WorldWideScience

Sample records for nonproductive base-pairing interactions

  1. Theoretical analysis of noncanonical base pairing interactions in RNA molecules

    Indian Academy of Sciences (India)

    Dhananjay Bhattacharyya; Siv Chand Koripella; Abhijit Mitra; Vijay Babu Rajendran; Bhabdyuti Sinha

    2007-08-01

    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered for secondary structure predictions. We present results of comparative ab initio studies of stabilities and interaction energies for the three standard and 24 selected unusual RNA base pairs reported in the literature. Hydrogen added models of isolated base pairs, with heavy atoms frozen in their ‘away from equilibrium’ geometries, built from coordinates extracted from NDB, were geometry optimized using HF/6-31G** basis set, both before and after unfreezing the heavy atoms. Interaction energies, including BSSE and deformation energy corrections, were calculated, compared with respective single point MP2 energies, and correlated with occurrence frequencies and with types and geometries of hydrogen bonding interactions. Systems having two or more N-H…O/N hydrogen bonds had reasonable interaction energies which correlated well with respective occurrence frequencies and highlighted the possibility of some of them playing important roles in improved secondary structure prediction methods. Several of the remaining base pairs with one N-H…O/N and/or one C-H…O/N interactions respectively, had poor interaction energies and negligible occurrences. High geometry variations on optimization of some of these were suggestive of their conformational switch like characteristics.

  2. Base pairing in RNA structures: A computational analysis of structural aspects and interaction energies

    Indian Academy of Sciences (India)

    Purshotam Sharma; Abhijit Mitra; Sitansh Sharma; Harjinder Singh

    2007-09-01

    The base pairing patterns in RNA structures are more versatile and completely different as compared to DNA. We present here results of ab-initio studies of structures and interaction energies of eight selected RNA base pairs reported in literature. Interaction energies, including BSSE correction, of hydrogen added crystal geometries of base pairs have been calculated at the HF/6-31G∗∗ level. The structures and interaction energies of the base pairs in the crystal geometry are compared with those obtained after optimization of the base pairs. We find that the base pairs become more planar on full optimization. No change in the hydrogen bonding pattern is seen. It is expected that the inclusion of appropriate considerations of many of these aspects of RNA base pairing would significantly improve the accuracy of RNA secondary structure prediction.

  3. Theoretical Studies on the Intermolecular Interactions of Potentially Primordial Base-Pair Analogues

    Energy Technology Data Exchange (ETDEWEB)

    Leszczynski, Jerzy [Computational Center for Molecular Structure and Interactions, Jackson, MS; Sponer, Judit [Academy of Sciences of the Czech Republic; Sponer, Jiri [Academy of Sciences of the Czech Republic; Sumpter, Bobby G [ORNL; Fuentes-Cabrera, Miguel A [ORNL; Vazquez-Mayagoitia, Alvaro [ORNL

    2010-01-01

    Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the bases and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.

  4. Density functional theory studies of interactions of ruthenium-arene complexes with base pair steps.

    Science.gov (United States)

    Mutter, Shaun T; Platts, James A

    2011-10-20

    Density functional theory (DFT) calculations have been performed to determine the strength and geometry of intermolecular interactions of "piano-stool" ruthenium arene complexes, which show potential as anticancer treatments. Model complexes with methane and benzene indicate that the coordinated arene has C-H···π acceptor ability similar to that of free benzene, whereas this arene acts as a much stronger C-H donor or partner in π-stacking than free benzene. The source of these enhanced interactions is identified as a combination of electrostatic and dispersion effects. Complexes of Ru-arene complexes with base-pair step fragments of DNA, in which the arene has the potential to act as an intercalator, have also been investigated. Binding energies are found to be sensitive to the size and nature of the arene, with larger and more flexible arenes having stronger binding. π-stacking and C-H···π interactions between arene and DNA bases and hydrogen bonds from coordinated N-H to DNA oxygen atoms, as well as covalent Ru-N bonding, contribute to the overall binding. The effect of complexation on DNA structure is also examined, with larger rise and more negative slide values than canonical B-DNA observed in all cases.

  5. The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision.

    Science.gov (United States)

    Perreault, Andrea A; Venters, Bryan J

    2016-12-23

    Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5' DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

  6. Interactions between Cellulolytic Enzymes with Native, Autohydrolysis, and Technical Lignins and the Effect of a Polysorbate Amphiphile in Reducing Nonproductive Binding.

    Science.gov (United States)

    Fritz, Consuelo; Ferrer, Ana; Salas, Carlos; Jameel, Hasan; Rojas, Orlando J

    2015-12-14

    Understanding enzyme-substrate interactions is critical in designing strategies for bioconversion of lignocellulosic biomass. In this study we monitored molecular events, in situ and in real time, including the adsorption and desorption of cellulolytic enzymes on lignins and cellulose, by using quartz crystal microgravimetry and surface plasmon resonance. The effect of a nonionic surface active molecule was also elucidated. Three lignin substrates relevant to the sugar platform in biorefinery efforts were considered, namely, hardwood autohydrolysis cellulolytic (HWAH), hardwood native cellulolytic (MPCEL), and nonwood native cellulolytic (WSCEL) lignin. In addition, Kraft lignins derived from softwoods (SWK) and hardwoods (HWK) were used as references. The results indicated a high affinity between the lignins with both, monocomponent and multicomponent enzymes. More importantly, the addition of nonionic surfactants at concentrations above their critical micelle concentration reduced remarkably (by over 90%) the nonproductive interactions between the cellulolytic enzymes and the lignins. This effect was hypothesized to be a consequence of the balance of hydrophobic and hydrogen bonding interactions. Moreover, the reduction of surface roughness and increased wettability of lignin surfaces upon surfactant treatment contributed to a lower affinity with the enzymes. Conformational changes of cellulases were observed upon their adsorption on lignin carrying preadsorbed surfactant. Weak electrostatic interactions were determined in aqueous media at pH between 4.8 and 5.5 for the native cellulolytic lignins (MPCEL and WSCEL), whereby a ∼20% reduction in the enzyme affinity was observed. This was mainly explained by electrostatic interactions (osmotic pressure effects) between charged lignins and cellulases. Noteworthy, adsorption of nonionic surfactants onto cellulose, in the form cellulose nanofibrils, did not affect its hydrolytic conversion. Overall, our results

  7. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V. Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J. W.; Patolsky, Fernando; Gazit, Ehud

    2015-05-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs—CG, GC and GG—could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  8. Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Tiwari, Gargi, E-mail: gargi.tiwari@rediffmail.com; Sharma, Dipendra, E-mail: d-11sharma@rediffmail.com; Dwivedi, K. K., E-mail: dwivedikarunesh4@gmail.com [Department of Physics, DDU Gorakhpur University, Gorakhpur (India); Dwivedi, M. K., E-mail: dwivedi-ji@rediffmail.com [Department of Physics, Banaras Hindu University, Varanasi (India)

    2016-05-06

    The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.

  9. Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs

    Science.gov (United States)

    Tiwari, Gargi; Sharma, Dipendra; Dwivedi, K. K.; Dwivedi, M. K.

    2016-05-01

    The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.

  10. Base pairing interaction between 5'- and 3'-UTRs controls icaR mRNA translation in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Igor Ruiz de los Mozos

    Full Text Available The presence of regulatory sequences in the 3' untranslated region (3'-UTR of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3'-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3'-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3'-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3'-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3'-UTR and the Shine-Dalgarno (SD region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG within icaR 3'-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3'-UTR with the 5'-UTR of the same mRNA.

  11. Base pairing interaction between 5'- and 3'-UTRs controls icaR mRNA translation in Staphylococcus aureus.

    Science.gov (United States)

    Ruiz de los Mozos, Igor; Vergara-Irigaray, Marta; Segura, Victor; Villanueva, Maite; Bitarte, Nerea; Saramago, Margarida; Domingues, Susana; Arraiano, Cecilia M; Fechter, Pierre; Romby, Pascale; Valle, Jaione; Solano, Cristina; Lasa, Iñigo; Toledo-Arana, Alejandro

    2013-01-01

    The presence of regulatory sequences in the 3' untranslated region (3'-UTR) of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3'-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3'-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3'-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3'-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3'-UTR and the Shine-Dalgarno (SD) region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG) within icaR 3'-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3'-UTR with the 5'-UTR of the same mRNA.

  12. Infrared spectrum of the Ag(+)-(pyridine)2 ionic complex: probing interactions in artificial metal-mediated base pairing.

    Science.gov (United States)

    Chakraborty, Shamik; Dopfer, Otto

    2011-07-11

    The isolated pyridine-Ag(+)-pyridine unit (Py-Ag(+)-Py) is employed as a model system to characterize the recently observed Ag(+)-mediated base pairing in DNA oligonucleotides at the molecular level. The structure and infrared (IR) spectrum of the Ag(+)-Py(2) cationic complex are investigated in the gas phase by IR multiple-photon dissociation (IRMPD) spectroscopy and quantum chemical calculations to determine the preferred metal-ion binding site and other salient properties of the potential-energy surface. The IRMPD spectrum has been obtained in the 840-1720 cm(-1) fingerprint region by coupling the IR free electron laser at the Centre Laser Infrarouge d'Orsay (CLIO) with a Fourier-transform ion cyclotron resonance (FT-ICR) mass spectrometer equipped with an electrospray ionization source. The spectroscopic results are interpreted with quantum chemical calculations conducted at the B3LYP/aug-cc-pVDZ level. The analysis of the IRMPD spectrum is consistent with a σ complex, in which the Ag(+) ion binds to the nitrogen lone pairs of the two Py ligands in a linear configuration. The binding motif of Py-Ag(+)-Py in the gas phase is the same as that observed in Ag(+)-mediated base pairing in solution. Ag(+) bonding to the π-electron system of the aromatic ring is predicted to be a substantially less-favorable binding motif.

  13. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    Energy Technology Data Exchange (ETDEWEB)

    Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: KLP3@cornell.edu [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)

    2013-06-05

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

  14. Base Pairing Interaction between 5′- and 3′-UTRs Controls icaR mRNA Translation in Staphylococcus aureus

    Science.gov (United States)

    Ruiz de los Mozos, Igor; Vergara-Irigaray, Marta; Segura, Victor; Villanueva, Maite; Bitarte, Nerea; Saramago, Margarida; Domingues, Susana; Arraiano, Cecilia M.; Fechter, Pierre; Romby, Pascale; Valle, Jaione; Solano, Cristina; Lasa, Iñigo; Toledo-Arana, Alejandro

    2013-01-01

    The presence of regulatory sequences in the 3′ untranslated region (3′-UTR) of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3′-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3′-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3′-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3′-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3′-UTR and the Shine-Dalgarno (SD) region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG) within icaR 3′-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3′-UTR with the 5′-UTR of the same mRNA. PMID:24367275

  15. Alternative DNA base pairing through metal coordination.

    Science.gov (United States)

    Clever, Guido H; Shionoya, Mitsuhiko

    2012-01-01

    Base-pairing in the naturally occurring DNA and RNA oligonucleotide duplexes is based on π-stacking, hydrogen bonding, and shape complementarity between the nucleobases adenine, thymine, guanine, and cytosine as well as on the hydrophobic-hydrophilic balance in aqueous media. This complex system of multiple supramolecular interactions is the product of a long-term evolutionary process and thus highly optimized to serve its biological functions such as information storage and processing. After the successful implementation of automated DNA synthesis, chemists have begun to introduce artificial modifications inside the core of the DNA double helix in order to study various aspects of base pairing, generate new base pairs orthogonal to the natural ones, and equip the biopolymer with entirely new functions. The idea to replace the hydrogen bonding interactions with metal coordination between ligand-like nucleosides and suitable transition metal ions culminated in the development of a plethora of artificial base-pairing systems termed "metal base-pairs" which were shown to strongly enhance the DNA duplex stability. Furthermore, they show great potential for the use of DNA as a molecular wire in nanoscale electronic architectures. Although single electrons have proven to be transmitted by natural DNA over a distance of several base pairs, the high ohmic resistance of unmodified oligonucleotides was identified as a serious obstacle. By exchanging some or all of the Watson-Crick base pairs in DNA with metal complexes, this problem may be solved. In the future, these research efforts are supposed to lead to DNA-like materials with superior conductivity for nano-electronic applications. Other fields of potential application such as DNA-based supramolecular architecture and catalysis may be strongly influenced by these developments as well. This text is meant to illustrate the basic concepts of metal-base pairing and give an outline over recent developments in this field.

  16. How Mg(2+) ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg(2+) ions through water-mediated interaction. It is important to know the synergic role of Mg(2+) and the water network surrounding Mg(2+) in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg(2+) is pulled from RNA, which causes disturbance of the water network. It was found that Mg(2+) remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg(2+) interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg(2+) and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg(2+) is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  17. Interaction of an anti-cancer photosensitizer with a genomic DNA: From base pair specificity and thermodynamic landscape to tuning the rate of detergent-sequestered dissociation.

    Science.gov (United States)

    Paul, Bijan K; Ghosh, Narayani; Mukherjee, Saptarshi

    2016-05-15

    A detailed characterization of the binding interaction of a potent cancer cell photosensitizer, norharmane (NHM) with a genomic DNA (herring sperm; hsDNA) is undertaken with particular emphasis on deciphering the strength, mode, dynamics, energetics and kinetics of binding. A major focus of the study underlies a successful exploration of the concept of detergent-sequestered dissociation of drug from the drug-DNA complex. Biophysical techniques such as absorption, steady-state and time-resolved fluorescence spectroscopy, circular dichroism, DNA helix melting, stopped-flow fluorescence kinetics and calorimetry have been used. A primarily intercalative mode of binding of NHM with DNA is shown. However, the overall interaction is governed by more than one type of binding forces. We demonstrate that the essential prerequisite of a slower dissociation rate of drug from DNA helix is achieved by tenable choice surfactants. Our results also highlight an effective tunability of the rate of dissociation of the DNA-intercalated drug via detergent-sequestration. A detailed isothermal titration calorimetric study unveils the key role of hydrophobic force underlying NHM-hsDNA association. This is further substantiated by the enthalpy-entropy compensation behavior. The major entropic contribution in detergent-induced dissociation of NHM from NHM-hsDNA complex is also demonstrated. Our results present not only a comprehensive structural and thermodynamic profile, base pair specificity, association kinetics for binding of NHM with DNA but also explore the thermodynamic and kinetic aspects of dissociation of bound drug. Characterization and tuning of the essential prerequisites for a drug to be efficient in anti-cancer functionality bear direct and widespread significance in contemporary global research.

  18. Noncovalent interactions of a benzo[a]pyrene diol epoxide with DNA base pairs: insight into the formation of adducts of (+)-BaP DE-2 with DNA.

    Science.gov (United States)

    Hargis, Jacqueline C; Schaefer, Henry F; Houk, K N; Wheeler, Steven E

    2010-02-01

    Noncovalent complexes of a tumorigenic benzo[a]pyrene diol epoxide with the guanine-cytosine (GC) and adenine-thymine (AT) base pairs have been examined computationally. (+)-BaP DE-2 forms covalent adducts with DNA via nucleophilic attack on the (+)-BaP DE-2 epoxide. Computational results predict five thermodynamically accessible complexes of AT with (+)-BaP DE-2 that are compatible with intact DNA. Among these, two are expected to lead to adenine adducts. In the lowest energy AT...(+)-BaP DE-2 complex, which has a gas-phase interaction energy of -20.9 kcal mol(-1), the exocyclic NH(2) of adenine is positioned for backside epoxide attack and formation of a trans adduct. The most energetically favorable complex leading to formation of a cis ring-opened adduct lies only 0.6 kcal mol(-1) higher in energy. For GC...(+)-BaP DE-2, there are only two thermodynamically accessible complexes. The higher-lying complex, bound in the gas phase by 24.4 kcal mol(-1) relative to separated GC and (+)-BaP DE-2, would lead to a trans ring-opened N(2)-guanine adduct. In the global minimum energy GC...(+)-BaP DE-2 complex, bound by 27.3 kcal mol(-1), the exocyclic NH(2) group of cytosine is positioned for cis epoxide addition. However, adducts of (+)-BaP DE-2 with cytosine are rarely observed experimentally. The paucity of cytosine adducts, despite the predicted thermodynamic stability of this GC...(+)-BaP DE-2 complex, is attributed to the electrostatic destabilization of the benzylic cation intermediate thought to precede cis addition.

  19. Nonproductive events in ring-closing metathesis using ruthenium catalysts.

    Science.gov (United States)

    Stewart, Ian C; Keitz, Benjamin K; Kuhn, Kevin M; Thomas, Renee M; Grubbs, Robert H

    2010-06-30

    The relative TONs of productive and nonproductive metathesis reactions of diethyl diallylmalonate are compared for eight different ruthenium-based catalysts. Nonproductive cross metathesis is proposed to involve a chain-carrying ruthenium methylidene. A second more-challenging substrate (dimethyl allylmethylallylmalonate) that forms a trisubstituted olefin product is used to further delineate the effect of catalyst structure on the relative efficiencies of these processes. A steric model is proposed to explain the observed trends.

  20. New Theoretical Insight into the Interactions and Properties of Formic Acid: Development of a Quantum-Based Pair Potential for Formic Acid.

    Energy Technology Data Exchange (ETDEWEB)

    Roszak, S; Gee, R; Balasubramanian, K; Fried, L

    2005-08-08

    We performed ab initio quantum chemical studies for the development of intra and intermolecular interaction potentials for formic acid for use in molecular dynamics simulations of formic acid molecular crystal. The formic acid structures considered in the ab initio studies include both the cis and trans monomers which are the conformers that have been postulated as part of chains constituting liquid and crystal phases under extreme conditions. Although the cis to trans transformation is not energetically favored, the trans isomer was found as a component of stable gas-phase species. Our decomposition scheme for the interaction energy indicates that the hydrogen bonded complexes are dominated by the Hartree-Fock forces while parallel clusters are stabilized by the electron correlation energy. The calculated three-body and higher interactions are found to be negligible, thus rationalizing the development of an atom-atom pair potential for formic acid based on high-level ab initio calculations of small formic acid clusters. Here we present an atom-atom pair potential that includes both intra- and inter-molecular degrees of freedom for formic acid. The newly developed pair potential is used to examine formic acid in the condensed phase via molecular dynamics simulations. The isothermal compression under hydrostatic pressure obtained from molecular dynamics simulations is in good agreement with experiment. Further, the calculated equilibrium melting temperature is found to be in good agreement with experiment.

  1. Higher order structural effects stabilizing the reverse Watson-Crick Guanine-Cytosine base pair in functional RNAs

    National Research Council Canada - National Science Library

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains...

  2. Partition function and base pairing probabilities of RNA heterodimers

    Directory of Open Access Journals (Sweden)

    Stadler Peter F

    2006-03-01

    Full Text Available Abstract Background RNA has been recognized as a key player in cellular regulation in recent years. In many cases, non-coding RNAs exert their function by binding to other nucleic acids, as in the case of microRNAs and snoRNAs. The specificity of these interactions derives from the stability of inter-molecular base pairing. The accurate computational treatment of RNA-RNA binding therefore lies at the heart of target prediction algorithms. Methods The standard dynamic programming algorithms for computing secondary structures of linear single-stranded RNA molecules are extended to the co-folding of two interacting RNAs. Results We present a program, RNAcofold, that computes the hybridization energy and base pairing pattern of a pair of interacting RNA molecules. In contrast to earlier approaches, complex internal structures in both RNAs are fully taken into account. RNAcofold supports the calculation of the minimum energy structure and of a complete set of suboptimal structures in an energy band above the ground state. Furthermore, it provides an extension of McCaskill's partition function algorithm to compute base pairing probabilities, realistic interaction energies, and equilibrium concentrations of duplex structures. Availability RNAcofold is distributed as part of the Vienna RNA Package, http://www.tbi.univie.ac.at/RNA/. Contact Stephan H. Bernhart – berni@tbi.univie.ac.at

  3. Contiguous metal-mediated base pairs comprising two Ag(I) ions.

    Science.gov (United States)

    Megger, Dominik A; Guerra, Célia Fonseca; Hoffmann, Jan; Brutschy, Bernhard; Bickelhaupt, F Matthias; Müller, Jens

    2011-05-27

    The incorporation of transition-metal ions into nucleic acids by using metal-mediated base pairs has proved to be a promising strategy for the site-specific functionalization of these biomolecules. We report herein the formation of Ag(+)-mediated Hoogsteen-type base pairs comprising 1,3-dideaza-2'-deoxyadenosine and thymidine. By defunctionalizing the Watson-Crick edge of adenine, the formation of regular base pairs is prohibited. The additional substitution of the N3 nitrogen atom of adenine by a methine moiety increases the basicity of the exocyclic amino group. Hence, 1,3-dideazaadenine and thymine are able to incorporate two Ag(+) ions into their Hoogsteen-type base pair (as compared with one Ag(+) ion in base pairs with 1-deazaadenine and thymine). We show by using a combination of experimental techniques (UV and circular dichroism (CD) spectroscopies, dynamic light scattering, and mass spectrometry) that this type of base pair is compatible with different sequence contexts and can be used contiguously in DNA double helices. The most stable duplexes were observed when using a sequence containing alternating purine and pyrimidine nucleosides. Dispersion-corrected density functional theory calculations have been performed to provide insight into the structure, formation and stabilization of the twofold metalated base pair. They revealed that the metal ions within a base pair are separated by an Ag···Ag distance of about 2.88 Å. The Ag-Ag interaction contributes some 16 kcal mol(-1) to the overall stability of the doubly metal-mediated base pair, with the dominant contribution to the Ag-Ag bonding resulting from a donor-acceptor interaction between silver 4d-type and 4s orbitals. These Hoogsteen-type base pairs enable a higher functionalization of nucleic acids with metal ions than previously reported metal-mediated base pairs, thereby increasing the potential of DNA-based nanotechnology.

