groove. These structures are predicted to have hydration energies of 9.7 and 11.8 kcal mol(-1), respectively. Upon interbase proton-transfer (PT), the anionic global minimum has water positioned in the major groove, and the hydration energy increases to 13.4 kcal mol(-1). PT GC·H2O(•-) has distonic character; the radical character resides on cytosine, while the negative charge is localized on guanine. The effects of proton transfer are further investigated through the computed adiabatic electron affinities (AEA) of GC and monohydrated GC, and the vertical detachment energies (VDE) of the corresponding anions. Monohydration increases the AEAs and VDEs by only 0.1 eV, while proton-transfer increases the VDEs substantially (0.8 eV). The molecular charge distribution of monohydrated guanine-cytosine radical anion depends heavily on interbase proton transfer.

  13. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    Science.gov (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  14. Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

    KAUST Repository

    Basset, Jean-Marie

    2016-06-09

    The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

  15. INTERACT

    DEFF Research Database (Denmark)

    Jochum, Elizabeth; Borggreen, Gunhild; Murphey, TD

    This paper considers the impact of visual art and performance on robotics and human-computer interaction and outlines a research project that combines puppetry and live performance with robotics. Kinesics—communication through movement—is the foundation of many theatre and performance traditions ...

  16. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  17. Physical mapping of a 330 X 10(3)-base-pair region of the Myxococcus xanthus chromosome that is preferentially labeled during spore germination

    International Nuclear Information System (INIS)

    Komano, T.; Inouye, S.; Inouye, M.

    1985-01-01

    Myxococcus xanthus was pulse-labeled with [ 3 H]thymidine immediately after germination of dimethyl sulfoxide-induced spores. The restriction enzyme digests of the total chromosomal DNA from the pulse- labeled cells were analyzed by one-dimensional as well as two- dimensional agarose gel electrophoresis. Four PstI fragments preferentially labeled at a very early stage of germination were cloned into the unique PstI site of pBR322. By using these clones as probes, a restriction enzyme map was established covering approximately 6% of the total M. xanthus genome (330 X 10(3) base pairs). The distribution of the specific activities of the restriction fragments pulse-labeled after germination suggests a bidirectional mode of DNA replication from a fixed origin

  18. A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards‡

    Science.gov (United States)

    Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

    2009-01-01

    Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246

  19. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

    Science.gov (United States)

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

    2005-01-01

    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  20. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Minoshima, Yusuke; Seki, Yusuke [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Takayanagi, Toshiyuki, E-mail: tako@mail.saitama-u.ac.jp [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Shiga, Motoyuki [Center for Computational Science and E-Systems, Japan Atomic Energy Agency, 148-4, Kashiwanoha Campus, 178-4 Wakashiba, Kashiwa, Chiba 277-0871 (Japan)

    2016-06-15

    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  1. A Single Base Pair Mutation Encoding a Premature Stop Codon in the MIS type II receptor is Responsible for Canine Persistent Müllerian Duct Syndrome

    Science.gov (United States)

    Wu, Xiufeng; Wan, Shengqin; Pujar, Shashikant; Haskins, Mark E.; Schlafer, Donald H.; Lee, Mary M.; Meyers-Wallen, Vicki N.

    2008-01-01

    Müllerian Inhibiting Substance (MIS), a secreted glycoprotein in the Transforming Growth Factor-beta (TGF-beta) family of growth factors, mediates regression of the Müllerian ducts during embryonic sex differentiation in males. In Persistent Müllerian Duct Syndrome (PMDS), rather than undergoing involution, the Müllerian ducts persist in males, giving rise to the uterus, Fallopian tubes, and upper vagina. Genetic defects in MIS or its receptor (MISRII) have been identified in patients with PMDS. The phenotype in the canine model of PMDS derived from the miniature schnauzer breed is strikingly similar to that of human patients. In this model, PMDS is inherited as a sex-limited autosomal recessive trait. Previous studies indicated that a defect in the MIS receptor or its downstream signaling pathway was likely to be causative of the canine syndrome. In this study the canine PMDS phenotype and clinical sequelae are described in detail. Affected and unaffected members of this pedigree are genotyped, identifying a single base pair substitution in MISRII that introduces a stop codon in exon 3. The homozygous mutation terminates translation at 80 amino acids, eliminating much of the extracellular domain and the entire transmembrane and intracellular signaling domains. Findings in this model may enable insights to be garnered from correlation of detailed clinical descriptions with molecular defects, which are not otherwise possible in the human syndrome. PMID:18723470

  2. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    Science.gov (United States)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-01-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

  3. TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome

    Science.gov (United States)

    Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya

    2014-01-01

    Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301

  4. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    International Nuclear Information System (INIS)

    Minoshima, Yusuke; Seki, Yusuke; Takayanagi, Toshiyuki; Shiga, Motoyuki

    2016-01-01

    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  5. A single base-pair change in 2009 H1N1 hemagglutinin increases human receptor affinity and leads to efficient airborne viral transmission in ferrets.

    Directory of Open Access Journals (Sweden)

    Akila Jayaraman

    2011-03-01

    Full Text Available The 2009 H1N1 influenza A virus continues to circulate among the human population as the predominant H1N1 subtype. Epidemiological studies and airborne transmission studies using the ferret model have shown that the transmission efficiency of 2009 H1N1 viruses is lower than that of previous seasonal strains and the 1918 pandemic H1N1 strain. We recently correlated this reduced transmission efficiency to the lower binding affinity of the 2009 H1N1 hemagglutinin (HA to α2→6 sialylated glycan receptors (human receptors. Here we report that a single point mutation (Ile219→Lys; a base pair change in the glycan receptor-binding site (RBS of a representative 2009 H1N1 influenza A virus, A/California/04/09 or CA04/09, quantitatively increases its human receptor-binding affinity. The increased human receptor-affinity is in the same range as that of the HA from highly transmissible seasonal and 1918 pandemic H1N1 viruses. Moreover, a 2009 H1N1 virus carrying this mutation in the RBS (generated using reverse genetics transmits efficiently in ferrets by respiratory droplets thereby reestablishing our previously observed correlation between human receptor-binding affinity and transmission efficiency. These findings are significant in the context of monitoring the evolution of the currently circulating 2009 H1N1 viruses.

  6. Cyclic AMP regulation of the human glycoprotein hormone α-subunit gene is mediated by an 18-base-pair element

    International Nuclear Information System (INIS)

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.

    1987-01-01

    cAMP regulates transcription of the gene encoding the α-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the α-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the α-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the α-subunit gene

  7. Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

    2012-01-01

    P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

  8. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni; Riplinger, Christoph; Minenkov, Yury; Cavallo, Luigi; Auer, Alexander A.; Neese, Frank

    2017-01-01

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  9. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni

    2017-06-12

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  10. A one base pair deletion in the canine ATP13A2 gene causes exon skipping and late-onset neuronal ceroid lipofuscinosis in the Tibetan terrier.

    Directory of Open Access Journals (Sweden)

    Anne Wöhlke

    2011-10-01

    Full Text Available Neuronal ceroid lipofuscinosis (NCL is a progressive neurodegenerative disease characterized by brain and retinal atrophy and the intracellular accumulation of autofluorescent lysosomal storage bodies resembling lipofuscin in neurons and other cells. Tibetan terriers show a late-onset lethal form of NCL manifesting first visible signs at 5-7 years of age. Genome-wide association analyses for 12 Tibetan-terrier-NCL-cases and 7 Tibetan-terrier controls using the 127K canine Affymetrix SNP chip and mixed model analysis mapped NCL to dog chromosome (CFA 2 at 83.71-84.72 Mb. Multipoint linkage and association analyses in 376 Tibetan terriers confirmed this genomic region on CFA2. A mutation analysis for 14 positional candidate genes in two NCL-cases and one control revealed a strongly associated single nucleotide polymorphism (SNP in the MAPK PM20/PM21 gene and a perfectly with NCL associated single base pair deletion (c.1620delG within exon 16 of the ATP13A2 gene. The c.1620delG mutation in ATP13A2 causes skipping of exon 16 presumably due to a broken exonic splicing enhancer motif. As a result of this mutation, ATP13A2 lacks 69 amino acids. All known 24 NCL cases were homozygous for this deletion and all obligate 35 NCL-carriers were heterozygous. In a sample of 144 dogs from eleven other breeds, the c.1620delG mutation could not be found. Knowledge of the causative mutation for late-onset NCL in Tibetan terrier allows genetic testing of these dogs to avoid matings of carrier animals. ATP13A2 mutations have been described in familial Parkinson syndrome (PARK9. Tibetan terriers with these mutations provide a valuable model for a PARK9-linked disease and possibly for manganese toxicity in synucleinopathies.

  11. Influence of nucleotide modifications at the C2' position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA.

    Science.gov (United States)

    Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle

    2017-09-29

    Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Use of Nucleic Acid Analogs for the Study of Nucleic Acid Interactions

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2011-01-01

    Full Text Available Unnatural nucleosides have been explored to expand the properties and the applications of oligonucleotides. This paper briefly summarizes nucleic acid analogs in which the base is modified or replaced by an unnatural stacking group for the study of nucleic acid interactions. We also describe the nucleoside analogs of a base pair-mimic structure that we have examined. Although the base pair-mimic nucleosides possess a simplified stacking moiety of a phenyl or naphthyl group, they can be used as a structural analog of Watson-Crick base pairs. Remarkably, they can adopt two different conformations responding to their interaction energies, and one of them is the stacking conformation of the nonpolar aromatic group causing the site-selective flipping of the opposite base in a DNA double helix. The base pair-mimic nucleosides can be used to study the mechanism responsible for the base stacking and the flipping of bases out of a nucleic acid duplex.

  13. A theoretical study on interaction of proline with gold cluster

    Indian Academy of Sciences (India)

    with Au3 (Pakiari and Jamshidi 2007) and interaction of. ∗. Author for correspondence (harjinder.singh@iiit.ac.in) small gold clusters with xDNA base pairs (Sharma et al. 2009) have motivated us to carry out a theoretical study on interaction of proline with gold nanoparticles. Proline is unique among the natural amino acids ...

  14. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    Science.gov (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  15. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1988-01-01

    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  16. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  17. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Recognition by nonaromatic and stereochemical subunit-containing polyamides of the four Watson-Crick base pairs in the DNA minor groove.

    Science.gov (United States)

    Zhang, Hong-Fei; Wu, Yan-Ling; Jiang, Shi-Kun; Wang, Pu; Sugiyama, Hiroshi; Chen, Xing-Lai; Zhang, Wen; Ji, Yan-Juan; Guo, Chuan-Xin

    2012-06-18

    In order to develop an optimal subunit as a T-recognition element in hairpin polyamides, 15 novel chirality-modified polyamides containing (R)-α,β-diaminopropionic acid ((R) β α-NH 2), (S)-α,β-diaminopropionic acid ((S) β α-NH 2), (1R,3S)-3-aminocyclopentanecarboxylic acid ((RS) Cp), (1S,3R)-3-amino-cyclopentanecarboxylic acid ((RS) Cp), (1R,3R)-3-aminocyclopentanecarboxylic acid ((RR) Cp) and (1S,3S)-3-amino-cyclopentanecarboxylic acid ((SS) Cp) residues were synthesized. Their binding characteristics to DNA sequences 5'-TGCNCAT-3'/3'-ACGN'GTA-5' (N⋅N'=A⋅T, T⋅A, G⋅C and C⋅G) were systemically studied by surface plasmon resonance (SPR) and molecular simulation (MSim) techniques. SPR showed that polyamide 4, AcIm-(S) β α-NH 2-ImPy-γ-ImPy-β-Py-βDp (β/(S) β α-NH 2 pair), bound to a DNA sequence containing a core binding site of 5'-TGCACAT-3' with a dissociation equilibrium constant (K(D) ) of 4.5×10(-8)  m. This was a tenfold improvement in specificity over 5'-TGCTCAT-3' (K(D) =4.5×10(-7)  M). MSim studies supported the SPR results. More importantly, for the first time, we found that chiral 3-aminocyclopentanecarboxylic acids in polyamides can be employed as base readers with only a small decrease in binding affinity to DNA. In particular, SPR showed that polyamide 9 ((RR) Cp/β pair) had a 15-fold binding preference for 5'-TGCTCAT-3' over 5'-TGCACAT-3'. A large difference in standard free energy change for A⋅T over T⋅A was determined (ΔΔG(o) =5.9 kJ mol(-1) ), as was a twofold decrease in interaction energy by MSim. Moreover, a 1:1 stoichiometry (9 to 5'-TGCTCAT-3'/3'-ACGAGTA-5') was shown by MSim to be optimal for the chiral five-membered cycle to fit the minor groove. Collectively, the study suggests that the (S)-α-amino-β-aminopropionic acid and (1R,3R)-3-aminocyclopentanecarboxylic acid can serve as a T-recognition element, and the stereochemistry and the nature of these subunits significantly influence

  19. Identifying and characterizing Hfq-RNA interactions.

    Science.gov (United States)

    Faner, M A; Feig, A L

    2013-09-15

    To regulate stress responses and virulence, bacteria use small regulatory RNAs (sRNAs). These RNAs can up or down regulate target mRNAs through base pairing by influencing ribosomal access and RNA decay. A large class of these sRNAs, called trans-encoded sRNAs, requires the RNA binding protein Hfq to facilitate base pairing between the regulatory RNA and its target mRNA. The resulting network of regulation is best characterized in Escherichia coli and Salmonella typhimurium, but the importance of Hfq dependent sRNA regulation is recognized in a diverse population of bacteria. In this review we present the approaches and methods used to discover Hfq binding RNAs, characterize their interactions and elucidate their functions. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  1. Gene-gene interaction between the cystathionine beta-synthase 31 base pair variable number of tandem repeats and the methylenetetrahydrofolate reductase 677C > T polymorphism on homocysteine levels and risk for neural tube defects.

    NARCIS (Netherlands)

    Afman, L.A.; Lievers, K.J.; Kluijtmans, L.A.J.; Trijbels, J.M.F.; Blom, H.J.

    2003-01-01

    INTRODUCTION: Most studies showed that mothers of children with NTD have elevated homocysteine levels pointing to a disturbed homocysteine metabolism as a risk factor for NTD. Folate lowers homocysteine levels by remethylation of homocysteine to methionine. Homocysteine can be irreversibly converted

  2. Rapid detection of the H275Y oseltamivir resistance mutation in influenza A/H1N1 2009 by single base pair RT-PCR and high-resolution melting.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses.A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay.The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.

  3. Kinetics for exchange of imino protons in the d(C-G-C-G-A-A-T-T-C-G-C-G) double helix and in two similar helices that contain a G . T base pair, d(C-G-T-G-A-A-T-T-C-G-C-G), and an extra adenine, d(C-G-C-A-G-A-A-T-T-C-G-C-G).

    Science.gov (United States)

    Pardi, A; Morden, K M; Patel, D J; Tinoco, I

    1982-12-07

    The relaxation lifetimes of imino protons from individual base pairs were measured in (I) a perfect helix, d(C-G-C-G-A-A-T-T-C-G-C-G), (II) this helix with a G . C base pair replaced with a G . T base pair, d(C-G-T-G-A-A-T-T-C-G-C-G), and (III) the perfect helix with an extra adenine base in a mismatch, d(C-G-C-A-G-A-A-T-T-C-G-C-G). The lifetimes were measured by saturation recovery proton nuclear magnetic resonance experiments performed on the imino protons of these duplexes. The measured lifetimes of the imino protons were shown to correspond to chemical exchange lifetimes at higher temperatures and spin-lattice relaxation times at lower temperatures. Comparison of the lifetimes in these duplexes showed that the destabilizing effect of the G . T base pair in II affected the opening rate of only the nearest-neighbor base pairs. For helix III, the extra adenine affected the opening rates of all the base pairs in the helix and thus was a larger perturbation for opening of the base pairs than the G . T base pair. The temperature dependence of the exchange rates of the imino proton in the perfect helix gives values of 14-15 kcal/mol for activation energies of A . T imino protons. These relaxation rates were shown to correspond to exchange involving individual base pair opening in this helix, which means that one base-paired imino proton can exchange independent of the others. For the other two helices that contain perturbations, much larger activation energies for exchange of the imino protons were found, indicating that a cooperative transition involving exchange of at least several base pairs was the exchange mechanism of the imino protons. The effects of a perturbation in a helix on the exchange rates and the mechanisms for exchange of imino protons from oligonucleotide helices are discussed.

  4. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  5. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  6. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  7. Interaction of the Adenine-Thymine Watson-Crick and Adenine-Adenine Reverse-Hoogsteen DNA Base Pairs with Hydrated Group IIa (Mg .sup.2+./sup., Ca .sup.2+./sup., Sr .sup.2+./sup., Ba .sup.2+./sup.) and IIb (Zn .sup.2+./sup., Cd .sup.2+./sup., Hg .sup.2+./sup.) Metal Cations: Absence of the Base Pair Stabilization by Metal-Induced Polarization Effects

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Sabat, M.; Burda, J. V.; Leszczynski, J.; Hobza, Pavel

    1999-01-01

    Roč. 103, č. 13 (1999), s. 2528-2534 ISSN 1089-5647 R&D Projects: GA ČR GA203/97/0029 Grant - others:NSF(US) EHR108767; NIH(US) GM08047 Subject RIV: BO - Biophysics Impact factor: 3.265, year: 1999

  8. Interaction entre la proteine ribosomique L20 et l'ARN 23S : sondage direct par piege optique

    OpenAIRE

    Mangeol , Pierre

    2009-01-01

    This thesis is focused on force measurements applied to single RNA alone or associated with a protein. One of the biggest challenges arising when studying RNA comes from its structure, essentially because the interactions taking place are not reduced to the Watson-Crick base pairs and tertiary interactions are frequent. Force measurements give complementary information compared to classical bulk measurements, because they enable to probe directly the complex interactions in RNA and give an ac...

  9. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    Science.gov (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  10. An interactive data management and analysis system for clinical investigators.

    Science.gov (United States)

    Groner, G F; Hopwood, M D; Palley, N A; Sibley, W L; Baker, W R; Christopher, T G; Thompson, H K

    1978-09-01

    An interactive minicomputer-based system has been developed that enables the clinical research investigator to personally explore and analyze his research data and, as a consequence of these explorations, to acquire more information. This system, which does not require extensive training or computer programming, enables the investigator to describe his data interactively in his own terms, enter data values while having them checked for validity, store time-oriented patient data in a carefully controlled on-line data base, retrieve data by patient, variable, and time, create subsets of patients with common characteristics, perform statistical analyses, and produce tables and graphs. It also permits data to be transferred to and from other computers. The system is well accepted and is being used by a variety of medical specialists at the three clinical research centers where it is operational. Reported benefits include less elapsed and nonproductive time, more thorough analysis of more data, greater and earlier insight into the meaning of research data, and increased publishable results.

  11. Model for an RNA tertiary interaction from the structure of an intermolecular complex between a GAAA tetraloop and an RNA helix.

    Science.gov (United States)

    Pley, H W; Flaherty, K M; McKay, D B

    1994-11-03

    In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.

  12. Optimal definition of inter-residual contact in globular proteins based on pairwise interaction energy calculations, its robustness, and applications.

    Science.gov (United States)

    Fačkovec, Boris; Vondrášek, Jiří

    2012-10-25

    Although a contact is an essential measurement for the topology as well as strength of non-covalent interactions in biomolecules and their complexes, there is no general agreement in the definition of this feature. Most of the definitions work with simple geometric criteria which do not fully reflect the energy content or ability of the biomolecular building blocks to arrange their environment. We offer a reasonable solution to this problem by distinguishing between "productive" and "non-productive" contacts based on their interaction energy strength and properties. We have proposed a method which converts the protein topology into a contact map that represents interactions with statistically significant high interaction energies. We do not prove that these contacts are exclusively stabilizing, but they represent a gateway to thermodynamically important rather than geometry-based contacts. The process is based on protein fragmentation and calculation of interaction energies using the OPLS force field and relies on pairwise additivity of amino acid interactions. Our approach integrates the treatment of different types of interactions, avoiding the problems resulting from different contributions to the overall stability and the different effect of the environment. The first applications on a set of homologous proteins have shown the usefulness of this classification for a sound estimate of protein stability.

  13. Hierarchical folding of multiple sequence alignments for the prediction of structures and RNA-RNA interactions

    DEFF Research Database (Denmark)

    Seemann, Ernst Stefan; Richter, Andreas S.; Gorodkin, Jan

    2010-01-01

    of that used for individual multiple alignments. Results: We derived a rather extensive algorithm. One of the advantages of our approach (in contrast to other RNARNA interaction prediction methods) is the application of covariance detection and prediction of pseudoknots between intra- and inter-molecular base...... pairs. As a proof of concept, we show an example and discuss the strengths and weaknesses of the approach....

  14. Energy hyperspace for stacking interaction in AU/AU dinucleotide step: Dispersion-corrected density functional theory study.

    Science.gov (United States)

    Mukherjee, Sanchita; Kailasam, Senthilkumar; Bansal, Manju; Bhattacharyya, Dhananjay

    2014-01-01

    Double helical structures of DNA and RNA are mostly determined by base pair stacking interactions, which give them the base sequence-directed features, such as small roll values for the purine-pyrimidine steps. Earlier attempts to characterize stacking interactions were mostly restricted to calculations on fiber diffraction geometries or optimized structure using ab initio calculations lacking variation in geometry to comment on rather unusual large roll values observed in AU/AU base pair step in crystal structures of RNA double helices. We have generated stacking energy hyperspace by modeling geometries with variations along the important degrees of freedom, roll, and slide, which were chosen via statistical analysis as maximally sequence dependent. Corresponding energy contours were constructed by several quantum chemical methods including dispersion corrections. This analysis established the most suitable methods for stacked base pair systems despite the limitation imparted by number of atom in a base pair step to employ very high level of theory. All the methods predict negative roll value and near-zero slide to be most favorable for the purine-pyrimidine steps, in agreement with Calladine's steric clash based rule. Successive base pairs in RNA are always linked by sugar-phosphate backbone with C3'-endo sugars and this demands C1'-C1' distance of about 5.4 Å along the chains. Consideration of an energy penalty term for deviation of C1'-C1' distance from the mean value, to the recent DFT-D functionals, specifically ωB97X-D appears to predict reliable energy contour for AU/AU step. Such distance-based penalty improves energy contours for the other purine-pyrimidine sequences also. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 107-120, 2014. Copyright © 2013 Wiley Periodicals, Inc.

  15. NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

    International Nuclear Information System (INIS)

    Gao, X.; Patel, D.J.

    1988-01-01

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

  16. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA.

    Science.gov (United States)

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R

    2009-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure.

  17. SparseMaps—A systematic infrastructure for reduced-scaling electronic structure methods. III. Linear-scaling multireference domain-based pair natural orbital N-electron valence perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Yang; Sivalingam, Kantharuban; Neese, Frank, E-mail: Frank.Neese@cec.mpg.de [Max Planck Institut für Chemische Energiekonversion, Stiftstr. 34-36, D-45470 Mülheim an der Ruhr (Germany); Valeev, Edward F. [Department of Chemistry, Virginia Tech, Blacksburg, Virginia 24014 (United States)

    2016-03-07

    Multi-reference (MR) electronic structure methods, such as MR configuration interaction or MR perturbation theory, can provide reliable energies and properties for many molecular phenomena like bond breaking, excited states, transition states or magnetic properties of transition metal complexes and clusters. However, owing to their inherent complexity, most MR methods are still too computationally expensive for large systems. Therefore the development of more computationally attractive MR approaches is necessary to enable routine application for large-scale chemical systems. Among the state-of-the-art MR methods, second-order N-electron valence state perturbation theory (NEVPT2) is an efficient, size-consistent, and intruder-state-free method. However, there are still two important bottlenecks in practical applications of NEVPT2 to large systems: (a) the high computational cost of NEVPT2 for large molecules, even with moderate active spaces and (b) the prohibitive cost for treating large active spaces. In this work, we address problem (a) by developing a linear scaling “partially contracted” NEVPT2 method. This development uses the idea of domain-based local pair natural orbitals (DLPNOs) to form a highly efficient algorithm. As shown previously in the framework of single-reference methods, the DLPNO concept leads to an enormous reduction in computational effort while at the same time providing high accuracy (approaching 99.9% of the correlation energy), robustness, and black-box character. In the DLPNO approach, the virtual space is spanned by pair natural orbitals that are expanded in terms of projected atomic orbitals in large orbital domains, while the inactive space is spanned by localized orbitals. The active orbitals are left untouched. Our implementation features a highly efficient “electron pair prescreening” that skips the negligible inactive pairs. The surviving pairs are treated using the partially contracted NEVPT2 formalism. A detailed

  18. Molecular structure and interactions of nucleic acid components in nanoparticles: ab initio calculations

    International Nuclear Information System (INIS)

    Rubin, Yu.V.; Belous, L.F.

    2012-01-01

    Self-associates of nucleic acid components (stacking trimers and tetramers of the base pairs of nucleic acids) and short fragments of nucleic acids are nanoparticles (linear sizes of these particles are more than 10 A). Modern quantum-mechanical methods and softwares allow one to perform ab initio calculations of the systems consisting of 150-200 atoms with enough large basis sets (for example, 6-31G * ). The aim of this work is to reveal the peculiarities of molecular and electronic structures, as well as the energy features of nanoparticles of nucleic acid components. We had carried out ab initio calculations of the molecular structure and interactions in the stacking dimer, trimer, and tetramer of nucleic base pairs and in the stacking (TpG)(ApC) dimer and (TpGpC) (ApCpG) trimer of nucleotides, which are small DNA fragments. The performed calculations of molecular structures of dimers and trimers of nucleotide pairs showed that the interplanar distance in the structures studied is equal to 3.2 A on average, and the helical angle in a trimer is approximately equal to 30 o : The distance between phosphor atoms in neighboring chains is 13.1 A. For dimers and trimers under study, we calculated the horizontal interaction energies. The analysis of interplanar distances and angles between nucleic bases and their pairs in the calculated short oligomers of nucleic acid base pairs (stacking dimer, trimer, and tetramer) has been carried out. Studies of interactions in the calculated short oligomers showed a considerable role of the cross interaction in the stabilization of the structures. The contribution of cross interactions to the horizontal interactions grows with the length of an oligomer. Nanoparticle components get electric charges in nanoparticles. Longwave low-intensity bands can appear in the electron spectra of nanoparticles.

  19. A computational approach for the annotation of hydrogen-bonded base interactions in crystallographic structures of the ribozymes

    Energy Technology Data Exchange (ETDEWEB)

    Hamdani, Hazrina Yusof, E-mail: hazrina@mfrlab.org [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi (Malaysia); Advanced Medical and Dental Institute, Universiti Sains Malaysia, Bertam, Kepala Batas (Malaysia); Artymiuk, Peter J., E-mail: p.artymiuk@sheffield.ac.uk [Dept. of Molecular Biology and Biotechnology, Firth Court, University of Sheffield, S10 T2N Sheffield (United Kingdom); Firdaus-Raih, Mohd, E-mail: firdaus@mfrlab.org [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi (Malaysia)

    2015-09-25

    A fundamental understanding of the atomic level interactions in ribonucleic acid (RNA) and how they contribute towards RNA architecture is an important knowledge platform to develop through the discovery of motifs from simple arrangements base pairs, to more complex arrangements such as triples and larger patterns involving non-standard interactions. The network of hydrogen bond interactions is important in connecting bases to form potential tertiary motifs. Therefore, there is an urgent need for the development of automated methods for annotating RNA 3D structures based on hydrogen bond interactions. COnnection tables Graphs for Nucleic ACids (COGNAC) is automated annotation system using graph theoretical approaches that has been developed for the identification of RNA 3D motifs. This program searches for patterns in the unbroken networks of hydrogen bonds for RNA structures and capable of annotating base pairs and higher-order base interactions, which ranges from triples to sextuples. COGNAC was able to discover 22 out of 32 quadruples occurrences of the Haloarcula marismortui large ribosomal subunit (PDB ID: 1FFK) and two out of three occurrences of quintuple interaction reported by the non-canonical interactions in RNA (NCIR) database. These and several other interactions of interest will be discussed in this paper. These examples demonstrate that the COGNAC program can serve as an automated annotation system that can be used to annotate conserved base-base interactions and could be added as additional information to established RNA secondary structure prediction methods.

  20. A computational approach for the annotation of hydrogen-bonded base interactions in crystallographic structures of the ribozymes

    International Nuclear Information System (INIS)

    Hamdani, Hazrina Yusof; Artymiuk, Peter J.; Firdaus-Raih, Mohd

    2015-01-01

    A fundamental understanding of the atomic level interactions in ribonucleic acid (RNA) and how they contribute towards RNA architecture is an important knowledge platform to develop through the discovery of motifs from simple arrangements base pairs, to more complex arrangements such as triples and larger patterns involving non-standard interactions. The network of hydrogen bond interactions is important in connecting bases to form potential tertiary motifs. Therefore, there is an urgent need for the development of automated methods for annotating RNA 3D structures based on hydrogen bond interactions. COnnection tables Graphs for Nucleic ACids (COGNAC) is automated annotation system using graph theoretical approaches that has been developed for the identification of RNA 3D motifs. This program searches for patterns in the unbroken networks of hydrogen bonds for RNA structures and capable of annotating base pairs and higher-order base interactions, which ranges from triples to sextuples. COGNAC was able to discover 22 out of 32 quadruples occurrences of the Haloarcula marismortui large ribosomal subunit (PDB ID: 1FFK) and two out of three occurrences of quintuple interaction reported by the non-canonical interactions in RNA (NCIR) database. These and several other interactions of interest will be discussed in this paper. These examples demonstrate that the COGNAC program can serve as an automated annotation system that can be used to annotate conserved base-base interactions and could be added as additional information to established RNA secondary structure prediction methods

  1. Ab initio O(N) elongation-counterpoise method for BSSE-corrected interaction energy analyses in biosystems

    Energy Technology Data Exchange (ETDEWEB)

    Orimoto, Yuuichi; Xie, Peng; Liu, Kai [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Yamamoto, Ryohei [Department of Molecular and Material Sciences, Interdisciplinary Graduate School of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Imamura, Akira [Hiroshima Kokusai Gakuin University, 6-20-1 Nakano, Aki-ku, Hiroshima 739-0321 (Japan); Aoki, Yuriko, E-mail: aoki.yuriko.397@m.kyushu-u.ac.jp [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012 (Japan)

    2015-03-14

    An Elongation-counterpoise (ELG-CP) method was developed for performing accurate and efficient interaction energy analysis and correcting the basis set superposition error (BSSE) in biosystems. The method was achieved by combining our developed ab initio O(N) elongation method with the conventional counterpoise method proposed for solving the BSSE problem. As a test, the ELG-CP method was applied to the analysis of the DNAs’ inter-strands interaction energies with respect to the alkylation-induced base pair mismatch phenomenon that causes a transition from G⋯C to A⋯T. It was found that the ELG-CP method showed high efficiency (nearly linear-scaling) and high accuracy with a negligibly small energy error in the total energy calculations (in the order of 10{sup −7}–10{sup −8} hartree/atom) as compared with the conventional method during the counterpoise treatment. Furthermore, the magnitude of the BSSE was found to be ca. −290 kcal/mol for the calculation of a DNA model with 21 base pairs. This emphasizes the importance of BSSE correction when a limited size basis set is used to study the DNA models and compare small energy differences between them. In this work, we quantitatively estimated the inter-strands interaction energy for each possible step in the transition process from G⋯C to A⋯T by the ELG-CP method. It was found that the base pair replacement in the process only affects the interaction energy for a limited area around the mismatch position with a few adjacent base pairs. From the interaction energy point of view, our results showed that a base pair sliding mechanism possibly occurs after the alkylation of guanine to gain the maximum possible number of hydrogen bonds between the bases. In addition, the steps leading to the A⋯T replacement accompanied with replications were found to be unfavorable processes corresponding to ca. 10 kcal/mol loss in stabilization energy. The present study indicated that the ELG-CP method is promising for

  2. Instrumental interaction

    OpenAIRE

    Luciani , Annie

    2007-01-01

    International audience; The expression instrumental interaction as been introduced by Claude Cadoz to identify a human-object interaction during which a human manipulates a physical object - an instrument - in order to perform a manual task. Classical examples of instrumental interaction are all the professional manual tasks: playing violin, cutting fabrics by hand, moulding a paste, etc.... Instrumental interaction differs from other types of interaction (called symbolic or iconic interactio...

  3. Structural Analysis of ‘key’ Interactions in Functional RNA Molecules

    KAUST Repository

    Chawla, Mohit

    2018-04-01

    The main objective of the thesis is to carry out structural bioinformatics study along with usage of advanced quantum chemical methods to look at the structural stability and energetics of RNA building blocks. The main focus of the work described here lies on understanding the reasons behind the intrinsic stability of key interactions in nucleic acids. Crystal structures of RNA molecules exhibit fascinating variety of non-covalent interactions, which play an important role in maintaining the three dimensional structures. An accurate atomic level description of these interactions in the structural building blocks of RNA is a key to understand the structure-function relationship in these molecules. An effort has been made to link the conclusions drawn from quantum chemical computations on RNA base pairs in wide biochemical context of their occurrence in RNA structures. The initial attention was on the impact of natural and non-natural modifications of the nucleic acid bases on the structure and stability of base pairs that they are involved in. In the remaining sections we cover other molecular interactions shaping nucleic acids, as the interaction between ribose and the bases, and the fluoride sensing riboswitch system in order to investigate structure and dynamics of nucleic acids at the atomic level and to gain insight into the physical chemistry behind.

  4. Structural Analysis of ‘key’ Interactions in Functional RNA Molecules

    KAUST Repository

    Chawla, Mohit

    2018-01-01

    The main objective of the thesis is to carry out structural bioinformatics study along with usage of advanced quantum chemical methods to look at the structural stability and energetics of RNA building blocks. The main focus of the work described here lies on understanding the reasons behind the intrinsic stability of key interactions in nucleic acids. Crystal structures of RNA molecules exhibit fascinating variety of non-covalent interactions, which play an important role in maintaining the three dimensional structures. An accurate atomic level description of these interactions in the structural building blocks of RNA is a key to understand the structure-function relationship in these molecules. An effort has been made to link the conclusions drawn from quantum chemical computations on RNA base pairs in wide biochemical context of their occurrence in RNA structures. The initial attention was on the impact of natural and non-natural modifications of the nucleic acid bases on the structure and stability of base pairs that they are involved in. In the remaining sections we cover other molecular interactions shaping nucleic acids, as the interaction between ribose and the bases, and the fluoride sensing riboswitch system in order to investigate structure and dynamics of nucleic acids at the atomic level and to gain insight into the physical chemistry behind.

  5. Hybridization and sequencing of nucleic acids using base pair mismatches

    Science.gov (United States)

    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

    2001-01-01

    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  6. Nanoscale protein diffusion by STED-based pair correlation analysis.

    Directory of Open Access Journals (Sweden)

    Paolo Bianchini

    Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

  7. Envisaging quantum transport phenomenon in a muddled base pair ...

    Indian Academy of Sciences (India)

    RAJAN VOHRA

    2018-03-27

    Mar 27, 2018 ... effect of mispairs G(anti)·A(syn) and G(anti)·A(anti) on electron transport by replacing ... used by us with two-probe system consisting of three parts: right, left ... The ballistic transport results if probability of transmitting electrons ...

  8. Maximizing profit per unit time in cointegration based pairs trading

    OpenAIRE

    Tutal, Duygu

    2014-01-01

    Ankara : The Department of Industrial Engineering and The Graduate School of Engineering and Science of Bilkent University, 2014. Thesis (Master's) -- Bilkent University, 2014. Includes bibliographical references leaves 57-59 Tutal, Duygu Master's

  9. Weak interactions

    International Nuclear Information System (INIS)

    Chanda, R.

    1981-01-01

    The theoretical and experimental evidences to form a basis for Lagrangian Quantum field theory for Weak Interactions are discussed. In this context, gauge invariance aspects of such interactions are showed. (L.C.) [pt

  10. Intermolecular interactions

    International Nuclear Information System (INIS)

    Kaplan, I.G.; Rodimova, O.B.; AN SSSR, Tomsk. Inst. Optiki Atmosfery)

    1978-01-01

    The present state of the intermolecular interaction theory is described. The general physical picture of the molecular interactions is given, the relative contributions of interactions of different types are analyzed (electrostatic, resonance, induction, dispersion, relativistic, magnetostatic and exchange), and the main ones in each range of separations are picked out. The methods of the potential curve calculations are considered, specific for definite separations between the interacting systems. The special attention is paid to the analysis of approximations used in different theoretical calculation methods

  11. Effective interactions

    International Nuclear Information System (INIS)

    Elliott, J.P.

    1981-01-01

    This chapter attempts to describe and compare some of the more important nucleon-nucleon interactions that have been used in nuclear structure calculations, and to relate them where possible to the real nucleon-nucleon interaction. Explains that different interactions have been used depending on whether one is fitting to total binding energies and densities with a Hartree Fock (HF) calculation or fitting to spectra and spectroscopic data in a shell model calculation. Examines both types of calculation after two preliminary sections concerned with notation and with the philosophy underlying the use of model spaces and effective interactions. Discusses Skyrme interactions, finite range interactions, small model space, large model space, and the Sussex potential matrix elements. Focuses on the more empirical approaches in which a simple form is chosen for the effective interaction in a given model space and the parameters are deduced from fitting many-body data

  12. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    RNA. Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... is nonfunctional. In contrast to the considerable effect the mutations have on function, they impart only slight structural changes on the naked rRNA, and these are limited to the immediate vicinity of the mutations. The data show that positions 1262 and 2017 pair in a Watson-Crick manner, but the data also...

  13. Weak interactions

    International Nuclear Information System (INIS)

    Ogava, S.; Savada, S.; Nakagava, M.

    1983-01-01

    The problem of the use of weak interaction laws to study models of elementary particles is discussed. The most typical examples of weak interaction is beta-decay of nucleons and muons. Beta-interaction is presented by quark currents in the form of universal interaction of the V-A type. Universality of weak interactions is well confirmed using as examples e- and μ-channels of pion decay. Hypothesis on partial preservation of axial current is applicable to the analysis of processes with pion participation. In the framework of the model with four flavours lepton decays of hadrons are considered. Weak interaction without lepton participation are also considered. Properties of neutral currents are described briefly

  14. Floor interaction

    DEFF Research Database (Denmark)

    Petersen, Marianne Graves; Krogh, Peter; Ludvigsen, Martin

    2005-01-01

    Within architecture, there is a long tradition of careful design of floors. The design has been concerned with both decorating floors and designing floors to carry information. Ubiquitous computing technology offers new opportunities for designing interactive floors. This paper presents three...... different interactive floor concepts. Through an urban perspective it draws upon the experiences of floors in architecture, and provides a set of design issues for designing interactive floors....

  15. Playful Interaction

    DEFF Research Database (Denmark)

    2003-01-01

    The video Playful Interaction describes a future architectural office, and envisions ideas and concepts for playful interactions between people, materials and appliances in a pervasive and augmented working environment. The video both describes existing developments, technologies and designs...... as well as ideas not yet implemented such as playful modes of interaction with an augmented ball. Playful Interaction has been used as a hybrid of a vision video and a video prototype (1). Externally the video has been used to visualising our new ideas, and internally the video has also worked to inspire...

  16. Aesthetic interaction

    DEFF Research Database (Denmark)

    Petersen, Marianne Graves; Iversen, Ole Sejer; Krogh, Peter

    2004-01-01

    , as it promotes aesthetics of use, rather than aesthetics of appearance. We coin this approach in the perspective of aesthetic interaction. Finally we make the point that aesthetics is not re-defining everything known about interactive systems. We provide a framework placing this perspective among other...

  17. Interactive benchmarking

    DEFF Research Database (Denmark)

    Lawson, Lartey; Nielsen, Kurt

    2005-01-01

    We discuss individual learning by interactive benchmarking using stochastic frontier models. The interactions allow the user to tailor the performance evaluation to preferences and explore alternative improvement strategies by selecting and searching the different frontiers using directional...... in the suggested benchmarking tool. The study investigates how different characteristics on dairy farms influences the technical efficiency....

  18. Explicit Interaction

    DEFF Research Database (Denmark)

    Löwgren, Jonas; Eriksen, Mette Agger; Linde, Per

    2006-01-01

    We report an ongoing study of palpable computing to support surgical rehabilitation, in the general field of interaction design for ubiquitous computing. Through explorative design, fieldwork and participatory design techniques, we explore the design principle of explicit interaction as an interp...

  19. Kinesthetic Interaction

    DEFF Research Database (Denmark)

    Fogtmann, Maiken Hillerup; Fritsch, Jonas; Kortbek, Karen Johanne

    2008-01-01

    Within the Human-Computer Interaction community there is a growing interest in designing for the whole body in interaction design. The attempts aimed at addressing the body have very different outcomes spanning from theoretical arguments for understanding the body in the design process, to more...... practical examples of designing for bodily potential. This paper presents Kinesthetic Interaction as a unifying concept for describing the body in motion as a foundation for designing interactive systems. Based on the theoretical foundation for Kinesthetic Interaction, a conceptual framework is introduced...... to reveal bodily potential in relation to three design themes – kinesthetic development, kinesthetic means and kinesthetic disorder; and seven design parameters – engagement, sociality, movability, explicit motivation, implicit motivation, expressive meaning and kinesthetic empathy. The framework is a tool...

  20. Programming Interactivity

    CERN Document Server

    Noble, Joshua

    2012-01-01

    Ready to create rich interactive experiences with your artwork, designs, or prototypes? This is the ideal place to start. With this hands-on guide, you'll explore several themes in interactive art and design-including 3D graphics, sound, physical interaction, computer vision, and geolocation-and learn the basic programming and electronics concepts you need to implement them. No previous experience is necessary. You'll get a complete introduction to three free tools created specifically for artists and designers: the Processing programming language, the Arduino microcontroller, and the openFr

  1. Visualization of drug-nucleic acid interactions at atomic resolution. I. Structure of an ethidium/dinucleoside monophosphate crystalline complex, ethidium:5-iodouridylyl(3'5')adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, C C; Jain, S C; Sobell, H M

    1977-01-01

    Ethidium forms a crystalline complex with the dinucleoside monophosphate 5-iodouridyly(3'-5')adenosine (iodoUpA). These crystals are monoclinic, space group C2, with unit cell dimensions, a = 28.45 A, b = 13.54 A, c = 34.13 A, ..beta.. = 98.6/sup 0/. The structure has been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least-squares to a residual of 0.20 on 2017 observed reflections. The asymmetric unit contains two ethidium molecules, two iodoUpA molecules and 27 water molecules, a total of 155 atoms excluding hydrogens. The two iodoUpA molecules are held together by adenine.uracil Watson--Crick-type base-pairing. Adjacent base-pairs within this paired iodoUpA structure and between neighboring iodoUpA molecules in adjoining unit cells are separated by about 6.7 A; this separation results from intercalative binding by one ethidium molecule and stacking by the other ethidium molecule above and below the base-pairs. Non-crystallographic 2-fold symmetry is utilized in this model drug--nucleic acid interaction, the intercalated ethidium molecule being oriented such that its phenyl and ethyl groups lie in the narrow groove of the miniature nucleic acid double-helix. Base-pairs within the paired nucleotide units are related by a twist of 8/sup 0/. The magnitude of this angular twist is related to conformational changes in the sugar--phosphate chains that accompany drug intercalation. These changes partly reflect the differences in ribose sugar ring puckering that are observed. Additional small but systematic changes occur in torsional angles that involve the phosphodiester linkages and the C4'--C5' bond. Solution studies have indicated a marked sequence-specific binding preference in ethidium--dinucleotide interactions, and a probable structural explanation for this is provided by this study.

  2. Interaction graphs

    DEFF Research Database (Denmark)

    Seiller, Thomas

    2016-01-01

    Interaction graphs were introduced as a general, uniform, construction of dynamic models of linear logic, encompassing all Geometry of Interaction (GoI) constructions introduced so far. This series of work was inspired from Girard's hyperfinite GoI, and develops a quantitative approach that should...... be understood as a dynamic version of weighted relational models. Until now, the interaction graphs framework has been shown to deal with exponentials for the constrained system ELL (Elementary Linear Logic) while keeping its quantitative aspect. Adapting older constructions by Girard, one can clearly define...... "full" exponentials, but at the cost of these quantitative features. We show here that allowing interpretations of proofs to use continuous (yet finite in a measure-theoretic sense) sets of states, as opposed to earlier Interaction Graphs constructions were these sets of states were discrete (and finite...

  3. Embarrassing Interactions

    DEFF Research Database (Denmark)

    Deterding, Sebastian; Lucero, Andrés; Holopainen, Jussi

    2015-01-01

    Wherever the rapid evolution of interactive technologies disrupts standing situational norms, creates new, often unclear situational audiences, or crosses cultural boundaries, embarrassment is likely. This makes embarrassment a fundamental adoption and engagement hurdle, but also a creative design...

  4. Diffractive interactions

    International Nuclear Information System (INIS)

    Del Duca, V.; Marage, P.

    1996-08-01

    The general framework of diffractive deep inelastic scattering is introduced and reports given in the session on diffractive interactions at the international workshop on deep-inelastic scattering and related phenomena, Rome, April 1996, are presented. (orig.)

  5. Interaction Widget

    DEFF Research Database (Denmark)

    Ingstrup, Mads

    2003-01-01

    This pattern describes the idea of making a user interface of discrete, reusable entities---here called interaction widgets. The idea behind widgets is described using two perspectives, that of the user and that of the developer. It is the forces from these two perspectives that are balanced...... in the pattern. The intended audience of the pattern is developers and researchers within the field of human computer interaction....

  6. Hair Interactions

    OpenAIRE

    Cani , Marie-Paule; Bertails , Florence

    2006-01-01

    International audience; Processing interactions is one of the main challenges in hair animation. Indeed, in addition to the collisions with the body, an extremely large number of contacts with high friction rates are permanently taking place between individual hair strands. Simulating the latter is essential: without hair self-interactions, strands would cross each other during motion or come to rest at the same location, yielding unrealistic behavior and a visible lack of hair volume. This c...

  7. The Effects of Noncellulosic Compounds on the Nanoscale Interaction Forces Measured between Carbohydrate-Binding Module and Lignocellulosic Biomass.

    Science.gov (United States)

    Arslan, Baran; Colpan, Mert; Ju, Xiaohui; Zhang, Xiao; Kostyukova, Alla; Abu-Lail, Nehal I

    2016-05-09

    The lack of fundamental understanding of the types of forces that govern how cellulose-degrading enzymes interact with cellulosic and noncellulosic components of lignocellulosic surfaces limits the design of new strategies for efficient conversion of biomass to bioethanol. In a step to improve our fundamental understanding of such interactions, nanoscale forces acting between a model cellulase-a carbohydrate-binding module (CBM) of cellobiohydrolase I (CBH I)-and a set of lignocellulosic substrates with controlled composition were measured using atomic force microscopy (AFM). The three model substrates investigated were kraft (KP), sulfite (SP), and organosolv (OPP) pulped substrates. These substrates varied in their surface lignin coverage, lignin type, and xylan and acetone extractives' content. Our results indicated that the overall adhesion forces of biomass to CBM increased linearly with surface lignin coverage with kraft lignin showing the highest forces among lignin types investigated. When the overall adhesion forces were decoupled into specific and nonspecific component forces via the Poisson statistical model, hydrophobic and Lifshitz-van der Waals (LW) forces dominated the binding forces of CBM to kraft lignin, whereas permanent dipole-dipole interactions and electrostatic forces facilitated the interactions of lignosulfonates to CBM. Xylan and acetone extractives' content increased the attractive forces between CBM and lignin-free substrates, most likely through hydrogen bonding forces. When the substrates treated differently were compared, it was found that both the differences in specific and nonspecific forces between lignin-containing and lignin-free substrates were the least for OPP. Therefore, cellulase enzymes represented by CBM would weakly bind to organosolv lignin. This will facilitate an easy enzyme recovery compared to other substrates treated with kraft or sulfite pulping. Our results also suggest that altering the surface hydrophobicity

  8. The Transcriptome of Compatible and Incompatible Interactions of Potato (Solanum tuberosum) with Phytophthora infestans Revealed by DeepSAGE Analysis

    DEFF Research Database (Denmark)

    Gyetvai, Gabor; Sønderkær, Mads; Göbel, Ulrike

    2012-01-01

    of the compatible and incompatible interaction were captured by DeepSAGE analysis of 44 biological samples comprising five genotypes, differing only by the presence or absence of the R1 transgene, three infection time points and three biological replicates. 30.859 unique 21 base pair sequence tags were obtained......Late blight, caused by the oomycete Phytophthora infestans, is the most important disease of potato (Solanum tuberosum). Understanding the molecular basis of resistance and susceptibility to late blight is therefore highly relevant for developing resistant cultivars, either by marker...... interactions over the infection time course and between compatible and incompatible genotypes. Transcriptional changes were more numerous in compatible than in incompatible interactions. In contrast to incompatible interactions, transcriptional changes in the compatible interaction were observed predominantly...

  9. Structural Variation and Uniformity among Tetraloop-Receptor Interactions and Other Loop-Helix Interactions in RNA Crystal Structures

    Science.gov (United States)

    Wu, Li; Chai, Dinggeng; Fraser, Marie E.; Zimmerly, Steven

    2012-01-01

    Tetraloop-receptor interactions are prevalent structural units in RNAs, and include the GAAA/11-nt and GNRA-minor groove interactions. In this study, we have compiled a set of 78 nonredundant loop-helix interactions from X-ray crystal structures, and examined them for the extent of their sequence and structural variation. Of the 78 interactions in the set, only four were classical GAAA/11-nt motifs, while over half (48) were GNRA-minor groove interactions. The GNRA-minor groove interactions were not a homogeneous set, but were divided into five subclasses. The most predominant subclass is characterized by two triple base pair interactions in the minor groove, flanked by two ribose zipper contacts. This geometry may be considered the “standard” GNRA-minor groove interaction, while the other four subclasses are alternative ways to form interfaces between a minor groove and tetraloop. The remaining 26 structures in the set of 78 have loops interacting with mostly idiosyncratic receptors. Among the entire set, a number of sequence-structure correlations can be identified, which may be used as initial hypotheses in predicting three-dimensional structures from primary sequences. Conversely, other sequence patterns are not predictive; for example, GAAA loop sequences and GG/CC receptors bind to each other with three distinct geometries. Finally, we observe an example of structural evolution in group II introns, in which loop-receptor motifs are substituted for each other while maintaining the larger three-dimensional geometry. Overall, the study gives a more complete view of RNA loop-helix interactions that exist in nature. PMID:23152878

  10. Interactive governance

    DEFF Research Database (Denmark)

    Sørensen, Eva; Torfing, Jacob; Peters, B. Guy

    Governance has become one of the most commonly used concepts in contemporary political science. It is, however, often used to mean a variety of different things. This book helps to clarify this conceptual muddle by concentrating on one variety of governance-interactive governance. The authors argue...... that although the state may remain important for many aspects of governing, interactions between state and society represent an important, and perhaps increasingly important, dimension of governance. These interactions may be with social actors such as networks, with market actors or with other governments......, but all these forms represent means of governing involving mixtures of state action with the actions of other entities.This book explores thoroughly this meaning of governance, and links it to broader questions of governance. In the process of explicating this dimension of governance the authors also...

  11. Multiquark interactions

    International Nuclear Information System (INIS)

    Luk'yanov, V.K.