  4. The non-Watson-Crick base pairs and their associated isostericity matrices

    National Research Council Canada - National Science Library

    Leontis, Neocles B; Stombaugh, Jesse; Westhof, Eric

    2002-01-01

    RNA molecules exhibit complex structures in which a large fraction of the bases engage in non-Watson-Crick base pairing, forming motifs that mediate long-range RNA-RNA interactions and create binding...

  5. Sequence dependency of canonical base pair opening in the DNA double helix.

    Science.gov (United States)

    Lindahl, Viveca; Villa, Alessandra; Hess, Berk

    2017-04-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair.

  6. NMR analysis of base-pair opening kinetics in DNA

    Science.gov (United States)

    Szulik, Marta W.; Voehler, Markus; Stone, Michael P.

    2014-01-01

    Base pairing in nucleic acids plays a crucial role in their structure and function. Differences in the base pair opening and closing kinetics of individual double stranded DNA sequences or between chemically modified base pairs provide insight into the recognition of these base pairs by DNA processing enzymes. This unit describes how to quantify the kinetics for localized base pairs by observing changes in the imino proton signals by nuclear magnetic resonance spectroscopy. The determination of all relevant parameters using state of the art techniques and NMR instrumentation, including cryoprobes, is discussed. PMID:25501592

  7. Sequence dependency of canonical base pair opening in the DNA double helix.

    Directory of Open Access Journals (Sweden)

    Viveca Lindahl

    2017-04-01

    Full Text Available The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair.

  8. Natural versus artificial creation of base pairs in DNA: origin of nucleobases from the perspectives of unnatural base pair studies.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko; Yamashige, Rie

    2012-12-18

    Since life began on Earth, the four types of bases (A, G, C, and T(U)) that form two sets of base pairs have remained unchanged as the components of nucleic acids that replicate and transfer genetic information. Throughout evolution, except for the U to T modification, the four base structures have not changed. This constancy within the genetic code raises the question of how these complicated nucleotides were generated from the molecules in a primordial soup on the early Earth. At some prebiotic stage, the complementarity of base pairs might have accelerated the generation and accumulation of nucleotides or oligonucleotides. We have no clues whether one pair of nucleobases initially appeared on the early Earth during this process or a set of two base pairs appeared simultaneously. Recently, researchers have developed new artificial pairs of nucleobases (unnatural base pairs) that function alongside the natural base pairs. Some unnatural base pairs in duplex DNA can be efficiently and faithfully amplified in a polymerase chain reaction (PCR) using thermostable DNA polymerases. The addition of unnatural base pair systems could expand the genetic alphabet of DNA, thus providing a new mechanism for the generation novel biopolymers by the site-specific incorporation of functional components into nucleic acids and proteins. Furthermore, the process of unnatural base pair development might provide clues to the origin of the natural base pairs in a primordial soup on the early Earth. In this Account, we describe the development of three representative types of unnatural base pairs that function as a third pair of nucleobases in PCR and reconsider the origin of the natural nucleic acids. As researchers developing unnatural base pairs, they use repeated "proof of concept" experiments. As researchers design new base pairs, they improve the structures that function in PCR and eliminate those that do not. We expect that this process is similar to the one functioning in the

  9. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  10. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  11. Targeting DNA base pair mismatch with artificial nucleobases. Advances and perspectives in triple helix strategy.

    Science.gov (United States)

    Malnuit, Vincent; Duca, Maria; Benhida, Rachid

    2011-01-21

    This review, divided into three sections, describes the contribution of the chemists' community to the development and application of triple helix strategy by using artificial nucleic acids, particularly for the recognition of DNA sequences incorporating base pair inversions. Firstly, the development of nucleobases that recognise CG inversion is surveyed followed secondly by specific recognition of TA inverted base pair. Finally, we point out in the last section recent perspectives and applications, driven from knowledge in nucleic acids interactions, in the growing field of nanotechnology and supramolecular chemistry at the border area of physics, chemistry and molecular biology.

  12. Second generation silver(I-mediated imidazole base pairs

    Directory of Open Access Journals (Sweden)

    Susanne Hensel

    2014-09-01

    Full Text Available The imidazole–Ag(I–imidazole base pair is one of the best-investigated artificial metal-mediated base pairs. We show here that its stability can be further improved by formally replacing the imidazole moiety by a 2-methylimidazole or 4-methylimidazole moiety. A comparison of the thermal stability of several double helices shows that the addition of one equivalent of Ag(I leads to a 50% larger increase in the melting temperature when a DNA duplex with methylated imidazole nucleosides is applied. This significant effect can likely be attributed to a better steric shielding of the metal ion within the metal-mediated base pair.

  13. 29 CFR 778.318 - Productive and nonproductive hours of work.

    Science.gov (United States)

    2010-07-01

    ... STATEMENTS OF GENERAL POLICY OR INTERPRETATION NOT DIRECTLY RELATED TO REGULATIONS OVERTIME COMPENSATION... Act; such nonproductive working hours must be counted and paid for. (b) Compensation payable for... hours standard is 40 hours is owed compensation at his regular rate for all of the first 40 hours and...

  14. Non-Production Benefits of Education: Crime, Health, and Good Citizenship. NBER Working Paper No. 16722

    Science.gov (United States)

    Lochner, Lance

    2011-01-01

    A growing body of work suggests that education offers a wide-range of benefits that extend beyond increases in labor market productivity. Improvements in education can lower crime, improve health, and increase voting and democratic participation. This chapter reviews recent developments on these "non-production" benefits of education with an…

  15. The essential role of stacking adenines in a two-base-pair RNA kissing complex.

    Science.gov (United States)

    Stephenson, William; Asare-Okai, Papa Nii; Chen, Alan A; Keller, Sean; Santiago, Rachel; Tenenbaum, Scott A; Garcia, Angel E; Fabris, Daniele; Li, Pan T X

    2013-04-17

    In minimal RNA kissing complexes formed between hairpins with cognate GACG tetraloops, the two tertiary GC pairs are likely stabilized by the stacking of 5'-unpaired adenines at each end of the short helix. To test this hypothesis, we mutated the flanking adenines to various nucleosides and examined their effects on the kissing interaction. Electrospray ionization mass spectrometry was used to detect kissing dimers in a multiequilibria mixture, whereas optical tweezers were applied to monitor the (un)folding trajectories of single RNA molecules. The experimental findings were rationalized by molecular dynamics simulations. Together, the results showed that the stacked adenines are indispensable for the tertiary interaction. By shielding the tertiary base pairs from solvent and reducing their fraying, the stacked adenines made terminal pairs act more like interior base pairs. The purine double-ring of adenine was essential for effective stacking, whereas additional functional groups modulated the stabilizing effects through varying hydrophobic and electrostatic forces. Furthermore, formation of the kissing complex was dominated by base pairing, whereas its dissociation was significantly influenced by the flanking bases. Together, these findings indicate that unpaired flanking nucleotides play essential roles in the formation of otherwise unstable two-base-pair RNA tertiary interactions.

  16. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    Science.gov (United States)

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  17. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  18. DFT Description of Intermolecular Forces between 9-Aminoacridines and DNA Base Pairs

    Directory of Open Access Journals (Sweden)

    Sandra Cotes Oyaga

    2013-01-01

    Full Text Available The B3LYP method with 6-31G* basis set was used to predict the geometries of five 9-aminoacridines (9-AA 1(a–e, DNA base pairs, and respective complexes. Polarizabilities, charge distribution, frontier molecular orbital (FMO, and dipole moments were used to analyze the nature of interactions that allow reasonable drug diffusion levels. The results showed that charge delocalization, high polarizabilities, and high dipole moments play an important role in intermolecular interactions with DNA. The interactions of 9-AA 1(a–e with GC are the strongest. 9-AA 1(d displayed the strongest interaction and 9-AA 1(b the weakest.

  19. Hydrogen bonding: a channel for protons to transfer through acid-base pairs.

    Science.gov (United States)

    Wu, Liang; Huang, Chuanhui; Woo, Jung-Je; Wu, Dan; Yun, Sung-Hyun; Seo, Seok-Jun; Xu, Tongwen; Moon, Seung-Hyeon

    2009-09-10

    Different from H(3)O(+) transport as in the vehicle mechanism, protons find another channel to transfer through the poorly hydrophilic interlayers in a hydrated multiphase membrane. This membrane was prepared from poly(phthalazinone ether sulfone kentone) (SPPESK) and H(+)-form perfluorosulfonic resin (FSP), and poorly hydrophilic electrostatically interacted acid-base pairs constitute the interlayer between two hydrophilic phases (FSP and SPPESK). By hydrogen bonds forming and breaking between acid-base pairs and water molecules, protons transport directly through these poorly hydrophilic zones. The multiphase membrane, due to this unique transfer mechanism, exhibits better electrochemical performances during fuel cell tests than those of pure FSP and Nafion-112 membranes: 0.09-0.12 S cm(-1) of proton conductivity at 25 degrees C and 990 mW cm(-2) of the maximum power density at a current density of 2600 mA cm(-2) and a cell voltage of 0.38 V.

  20. Characterization of the trans Watson-Crick GU base pair located in the catalytic core of the antigenomic HDV ribozyme.

    Directory of Open Access Journals (Sweden)

    Dominique Lévesque

    Full Text Available The HDV ribozyme's folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U(23 and G(28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U(23 and G(28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction.

  1. Ultrafast dynamics in DNA base pairs following ultraviolet excitation.

    Science.gov (United States)

    Orr-Ewing, Andrew

    2015-03-01

    Photo-protective mechanisms in DNA are essential to maintain the integrity of the genetic code by preventing damage from absorption of solar ultraviolet (UV) radiation. We have used time-resolved infra-red (TRIR) spectroscopy to observe the dynamics of Watson-Crick nucleobase pairs following absorption of femtosecond UV laser pulses. The base pairs are prepared as nucleosides in solution, and photo-induced dynamics are probed in the carbonyl and N-H bond stretching regions using broadband IR pulses with picosecond time resolution. Results will be presented for the guanine-cytosine (G-C) base pair, contrasting the rapid recovery of ground-state products (the photo-protection pathway) with formation of other photoproducts which might represent photo-damage mechanisms. This work is a collaboration with the group of Prof F. Temps (Christian-Albrechts-Universitat zu Kiel). This research is supported by ERC Advanced Grant 290966 CAPRI.

  2. The effect of base pair mismatch on DNA strand displacement

    CERN Document Server

    Broadwater, Bo

    2016-01-01

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single base pair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration, and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term, the concurrent displacement model, and used the first passage t...

  3. Efficacy and tolerability of levodropropizine and dropropizine in children with non-productive cough.

    Science.gov (United States)

    Banderali, G; Riva, E; Fiocchi, A; Cordaro, C I; Giovannini, M

    1995-01-01

    The antitussive efficacy and tolerability of dropropizine and of its enantiomer levodropropizine were evaluated in children with non-productive cough; 258 were evaluable for tolerability and 254 for efficacy. Patients randomly received either 1 mg/kg dropropizine or 2 mg/kg levodropropizine orally, three times daily for 3 days. There were statistically significant decreases in the frequency of coughing spells and nocturnal awakenings after both levodropropizine and dropropizine treatments (P Levodropropizine is as effective as an antitussive as dropropizine, but appears to carry a lower risk of daytime somnolence.

  4. Computational study of productive and non-productive cycles in fluoroalkene metathesis

    Directory of Open Access Journals (Sweden)

    Markéta Rybáčková

    2015-11-01

    Full Text Available A detailed DFT study of the mechanism of metathesis of fluoroethene, 1-fluoroethene, 1,1-difluoroethene, cis- and trans-1,2-difluoroethene, tetrafluoroethene and chlorotrifluoroethene catalysed with the Hoveyda–Grubbs 2nd generation catalyst was performed. It revealed that a successful metathesis of hydrofluoroethenes is hampered by a high preference for a non-productive catalytic cycle proceeding through a ruthenacyclobutane intermediate bearing fluorines in positions 2 and 4. Moreover, the calculations showed that the cross-metathesis of perfluoro- or perhaloalkenes should be a feasible process and that the metathesis is not very sensitive to stereochemical issues.

  5. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  6. Stimulation of methane generation from nonproductive coal by addition of nutrients or a microbial consortium.

    Science.gov (United States)

    Jones, Elizabeth J P; Voytek, Mary A; Corum, Margo D; Orem, William H

    2010-11-01

    Biogenic formation of methane from coal is of great interest as an underexploited source of clean energy. The goal of some coal bed producers is to extend coal bed methane productivity and to utilize hydrocarbon wastes such as coal slurry to generate new methane. However, the process and factors controlling the process, and thus ways to stimulate it, are poorly understood. Subbituminous coal from a nonproductive well in south Texas was stimulated to produce methane in microcosms when the native population was supplemented with nutrients (biostimulation) or when nutrients and a consortium of bacteria and methanogens enriched from wetland sediment were added (bioaugmentation). The native population enriched by nutrient addition included Pseudomonas spp., Veillonellaceae, and Methanosarcina barkeri. The bioaugmented microcosm generated methane more rapidly and to a higher concentration than the biostimulated microcosm. Dissolved organics, including long-chain fatty acids, single-ring aromatics, and long-chain alkanes accumulated in the first 39 days of the bioaugmented microcosm and were then degraded, accompanied by generation of methane. The bioaugmented microcosm was dominated by Geobacter sp., and most of the methane generation was associated with growth of Methanosaeta concilii. The ability of the bioaugmentation culture to produce methane from coal intermediates was confirmed in incubations of culture with representative organic compounds. This study indicates that methane production could be stimulated at the nonproductive field site and that low microbial biomass may be limiting in situ methane generation. In addition, the microcosm study suggests that the pathway for generating methane from coal involves complex microbial partnerships.

  7. Stimulation of methane generation from nonproductive coal by addition of nutrients or a microbial consortium

    Science.gov (United States)

    Jones, Elizabeth J.P.; Voytek, Mary A.; Corum, Margo D.; Orem, William H.

    2010-01-01

    Biogenic formation of methane from coal is of great interest as an underexploited source of clean energy. The goal of some coal bed producers is to extend coal bed methane productivity and to utilize hydrocarbon wastes such as coal slurry to generate new methane. However, the process and factors controlling the process, and thus ways to stimulate it, are poorly understood. Subbituminous coal from a nonproductive well in south Texas was stimulated to produce methane in microcosms when the native population was supplemented with nutrients (biostimulation) or when nutrients and a consortium of bacteria and methanogens enriched from wetland sediment were added (bioaugmentation). The native population enriched by nutrient addition included Pseudomonas spp., Veillonellaceae, and Methanosarcina barkeri. The bioaugmented microcosm generated methane more rapidly and to a higher concentration than the biostimulated microcosm. Dissolved organics, including long-chain fatty acids, single-ring aromatics, and long-chain alkanes accumulated in the first 39 days of the bioaugmented microcosm and were then degraded, accompanied by generation of methane. The bioaugmented microcosm was dominated by Geobacter sp., and most of the methane generation was associated with growth of Methanosaeta concilii. The ability of the bioaugmentation culture to produce methane from coal intermediates was confirmed in incubations of culture with representative organic compounds. This study indicates that methane production could be stimulated at the nonproductive field site and that low microbial biomass may be limiting in situ methane generation. In addition, the microcosm study suggests that the pathway for generating methane from coal involves complex microbial partnerships.

  8. Physics of base-pairing dynamics in DNA

    Science.gov (United States)

    Manghi, Manoel; Destainville, Nicolas

    2016-05-01

    As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

  9. On the role of the cis Hoogsteen:sugar-edge family of base pairs in platforms and triplets-quantum chemical insights into RNA structural biology.

    Science.gov (United States)

    Sharma, Purshotam; Sponer, Judit E; Sponer, Jirí; Sharma, Sitansh; Bhattacharyya, Dhananjay; Mitra, Abhijit

    2010-03-11

    Base pairs belonging to the cis Hoogsteen:sugar-edge (H:S) family play important structural roles in folded RNA molecules. Several of these are present in internal loops, where they are involved in interactions leading to planar dinucleotide platforms which stabilize higher order structures such as base triplets and quartets. We report results of analysis of 30 representative examples spanning 16 possible base pair combinations, with several of them showing multimodality of base pairing geometry. The geometries of 23 of these base pairs were modeled directly from coordinates extracted from RNA crystal structures. The other seven were predicted structures which were modeled on the basis of observed isosteric analogues. After appropriate satisfaction of residual valencies, these structures were relaxed using the B3LYP/6-31G(d,p) method and interaction energies were derived at the RIMP2/aug-cc-pVDZ level of theory. The geometries for each of the studied base pairs have been characterized in terms of the number and nature of H-bonds, rmsd values observed on optimization, base pair geometrical parameters, and sugar pucker analysis. In addition to its evaluation, the nature of intermolecular interaction in these complexes was also analyzed using Morokuma decomposition. The gas phase interaction energies range between -5.2 and -20.6 kcal/mol and, in contrast to the H:S trans base pairs, show enhanced relative importance of the electron correlation component, indicative of the greater role of dispersion energy in stabilization of these base pairs. The rich variety of hydrogen bonding pattern, involving the flexible sugar edge, appears to hold the key to several features of structural motifs, such as planarity and propensity to participate in triplets, observed in this family of base pairs. This work explores these aspects by integrating database analysis, and detailed base pairing geometry analysis at the atomistic level, with ab initio computation of interaction energies

  10. Efficacy and safety of levodropropizine and dihydrocodeine on nonproductive cough in primary and metastatic lung cancer.

    Science.gov (United States)

    Luporini, G; Barni, S; Marchi, E; Daffonchio, L

    1998-07-01

    Nonproductive cough is a frequent and distressing symptom in patients with lung cancer, and it is not even relieved by palliative chemotherapy. A double-blind, randomized clinical trial regarding the treatment of nonproductive cough was performed in 140 adults with primary lung cancer or metastatic cancer of the lungs. The therapeutic efficacy and the tolerability of a 7-day treatment with levodropropizine drops (75 mg t.i.d.) were evaluated in comparison with dihydrocodeine drops (10 mg t.i.d.; 7 days). Efficacy was assessed on the basis of cough severity scores, number of night awakenings due to cough, and overall estimate of antitussive efficacy. Tolerability was evaluated by laboratory results, vital signs and any adverse event occurring during the clinical trial, including presence or absence of somnolence. Subjective cough severity was significantly reduced during treatment with either levodropropizine and dihydrocodeine, the antitussive effect and its time-profile being similar for both drugs. Also, according to the investigator's evaluation, both levodropropizine and dihydrocodeine produced a significant decrease in cough severity. Concurrently with the relief of cough, the number of night awakenings was decreased significantly by both drugs, with no difference between the two treatments. No change in laboratory test values was considered clinically relevant, and vital signs were not clinically affected. The number of patients reporting adverse events was similar in the levodropropizine (n=6) and dihydrocodeine (n=4) group. However, the percentage of patients experiencing somnolence in the group receiving levodropropizine (8%) was significantly lower as compared with that of the dihydrocodeine group (22%). These results confirm the antitussive effectiveness of levodropropizine and suggest a more favourable benefit/risk profile when compared to dihydrocodeine.

  11. Unique magnetic signatures of mismatched base pairs in DNA

    Science.gov (United States)

    Apalkov, Vadim; Berashevich, Julia; Chakraborty, Tapash

    2010-02-01

    Magnetic properties of DNA containing mispairs, such as different conformations of the GṡA mispair, or a GṡT mispair inserted into the DNA chain, have been theoretically investigated. The essential ingredients for these studies, the charge transfer integrals, were evaluated from the DNA sequences containing the mispair and optimized in the solvent. We find that the magnetic susceptibilities of the host DNA chain containing a large number of Watson-Crick base pairs are significantly altered in the presence of the mispairs, and the effects depend on the choice of mispairs. In particular, insertion of even a single GṡA mispair changes the nature of magnetization (sign of the susceptibility) of the host DNA. We propose that measurement of the magnetic properties of DNA might provide a direct route to detection and identification of those mispairs.

  12. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... than the corresponding deoxyribooligonucleotides and that they cannot function as primers for DNA polymerases. We show that a PNA/DNA complex can effectively block the formation of a PCR product when the PNA is targeted against one of the PCR primer sites. Furthermore, we demonstrate that this blockage...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  13. Effect of base pairing on the electrochemical oxidation of guanine.

    Science.gov (United States)

    Costentin, Cyrille; Hajj, Viviane; Robert, Marc; Savéant, Jean-Michel; Tard, Cédric

    2010-07-28

    The effect of base pairing by cytosine on the electrochemical oxidation of guanine is examined by means of cyclic voltammetry on carefully purified reactants in a solvent, CHCl(3), which strongly favors the formation of an H-bonded pair. The thermodynamics and kinetics of the oxidation reaction are not strongly influenced by the formation of the pair. They are actually similar to those of the reaction in which 2,6-lutidine, an encumbered base that cannot form a pair with guanine, replaces cytosine. The reaction does not entail a concerted proton-electron mechanism, as attested by the absence of H/D isotope effect. It rather involves the rate-determining formation of the cation radical, followed by its deprotonation and dimerization of the resulting neutral radical in competition with its further oxidation.