    1984-01-01

    To study multiquark interactions (MQI) the data of experiments confirming the presence of 3q, 6q, 12q states in interacting nuclear nucleons, in hadron- and lepton-nuclear processes at high energies and high momentum transfers are considered. Experimental data on cumulative processes pointing to the existence of MQI are analyzed. Two-channel model of a nucleus (the model of interacting nucleons) in the theory of coupled channels is discussed. The behaviour of form factor of deuteron and NQI (6q) contributions to ed scattering as well as deep inelastic scattering on nuclei are studied. The data known as EMC effect are discussed. It is pointed out that introduction of the notion MQI and consideration of a nucleus as a system of nucleons with a low MQI addition will help to explain such processes as cumulative reactions, form factors of a deuteron and light nuclei, deep inelastic scattering on nuclei

  12. On modeling biomolecular–surface nonbonded interactions: application to nucleobase adsorption on single-wall carbon nanotube surfaces

    International Nuclear Information System (INIS)

    Akdim, B; Pachter, R; Day, P N; Kim, S S; Naik, R R

    2012-01-01

    In this work we explored the selectivity of single nucleobases towards adsorption on chiral single-wall carbon nanotubes (SWCNTs) by density functional theory calculations. Specifically, the adsorption of molecular models of guanine (G), adenine (A), thymine (T), and cytosine (C), as well as of AT and GC Watson–Crick (WC) base pairs on chiral SWCNT C(6, 5), C(9, 1) and C(8, 3) model structures, was analyzed in detail. The importance of correcting the exchange–correlation functional for London dispersion was clearly demonstrated, yet limitations in modeling such interactions by considering the SWCNT as a molecular model may mask subtle effects in a molecular–macroscopic material system. The trend in the calculated adsorption energies of the nucleobases on same diameter C(6, 5) and C(9, 1) SWCNT surfaces, i.e. G > A > T > C, was consistent with related computations and experimental work on graphitic surfaces, however contradicting experimental data on the adsorption of single-strand short homo-oligonucleotides on SWCNTs that demonstrated a trend of G > C > A > T (Albertorio et al 2009 Nanotechnology 20 395101). A possible role of electrostatic interactions in this case was partially captured by applying the effective fragment potential method, emphasizing that the interplay of the various contributions in modeling nonbonded interactions is complicated by theoretical limitations. Finally, because the calculated adsorption energies for Watson–Crick base pairs have shown little effect upon adsorption of the base pair farther from the surface, the results on SWCNT sorting by salmon genomic DNA could be indicative of partial unfolding of the double helix upon adsorption on the SWCNT surface. (paper)

  13. Interaction of a gibberellin-induced factor with the upstream region of an alpha-amylase gene in rice aleurone tissue.

    OpenAIRE

    Ou-Lee, T M; Turgeon, R; Wu, R

    1988-01-01

    The interaction between the DNA sequences of an alpha-amylase (EC 3.2.1.1) gene and a tissue-specific factor induced in rice (Oryza sativa L.) aleurone tissue by gibberellin was studied. DNA mobility-shift during electrophoresis indicated that a 500-base-pair sequence (HS500) of a rice alpha-amylase genomic clone (OSamy-a) specifically interacted with a factor from gibberellin-induced rice aleurone tissue. The amount of complex formed between the HS500 DNA fragment and the gibberellin-induced...

  14. Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

    Science.gov (United States)

    Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

    2010-06-15

    The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

  15. Preliminary study of mechanism of action of SN38 derivatives. Physicochemical data, evidence of interaction and alkylation of DNA octamer d(GCGATCGC)2.

    Science.gov (United States)

    Naumczuk, Beata; Kawęcki, Robert; Bocian, Wojciech; Bednarek, Elżbieta; Sitkowski, Jerzy; Kozerski, Lech

    2017-02-01

    The synthesis of water-soluble SN38 derivatives is presented, and their stability in solutions used during drug development studies has been investigated. A preliminary study of mechanism of action of 9-aminomethyl SN38 is presented. Using NMR techniques, the interaction of the oligomer d(GCGATCGC) 2 is studied, showing that the terminal GC base pairs are the main site of interaction. Using pulsed field gradient spin echo and mass spectroscopy, evidence of a spontaneous alkylation reaction of the DNA oligomer with SN38 derivatives is presented. A proposed mechanism of reaction is suggested. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  16. Raman spectroscopy of DNA-metal complexes. I. Interactions and conformational effects of the divalent cations: Mg, Ca, Sr, Ba, Mn, Co, Ni, Cu, Pd, and Cd

    OpenAIRE

    Duguid, J.; Bloomfield, V.A.; Benevides, J.; Thomas Jr, G.J.

    1993-01-01

    Interactions of divalent metal cations (Mg2+, Ca2+, Ba2+, Sr2+, Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) with DNA have been investigated by laser Raman spectroscopy. Both genomic calf-thymus DNA (> 23 kilobase pairs) and mononucleosomal fragments (160 base pairs) were employed as targets of metal interaction in solutions containing 5 weight-% DNA and metal:phosphate molar ratios of 0.6:1. Raman difference spectra reveal that transition metal cations (Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) ind...

  17. Interaction region

    International Nuclear Information System (INIS)

    Anon.

    1982-01-01

    The Interaction Region Group addressed the basic questions of how to collide the SLC beams, how to maximize and monitor the luminosity, and how to minimize the detector backgrounds at the interaction region. In practice, five subgroups evolved to study these questions. The final focus group provided three alternative designs to acheive the 1 to 2 micron beam spot size required by the SLC, as well as studying other problems including: eta, eta' matching from the collider arcs, the implementation of soft bends near the interaction region, beam emittance growth, and magnet tolerances in the final focus. The beam position monitor group proposed two devices, a strip line monitor, and a beamstrahlung monitor, to bring the beams into collision. The luminosity monitor group reviewed the possible QED processes that would be insensitive to weak interaction (Z 0 ) effects. The beam dumping group proposed locations for kicker and septum magnets in the final focus that would achieve a high dumping efficiency and would meet the desired beam tolerances at the Moller scattering target in the beam dump line. Working with the Polarization Group, the Moller experiment was designed into the beam dump beam line. A beam dump was proposed that would maintain radiation backgrounds (penetrating muons) at acceptible levels. The detector backgrounds group proposed soft-bend and masking configurations to shield the detector from synchrotron radiation from the hard/soft bends and from the final focus quadrupoles and evaluated the effectiveness of these designs for the three final focus optics designs. Backgrounds were also estimated from: large angle synchrotron radiation, local and distant beam-gas interactions, 2-photon interactions, and from neutrons and backscattered photons from the beamstrahlung dump

  18. Programming Interactivity

    CERN Document Server

    Noble, Joshua

    2009-01-01

    Make cool stuff. If you're a designer or artist without a lot of programming experience, this book will teach you to work with 2D and 3D graphics, sound, physical interaction, and electronic circuitry to create all sorts of interesting and compelling experiences -- online and off. Programming Interactivity explains programming and electrical engineering basics, and introduces three freely available tools created specifically for artists and designers: Processing, a Java-based programming language and environment for building projects on the desktop, Web, or mobile phonesArduino, a system t

  19. Interacting binaries

    International Nuclear Information System (INIS)

    Eggleton, P.P.; Pringle, J.E.

    1985-01-01

    This volume contains 15 review articles in the field of binary stars. The subjects reviewed span considerably, from the shortest period of interacting binaries to the longest, symbiotic stars. Also included are articles on Algols, X-ray binaries and Wolf-Rayet stars (single and binary). Contents: Preface. List of Participants. Activity of Contact Binary Systems. Wolf-Rayet Stars and Binarity. Symbiotic Stars. Massive X-ray Binaries. Stars that go Hump in the Night: The SU UMa Stars. Interacting Binaries - Summing Up

  20. Hadron interactions

    International Nuclear Information System (INIS)

    Fischer, J.; Kolar, P.; Kundrat, V.

    1988-01-01

    The proceedings contain invited lectures and papers presente at the symposium. Attention was devoted to hadron interactions a high energy in QCD, to the structure and decay of hadrons, the production of hadrons and supersymmetric particles in e + e - and ep collisions, to perturbation theory in quantum field theory, and new supersymmetric extensions of relativistic algebra. (Z.J

  1. Interactive Storytelling

    DEFF Research Database (Denmark)

    Schoenau-Fog, Henrik; Reng, Lars

    2015-01-01

    This book constitutes the refereed proceedings of the 8th International Conference on Interactive Digital Storytelling, ICIDS 2015, held in Copenhagen, Denmark, in November/December 2015. The 18 revised full papers and 13 short papers presented together with 9 posters, 9 workshop descriptions, an...

  2. Rigidity of Nominal Wages of Non-Production Workers in Industrial Sector

    Directory of Open Access Journals (Sweden)

    Bambang Sulistiyono

    2016-06-01

    Full Text Available Excess supply of labor leads to low the levels of nominal wages received by workers. The amount of minimum wage rate exceeds the market wage rate. The determination of minimum wage is a factor manifested in the institutional and regulatory Provincial Minimum Wage or a District Minimum Wage. Unfortunately, it has made nominal wages  difficult to drop below the minimum wage level. High or low level of nominal wages are associated with worker productivity. Further, nominal wages are rigid to go down. If they have increased, they can not be dropped in the future even though the company's performance is declined. Knowing that condition, in designing the remuneration system, an employer should pay attention to the rigidity of nominal wages, so that when  company's performance declines, the company will not be interfered because of the wages burden.  Furthermore, unions and government should consider the rigidity impact of nominal wages that go down. Thus, when macroeconomic conditions deteriorate and company's performance drops, the company will not go bankrupt due to high labor costs. If the company goes bankrupt, the workers will loose their jobs as a result of employment termination, while the government will face the unemployment problem. 

  3. A 29-Year-Old Man With Nonproductive Cough, Exertional Dyspnea, and Chest Discomfort.

    Science.gov (United States)

    Halpenny, Darragh; Suh, James; Garofano, Suzette; Alpert, Jeffrey

    2015-09-01

    A 29-year-old man presented with a 5-month history of worsening dry cough, exertional dyspnea, chest tightness, and palpitations. He had been treated by his primary care physician with trials of guaifenesin/codeine, azithromycin, albuterol, and omeprazole without improvement. He denied wheezing, fever, sweats, anorexia, joint pain, swelling, or rash. He had no past medical history. He denied a history of tobacco smoking or IV drug use. He kept no pets, worked as a manager in an office environment, and had no history of occupational inhalational exposure. He reported using aerosolized insect spray to eradicate bed bugs in his house shortly before the cough began but did not report any acute symptoms when using the spray.

  4. Optimizing Fire Department Operations Through Work Schedule Analysis, Alternative Staffing, and Nonproductive Time Reduction

    Science.gov (United States)

    2014-09-01

    and disadvantages ; for example, although the majority of fire departments in the United States abide by the 24/48- schedule, this schedule also leads...costs. The local bargaining group also falls into these criteria. The local bargaining unit must be agreeable to the policy changes. They cannot... agreeable to the local bargaining group particularly when it is addressed in an article of the current bargaining agreement. Additionally, the local

  5. Lignosulfonate-mediated cellulase adsorption: enhanced enzymatic saccharification of lignocellulose through weakening nonproductive binding to lignin

    Science.gov (United States)

    Zhaojiang Wang; JY Zhu; Yingjuan Fu; Menghua Qin; Zhiyong Shao; Jungang Jiang; Fang Yang

    2013-01-01

    Thermochemical pretreatment of lignocellulose is crucial to bioconversion in the fields of biorefinery and biofuels. However, the enzyme inhibitors in pretreatment hydrolysate make solid substrate washing and hydrolysate detoxification indispensable prior to enzymatic hydrolysis. Sulfite pretreatment to overcome recalcitrance of lignocelluloses (SPORL) is a relatively...

  6. A comparison of productive and non-productive green water-use ...

    African Journals Online (AJOL)

    productive (canopy and litter interception and soil evaporation) fluxes. There is a widespread perception within South Africa that indigenous tree species, in contrast to commercial forestry genera/species, are water-wise and should thus be planted ...

  7. Visualization of drug-nucleic acid interactions at atomic resolution. II. Structure of an ethidium/dinucleoside monophosphate crystalline complex, ethidium:5-iodocytidylyl(3'5')guanosine

    Energy Technology Data Exchange (ETDEWEB)

    Jain, S C; Tsair, C C; Sobell, H M

    1977-01-01

    Ethidium forms a second crystalline complex with the dinucleoside monophosphate 5-iodocytidyl(3'-5')guanosine (iodoCpG). These crystals are monoclinic, P2/sub 1/, with a = 14.06 A, b = 32.34 A, c = 16.53 A, ..beta.. = 117.8/sup 0/. The structure has been solved to atomic resolution using rigid-body Patterson vector search and Fourier methods, and refined by full matrix least-squares to a residual of 0.16 on 3180 observed reflections. Both iodoCpG molecules are hydrogen-bonded together by guanine.cytosine Watson--Crick base-pairing. Adjacent base-pairs within this paired iodoCpG structure and between neighboring iodoCpG molecules in adjoining unit cells are separated by 6.7 A. Approximate 2-fold symmetry is used in the interaction; this reflects the pseudo-2-fold symmetry axis of the phenanthridinium ring system in ethidium coinciding with the approximate 2-fold axis relating base-paired iodoCpG molecules. The phenyl and ethyl groups of the intercalated ethidium molecule lie in the narrow groove of the miniature iodoCpG double-helix. The stacked ethidium, however, lies in the opposite direction, its phenyl and ethyl groups neighboring iodine atoms on cytosine residues. Base-pairs within the paired nucleotide units are related by a twist of about 8/sup 0/. The magnitude of this angular twist reflects conformational changes in the sugar--phosphate chains accompanying intercalation. These primarily reflect the differences in ribose sugar ring puckering that are observed (i.e., both iodocytidine residues have C3' endo sugar conformations, while both guanosine residues have C2' endo sugar conformations), and alterations in the glycosidic torsional angles that describe the base-sugar orientation.

  8. Interactive cinema : engagement and interaction

    NARCIS (Netherlands)

    Vosmeer, M.; Schouten, B.; Mitchell, A.

    2014-01-01

    Technologies that were initially developed to be applied within the domain of video games are currently being used in experiments to explore their meaning and possibilities for cinema and cinema audiences. In this position paper we examine how narrativity, interactivity and engagement are mutually

  9. Interactive Macroeconomics

    Science.gov (United States)

    Di Guilmi, Corrado; Gallegati, Mauro; Landini, Simone

    2017-04-01

    Preface; List of tables; List of figures, 1. Introduction; Part I. Methodological Notes and Tools: 2. The state space notion; 3. The master equation; Part II. Applications to HIA Based Models: 4. Financial fragility and macroeconomic dynamics I: heterogeneity and interaction; 5. Financial fragility and macroeconomic Dynamics II: learning; Part III. Conclusions: 6. Conclusive remarks; Part IV. Appendices and Complements: Appendix A: Complements to Chapter 3; Appendix B: Solving the ME to solve the ABM; Appendix C: Specifying transition rates; Index.

  10. Interactive Governance

    DEFF Research Database (Denmark)

    Bang, Henrik

    2016-01-01

    Governance analysis has exploded in recent years, and it has become nearly impossible to tell what difference the concept and practice of governance makes from those of government and state. In addition governance analysis has been placed more and more in the shadow of the new institutionalisms and...... and growth. However, interactive governance is not a property or effect of institutions; nor does it apply solely to those individuals who seek success above everything else. It is connective more than individualistic or collectivistic in nature; and it manifests a governability capacity which...

  11. Collocated Interaction

    DEFF Research Database (Denmark)

    E. Fischer, Joel; Porcheron, Martin; Lucero, Andrés

    2016-01-01

    interactions. Yet, new challenges abound as people wear and carry more devices than ever, creating fragmented device ecologies at work, and changing the ways we socialise with each other. In this workshop we seek to start a dialogue to look back as well as forward, review best practices, discuss and design......In the 25 years since Ellis, Gibbs, and Rein proposed the time-space taxonomy, research in the ‘same time, same place’ quadrant has diversified, perhaps even fragmented. This one-day workshop will bring together researchers with diverse, yet convergent interests in tabletop, surface, mobile...

  12. Weak interactions

    International Nuclear Information System (INIS)

    Bjorken, J.D.

    1978-01-01

    Weak interactions are studied from a phenomenological point of view, by using a minimal number of theoretical hypotheses. Charged-current phenomenology, and then neutral-current phenomenology are discussed. This all is described in terms of a global SU(2) symmetry plus an electromagnetic correction. The intermediate-boson hypothesis is introduced and lower bounds on the range of the weak force are inferred. This phenomenology does not yet reconstruct all the predictions of the conventional SU(2)xU(1) gauge theory. To do that requires an additional assumption of restoration of SU(2) symmetry at asymptotic energies

  13. Strong interactions

    International Nuclear Information System (INIS)

    Froissart, Marcel

    1976-01-01

    Strong interactions are introduced by their more obvious aspect: nuclear forces. In hadron family, the nucleon octet, OMEGA - decuplet, and quark triply are successively considered. Pion wave having been put at the origin of nuclear forces, low energy phenomena are described, the force being explained as an exchange of structure corresponding to a Regge trajectory in a variable rotating state instead of the exchange of a well defined particle. At high energies the concepts of pomeron, parton and stratons are introduced, pionization and fragmentation are briefly differentiated [fr

  14. Interactive Workspaces

    DEFF Research Database (Denmark)

    Mogensen, Preben Holst

    augmented reality, interactive building elements, and mobile devices to support new ways of working in a diversity of application domains with work situations ranging from individual work, through local collaboration, to distributed collaboration. The work situations may take place in offices/project rooms......Many application domains such as architecture, engineering, industrial design, city planning, environmental supervision, health care etc. share the properties of users working collaboratively with complex mixtures of physical and digital materials. Studies in such domains show that it is hard...... to maintain and integrate these heterogeneous materials in traditional desktop computing environments. Our thesis is that pervasive computing technologies can be developed to support a more natural user collaboration in a rich variety of application. This may be achieved by going beyond the traditional...

  15. Electromagnetic interactions

    International Nuclear Information System (INIS)

    Bosanac, Slobodan Danko

    2016-01-01

    This book is devoted to theoretical methods used in the extreme circumstances of very strong electromagnetic fields. The development of high power lasers, ultrafast processes, manipulation of electromagnetic fields and the use of very fast charged particles interacting with other charges requires an adequate theoretical description. Because of the very strong electromagnetic field, traditional theoretical approaches, which have primarily a perturbative character, have to be replaced by descriptions going beyond them. In the book an extension of the semi-classical radiation theory and classical dynamics for particles is performed to analyze single charged atoms and dipoles submitted to electromagnetic pulses. Special attention is given to the important problem of field reaction and controlling dynamics of charges by an electromagnetic field.

  16. Electroweak interactions

    International Nuclear Information System (INIS)

    Bjorken, J.D.

    1980-10-01

    A point of view of the electroweak interaction is presented. It begins phenomenologically and moves in stages toward the conventional gauge theory formalism containing elementary scalar Higgs-fields and then beyond. The purpose in so doing is that the success of the standard SU(2) x U(1) theory in accounting for low energy phenomena need not automatically imply success at high energies. It is deemed unlikely by most theorists that the predicted W +- or Z 0 does not exist or does not have the mass and/or couplings anticipated in the standard model. However, the odds that the standard predictions will work are not 100%. Therefore there is some reason to look at the subject as one would were he forced by a wrong experimental outcome - to go back to fundamentals and ascertain what is the minimal amount of theory necessary to account for the data

  17. Designing "Interaction": How Do Interaction Design Students Address Interaction?

    Science.gov (United States)

    Karlgren, Klas; Ramberg, Robert; Artman, Henrik

    2016-01-01

    Interaction design is usually described as being concerned with interactions with and through artifacts but independent of a specific implementation. Design work has been characterized as a conversation between the designer and the situation and this conversation poses a particular challenge for interaction design as interactions can be elusive…

  18. DNA hosted and aligned in aqueous interstitia of a lamellar liquid crystal – a membrane–biomacromolecule interaction model system

    KAUST Repository

    Carlsson, Nils; Jonsson, Fabian; Wilhelmsson, L. Marcus; Nordé n, Bengt; Å kerman, Bjö rn

    2013-01-01

    We report that DNA molecules can be intercalated and macroscopically oriented in the aqueous interstitia of a lyotropic lamellar liquid crystal. Using UV-vis linear dichroism and fluorescence spectroscopy we show that double-stranded oligonucleotides (25 base pairs) in the water-octanoate-decanol system remain base-paired in the B conformation and are confined in two dimensions, with the helix axis preferentially parallel to the lipid bilayer surfaces but free to rotate within this plane. The degree of helix confinement and the corresponding 2-D orientation can be improved by decreasing the thickness of the water interstitia via the fraction of water in the ternary mixture. Not surprisingly, the corresponding single-stranded oligonucleotides are not aligned, with their persistence length being short in comparison to the lamellar interstitium thickness. We propose this as a model system for studying interactions of DNA-ligand complexes near a lipid bilayer membrane which we demonstrate by using dye probes that are either covalently attached to one end of the oligonucleotide or reversibly bound by intercalation between the base pairs. Three cationic dyes, all strongly bound by intercalation to DNA when free in solution, are found to not bind to DNA but to prefer the membrane surface. The covalently attached Cy5 also binds to the bilayer while Cy3 tends to end-stack to the oligonucleotide duplex. The orientation of Cy5 parallel to the membrane indicates that electrostatic surface binding predominates over insertion into the hydrophobic interior of the membrane. Anionic and zwitterionic dyes (FAM and ROX) are found to remain randomly oriented in the water between the lipid bilayer surfaces. © The Royal Society of Chemistry.

  19. An electrochemical study of neutral red-DNA interaction

    International Nuclear Information System (INIS)

    Heli, H.; Bathaie, S.Z.; Mousavi, M.F.

    2005-01-01

    Electrochemical methods were used to investigate the interaction of neutral red (NR) with double-stranded calf thymus DNA, in solution as well as using a DNA-modified glassy carbon (GC-DNA) electrode. The results were compared with those obtained from bare glassy carbon (GC) electrode. The formal potential of NR was more positive when GC-DNA electrode was used although the rate of heterogeneous electron transfer is as high as that of using GC electrode. GC-DNA electrode enables preconcentration of NR for chosen times on the electrode surface, despite the fact that the mass transfer effects in the thin DNA layer adsorbed on the surface was still observed using cyclic voltammetry and electrochemical impedance spectroscopy techniques. Parameters, such as the diffusion coefficient of NR, binding site size in base pairs and the ratio of the binding constants for the oxidized and reduced forms of the bound species were obtained. A binding isotherm for NR at GC-DNA electrode was obtained from coulometric titrations and gave an affinity constant equal to 2.76 x 10 4 L mol -1 . From the studies of the interaction in solution, the diffusion coefficient of free and DNA-bound NR, binding constant and binding site size of the DNA-NR complex was also obtained simultaneously by non-linear fitting analysis of voltammetric data

  20. Drug Interaction API

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Interaction API is a web service for accessing drug-drug interactions. No license is needed to use the Interaction API. Currently, the API uses DrugBank for its...

  1. The structure of metallo-DNA with consecutive thymine-Hg-II-thymine base pairs explains positive entropy for the metallo base pair formation

    Czech Academy of Sciences Publication Activity Database

    Yamaguchi, H.; Šebera, Jakub; Kondo, J.; Oda, S.; Komuro, T.; Kawamura, T.; Dairaku, T.; Kondo, Y.; Okamoto, I.; Ono, A.; Burda, J. V.; Kojima, C.; Sychrovský, Vladimír; Tanaka, Y.

    2014-01-01

    Roč. 42, č. 6 (2014), s. 4094-4099 ISSN 0305-1048 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : NMR structures * mercury * metalation * metal- DNA binding * DFT Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/6/4094.full

  2. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    Czech Academy of Sciences Publication Activity Database

    Lavery, R.; Zakrzewska, K.; Beveridge, D.; Bishop, T. C.; Case, D. A.; Cheatham III, T. E.; Dixit, S.; Jayaram, B.; Lankaš, Filip; Laughton, Ch.; Maddocks, J. H.; Michon, A.; Osman, R.; Orozco, M.; Pérez, A.; Singh, T.; Špačková, Naďa; Šponer, Jiří

    Roč. 38, č. 1 ( 2010 ), s. 299-313 ISSN 0305-1048 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA ČR GA203/09/1476; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : B-DNA * molecular dynamics * sequence dependet structure and dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 7.836, year: 2010

  3. Designing for mobile interaction

    DEFF Research Database (Denmark)

    Nazzi, Elena

    2009-01-01

    The theme of this PhD project is designing for mobile interaction with devices and services, for the accessing, making, and sharing of information, taking into account the dynamic physical and social settings that embrace this interaction. To narrow down this theme, the whole project focuses...... on the exploitation of social interaction --- in particular among senior citizens --- to enhance and support mobile interaction....

  4. Interaction for visualization

    CERN Document Server

    Tominski, Christian

    2015-01-01

    Visualization has become a valuable means for data exploration and analysis. Interactive visualization combines expressive graphical representations and effective user interaction. Although interaction is an important component of visualization approaches, much of the visualization literature tends to pay more attention to the graphical representation than to interaction.The goal of this work is to strengthen the interaction side of visualization. Based on a brief review of general aspects of interaction, we develop an interaction-oriented view on visualization. This view comprises five key as

  5. From nonspecific DNA-protein encounter complexes to the prediction of DNA-protein interactions.

    Directory of Open Access Journals (Sweden)

    Mu Gao

    2009-03-01

    Full Text Available DNA-protein interactions are involved in many essential biological activities. Because there is no simple mapping code between DNA base pairs and protein amino acids, the prediction of DNA-protein interactions is a challenging problem. Here, we present a novel computational approach for predicting DNA-binding protein residues and DNA-protein interaction modes without knowing its specific DNA target sequence. Given the structure of a DNA-binding protein, the method first generates an ensemble of complex structures obtained by rigid-body docking with a nonspecific canonical B-DNA. Representative models are subsequently selected through clustering and ranking by their DNA-protein interfacial energy. Analysis of these encounter complex models suggests that the recognition sites for specific DNA binding are usually favorable interaction sites for the nonspecific DNA probe and that nonspecific DNA-protein interaction modes exhibit some similarity to specific DNA-protein binding modes. Although the method requires as input the knowledge that the protein binds DNA, in benchmark tests, it achieves better performance in identifying DNA-binding sites than three previously established methods, which are based on sophisticated machine-learning techniques. We further apply our method to protein structures predicted through modeling and demonstrate that our method performs satisfactorily on protein models whose root-mean-square Calpha deviation from native is up to 5 A from their native structures. This study provides valuable structural insights into how a specific DNA-binding protein interacts with a nonspecific DNA sequence. The similarity between the specific DNA-protein interaction mode and nonspecific interaction modes may reflect an important sampling step in search of its specific DNA targets by a DNA-binding protein.

  6. Designing for Interactional Empowerment

    OpenAIRE

    Ståhl, Anna

    2014-01-01

    This thesis further defines how to reach Interactional Empowerment through design for users. Interactional Empowerment is an interaction design program within the general area of affective interaction, focusing on the users’ abil­ity to reflect, express themselves and engage in profound meaning-making. This has been explored through design of three systems eMoto, Affective Di­ary and Affective Health, which all mirror users’ emotions or bodily reactions in interaction in some way. From these ...

  7. Occurrence and stability of lone pair–π stacking interactions between ribose and nucleobases in functional RNAs

    KAUST Repository

    Chawla, Mohit; Chermak, Edrisse; Zhang, Qingyun; Bujnicki, Janusz M.; Oliva, Romina; Cavallo, Luigi

    2017-01-01

    The specific folding pattern and function of RNA molecules lies in various weak interactions, in addition to the strong base-base pairing and stacking. One of these relatively weak interactions, characterized by the stacking of the O4′ atom of a ribose on top of the heterocycle ring of a nucleobase, has been known to occur but has largely been ignored in the description of RNA structures. We identified 2015 ribose–base stacking interactions in a high-resolution set of non-redundant RNA crystal structures. They are widespread in structured RNA molecules and are located in structural motifs other than regular stems. Over 50% of them involve an adenine, as we found ribose-adenine contacts to be recurring elements in A-minor motifs. Fewer than 50% of the interactions involve a ribose and a base of neighboring residues, while approximately 30% of them involve a ribose and a nucleobase at least four residues apart. Some of them establish inter-domain or inter-molecular contacts and often implicate functionally relevant nucleotides. In vacuo ribose-nucleobase stacking interaction energies were calculated by quantum mechanics methods. Finally, we found that lone pair–π stacking interactions also occur between ribose and aromatic amino acids in RNA–protein complexes.

  8. Occurrence and stability of lone pair–π stacking interactions between ribose and nucleobases in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2017-08-18

    The specific folding pattern and function of RNA molecules lies in various weak interactions, in addition to the strong base-base pairing and stacking. One of these relatively weak interactions, characterized by the stacking of the O4′ atom of a ribose on top of the heterocycle ring of a nucleobase, has been known to occur but has largely been ignored in the description of RNA structures. We identified 2015 ribose–base stacking interactions in a high-resolution set of non-redundant RNA crystal structures. They are widespread in structured RNA molecules and are located in structural motifs other than regular stems. Over 50% of them involve an adenine, as we found ribose-adenine contacts to be recurring elements in A-minor motifs. Fewer than 50% of the interactions involve a ribose and a base of neighboring residues, while approximately 30% of them involve a ribose and a nucleobase at least four residues apart. Some of them establish inter-domain or inter-molecular contacts and often implicate functionally relevant nucleotides. In vacuo ribose-nucleobase stacking interaction energies were calculated by quantum mechanics methods. Finally, we found that lone pair–π stacking interactions also occur between ribose and aromatic amino acids in RNA–protein complexes.

  9. Multispectroscopic methods reveal different modes of interaction of anti cancer drug mitoxantrone with Poly(dG-dC).Poly(dG-dC) and Poly(dA-dT).Poly(dA-dT).

    Science.gov (United States)

    Awasthi, Pamita; Dogra, Shilpa; Barthwal, Ritu

    2013-10-05

    The interaction of mitoxantrone with alternating Poly(dG-dC).Poly(dG-dC) and Poly(dA-dT).Poly(dA-dT) duplex has been studied by absorption, fluorescence and Circular Dichroism (CD) spectroscopy at Drug to Phosphate base pair ratios D/P=20.0-0.04. Binding to GC polymer occurs in two distinct modes: partial stacking characterized by red shifts of 18-23nm at D/P=0.2-0.8 and external binding at D/P=1.0-20.0 whereas that to AT polymer occurs externally in the entire range of D/P. The binding constant and number of binding sites is 3.7×10(5)M(-1), 0.3 and 1.3× 10(4)M(-1), 1.5 in GC and AT polymers, respectively at low D/P ratios. CD binding isotherms show breakpoints at D/P=0.1, 0.5 and 0.25, 0.5 in GC and AT polymers, respectively. The intrinsic CD bands indicate that the distortions in GC polymer are significantly higher than that in AT polymer. Docking studies show partial insertion of mitoxantrone rings between to GC base pairs in alternating GC polymer. Side chains of mitoxantrone interact specifically with base pairs and DNA backbone. The studies are relevant to the understanding of suppression or inhibition of DNA cleavage on formation of ternary complex with topoisomerase-II enzyme and hence the anti cancer action. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Interactive pinball business

    DEFF Research Database (Denmark)

    Buur, Jacob; Gudiksen, Sune Klok

    2012-01-01

    Interaction design expands into new fields. Interaction design and business model innovation is a promising meeting of disciplines: Many businesses see the need to rethink their ways of doing business, and, as business models pose highly dynamic and interactive problems, interaction design has much...... with hypotheses and experiment with scenarios as a way of innovating their business models, and why this is so...... to offer. This paper compares 'tangible business models' in the form of pinball-like contraptions, designed by interaction design students with those developed by groups of professionals around concrete business issues. We will show how the interactive models encourage business people to play...

  11. Interacting dark sector with transversal interaction

    Energy Technology Data Exchange (ETDEWEB)

    Chimento, Luis P.; Richarte, Martín G. [Departamento de Física, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires and IFIBA, CONICET, Ciudad Universitaria, Pabellón I, Buenos Aires 1428 (Argentina)

    2015-03-26

    We investigate the interacting dark sector composed of dark matter, dark energy, and dark radiation for a spatially flat Friedmann-Robertson-Walker (FRW) background by introducing a three-dimensional internal space spanned by the interaction vector Q and solve the source equation for a linear transversal interaction. Then, we explore a realistic model with dark matter coupled to a scalar field plus a decoupled radiation term, analyze the amount of dark energy in the radiation era and find that our model is consistent with the recent measurements of cosmic microwave background anisotropy coming from Planck along with the future constraints achievable by CMBPol experiment.

  12. Perturbations in DNA structure upon interaction with porphyrins revealed by chemical probes, DNA footprinting and molecular modelling.

    Science.gov (United States)

    Ford, K G; Neidle, S

    1995-06-01

    The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.

  13. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Science.gov (United States)

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  14. Substrate interactions and promiscuity in a viral DNA packaging motor.

    Science.gov (United States)

    Aathavan, K; Politzer, Adam T; Kaplan, Ariel; Moffitt, Jeffrey R; Chemla, Yann R; Grimes, Shelley; Jardine, Paul J; Anderson, Dwight L; Bustamante, Carlos

    2009-10-01

    The ASCE (additional strand, conserved E) superfamily of proteins consists of structurally similar ATPases associated with diverse cellular activities involving metabolism and transport of proteins and nucleic acids in all forms of life. A subset of these enzymes consists of multimeric ringed pumps responsible for DNA transport in processes including genome packaging in adenoviruses, herpesviruses, poxviruses and tailed bacteriophages. Although their mechanism of mechanochemical conversion is beginning to be understood, little is known about how these motors engage their nucleic acid substrates. Questions remain as to whether the motors contact a single DNA element, such as a phosphate or a base, or whether contacts are distributed over several parts of the DNA. Furthermore, the role of these contacts in the mechanochemical cycle is unknown. Here we use the genome packaging motor of the Bacillus subtilis bacteriophage varphi29 (ref. 4) to address these questions. The full mechanochemical cycle of the motor, in which the ATPase is a pentameric-ring of gene product 16 (gp16), involves two phases-an ATP-loading dwell followed by a translocation burst of four 2.5-base-pair (bp) steps triggered by hydrolysis product release. By challenging the motor with a variety of modified DNA substrates, we show that during the dwell phase important contacts are made with adjacent phosphates every 10-bp on the 5'-3' strand in the direction of packaging. As well as providing stable, long-lived contacts, these phosphate interactions also regulate the chemical cycle. In contrast, during the burst phase, we find that DNA translocation is driven against large forces by extensive contacts, some of which are not specific to the chemical moieties of DNA. Such promiscuous, nonspecific contacts may reflect common translocase-substrate interactions for both the nucleic acid and protein translocases of the ASCE superfamily.

  15. Testing strong interaction theories

    International Nuclear Information System (INIS)

    Ellis, J.

    1979-01-01

    The author discusses possible tests of the current theories of the strong interaction, in particular, quantum chromodynamics. High energy e + e - interactions should provide an excellent means of studying the strong force. (W.D.L.)

  16. The interactive microbial ocean

    NARCIS (Netherlands)

    Brussaard, C.P.D.; Bidle, K.D.; Pedrós-Alió, C.; Legrand, C.

    2016-01-01

    Marine microorganisms inhabit diverse environments and interact over different spatial and temporal scales. To fully understand how these interactions shape genome structures, cellular responses, lifestyles, community ecology and biogeochemical cycles, integration of diverse approaches and data is

  17. Health Data Interactive (HDI)

    Data.gov (United States)

    U.S. Department of Health & Human Services — Health Data Interactive (HDI) presents a broad range of important public health indicators through an interactive web-based application that provides access to...

  18. Gestalt Interactional Groups

    Science.gov (United States)

    Harman, Robert L.; Franklin, Richard W.

    1975-01-01

    Gestalt therapy in groups is not limited to individual work in the presence of an audience. Describes several ways to involve gestalt groups interactionally. Interactions described focus on learning by doing and discovering, and are noninterpretive. (Author/EJT)

  19. Interacting agents in finance

    NARCIS (Netherlands)

    Hommes, C.; Durlauf, S.N.; Blume, L.E.

    2008-01-01

    Interacting agents in finance represent a behavioural, agent-based approach in which financial markets are viewed as complex adaptive systems consisting of many boundedly rational agents interacting through simple heterogeneous investment strategies, constantly adapting their behaviour in response

  20. Gaze Interactive Building Instructions

    DEFF Research Database (Denmark)

    Hansen, John Paulin; Ahmed, Zaheer; Mardanbeigi, Diako

    We combine eye tracking technology and mobile tablets to support hands-free interaction with digital building instructions. As a proof-of-concept we have developed a small interactive 3D environment where one can interact with digital blocks by gaze, keystroke and head gestures. Blocks may be moved...

  1. Convergence in Multispecies Interactions

    OpenAIRE

    Bittleston, Leonora Sophia; Pierce, Naomi E.; Ellison, Aaron M.; Pringle, Anne

    2016-01-01

    The concepts of convergent evolution and community convergence highlight how selective pressures can shape unrelated organisms or communities in similar ways. We propose a related concept, convergent interactions, to describe the independent evolution of multispecies interactions with similar physiological or ecological functions. A focus on convergent interactions clarifies how natural selection repeatedly favors particular kinds of associations among species. Characterizing convergent inter...

  2. Restricted Variance Interaction Effects

    DEFF Research Database (Denmark)

    Cortina, Jose M.; Köhler, Tine; Keeler, Kathleen R.

    2018-01-01

    Although interaction hypotheses are increasingly common in our field, many recent articles point out that authors often have difficulty justifying them. The purpose of this article is to describe a particular type of interaction: the restricted variance (RV) interaction. The essence of the RV int...

  3. Weak interactions with nuclei

    International Nuclear Information System (INIS)

    Walecka, J.D.

    1983-01-01

    Nuclei provide systems where the strong, electomagnetic, and weak interactions are all present. The current picture of the strong interactions is based on quarks and quantum chromodynamics (QCD). The symmetry structure of this theory is SU(3)/sub C/ x SU(2)/sub W/ x U(1)/sub W/. The electroweak interactions in nuclei can be used to probe this structure. Semileptonic weak interactions are considered. The processes under consideration include beta decay, neutrino scattering and weak neutral-current interactions. The starting point in the analysis is the effective Lagrangian of the Standard Model

  4. Media Facades beyond Interaction

    DEFF Research Database (Denmark)

    Fritsch, Jonas

    2008-01-01

    As part of a the research project Digital Urban Living [www.digitalurbanliving.dk], we have taken part in the design of two large-scale installations that employ interactive technologies to facilitate participation and foster social interactions in public, urban settings. We present the two cases......, Aarhus by Light and Projected Poetry, and discuss the future trajectory of our work in this field, as well as some of our findings regarding the challenges of designing large-scale public interactive installations. In doing so, we specifically highlight the possibilities in relation to designing...... for affective experience and engaging interaction that advocate for a long-term interactive experience....

  5. Convergence in Multispecies Interactions.

    Science.gov (United States)

    Bittleston, Leonora S; Pierce, Naomi E; Ellison, Aaron M; Pringle, Anne

    2016-04-01

    The concepts of convergent evolution and community convergence highlight how selective pressures can shape unrelated organisms or communities in similar ways. We propose a related concept, convergent interactions, to describe the independent evolution of multispecies interactions with similar physiological or ecological functions. A focus on convergent interactions clarifies how natural selection repeatedly favors particular kinds of associations among species. Characterizing convergent interactions in a comparative context is likely to facilitate prediction of the ecological roles of organisms (including microbes) in multispecies interactions and selective pressures acting in poorly understood or newly discovered multispecies systems. We illustrate the concept of convergent interactions with examples: vertebrates and their gut bacteria; ectomycorrhizae; insect-fungal-bacterial interactions; pitcher-plant food webs; and ants and ant-plants. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Nonproductive human immunodeficiency virus type 1 infection of human fetal astrocytes: independence from CD4 and major chemokine receptors.

    Science.gov (United States)

    Sabri, F; Tresoldi, E; Di Stefano, M; Polo, S; Monaco, M C; Verani, A; Fiore, J R; Lusso, P; Major, E; Chiodi, F; Scarlatti, G

    1999-11-25

    Human immunodeficiency virus type 1 (HIV-1) infection of the brain is associated with neurological manifestations both in adults and in children. The primary target for HIV-1 infection in the brain is the microglia, but astrocytes can also be infected. We tested 26 primary HIV-1 isolates for their capacity to infect human fetal astrocytes in culture. Eight of these isolates, independent of their biological phenotype and chemokine receptor usage, were able to infect astrocytes. Although no sustained viral replication could be demonstrated, the virus was recovered by coculture with receptive cells such as macrophages or on stimulation with interleukin-1beta. To gain knowledge into the molecular events that regulate attachment and penetration of HIV-1 in astrocytes, we investigated the expression of several chemokine receptors. Fluorocytometry and calcium-mobilization assay did not provide evidence of expression of any of the major HIV-1 coreceptors, including CXCR4, CCR5, CCR3, and CCR2b, as well as the CD4 molecule on the cell surface of human fetal astrocytes. However, mRNA transcripts for CXCR4, CCR5, Bonzo/STRL33/TYMSTR, and APJ were detected by RT-PCR. Furthermore, infection of astrocytes by HIV-1 isolates with different chemokine receptor usage was not inhibited by the chemokines SDF-1beta, RANTES, MIP-1beta, or MCP-1 or by antibodies directed against the third variable region or the CD4 binding site of gp120. These data show that astrocytes can be infected by primary HIV-1 isolates via a mechanism independent of CD4 or major chemokine receptors. Furthermore, astrocytes are potential carriers of latent HIV-1 and on activation may be implicated in spreading the infection to other neighbouring cells, such as microglia or macrophages. Copyright 1999 Academic Press.

  7. Raman spectroscopy of DNA-metal complexes. I. Interactions and conformational effects of the divalent cations: Mg, Ca, Sr, Ba, Mn, Co, Ni, Cu, Pd, and Cd.

    Science.gov (United States)

    Duguid, J; Bloomfield, V A; Benevides, J; Thomas, G J

    1993-11-01

    Interactions of divalent metal cations (Mg2+, Ca2+, Ba2+, Sr2+, Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) with DNA have been investigated by laser Raman spectroscopy. Both genomic calf-thymus DNA (> 23 kilobase pairs) and mononucleosomal fragments (160 base pairs) were employed as targets of metal interaction in solutions containing 5 weight-% DNA and metal:phosphate molar ratios of 0.6:1. Raman difference spectra reveal that transition metal cations (Mn2+, Co2+, Ni2+, Cu2+, Pd2+, and Cd2+) induce the greatest structural changes in B-DNA. The Raman (vibrational) band differences are extensive and indicate partial disordering of the B-form backbone, reduction in base stacking, reduction in base pairing, and specific metal interaction with acceptor sites on the purine (N7) and pyrimidine (N3) rings. Many of the observed spectral changes parallel those accompanying thermal denaturation of B-DNA and suggest that the metals link the bases of denatured DNA. While exocyclic carbonyls of dT, dG, and dC may stabilize metal ligation, correlation plots show that perturbations of the carbonyls are mainly a consequence of metal-induced denaturation of the double helix. Transition metal interactions with the DNA phosphates are weak in comparison to interactions with the bases, except in the case of Cu2+, which strongly perturbs both base and phosphate group vibrations. On the other hand, the Raman signature of B-DNA is largely unperturbed by Mg2+, Ca2+, Sr2+, and Ba2+, suggesting much weaker interactions of the alkaline earth metals with both base and phosphate sites. A notable exception is a moderate perturbation by alkaline earths of purine N7 sites in 160-base pair DNA, with Ca2+ causing the greatest effect. Correlation plots demonstrate a strong interrelationship between perturbations of Raman bands assigned to ring vibrations of the bases and those of bands assigned to exocyclic carbonyls and backbone phosphodiester groups. However, strong correlations do not occur between

  8. Food-drug interactions

    DEFF Research Database (Denmark)

    Schmidt, Lars E; Dalhoff, Kim

    2002-01-01

    Interactions between food and drugs may inadvertently reduce or increase the drug effect. The majority of clinically relevant food-drug interactions are caused by food-induced changes in the bioavailability of the drug. Since the bioavailability and clinical effect of most drugs are correlated......, the bioavailability is an important pharmacokinetic effect parameter. However, in order to evaluate the clinical relevance of a food-drug interaction, the impact of food intake on the clinical effect of the drug has to be quantified as well. As a result of quality review in healthcare systems, healthcare providers...... are increasingly required to develop methods for identifying and preventing adverse food-drug interactions. In this review of original literature, we have tried to provide both pharmacokinetic and clinical effect parameters of clinically relevant food-drug interactions. The most important interactions are those...

  9. Grasp interaction with tablets

    CERN Document Server

    Wolf, Katrin

    2015-01-01

    This book presents guidelines for a future device type: a tablet that allows ergonomic front- and back-of-device interaction. These guidelines help designers and developers of user interfaces to build ergonomic applications for tablet devices, in particular for devices that enable back-of-device interaction. In addition, manufacturers of tablet devices obtain arguments that back-of-device interaction is a promising extension of the interaction design space and results in increased input capabilities, enriched design possibilities, and proven usability. The guidelines are derived from empirical studies and developed to fit the users’ skills to the way the novel device type is held. Three particular research areas that are relevant to develop design guidelines for tablet interaction are investigated: ergonomic gestures, interaction areas, and pointing techniques.

  10. Quantum interaction. Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Bruza, Peter [Queensland Univ. of Technology, Brisbane (Australia). Faculty of Science and Technology; Sofge, Donald [Navy Center for Applied Research in Artificial Intelligence, Washington, DC (United States). Naval Research Lab.; Lawless, William [Paine Coll., Augusta, GA (United States); Rijsbergen, Keith van [Glasgow Univ. (United Kingdom). Dept. of Computing Science; Klusch, Matthias (eds.) [German Research Center for Artificial Intelligence, Saarbruecken (Germany)

    2009-07-01

    This book constitutes the refereed proceedings of the Third International Symposium on Quantum Interaction, QI 2009, held in Saarbruecken, Germany, in March 2009. The 21 revised full papers presented together with the 3 position papers were carefully reviewed and selected from numerous submissions. The papers show the cross-disciplinary nature of quantum interaction covering topics such as computation, cognition, decision theory, information retrieval, information systems, social interaction, computational linguistics and finance. (orig.)

  11. Food-Drug Interactions

    Directory of Open Access Journals (Sweden)

    Arshad Yar Khan

    2011-03-01

    Full Text Available The effect of drug on a person may be different than expected because that drug interacts with another drug the person is taking (drug-drug interaction, food, beverages, dietary supplements the person is consuming (drug-nutrient/food interaction or another disease the person has (drug-disease interaction. A drug interaction is a situation in which a substance affects the activity of a drug, i.e. the effects are increased or decreased, or they produce a new effect that neither produces on its own. These interactions may occur out of accidental misuse or due to lack of knowledge about the active ingredients involved in the relevant substances. Regarding food-drug interactions physicians and pharmacists recognize that some foods and drugs, when taken simultaneously, can alter the body's ability to utilize a particular food or drug, or cause serious side effects. Clinically significant drug interactions, which pose potential harm to the patient, may result from changes in pharmaceutical, pharmacokinetic, or pharmacodynamic properties. Some may be taken advantage of, to the benefit of patients, but more commonly drug interactions result in adverse drug events. Therefore it is advisable for patients to follow the physician and doctors instructions to obtain maximum benefits with least fooddrug interactions. The literature survey was conducted by extracting data from different review and original articles on general or specific drug interactions with food. This review gives information about various interactions between different foods and drugs and will help physicians and pharmacists prescribe drugs cautiously with only suitable food supplement to get maximum benefit for the patient.

  12. Quantum interaction. Proceedings

    International Nuclear Information System (INIS)

    Bruza, Peter; Rijsbergen, Keith van

    2009-01-01

    This book constitutes the refereed proceedings of the Third International Symposium on Quantum Interaction, QI 2009, held in Saarbruecken, Germany, in March 2009. The 21 revised full papers presented together with the 3 position papers were carefully reviewed and selected from numerous submissions. The papers show the cross-disciplinary nature of quantum interaction covering topics such as computation, cognition, decision theory, information retrieval, information systems, social interaction, computational linguistics and finance. (orig.)

  13. Interactive Strategy-Making

    DEFF Research Database (Denmark)

    Andersen, Torben Juul

    2015-01-01

    This article outlines an interactive strategy-making model that combines central reasoning with ongoing learning from decentralised responses. The management literature often presents strategy as implementing an optimal plan identified through rational analysis and ascribes potential shortcomings...... to failed communication and execution of the planned actions. However, effective strategy-making comprises both central reasoning from forward-looking planning considerations and decentralised responses to emerging events as interacting elements in a dynamic adaptive system. The interaction between...

  14. Interactions in multispecies biofilms

    DEFF Research Database (Denmark)

    Burmølle, Mette; Ren, Dawei; Bjarnsholt, Thomas

    2014-01-01

    The recent focus on complex bacterial communities has led to the recognition of interactions across species boundaries. This is particularly pronounced in multispecies biofilms, where synergistic interactions impact the bacterial distribution and overall biomass produced. Importantly, in a number...... of settings, the interactions in a multispecies biofilm affect its overall function, physiology, or surroundings, by resulting in enhanced resistance, virulence, or degradation of pollutants, which is of significant importance to human health and activities. The underlying mechanisms causing these synergistic...

  15. Theory of particle interactions

    International Nuclear Information System (INIS)

    Belokurov, V.V.; Shirkov, D.V.

    1986-01-01

    Development and modern state of the theory of elementary particle interactions is described. The main aim of the paper is to give a picture of quantum field theory development in the form easily available for physicists not occupied in this field of science. Besides the outline of chronological development of main representations, the description of renormalization and renorm-groups, gauge theories, models of electro-weak interactions and quantum chromodynamics, the latest investigations related to joining all interactions and supersymmetries is given

  16. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit; Autiero, Ida; Oliva, Romina; Cavallo, Luigi

    2018-01-01

    the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM

  17. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  18. Charge transport in DNA oligonucleotides with various base-pairing patterns

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Todorciuc, Tatiana; Král, Karel; Němec, Hynek; Bunček, M.; Šebera, Jakub; Záliš, Stanislav; Vokáčová, Zuzana; Sychrovský, Vladimír; Bednárová, Lucie; Mojzeš, P.; Schneider, Bohdan

    2010-01-01

    Roč. 114, č. 15 (2010), 5196–5205 ISSN 1520-6106 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA ČR GA202/07/0643; GA AV ČR IAA400550701; GA AV ČR KAN200100801; GA AV ČR KAN100400702; GA ČR GA202/09/0193 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z40400503; CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : DNA * charge transport * Scanning Tunneling Microscopy Subject RIV: CC - Organic Chemistry Impact factor: 3.603, year: 2010

  19. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).

  20. Structure of 2,4-Diaminopyrimidine-Theobromine Alternate Base Pairs

    Czech Academy of Sciences Publication Activity Database

    Gengeliczki, Z.; Callahan, M. P.; Kabeláč, Martin; Rijs, A. M.; de Vries, M. S.

    2011-01-01

    Roč. 115, č. 41 (2011), s. 11423-11427 ISSN 1089-5639 R&D Projects: GA MŠk LC512; GA AV ČR IAA400550808 Institutional research plan: CEZ:AV0Z40550506 Keywords : ab-initio calculations * double resonance spectroscopy * basis-set * guanine * cytosine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.946, year: 2011

  1. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    Science.gov (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  2. Structure of 2,4-Diaminopyrimidine-Theobromine Alternate Base Pairs

    NARCIS (Netherlands)

    Gengeliczki, Z.; Callahan, M. P.; Kabelac, M.; Rijs, A. M.; de Vries, M. S.

    2011-01-01

    We report the structure of dusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate

  3. Time series regression-based pairs trading in the Korean equities market

    Science.gov (United States)

    Kim, Saejoon; Heo, Jun

    2017-07-01

    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  4. Base Pair Fraying in Molecular Dynamics Simulations of DNA and RNA

    Czech Academy of Sciences Publication Activity Database

    Zgarbová, M.; Otyepka, Michal; Šponer, Jiří; Lankaš, Filip; Jurečka, P.