  14. Thermodynamic contribution and nearest-neighbor parameters of pseudouridine-adenosine base pairs in oligoribonucleotides.

    Science.gov (United States)

    Hudson, Graham A; Bloomingdale, Richard J; Znosko, Brent M

    2013-11-01

    Pseudouridine (Ψ) is the most common noncanonical nucleotide present in naturally occurring RNA and serves a variety of roles in the cell, typically appearing where structural stability is crucial to function. Ψ residues are isomerized from native uridine residues by a class of highly conserved enzymes known as pseudouridine synthases. In order to quantify the thermodynamic impact of pseudouridylation on U-A base pairs, 24 oligoribonucleotides, 16 internal and eight terminal Ψ-A oligoribonucleotides, were thermodynamically characterized via optical melting experiments. The thermodynamic parameters derived from two-state fits were used to generate linearly independent parameters for use in secondary structure prediction algorithms using the nearest-neighbor model. On average, internally pseudouridylated duplexes were 1.7 kcal/mol more stable than their U-A counterparts, and terminally pseudouridylated duplexes were 1.0 kcal/mol more stable than their U-A equivalents. Due to the fact that Ψ-A pairs maintain the same Watson-Crick hydrogen bonding capabilities as the parent U-A pair in A-form RNA, the difference in stability due to pseudouridylation was attributed to two possible sources: the novel hydrogen bonding capabilities of the newly relocated imino group as well as the novel stacking interactions afforded by the electronic configuration of the Ψ residue. The newly derived nearest-neighbor parameters for Ψ-A base pairs may be used in conjunction with other nearest-neighbor parameters for accurately predicting the most likely secondary structure of A-form RNA containing Ψ-A base pairs.

  15. Micromechanics of base pair unzipping in the DNA duplex.

    Science.gov (United States)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov'yov, Andrey V

    2012-01-25

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G·C content and rather distinct for the parts with A·T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork.

  16. Efficacy and tolerability of levodropropizine in adult patients with non-productive cough. Comparison with dextromethorphan.

    Science.gov (United States)

    Catena, E; Daffonchio, L

    1997-01-01

    The results of a double-blind, randomized clinical trial involving 209 adult patients of either sex with moderate non-productive cough are reported. The therapeutic efficacy and the tolerability of levodropropizine syrup (60 mg t.i.d. for 5 days) was evaluated in comparison with dextromethorphan syrup (15 mg t.i.d. for 5 days). Efficacy was assessed by the number of coughing spells in a 6h period, the cough frequency classes, the cough intensity and the night awakenings due to cough. Tolerability was evaluated by laboratory results, vital signs and any adverse event occurred during the clinical trial, including presence or absence of somnolence. Independently from the underlying pathology and from the degree of baseline cough severity, the number of coughing spells was significantly (P levodropropizine and dextromethorphan already after the 2nd day of treatment, the effect and its time of onset being similar for both drugs. Cough intensity was significantly (P levodropropizine than with dextromethorphan. Concurrently with the relief of cough, the number of night awakenings was decreased remarkably and significantly (P levodropropizine displaying an improvement significantly higher (P levodropropizine (3.6%) group. Overall, somnolence was reported for a low percentage of patients with both drugs, with the percentage of patients experiencing this side effect being one half in the group treated with levodropropizine (4.6%) as compared with dextromethorphan (10.4%). These results confirm the antitussive effectiveness of levodropropizine and point out a more favourable benefit/risk profile when compared to dextromethorphan.

  17. Flexibility of short DNA helices with finite-length effect: from base pairs to tens of base pairs

    CERN Document Server

    Wu, Yuan-Yan; Zhang, Xi; Tan, Zhi-Jie

    2015-01-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5 to 50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ~6 bps at each helix end. Correspondingly, the apparent persistence length lp of short DNAs increases gradually from ~29nm to ~45nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ~6 bps at each helix end have...

  18. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie, E-mail: zjtan@whu.edu.cn [Department of Physics and Key Laboratory of Artificial Micro and Nano-structures of Ministry of Education, School of Physics and Technology, Wuhan University, Wuhan 430072 (China)

    2015-03-28

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l{sub p} of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l{sub p} ∼ 50 nm.

  19. Calculation of the Stabilization Energies of Oxidatively Damaged Guanine Base Pairs with Guanine

    Directory of Open Access Journals (Sweden)

    Hiroshi Miyazawa

    2012-06-01

    Full Text Available DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H-oxazolone (Oz, guanidinohydantoin (Gh/iminoallantoin (Ia and spiro-imino-dihydantoin (Sp are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  20. Structure of the 2-Aminopurine-Cytosine Base Pair Formed in the Polymerase Active Site of the RB69 Y567A-DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Reha-Krantz, Linda J.; Hariharan, Chithra; Subuddhi, Usharani; Xia, Shuangluo; Zhao, Chao; Beckman, Jeff; Christian, Thomas; Konigsberg, William (Yale); (Alberta)

    2011-11-21

    The adenine base analogue 2-aminopurine (2AP) is a potent base substitution mutagen in prokaryotes because of its enhanceed ability to form a mutagenic base pair with an incoming dCTP. Despite more than 50 years of research, the structure of the 2AP-C base pair remains unclear. We report the structure of the 2AP-dCTP base pair formed within the polymerase active site of the RB69 Y567A-DNA polymerase. A modified wobble 2AP-C base pair was detected with one H-bond between N1 of 2AP and a proton from the C4 amino group of cytosine and an apparent bifurcated H-bond between a proton on the 2-amino group of 2-aminopurine and the ring N3 and O2 atoms of cytosine. Interestingly, a primer-terminal region rich in AT base pairs, compared to GC base pairs, facilitated dCTP binding opposite template 2AP. We propose that the increased flexibility of the nucleotide binding pocket formed in the Y567A-DNA polymerase and increased 'breathing' at the primer-terminal junction of A+T-rich DNA facilitate dCTP binding opposite template 2AP. Thus, interactions between DNA polymerase residues with a dynamic primer-terminal junction play a role in determining base selectivity within the polymerase active site of RB69 DNA polymerase.

  1. Design and development of three-dimensional DNA crystals utilizing CGAA parallel base paired motifs

    Science.gov (United States)

    Muser, Stephanie Elizabeth

    Three-dimensional (3D) DNA crystals hold great potential for various applications such as the development of molecular scaffolds for use in protein structure determination by x-ray crystallography. The programmability and predictability of DNA make it a powerful tool for self-assembly but it is hindered by the linearity of the duplex structure. Predictable noncanonical base pairs and motifs have the potential to connect linear double-helical DNA segments into complex 3D structures. The sequence d(GCGAAAGCT) has been observed to form 3D crystals containing both noncanonical parallel pairs and canonical Watson-Crick pairs. This provided a template structure that we used in expanding the design and development of 3D DNA crystals along with exploring the use of predictable noncanonical motifs. The structures we determined contained all but one or two of the designed secondary structure interactions, depending on pH.

  2. DNA duplex stability of the thio-iso-guanine•methyl-iso-Cytosine base pair.

    Science.gov (United States)

    Lee, Dongkye; Switzer, Christopher

    2015-01-01

    We report the synthesis, incorporation into oligonucleotides, and base-pairing properties of the 2-thio-variant of iso-guanine. Iso-guanine is the purine component of a nonstandard base pair with 5-methyl-iso-cytosine. The 2-thio-iso-guanine • 5-methyl-iso-cytosine base pair is found to have similar stability to an adenine • thymine pair.

  3. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    OpenAIRE

    Hisae Tateishi-Karimata; Miki Nakano; Naoki Sugimoto

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stabi...

  4. Energy basis of recognition of base pair for platinum-based antitumour drug ZD0473 and cisplatin

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Platinum-based antitumour drug ZD0473 was designed to reduce the cisplatin resistance to the tumor cells. In this paper, the mixed method of molecular mechanics and quantum chemistry, HF/lanl2dz// MM/uff and B3LYP/lanl2dz//6-31G*, are used to investigate the differences between four types of GG, 3′AG5′, 3′GA5′, and AA complexes, which are formed from four discrete DNA fragments recognized by ZD0473 and cisplatin. The results show that the binding interaction of both ZD0473 and cisplatin drugs with the GG base pair is much stronger than with other base pairs, namely the recognition capability of such drugs to the GG base pair is more considerable. Moreover, the interaction of four complexes of ZD0473 with DNA fragments is stronger than that of cisplatin with corresponding DNA fragments, which indicates the stronger binding capability of ZD0473 with DNA fragments and high antitumour activity of ZD0473. The main reason for easier forming of 3′GA5′ complex than the 3′AG5′ one is that the drug molecule prefers to bind with a single G base to form a monoligand compound firstly; then the con- figuration transformation from such monoligand compound to the bi-ligand one is limited.

  5. Enersy basis of recognition of base pair for platinum-based antitumour drug ZD0473 and cisplatin

    Institute of Scientific and Technical Information of China (English)

    HAO Lan; LI XiChen; TAN HongWei; CHEN GuangJu; JIA MuXin

    2008-01-01

    Platinum-based antitumour drug ZD0473 was designed to reduce the cisplatin resistance to the tumor cells. In this paper, the mixed method of molecular mechanics and quantum chemistry, HF/lan12dz//MM/uff and B3LYP/lan12dz//6-31G*, are used to investigate the differences between four types of GG, 3'AG5', 3'GA5', and AA complexes, which are formed from four discrete DNA fragments recognized by ZD0473 and cisplatin. The results show that the binding interaction of both ZD0473 and cisplatin drugs with the GG base pair is much stronger than with other base pairs, namely the recognition capability of such drugs to the GG base pair is more considerable. Moreover, the interaction of four complexes of ZD0473 with DNA fragments is stronger than that of cisplatin with corresponding DNA fragments, which indicates the stronger binding capability of ZD0473 with DNA fragments and high antitumour activity of ZD0473. The main reason for easier forming of 3'GA5' complex than the 3'AG5' one is that the drug molecule prefers to bind with a single G base to form a monoligand compound firstly; then the con-figuration transformation from such monoligand compound to the bi-ligand one is limited.

  6. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  7. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn;

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  8. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  9. Mismatched base-pair simulations for ASFV Pol X/DNA complexes help interpret frequent G*G misincorporation.

    Science.gov (United States)

    Sampoli Benítez, Benedetta A; Arora, Karunesh; Balistreri, Lisa; Schlick, Tamar

    2008-12-31

    DNA polymerase X (pol X) from the African swine fever virus is a 174-amino-acid repair polymerase that likely participates in a viral base excision repair mechanism, characterized by low fidelity. Surprisingly, pol X's insertion rate of the G*G mispair is comparable to that of the four Watson-Crick base pairs. This behavior is in contrast with another X-family polymerase, DNA polymerase beta (pol beta), which inserts G*G mismatches poorly, and has higher DNA repair fidelity. Using molecular dynamics simulations, we previously provided support for an induced-fit mechanism for pol X in the presence of the correct incoming nucleotide. Here, we perform molecular dynamics simulations of pol X/DNA complexes with different incoming incorrect nucleotides in various orientations [C*C, A*G, and G*G (anti) and A*G and G*G (syn)] and compare the results to available kinetic data and prior modeling. Intriguingly, the simulations reveal that the G*G mispair with the incoming nucleotide in the syn configuration undergoes large-scale conformational changes similar to that observed in the presence of correct base pair (G*C). The base pairing in the G*G mispair is achieved via Hoogsteen hydrogen bonding with an overall geometry that is well poised for catalysis. Simulations for other mismatched base pairs show that an intermediate closed state is achieved for the A*G and G*G mispair with the incoming dGTP in anti conformation, while the protein remains near the open conformation for the C*C and the A*G syn mismatches. In addition, catalytic site geometry and base pairing at the nascent template-incoming nucleotide interaction reveal distortions and misalignments that range from moderate for A*G anti to worst for the C*C complex. These results agree well with kinetic data for pol X and provide a structural/dynamic basis to explain, at atomic level, the fidelity of this polymerase compared with other members of the X family. In particular, the more open and pliant active site of pol X

  10. N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

    Science.gov (United States)

    Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

    2013-01-01

    We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

  11. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  12. Self-organised criticality in base-pair breathing in DNA with a defect

    CERN Document Server

    Duduiala, Ciprian-Ionut; Laughton, Charles A

    2011-01-01

    We analyse base-pair breathing in a DNA sequence of 12 base-pairs with a defective base at its centre. We use both all-atom molecular dynamics (MD) simulations and a system of stochastic differential equations (SDE). In both cases, Fourier analysis of the trajectories reveals self-organised critical behaviour in the breathing of base-pairs. The Fourier Transforms (FT) of the interbase distances show power-law behaviour with gradients close to -1. The scale-invariant behaviour we have found provides evidence for the view that base-pair breathing corresponds to the nucleation stage of large-scale DNA opening (or 'melting') and that this process is a (second-order) phase transition. Although the random forces in our SDE system were introduced as white noise, FTs of the displacements exhibit pink noise, as do the displacements in the AMBER/MD simulations.

  13. Development of the ABEEMσπ Polarization Force Field for Base Pairs with Amino Acid Residue Complexes.

    Science.gov (United States)

    Liu, Cui; Li, Yue; Han, Bing-Yu; Gong, Li-Dong; Lu, Li-Nan; Yang, Zhong-Zhi; Zhao, Dong-Xia

    2017-05-09

    DNA damage caused by oxidized bases can lead to aging and cancer in living beings. Luckily, a repair enzyme is able to repair the oxidized bases. The key step is to accurately recognize the oxidized bases, which mainly rely on complex hydrogen bond interactions. We have calibrated the charge parameters and torsional parameters of the ABEEMσπ polarization force field (ABEEMσπ PFF) to accurately describe the intermolecular and intramolecular interactions. Taking the experiment and quantum chemical method as the benchmark, a series of properties of base pair-amino acid residue systems, DNA and DNA-protein interaction systems were calculated and compared with those of other force fields. We have done a tremendous amount of tasks in testing, calibrations, and analyses. The ABEEMσπ PFF not only explicitly gives the position and the partial charge of lone-pair electrons but also introduces a function kHB to fit special electrostatic interactions in hydrogen bond interaction regions. Therefore, it can accurately simulate the polarization effect and charge transfer of hydrogen bond interactions, especially for charged systems and sulfur-containing systems, such as the binding energy between amino acid and base pairs (24-28 kcal/mol), which is induced by charge transfer. The RMSD of ABEEMσπ PFF is 1.18 kcal/mol, whereas the RMSD of Amber OL15 is 8.21 kcal/mol. The relative positions of the amino acid residue have significantly changed, and the hydrogen bonds were broken when simulated by fixed charge force fields. In addition, owing to refitting the reasonable torsional parameters, the geometric structures optimized by ABEEMσπ PFF were well consistent with those of the M06-2X/6-311++G** method, but the simulations by fixed force fields have a large rotation of methyl and distortion of the plane of the base pair. After extensive MD simulation with four test DNAs and a DNA-protein system, we conclude that ABEEMσπ PFF shows better agreement when compared to

  14. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  15. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-07-31

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. The consequences of base pair composition biases for regulatory network organization in prokaryotes.

    Science.gov (United States)

    Cordero, Otto X; Hogeweg, Paulien

    2009-10-01

    Given the dramatic variation in guanine-cytosine (GC) content observed in prokaryotes, from approximately 20% to approximately 75% GC, one wonders if these extreme biases in base pair composition affect the evolution of transcription factor-binding sites (BS). This letter shows that, along the wide range of GC content variation in bacteria, bacterial BS keep a high frequency of AT bases, roughly independently of the background (BG) base pair composition of intergenic regions. As a result, the equilibrium base pair frequencies of BS depart the most from those of BS DNA in GC-rich genomes. This not only implies a higher specificity but also a higher coding barrier for BS in GC-rich genomes. In accordance, we observe that the average percentage of divergently transcribed regions increases with the GC content of the genome, suggesting the use of a more efficient coding strategy.

  17. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  18. Does base-pairing strength play a role in microRNA repression?

    OpenAIRE

    2012-01-01

    In this paper, the authors explore the possibility that the base-pairing strength of miRNA–mRNA target plays a role in microRNA-mediated gene regulation. The authors found a significant correlation between the physiological temperature of the organism and the average G/C content of its miRNAs. This study suggests that an organism adapts its miRNA–target free energy according to its physiological temperature, thus highlighting the importance of base-pairing strength in miRNA activity.

  19. Understanding the role of base stacking in nucleic acids. MD and QM analysis of tandem GA base pairs in RNA duplexes.

    Science.gov (United States)

    Morgado, Claudio A; Svozil, Daniel; Turner, Douglas H; Šponer, Jiří

    2012-09-28

    Preceding NMR experiments show that the conformation of tandem GA base pairs, an important recurrent non-canonical building block in RNA duplexes, is context dependent. The GA base pairs adopt "sheared" N3(G)-N6(A), N2(G)-N7(A) geometry in the r(CGAG)(2) and r(iGGAiC)(2) contexts while switching to "imino" N1(G)-N1(A), O6(G)-N6(A) geometry in the r(GGAC)(2) and r(iCGAiG)(2) contexts (iC and iG stand for isocytosine and isoguanine, respectively). As base stacking is likely to be one of the key sources of the context dependence of the conformation of GA base pairs, we calculated base stacking energies in duplexes containing such base pairs, to see if this dependence can be predicted by stacking energy calculations. When investigating the context dependence of the GA geometry two different conformations of the same duplex were compared (imino vs. sheared). The geometries were generated via explicit solvent MD simulations of the respective RNA duplexes, while the subsequent QM energy calculations focused on base stacking interactions of the four internal base pairs. Geometrical relaxation of nucleobase atoms prior to the stacking energy computations has a non-negligible effect on the results. The stacking energies were derived at the DFT-D/6-311++G(3df,3pd) level. We show a rather good correspondence between the intrinsic gas-phase stacking energies and the NMR-determined GA geometries. The conformation with more favorable gas-phase stacking is in most cases the one observed in experiments. This correlation is not improved when including solvent effects via the COSMO method. On the other side, the stacking calculations do not predict the relative thermodynamic stability of duplex formation for different sequences.

  20. DNA Electronic Circular Dichroism on the Inter-Base Pair Scale: An Experimental-Theoretical Case Study of the AT Homo-Oligonucleotide.

    Science.gov (United States)

    Di Meo, Florent; Pedersen, Morten N; Rubio-Magnieto, Jenifer; Surin, Mathieu; Linares, Mathieu; Norman, Patrick

    2015-02-05

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment.

  1. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Shukla, P.K. [Department of Physics, Assam University, Silchar 788 011 (India); Ganapathy, Vinay [Department of Physics, Banaras Hindu University, Varanasi 221 005 (India); Mishra, P.C., E-mail: pcmishra_in@yahoo.com [Department of Physics, Banaras Hindu University, Varanasi 221 005 (India)

    2011-09-22

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: {yields} Methylation of the DNA bases is important as it can cause mutation and cancer. {yields} Methylation reactions of the GC and AT base pairs with CH{sub 3}N{sub 2}{sup +} were not studied earlier theoretically. {yields} Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  2. Facile syntheses of dissymmetric ferrocene-functionalized Lewis acids and acid-base pairs.

    Science.gov (United States)

    Morgan, Ian R; Di Paolo, Angela; Vidovic, Dragoslav; Fallis, Ian A; Aldridge, Simon

    2009-12-21

    A facile synthetic approach is reported for the synthesis of dissymmetric 1,2-ferrocenediyl Lewis acids and mixed acid-base pairs including the first example of a 1-phosphino-2-borylferrocene; the use of non-racemic electrophiles allows for the isolation of single diastereomer products.

  3. Molecular Design of Ionization-Induced Proton Switching Element Based on Fluorinated DNA Base Pair.

    Science.gov (United States)

    Tachikawa, Hiroto; Kawabata, Hiroshi

    2016-03-10

    To design theoretically the high-performance proton switching element based on DNA base pair, the effects of fluorine substitution on the rate of proton transfer (PT) in the DNA model base pair have been investigated by means of direct ab initio molecular dynamics (AIMD) method. The 2-aminopyridine dimer, (AP)2, was used as the model of the DNA base pair. One of the hydrogen atoms of the AP molecule in the dimer was substituted by a fluorine (F) atom, and the structures of the dimer, expressed by F-(AP)2, were fully optimized at the MP2/6-311++G(d,p) level. The direct AIMD calculations showed that the proton is transferred within the base pair after the vertical ionization. The rates of PT in F-(AP)2(+) were calculated and compared with that of (AP)2(+) without an F atom. It was found that PT rate is accelerated by the F-substitution. Also, the direction of PT between F-AP and AP molecules can be clearly controlled by the position of F-substitution (AP)2 in the dimer.

  4. Single-molecule derivation of salt dependent base-pair free energies in DNA

    CERN Document Server

    Huguet, J M; Forns, N; Smith, S B; Bustamante, C; Ritort, F; 10.1073/pnas.1001454107

    2010-01-01

    Accurate knowledge of the thermodynamic properties of nucleic acids is crucial to predicting their structure and stability. To date most measurements of base-pair free energies in DNA are obtained in thermal denaturation experiments, which depend on several assumptions. Here we report measurements of the DNA base-pair free energies based on a simplified system, the mechanical unzipping of single DNA molecules. By combining experimental data with a physical model and an optimization algorithm for analysis, we measure the 10 unique nearest-neighbor base-pair free energies with 0.1 kcal mol-1 precision over two orders of magnitude of monovalent salt concentration. We find an improved set of standard energy values compared with Unified Oligonucleotide energies and a unique set of 10 base-pair-specific salt-correction values. The latter are found to be strongest for AA/TT and weakest for CC/GG. Our new energy values and salt corrections improve predictions of DNA unzipping forces and are fully compatible with melt...

  5. Genome filtering using methylation-sensitive restriction enzymes with six-base pair recognition sites

    Science.gov (United States)

    The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl sensitive restriction enzymes with six base pair recognition sites...

  6. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...

  7. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NARCIS (Netherlands)

    Urakawa, H.; Fantroussi, El S.; Smidt, H.; Smoot, J.C.; Tribou, E.H.; Kelly, J.J.; Noble, P.A.; Stahl, D.A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of

  8. Base Pairing between Hepatitis C Virus RNA and MicroRNA 122 3′ of Its Seed Sequence Is Essential for Genome Stabilization and Production of Infectious Virus

    Science.gov (United States)

    Shimakami, Tetsuro; Yamane, Daisuke; Welsch, Christoph; Hensley, Lucinda; Jangra, Rohit K.

    2012-01-01

    MicroRNA 122 (miR-122) facilitates hepatitis C virus (HCV) replication by recruiting an RNA-induced silencing complex (RISC)-like complex containing argonaute 2 (Ago2) to the 5′ end of the HCV genome, thereby stabilizing the viral RNA. This requires base pairing between the miR-122 “seed sequence” (nucleotides [nt] 2 to 8) and two sequences near the 5′ end of the HCV RNA: S1 (nt 22 to 28) and S2 (nt 38 to 43). However, recent reports suggest that additional base pair interactions occur between HCV RNA and miR-122. We searched 606 sequences from a public database (genotypes 1 to 6) and identified two conserved, putatively single-stranded RNA segments, upstream of S1 (nt 2 and 3) and S2 (nt 30 to 34), with potential for base pairing to miR-122 (nt 15 and 16 and nt 13 to 16, respectively). Mutagenesis and genetic complementation experiments confirmed that HCV nt 2 and 3 pair with nt 15 and 16 of miR-122 bound to S1, while HCV nt 30 to 33 pair with nt 13 to 16 of miR-122 at S2. In genotype 1 and 6 HCV, nt 4 also base pairs with nt 14 of miR-122. These 3′ supplementary base pair interactions of miR-122 are functionally important and are required for Ago2 recruitment to HCV RNA by miR-122, miR-122-mediated stabilization of HCV RNA, and production of infectious virus. However, while complementary mutations at HCV nt 30 and 31 efficiently rescued the activity of a 15C,16C miR-122 mutant targeting S2, similar mutations at nt 2 and 3 failed to rescue Ago2 recruitment at S1. These data add to the current understanding of miR-122 interactions with HCV RNA but indicate that base pairing between miR-122 and the 5′ 43 nt of the HCV genome is more complex than suggested by existing models. PMID:22532678

  9. DNA methylation analysis of chromosome 21 gene promoters at single base pair and single allele resolution.

    Directory of Open Access Journals (Sweden)

    Yingying Zhang

    2009-03-01

    Full Text Available Differential DNA methylation is an essential epigenetic signal for gene regulation, development, and disease processes. We mapped DNA methylation patterns of 190 gene promoter regions on chromosome 21 using bisulfite conversion and subclone sequencing in five human cell types. A total of 28,626 subclones were sequenced at high accuracy using (long-read Sanger sequencing resulting in the measurement of the DNA methylation state of 580427 CpG sites. Our results show that average DNA methylation levels are distributed bimodally with enrichment of highly methylated and unmethylated sequences, both for amplicons and individual subclones, which represent single alleles from individual cells. Within CpG-rich sequences, DNA methylation was found to be anti-correlated with CpG dinucleotide density and GC content, and methylated CpGs are more likely to be flanked by AT-rich sequences. We observed over-representation of CpG sites in distances of 9, 18, and 27 bps in highly methylated amplicons. However, DNA sequence alone is not sufficient to predict an amplicon's DNA methylation status, since 43% of all amplicons are differentially methylated between the cell types studied here. DNA methylation in promoter regions is strongly correlated with the absence of gene expression and low levels of activating epigenetic marks like H3K4 methylation and H3K9 and K14 acetylation. Utilizing the single base pair and single allele resolution of our data, we found that i amplicons from different parts of a CpG island frequently differ in their DNA methylation level, ii methylation levels of individual cells in one tissue are very similar, and iii methylation patterns follow a relaxed site-specific distribution. Furthermore, iv we identified three cases of allele-specific DNA methylation on chromosome 21. Our data shed new light on the nature of methylation patterns in human cells, the sequence dependence of DNA methylation, and its function as epigenetic signal in gene

  10. Structure of p53 binding to the BAX response element reveals DNA unwinding and compression to accommodate base-pair insertion

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Y.; Zhang, X.; Dantas Machado, A. C.; Ding, Y.; Chen, Z.; Qin, P. Z.; Rohs, R.; Chen, L.

    2013-07-08

    The p53 core domain binds to response elements (REs) that contain two continuous half-sites as a cooperative tetramer, but how p53 recognizes discontinuous REs is not well understood. Here we describe the crystal structure of the p53 core domain bound to a naturally occurring RE located at the promoter of the Bcl-2-associated X protein (BAX) gene, which contains a one base-pair insertion between the two half-sites. Surprisingly, p53 forms a tetramer on the BAX-RE that is nearly identical to what has been reported on other REs with a 0-bp spacer. Each p53 dimer of the tetramer binds in register to a half-site and maintains the same protein–DNA interactions as previously observed, and the two dimers retain all the protein–protein contacts without undergoing rotation or translation. To accommodate the additional base pair, the DNA is deformed and partially disordered around the spacer region, resulting in an apparent unwinding and compression, such that the interactions between the dimers are maintained. Furthermore, DNA deformation within the p53-bound BAX-RE is confirmed in solution by site-directed spin labeling measurements. Our results provide a structural insight into the mechanism by which p53 binds to discontinuous sites with one base-pair spacer.

  11. Solution NMR determination of hydrogen bonding and base pairing between the glyQS T box riboswitch Specifier domain and the anticodon loop of tRNA(Gly).

    Science.gov (United States)

    Chang, Andrew T; Nikonowicz, Edward P

    2013-11-01

    In Gram-positive bacteria the tRNA-dependent T box riboswitch regulates the expression of many amino acid biosynthetic and aminoacyl-tRNA synthetase genes through a transcription attenuation mechanism. The Specifier domain of the T box riboswitch contains the Specifier sequence that is complementary to the tRNA anticodon and is flanked by a highly conserved purine nucleotide that could result in a fourth base pair involving the invariant U33 of tRNA. We show that the interaction between the T box Specifier domain and tRNA consists of three Watson-Crick base pairs and that U33 confers stability to the complex through intramolecular hydrogen bonding. Enhanced packing within the Specifier domain loop E motif may stabilize the complex and contribute to cognate tRNA selection.

  12. Polypyrimidine tract binding protein inhibits IgM pre-mRNA splicing by diverting U2 snRNA base-pairing away from the branch point.

    Science.gov (United States)

    Zheng, Xuexiu; Cho, Sunghee; Moon, Heegyum; Loh, Tiing Jen; Oh, Huyn Kyung; Green, Michael R; Shen, Haihong

    2014-04-01

    The mouse immunoglobulin (IgM) pre-mRNA contains a splicing inhibitor that bears multiple binding sites for the splicing repressor polypyrimidine tract binding protein (PTB). Here we show that the inhibitor directs assembly of an ATP-dependent complex that contains PTB and U1 and U2 small nuclear RNAs (snRNAs). Unexpectedly, although U2 snRNA is present in the inhibitor complex, it is not base-paired to the branch point. We present evidence that inhibitor-bound PTB contacts U2 snRNA to promote base-pairing to an adjacent branch point-like sequence within the inhibitor, thereby preventing the U2 snRNA-branch point interaction and resulting in splicing repression. Our studies reveal a novel mechanism by which PTB represses splicing.

  13. SIMULATION AS AN APPROPRIATE WAY OF VERIFYING THE EFFICIENCY OF PRODUCTION VARIANTS IN THE DESIGN OF PRODUCTION AND NON-PRODUCTION SYSTEMS

    Directory of Open Access Journals (Sweden)

    Marek Kliment

    2014-12-01

    Full Text Available The paper deals with simulation and her forms of use in designing of production and non-production systems. Points to the possibility of using software can help in planning and subsequently in other phase of the lifecycle production and products. Article informs about some of the advantages of this type of software and his options. Sets out some theoretical knowledge of simulation and in the practical part presents some frequently used simulation software.

  14. Spontaneous formation and base pairing of plausible prebiotic nucleotides in water.

    Science.gov (United States)

    Cafferty, Brian J; Fialho, David M; Khanam, Jaheda; Krishnamurthy, Ramanarayanan; Hud, Nicholas V

    2016-04-25

    The RNA World hypothesis presupposes that abiotic reactions originally produced nucleotides, the monomers of RNA and universal constituents of metabolism. However, compatible prebiotic reactions for the synthesis of complementary (that is, base pairing) nucleotides and mechanisms for their mutual selection within a complex chemical environment have not been reported. Here we show that two plausible prebiotic heterocycles, melamine and barbituric acid, form glycosidic linkages with ribose and ribose-5-phosphate in water to produce nucleosides and nucleotides in good yields. Even without purification, these nucleotides base pair in aqueous solution to create linear supramolecular assemblies containing thousands of ordered nucleotides. Nucleotide anomerization and supramolecular assemblies favour the biologically relevant β-anomer form of these ribonucleotides, revealing abiotic mechanisms by which nucleotide structure and configuration could have been originally favoured. These findings indicate that nucleotide formation and selection may have been robust processes on the prebiotic Earth, if other nucleobases preceded those of extant life.

  15. Atomistic understanding of the C·T mismatched DNA base pair tautomerization via the DPT: QM and QTAIM computational approaches.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2013-11-15

    It was established that the cytosine·thymine (C·T) mismatched DNA base pair with cis-oriented N1H glycosidic bonds has propeller-like structure (|N3C4C4N3| = 38.4°), which is stabilized by three specific intermolecular interactions-two antiparallel N4H…O4 (5.19 kcal mol(-1)) and N3H…N3 (6.33 kcal mol(-1)) H-bonds and a van der Waals (vdW) contact O2…O2 (0.32 kcal mol(-1)). The C·T base mispair is thermodynamically stable structure (ΔG(int) = -1.54 kcal mol(-1) ) and even slightly more stable than the A·T Watson-Crick DNA base pair (ΔG(int) = -1.43 kcal mol(-1)) at the room temperature. It was shown that the C·T ↔ C*·T* tautomerization via the double proton transfer (DPT) is assisted by the O2…O2 vdW contact along the entire range of the intrinsic reaction coordinate (IRC). The positive value of the Grunenberg's compliance constants (31.186, 30.265, and 22.166 Å/mdyn for the C·T, C*·T*, and TS(C·T ↔ C*·T*), respectively) proves that the O2…O2 vdW contact is a stabilizing interaction. Based on the sweeps of the H-bond energies, it was found that the N4H…O4/O4H…N4, and N3H…N3 H-bonds in the C·T and C*·T* base pairs are anticooperative and weaken each other, whereas the middle N3H…N3 H-bond and the O2…O2 vdW contact are cooperative and mutually reinforce each other. It was found that the tautomerization of the C·T base mispair through the DPT is concerted and asynchronous reaction that proceeds via the TS(C·T ↔ C*·T*) stabilized by the loosened N4-H-O4 covalent bridge, N3H…N3 H-bond (9.67 kcal mol(-1) ) and O2…O2 vdW contact (0.41 kcal mol(-1) ). The nine key points, describing the evolution of the C·T ↔ C*·T* tautomerization via the DPT, were detected and completely investigated along the IRC. The C*·T* mispair was revealed to be the dynamically unstable structure with a lifetime 2.13·× 10(-13) s. In this case, as for the A·T Watson-Crick DNA base pair, activates the mechanism of the quantum protection of the C

  16. Unnatural imidazopyridopyrimidine:naphthyridine base pairs: selective incorporation and extension reaction by Deep Vent (exo- ) DNA polymerase.

    Science.gov (United States)

    Ogata, Shintaro; Takahashi, Mayumi; Minakawa, Noriaki; Matsuda, Akira

    2009-09-01

    In our previous communication we reported the enzymatic recognition of unnatural imidazopyridopyrimidine:naphthyridine (Im:Na) base pairs, i.e. ImO(N):NaN(O) and ImN(O):NaO(N), using the Klenow fragment exo(-) [KF (exo(-))]. We describe herein the successful results of (i) improved enzymatic recognition for ImN(O):NaO(N) base pairs and (ii) further primer extension reactions after the Im:Na base pairs by Deep Vent DNA polymerase exo(-) [Deep Vent (exo(-))]. Since KF (exo(-)) did not catalyze primer extension reactions after the Im:Na base pair, we carried out a screening of DNA polymerases to promote the primer extension reaction as well as to improve the selectivity of base pair recognition. As a result, a family B DNA polymerase, especially Deep Vent (exo(-)), seemed most promising for this purpose. In the ImO(N):NaN(O) base pair, incorporation of NaN(O)TP against ImO(N) in the template was preferable to that of the natural dNTPs, while incorporation of dATP as well as dGTP competed with that of ImO(N)TP when NaN(O) was placed in the template. Thus, the selectivity of base pair recognition by Deep Vent (exo(-)) was less than that by KF (exo(-)) in the case of the ImO(N):NaN(O) base pair. On the other hand, incorporation of NaO(N)TP against ImN(O) in the template and that of ImN(O)TP against NaO(N) were both quite selective. Thus, the selectivity of base pair recognition was improved by Deep Vent (exo(-)) in the ImN(O):NaO(N) base pair. Moreover, this enzyme catalyzed further primer extension reactions after the ImN(O):NaO(N) base pair to afford a faithful replicate, which was confirmed by MALDI-TOF mass spectrometry as well as the kinetics data for extension fidelity next to the ImN(O):NaO(N) base pair. The results presented in this paper revealed that the ImN(O):NaO(N) base pair might be a third base pair beyond the Watson-Crick base pairs.

  17. A chemical approach to mapping nucleosomes at base pair resolution in yeast.

    Science.gov (United States)

    Brogaard, Kristin R; Xi, Liqun; Wang, Ji-Ping; Widom, Jonathan

    2012-01-01

    Most eukaryotic DNA exists in DNA-protein complexes known as nucleosomes. The exact locations of nucleosomes along the genome play a critical role in chromosome functions and gene regulation. However, the current methods for nucleosome mapping do not provide the necessary accuracy to identify the precise nucleosome locations. Here we describe a new experimental approach that directly maps nucleosome center locations in vivo genome-wide at single base pair resolution.

  18. Occupational exposure to chemical and biological agents in the nonproduction departments of pulp, paper, and paper product mills: an international study.

    Science.gov (United States)

    Teschke, K; Ahrens, W; Andersen, A; Boffetta, P; Fincham, S; Finkelstein, M; Henneberger, P; Kauppinen, T; Kogevinas, M; Korhonen, K; Liss, G; Liukkonnen, T; Osvoll, P; Savela, A; Szadkowska-Stanczyk, I; Westberg, H; Widerkiewicz, K

    1999-01-01

    As part of an international epidemiological study of workers in the pulp and paper industry, previously unpublished exposure measurements were assembled in a database. This article describes 7293 measurements in nonproduction departments from 147 mills in 11 countries. The greatest variety of agents was measured in the maintenance, construction, and cleaning department, where high exposures to asbestos, chromium [VI] compounds, copper, mercury in urine, nitrogen dioxide, ozone, styrene, sulfur dioxide, trichloroethylene, and welding fumes were observed. Measurements in the storage, yard, loading, and shipping department indicated high exposures to asbestos, carbon monoxide, fungal spores, nitrogen oxides, sulfur dioxide, and total dust. The steam and power generation department had high exposures to methyl mercaptan, silica, and total dust. Measurements in process and effluent water treatment, laboratory and research, engineering, and office, administration, and cafeteria areas had few elevated exposures. Throughout the nonproduction departments, measurements of pulp-production chemicals such as chlorine and sulfur compounds tended to be low, with many below detection limits. There were some problems with the available data; in particular, detection limits were often not specified, and the data tended to be clustered in such a way that sources of exposure variability could not be distinguished. Despite these problems, the data provide new insight into the exposures of nonproduction pulp and paper industry personnel.

  19. Comparative efficacy and tolerability of pholcodine and dextromethorphan in the management of patients with acute, non-productive cough : a randomized, double-blind, multicenter study.

    Science.gov (United States)

    Equinozzi, Roberto; Robuschi, Maria

    2006-01-01

    The aim of this study was to compare the efficacy and tolerability of pholcodine with that of dextromethorphan, one of the most used cough sedative products, in patients with acute, non-productive cough. 129 adults with a diagnosis of acute, frequent, non-productive cough participated in a randomized, double-blind, parallel-group, multicenter trial. Medications were in a syrup formulation and were taken orally three times daily for 3 days. The efficacy endpoints were the change from baseline in the daytime and night-time cough frequency on 5-point scales at day 3, and cough intensity. A reduction of 1.4 and 1.3 points in the mean daytime cough frequency at day 3 was seen in the pholcodine and dextromethorphan groups, respectively, in the per-protocol population. The reduction in mean night-time cough was 1.3 for both groups. Cough intensity reduction was 0.7 for pholcodine and 0.8 for dextromethorphan. These findings indicate that the efficacy of a 3-day course of pholcodine is similar to that of dextromethorphan in the treatment of adult patients with acute, non-productive cough. Both medications were well tolerated.

  20. Understanding the Nonproductive Enzyme Adsorption and Physicochemical Properties of Residual Lignins in Moso Bamboo Pretreated with Sulfuric Acid and Kraft Pulping.

    Science.gov (United States)

    Huang, Caoxing; He, Juan; Min, Douyong; Lai, Chenhuan; Yong, Qiang

    2016-12-01

    In this work, to elucidate why the acid-pretreated bamboo shows disappointingly low enzymatic digestibility comparing to the alkali-pretreated bamboo, residual lignins in acid-pretreated and kraft pulped bamboo were isolated and analyzed by adsorption isotherm to evaluate their extents of nonproductive enzyme adsorption. Meanwhile, physicochemical properties of the isolated lignins were analyzed and a relationship was established with non-productive adsorption. Results showed that the adsorption affinity and binding strength of cellulase on acid-pretreated bamboo lignin (MWLa) was significantly higher than that on residual lignin in pulped bamboo (MWLp). The maximum adsorption capacity of cellulase on MWLp was 129.49 mg/g lignin, which was lower than that on MWLa (160.25 mg/g lignin). When isolated lignins were added into the Avicel hydrolysis solution, the inhibitory effect on enzymatic hydrolysis efficiency of MWLa was found to be considerably stronger than that with MWLp. The cellulase adsorption on isolated lignins was correlated positively with hydrophobicity, phenolic hydroxyl group, and degree of condensation but negatively with surface charges and aliphatic hydroxyl group. These results suggest that the higher nonproductive cellulase adsorption and physicochemical properties of residual lignin in acid-pretreated bamboo may be responsible for its disappointingly low enzymatic digestibility.

  1. Theory of phase segregation in DNA assemblies containing two different base-pair sequence types

    Science.gov (United States)

    (O’ Lee, Dominic J.; Wynveen, Aaron; Kornyshev, Alexei A.

    2017-01-01

    Spontaneous pairing of homologous DNA sequences—a challenging subject in molecular biophysics, often referred to as ‘homology recognition’—has been observed in vitro for several DNA systems. One of these experiments involved liquid crystalline quasi-columnar phases formed by a mixture of two kinds of double stranded DNA oligomer. Both oligomer types were of the same length and identical stoichiometric base-pair composition, but the base-pairs followed a different order. Phase segregation of the two DNA types was observed in the experiments, with the formation of boundaries between domains rich in molecules of one type (order) of base pair sequence. We formulate here a modified ‘X–Y model’ for phase segregation in such assemblies, obtain approximate solutions of the model, compare analytical results to Monte Carlo simulations, and rationalise past experimental observations. This study, furthermore, reveals the factors that affect the degree of segregation. Such information could be used in planning new versions of similar segregation experiments, needed for deepening our understanding of forces that might be involved, e.g., in gene–gene recognition.

  2. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  3. DNA Aptamer Generation by Genetic Alphabet Expansion SELEX (ExSELEX) Using an Unnatural Base Pair System.

    Science.gov (United States)

    Kimoto, Michiko; Matsunaga, Ken-ichiro; Hirao, Ichiro

    2016-01-01

    Genetic alphabet expansion of DNA using unnatural base pair systems is expected to provide a wide variety of novel tools and methods. Recent rapid progress in this area has enabled the creation of several types of unnatural base pairs that function as a third base pair in polymerase reactions. Presently, a major topic is whether the genetic alphabet expansion system actually increases nucleic acid functionalities. We recently applied our unnatural base pair system to in vitro selection (SELEX), using a DNA library containing four natural bases and an unnatural base, and succeeded in the generation of high-affinity DNA aptamers that specifically bind to target proteins. Only a few hydrophobic unnatural bases greatly augmented the affinity of the aptamers. Here, we describe a new approach (genetic alphabet Expansion SELEX, ExSELEX), using our hydrophobic unnatural base pair system for high affinity DNA aptamer generation.