    2014-01-01

    Roč. 10, č. 8 (2014), s. 3177-3189 ISSN 1549-9618 Grant - others:GA ČR(CZ) GP14-29874P Institutional support: RVO:68081707 ; RVO:61388963 Keywords : QUANTUM-CHEMICAL COMPUTATIONS * NUCLEIC-ACID STRUCTURES * AMBER FORCE-FIELD Subject RIV: BO - Biophysics; CC - Organic Chemistry (UOCHB-X) Impact factor: 5.498, year: 2014

  5. Hg-II/Ag-I-mediated base pairs and their NMR spectroscopic studies

    Czech Academy of Sciences Publication Activity Database

    Dairaku, T.; Furuita, K.; Sato, H.; Šebera, Jakub; Nakashima, K.; Ono, A.; Sychrovský, Vladimír; Kojima, C.; Tanaka, Y.

    2016-01-01

    Roč. 452, Oct 1 (2016), s. 34-42 ISSN 0020-1693 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : NMR * Hg * Ag * metal-DNA Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  6. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  7. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    pdb1. 2.00. CATGGCCATG. 158d.pdb1. 1.90. CCAAGCTTGG. 167d.pdb1. 2.30. CCATTAATGG. 194d.pdb1. 2.30. CGCGTTAACGCG. 196d.pdb1. 1.70. CTCTCGAGAG. 1bd1.pdb1. 1.60. CCAGGCCTGG. 1bdn.pdb1. 2.60. CGCAAAAATGCG.

  8. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... explicit consideration of water and ions and provides a descrip- tion of structure ... peaks and valleys in DNA–water radial distribution functions. Within the ...... Chocholousova J and Feig M 2006 Implicit solvent simulations of.

  9. Reference quantum chemical calculations on RNA base pairs directly involving the 2'-OH group of ribose

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Zgarbová, M.; Jurečka, Petr; Riley, K.E.; Šponer, Judit E.; Hobza, Pavel

    2009-01-01

    Roč. 5, č. 4 (2009), s. 1166-1179 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA AV ČR(CZ) IAA400550701; GA MŠk(CZ) LC06030; GA MŠk(CZ) LC512 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : RNA * ribose * quantum calculations Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  10. Computational analysis of the stabilization effects in successive U-Hg-U base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Sychrovský, Vladimír

    2010-01-01

    Roč. 17, 1a (2010), b14-b14 ISSN 1210-8529. [Discussions in Structural Molecular Biology /8./. 18.03.-20.03.2010, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : metallophilic attraction * metallated nucleic acids * mercury

  11. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles

    Czech Academy of Sciences Publication Activity Database

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal

    2016-01-01

    Roč. 120, č. 27 (2016), s. 4720-4730 ISSN 1089-5639 R&D Projects: GA ČR GA14-14082S Institutional support: RVO:61388955 ; RVO:61388963 Keywords : doped nanoparticles * argon * biomolecule s Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.847, year: 2016

  12. A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

    Science.gov (United States)

    Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

    2003-01-01

    A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

  13. Vision-based interaction

    CERN Document Server

    Turk, Matthew

    2013-01-01

    In its early years, the field of computer vision was largely motivated by researchers seeking computational models of biological vision and solutions to practical problems in manufacturing, defense, and medicine. For the past two decades or so, there has been an increasing interest in computer vision as an input modality in the context of human-computer interaction. Such vision-based interaction can endow interactive systems with visual capabilities similar to those important to human-human interaction, in order to perceive non-verbal cues and incorporate this information in applications such

  14. Proxemic Mobile Collocated Interactions

    DEFF Research Database (Denmark)

    Porcheron, Martin; Lucero, Andrés; Quigley, Aaron

    2016-01-01

    and their digital devices (i.e. the proxemic relationships). Building on the ideas of proxemic interactions, this workshop is motivated by the concept of ‘proxemic mobile collocated interactions’, to harness new or existing technologies to create engaging and interactionally relevant experiences. Such approaches......Recent research on mobile collocated interactions has been looking at situations in which collocated users engage in collaborative activities using their mobile devices. However, existing practices fail to fully account for the culturally-dependent spatial relationships between people...... in exploring proxemics and mobile collocated interactions....

  15. Framing interactive methods

    DEFF Research Database (Denmark)

    Rasmussen, Lauge Baungaard

    2011-01-01

    Two paradigms of organization and leadership is outlined and compared. A theoretical model of interactive leadership is developed, combining learning, knowledge flow, leadership and organizational principles....

  16. Two interacting Hofstadter butterflies

    International Nuclear Information System (INIS)

    Barelli, A.; Bellissard, J.; Jacquod, P.

    1997-01-01

    The problem of two interacting particles in a quasiperiodic potential is addressed. Using analytical and numerical methods, we explore the spectral properties and eigenstates structure from the weak to the strong interaction case. More precisely, a semiclassical approach based on noncommutative geometry techniques is used to understand the intricate structure of such a spectrum. An interaction induced localization effect is furthermore emphasized. We discuss the application of our results on a two-dimensional model of two particles in a uniform magnetic field with on-site interaction. copyright 1997 The American Physical Society

  17. Philosophy of Interaction

    DEFF Research Database (Denmark)

    Svanæs, Dag

    2011-01-01

    This is an encyclopedia entry for the Interaction-Design.org free IxD encyclopedia. The topic of the entry is the application of the philosophy of Heidegger and Merleau-Ponty to a theory of interactivity. Comments by Don Norman and Eva Hornecker.......This is an encyclopedia entry for the Interaction-Design.org free IxD encyclopedia. The topic of the entry is the application of the philosophy of Heidegger and Merleau-Ponty to a theory of interactivity. Comments by Don Norman and Eva Hornecker....

  18. Antibacterial effect of cationic porphyrazines and anionic phthalocyanine and their interaction with plasmid DNA

    Science.gov (United States)

    Hassani, Leila; Hakimian, Fatemeh; Safaei, Elham; Fazeli, Zahra

    2013-11-01

    Resistance to antibiotics is a public health issue and identification of new antibacterial agents is one of the most important goals of pharmacological research. Among the novel developed antibacterial agents, porphyrin complexes and their derivatives are ideal candidates for use in medical applications. Phthalocyanines differ from porphyrins by having nitrogen atoms link the individual pyrrol units. The aza analogues of the phthalocyanines (azaPcs) such as tetramethylmetalloporphyrazines are heterocyclic Pc analogues. In this investigation, interaction of an anionic phthalocyanine (Cu(PcTs)) and two cationic tetrapyridinoporphyrazines including [Cu(2,3-tmtppa)]4+ and [Cu(3,4-tmtppa)]4+ complexes with plasmid DNA was studied using spectroscopic and gel electrophoresis methods. In addition, antibacterial effect of the complexes against Gram-positive (Staphylococcus aureus) and Gram-negative (Escherichia coli) bacteria was investigated using dilution test method. The results indicated that both porphyrazines have significant antibacterial properties, but Cu(PcTs) has weak antibacterial effect. Compairing the binding of the phthalocyanine and the porphyrazines to DNA demonstrated that the interaction of cationic porphyrazines is stronger than the anionic phthalocyanine remarkably. The extent of hypochromicity and red shift of absorption spectra indicated preferential intercalation of the two porphyrazine into the base pairs of DNA helix. Gel electrophoresis result implied Cu(2,3-tmtppa) and Cu(3,4-tmtppa) are able to perform cleavage of the plasmid DNA. Consequently, DNA binding and cleavage might be one of the antibacterial mechanisms of the complexes.

  19. Kinetics of depletion interactions

    NARCIS (Netherlands)

    Vliegenthart, G.A.; Schoot, van der P.P.A.M.

    2003-01-01

    Depletion interactions between colloidal particles dispersed in a fluid medium are effective interactions induced by the presence of other types of colloid. They are not instantaneous but built up in time. We show by means of Brownian dynamics simulations that the static (mean-field) depletion force

  20. Curiosity and Interaction

    NARCIS (Netherlands)

    Tieben, R.; Bekker, M.M.; Schouten, B.A.M.

    2011-01-01

    We explore the concepts of curiosity and interaction: how can we elicit curiosity in public spaces through interactive systems? We have developed a model consisting of five curiosity-evoking principles. In an iterative design research approach, we have explored the design implementations of these

  1. Storyboarding Multimedia Interactions.

    Science.gov (United States)

    Martin, Linda C.

    2000-01-01

    Understanding how to include interactivity when designing multimedia-based training (MBT) storyboards is a major key for a successful MBT. Discusses the basic formats of interactions and when to use each format. Describes how to storyboard and areas to address, including: the display area, prompts, branching, programming and graphics notes,…

  2. Designing for Interaction Proxemics

    DEFF Research Database (Denmark)

    Grønbæk, Jens Emil

    2018-01-01

    Design of interactive technology provides opportunities as well as constraints in how a group of users can organize in a shared space. The core argument of interaction proxemics is to consider this in designing for collaboration. In my thesis, I focus on conceptualizing design of ubicomp...

  3. INTERACT Station Catalogue - 2015

    DEFF Research Database (Denmark)

    INTERACT stations are located in all major environmental envelopes of the Arctic providing an ideal platform for studying climate change and its impact on the environment and local communities. Since alpine environments face similar changes and challenges as the Arctic, the INTERACT network also ...... catalogue includes descriptions of 73 research stations included in the network at the time of printing....

  4. Electroweak interactions in nuclei

    International Nuclear Information System (INIS)

    Henley, E.M.

    1984-06-01

    Topics include: introduction to electroweak theory; the Weinberg-Salam theory for leptons; the Weinberg-Salam theory for hadrons-the GIM mechanism; electron scattering as a probe of the electroweak interaction (observation of PV, the weak interaction for nucleons, and parity violation in atoms); and time reversed invariance and electric dipole moments of nucleons, nuclei, and atoms. 52 references

  5. Elementary particle interactions

    International Nuclear Information System (INIS)

    Bugg, W.M.; Condo, G.T.; Handler, T.; Hart, E.L.; Ward, B.F.L.; Close, F.E.; Christophorou, L.G.

    1990-10-01

    This report discusses freon bubble chamber experiments exposed to μ + and neutrinos, photon-proton interactions; shower counter simulations; SLD detectors at the Stanford Linear Collider, and the detectors at the Superconducting Super Collider; elementary particle interactions; physical properties of dielectric materials used in High Energy Physics detectors; and Nuclear Physics

  6. Foreign language interactive didactics

    Directory of Open Access Journals (Sweden)

    Arnaldo Moisés Gómez

    2016-06-01

    Full Text Available Foreign Language Interactive Didactics is intended for foreign language teachers and would-be teachers since it is an interpretation of the foreign language teaching-learning process is conceived from a reflexive social interaction. This interpretation declares learning based on interactive tasks that provide learners with opportunities to interact meaningfully among them, as a way to develop interactional competence as objective in itself and as a means to obtain communicative competence. Foreign language interactive didactics claims for the unity of reflection and action while learning the language system and using it to communicate, by means of solving problems presented in interactive tasks. It proposes a kind of teaching that is interactive, developmental, collaborative, holist, cognitive, problematizing, reflexive, student centered, humanist, and with a strong affective component that empower the influencing psychological factors in learning. This conception appears in the book: DIDÁCTICA INTERACTIVA DE LENGUAS (2007 y 2010. The book is used as a textbook for the subject of Didactics that is part of the curriculum in language teachers’ formation of all the pedagogical sciences universities, in Spanish teachers’ formation who are not Spanish speaking people at Havana University, and also as a reference book for postgraduate courses, master’s and doctorate’ s degrees.

  7. Interactive baby feeding bottle

    NARCIS (Netherlands)

    2013-01-01

    An interactive baby bottle with an electronic unit is disclosed. The electronic unit comprises a sensor unit configured to sense the heart beat of a person bottle feeding a baby and an actuator unit configured to transmit the sensed heart beat to the baby. The disclosed interactive baby bottle can

  8. Drug interactions with radiopharmaceuticals

    International Nuclear Information System (INIS)

    Hesslewood, S.; Leung, E.

    1994-01-01

    Considerable information on documented drug and radiopharmaceutical interactions has been assembled in a tabular form, classified by the type of nuclear medicine study. The aim is to provide a rapid reference for nuclear medicine staff to look for such interactions. The initiation of drug chart monitoring or drug history taking of nuclear medicine patients and the reporting of such events are encouraged. (orig.)

  9. Let Social Interaction Flourish

    Science.gov (United States)

    Case, Anny Fritzen

    2016-01-01

    The author describes lessons learned--through a high school project that grouped English language learners with native speakers to create a video--about ways to foster respectful, productive interaction among English learners and peers who are native speakers. The potential benefits of students who are just learning English interacting socially…

  10. Photon-photon interactions

    International Nuclear Information System (INIS)

    Gilman, F.J.

    1980-01-01

    A brief summary of the present status of photon-photon interactions is presented. Stress is placed on the use of two-photon collisions to test present ideas on the quark constituents of hadrons and on the theory of strong interactions

  11. Computations and interaction

    NARCIS (Netherlands)

    Baeten, J.C.M.; Luttik, S.P.; Tilburg, van P.J.A.; Natarajan, R.; Ojo, A.

    2011-01-01

    We enhance the notion of a computation of the classical theory of computing with the notion of interaction. In this way, we enhance a Turing machine as a model of computation to a Reactive Turing Machine that is an abstract model of a computer as it is used nowadays, always interacting with the user

  12. Antiproton-nucleus interaction

    International Nuclear Information System (INIS)

    Gibbs, W.R.

    1984-01-01

    Several facets of antinucleon-nucleus interactions are explored. The topics treated are: coherent interactions, production of unusual states and particles in the nuclear medium, and the creation of extreme states of matter by antimatter annihilation. It is found that temperatures of the magnitude necessary to achieve the predicted quark-gluon phase transition are obtained. 20 references

  13. Media Facades beyond Interaction

    DEFF Research Database (Denmark)

    Fritsch, Jonas

    2008-01-01

    As part of a the research project Digital Urban Living [www.digitalurbanliving.dk], we have taken part in the design of two large-scale installations that employ interactive technologies to facilitate participation and foster social interactions in public, urban settings. We present the two cases...

  14. Interaction Analysis and Supervision.

    Science.gov (United States)

    Amidon, Edmund

    This paper describes a model that uses interaction analysis as a tool to provide feedback to a teacher in a microteaching situation. The author explains how interaction analysis can be used for teacher improvement, describes the category system used in the model, the data collection methods used, and the feedback techniques found in the model. (JF)

  15. Interaction of atmospheric pollutants

    Energy Technology Data Exchange (ETDEWEB)

    Bustueva, K A; Sanotsky, I V

    1975-01-01

    In evaluating the health effects of chemical and physical factors, it is of great importance to know the possible interactions between different pollutants. The biological effects of interactions, when present, may be synergistic, antagonistic or additive. Each type of interaction calls for a different evaluation and different practical measures. As yet the understanding of such effects is not clear, probably because of differing definitions of terminology. For example, the combined effect of sulfur dioxide and particulates is interpreted as a synergistic effect; in the author's opinion, this is an aggravating effect. The type of interaction depends on the levels of concentration observed, for example, the synergism shown at high levels of concentration is not always demonstrated for low levels of concentration. In fact there is little evidence of synergistic effects from ambient air pollutant; the more common type of interaction is additive in effect. 12 references.

  16. Diachronic Perspective and Interaction

    DEFF Research Database (Denmark)

    Marchetti, Emanuela; Valente, Andrea

    . An ongoing participatory inquiry is being conducted, to explore deeper forms of learning and communication for historical museums. Our hypothesis is that the diachronic perspective on historical processes, defined as social interaction within the environment through time, is a key missing element....... Although this interaction style may appeal to teachers, as it reminds of school teaching, it has several disadvantages: a dialogue never occurs between adults and children, who listen in silence, hence it becomes hard to evaluate what has being learnt and how deeply, and finally it is not very engaging....... Explorations of more interactive representations of the diachronic perspective, through play and tangible interaction, may foster a dialogue with young visitors. Therefore, a new interactive installation is being designed, intended as a tool to enrich learning, allowing children to experience historical...

  17. Density dependent effective interactions

    International Nuclear Information System (INIS)

    Dortmans, P.J.; Amos, K.

    1994-01-01

    An effective nucleon-nucleon interaction is defined by an optimal fit to select on-and half-off-of-the-energy shell t-and g-matrices determined by solutions of the Lippmann-Schwinger and Brueckner-Bethe-Goldstone equations with the Paris nucleon-nucleon interaction as input. As such, it is seen to better reproduce the interaction on which it is based than other commonly used density dependent effective interactions. The new (medium modified) effective interaction when folded with appropriate density matrices, has been used to define proton- 12 C and proton- 16 O optical potentials. With them elastic scattering data are well fit and the medium effects identifiable. 23 refs., 8 figs

  18. Magnetic interactions between nanoparticles

    DEFF Research Database (Denmark)

    Mørup, Steen; Hansen, Mikkel Fougt; Frandsen, Cathrine

    2010-01-01

    We present a short overview of the influence of inter-particle interactions on the properties of magnetic nanoparticles. Strong magnetic dipole interactions between ferromagnetic or ferrimagnetic particles, that would be superparamagnetic if isolated, can result in a collective state...... of nanoparticles. This collective state has many similarities to spin-glasses. In samples of aggregated magnetic nanoparticles, exchange interactions are often important and this can also lead to a strong suppression of superparamagnetic relaxation. The temperature dependence of the order parameter in samples...... of strongly interacting hematite nanoparticles or goethite grains is well described by a simple mean field model. Exchange interactions between nanoparticles with different orientations of the easy axes can also result in a rotation of the sub-lattice magnetization directions....

  19. Drug-radiopharmaceutical interactions

    International Nuclear Information System (INIS)

    Hladik, W.B.; Ponto, J.A.; Stathis, V.J.

    1985-01-01

    Patients seen in the nuclear medicine department have a wide variety of disorders and, consequently, may be receiving any number of therapeutic drugs. For this reason, nuclear medicine professionals should be aware of the potential effects that these pharmacologic agents may have on the bio-distribution of subsequently administered radiopharmaceuticals, commonly referred to as ''drug-radiopharmaceutical interactions.'' Compared with the quantity of literature written about interactions between various therapeutic drugs, the information available on drug-radiopharmaceutical interactions is scarce. However, there has been increasing interest in this subject, particularly during the past five years. Some of the reported interactions are used intentionally to add a new dimension to the nuclear medicine study and increase its diagnostic capabilities, i.e., pharmacologic intervention. These beneficial ''interactions'' are discussed in detail in several other chapters of this book. Other interactions, however, cause changes in the normal distribution of radiopharmaceuticals, which may interfere with the diagnostic utility of various nuclear medicine procedures. The latter group of interactions is the focus of this chapter

  20. Sketches in Embodied Interaction

    DEFF Research Database (Denmark)

    Erkut, Cumhur; Dahl, Sofia; Triantafyllidis, Georgios

    2014-01-01

    and provide a simple example as a design outcome. The variety and the qualities of the initial ideas indicate that this approach might provide a better foundation for our participants, compared to the approaches that focus only on technologies. The interactive sketches were demonstrated at the conference.......We present an approach for teaching and designing embodied interaction based on interactive sketches. We have combined the mover perspective and felt experiences of movement with advanced technologies (multi-agents, physical simulations) in a generative design session. We report our activities...

  1. Interaction university and school

    Directory of Open Access Journals (Sweden)

    Gionara Tauchen

    2016-05-01

    Full Text Available Considering that the interaction between universities and middle schools is fundamental for organization and the qualification of the education system, we conducted a qualitative study on twenty public municipal schools of Rio Grande, RS, designed to investigate and understand the effectiveness of university activities (teaching, research and extension in regard to the promotion and strengthening of the interactions between these institutions. We highlight the activities related to Pibid, the Education Observatory, extension, supervised internships, and to undergraduate and postgraduate research. From comprehensions about these activities, we discuss the interaction between school and university.

  2. Multiactivity in Social Interaction

    DEFF Research Database (Denmark)

    Doing more than one thing at the same time – a phenomenon that is often called ‘multitasking’ – is characteristic to many situations in everyday and professional life. Although we all experience it, its real time features remain understudied. Multiactivity in Social Interaction: Beyond multitasking...... by using video recordings of real-life interactions from a range of different contexts, such as medical settings, office workplaces and car driving. With the companion collection Interacting with Objects: Language, materiality, and social activity, the book advances understanding of the complex...

  3. Plasma-wall interactions

    International Nuclear Information System (INIS)

    Behrisch, Rainer

    1978-01-01

    The plasma wall interactions for two extreme cases, the 'vacuum model' and the 'cold gas blanket' are outlined. As a first step for understanding the plasma wall interactions the elementary interaction processes at the first wall are identified. These are energetic ion and neutral particle trapping and release, ion and neutral backscattering, ion sputtering, desorption by ions, photons and electrons and evaporation. These processes have only recently been started to be investigated in the parameter range of interest for fusion research. The few measured data and their extrapolation into regions not yet investigated are reviewed

  4. Intermediate energy electromagnetic interactions

    International Nuclear Information System (INIS)

    Garcon, M.

    1994-11-01

    Polarization measurements in electromagnetic interactions are reviewed. Deep inelastic scattering of polarized electrons and muons an polarized targets, photoproduction of pseudoscalar mesons on protons, photonuclear reactions, and the electromagnetic structure of the deuteron are discussed. (K.A.)

  5. Intermediate energy electromagnetic interactions

    Energy Technology Data Exchange (ETDEWEB)

    Garcon, M.

    1994-11-01

    Polarization measurements in electromagnetic interactions are reviewed. Deep inelastic scattering of polarized electrons and muons an polarized targets, photoproduction of pseudoscalar mesons on protons, photonuclear reactions, and the electromagnetic structure of the deuteron are discussed. (K.A.).

  6. Interaction as Negotiation

    DEFF Research Database (Denmark)

    Kristensen, Jannie Friis; Nielsen, Christina

    In this paper we discuss recent developments in interaction design principles for ubiquitous computing environments, specifically implications related to situated and mobile aspects of work. We present 'Interaction through Negotiation' as a general Human-Computer Interaction (HCI) paradigm, aimed...... at ubiquitous/pervasive technology and environments, with focus on facilitating negotiation in and between webs of different artifacts, humans and places. This approach is concerned with the way technology presents itself to us, both as physical entities and as conceptual entities, as well as the relations...... on several extensive empirical case studies, as well as co-operative design-sessions, we present a reflective analysis providing insights into results of the "Interaction through Negotiation" design approach in action. A very promising area of application is exception handling in pervasive computing...

  7. Atomic and Molecular Interactions

    International Nuclear Information System (INIS)

    2002-01-01

    The Gordon Research Conference (GRC) on Atomic and Molecular Interactions was held at Roger Williams University, Bristol, RI. Emphasis was placed on current unpublished research and discussion of the future target areas in this field

  8. Elementary particle interactions

    International Nuclear Information System (INIS)

    Bugg, W.M.; Condo, G.T.; Handler, T.; Hart, E.L.; Read, K.; Ward, B.F.L.

    1992-10-01

    Work continues on strange particle production in weak interactions using data from a high-energy neutrino exposure in a freon bubble chamber. Meson photoproduction has also consumed considerable effort. Detector research and development activities have been carried out

  9. ENTREPRENEURSHIP AS SOCIAL INTERACTION

    DEFF Research Database (Denmark)

    Larsen, Henry; Lima, Patricia; Olsen, Bente

    2013-01-01

    This paper aims to explore how entrepreneurs work with innovation; to explore and develop attention points in understanding entrepreneurship as social processes of interaction between people. Through interviews and engagement with entrepreneurs and key stakeholders, their actual social practices...... entrepreneurship as socially constructed through local interactions between players and identify key themes in these interactions within the organisation, such as leadership, becoming part of the initiative and trust/mistrust. By doing so, this paper contributes to an understanding of entrepreneurship as social...... and the influence on the progress as innovators are explored. It is focused on a new local activity in a Danish town, named the I-factory which has within a year gathered almost 40 entrepreneurs. As a part of the interaction, there were created activities to encourage even more collaboration. We see...

  10. Multiactivity in Social Interaction

    DEFF Research Database (Denmark)

    Doing more than one thing at the same time – a phenomenon that is often called ‘multitasking’ – is characteristic to many situations in everyday and professional life. Although we all experience it, its real time features remain understudied. Multiactivity in Social Interaction: Beyond multitasking...... offers a fresh view to the phenomenon by presenting studies that explore how two or more activities can be related and made co-relevant as people interact with one another. The studies build on the basis that multiactivity is a social, verbal and embodied phenomenon. They investigate multiactivity...... by using video recordings of real-life interactions from a range of different contexts, such as medical settings, office workplaces and car driving. With the companion collection Interacting with Objects: Language, materiality, and social activity, the book advances understanding of the complex...

  11. Chasing Ecological Interactions.

    Science.gov (United States)

    Jordano, Pedro

    2016-09-01

    Basic research on biodiversity has concentrated on individual species-naming new species, studying distribution patterns, and analyzing their evolutionary relationships. Yet biodiversity is more than a collection of individual species; it is the combination of biological entities and processes that support life on Earth. To understand biodiversity we must catalog it, but we must also assess the ways species interact with other species to provide functional support for the Tree of Life. Ecological interactions may be lost well before the species involved in those interactions go extinct; their ecological functions disappear even though they remain. Here, I address the challenges in studying the functional aspects of species interactions and how basic research is helping us address the fast-paced extinction of species due to human activities.

  12. Air-Sea Interaction

    Science.gov (United States)

    Csanady, G. T.

    2001-03-01

    In recent years air-sea interaction has emerged as a subject in its own right, encompassing small-scale and large-scale processes in both air and sea. Air-Sea Interaction: Laws and Mechanisms is a comprehensive account of how the atmosphere and the ocean interact to control the global climate, what physical laws govern this interaction, and its prominent mechanisms. The topics covered range from evaporation in the oceans, to hurricanes, and on to poleward heat transport by the oceans. By developing the subject from basic physical (thermodynamic) principles, the book is accessible to graduate students and research scientists in meteorology, oceanography, and environmental engineering. It will also be of interest to the broader physics community involved in the treatment of transfer laws, and thermodynamics of the atmosphere and ocean.