  4. A map of nucleosome positions in yeast at base-pair resolution.

    Science.gov (United States)

    Brogaard, Kristin; Xi, Liqun; Wang, Ji-Ping; Widom, Jonathan

    2012-06-28

    The exact positions of nucleosomes along genomic DNA can influence many aspects of chromosome function. However, existing methods for mapping nucleosomes do not provide the necessary single-base-pair accuracy to determine these positions. Here we develop and apply a new approach for direct mapping of nucleosome centres on the basis of chemical modification of engineered histones. The resulting map locates nucleosome positions genome-wide in unprecedented detail and accuracy. It shows new aspects of the in vivo nucleosome organization that are linked to transcription factor binding, RNA polymerase pausing and the higher-order structure of the chromatin fibre.

  5. Acid-Base Pairs in Lewis Acidic Zeolites Promote Direct Aldol Reactions by Soft Enolization.

    Science.gov (United States)

    Lewis, Jennifer D; Van de Vyver, Stijn; Román-Leshkov, Yuriy

    2015-08-17

    Hf-, Sn-, and Zr-Beta zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations

    Indian Academy of Sciences (India)

    Surjit B Dixit; Mihaly Mezei; David L Beveridge

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute–solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interactmore strongly with watermolecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning’s counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 Å from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general

  7. How Does Guanine-Cytosine Base Pair Affect Excess-Electron Transfer in DNA?

    Science.gov (United States)

    Lin, Shih-Hsun; Fujitsuka, Mamoru; Majima, Tetsuro

    2015-06-25

    Charge transfer and proton transfer in DNA have attracted wide attention due to their relevance in biological processes and so on. Especially, excess-electron transfer (EET) in DNA has strong relation to DNA repair. However, our understanding on EET in DNA still remains limited. Herein, by using a strongly electron-donating photosensitizer, trimer of 3,4-ethylenedioxythiophene (3E), and an electron acceptor, diphenylacetylene (DPA), two series of functionalized DNA oligomers were synthesized for investigation of EET dynamics in DNA. The transient absorption measurements during femtosecond laser flash photolysis showed that guanine:cytosine (G:C) base pair affects EET dynamics in DNA by two possible mechanisms: the excess-electron quenching by proton transfer with the complementary G after formation of C(•-) and the EET hindrance by inserting a G:C base pair as a potential barrier in consecutive thymines (T's). In the present paper, we provided useful information based on the direct kinetic measurements, which allowed us to discuss EET through oligonucleotides for the investigation of DNA damage/repair.

  8. A new unnatural base pair system between fluorophore and quencher base analogues for nucleic acid-based imaging technology.

    Science.gov (United States)

    Kimoto, Michiko; Mitsui, Tsuneo; Yamashige, Rie; Sato, Akira; Yokoyama, Shigeyuki; Hirao, Ichiro

    2010-11-03

    In the development of orthogonal extra base pairs for expanding the genetic alphabet, we created novel, unnatural base pairs between fluorophore and quencher nucleobase analogues. We found that the nucleobase analogue, 2-nitropyrrole (denoted by Pn), and its 4-substitutions, such as 2-nitro-4-propynylpyrrole (Px) and 4-[3-(6-aminohexanamido)-1-propynyl]-2-nitropyrrole (NH(2)-hx-Px), act as fluorescence quenchers. The Pn and Px bases specifically pair with their pairing partner, 7-(2,2'-bithien-5-yl)imidazo[4,5-b]pyridine (Dss), which is strongly fluorescent. Thus, these unnatural Dss-Pn and Dss-Px base pairs function as reporter-quencher base pairs, and are complementarily incorporated into DNA by polymerase reactions as a third base pair in combination with the natural A-T and G-C pairs. Due to the static contact quenching, the Pn and Px quencher bases significantly decreased the fluorescence intensity of Dss by the unnatural base pairings in DNA duplexes. In addition, the Dss-Px pair exhibited high efficiency and selectivity in PCR amplification. Thus, this new unnatural base pair system would be suitable for detection methods of target nucleic acid sequences, and here we demonstrated the applications of the Dss-Pn and Dss-Px pairs as molecular beacons and in real-time PCR. The genetic alphabet expansion system with the replicable, unnatural fluorophore-quencher base pair will be a useful tool for sensing and diagnostic applications, as well as an imaging tool for basic research.

  9. O⁶-carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine.

    Science.gov (United States)

    Zhang, Fang; Tsunoda, Masaru; Kikuchi, Yuji; Wilkinson, Oliver; Millington, Christopher L; Margison, Geoffrey P; Williams, David M; Takénaka, Akio

    2014-06-01

    N-Nitrosation of glycine and its derivatives generates potent alkylating agents that can lead to the formation of O(6)-carboxymethylguanine (O(6)-CMG) in DNA. O(6)-CMG has been identified in DNA derived from human colon tissue and its occurrence has been linked to diets high in red and processed meats, implying an association with the induction of colorectal cancer. By analogy to O(6)-methylguanine, O(6)-CMG is expected to be mutagenic, inducing G-to-A mutations that may be the molecular basis of increased cancer risk. Previously, the crystal structure of the DNA dodecamer d(CGCG[O(6)-CMG]ATTCGCG) has been reported, in which O(6)-CMG forms a Watson-Crick-type pair with thymine similar to the canonical A:T pair. In order to further investigate the versatility of O(6)-CMG in base-pair formation, the structure of the DNA dodecamer d(CGC[O(6)-CMG]AATTTGCG) containing O(6)-CMG at a different position has been determined by X-ray crystallography using four crystal forms obtained under conditions containing different solvent ions (Sr(2+), Ba(2+), Mg(2+), K(+) or Na(+)) with and without Hoechst 33258. The most striking finding is that the pairing modes of O(6)-CMG with T are quite different from those previously reported. In the present dodecamer, the T bases are displaced (wobbled) into the major groove to form a hydrogen bond between the thymine N(3) N-H and the carboxyl group of O(6)-CMG. In addition, a water molecule is bridged through two hydrogen bonds between the thymine O(2) atom and the 2-amino group of O(6)-CMG to stabilize the pairing. These interaction modes commonly occur in the four crystal forms, regardless of the differences in crystallization conditions. The previous and the present results show that O(6)-CMG can form a base pair with T in two alternative modes: the Watson-Crick type and a high-wobble type, the nature of which may depend on the DNA-sequence context.

  10. Can copper(II) mediate Hoogsteen base-pairing in a left-handed DNA duplex? A pulse EPR study.

    Science.gov (United States)

    Santangelo, Maria Grazia; Antoni, Philipp M; Spingler, Bernhard; Jeschke, Gunnar

    2010-02-22

    Pulse EPR spectroscopy is used to investigate possible structural features of the copper(II) ion coordinated to poly(dG-dC).poly(dG-dC) in a frozen aqueous solution, and the structural changes of the polynucleotide induced by the presence of the metal ion. Two different copper species were identified and their geometry explained by a molecular model. According to this model, one species is exclusively coordinated to a single guanine with the N7 nitrogen atom forming a coordinative bond with the copper. In the other species, a guanine and a cytosine form a ternary complex together with the copper ion. A copper crosslink between the N7 of guanine and N3 of cytosine is proposed as the most probable coordination site. Moreover, no evidence was found for an interaction of either copper species with a phosphate group or equatorial water molecules. In addition, circular dichroism (CD) spectroscopy showed that the DNA of the Cu(II)-poly(dG-dC).poly(dG-dC) adducts resembles the left-handed Z-form. These results suggest that metal-mediated Hoogsteen base pairing, as previously proposed for a right-handed DNA duplex, can also occur in a double-stranded left-handed DNA.

  11. Excited states of DNA base pairs using long-range corrected time-dependent density functional theory.

    Science.gov (United States)

    Jensen, Lasse; Govind, Niranjan

    2009-09-10

    In this work, we present a study of the excitation energies of adenine, cytosine, guanine, thymine, and the adenine-thymine (AT) and guanine-cytosine (GC) base pairs using long-range corrected (LC) density functional theory. We compare three recent LC functionals, BNL, CAM-B3LYP, and LC-PBE0, with B3LYP and coupled cluster results from the literature. We find that the best overall performance is for the BNL functional based on LDA. However, in order to achieve this good agreement, a smaller attenuation parameter is needed, which leads to nonoptimum performance for ground-state properties. B3LYP, on the other hand, severely underestimates the charge-transfer (CT) transitions in the base pairs. Surprisingly, we also find that the CAM-B3LYP functional also underestimates the CT excitation energy for the GC base pair but correctly describes the AT base pair. This illustrates the importance of retaining the full long-range exact exchange even at distances as short as that of the DNA base pairs. The worst overall performance is obtained with the LC-PBE0 functional, which overestimates the excitations for the individual bases as well as the base pairs. It is therefore crucial to strike a good balance between the amount of local and long-range exact exchange. Thus, this work highlights the difficulties in obtained LC functionals, which provides a good description of both ground- and excited-state properties.

  12. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  13. Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs

    CERN Document Server

    Fang, Wei; Rossi, Mariana; Feng, Yexin; Li, Xin-Zheng; Michaelides, Angelos

    2016-01-01

    Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general.

  14. Base-pairing versatility determines wobble sites in tRNA anticodons of vertebrate mitogenomes.

    Directory of Open Access Journals (Sweden)

    Miguel M Fonseca

    Full Text Available BACKGROUND: Vertebrate mitochondrial genomes typically have one transfer RNA (tRNA for each synonymous codon family. This limited anticodon repertoire implies that each tRNA anticodon needs to wobble (establish a non-Watson-Crick base pairing between two nucleotides in RNA molecules to recognize one or more synonymous codons. Different hypotheses have been proposed to explain the factors that determine the nucleotide composition of wobble sites in vertebrate mitochondrial tRNA anticodons. Until now, the two major postulates--the "codon-anticodon adaptation hypothesis" and the "wobble versatility hypothesis"--have not been formally tested in vertebrate mitochondria because both make the same predictions regarding the composition of anticodon wobble sites. The same is true for the more recent "wobble cost hypothesis". PRINCIPAL FINDINGS: In this study we have analyzed the occurrence of synonymous codons and tRNA anticodon wobble sites in 1553 complete vertebrate mitochondrial genomes, focusing on three fish species with mtDNA codon usage bias reversal (L-strand is GT-rich. These mitogenomes constitute an excellent opportunity to study the evolution of the wobble nucleotide composition of tRNA anticodons because due to the reversal the predictions for the anticodon wobble sites differ between the existing hypotheses. We observed that none of the wobble sites of tRNA anticodons in these unusual mitochondrial genomes coevolved to match the new overall codon usage bias, suggesting that nucleotides at the wobble sites of tRNA anticodons in vertebrate mitochondrial genomes are determined by wobble versatility. CONCLUSIONS/SIGNIFICANCE: Our results suggest that, at wobble sites of tRNA anticodons in vertebrate mitogenomes, selection favors the most versatile nucleotide in terms of wobble base-pairing stability and that wobble site composition is not influenced by codon usage. These results are in agreement with the "wobble versatility hypothesis".

  15. Hydrogen-bonded proton transfer in the protonated guanine-cytosine (GC+H)+ base pair.

    Science.gov (United States)

    Lin, Yuexia; Wang, Hongyan; Gao, Simin; Schaefer, Henry F

    2011-10-13

    The single proton transfer at the different sites of the Watson-Crick (WC) guanine-cytosine (GC) DNA base pair are studied here using density functional methods. The conventional protonated structures, transition state (TS) and proton-transferred product (PT) structures of every relevant species are optimized. Each transition state and proton-transferred product structure has been compared with the corresponding conventional protonated structure to demonstrate the process of proton transfer and the change of geometrical structures. The relative energies of the protonated tautomers and the proton-transfer energy profiles in gas and solvent are analyzed. The proton-transferred product structure G(+H(+))-H(+)C(N3)(-H(+))(PT) has the lowest relative energy for which only two hydrogen bonds exist. Almost all 14 isomers of the protonated GC base pair involve hydrogen-bonded proton transfer following the three pathways, with the exception of structure G-H(+)C(O2). When the positive charge is primarily "located" on the guanine moiety (H(+)G-C, G-H(+)C(C4), and G-H(+)C(C6)), the H(1) proton transfers from the N(1) site of guanine to the N(3) site of cytosine. The structures G-H(+)C(C5) and G-H(+)C(C4) involve H(4a) proton transfer from the N(4) of cytosine to the O(6) site of guanine. H(2a) proton transfer from the N(2) site of guanine to the O(2) site of cytosine is found only for the structure G-H(+)C(C4). The structures to which a proton is added on the six-centered sites adjoining the hydrogen bonds are more prone to proton transfer in the gas phase, whereas a proton added on the minor groove and the sites adjoining the hydrogen bonds is favorable to the proton transfer in energy in the aqueous phase.

  16. Kinetic selection vs. free energy of DNA base pairing in control of polymerase fidelity.

    Science.gov (United States)

    Oertell, Keriann; Harcourt, Emily M; Mohsen, Michael G; Petruska, John; Kool, Eric T; Goodman, Myron F

    2016-04-19

    What is the free energy source enabling high-fidelity DNA polymerases (pols) to favor incorporation of correct over incorrect base pairs by 10(3)- to 10(4)-fold, corresponding to free energy differences of ΔΔGinc∼ 5.5-7 kcal/mol? Standard ΔΔG° values (∼0.3 kcal/mol) calculated from melting temperature measurements comparing matched vs. mismatched base pairs at duplex DNA termini are far too low to explain pol accuracy. Earlier analyses suggested that pol active-site steric constraints can amplify DNA free energy differences at the transition state (kinetic selection). A recent paper [Olson et al. (2013)J Am Chem Soc135:1205-1208] used Vent pol to catalyze incorporations in the presence of inorganic pyrophosphate intended to equilibrate forward (polymerization) and backward (pyrophosphorolysis) reactions. A steady-state leveling off of incorporation profiles at long reaction times was interpreted as reaching equilibrium between polymerization and pyrophosphorolysis, yielding apparent ΔG° = -RTlnKeq, indicating ΔΔG° of 3.5-7 kcal/mol, sufficient to account for pol accuracy without need of kinetic selection. Here we perform experiments to measure and account for pyrophosphorolysis explicitly. We show that forward and reverse reactions attain steady states far from equilibrium for wrong incorporations such as G opposite T. Therefore,[Formula: see text]values obtained from such steady-state evaluations ofKeqare not dependent on DNA properties alone, but depend largely on constraints imposed on right and wrong substrates in the polymerase active site.

  17. Structure of Stacked Dimers of N-Methylated Watson–Crick Adenine–Thymine Base Pairs

    Directory of Open Access Journals (Sweden)

    Sándor Suhai

    2003-09-01

    Full Text Available Abstract: The structure of two isomeric stacked dimers of Watson-Crick 9-methyladenine-1-methylthymine pairs was fully optimized using an approximate density functional theory (DFT method augmented with an empirical dispersion interaction. The results of the calculations reveal that head-to-tail (AT-TA and head-to-head (AT-AT dimers possess a significantly different geometry. The structure of both complexes is stabilized by vertical CH…O and C-H…N hydrogen bonds with the participation of the hydrogen atoms of the methyl groups. The energy of hydrogen bonding and stacking interactions was additionally calculated using the MP2/6-31G*(0.25 method. Differences in the mutual arrangement of the base pairs in two isomeric dimers lead to significant changes of intra and interstrand stacking interaction energies.

  18. Co-Administration of an Excipient Oligonucleotide Helps Delineate Pathways of Productive and Nonproductive Uptake of Phosphorothioate Antisense Oligonucleotides in the Liver.

    Science.gov (United States)

    Donner, Aaron J; Wancewicz, Edward V; Murray, Heather M; Greenlee, Sarah; Post, Noah; Bell, Melanie; Lima, Walt F; Swayze, Eric E; Seth, Punit P

    2017-08-01

    Phosphorothioate (PS) modified antisense oligonucleotides (ASOs) have progressed rapidly in the clinic for treating a variety of disease indications. We previously demonstrated that the activity of PS ASOs in the liver can be enhanced by co-infusion of an excipient oligonucleotide (EON). It was posited that the EON saturates a nonproductive uptake pathway(s) thereby permitting accumulation of the PS ASO in a productive tissue compartment. In this report, we measured PS ASO activity following administration by bolus, infusion or co-fusion with EON within hepatocytes and nonparenchymal cells (NPCs), of the liver. This revealed that while ASOs accumulate preferentially in NPCs, they are intrinsically more active in hepatocytes. Furthermore, we show that the EON enhances ASO potency when infused up to 72 h before or after administration of the active ASO suggesting that the EON can saturate and displace the ASO from nonproductive to productive compartments. Physical presence of the EON in tissues was required for optimal potentiation suggesting that there is a dynamic distribution of the ASO and EON between the compartments. Lastly, using a candidate approach, we confirmed Stabilin-2 as a molecular pathway for ASO uptake in sinusoidal endothelial cells and the ASGR as a pathway for ASO uptake into hepatocytes in the liver.

  19. Calculating Distortions of Short DNA Duplexes with Base Pairing Between an Oxidatively Damaged Guanine and a Guanine

    Directory of Open Access Journals (Sweden)

    Masayo Suzuki

    2014-07-01

    Full Text Available DNA is constantly being oxidized, and oxidized DNA is prone to mutation; moreover, guanine is highly sensitive to several oxidative stressors. Several oxidatively damaged forms of guanine—including 2,2,4-triamino-5(2H-oxazolone (Oz, iminoallantoin (Ia, and spiroiminodihydantoin (Sp—can be paired with guanine, and cause G:C-C:G transversions. Previous findings indicate that guanine is incorporated more efficiently opposite Oz than opposite Ia or Sp, and that these differences in efficiency cannot be explained by differences in the stabilities of G:Oz, G:Ia, and G:Sp base pairs calculated ab initio. Here, to explain previous experimental result, we used a 3-base-pair model DNA duplex to calculate the difference in the stability and the distortion of DNA containing a G:Oz, G:Ia, or G:Sp base pair. We found that the stability of the structure containing 5ꞌ and 3ꞌ base pairs adjacent to G:Oz was more stable than that containing the respective base pairs adjacent to G:Ia or G:Sp. Moreover, the distortion of the structure in the DNA model duplex that contained a G:Oz was smaller than that containing a G:Ia or G:Sp. Therefore, our discussion can explain the previous results involving translesion synthesis past an oxidatively damaged guanine.

  20. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  1. Analysis of diffuse K+ and Mg2+ ion binding to a two-base-pair kissing complex by single-molecule mechanical unfolding.

    Science.gov (United States)

    Li, Pan T X

    2013-07-23

    The folding and stability of RNA tertiary interactions depend critically on cationic conditions. It is usually difficult, however, to isolate such effects on tertiary interactions from those on the entire RNA. By manipulating conformations of single RNA molecules using optical tweezers, we distinguished individual steps of breaking and forming of a two-base-pair kissing interaction from those of secondary folding. The binding of metal ions to the small tertiary structure appeared to be saturable with an apparent Kd of 160 mM for K(+) and 1.5 mM for Mg(2+). The kissing formation was estimated to be associated with binding of ~2-3 diffuse K(+) or Mg(2+) ions. At their saturated binding, Mg(2+) provided ~3 kcal/mol more stabilizing energy to the structure than K(+). Furthermore, the cations change the unkissing forces significantly more than the kissing ones. For example, the presence of Mg(2+) ions increased the average unkissing force from 21 pN to 44 pN, surprisingly high for breaking merely two base pairs; in contrast, the mean kissing force was changed by only 4.5 pN. Interestingly, the differential salt effects on the transition forces were not caused by different changes in the height of the kinetic barriers but were instead attributed to how different molecular structures respond to the applied force. Our results showed the importance of diffuse cation binding to the stability of tertiary interaction and demonstrated the utility of mechanical unfolding in studying tertiary interactions.

  2. Investigation of base pairs containing oxidized guanine using ab initio method and ABEEMσπ polarizable force field.

    Science.gov (United States)

    Liu, Cui; Wang, Yang; Zhao, Dongxia; Gong, Lidong; Yang, Zhongzhi

    2014-02-01

    The integrity of the genetic information is constantly threatened by oxidizing agents. Oxidized guanines have all been linked to different types of cancers. Theoretical approaches supplement the assorted experimental techniques, and bring new sight and opportunities to investigate the underlying microscopic mechanics. Unfortunately, there is no specific force field to DNA system including oxidized guanines. Taking high level ab initio calculations as benchmark, we developed the ABEEMσπ fluctuating charge force field, which uses multiple fluctuating charges per atom. And it was applied to study the energies, structures and mutations of base pairs containing oxidized guanines. The geometries were obtained in reference to other studies or using B3LYP/6-31+G* level optimization, which is more rational and timesaving among 24 quantum mechanical methods selected and tested by this work. The energies were determined at MP2/aug-cc-pVDZ level with BSSE corrections. Results show that the constructed potential function can accurately simulate the change of H-bond and the buckled angle formed by two base planes induced by oxidized guanine, and it provides reliable information of hydrogen bonding, stacking interaction and the mutation processes. The performance of ABEEMσπ polarizable force field in predicting the bond lengths, bond angles, dipole moments etc. is generally better than those of the common force fields. And the accuracy of ABEEMσπ PFF is close to that of the MP2 method. This shows that ABEEMσπ model is a reliable choice for further research of dynamics behavior of DNA fragment including oxidized guanine.

  3. Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet.