  13. Interactive Topology Optimization

    DEFF Research Database (Denmark)

    Nobel-Jørgensen, Morten

    Interactivity is the continuous interaction between the user and the application to solve a task. Topology optimization is the optimization of structures in order to improve stiffness or other objectives. The goal of the thesis is to explore how topology optimization can be used in applications...... on theory of from human-computer interaction which is described in Chapter 2. Followed by a description of the foundations of topology optimization in Chapter 3. Our applications for topology optimization in 2D and 3D are described in Chapter 4 and a game which trains the human intuition of topology...... optimization is presented in Chapter 5. Topology optimization can also be used as an interactive modeling tool with local control which is presented in Chapter 6. Finally, Chapter 7 contains a summary of the findings and concludes the dissertation. Most of the presented applications of the thesis are available...

  14. Mobile Collocated Interactions

    DEFF Research Database (Denmark)

    Lucero, Andrés; Clawson, James; Lyons, Kent

    2015-01-01

    Mobile devices such as smartphones and tablets were originally conceived and have traditionally been utilized for individual use. Research on mobile collocated interactions has been looking at situations in which collocated users engage in collaborative activities using their mobile devices, thus...... going from personal/individual toward shared/multiuser experiences and interactions. However, computers are getting smaller, more powerful, and closer to our bodies. Therefore, mobile collocated interactions research, which originally looked at smartphones and tablets, will inevitably include ever......-smaller computers, ones that can be worn on our wrists or other parts of the body. The focus of this workshop is to bring together a community of researchers, designers and practitioners to explore the potential of extending mobile collocated interactions to the use of wearable devices....

  15. Magnon Interactions in Terbium

    DEFF Research Database (Denmark)

    Nielsen, Mourits; Bjerrum Møller, Hans; Mackintosh, Allan

    1970-01-01

    Magnon energies and lifetimes have been studied in Tb and Tb-10% Ho single crystals by inelastic neutron scattering. The lifetimes of magnons propagating in the c-direction have been measured in the ferromagnetic phase of Tb, and are found to decrease with increasing temperature and wave......-vector, probably principally due to magnon-magnon interactions. The interaction of magnons with phonons has also been observed and the effect of Ho impurities on this interaction studied. In addition, excitations which are ascribed to local modes associated with the Ho ions have been observed. The dependence...... of the indirect exchange interaction on temperature in the alloy gives information on the mechanisms responsible for the transition from the helical to ferromagnetic structures. The dependence of the magnon energies on magnetic field at low temperatures gives detailed information on the role of magnetoelastic...

  16. Fibronectin-cell interactions

    DEFF Research Database (Denmark)

    Couchman, J R; Austria, M R; Woods, A

    1990-01-01

    Fibronectins are widespread extracellular matrix and body fluid glycoproteins, capable of multiple interactions with cell surfaces and other matrix components. Their structure at a molecular level has been resolved, yet there are still many unanswered questions regarding their biologic activity...... in vivo. Much data suggests that fibronectins may promote extracellular matrix assembly, and cell adhesion to those matrices. However, one outstanding enigma is that fibronectins may, under different circumstances, promote both cell migration and anchorage. An analysis of the interaction of fibroblasts...... with proteolytically derived and purified domains of plasma fibronectin revealed that the type of adhesion and the correlated cytoskeletal organization depended on multiple interactions of fibronectin domains with the cell surface. Human dermal fibroblasts were capable of interacting with the integrin-binding domain...

  17. Host–Pathogen Interactions

    NARCIS (Netherlands)

    Smits, M.A.; Schokker, D.J.

    2011-01-01

    The outcome of an infection is determined by numerous interactions between hosts and pathogens occurring at many different biological levels, ranging from molecule to population. To develop new control strategies for infectious diseases in livestock species, appropriate methodologies are needed

  18. Quark-quark interactions

    International Nuclear Information System (INIS)

    Jacob, M.

    1982-01-01

    This chapter discusses interactions only at the constituent level, as observed in hadron-hadron collisions. It defines quarks and gluons as constituents of the colliding hadrons, reviews some applications of perturbative OCD, discussing in turn lepton pair production, which in lowest order approximation corresponds to the Drell-Yan process. It investigates whether quark-quark interactions could not lead to some new color structure different from those prevalent for known baryons and mesons, which could be created in hadron interactions, and whether color objects (not specifically quarks or gluons) could not appear as free particles. Discussed is perturbative QCD in hadron collisions; the quark approach to soft processes; and new color structures. It points out that perturbative QCD has been at the origin of much progress in the understanding of hadron interactions at the constituent level

  19. Semi-leptonic interactions

    International Nuclear Information System (INIS)

    Gaillard, J.M.

    In spite of the presence of poorly understood strong interaction effects, the theory of hadronic currents leads to a considerable predictive power. This is shown in the discussion of the semi-leptonic decays

  20. Fundamentals of Filament Interaction

    Science.gov (United States)

    2017-05-19

    AFRL-AFOSR-VA-TR-2017-0110 FUNDAMENTALS OF FILAMENT INTERACTION Martin Richardson UNIVERSITY OF CENTRAL FLORIDA Final Report 06/02/2017 DISTRIBUTION...of Filament Interaction 5a. CONTRACT NUMBER 5b. GRANT NUMBER FA95501110001 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Martin Richardson 5d. PROJECT...NAME OF RESPONSIBLE PERSON Martin Richardson a. REPORT b. ABSTRACT c. THIS PAGE 19b. TELEPHONE NUMBER (Include area code) 407-823-6819 Standard Form

  1. Succeeding with interactive research

    DEFF Research Database (Denmark)

    Krogh, Andreas Hagedorn; Nielsen, Morten Velsing

    2017-01-01

    the capacity for critique and ensuring that scientific standards are met. Based on our own experience and theories of interactive governance, network management and collaborative leadership, as well as on existing methodological literature, we provide guidance and suggest concrete tools and methods......Increasingly, social science research is carried out in collaboration with partners outside universities, yet research methodology is lacking on how to manoeuvre in a terrain where multiple actors set expectations for research. This article conceptualizes interactive research as research...

  2. Interaction quality: a review

    OpenAIRE

    Ultes, Stefan; Minker, Wolfgang

    2013-01-01

    Automatically deriving the quality of a Spoken Dialogue System is an important task for both assessing dialogue systems and improving them. Work on automatic quality estimation for each system-user-exchange further holds the opportunity of using this quality information for online-adaption of the dialogues. The Interaction Quality paradigm is the first metric holding those features. Hence, this contribution gives an overview over the Interaction Quality paradigm and reviews recent estimation ...

  3. Quantum interaction. Selected papers

    Energy Technology Data Exchange (ETDEWEB)

    Atmanspacher, Harald [Eidgenoessische Technische Hochschule, Zurich (Switzerland); Haven, Emmanuel [Leicester Univ. (United Kingdom). School of Management; Kitto, Kirsty [Queensland Univ. of Technology, Brisbane, QLD (Australia); Raine, Derek (ed.) [Leicester Univ. (United Kingdom). Centre for Interdisciplinary Science

    2014-07-01

    This book constitutes the refereed proceedings of the 7th International Conference on Quantum Interaction, QI 2013, held in Leicester, UK, in July 2013. The 31 papers presented in this book were carefully selected from numerous submissions. The papers cover various topics on quantum interaction and revolve around four themes: information processing/retrieval/semantic representation and logic; cognition and decision making; finance/economics and social structures and biological systems.

  4. Smoking and Social Interaction

    OpenAIRE

    Panu Poutvaara; Lars-H.R. Siemers

    2007-01-01

    We study the social interaction of non-smokers and smokers as a sequential game, incorporating insights from social psychology and experimental economics into an economic model. Social norms a®ect human behavior such that non-smokers do not ask smokers to stop smoking and stay with them, even though disutility from smoking exceeds utility from social interaction. Overall, smoking is unduly often accepted when accommodating smoking is the social norm. The introduction of smoking and non-smokin...

  5. Interaction and observation, categorically

    Directory of Open Access Journals (Sweden)

    Vincenzo Ciancia

    2011-07-01

    Full Text Available This paper proposes to use dialgebras to specify the semantics of interactive systems in a natural way. Dialgebras are a conservative extension of coalgebras. In this categorical model, from the point of view that we provide, the notions of observation and interaction are separate features. This is useful, for example, in the specification of process equivalences, which are obtained as kernels of the homomorphisms of dialgebras. As an example we present the asynchronous semantics of the CCS.

  6. Soil-dithiocarbamate interactions

    International Nuclear Information System (INIS)

    Raghu, K.

    1980-01-01

    Soil is the ultimate repository of the pesticides applied for the control of plant pests and diseases. A variety of interactions like leaching, adsorption, chemical and microbial degradation etc take place between soil and pesticide. Results on work on two dialkyldithiocarbamates viz. thiram (tetramethylthiuram disulfide) and ziram (zinc dimethyldithiocarbamate) with respect to above interactions in soil are discussed and summarised. 35 S-labelled thiram and ziram were used in the studies. (author)

  7. Grapefruit and drug interactions.

    Science.gov (United States)

    2012-12-01

    Since the late 1980s, grapefruit juice has been known to affect the metabolism of certain drugs. Several serious adverse effects involving drug interactions with grapefruit juice have been published in detail. The components of grapefruit juice vary considerably depending on the variety, maturity and origin of the fruit, local climatic conditions, and the manufacturing process. No single component accounts for all observed interactions. Other grapefruit products are also occasionally implicated, including preserves, lyophylised grapefruit juice, powdered whole grapefruit, grapefruit seed extract, and zest. Clinical reports of drug interactions with grapefruit juice are supported by pharmacokinetic studies, each usually involving about 10 healthy volunteers, in which the probable clinical consequences were extrapolated from the observed plasma concentrations. Grapefruit juice inhibits CYP3A4, the cytochrome P450 isoenzyme most often involved in drug metabolism. This increases plasma concentrations of the drugs concerned, creating a risk of overdose and dose-dependent adverse effects. Grapefruit juice also inhibits several other cytochrome P450 isoenzymes, but they are less frequently implicated in interactions with clinical consequences. Drugs interacting with grapefruit and inducing serious clinical consequences (confirmed or very probable) include: immunosuppressants, some statins, benzodiazepines, most calcium channel blockers, indinavir and carbamazepine. There are large inter-individual differences in enzyme efficiency. Along with the variable composition of grapefruit juice, this makes it difficult to predict the magnitude and clinical consequences of drug interactions with grapefruit juice in a given patient. There is increasing evidence that transporter proteins such as organic anion transporters and P-glycoprotein are involved in interactions between drugs and grapefruit juice. In practice, numerous drugs interact with grapefruit juice. Although only a few

  8. Beam-Material Interaction

    CERN Document Server

    Mokhov, N.V.

    2016-01-01

    Th is paper is motivated by the growing importance of better understanding of the phenomena and consequences of high- intensity energetic particle beam interactions with accelerator, generic target , and detector components. It reviews the principal physical processes of fast-particle interactions with matter, effects in materials under irradiation, materials response, related to component lifetime and performance, simulation techniques, and methods of mitigating the impact of radiation on the components and envir onment in challenging current and future application

  9. Succeeding with interactive research

    DEFF Research Database (Denmark)

    Krogh, Andreas Hagedorn; Nielsen, Morten Velsing

    2017-01-01

    Increasingly, social science research is carried out in collaboration with partners outside universities, yet research methodology is lacking on how to manoeuvre in a terrain where multiple actors set expectations for research. This article conceptualizes interactive research as research...... the capacity for critique and ensuring that scientific standards are met. Based on our own experience and theories of interactive governance, network management and collaborative leadership, as well as on existing methodological literature, we provide guidance and suggest concrete tools and methods...

  10. Plasma-wall interaction

    International Nuclear Information System (INIS)

    Reichle, R.

    2004-01-01

    This document gathers the 43 slides presented in the framework of the week long lecture 'hot plasmas 2004' and dedicated to plasma-wall interaction in a tokamak. This document is divided into 4 parts: 1) thermal load on the wall, power extraction and particle recovery, 2) basic edge plasma physics, 3) processes that drive the plasma-solid interaction, and 4) material conditioning (surface treatment...) for ITER

  11. Human-machine interactions

    Science.gov (United States)

    Forsythe, J Chris [Sandia Park, NM; Xavier, Patrick G [Albuquerque, NM; Abbott, Robert G [Albuquerque, NM; Brannon, Nathan G [Albuquerque, NM; Bernard, Michael L [Tijeras, NM; Speed, Ann E [Albuquerque, NM

    2009-04-28

    Digital technology utilizing a cognitive model based on human naturalistic decision-making processes, including pattern recognition and episodic memory, can reduce the dependency of human-machine interactions on the abilities of a human user and can enable a machine to more closely emulate human-like responses. Such a cognitive model can enable digital technology to use cognitive capacities fundamental to human-like communication and cooperation to interact with humans.

  12. K+-nucleus interaction

    International Nuclear Information System (INIS)

    Gibbs, W.R.

    1984-01-01

    The K + -nucleus system is reviewed and comparison with data is made. The principal conclusions are that the theoretical uncertainties in relating the K + -nucleus interaction to the K + -nucleon interaction are very small and hence the positive kaon makes an excellent probe of the nucleus. It is suggested that this particle may be more sensitive to non-nucleonic degrees of freedom (especially quarks) than classical probes

  13. Interactive Virtual Cinematography

    OpenAIRE

    Burelli, Paolo

    2012-01-01

    A virtual camera represents the point-of-view of the player through which sheperceives the game world and gets feedback on her actions. Thus, the virtualcamera plays a vital role in 3D computer games and aects player experienceand enjoyability in games. Interactive virtual cinematography is the process ofvisualising the content of a virtual environment by positioning and animatingthe virtual camera in the context of interactive applications such as a computergame.Camera placement and animatio...

  14. Beam-Material Interaction

    Energy Technology Data Exchange (ETDEWEB)

    Mokhov, N. V. [Fermilab; Cerutti, F. [CERN

    2016-01-01

    Th is paper is motivated by the growing importance of better understanding of the phenomena and consequences of high-intensity energetic particle beam interactions with accelerator, generic target, and detector components. It reviews the principal physical processes of fast-particle interactions with matter, effects in materials under irradiation, materials response, related to component lifetime and performance, simulation techniques, and methods of mitigating the impact of radiation on the components and environment in challenging current and future applications.

  15. Interacting Agegraphic Dark Energy

    OpenAIRE

    Wei, Hao; Cai, Rong-Gen

    2007-01-01

    A new dark energy model, named "agegraphic dark energy", has been proposed recently, based on the so-called K\\'{a}rolyh\\'{a}zy uncertainty relation, which arises from quantum mechanics together with general relativity. In this note, we extend the original agegraphic dark energy model by including the interaction between agegraphic dark energy and pressureless (dark) matter. In the interacting agegraphic dark energy model, there are many interesting features different from the original agegrap...

  16. Quantum interaction. Selected papers

    International Nuclear Information System (INIS)

    Atmanspacher, Harald; Haven, Emmanuel; Raine, Derek

    2014-01-01

    This book constitutes the refereed proceedings of the 7th International Conference on Quantum Interaction, QI 2013, held in Leicester, UK, in July 2013. The 31 papers presented in this book were carefully selected from numerous submissions. The papers cover various topics on quantum interaction and revolve around four themes: information processing/retrieval/semantic representation and logic; cognition and decision making; finance/economics and social structures and biological systems.

  17. Interacting boson model with surface delta interaction between nucleons

    International Nuclear Information System (INIS)

    Druce, C.; Moszkowski, S.A.

    1984-01-01

    The surface delta interaction is used as an effective nucleon-nucleon interaction to investigate the structure and interaction of the bosons in the interacting boson model. The authors have obtained analytical expressions for the coefficients of a multipole expansion of the neutron-boson proton-boson interaction for the case of degenerate orbits

  18. Conducting interactive experiments online.

    Science.gov (United States)

    Arechar, Antonio A; Gächter, Simon; Molleman, Lucas

    2018-01-01

    Online labor markets provide new opportunities for behavioral research, but conducting economic experiments online raises important methodological challenges. This particularly holds for interactive designs. In this paper, we provide a methodological discussion of the similarities and differences between interactive experiments conducted in the laboratory and online. To this end, we conduct a repeated public goods experiment with and without punishment using samples from the laboratory and the online platform Amazon Mechanical Turk. We chose to replicate this experiment because it is long and logistically complex. It therefore provides a good case study for discussing the methodological and practical challenges of online interactive experimentation. We find that basic behavioral patterns of cooperation and punishment in the laboratory are replicable online. The most important challenge of online interactive experiments is participant dropout. We discuss measures for reducing dropout and show that, for our case study, dropouts are exogenous to the experiment. We conclude that data quality for interactive experiments via the Internet is adequate and reliable, making online interactive experimentation a potentially valuable complement to laboratory studies.

  19. Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

    Science.gov (United States)

    Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

    2013-04-08

    Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

  20. Scaled MP3 non-covalent interaction energies agree closely with accurate CCSD(T) benchmark data.

    Science.gov (United States)

    Pitonák, Michal; Neogrády, Pavel; Cerný, Jirí; Grimme, Stefan; Hobza, Pavel

    2009-01-12

    Scaled MP3 interaction energies calculated as a sum of MP2/CBS (complete basis set limit) interaction energies and scaled third-order energy contributions obtained in small or medium size basis sets agree very closely with the estimated CCSD(T)/CBS interaction energies for the 22 H-bonded, dispersion-controlled and mixed non-covalent complexes from the S22 data set. Performance of this so-called MP2.5 (third-order scaling factor of 0.5) method has also been tested for 33 nucleic acid base pairs and two stacked conformers of porphine dimer. In all the test cases, performance of the MP2.5 method was shown to be superior to the scaled spin-component MP2 based methods, e.g. SCS-MP2, SCSN-MP2 and SCS(MI)-MP2. In particular, a very balanced treatment of hydrogen-bonded compared to stacked complexes is achieved with MP2.5. The main advantage of the approach is that it employs only a single empirical parameter and is thus biased by two rigorously defined, asymptotically correct ab-initio methods, MP2 and MP3. The method is proposed as an accurate but computationally feasible alternative to CCSD(T) for the computation of the properties of various kinds of non-covalently bound systems.

  1. A comparative study on the interaction of phenazinium dyes with low pH induced protonated structure and B-form structure of naturally occurring deoxyribonucleic acid

    International Nuclear Information System (INIS)

    Pradhan, Ankur Bikash; Das, Shubhajit; Haque, Lucy; Bhuiya, Sutanwi; Das, Suman

    2016-01-01

    The interaction of two phenazinium dyes namely Phenosafranine (PSF) and Safranin T (ST) with right-handed B-form and left-handed protonated form of Calf Thymus (CT) DNA was investigated using different spectroscopic techniques. Both the dyes have been shown to bind strongly to the right-handed B-form of DNA by the mechanism intercalation as revealed from fluorescence quenching, circular dichroism (CD) and viscosity measurement. From circular dichroic studies it was evidenced that both of them convert the low pH induced left-handed protonated form of DNA back to the bound right-handed form. Scatchard analysis showed that both the dyes bound strongly to B-form of DNA in a non-cooperative manner. In case of protonated form, there was sequential conversion of the polynucleotide from left-handed to the bound right-handed conformation. Our results suggest that the binding environment of the dyes in the two forms of DNA is similar and our data predict that PSF is more effective in the conversion than ST. Experimental data enabled the calculation of the number of base pairs of protonated-form that adopted a right-handed conformation for each bound dye. Our data revealed that PSF is more effective in the conversion compard to that of ST. These results are attributed to greater steric crowd in ST compared to PSF which restricts the former to intercalate between DNA base pairs. The results of these studies allow a better understanding of dye-polymorphic nucleic acid interactions at a molecular level.

  2. Large-scale symmetry-adapted perturbation theory computations via density fitting and Laplace transformation techniques: investigating the fundamental forces of DNA-intercalator interactions.

    Science.gov (United States)

    Hohenstein, Edward G; Parrish, Robert M; Sherrill, C David; Turney, Justin M; Schaefer, Henry F

    2011-11-07

    Symmetry-adapted perturbation theory (SAPT) provides a means of probing the fundamental nature of intermolecular interactions. Low-orders of SAPT (here, SAPT0) are especially attractive since they provide qualitative (sometimes quantitative) results while remaining tractable for large systems. The application of density fitting and Laplace transformation techniques to SAPT0 can significantly reduce the expense associated with these computations and make even larger systems accessible. We present new factorizations of the SAPT0 equations with density-fitted two-electron integrals and the first application of Laplace transformations of energy denominators to SAPT. The improved scalability of the DF-SAPT0 implementation allows it to be applied to systems with more than 200 atoms and 2800 basis functions. The Laplace-transformed energy denominators are compared to analogous partial Cholesky decompositions of the energy denominator tensor. Application of our new DF-SAPT0 program to the intercalation of DNA by proflavine has allowed us to determine the nature of the proflavine-DNA interaction. Overall, the proflavine-DNA interaction contains important contributions from both electrostatics and dispersion. The energetics of the intercalator interaction are are dominated by the stacking interactions (two-thirds of the total), but contain important contributions from the intercalator-backbone interactions. It is hypothesized that the geometry of the complex will be determined by the interactions of the intercalator with the backbone, because by shifting toward one side of the backbone, the intercalator can form two long hydrogen-bonding type interactions. The long-range interactions between the intercalator and the next-nearest base pairs appear to be negligible, justifying the use of truncated DNA models in computational studies of intercalation interaction energies.

  3. Interactions between photodegradation components

    Directory of Open Access Journals (Sweden)

    Abdollahi Yadollah

    2012-09-01

    Full Text Available Abstract Background The interactions of p-cresol photocatalytic degradation components were studied by response surface methodology. The study was designed by central composite design using the irradiation time, pH, the amount of photocatalyst and the p-cresol concentration as variables. The design was performed to obtain photodegradation % as actual responses. The actual responses were fitted with linear, two factor interactions, cubic and quadratic model to select an appropriate model. The selected model was validated by analysis of variance which provided evidences such as high F-value (845.09, very low P-value (2 = 0.999, adjusted R-squared (Radj2 = 0.998, predicted R-squared (Rpred2 = 0.994 and the adequate precision (95.94. Results From the validated model demonstrated that the component had interaction with irradiation time under 180 min of the time while the interaction with pH was above pH 9. Moreover, photocatalyst and p-cresol had interaction at minimal amount of photocatalyst (p-cresol. Conclusion These variables are interdependent and should be simultaneously considered during the photodegradation process, which is one of the advantages of the response surface methodology over the traditional laboratory method.

  4. Electromagnetic processes and interactions

    International Nuclear Information System (INIS)

    Scheck, F.

    1983-01-01

    The electron and muon are important tools in testing the structure of the fundamental electromagnetic interactions. On the other hand, if these interactions are known, they serve as ideal probes for the internal structure of complex hadronic targets such as nucleons and nuclei. Purely electromagnetic interactions play a distinctive role, for obvious experimental reasons: At low and intermediate energies the effective electromagnetic coupling is larger by many orders of magnitude than the weak couplings, so that electromagnetic processes are measurable to much higher accuracy than purely weak processes. The present chapter deals primarily with applications of charged leptons to problems of nucleon and nuclear structure, and to selected precision tests of quantum electrodynamics (QED) at low momentum transfers. In most of these applications the electromagnetic interactions effectively appear in the form of external fields in the leptonic particle's Dirac equation. This is the domain where the physics of (electromagnetically) interacting leptons can still be described in the framework of an effective, though relativistic, single particle theory. (orig.)

  5. Strongly interacting Fermi gases

    Directory of Open Access Journals (Sweden)

    Bakr W.

    2013-08-01

    Full Text Available Strongly interacting gases of ultracold fermions have become an amazingly rich test-bed for many-body theories of fermionic matter. Here we present our recent experiments on these systems. Firstly, we discuss high-precision measurements on the thermodynamics of a strongly interacting Fermi gas across the superfluid transition. The onset of superfluidity is directly observed in the compressibility, the chemical potential, the entropy, and the heat capacity. Our measurements provide benchmarks for current many-body theories on strongly interacting fermions. Secondly, we have studied the evolution of fermion pairing from three to two dimensions in these gases, relating to the physics of layered superconductors. In the presence of p-wave interactions, Fermi gases are predicted to display toplogical superfluidity carrying Majorana edge states. Two possible avenues in this direction are discussed, our creation and direct observation of spin-orbit coupling in Fermi gases and the creation of fermionic molecules of 23Na 40K that will feature strong dipolar interactions in their absolute ground state.

  6. Secondary interactions in HIJET

    International Nuclear Information System (INIS)

    Longacre, R.S.

    1990-01-01

    This talk deals with the investigation of secondary interactions in proton-nucleus and nucleus-nucleus collisions using the Monte Carlo event generator HIJET. The HIJET generator considers p-A and A-A collisions to be a sum of independent N-N collisions, with the N-N cross section and scattering dynamics not dependent on whether the nucleon has previously participated in an interaction. It is very reasonable to assume that each collision should be well represented by an independent N-N collision, however the cross section for the forward going struck nucleon may be different. For each primary N-N interaction, a call is made to the MINBIAS routine of the program ISAJET - an event generator for high energy N-N interactions. MINBIAS computes the energy loss of the colliding nucleons and production of particles. MINBIAS is based on inclusive high energy N-N interactions forming multi-pomeron chains, with each chain fragmenting according to the Field-Feynman algorithm

  7. 5. Laser plasma interaction

    International Nuclear Information System (INIS)

    Labaune, C.; Fuchs, J.; Bandulet, H.

    2002-01-01

    Imprint elimination, smoothing and preheat control are considerable problems in inertial fusion and their possible solution can be achieved by using low-density porous materials as a buffer in target design. The articles gathered in this document present various aspects of the laser-plasma interaction, among which we have noticed: -) numerical algorithmic improvements of the Vlasov solver toward the simulation of the laser-plasma interaction are proposed, -) the dependence of radiation temperatures and X-ray conversion efficiencies of hohlraum on the target structures and laser irradiation conditions are investigated, -) a study of laser interaction with ultra low-density (0,5 - 20 mg/cm 3 ) porous media analyzing backscattered light at incident laser frequency ω 0 and its harmonics 3*ω 0 /2 and 2*ω 0 is presented, -) investigations of laser interaction with solid targets and crater formation are carried out with the objective to determine the ablation loading efficiency, -) a self organization in an intense laser-driven plasma and the measure of the relative degree of order of the states in an open system based on the S-theorem are investigated, and -) the existence and stability of electromagnetic solitons generated in a relativistic interaction of an intense laser light with uniform under-dense cold plasma are studied

  8. Tidal interaction of galaxies

    International Nuclear Information System (INIS)

    Kozlov, N.N.; Syunyaev, R.A.; Ehneev, T.M.

    1974-01-01

    One of the hypotheses explaining the occurrence of anomalous details in interacting galaxies has been investigated. Pairs of galaxies with 'tails' oppositely directed or neighbouring galaxies with cofferdams 'bridges', as if connecting the galaxies, are called interacting galaxies. The hypothesis connects the origin of cofferdams and 'tails' of interacting galaxies with tidal effects ; the action of power gravitational forces in the intergalactic space. A source of such forces may be neighbouring stellar systems or invisible bodies, for instance, 'dead' quasars after a gravitational collapse. The effect of large masses of matter on the galaxy evolution has been investigated in the Institute of Applied Mathematics of the Academy of Sciences of the USSSR in 1971-1972 by numerical simulation of the process on a digital computer with the subsequent data transmission on a display. Different versions of a massive body flight relative to a galaxy disk are considered. Photographs of a display screen at different moments of time are presented. As a result of mathematical simulation of galaxies gravitational interactions effects are discovered which resemble real structures in photographs of galaxies. It seems to be premature to state that namely these mechanisms cause the formation of 'tails' and cofferdams between galaxies. However, even now it is clear that the gravitational interaction strongly affects the dynamics of the stellar system evolution. Further studies should ascertain a true scale of this effect and its genuine role in galaxy evolution

  9. Electromagnetic cellular interactions.

    Science.gov (United States)

    Cifra, Michal; Fields, Jeremy Z; Farhadi, Ashkan

    2011-05-01

    Chemical and electrical interaction within and between cells is well established. Just the opposite is true about cellular interactions via other physical fields. The most probable candidate for an other form of cellular interaction is the electromagnetic field. We review theories and experiments on how cells can generate and detect electromagnetic fields generally, and if the cell-generated electromagnetic field can mediate cellular interactions. We do not limit here ourselves to specialized electro-excitable cells. Rather we describe physical processes that are of a more general nature and probably present in almost every type of living cell. The spectral range included is broad; from kHz to the visible part of the electromagnetic spectrum. We show that there is a rather large number of theories on how cells can generate and detect electromagnetic fields and discuss experimental evidence on electromagnetic cellular interactions in the modern scientific literature. Although small, it is continuously accumulating. Copyright © 2010 Elsevier Ltd. All rights reserved.

  10. Making an Interactive Calculus Textbook.

    Science.gov (United States)

    Larson, Timothy R.

    1995-01-01

    Presents a case study of the design and production of "Interactive Calculus," an interactive multimedia textbook. Discusses reasons for using multimedia textbooks; what an interactive textbook is; content, organization, graphic design, authoring and composition; and work flow. (AEF)

  11. New interactions for superstrings

    International Nuclear Information System (INIS)

    Greensite, J.; Klinkhamer, F.R.

    1987-01-01

    The supersymmetry relation {Q -A , Qsup(anti B}=2Hδsup(Aanti B) implies the existence of a new quartic vertex in the open superstring light-cone hamiltonian, if the supercharges are cubic in the string fields. Green and Schwarz have argued that this vertex almost vanishes, due to exact cancellations among fermionic operators, with perhaps a non-local interaction remaining. In this article we show that these exact cancellations do not occur for certain contributions to the anticommutator, and that new local, and possibly divergent, 4-string interactions are generated. On the basis of vacuum stability, we argue that 4-string interaction terms should also exist for closed superstring hamiltonians. (orig.)

  12. Dike/Drift Interactions

    Energy Technology Data Exchange (ETDEWEB)

    E. Gaffiney

    2004-11-23

    This report presents and documents the model components and analyses that represent potential processes associated with propagation of a magma-filled crack (dike) migrating upward toward the surface, intersection of the dike with repository drifts, flow of magma in the drifts, and post-magma emplacement effects on repository performance. The processes that describe upward migration of a dike and magma flow down the drift are referred to as the dike intrusion submodel. The post-magma emplacement processes are referred to as the post-intrusion submodel. Collectively, these submodels are referred to as a conceptual model for dike/drift interaction. The model components and analyses of the dike/drift interaction conceptual model provide the technical basis for assessing the potential impacts of an igneous intrusion on repository performance, including those features, events, and processes (FEPs) related to dike/drift interaction (Section 6.1).

  13. Sonic Interaction Design

    DEFF Research Database (Denmark)

    ) challenges these prevalent approaches by considering sound as an active medium that can enable novel sensory and social experiences through interactive technologies. This book offers an overview of the emerging SID research, discussing theories, methods, and practices, with a focus on the multisensory......Sound is an integral part of every user experience but a neglected medium in design disciplines. Design of an artifact’s sonic qualities is often limited to the shaping of functional, representational, and signaling roles of sound. The interdisciplinary field of sonic interaction design (SID...... aspects of sonic experience. Sonic Interaction Design gathers contributions from scholars, artists, and designers working at the intersections of fields ranging from electronic music to cognitive science. They offer both theoretical considerations of key themes and case studies of products and systems...

  14. History of Weak Interactions

    Science.gov (United States)

    Lee, T. D.

    1970-07-01

    While the phenomenon of beta-decay was discovered near the end of the last century, the notion that the weak interaction forms a separate field of physical forces evolved rather gradually. This became clear only after the experimental discoveries of other weak reactions such as muon-decay, muon-capture, etc., and the theoretical observation that all these reactions can be described by approximately the same coupling constant, thus giving rise to the notion of a universal weak interaction. Only then did one slowly recognize that the weak interaction force forms an independent field, perhaps on the same footing as the gravitational force, the electromagnetic force, and the strong nuclear and sub-nuclear forces.

  15. Dike/Drift Interactions

    International Nuclear Information System (INIS)

    Gaffiney, E.

    2004-01-01

    This report presents and documents the model components and analyses that represent potential processes associated with propagation of a magma-filled crack (dike) migrating upward toward the surface, intersection of the dike with repository drifts, flow of magma in the drifts, and post-magma emplacement effects on repository performance. The processes that describe upward migration of a dike and magma flow down the drift are referred to as the dike intrusion submodel. The post-magma emplacement processes are referred to as the post-intrusion submodel. Collectively, these submodels are referred to as a conceptual model for dike/drift interaction. The model components and analyses of the dike/drift interaction conceptual model provide the technical basis for assessing the potential impacts of an igneous intrusion on repository performance, including those features, events, and processes (FEPs) related to dike/drift interaction (Section 6.1)

  16. Interactive Karyotyping Training

    Directory of Open Access Journals (Sweden)

    Ashwin Kotwaliwale

    2013-01-01

    Full Text Available Despite the wide use of newer techniques in genetic diagnostics, there remains a need for technologists to learn human chromosome morphology, identify abnormal metaphases and report clinical abnormalities. Global short age of cytogenetic trainers and a time consuming training process makes Karyotyping training difficult. We have developed a web based interactive Karyotyping training tool, KaryoTutor©, that allows technologists to learn karyotyping in an interactive environment and aids the trainer in the training process. KaryoTutor©provides visual clues for identifying abnormal chromosomes, provides instant test scores and includes a reference library of ideograms,sample chromosome images and reference materials. Trainees are able to recursively work on a case till a satisfactory result is achieved,with KaryoTutor providing interactive inputs.Additionally, trainers can assign cases and monitor trainee progress using audit trail management and other administrative features.

  17. Interactive Information Retrieval

    DEFF Research Database (Denmark)

    Borlund, Pia

    2013-01-01

    The paper introduces the research area of interactive information retrieval (IIR) from a historical point of view. Further, the focus here is on evaluation, because much research in IR deals with IR evaluation methodology due to the core research interest in IR performance, system interaction...... and satisfaction with retrieved information. In order to position IIR evaluation, the Cranfield model and the series of tests that led to the Cranfield model are outlined. Three iconic user-oriented studies and projects that all have contributed to how IIR is perceived and understood today are presented......: The MEDLARS test, the Book House fiction retrieval system, and the OKAPI project. On this basis the call for alternative IIR evaluation approaches motivated by the three revolutions (the cognitive, the relevance, and the interactive revolutions) put forward by Robertson & Hancock-Beaulieu (1992) is presented...

  18. Plasma-material interactions

    International Nuclear Information System (INIS)

    Wilson, K.L.

    1984-01-01

    Plasma-interactive components must be resistant to erosion processes, efficient in heat removal, and effective in minimizing tritium inventory and permeation. As long as plasma edge temperatures are 50 eV, no one material can satisfy the diverse requirements imposed by these plasma materials interactions. The only solution is the design of duplex, or even more complicated, structures. The material that faces the plasma should be low atomic number, with acceptable erosion and evaporation characteristics. The substrate material must have high thermal conductivity for heat removal. Finally, materials must be selected judiciously for tritium compatibility. In conclusion, materials play a critical role in the achievement of safe and economical magnetic fusion energy. Improvements in materials have already led to many advances in present day device operation, but additional innovative materials solutions are required for the critical plasma materials interaction issues in future power reactors

  19. Interactive Sample Book (ISB)

    DEFF Research Database (Denmark)

    Heimdal, Elisabeth Jacobsen; Lenau, Torben Anker; Guglielmi, Michel

    2009-01-01

    supervisor Torben A. Lenau. Inspiration to use smart materials Interactive textiles are still quite an unknown phenomenon to many. It is thus often difficult to communicate what kind of potentials lie within these materials. This is why the ISB project was started, as a practice based research project...... and senses in relation to integrated decoration and function primarily to indoor applications. The result of the project will be a number of interactive textiles, to be gathered in an interactive sample book (ISB), in a similar way as the sample books of wallpapers one can take home from the shop and choose...... from. In other words, it is a kind of display material, which in a simple manner can illustrate how different techniques and smart materials work. The sample book should display a number of possibilities where sensor technology, smart materials and textiles are mixed to such an extent that the textile...

  20. Interacting hot dark matter

    International Nuclear Information System (INIS)

    Atrio-Barandela, F.; Davidson, S.

    1997-01-01

    We discuss the viability of a light particle (∼30eV neutrino) with strong self-interactions as a dark matter candidate. The interaction prevents the neutrinos from free-streaming during the radiation-dominated regime so galaxy-sized density perturbations can survive. Smaller scale perturbations are damped due to neutrino diffusion. We calculate the power spectrum in the imperfect fluid approximation, and show that it is damped at the length scale one would estimate due to neutrino diffusion. The strength of the neutrino-neutrino coupling is only weakly constrained by observations, and could be chosen by fitting the power spectrum to the observed amplitude of matter density perturbations. The main shortcoming of our model is that interacting neutrinos cannot provide the dark matter in dwarf galaxies. copyright 1997 The American Physical Society

  1. Magnetic interactions through fluoride

    DEFF Research Database (Denmark)

    Pedersen, Kasper Steen; Sigrist, Marc; Weihe, Høgni

    2014-01-01

    support the parameter values and resolve |E| ≈ 0.04 cm(-1). The exchange coupling constant (J) is 1 order of magnitude smaller than that found in comparable systems with linear oxide bridging but comparable to typical magnitudes through cyanide, thus underlining the potential of fluoride complexes......The nature of the magnetic interaction through fluoride in a simple, dinuclear manganese(III) complex (1), bridged by a single fluoride ion in a perfectly linear fashion, is established by experiment and density functional theory. The magnitude of the antiferromagnetic exchange interaction...

  2. Alkane dimers interaction

    DEFF Research Database (Denmark)

    Ferrighi, Lara; Madsen, Georg Kent Hellerup; Hammer, Bjørk

    2010-01-01

    The interaction energies of a series of n-alkane dimers, from methane to decane, have been investigated with Density Functional Theory (DFT), using the MGGA-M06-L density functional. The results are compared both to the available wavefunction-based values as well as to dispersion corrected DFT...... values. The MGGA-M06-L density functional is a semi-local functional designed and has proven to provide accurate estimates of dispersion interactions for several systems at moderate computational cost. In the present application, it reproduces the trends obtained by the more expensive wavefunction...

  3. Urban Interaction Design

    DEFF Research Database (Denmark)

    Brynskov, Martin; Bermúdez, Juan Carlos Carvajal; Fernández, Manu

    This book is an effort to explore the newly emerging field of urban interaction design that addresses these issues. In the first part of the book, 'Foundations', we look into its origins. Where do its practitioners come from? How are they working together? What methodologies do they bring...... to the table? What are the key concepts they are addressing in their work? In the second part of the book named 'Trends', we go into current developments in the networked city and how urban interaction design as a field addresses these. Taken together, these sections will not give the definite definition...

  4. Mixed Interaction Spaces

    DEFF Research Database (Denmark)

    Lykke-Olesen, Andreas; Eriksson, E.; Hansen, T.R.

    In this paper, we describe a new interaction technique for mobile devices named Mixed Interaction Space that uses the camera of the mobile device to track the position, size and rotation of a fixed-point. In this demonstration we will present a system that uses a hand-drawn circle, colored object...... or a person’s face as a fixed-point to determine the location of the device. We use these features as a 4 dimensional input vector to a set of different applications....

  5. Interacting agegraphic dark energy

    International Nuclear Information System (INIS)

    Wei, Hao; Cai, Rong-Gen

    2009-01-01

    A new dark energy model, named ''agegraphic dark energy'', has been proposed recently, based on the so-called Karolyhazy uncertainty relation, which arises from quantum mechanics together with general relativity. In this note, we extend the original agegraphic dark energy model by including the interaction between agegraphic dark energy and pressureless (dark) matter. In the interacting agegraphic dark energy model, there are many interesting features different from the original agegraphic dark energy model and holographic dark energy model. The similarity and difference between agegraphic dark energy and holographic dark energy are also discussed. (orig.)

  6. Interacting binary stars

    CERN Document Server

    Sahade, Jorge; Ter Haar, D

    1978-01-01

    Interacting Binary Stars deals with the development, ideas, and problems in the study of interacting binary stars. The book consolidates the information that is scattered over many publications and papers and gives an account of important discoveries with relevant historical background. Chapters are devoted to the presentation and discussion of the different facets of the field, such as historical account of the development in the field of study of binary stars; the Roche equipotential surfaces; methods and techniques in space astronomy; and enumeration of binary star systems that are studied

  7. Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA

    Directory of Open Access Journals (Sweden)

    Eric R. Gamache

    2017-04-01

    Full Text Available The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT. To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1, a 1-nucleotide interhelical loop and an 8-bp stem (S2 that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging.

  8. Study of DNA interactions with bifenthrin by spectroscopic techniques and molecular modeling

    Science.gov (United States)

    Zhu, Pan; Zhang, Guowen; Ma, Yadi; Zhang, Yepeng; Miao, Hong; Wu, Yongning

    2013-08-01

    The interaction between bifenthrin (BF) and calf thymus DNA (ctDNA) in physiological buffer (pH 7.4) was investigated by UV-vis absorption, fluorescence, circular dichroism (CD), and Fourier transform infrared (FT-IR) spectroscopy, coupled with viscosity measurements and molecular docking techniques. It was found that BF molecular could intercalate into the base pairs of ctDNA as evidenced by significant increases in absorption intensity, fluorescence polarization and relative viscosity of ctDNA, decrease in iodide quenching effect, and induced CD spectral changes. The association constant of BF with ctDNA was evaluated to be in the order of 104 L mol-1. Thermodynamic analysis of the binding data obtained at different temperatures suggested that the binding process was primarily driven by hydrogen bonds and van der Waals forces, as the values of the enthalpy change (ΔH) and the entropy change (ΔS) were calculated to be -31.13 ± 1.89 kJ mol-1 and -22.79 ± 1.21 J mol-1 K-1, respectively. The results of FT-IR spectra and molecular docking showed that a specific binding mainly existed between BF and adenine and guanine bases.

  9. Terminal structures of West Nile virus genomic RNA and their interactions with viral NS5 protein

    International Nuclear Information System (INIS)

    Dong Hongping; Zhang Bo; Shi Peiyong

    2008-01-01

    Genome cyclization is essential for flavivirus replication. We used RNases to probe the structures formed by the 5'-terminal 190 nucleotides and the 3'-terminal 111 nucleotides of the West Nile virus (WNV) genomic RNA. When analyzed individually, the two RNAs adopt stem-loop structures as predicted by the thermodynamic-folding program. However, when mixed together, the two RNAs form a duplex that is mediated through base-pairings of two sets of RNA elements (5'CS/3'CSI and 5'UAR/3'UAR). Formation of the RNA duplex facilitates a conformational change that leaves the 3'-terminal nucleotides of the genome (position - 8 to - 16) to be single-stranded. Viral NS5 binds specifically to the 5'-terminal stem-loop (SL1) of the genomic RNA. The 5'SL1 RNA structure is essential for WNV replication. The study has provided further evidence to suggest that flavivirus genome cyclization and NS5/5'SL1 RNA interaction facilitate NS5 binding to the 3' end of the genome for the initiation of viral minus-strand RNA synthesis

  10. Sequence-influenced interactions of oligoacridines with DNA detected by retarded gel electrophorectic migrations

    International Nuclear Information System (INIS)

    Nielsen, P.E.; Zhen, W.; Henriksen, U.; Buchardt, O.

    1988-01-01

    The authors have found that di-, tri-, tetra-, and hexa-9-acridinylamines are so efficiently associated with DNA during electrophoresis in polyacrylamide or agarose gels that they retard its migration. The retardation is roughly proportional to the reagent to base pair ratio, and the magnitude of the retardation indicates that a combined charge neutralization/helix extension mechanism is mainly responsible for the effect. Furthermore, DNA sequence dependent differences are observed. Thus, the pUC 19 restriction fragments (HaeIII or AluI), which in the native state comigrate upon gel electrophoretic analysis, could be separated in the presence of a diacridine, and specific DNA fragments responded differently to different diacridines. These results suggest that the effect also is due to a contribution from the DNA conformation and that the DNA conformation dynamics are influenced differently upon binding of different diacridines. They foresee three applications of this observation: (1) in analytical gel electrophoretic separation of otherwise comigrating DNA molecules, (2) in studies of polyintercalator-DNA interaction, and (3) in measurements of polyintercalator-induced DNA unwinding

  11. Adhesive interactions with wood

    Science.gov (United States)

    Charles R. Frihart

    2004-01-01

    While the chemistry for the polymerization of wood adhesives has been studied systematically and extensively, the critical aspects of the interaction of adhesives with wood are less clearly understood. General theories of bond formation need to be modified to take into account the porosity of wood and the ability of chemicals to be absorbed into the cell wall....

  12. Interactive Foresight Simulation

    DEFF Research Database (Denmark)

    Hansen, Mette Sanne; Rasmussen, Lauge Baungaard; Jacobsen, Peter

    2016-01-01

    The Combined Simulation Approach (CSA) is a way to evaluate risks and address potential unforeseen problems in a more interactive way than what is often observed in practice in companies or sectors. The approach is based on a combination of scenario analysis and discrete-event computer simulation...

  13. Interaction Before Agriculture

    DEFF Research Database (Denmark)

    Richter, Tobias; Garrard, Andrew; Allcock, Samantha

    2011-01-01

    This article discusses social interaction in the Epipalaeolithic of southwest Asia. Discussions of contact, social relationships and social organization have primarily focused on the Pre-Pottery Neolithic and are often considered to represent typical hallmarks of emergent farming societies. The h...

  14. Human Work Interaction Design

    DEFF Research Database (Denmark)

    Lopes, Arminda; Ørngreen, Rikke

    . The papers reflect many different areas and address many complex and diverse work domains, ranging from medical user interfaces, work and speech interactions at elderly care facilities, greenhouse climate control, navigating through large oil industry engineering models, crisis management, library usability...

  15. Child Computer Interaction SIG

    DEFF Research Database (Denmark)

    Read, Janet; Hourcade, Juan Pablo; Markopoulos, Panos

    a mixture of facilitated creative thinking and a world café approach to bring the community together to tackle these two key challenges. The CCI SIG will be the natural meeting place for members of this community at CHI and will disseminate its discussion to the CCI and CHI communities through...... the production of visual and interactive materials at the CHI conference....

  16. Data Interactive Publications Revisited

    Science.gov (United States)

    Domenico, B.; Weber, W. J.

    2011-12-01

    A few years back, the authors presented examples of online documents that allowed the reader to interact directly with datasets, but there were limitations that restricted the interaction to specific desktop analysis and display tools that were not generally available to all readers of the documents. Recent advances in web service technology and related standards are making it possible to develop systems for publishing online documents that enable readers to access, analyze, and display the data discussed in the publication from the perspective and in the manner from which the author wants it to be represented. By clicking on embedded links, the reader accesses not only the usual textual information in a publication, but also data residing on a local or remote web server as well as a set of processing tools for analyzing and displaying the data. With the option of having the analysis and display processing provided on the server, there are now a broader set of possibilities on the client side where the reader can interact with the data via a thin web client, a rich desktop application, or a mobile platform "app." The presentation will outline the architecture of data interactive publications along with illustrative examples.

  17. Data Interactive Publications

    Science.gov (United States)

    Domenico, B.; Weber, J.

    2012-04-01

    For some years now, the authors have developed examples of online documents that allowed the reader to interact directly with datasets, but there were limitations that restricted the interaction to specific desktop analysis and display tools that were not generally available to all readers of the documents. Recent advances in web service technology and related standards are making it possible to develop systems for publishing online documents that enable readers to access, analyze, and display the data discussed in the publication from the perspective and in the manner from which the author wants it to be represented. By clicking on embedded links, the reader accesses not only the usual textual information in a publication, but also data residing on a local or remote web server as well as a set of processing tools for analyzing and displaying the data. With the option of having the analysis and display processing provided on the server (or in the cloud), there are now a broader set of possibilities on the client side where the reader can interact with the data via a thin web client, a rich desktop application, or a mobile platform "app." The presentation will outline the architecture of data interactive publications along with illustrative examples.

  18. Connectionist Interaction Information Retrieval.

    Science.gov (United States)

    Dominich, Sandor

    2003-01-01

    Discussion of connectionist views for adaptive clustering in information retrieval focuses on a connectionist clustering technique and activation spreading-based information retrieval model using the interaction information retrieval method. Presents theoretical as well as simulation results as regards computational complexity and includes…

  19. Dust-Plasma Interactions

    International Nuclear Information System (INIS)

    Rosenberg, Marelene

    2005-01-01

    Our theoretical research on dust-plasma interactions has concentrated on three main areas: (a)studies of grain charging and applications; (b) waves and instabilities in weakly correlated dusty plasma with applications to space and laboratory plasmas; (c) waves in strongly coupled dusty plasmas.

  20. Gaze interaction from bed

    DEFF Research Database (Denmark)

    Hansen, John Paulin; San Agustin, Javier; Jensen, Henrik Tomra Skovsgaard Hegner

    2011-01-01

    This paper presents a low-cost gaze tracking solution for bedbound people composed of free-ware tracking software and commodity hardware. Gaze interaction is done on a large wall-projected image, visible to all people present in the room. The hardware equipment leaves physical space free to assis...

  1. ROILA : RObot Interaction LAnguage

    NARCIS (Netherlands)

    Mubin, O.

    2011-01-01

    The number of robots in our society is increasing rapidly. The number of service robots that interact with everyday people already outnumbers industrial robots. The easiest way to communicate with these service robots, such as Roomba or Nao, would be natural speech. However, the limitations

  2. Empowered interaction through creativity

    DEFF Research Database (Denmark)

    Hasselblad, Stefan; Petersson, Eva; Brooks, Tony

    2007-01-01

    This paper reflects upon a case study where exploration, play and empowerment in interactive therapy sessions with audio and visual stimuli resulted in achievement, self-esteem and a shared pride between a young adult with profound and multiple learning disabilities (PMLD), his mother and the spe...

  3. Virtual Interactive Space (VIS)

    DEFF Research Database (Denmark)

    Brooks, Anthony Lewis

    2015-01-01

    This paper shares code that enables the making of a Virtual Interactive Space (VIS) where the skin of the invisible active sensor area is dynamically responsive to the velocity of a limb e.g. hand. Used in proprioception training of movement the patch is at the core of the author’s Reafferentation...

  4. Dilations and interaction

    International Nuclear Information System (INIS)

    Buchholz, D.; Fredenhagen, K.

    1976-07-01

    As a consequence of the geometrical features of dilations massless particles do not interact in a local, dilationally invariant quantum theory. This result also holds in models in which dilations are only an asymptotically visible symmetry of the S-matrix. (orig.) [de

  5. Interaction with William Carnall

    International Nuclear Information System (INIS)

    Judd, Brian R.

    2005-01-01

    A personal account is given of interaction with William T. Carnall during the period 1977-1988, when I made regular visits to the Argonne National Laboratory to discuss the theoretical background to the spectroscopic work he was carrying out on the lanthanides and actinides

  6. Interactive Stable Ray Tracing

    DEFF Research Database (Denmark)

    Dal Corso, Alessandro; Salvi, Marco; Kolb, Craig

    2017-01-01

    Interactive ray tracing applications running on commodity hardware can suffer from objectionable temporal artifacts due to a low sample count. We introduce stable ray tracing, a technique that improves temporal stability without the over-blurring and ghosting artifacts typical of temporal post-pr...

  7. Human Work Interaction Design

    DEFF Research Database (Denmark)

    Lopes, Arminda; Ørngreen, Rikke

    This book constitutes the thoroughly refereed post-conference proceedings of the Third IFIP WG 13.6 Working Conference on Human Work Interaction Design, HWID 2012, held in Copenhagen, Denmark, in December 2012. The 16 revised papers presented were carefully selected for inclusion in this volume...