    Science.gov (United States)

    Dhami, Kirandeep; Malyshev, Denis A; Ordoukhanian, Phillip; Kubelka, Tomáš; Hocek, Michal; Romesberg, Floyd E

    2014-01-01

    We have developed a family of unnatural base pairs (UBPs), which rely on hydrophobic and packing interactions for pairing and which are well replicated and transcribed. While the pair formed between d5SICS and dNaM (d5SICS-dNaM) has received the most attention, and has been used to expand the genetic alphabet of a living organism, recent efforts have identified dTPT3-dNaM, which is replicated with even higher fidelity. These efforts also resulted in more UBPs than could be independently analyzed, and thus we now report a PCR-based screen to identify the most promising. While we found that dTPT3-dNaM is generally the most promising UBP, we identified several others that are replicated nearly as well and significantly better than d5SICS-dNaM, and are thus viable candidates for the expansion of the genetic alphabet of a living organism. Moreover, the results suggest that continued optimization should be possible, and that the putatively essential hydrogen-bond acceptor at the position ortho to the glycosidic linkage may not be required. These results clearly demonstrate the generality of hydrophobic forces for the control of base pairing within DNA, provide a wealth of new structure-activity relationship data and importantly identify multiple new candidates for in vivo evaluation and further optimization.

  4. Mismatch base pairing of the mutagen 8-oxoguanine and its derivatives with adenine: A theoretical search for possible antimutagenic agents

    Science.gov (United States)

    Singh, A. K.; Mishra, P. C.

    Molecular geometries of 8-oxoguanine (8OG), those of its substituted derivatives with the substitutions CH2, CF2, CO, CNH, O, and S in place of the N7H7 group, adenine (A), and the base pairs of 8OG and its substituted derivatives with adenine were optimized using the RHF/6-31+G* and B3LYP/6-31+G* methods in gas phase. All the molecules and their hydrogen-bonded complexes were solvated in aqueous media employing the polarized continuum model (PCM) of the self-consistent reaction field (SCRF) theory using the RHF/6-31+G* and B3LYP/6-31+G* methods. The optimized geometrical parameters of the 8OG-A base pair at the RHF/6-31+G* and B3LYP/6-31+G* levels of theory agree satisfactorily with those of an oligonucleotide containing the base pair found from X-ray crystallography. The pattern of hydrogen bonding in the CF2- and O-substituted 8OG-A base pair is of Watson-Crick type and that in the unsubstituted and CH2-, CNH-, and S-substituted base pairs is of Hoogsteen type. In the CO-substituted base pair, the hydrogen bonding pattern is of neither Watson-Crick nor Hoogsteen type. The CF2-substitution appears to introduce steric hindrance for stacking of DNA bases. On the basis of these results, it appears that among all the substituted 8OG molecules considered here, the O-substituted derivative may be useful as an antimutagenic drug. It is, however, subject to experimental verification. Content:text/plain; charset="UTF-8"

  5. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    Energy Technology Data Exchange (ETDEWEB)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart [Biodesign Institute, Arizona State University, Tempe, AZ 85287 (United States); Young, Michael [Department of Physics, Arizona State University, Tempe, AZ 85287 (United States)], E-mail: Stuart.Lindsay@asu.edu

    2009-05-06

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  6. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles.

    Science.gov (United States)

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal

    2016-07-14

    Ice nanoparticles (H2O)N, N ≈ 450 generated in a molecular beam experiment pick up individual gas phase molecules of 2-hydroxypyridine and 2-pyridone (HP) evaporated in a pickup cell at temperatures between 298 and 343 K. The mass spectra of the doped nanoparticles show evidence for generation of clusters of adsorbed molecules (HP)n up to n = 8. The clusters are ionized either by 70 eV electrons or by two photons at 315 nm (3.94 eV). The two ionization methods yield different spectra, and their comparison provides an insight into the neutral cluster composition, ionization and intracluster ion-molecule reactions, and cluster fragmentation. Quite a few molecules were reported not to coagulate on ice nanoparticles previously. The (HP)n cluster generation on ice nanoparticles represents the first evidence for coagulating of molecules and cluster formation on free ice nanoparticles. For comparison, we investigate the coagulation of HP molecules picked up on large clusters ArN, N ≈ 205, and also (HP)n clusters generated in supersonic expansions with Ar buffer gas. This comparison points to a propensity for the (HP)2 dimer generation on ice nanoparticles. This shows the feasibility of base pairing for model of biological molecules on free ice nanoparticles. This result is important for hypotheses of the biomolecule synthesis on ice grains in the space. We support our findings by theoretical calculations that show, among others, the HP dimer structures on water clusters.

  7. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae)

    Science.gov (United States)

    Bardella, Vanessa Bellini; Pita, Sebastián; Vanzela, André Luis Laforga; Galvão, Cleber; Panzera, Francisco

    2016-01-01

    The subfamily Triatominae (Hemiptera, Reduviidae) includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae. PMID:27759763

  8. Single-molecule measurements of synthesis by DNA polymerase with base-pair resolution.

    Science.gov (United States)

    Christian, Thomas D; Romano, Louis J; Rueda, David

    2009-12-15

    The catalytic mechanism of DNA polymerases involves multiple steps that precede and follow the transfer of a nucleotide to the 3'-hydroxyl of the growing DNA chain. Here we report a single-molecule approach to monitor the movement of E. coli DNA polymerase I (Klenow fragment) on a DNA template during DNA synthesis with single base-pair resolution. As each nucleotide is incorporated, the single-molecule Förster resonance energy transfer intensity drops in discrete steps to values consistent with single-nucleotide incorporations. Purines and pyrimidines are incorporated with comparable rates. A mismatched primer/template junction exhibits dynamics consistent with the primer moving into the exonuclease domain, which was used to determine the fraction of primer-termini bound to the exonuclease and polymerase sites. Most interestingly, we observe a structural change after the incorporation of a correctly paired nucleotide, consistent with transient movement of the polymerase past the preinsertion site or a conformational change in the polymerase. This may represent a previously unobserved step in the mechanism of DNA synthesis that could be part of the proofreading process.

  9. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae

    Directory of Open Access Journals (Sweden)

    Vanessa Bellini Bardella

    Full Text Available The subfamily Triatominae (Hemiptera, Reduviidae includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae.

  10. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  11. CanScript, an 18-Base pair DNA sequence, boosts tumor cell-specific promoter activity

    Science.gov (United States)

    Huang, Yu-Hung; Cozzitorto, Joseph A; Richards, Nathan G; Eltoukhy, Ahmed A; Yeo, Charles J; Langer, Robert; Anderson, Daniel G; Brody, Jonathan R

    2010-01-01

    Gene therapy protocols for the treatment of cancer often employ gene promoter sequences that are known to be overexpressed in specific tumor cell types relative to normal cells. These promoters, while specific, are often weakly active. It would be desirable to increase the activity of such promoters, while at the same time retain specificity, so that the therapeutic gene is more robustly expressed. Using a luciferase reporter DNA construct in both in vitro cell transfection assays and in vivo mouse tumor models, we have determined that in the absence of any other DNA sequence, a previously identified 18-base pair enhancer sequence called CanScript, lying upstream of the MSLN gene, has ∼25% of the promoter activity of CAG, a very strong non-specific promoter/enhancer, in tumor cells in which MSLN is highly expressed. Furthermore, tandem repeat copies of CanScript enhance transcription in a dose-dependent manner and, when coupled with promoter sequences that are active in tumor cells, increase promoter activity. These findings suggest that the incorporation of CanScript into gene constructs may have application in enhancing activity of promoters used in cancer-targeting gene therapy strategies, thereby improving therapeutic efficacy. PMID:20798601

  12. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  13. Base pairing enhances fluorescence and favors cyclobutane dimer formation induced upon absorption of UVA radiation by DNA.

    Science.gov (United States)

    Banyasz, Akos; Vayá, Ignacio; Changenet-Barret, Pascale; Gustavsson, Thomas; Douki, Thierry; Markovitsi, Dimitra

    2011-04-13

    The photochemical properties of the DNA duplex (dA)(20)·(dT)(20) are compared with those of the parent single strands. It is shown that base pairing increases the probability of absorbing UVA photons, probably due to the formation of charge-transfer states. UVA excitation induces fluorescence peaking at ∼420 nm and decaying on the nanosecond time scale. The fluorescence quantum yield, the fluorescence lifetime, and the quantum yield for cyclobutane dimer formation increase upon base pairing. Such behavior contrasts with that of the UVC-induced processes.

  14. Pt(Ⅱ), Pd(Ⅱ) and Ni(Ⅱ) Complexes Binding to the N(7) Position of Guanine: Influence on the Guanine and Watson-crick GC Base Pair

    Institute of Scientific and Technical Information of China (English)

    章志强; 周立新; 和芹; 赵亚英

    2005-01-01

    Comprehensive ab initio calculations were performed on the coordination of Pt(II), Pd(II) and Ni(II) adducts to the N(7) of guanine and guanine-cytosine (GC) base pair at the DFT level. The fully optimized geometries of the metal complexes were obtained and the stabilization energies of the interaction between metal adducts and nucleobase were calculated with B3LYP method by using 6-31* basis set for the light atom. While the effective core potential (ECP) is used for metal cation. The results show that both cispalladium and cisnickel cause similar geometric changes of the base pair as cisplatin. For the coordination of metal adducts to guanine, platinum adduct possesses the highest stabilization energy; but the interaction between metal-guanine and cytosine for nickel is larger than that for platinum and palladium. It is worthy to note that hydrolysis effect can also cause significant changes in H-bonds.

  15. Stacking interactions and DNA intercalation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Dr. Shen [Fred Hutchinson Cancer Research Center; Cooper, Valentino R [ORNL; Thonhauser, Prof. Timo [Wake Forest University, Winston-Salem, NC; Lundqvist, Prof. Bengt I. [Chalmers University of Technology, Sweden; Langreth, David C. [Rutgers University

    2009-01-01

    The relationship between stacking interactions and the intercalation of proflavine and ellipticine within DNA is investigated using a nonempirical van der Waals density functional for the correlation energy. Our results, employing a binary stack model, highlight fundamental, qualitative differences between base-pair base-pair interactions and that of the stacked intercalator base pair system. Most notable result is the paucity of torque which so distinctively defines the Twist of DNA. Surprisingly, this model, when combined with a constraint on the twist of the surrounding base-pair steps to match the observed unwinding of the sugar-phosphate backbone, was sufficient for explaining the experimentally observed proflavine intercalator configuration. Our extensive mapping of the potential energy surface of base-pair intercalator interactions can provide valuable information for future nonempirical studies of DNA intercalation dynamics.

  16. Mitochondrial DNA 4977-base pair common deletion in blood leukocytes and melanoma risk.

    Science.gov (United States)

    Shen, Jie; Wan, Jie; Huff, Chad; Fang, Shenying; Lee, Jeffrey E; Zhao, Hua

    2016-05-01

    The 4977-base pair common deletion DmtDNA4977 is the most frequently observed mitochondrial DNA mutation in human tissues. Because mitochondrial DNA mutations are mainly caused by reactive oxygen species (ROS), and given that oxidative stress plays an important role in melanoma carcinogenesis, the investigation of DmtDNA4977 may be particularly relevant to the development of melanoma. In this study, we compared DmtDNA4977 levels in blood leukocytes from 206 melanoma patients and 219 healthy controls. Overall, melanoma cases had significantly higher levels of DmtDNA4977 than healthy controls (median: 0.60 vs 0.20, P = 0.008). The difference was evident among individuals who were older than 47 yrs, women, and had pigmentation risk factors (e.g., blond or red hair, blue eye, fair skin, light, or none tanning ability after prolonged sun exposure, and freckling in the sun as a child). The difference was also evident among those who had at least one lifetime sunburn with blistering and had no reported use of a sunlamp. Interestingly, among controls, DmtDNA4977 levels differed by phenotypic index and reported use of a sunlamp. In the risk assessment, increased levels of DmtDNA4977 were associated with a 1.23-fold increased risk of melanoma (odds ratio (OR): 1.23, 95% confidence interval (90% CI): 1.01, 1.50). A significant dose-response relationship was observed in quartile analysis (P = 0.001). In summary, our study suggests that high levels of DmtDNA4977 in blood leukocytes are associated with increased risk of melanoma and that association is affected by both pigmentation and personal history of sun exposure.

  17. Lethal osteogenesis imperfecta congenita and a 300 base pair gene deletion for an α1(I)-like collagen.

    NARCIS (Netherlands)

    F.M. Pope; K.S.E. Cheah (Kathryn); A.C. Nicholls; A.B. Price; F.G. Grosveld (Frank)

    1984-01-01

    textabstractBroad boned lethal osteogenesis imperfecta is a severely crippling disease of unknown cause. By means of recombinant DNA technology a 300 base pair deletion in an alpha 1(I)-like collagen gene was detected in six patients and four complete parent-child groups including patients with this

  18. [Structural and energetic properties of the four configurations of the A.T and G.C DNA base pairs].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    Using the methods of non-empirical quantum chemistry at the MP2/6-311++G(2df,pd)// B3LYP/6-311++G(d,p) level of theory it was established for the first time, that Hoogsteen, reverse Hoogsteen, Watson-Crick and reverse Watson-Crick configurations of the A.T and G.C DNA base pairs are isoelectronic and isomorphic structures with similar dynamic properties. Based on these results, non-ionisation mechanism of the Hoogsteen <"breathing" of the G*.C* DNA base pair, namely transformation of the tautomerised (Lowdin's) G-C base pair with Watson-Crick geometry into the Hoogsteen electroneutral G*.C* H base pair stabilized by the three O6H...N4, N3H...N7 and C8H...02 H-bonds, was postulated. It is suggested that such scenario activates only in those cases, when DNA is not located in aqueous solution, but works together with proteins and cytosine protonation at the N3 atom is precluded.

  19. Lethal osteogenesis imperfecta congenita and a 300 base pair gene deletion for an α1(I)-like collagen.

    NARCIS (Netherlands)

    F.M. Pope; K.S.E. Cheah (Kathryn); A.C. Nicholls; A.B. Price; F.G. Grosveld (Frank)

    1984-01-01

    textabstractBroad boned lethal osteogenesis imperfecta is a severely crippling disease of unknown cause. By means of recombinant DNA technology a 300 base pair deletion in an alpha 1(I)-like collagen gene was detected in six patients and four complete parent-child groups including patients with this

  20. Molecular dynamics simulation reveals conformational switching of water-mediated uracil-cytosine base-pairs in an RNA duplex.

    Science.gov (United States)

    Schneider, C; Brandl, M; Sühnel, J

    2001-01-26

    A 4 ns molecular dynamics simulation of an RNA duplex (r-GGACUUCGGUCC)(2 )in solution with Na+ and Cl- as counterions was performed. The X-ray structure of this duplex includes two water-mediated uracil-cytosine pairs. In contrast to the other base-pairs in the duplex the water-mediated pairs switch between different conformations. One conformation corresponds to the geometry of the water-mediated UC pairs in the duplex X-ray structure with water acting both as hydrogen-bond donor and acceptor. Another conformation is close to that of a water-mediated UC base-pair found in the X-ray structure of the 23 S rRNA sarcin/ricin domain. In this case the oxygen of the water molecule is linked to two-base donor sites. For a very short time also a direct UC base-pair and a further conformation that is similar to the one found in the RNA duplex structure but exhibits an increased H3(U)...N3(C) distance is observed. Water molecules with unusually long residence times are involved in the water-mediated conformations. These results indicate that the dynamic behaviour of the water-mediated UC base-pairs differs from that of the duplex Watson-Crick and non-canonical guanine-uracil pairs with two or three direct hydrogen bonds. The conformational variability and increased flexibility has to be taken into account when considering these base-pairs as RNA building blocks and as recognition motifs. Copyright 2001 Academic Press.

  1. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs.

    Science.gov (United States)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-29

    Two identical 5'GACG3' tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5' end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5'GACG3') forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5'A·U3' for H3, 5'U·A3' for H2) to 5'G·C3'/5'C·G3' has significant effect on the stability of the kissing complexes: the substitution to 5'C·G3' significantly decreases both thermal and mechanical stability, while switching to the 5'G·C3' significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5'A·U3' for H3 and 5'U·A3' for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Identification of the base-pairing requirements for repression of hctA translation by the small RNA IhtA leads to the discovery of a new mRNA target in Chlamydia trachomatis.

    Directory of Open Access Journals (Sweden)

    Nicole A Grieshaber

    Full Text Available The non-coding small RNA, IhtA expressed by the obligate intracellular human pathogen Chlamydia trachomatis modulates the translation of HctA, a key protein involved in replicative to infectious cell type differentiation. Using a combination of bioinformatics and mutagenesis we sought to identify the base pairing requirement for functional repression of HctA protein expression, with an eye to applying our findings towards the identification of additional targets. IhtA is predicted to fold into a three stem:loop structure. We found that loop 1 occludes the initiation codon of hctA, while loop 2 and 3 are not required for function. This 7 nucleotide region forms G/C rich interactions surrounding the AUG of hctA. Two additional genes in the chlamydial genome, CTL0322 and CTL0097, contained some elements of the hctA:IhtA recognition sequence. The mRNA of both CTL0322and CTL0097 interacted with IhtA in vitro as measured by biolayer interferometry. However, using a CheZ reporter expression system, IhtA only inhibited the translation of CTL0322. The proposed IhtA recognition site in the CTL0322 message contains significant G/C base pairing on either side of the initiation codon while CTL0097 only contains G/C base pairing 3' to the AUG initiation codon. These data suggest that as the functional interacting region is only 6-7nt in length that full translation repression is dependent on the degree of G/C base pairing. Additionally our results indicate that IhtA may regulate multiple mRNAs involved in the chlamydial infectious cycle.

  3. Identification of the Base-Pairing Requirements for Repression of hctA Translation by the Small RNA IhtA Leads to the Discovery of a New mRNA Target in Chlamydia trachomatis

    Science.gov (United States)

    Grieshaber, Nicole A.; Tattersall, Jeremiah S.; Liguori, Johella; Lipat, Joseph N.; Runac, Justin; Grieshaber, Scott S.

    2015-01-01

    The non-coding small RNA, IhtA expressed by the obligate intracellular human pathogen Chlamydia trachomatis modulates the translation of HctA, a key protein involved in replicative to infectious cell type differentiation. Using a combination of bioinformatics and mutagenesis we sought to identify the base pairing requirement for functional repression of HctA protein expression, with an eye to applying our findings towards the identification of additional targets. IhtA is predicted to fold into a three stem:loop structure. We found that loop 1 occludes the initiation codon of hctA, while loop 2 and 3 are not required for function. This 7 nucleotide region forms G/C rich interactions surrounding the AUG of hctA. Two additional genes in the chlamydial genome, CTL0322 and CTL0097, contained some elements of the hctA:IhtA recognition sequence. The mRNA of both CTL0322and CTL0097 interacted with IhtA in vitro as measured by biolayer interferometry. However, using a CheZ reporter expression system, IhtA only inhibited the translation of CTL0322. The proposed IhtA recognition site in the CTL0322 message contains significant G/C base pairing on either side of the initiation codon while CTL0097 only contains G/C base pairing 3’ to the AUG initiation codon. These data suggest that as the functional interacting region is only 6-7nt in length that full translation repression is dependent on the degree of G/C base pairing. Additionally our results indicate that IhtA may regulate multiple mRNAs involved in the chlamydial infectious cycle. PMID:25756658

  4. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices.

  5. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    Science.gov (United States)

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  6. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

  7. Structure, stability and function of 5-chlorouracil modified A:U and G:U base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Patra, Amritraj [Vanderbilt Univ., Nashville, TN (United States); Harp, Joel [Vanderbilt Univ., Nashville, TN (United States); Pallan, Pradeep S. [Vanderbilt Univ., Nashville, TN (United States); Zhao, Linlin [Vanderbilt Univ., Nashville, TN (United States); Abramov, Mikhail [Rega Inst. for Medical Research (Belgium); Herdewijn, Piet [Rega Inst. for Medical Research (Belgium); Univ. of Evry-Val-d' Essonne (France); Egli, Martin [Vanderbilt Univ., Nashville, TN (United States)

    2012-12-28

    The thymine analog 5-chlorouridine, first reported in the 1950s as anti-tumor agent, is known as an effective mutagen, clastogen and toxicant as well as an effective inducer of sister-chromatid exchange. Recently, the first microorganism with a chemically different genome was reported; the selected Escherichia coli strain relies on the four building blocks 5-chloro-2'-deoxyuridine (ClU), A, C and G instead of the standard T, A, C, G alphabet [Marlière,P., Patrouix,J., Döring,V., Herdewijn,P., Tricot,S., Cruveiller,S., Bouzon,M. and Mutzel,R. (2011) Chemical evolution of a bacterium’s genome. Angew. Chem. Int. Ed., 50, 7109–7114]. The residual fraction of T in the DNA of adapted bacteria was <2% and the switch from T to ClU was accompanied by a massive number of mutations, including >1500 A to G or G to A transitions in a culture. The former is most likely due to wobble base pairing between ClU and G, which may be more common for ClU than T. To identify potential changes in the geometries of base pairs and duplexes as a result of replacement of T by ClU, we determined four crystal structures of a B-form DNA dodecamer duplex containing ClU:A or ClU:G base pairs. The structures reveal nearly identical geometries of these pairs compared with T:A or T:G, respectively, and no consequences for stability and cleavage by an endonuclease (EcoRI). The lack of significant changes in the geometry of ClU:A and ClU:G base pairs relative to the corresponding native pairs is consistent with the sustained unlimited self-reproduction of E. coli strains with virtually complete T→ClU genome substitution.

  8. Computer simulation of acetonitrile and methanol with ab initio-based pair potentials

    Science.gov (United States)

    Hloucha, M.; Sum, A. K.; Sandler, S. I.

    2000-10-01

    This study address the adequacy of ab initio pair interaction energy potentials for the prediction of macroscopic properties. Recently, Bukowski et al. [J. Phys. Chem. A 103, 7322 (1999)] performed a comprehensive study of the potential energy surfaces for several pairs of molecules using symmetry-adapted perturbation theory. These ab initio energies were then fit to an appropriate site-site potential form. In an attempt to bridge the gap between ab initio interaction energy information and macroscopic properties prediction, we performed Gibbs ensemble Monte Carlo (GEMC) simulations using their developed pair potentials for acetonitrile and methanol. The simulations results show that the phase behavior of acetonitrile is well described by just the pair interaction potential. For methanol, on the other hand, pair interactions are insufficient to properly predict its vapor-liquid phase behavior, and its saturated liquid density. We also explored simplified forms for representing the ab initio interaction energies by refitting a selected range of the data to a site-site Lennard-Jones and to a modified Buckingham (exponential-6) potentials plus Coulombic interactions. These were also used in GEMC simulations in order to evaluate the quality and computational efficiency of these different potential forms. It was found that the phase behavior prediction for acetonitrile and methanol are highly dependent on the details of the interaction potentials developed.

  9. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events.

  10. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  11. Spliceosomal small nuclear RNAs of Tetrahymena thermophila and some possible snRNA-snRNA base-pairing interactions

    DEFF Research Database (Denmark)

    Orum, H; Nielsen, Henrik; Engberg, J

    1991-01-01

    We have identified and characterized the full set of spliceosomal small nuclear RNAs (snRNAs; U1, U2, U4, U5 and U6) from the ciliated protozoan Tetrahymena thermophila. With the exception of U4 snRNA, the sizes of the T. thermophila snRNAs are closely similar to their metazoan homologues. The T...

  12. Robust IR-based detection of stable and fractionally populated G-C(+) and A-T Hoogsteen base pairs in duplex DNA.

    Science.gov (United States)

    Stelling, Allison L; Xu, Yu; Zhou, Huiqing; Choi, Seung H; Clay, Mary C; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-06-01

    Noncanonical G-C(+) and A-T Hoogsteen base pairs can form in duplex DNA and play roles in recognition, damage repair, and replication. Identifying Hoogsteen base pairs in DNA duplexes remains challenging due to difficulties in resolving syn versus antipurine bases with X-ray crystallography; and size limitations and line broadening can make them difficult to characterize by NMR spectroscopy. Here, we show how infrared (IR) spectroscopy can identify G-C(+) and A-T Hoogsteen base pairs in duplex DNA across a range of different structural contexts. The utility of IR-based detection of Hoogsteen base pairs is demonstrated by characterizing the first example of adjacent A-T and G-C(+) Hoogsteen base pairs in a DNA duplex where severe broadening complicates detection with NMR. © 2017 Federation of European Biochemical Societies.

  13. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  14. Effects of non-ionic surfactants on the interactions between cellulases and tannic acid

    DEFF Research Database (Denmark)

    Olsen, Søren Nymand; Bohlin, Christina Helena; Murphy, Leigh

    2011-01-01

    Addition of non-ionic surfactants (NIS) is known to accelerate enzymatic lignocellulose hydrolysis. The mechanism behind this accelerating effect is still not elucidated but has been hypothesized to originate from favorable NIS–lignin interactions which alleviate non-productive adsorption...

  15. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    Energy Technology Data Exchange (ETDEWEB)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

    2016-02-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  16. Reversible phospholipid nanogels for deoxyribonucleic acid fragment size determinations up to 1500 base pairs and integrated sample stacking.

    Science.gov (United States)

    Durney, Brandon C; Bachert, Beth A; Sloane, Hillary S; Lukomski, Slawomir; Landers, James P; Holland, Lisa A

    2015-06-23

    Phospholipid additives are a cost-effective medium to separate deoxyribonucleic acid (DNA) fragments and possess a thermally-responsive viscosity. This provides a mechanism to easily create and replace a highly viscous nanogel in a narrow bore capillary with only a 10°C change in temperature. Preparations composed of dimyristoyl-sn-glycero-3-phosphocholine (DMPC) and 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC) self-assemble, forming structures such as nanodisks and wormlike micelles. Factors that influence the morphology of a particular DMPC-DHPC preparation include the concentration of lipid in solution, the temperature, and the ratio of DMPC and DHPC. It has previously been established that an aqueous solution containing 10% phospholipid with a ratio of [DMPC]/[DHPC]=2.5 separates DNA fragments with nearly single base resolution for DNA fragments up to 500 base pairs in length, but beyond this size the resolution decreases dramatically. A new DMPC-DHPC medium is developed to effectively separate and size DNA fragments up to 1500 base pairs by decreasing the total lipid concentration to 2.5%. A 2.5% phospholipid nanogel generates a resolution of 1% of the DNA fragment size up to 1500 base pairs. This increase in the upper size limit is accomplished using commercially available phospholipids at an even lower material cost than is achieved with the 10% preparation. The separation additive is used to evaluate size markers ranging between 200 and 1500 base pairs in order to distinguish invasive strains of Streptococcus pyogenes and Aspergillus species by harnessing differences in gene sequences of collagen-like proteins in these organisms. For the first time, a reversible stacking gel is integrated in a capillary sieving separation by utilizing the thermally-responsive viscosity of these self-assembled phospholipid preparations. A discontinuous matrix is created that is composed of a cartridge of highly viscous phospholipid assimilated into a separation matrix

  17. Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

    Directory of Open Access Journals (Sweden)

    Sergei Kuchin

    2011-03-01

    Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

  18. PNA(T).DNA(AT) triplexes with Hoogsteen base pairing are more favorable

    Institute of Scientific and Technical Information of China (English)

    XIE Jun; LIU Ciquan; QU Lianghu

    2003-01-01

    Peptide nucleic acids (PNAs) are nucleic acid analogs with the deoxyribose phosphate backbone replaced by pseudo-peptide polymers to which the nucleobases are linked. The achiral, uncharged and rather flexible properties of the peptide backbone permit peptide nucleic acids more potential than oligonucleotides in application to antisence and antigenic reagents. The process of PNA binding to DNA duplex and forming triplex is the first step of PNA interacting with PNA. But there are no PNA.2DNA triplex crystal data up to date and little has been reported on the structure features and the force of the PNA.2DNA triplex. In this work,PNA(T).DNA(AT) triplexes are successfully built and the structures and forces to stabilize the triplex after optimizations and molecule dynamics are systematically examined,which are expected to aid in the application of PNAs as anticense and antigene agents.

  19. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  20. A naproxen complex of dysprosium intercalates into calf thymus DNA base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Mengsi; Jin, Jianhua; Xu, Guiqing [School of Chemistry and Chemical Engineering, Key Laboratory of Green Chemical Media and Reactions, Ministry of Education, Henan Normal University, Xinxiang 453007 (China); Cui, Fengling, E-mail: fenglingcui@hotmail.com [School of Chemistry and Chemical Engineering, Key Laboratory of Green Chemical Media and Reactions, Ministry of Education, Henan Normal University, Xinxiang 453007 (China); Luo, Hongxia [Department of Chemistry, Renmin University of China, Beijing 100872 (China)

    2014-01-15

    Highlights: • Binding mode to ctDNA was studied by various methods. • Intercalation is the most possible binding mode. • Dynamic and static quenching occurred simultaneously. • Hydrophobic force played a major role. • Binding characteristic of rare earth complexes to DNA are dependent on the element. - Abstract: The binding mode and mechanism of dysprosium–naproxen complex (Dy–NAP) with calf thymus deoxyribonucleic acid (ctDNA) were studied using UV–vis and fluorescence spectra in physiological buffer (pH 7.4). The results showed that more than one type of quenching process occurred and the binding mode between Dy–NAP with ctDNA might be intercalation. In addition, ionic strength, iodide quenching and fluorescence polarization experiments corroborated the intercalation binding mode between Dy–NAP and ctDNA. The calculated thermodynamic parameters ΔG, ΔH and ΔS at different temperature demonstrated that hydrophobic interaction force played a major role in the binding process.

  1. Advanced formulation of base pair changes in the stem regions of ribosomal RNAs; its application to mitochondrial rRNAs for resolving the phylogeny of animals.

    Science.gov (United States)

    Otsuka, Jinya; Sugaya, Nobuyoshi

    2003-06-21

    The ribosomal RNAs (rRNAs) of animal mitochondria, especially those of arthropod mitochondria, have a higher content of G:U and U:G base pairs in their stem regions than the nuclear rRNAs. Thus, the theoretical formulation of base pair changes is extended to incorporate the faster base pair changes A:UG:UG:C and U:AU:GC:G into the previous formulation of the slower base pair changes between A:U, G:C, C:G and U:A. The relative base pair change probability containing the faster and slower base pair changes is theoretically derived to estimate the divergence time of rRNAs under the influence of selection for these base pairs. Using the cartilaginous fish-teleost fish divergence and the crustacean-insect divergence as calibration points, the present method successfully predicts the divergence times of the main branches of animals: Deuterostomia and Protostomia diverged 9.2 x 10(8) years ago, the divergence of Echinodermata, Hemichordata and Cephalochordata succeedingly occurred during the period from 8 x 10(8) to 6 x 10(8) years ago, while Arthropoda, Annelida and Mollusca diverged almost concomitantly about 7 x 10(8) years ago. The dating for the divergence of Platyhelminthes and Cnidaria is traced back to 1.2 x 10(9) years ago. This result is consistent with the fossil records in the Stirling Range Formation of southwestern Australia, the Ediacara and Avalon faunas and the Cambrian Burgess Shale. Thus, the present method may be useful for estimating the divergence times of animals ranging from 10(8) to 10(9) years ago, resolving the difficult problems, e.g. deviation from rate constancy and large sampling variances, in the usual methods of treating apparent change rates between individual bases and/or base pairs.

  2. Nonproductive Factor Allowance. (Pilot Study).

    Science.gov (United States)

    1980-03-31

    a separate factor for each size of facility, i.e., MEDCEN, Large MEDDAC, and Small MEDDAC. f. In a GAO audit report, "Development and Use of Military...measurement in determining and Justifying staffing requirements. g. Another GAO audit report, "Uniform Accounting and Workload Measurement Systems Needed for...Effective Writing, AFIT, Survival, TDY, Technical Training, IDEA High School, CDC and Survey Taking. Also taking tests such as PFE , SKT, AF Sup Exam, CLEP

  3. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    Energy Technology Data Exchange (ETDEWEB)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-04-17

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson–Crick adenine–thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39 –2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson–Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  4. Can an excess electron localize on a purine moiety in the adenine-thymine Watson-Crick base pair? A computational study

    Science.gov (United States)

    Mazurkiewicz, Kamil; Harańczyk, Maciej; Gutowski, Maciej; Rak, Janusz

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.0

  5. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu

    2012-08-01

    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  6. Biological phosphorylation of an Unnatural Base Pair (UBP) using a Drosophila melanogaster deoxynucleoside kinase (DmdNK) mutant

    Science.gov (United States)

    Daugherty, Ashley B.; Yang, Zunyi; Shaw, Ryan; Dong, Mengxing; Lutz, Stefan; Benner, Steven A.

    2017-01-01

    One research goal for unnatural base pair (UBP) is to replicate, transcribe and translate them in vivo. Accordingly, the corresponding unnatural nucleoside triphosphates must be available at sufficient concentrations within the cell. To achieve this goal, the unnatural nucleoside analogues must be phosphorylated to the corresponding nucleoside triphosphates by a cascade of three kinases. The first step is the monophosphorylation of unnatural deoxynucleoside catalyzed by deoxynucleoside kinases (dNK), which is generally considered the rate limiting step because of the high specificity of dNKs. Here, we applied a Drosophila melanogaster deoxyribonucleoside kinase (DmdNK) to the phosphorylation of an UBP (a pyrimidine analogue (6-amino-5-nitro-3-(1’-b-d-2’-deoxyribofuranosyl)-2(1H)-pyridone, Z) and its complementary purine analogue (2-amino-8-(1’-b-d-2’-deoxyribofuranosyl)-imidazo[1,2-a]-1,3,5-triazin-4(8H)-one, P). The results showed that DmdNK could efficiently phosphorylate only the dP nucleoside. To improve the catalytic efficiency, a DmdNK-Q81E mutant was created based on rational design and structural analyses. This mutant could efficiently phosphorylate both dZ and dP nucleoside. Structural modeling indicated that the increased efficiency of dZ phosphorylation by the DmdNK-Q81E mutant might be related to the three additional hydrogen bonds formed between E81 and the dZ base. Overall, this study provides a groundwork for the biological phosphorylation and synthesis of unnatural base pair in vivo. PMID:28323896

  7. Design of laser pulses for selective vibrational excitation of the N6-H bond of adenine and adenine-thymine base pair using optimal control theory.

    Science.gov (United States)

    Sharma, Sitansh; Sharma, Purshotam; Singh, Harjinder; Balint-Kurti, Gabriel G

    2009-06-01

    Time dependent quantum dynamics and optimal control theory are used for selective vibrational excitation of the N6-H (amino N-H) bond in free adenine and in the adenine-thymine (A-T) base pair. For the N6-H bond in free adenine we have used a one dimensional model while for the hydrogen bond, N6-H(A)...O4(T), present in the A-T base pair, a two mathematical dimensional model is employed. The conjugate gradient method is used for the optimization of the field dependent cost functional. Optimal laser fields are obtained for selective population transfer in both the model systems, which give virtually 100% excitation probability to preselected vibrational levels. The effect of the optimized laser field on the other hydrogen bond, N1(A)...H-N3(T), present in A-T base pair is also investigated.

  8. The –SH Protection Method for Determining Accurate Kd Values for Enzyme-Coenzyme Complexes of NAD+-Dependent Glutamate Dehydrogenase and Engineered Mutants: Evidence for Nonproductive NADPH Complexes

    Directory of Open Access Journals (Sweden)

    Joanna Griffin

    2010-01-01

    Full Text Available Inactivation rates have been measured for clostridial glutamate dehydrogenase and several engineered mutants at various DTNB concentrations. Analysis of rate constants allowed determination of Kd for each non-covalent enzyme-DTNB complex and the rate constant for reaction to form the inactive enzyme-thionitrobenzoate adduct. Both parameters are sensitive to the mutations F238S, P262S, the double mutation F238S/P262S, and D263K, all in the coenzyme binding site. Study of the effects of NAD+, NADH and NADPH at various concentrations in protecting against inactivation by 200 μM DTNB allowed determination of Kd values for binding of these coenzymes to each protein, yielding surprising results. The mutations were originally devised to lessen discrimination against the disfavoured coenzyme NADP(H, and activity measurements showed this was achieved. However, the Kd determinations indicated that, although Kd values for NAD+ and NADH were increased considerably, Kd for NADPH was increased even more than for NADH, so that discrimination against binding of NADPH was not decreased. This apparent contradiction can only be explained if NADPH has a nonproductive binding mode that is not weakened by the mutations, and a catalytically productive mode that, though strengthened, is masked by the nonproductive binding. Awareness of the latter is important in planning further mutagenesis.

  9. Type I-E CRISPR-cas systems discriminate target from non-target DNA through base pairing-independent PAM recognition.

    Directory of Open Access Journals (Sweden)

    Edze R Westra

    Full Text Available Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat, into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism.

  10. Isolation breeds naivety: island living robs Australian varanid lizards of toad-toxin immunity via four-base-pair mutation.

    Science.gov (United States)

    Ujvari, Beata; Mun, Hee-chang; Conigrave, Arthur D; Bray, Alessandra; Osterkamp, Jens; Halling, Petter; Madsen, Thomas

    2013-01-01

    Since their introduction to the toad-free Australian continent cane toads (Bufo marinus) have caused a dramatic increase in naïve varanid mortality when these large lizards attempt to feed on this toxic amphibian. In contrast Asian-African varanids, which have coevolved with toads, are resistant to toad toxin. Toad toxins, such as Bufalin target the H1-H2 domain of the α(1) subunit of the sodium-potassium-ATPase enzyme. Sequencing of this domain revealed identical nucleotide sequences in four Asian as well as in three African varanids, and identical sequences in all 11 Australian varanids. However, compared to the Asian-African varanids, the Australian varanids showed four-base-pair substitutions, resulting in the alteration in three of the 12 amino acids representing the H1-H2 domain. The phenotypic effect of the substitutions was investigated in human embryonic kidney (HEK) 293 cells stably transfected with the Australian and the Asian-African H1-H2 domains. The transfections resulted in an approximate 3000-fold reduction in resistance to Bufalin in the Australian HEK293 cells compared to the Asian-African HEK293 cells, demonstrating the critical role of this minor mutation in providing Bufalin resistance. Our study hence presents a clear link between genotype and phenotype, a critical step in understanding the evolution of phenotypic diversity.

  11. Chemical shifts assignments of the archaeal MC1 protein and a strongly bent 15 base pairs DNA duplex in complex.

    Science.gov (United States)

    Loth, Karine; Landon, Céline; Paquet, Françoise

    2015-04-01

    MC1 is the most abundant architectural protein present in Methanosarcina thermophila CHTI55 in laboratory growth conditions and is structurally unrelated to other DNA-binding proteins. MC1 functions are to shape and to protect DNA against thermal denaturation by binding to it. Therefore, MC1 has a strong affinity for any double-stranded DNA. However, it recognizes and preferentially binds to bent DNA, such as four-way junctions and negatively supercoiled DNA minicircles. Combining NMR data, electron microscopy data, biochemistry, molecular modelisation and docking approaches, we proposed recently a new type of DNA/protein complex, in which the monomeric protein MC1 binds on the concave side of a strongly bent 15 base pairs DNA. We present here the NMR chemical shifts assignments of each partner in the complex, (1)H (15)N MC1 protein and (1)H (13)C (15)N bent duplex DNA, as first step towards the first experimental 3D structure of this new type of DNA/protein complex.

  12. A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

    Science.gov (United States)

    Sawada, Tomohisa; Fujita, Makoto

    2010-05-26

    Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

  13. Demonstration of polarization sensitivity of emulsion-based pair conversion telescope for cosmic gamma-ray polarimetry

    CERN Document Server

    Ozaki, Keita; Aoki, Shigeki; Kamada, Keiki; Kaneyama, Taichi; Nakagawa, Ryo; Rokujo, Hiroki

    2016-01-01

    Linear polarization of high-energy gamma-rays (10 MeV-100 GeV) can be detected by measuring the azimuthal angle of electron-positron pairs and observing the modulation of the azimuthal distribution. To demonstrate the gamma-ray polarization sensitivity of emulsion, we conducted a test using a polarized gamma-ray beam at SPring-8/LEPS. Emulsion tracks were reconstructed using scanning data, and gamma-ray events were selected automatically. Using an optical microscope, out of the 2381 gamma-ray conversions that were observed, 1372 remained after event selection, on the azimuthal angle distribution of which we measured the modulation. From the distribution of the azimuthal angles of the selected events, a modulation factor of 0.21 + 0.11 - 0.09 was measured, from which the detection of a non-zero modulation was established with a significance of 3.06 $\\sigma$. This attractive polarimeter will be applied to the GRAINE project, a balloon-borne experiment that observes cosmic gamma-rays with an emulsion-based pair ...

  14. Deep RNA sequencing reveals the smallest known mitochondrial micro exon in animals: The placozoan cox1 single base pair exon.

    Science.gov (United States)

    Osigus, Hans-Jürgen; Eitel, Michael; Schierwater, Bernd

    2017-01-01

    The phylum Placozoa holds a key position for our understanding of the evolution of mitochondrial genomes in Metazoa. Placozoans possess large mitochondrial genomes which harbor several remarkable characteristics such as a fragmented cox1 gene and trans-splicing cox1 introns. A previous study also suggested the existence of cox1 mRNA editing in Trichoplax adhaerens, yet the only formally described species in the phylum Placozoa. We have analyzed RNA-seq data of the undescribed sister species, Placozoa sp. H2 ("Panama" clone), with special focus on the mitochondrial mRNA. While we did not find support for a previously postulated cox1 mRNA editing mechanism, we surprisingly found two independent transcripts representing intermediate cox1 mRNA splicing stages. Both transcripts consist of partial cox1 exon as well as overlapping intron fragments. The data suggest that the cox1 gene harbors a single base pair (cytosine) micro exon. Furthermore, conserved group I intron structures flank this unique micro exon also in other placozoans. We discuss the evolutionary origin of this micro exon in the context of a self-splicing intron gain in the cox1 gene of the last common ancestor of extant placozoans.

  15. A critical base pair in k-turns that confers folding characteristics and correlates with biological function

    Science.gov (United States)

    McPhee, Scott A.; Huang, Lin; Lilley, David M. J.

    2014-10-01

    Kink turns (k-turns) are widespread elements in RNA that mediate tertiary contacts by kinking the helical axis. We have found that the ability of k-turns to undergo ion-induced folding is conferred by a single base pair that follows the conserved A·G pairs, that is, the 3b·3n position. A Watson-Crick pair leads to an inability to fold in metal ions alone, while 3n=G or 3b=C (but not both) permits folding. Crystallographic study reveals two hydrated metal ions coordinated to O6 of G3n and G2n of Kt-7. Removal of either atom impairs Mg2+-induced folding in solution. While SAM-I riboswitches have 3b·3n sequences that would predispose them to ion-induced folding, U4 snRNA are strongly biased to an inability to such folding. Thus riboswitch sequences allow folding to occur independently of protein binding, while U4 should remain unfolded until bound by protein. The empirical rules deduced for k-turn folding have strong predictive value.