  8. Space for Interaction

    DEFF Research Database (Denmark)

    Jørgensen, Mariane Ellen; Folmer, Mette Blicher; Mullins, Michael

    SPACE FOR INTERACTION QUALIFYING GROUP TREATMENT FOR PATIENTS WITH CHRONIC PAIN THROUGH OPTIMIZATION(?) OF SPACE. A RANDOMIZED PILOT STUDY. In a Ph-D. Mariane Ellen Jørgensen / Nurse + psykoterapist / maej@rn.dk / Pain Center / Aalborg University Hospital / Denmark / Mette Blicher Folmer / Archit...

  9. Interactive Mold House Tour

    Science.gov (United States)

    Get a quick glimpse of some of the most important ways to protect your home from mold by this interactive tour of the Mold House. Room-by-room, you'll learn about common mold issues and how to address them.

  10. Teaching with Interactive Multimedia.

    Science.gov (United States)

    Hudson, Tim

    Based on the idea that anyone who is interested in making entertaining and informative presentations in educational settings is interested in multimedia, this practical guide offers tips for communication (and other) teachers who want to integrate and program interactive multimedia into their courses. The guide suggests that teachers on limited…

  11. Aesthetics of Mundane Interactions

    NARCIS (Netherlands)

    Vyas, Dhaval; Hassenzahl, M.

    2008-01-01

    John Dewey’s pragmatist aesthetics is used as a conceptual basis for designing new technologies that support staff-members’ mundane social interactions in an academic department. From this perspective, aesthetics is seen as a broader phenomenon that encompasses experiential aspects of staff-members’

  12. Aesthetics of Mundane Interactions

    OpenAIRE

    Vyas, Dhaval; Hassenzahl, M.

    2008-01-01

    John Dewey’s pragmatist aesthetics is used as a conceptual basis for designing new technologies that support staff-members’ mundane social interactions in an academic department. From this perspective, aesthetics is seen as a broader phenomenon that encompasses experiential aspects of staff-members’ everyday lives and not only a look-&-feel aspect.

  13. Human Work Interaction Design

    DEFF Research Database (Denmark)

    Gonçalves, Frederica; Campos, Pedro; Clemmensen, Torkil

    2015-01-01

    In this paper, we review research in the emerging practice and research field of Human Work Interaction Design (HWID). We present a HWID frame-work, and a sample of 54 papers from workshops, conferences and journals from the period 2009-2014. We group the papers into six topical groups, and then ...

  14. Interactive Playgrounds for Children

    NARCIS (Netherlands)

    Poppe, Ronald Walter; van Delden, Robertus Wilhelmus; Moreno Celleri, Alejandro Manuel; Reidsma, Dennis; Nijholt, A.; Nijholt, Antinus

    Play is an important factor in the life of children. It plays a role in their cognitive, social, and physical development, and provides entertaining and fulfilling activities in itself. As with any field of human endeavor, interactive technology has a huge potential for transforming and enhancing

  15. Cultivating objects in interaction

    DEFF Research Database (Denmark)

    Hazel, Spencer

    2014-01-01

    is chapter explores patterns of repeated orientations to physical objects in interactants’ visuo-spatial and haptic surround. A number of examples are presented from advice-giving activities in various institutional settings, where participants-in-interaction initially draw on material objects...

  16. Exploring governmentality as interaction

    DEFF Research Database (Denmark)

    Fahnøe, Kristian

    from an interactionistic perspective, based on Goffman’s dramaturgy. The focal point is how Goffman's concepts of interaction order, rituals, role and role performance might be an point of entry for studying the techniques the self and the techniques of domination through which governmentality operates...

  17. Interactive Purchasing Situations

    NARCIS (Netherlands)

    Groote Schaarsberg, M.; Borm, P.E.M.; Hamers, H.J.M.; Reijnierse, J.H.

    2012-01-01

    Abstract: This paper introduces a new class of interactive cooperative purchasing situations and provides an explicit alternative characterization of the nucleolus of cooperative games, which offers an alternative to Kohlberg (1971). In our cooperative purchasing situation, the unit price of a

  18. Interactive shape metamorphosis

    Science.gov (United States)

    Chen, David T.; State, Andrei; Banks, David

    1994-01-01

    A technique for controlled metamorphosis between surfaces in 3-space is described. Well-understood techniques to produce shape metamorphosis between models in a 2D parametric space is applied. The user selects morphable features interactively, and the morphing process executes in real time on a high-performance graphics multicomputer.

  19. Tritium-surface interactions

    International Nuclear Information System (INIS)

    Kirkaldy, J.S.

    1983-06-01

    The report deals broadly with tritium-surface interactions as they relate to a fusion power reactor enterprise, viz., the vacuum chamber, first wall, peripherals, pumping, fuel recycling, isotope separation, repair and maintenance, decontamination and safety. The main emphasis is on plasma-surface interactions and the selection of materials for fusion chamber duty. A comprehensive review of the international (particularly U.S.) research and development is presented based upon a literature review (about 1 000 reports and papers) and upon visits to key laboratories, Sandia, Albuquerque, Sandia, Livermore and EGβG Idaho. An inventory of Canadian expertise and facilities for RβD on tritium-surface interactions is also presented. A number of proposals are made for the direction of an optimal Canadian RβD program, emphasizing the importance of building on strength in both the technological and fundamental areas. A compendium of specific projects and project areas is presented dealing primarily with plasma-wall interactions and permeation, anti-permeation materials and surfaces and health, safety and environmental considerations. Potential areas of industrial spinoff are identified

  20. A tabletop interactive storytelling system: designing for social interaction

    NARCIS (Netherlands)

    Alofs, Thijs; Theune, Mariet; Swartjes, I.M.T.

    This paper presents the Interactive Storyteller, a multi-user interface for AI-based interactive storytelling, where stories emerge from the interaction of human players with intelligent characters in a simulated story world. To support face-to-face contact and social interaction, we position users

  1. An Ultraviolet Resonance Raman Spectroscopic Study of Cisplatin and Transplatin Interactions with Genomic DNA.

    Science.gov (United States)

    Geng, Jiafeng; Aioub, Mena; El-Sayed, Mostafa A; Barry, Bridgette A

    2017-09-28

    Ultraviolet resonance Raman (UVRR) spectroscopy is a label-free method to define biomacromolecular interactions with anticancer compounds. Using UVRR, we describe the binding interactions of two Pt(II) compounds, cisplatin (cis-diamminedichloroplatinum(II)) and its isomer, transplatin, with nucleotides and genomic DNA. Cisplatin binds to DNA and other cellular components and triggers apoptosis, whereas transplatin is clinically ineffective. Here, a 244 nm UVRR study shows that purine UVRR bands are altered in frequency and intensity when mononucleotides are treated with cisplatin. This result is consistent with previous suggestions that purine N7 provides the cisplatin-binding site. The addition of cisplatin to DNA also causes changes in the UVRR spectrum, consistent with binding of platinum to purine N7 and disruption of hydrogen-bonding interactions between base pairs. Equally important is that transplatin treatment of DNA generates similar UVRR spectral changes, when compared to cisplatin-treated samples. Kinetic analysis, performed by monitoring decreases of the 1492 cm -1 band, reveals biphasic kinetics and is consistent with a two-step binding mechanism for both platinum compounds. For cisplatin-DNA, the rate constants (6.8 × 10 -5 and 6.5 × 10 -6 s -1 ) are assigned to the formation of monofunctional adducts and to bifunctional, intrastrand cross-linking, respectively. In transplatin-DNA, there is a 3.4-fold decrease in the rate constant of the slow phase, compared with the cisplatin samples. This change is attributed to generation of interstrand, rather than intrastrand, adducts. This longer reaction time may result in increased competition in the cellular environment and account, at least in part, for the lower pharmacological efficacy of transplatin.

  2. Evolutionary patterns of Escherichia coli small RNAs and their regulatory interactions.

    Science.gov (United States)

    Peer, Asaf; Margalit, Hanah

    2014-07-01

    Most bacterial small RNAs (sRNAs) are post-transcriptional regulators of gene expression, exerting their regulatory function by base-pairing with their target mRNAs. While it has become evident that sRNAs play central regulatory roles in the cell, little is known about their evolution and the evolution of their regulatory interactions. Here we used the prokaryotic phylogenetic tree to reconstruct the evolutionary history of Escherichia coli sRNAs and their binding sites on target mRNAs. We discovered that sRNAs currently present in E. coli mainly accumulated inside the Enterobacteriales order, succeeding the appearance of other types of noncoding RNAs and concurrently with the evolution of a variant of the Hfq protein exhibiting a longer C-terminal region. Our analysis of the evolutionary ages of sRNA-mRNA interactions revealed that while all sRNAs were evolutionarily older than most of their known binding sites on mRNA targets, for quite a few sRNAs there was at least one binding site that coappeared with or preceded them. It is conceivable that the establishment of these first interactions forced selective pressure on the sRNAs, after which additional targets were acquired by fitting a binding site to the active region of the sRNA. This conjecture is supported by the appearance of many binding sites on target mRNAs only after the sRNA gain, despite the prior presence of the target gene in ancestral genomes. Our results suggest a selective mechanism that maintained the sRNAs across the phylogenetic tree, and shed light on the evolution of E. coli post-transcriptional regulatory network. © 2014 Peer and Margalit; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  3. Interacting boson model with surface delta interaction between nucleons: Structure and interaction of bosons

    International Nuclear Information System (INIS)

    Druce, C.H.; Moszkowski, S.A.

    1986-01-01

    The surface delta interaction is used as an effective nucleon-nucleon interaction to investigate the structure and interaction of the bosons in the interacting boson model. We have obtained analytical expressions for the coefficients of a multipole expansion of the neutron-boson-proton-boson interaction for the case of degenerate orbits. A connection is made between these coefficients and the parameters of the interaction boson model Hamiltonian. A link between the latter parameters and the single boson energies is suggested

  4. Interacting boson model with surface delta interaction between nucleons: Structure and interaction of bosons

    Energy Technology Data Exchange (ETDEWEB)

    Druce, C.H.; Moszkowski, S.A.

    1986-01-01

    The surface delta interaction is used as an effective nucleon-nucleon interaction to investigate the structure and interaction of the bosons in the interacting boson model. We have obtained analytical expressions for the coefficients of a multipole expansion of the neutron-boson-proton-boson interaction for the case of degenerate orbits. A connection is made between these coefficients and the parameters of the interaction boson model Hamiltonian. A link between the latter parameters and the single boson energies is suggested.

  5. Binding of the biogenic polyamines to deoxyribonucleic acids of varying base composition: base specificity and the associated energetics of the interaction.

    Directory of Open Access Journals (Sweden)

    Ayesha Kabir

    Full Text Available BACKGROUND: The thermodynamics of the base pair specificity of the binding of the polyamines spermine, spermidine, putrescine, and cadaverine with three genomic DNAs Clostridium perfringens, 27% GC, Escherichia coli, 50% GC and Micrococcus lysodeikticus, 72% GC have been studied using titration calorimetry and the data supplemented with melting studies, ethidium displacement and circular dichroism spectroscopy results. METHODOLOGY/PRINCIPAL FINDINGS: Isothermal titration calorimetry, differential scanning calorimetry, optical melting studies, ethidium displacement, circular dichroism spectroscopy are the various techniques employed to characterize the interaction of four polyamines, spermine, spermidine, putersine and cadaverine with the DNAs. Polyamines bound stronger with AT rich DNA compared to the GC rich DNA and the binding varied depending on the charge on the polyamine as spermine>spermidine >putrescine>cadaverine. Thermodynamics of the interaction revealed that the binding was entropy driven with small enthalpy contribution. The binding was influenced by salt concentration suggesting the contribution from electrostatic forces to the Gibbs energy of binding to be the dominant contributor. Each system studied exhibited enthalpy-entropy compensation. The negative heat capacity changes suggested a role for hydrophobic interactions which may arise due to the non polar interactions between DNA and polyamines. CONCLUSION/SIGNIFICANCE: From a thermodynamic analysis, the AT base specificity of polyamines to DNAs has been elucidated for the first time and supplemented by structural studies.

  6. Binding of the biogenic polyamines to deoxyribonucleic acids of varying base composition: base specificity and the associated energetics of the interaction.

    Science.gov (United States)

    Kabir, Ayesha; Suresh Kumar, Gopinatha

    2013-01-01

    The thermodynamics of the base pair specificity of the binding of the polyamines spermine, spermidine, putrescine, and cadaverine with three genomic DNAs Clostridium perfringens, 27% GC, Escherichia coli, 50% GC and Micrococcus lysodeikticus, 72% GC have been studied using titration calorimetry and the data supplemented with melting studies, ethidium displacement and circular dichroism spectroscopy results. Isothermal titration calorimetry, differential scanning calorimetry, optical melting studies, ethidium displacement, circular dichroism spectroscopy are the various techniques employed to characterize the interaction of four polyamines, spermine, spermidine, putersine and cadaverine with the DNAs. Polyamines bound stronger with AT rich DNA compared to the GC rich DNA and the binding varied depending on the charge on the polyamine as spermine>spermidine >putrescine>cadaverine. Thermodynamics of the interaction revealed that the binding was entropy driven with small enthalpy contribution. The binding was influenced by salt concentration suggesting the contribution from electrostatic forces to the Gibbs energy of binding to be the dominant contributor. Each system studied exhibited enthalpy-entropy compensation. The negative heat capacity changes suggested a role for hydrophobic interactions which may arise due to the non polar interactions between DNA and polyamines. From a thermodynamic analysis, the AT base specificity of polyamines to DNAs has been elucidated for the first time and supplemented by structural studies.

  7. Quantity Estimation Of The Interactions

    International Nuclear Information System (INIS)

    Gorana, Agim; Malkaj, Partizan; Muda, Valbona

    2007-01-01

    In this paper we present some considerations about quantity estimations, regarding the range of interaction and the conservations laws in various types of interactions. Our estimations are done under classical and quantum point of view and have to do with the interaction's carriers, the radius, the influence range and the intensity of interactions

  8. Global opportunities in land and water use while staying within the safe (and just) operating space: quantifications of interactions and tradeoffs

    Science.gov (United States)

    Gerten, Dieter; Jägermeyr, Jonas; Heck, Vera

    2016-04-01

    Staying within the safe and just operating space as defined by multiple planetary boundaries will be a major challenge especially in view of anticipated future increases in food demand, the potential need for balancing climate change (e.g. through terrestrial carbon dioxide removal) and its impacts, and the water and land demand associated with these goals and measures. This presentation will show simulation results from a comprehensive model-based study on the global potentials of diverse crop management options considered as opportunities to stay within the planetary boundaries for human freshwater use and land-system change. The quantified on-farm options include rainwater harvesting, soil conservation and more efficient irrigation, all of which are designed to use neither more water nor more land for agriculture than is presently the case. Results show that irrigation efficiency improvements could save substantial amounts of water in many river basins (globally 48% of non-productive water consumption in an ambitious scenario), and if rerouted to irrigate neighbouring rainfed systems, could at the same time boost kilocalorie production by 26% globally. Low-tech solutions for small-scale farmers on water-limited croplands show the potential to increase rainfed yields to a similar extent. In combination, such ambitious yet achievable integrated water management strategies could increase global kcal production by 41% and close the water-related yield gap by 62%. Global climate change would have adverse effects on crop yields in many regions, but the improvements in water management quantified here could buffer such effects to a significant degree. Thus, a substantial amount of anticipated future needs for food production could be fulfilled without further approaching / transgressing planetary boundaries. In addition, it will be shown how large-scale biomass plantations for the purpose of terrestrial CO2 removal (climate engineering, potentially implemented should

  9. Interaction Design for Public Spaces

    DEFF Research Database (Denmark)

    Kortbek, Karen Johanne

    2008-01-01

    In this abstract I describe the doctorial research project "Interaction Design for Public Spaces". The objective of the project is to explore and design interaction contexts in culture related public spaces such as museums, experience centres and festivals. As a perspective on this domain, I...... will focus on the usage of the body as an interaction device. Furthermore, the project will involve a dramaturgic take on communication and design of interactive systems in the pursuit of new ways to stage the interactive contexts. The outcome of the project will be guidelines and conceptual frameworks which...... will help interaction designers when designing for bodily movement, and communicating and staging interactive content in public spaces....

  10. Macromolecular competition titration method accessing thermodynamics of the unmodified macromolecule-ligand interactions through spectroscopic titrations of fluorescent analogs.

    Science.gov (United States)

    Bujalowski, Wlodzimierz; Jezewska, Maria J

    2011-01-01

    Analysis of thermodynamically rigorous binding isotherms provides fundamental information about the energetics of the ligand-macromolecule interactions and often an invaluable insight about the structure of the formed complexes. The Macromolecular Competition Titration (MCT) method enables one to quantitatively obtain interaction parameters of protein-nucleic acid interactions, which may not be available by other methods, particularly for the unmodified long polymer lattices and specific nucleic acid substrates, if the binding is not accompanied by adequate spectroscopic signal changes. The method can be applied using different fluorescent nucleic acids or fluorophores, although the etheno-derivatives of nucleic acid are especially suitable as they are relatively easy to prepare, have significant blue fluorescence, their excitation band lies far from the protein absorption spectrum, and the modification eliminates the possibility of base pairing with other nucleic acids. The MCT method is not limited to the specific size of the reference nucleic acid. Particularly, a simple analysis of the competition titration experiments is described in which the fluorescent, short fragment of nucleic acid, spanning the exact site-size of the protein-nucleic acid complex, and binding with only a 1:1 stoichiometry to the protein, is used as a reference macromolecule. Although the MCT method is predominantly discussed as applied to studying protein-nucleic acid interactions, it can generally be applied to any ligand-macromolecule system by monitoring the association reaction using the spectroscopic signal originating from the reference macromolecule in the presence of the competing macromolecule, whose interaction parameters with the ligand are to be determined. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Macromolecular Competition Titration Method: Accessing Thermodynamics of the Unmodified Macromolecule–Ligand Interactions Through Spectroscopic Titrations of Fluorescent Analogs

    Science.gov (United States)

    Bujalowski, Wlodzimierz; Jezewska, Maria J.

    2011-01-01

    Analysis of thermodynamically rigorous binding isotherms provides fundamental information about the energetics of the ligand–macromolecule interactions and often an invaluable insight about the structure of the formed complexes. The Macromolecular Competition Titration (MCT) method enables one to quantitatively obtain interaction parameters of protein–nucleic acid interactions, which may not be available by other methods, particularly for the unmodified long polymer lattices and specific nucleic acid substrates, if the binding is not accompanied by adequate spectroscopic signal changes. The method can be applied using different fluorescent nucleic acids or fluorophores, although the etheno-derivatives of nucleic acid are especially suitable as they are relatively easy to prepare, have significant blue fluorescence, their excitation band lies far from the protein absorption spectrum, and the modification eliminates the possibility of base pairing with other nucleic acids. The MCT method is not limited to the specific size of the reference nucleic acid. Particularly, a simple analysis of the competition titration experiments is described in which the fluorescent, short fragment of nucleic acid, spanning the exact site-size of the protein–nucleic acid complex, and binding with only a 1:1 stoichiometry to the protein, is used as a reference macromolecule. Although the MCT method is predominantly discussed as applied to studying protein–nucleic acid interactions, it can generally be applied to any ligand–macromolecule system by monitoring the association reaction using the spectroscopic signal originating from the reference macromolecule in the presence of the competing macromolecule, whose interaction parameters with the ligand are to be determined. PMID:21195223

  12. Electron-positron interactions

    International Nuclear Information System (INIS)

    Wiik, B.; Wolf, G.

    1979-01-01

    This book is an introduction into the physics of electron-positron interactions. After a description of electron-positron storage rings pure electromagnetic e + e - interactions, and the total cross section are considered. Then low energy processes, the production of the J/psi and psi' particles including their radiative decay as well as the search for other narrow vector states are described. Then after the quark model interpretation of J/psi and psi' charmed mesons, the heavy lepton t, and the upsilon resonances are described. Thereafter inclusive hadron production and jet formation is discussed. Finally the next generation of e + e - colliding rings is described, and the first results from PETRA are presented. This book is suited for all physicists, who want to get a general review about e + e - physics. (HSI) 891 HSI/HSI 892 RKD

  13. Intelligent Interactive Multimedia

    CERN Document Server

    Watanabe, Toyohide; Takahashi, Naohisa; 5th International Conference on Intelligent Interactive Multimedia Systems and Services

    2012-01-01

    This volume contains the Proceedings of the 5th International Conference on Intelligent Interactive Multimedia Systems and Services (KES-IIMSS-12).  The Conference was jointly organised by Nagoya University in Japan and the KES International organisation, and held in the attractive city of Gifu.   The KES-IIMSS conference series, (series chairs Prof. Maria Virvou and Prof. George Tsihrintzis), presents novel research in various areas of intelligent multimedia system relevant to the development of a new generation of interactive, user-centric devices and systems.  The aim of the conference is to provide an internationally respected forum for scientific research in the technologies and applications of this new and dynamic research area.

  14. Interacting adiabatic quantum motor

    Science.gov (United States)

    Bruch, Anton; Kusminskiy, Silvia Viola; Refael, Gil; von Oppen, Felix

    2018-05-01

    We present a field-theoretic treatment of an adiabatic quantum motor. We explicitly discuss a motor called the Thouless motor which is based on a Thouless pump operating in reverse. When a sliding periodic potential is considered to be the motor degree of freedom, a bias voltage applied to the electron channel sets the motor in motion. We investigate a Thouless motor whose electron channel is modeled as a Luttinger liquid. Interactions increase the gap opened by the periodic potential. For an infinite Luttinger liquid the coupling-induced friction is enhanced by electron-electron interactions. When the Luttinger liquid is ultimately coupled to Fermi liquid reservoirs, the dissipation reduces to its value for a noninteracting electron system for a constant motor velocity. Our results can also be applied to a motor based on a nanomagnet coupled to a quantum spin Hall edge.

  15. Theory of fundamental interactions

    International Nuclear Information System (INIS)

    Pestov, A.B.

    1992-01-01

    In the present article the theory of fundamental interactions is derived in a systematic way from the first principles. In the developed theory there is no separation between space-time and internal gauge space. Main equations for basic fields are derived. In is shown that the theory satisfies the correspondence principle and gives rise to new notions in the considered region. In particular, the conclusion is made about the existence of particles which are characterized not only by the mass, spin, charge but also by the moment of inertia. These are rotating particles, the particles which represent the notion of the rigid body on the microscopical level and give the key for understanding strong interactions. The main concepts and dynamical laws for these particles are formulated. The basic principles of the theory may be examined experimentally not in the distant future. 29 refs

  16. Interactive design center.

    Energy Technology Data Exchange (ETDEWEB)

    Pomplun, Alan R. (Sandia National Laboratories, Livermore, CA)

    2005-07-01

    Sandia's advanced computing resources provide researchers, engineers and analysts with the ability to develop and render highly detailed large-scale models and simulations. To take full advantage of these multi-million data point visualizations, display systems with comparable pixel counts are needed. The Interactive Design Center (IDC) is a second generation visualization theater designed to meet this need. The main display integrates twenty-seven projectors in a 9-wide by 3-high array with a total display resolution of more than 35 million pixels. Six individual SmartBoard displays offer interactive capabilities that include on-screen annotation and touch panel control of the facility's display systems. This report details the design, implementation and operation of this innovative facility.

  17. Theory of gravitational interactions

    CERN Document Server

    Gasperini, Maurizio

    2017-01-01

    This is the second edition of a well-received book that is a modern, self-contained introduction to the theory of gravitational interactions. The new edition includes more details on gravitational waves of cosmological origin, the so-called brane world scenario, and gravitational time-delay effects. The first part of the book follows the traditional presentation of general relativity as a geometric theory of the macroscopic gravitational field, while the second, more advanced part discusses the deep analogies (and differences) between a geometric theory of gravity and the “gauge” theories of the other fundamental interactions. This fills a gap within the traditional approach to general relativity which usually leaves students puzzled about the role of gravity. The required notions of differential geometry are reduced to the minimum, allowing room for aspects of gravitational physics of current phenomenological and theoretical interest, such as the properties of gravitational waves, the gravitational inter...

  18. Interactive Virtual Cinematography

    DEFF Research Database (Denmark)

    Burelli, Paolo

    is the process of visualising the content of a virtual environment by positioning and animating the virtual camera in the context of interactive applications such as a computer game. Camera placement and animation in games are usually directly controlled by the player or statically predened by designers. Direct...... control of the camera by the player increases the complexity of the interaction and reduces the designer's control on game storytelling. A completely designer-driven camera releases the player from the burden of controlling the point of view, but might generate undesired camera behaviours. Furthermore......, if the content of the game is procedurally generated, the designer might not have the necessary information to dene a priori the camera positions and movements. Automatic camera control aims to dene an abstraction layer that permits to control the camera using high-level and environment-independent rules...

  19. Student interaction in workshops

    DEFF Research Database (Denmark)

    Evers, Winie

    2014-01-01

    A kind of teaching for active learning has been experimented with at SDU Sønderborg as part of the course Supply Chain Dynamics. In this course the students learn about complex systems, system dynamics as well as supply chain instability and oscillation, the course lecturer invited the author...... to experiment with novel workshop methods and techniques, where objects are used to illustrate and model business issues (Heinemann et al, 2011, Buur et al, 2013). The idea was to see how students could be engaged in a different and more interactive way to learn about these topics, by assigning the students...... teaching should reflect this diversity by embracing and experimenting with multiple forms, including activation of students by students’ interaction and manipulation with objects....

  20. Embodying multilingual interaction

    DEFF Research Database (Denmark)

    Hazel, Spencer; Mortensen, Janus

    this linguistic diversity is managed in situ by participants engaged in dialogue with one another, and what it is used for in these transient multilingual communities. This paper presents CA-based micro-ethnographic analyses of language choice in an informal social setting – a kitchen – of an international study...... literature on language choice in interaction, our findings emphasize that analyses of language choice in multilingual settings need to take into account social actions beyond the words that are spoken. We show that facial, spatial and postural configurations, gaze orientation and gestures as well as prosodic...... in the particular community of practice that we are investigating. Reference Hazel, Spencer, and Janus Mortensen. forthcoming. Kitchen talk: Exploring linguistic practices in liminal institutional interactions in a multilingual university setting. in Language Alternation, Language Choice, and Language Encounter...