  16. Repairing the sickle cell mutation. I. Specific covalent binding of a photoreactive third strand to the mutated base pair.

    Science.gov (United States)

    Broitman, S; Amosova, O; Dolinnaya, N G; Fresco, J R

    1999-07-30

    A DNA third strand with a 3'-psoralen substituent was designed to form a triplex with the sequence downstream of the T.A mutant base pair of the human sickle cell beta-globin gene. Triplex-mediated psoralen modification of the mutant T residue was sought as an approach to gene repair. The 24-nucleotide purine-rich target sequence switches from one strand to the other and has four pyrimidine interruptions. Therefore, a third strand sequence favorable to two triplex motifs was used, one parallel and the other antiparallel to it. To cope with the pyrimidine interruptions, which weaken third strand binding, 5-methylcytosine and 5-propynyluracil were used in the third strand. Further, a six residue "hook" complementary to an overhang of a linear duplex target was added to the 5'-end of the third strand via a T(4) linker. In binding to the overhang by Watson-Crick pairing, the hook facilitates triplex formation. This third strand also binds specifically to the target within a supercoiled plasmid. The psoralen moiety at the 3'-end of the third strand forms photoadducts to the targeted T with high efficiency. Such monoadducts are known to preferentially trigger reversion of the mutation by DNA repair enzymes.

  17. Predicting the probability of H3K4me3 occupation at a base pair from the genome sequence context.

    Science.gov (United States)

    Ha, Misook; Hong, Soondo; Li, Wen-Hsiung

    2013-05-01

    Histone modifications regulate chromatin structure and gene expression. Although nucleosome formation is known to be affected by primary DNA sequence composition, no sequence signature has been identified for histone modifications. It is known that dense H3K4me3 nucleosome sites are accompanied by a low density of other nucleosomes and are associated with gene activation. This observation suggests a different sequence composition of H3K4me3 from other nucleosomes. To understand the relationship between genome sequence and chromatin structure, we studied DNA sequences at histone modification sites in various human cell types. We found sequence specificity for H3K4me3, but not for other histone modifications. Using the sequence specificities of H3 and H3K4me3 nucleosomes, we developed a model that computes the probability of H3K4me3 occupation at each base pair from the genome sequence context. A comparison of our predictions with experimental data suggests a high performance of our method, revealing a strong association between H3K4me3 and specific genomic DNA context. The high probability of H3K4me3 occupation occurs at transcription start and termination sites, exon boundaries and binding sites of transcription regulators involved in chromatin modification activities, including histone acetylases and enhancer- and insulator-associated factors. Thus, the human genome sequence contains signatures for chromatin modifications essential for gene regulation and development. Our method may be applied to find new sequence elements functioning by chromatin modulation. Software and supplementary data are available at Bioinformatics online.

  18. Predicting the probability of H3K4me3 occupation at a base pair from the genome sequence context

    Science.gov (United States)

    Ha, Misook; Hong, Soondo; Li, Wen-Hsiung

    2013-01-01

    Motivation: Histone modifications regulate chromatin structure and gene expression. Although nucleosome formation is known to be affected by primary DNA sequence composition, no sequence signature has been identified for histone modifications. It is known that dense H3K4me3 nucleosome sites are accompanied by a low density of other nucleosomes and are associated with gene activation. This observation suggests a different sequence composition of H3K4me3 from other nucleosomes. Approach: To understand the relationship between genome sequence and chromatin structure, we studied DNA sequences at histone modification sites in various human cell types. We found sequence specificity for H3K4me3, but not for other histone modifications. Using the sequence specificities of H3 and H3K4me3 nucleosomes, we developed a model that computes the probability of H3K4me3 occupation at each base pair from the genome sequence context. Results: A comparison of our predictions with experimental data suggests a high performance of our method, revealing a strong association between H3K4me3 and specific genomic DNA context. The high probability of H3K4me3 occupation occurs at transcription start and termination sites, exon boundaries and binding sites of transcription regulators involved in chromatin modification activities, including histone acetylases and enhancer- and insulator-associated factors. Thus, the human genome sequence contains signatures for chromatin modifications essential for gene regulation and development. Our method may be applied to find new sequence elements functioning by chromatin modulation. Availability: Software and supplementary data are available at Bioinformatics online. Contact: misook.ha@samsung.com or wli@uchicago.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23511541

  19. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine.

  20. Netropsin . dG-dG-dA-dA-dT-dT-dC-dC complex. Antibiotic binding at adenine . thymine base pairs in the minor groove of the self-complementary octanucleotide duplex.

    Science.gov (United States)

    Patel, D J

    1979-09-01

    The structure of the netropsin . dG-dG-dA-dA-dT-dT-dC-dC complex (one antibiotic molecule/self-complementary octanucleodide duplex) and its dynamics as a function of temperature have been monitored by the nuclear magnetic resonances of the Watson-Crick protons, the nonexchangeable base and sugar protons and the backbone phosphates. The antibiotic forms a complex with the nucleic acid duplex at the dA . dT-containing tetranucleotide segment dA-dA-dT-dT, with slow migration amongst potential binding sites at low temperature. The downfield shifts in the exchangeable protons of netropsin on complex formation demonstrate the contributions of hydrogen-bonding interactions between the antibiotic and the nucleic acid to the stability of the complex. Complex formation results in changes in the glycosidic torsion angles of both thymidine residues and one deoxyadenosine residue as monitored by chemical shift changes in the thymine C-6 and adenine C-8 protons. The close proximity of the pyrrole rings of the antibiotic and the base-pair edges in the minor groove is manifested in the downfield shifts (0.3--0.5 ppm) of the pyrrole C-3 protons of netropsin and one adenine C-2 proton and one thymine N-3 base-pair proton on complex formation. The internucleotide phosphates of the octanucleotide undergo 31P chemical shift changes on addition of netropsin and these may reflect, in part, contributions from electrostatic interactions between the charged ends of the antibiotic and the backbone phosphates of the nucleic acid.

  1. Using a pruned basis, a non-product quadrature grid, and the exact Watson normal-coordinate kinetic energy operator to solve the vibrational Schrödinger equation for C2H4

    Science.gov (United States)

    Avila, Gustavo; Carrington, Tucker

    2011-08-01

    In this paper we propose and test a method for computing numerically exact vibrational energy levels of a molecule with six atoms. We use a pruned product basis, a non-product quadrature, the Lanczos algorithm, and the exact normal-coordinate kinetic energy operator (KEO) with the πtμπ term. The Lanczos algorithm is applied to a Hamiltonian with a KEO for which μ is evaluated at equilibrium. Eigenvalues and eigenvectors obtained from this calculation are used as a basis to obtain the final energy levels. The quadrature scheme is designed, so that integrals for the most important terms in the potential will be exact. The procedure is tested on C2H4. All 12 coordinates are treated explicitly. We need only ˜1.52 × 108 quadrature points. A product Gauss grid with which one could calculate the same energy levels has at least 5.67 × 1013 points.

  2. Interplay of nonlinearity and geometry in a DNA-related, Klein-Gordon model with long-range dipole-dipole interaction

    DEFF Research Database (Denmark)

    Archilla, J. F.R.; Christiansen, Peter Leth; Gaididei, Yuri Borisovich

    2002-01-01

    Most of the studies on mathematical models of DNA are limited to next neighbor interaction. However, the coupling between base pairs is thought to be caused by dipole interaction, and, when the DNA strand is bent, the distances between base pairs become shorter, therefore the interactions with di...

  3. DPT tautomerization of the long A∙A Watson-Crick base pair formed by the amino and imino tautomers of adenine: combined QM and QTAIM investigation.

    Science.gov (United States)

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2013-10-01

    Combining quantum-mechanical (QM) calculations with quantum theory of atoms in molecules (QTAIM) and using the methodology of sweeps of the energetic, electron-topological, geometric and polar parameters, which describe the course of the tautomerization along the intrinsic reaction coordinate (IRC), we showed for the first time that the biologically important A∙A base pair (Cs symmetry) formed by the amino and imino tautomers of adenine (A) tautomerizes via asynchronous concerted double proton transfer (DPT) through a transition state (TS), which is the A(+)∙A(-) zwitterion with the separated charge, with Cs symmetry. The nine key points, which can be considered as electron-topological "fingerprints" of the asynchronous concerted A∙A ↔A ∙A tautomerization process via the DPT, were detected and completely investigated along the IRC of the A∙A*↔A*∙A tautomerization. Based on the sweeps of the H-bond energies, it was found that intermolecular antiparallel N6Н⋯N6 (7.01 kcal mol(-1)) and N1H⋯N1 (6.88 kcal mol(-1)) H-bonds are significantly cooperative and mutually reinforce each other. It was shown for the first time that the A∙A ↔A ∙A tautomerization is assisted by the third C2H⋯HC2 dihydrogen bond (DHB), which, in contrast to the two others N6H⋯N6 and N1H⋯N1 H-bonds, exists within the IRC range from -2.92 to 2.92 Å. The DHB cooperatively strengthens, reaching its maximum energy 0.42 kcal mol(-1) at IRC = -0.52 Å and minimum energy 0.25 kcal mol(-1) at IRC = -2.92 Å, and is accompanied by strengthening of the two other aforementioned classical H-bonds. We established that the C2H⋯HC2 DHB completely satisfies the electron-topological criteria for H-bonding, in particular Bader's and all eight "two-molecule" Koch and Popelier's criteria. The positive value of the Grunenberg's compliance constant (5.203 Å/mdyn) at the TSA∙A ↔A ∙A proves that the C2H⋯HC2 DHB is a stabilizing interaction. NBO analysis predicts transfer

  4. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs

    DEFF Research Database (Denmark)

    van Beest, M; Dooijes, D; van De Wetering, M

    2000-01-01

    Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment...

  5. Comprehensive evaluation of medium and long range correlated density functionals in TD-DFT investigation of DNA bases and base pairs: gas phase and water solution study

    Science.gov (United States)

    Shukla, Manoj K.; Leszczynski, Jerzy

    2010-11-01

    A comprehensive analysis of the performance of the TD-DFT method using different density functionals including recently developed medium and long-range correlation corrected density functionals have been carried out for lower-lying electronic singlet valence transitions of nucleic acid bases and the Watson-Crick base pairs in the gas phase and in the water solution. The standard 6-311++G(d,p) basis set was used. Ground state geometries of bases and base pairs were optimized at the M05-2X/6-311++G(d,p) level. The nature of potential energy surfaces (PES) was ascertained through the harmonic vibrational frequency analysis; all geometries were found to be minima at the respective PES. Electronic singlet vertical transition energies were also computed at the CC2/def2-TZVP level in the gas phase. The effect of state-specific water solvation on TD-DFT computed transition energies was considered using the PCM model. For the isolated bases the performance of the B3LYP functional was generally found to be superior among all functionals, but it measurably fails for charge-transfer states in the base pairs. The CC2/def2-TZVP computed transition energies were also revealed to be inferior compared with B3LYP results for the isolated bases. The performance of the ωB97XD, CAM-B3LYP and BMK functionals were found to be similar and comparable with the CC2 results for the isolated bases. However, for the Watson-Crick adenine-thymine and guanine-cytosine base pairs the performance of the ωB97XD functional was found to be the best among all the studied functionals in the present work in predicting the locally excited transitions as well as charge transfer states.

  6. Proximal disruption of base pairing of the second stem in the upper stem of pri-miR156a caused ambient temperature-sensitive flowering in Arabidopsis.

    Science.gov (United States)

    Kim, Wanhui; Jun, A Rim; Ahn, Ji Hoon

    2016-10-02

    MicroRNAs are generated from primary transcripts (pri-miRNAs) that form hairpin structures. Plant miRNAs play an important role in regulating flowering; however, little is known about the role of their structures in ambient temperature-responsive flowering. We recently showed that disruption of base pairing in the second stem (S2) in the upper stem of pri-miR156a caused hypersensitive flowering in response to ambient temperature changes. To further substantiate our findings on the role of S2 of pri-miR156a, we analyzed the effects of serial disruption (from the proximal or distal sides) of base-pairing in S2 of pri-miR156a on temperature-dependent flowering. We found that flowering time was gradually delayed with increasing size of the proximal disruption of S2 at 16°C. Particularly, disrupting base pairing of 5 nucleotides from the proximal side caused flowering to be hypersensitive to ambient temperature changes, which is similar to the phenotype of plants overexpressing pri-miR156a with a disruption of S2 (156-DBP-S2). However, disrupting base pairing from the distal side did not cause late flowering at 16°C and thus did not cause temperature-sensitive flowering. These results supported our notion that the second stem (S2) in the upper stem of pri-miR156a plays a role in the regulation of ambient temperature-responsive flowering.

  7. Non-Watson Crick base pairs might stabilize RNA structural motifs in ribozymes – A comparative study of group-I intron structures

    Indian Academy of Sciences (India)

    K Chandrasekhar; R Malathi

    2003-09-01

    In recent decades studies on RNA structure and function have gained significance due to discoveries on diversified functions of RNA. A common element for RNA secondary structure formed by series of non-Watson/Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural motifs in ribozymes, playing a crucial role in their enzymatic activity. To understand the functional significance of these non-canonical base pairs in catalytic RNA, we analysed the sequences of group-I introns from nuclear genes. The results suggest that they might form the building blocks of folded RNA motifs which are crucial to the catalytic activity of the ribozyme. The conservation of these, as observed from divergent organisms, argues for the presence of non-canonical base pairs as an important requisite for the structure and enzymatic property of ribozymes by enabling them to carry out functions such as replication, polymerase activity etc. in primordial conditions in the absence of proteins.

  8. Base-pair opening dynamics of the microRNA precursor pri-miR156a affect temperature-responsive flowering in Arabidopsis.

    Science.gov (United States)

    Kim, Hee-Eun; Kim, Wanhui; Lee, Ae-Ree; Jin, Suhyun; Jun, A Rim; Kim, Nak-Kyoon; Lee, Joon-Hwa; Ahn, Ji Hoon

    2017-03-18

    Internal and environmental cues, including ambient temperature changes, regulate the timing of flowering in plants. Arabidopsis miR156 represses flowering and plays an important role in the regulation of temperature-responsive flowering. However, the molecular basis of miR156 processing at lower temperatures remains largely unknown. Here, we performed nuclear magnetic resonance studies to investigate the base-pair opening dynamics of model RNAs at 16 °C and investigated the in vivo effects of the mutant RNAs on temperature-responsive flowering. The A9C and A10CG mutations in the B5 bulge of the lower stem of pri-miR156a stabilized the C15∙G98 and U16∙A97 base-pairs at the cleavage site of pri-miR156a at 16 °C. Consistent with this, production of mature miR156 was severely affected in plants overexpressing the A9C and A10CG constructs and these plants exhibited almost no delay in flowering at 16 °C. The A10G and A9AC mutations did not strongly affect C15∙G98 and U16∙A97 base-pairs at 16 °C, and plants overexpressing A10G and A9AC mutants of miR156 produced more mature miR156 than plants overexpressing the A9C and A10CG mutants and showed a strong delay in flowering at 16 °C. Interestingly, the A9AC mutation had distinct effects on the opening dynamics of the C15∙G98 and U16∙A97 base-pairs between 16 °C and 23 °C, and plants expressing the A9AC mutant miR156 showed only a moderate delay in flowering at 16 °C. Based on these results, we propose that fine-tuning of the base-pair stability at the cleavage site is essential for efficient processing of pri-miR156a at a low temperature and for reduced flowering sensitivity to ambient temperature changes. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Effect of LNA- and OMeN-modified oligonucleotide probes on the stability and discrimination of mismatched base pairs of duplexes

    Indian Academy of Sciences (India)

    Ying Yan; Jing Yan; Xianyu Piao; Tianbiao Zhang; Yifu Guan

    2012-06-01

    Locked nucleic acid (LNA) and 2′--methyl nucleotide (OMeN) are the most extensively studied nucleotide analogues. Although both LNA and OMeN are characterized by the C3′-endo sugar pucker conformation, which is dominant in A-form DNA and RNA nucleotides, they demonstrate different binding behaviours. Previous studies have focused attention on their properties of duplex stabilities, hybridization kinetics and resistance against nuclease digestion; however, their ability to discriminate mismatched hybridizations has been explored much less. In this study, LNA- and OMeN-modified oligonucleotide probes have been prepared and their effects on the DNA duplex stability have been examined: LNA modifications can enhance the duplex stability, whereas OMeN modifications reduce the duplex stability. Next, we studied how the LNA:DNA and OMeN:DNA mismatches reduced the duplex stability. Melting temperature measurement showed that different LNA:DNA or OMeN:DNA mismatches indeed influence the duplex stability differently. LNA purines can discriminate LNA:DNA mismatches more effectively than LNA pyrimidines as well as DNA nucleotides. Furthermore, we designed five LNA- and five OMeN-modified oligonucleotide probes to simulate realistic situations where target–probe duplexes contain a complementary LNA:DNA or OMeN:DNA base pairs and a DNA:DNA mismatch simultaneously. The measured collective effect showed that the duplex stability was enhanced by the complementary LNA:DNA base pair but decreased by the DNA:DNA mismatch in a position-dependent manner regardless of the chemical identity and position of the complementary LNA:DNA base pair. On the other hand, the OMeN-modified probes also showed that the duplex stability was reduced by both the OMeN modification and the OMeN:DNA mismatch in a position-dependent manner.

  10. Key Roles of Lewis Acid-base Pairs on ZnxZryOz in Direct Ethanol/Acetone to Isobutene Conversion

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Junming; Baylon, Rebecca A.; Liu, Changjun; Mei, Donghai; Martin, Kevin J.; Venkitasubramanian, Padmesh; Wang, Yong

    2016-01-20

    The effects of surface acidity on the cascade ethanol-to-isobutene conversion were studied using ZnxZryOz catalysts. The ethanol-to-isobutene reaction was found to be limited by the secondary reaction of the key intermediate, acetone, namely the acetone-to-isobutene reaction. Although the catalysts with coexisting Brønsted acidity could catalyze the rate-limiting acetone-to-isobutene reaction, the presence of Brønsted acidity is also detrimental. First, secondary isobutene isomerization is favored, producing a mixture of butene isomers. Second, undesired polymerization and coke formation prevail, leading to rapid catalyst deactivation. Most importantly, both steady-state and kinetic reaction studies as well as FTIR analysis of adsorbed acetone-d6 and D2O unambiguously showed that a highly active and selective nature of balanced Lewis acid-base pairs was masked by the coexisting Brønsted acidity in the aldolization and self-deoxygenation of acetone to isobutene. As a result, ZnxZryOz catalysts with only Lewis acid-base pairs were discovered, on which nearly a theoretical selectivity to isobutene (~88.9%) was successfully achieved, which has never been reported before. Moreover, the absence of Brønsted acidity in such ZnxZryOz catalysts also eliminates the side isobutene isomerization and undesired polymerization/coke reactions, resulting in the production of high purity isobutene with significantly improved catalyst stability (< 2% activity loss after 200 h time-on-stream). This work not only demonstrates a balanced Lewis acid-base pair for the highly active and selective cascade ethanol-to-isobutene reaction, but also sheds light on the rational design of selective and robust acid-base catalyst for C-C coupling via aldolization reaction.

  11. INTERACT

    DEFF Research Database (Denmark)

    Jochum, Elizabeth; Borggreen, Gunhild; Murphey, TD

    This paper considers the impact of visual art and performance on robotics and human-computer interaction and outlines a research project that combines puppetry and live performance with robotics. Kinesics—communication through movement—is the foundation of many theatre and performance traditions...... interaction between a human operator and an artificial actor or agent. We can apply insights from puppetry to develop culturally-aware robots. Here we describe the development of a robotic marionette theatre wherein robotic controllers assume the role of human puppeteers. The system has been built, tested...

  12. Electron attachment to the guanine-cytosine nucleic acid base pair and the effects of monohydration and proton transfer.

    Science.gov (United States)

    Gupta, Ashutosh; Jaeger, Heather M; Compaan, Katherine R; Schaefer, Henry F

    2012-05-17

    The guanine-cytosine (GC) radical anion and its interaction with a single water molecule is studied using ab initio and density functional methods. Z-averaged second-order perturbation theory (ZAPT2) was applied to GC radical anion for the first time. Predicted spin densities show that the radical character is localized on cytosine. The Watson-Crick monohydrated GC anion is compared to neutral GC·H2O, as well as to the proton-transferred analogue on the basis of structural and energetic properties. In all three systems, local minima are identified that correspond to water positioned in the major and minor grooves of macromolecular DNA. On the anionic surface, two novel structures have water positioned above or below the GC plane. On the neutral and anionic surfaces, the global minimum can be described as water interacting with the minor groove. These structures are predicted to have hydration energies of 9.7 and 11.8 kcal mol(-1), respectively. Upon interbase proton-transfer (PT), the anionic global minimum has water positioned in the major groove, and the hydration energy increases to 13.4 kcal mol(-1). PT GC·H2O(•-) has distonic character; the radical character resides on cytosine, while the negative charge is localized on guanine. The effects of proton transfer are further investigated through the computed adiabatic electron affinities (AEA) of GC and monohydrated GC, and the vertical detachment energies (VDE) of the corresponding anions. Monohydration increases the AEAs and VDEs by only 0.1 eV, while proton-transfer increases the VDEs substantially (0.8 eV). The molecular charge distribution of monohydrated guanine-cytosine radical anion depends heavily on interbase proton transfer.

  13. Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

    KAUST Repository

    Basset, Jean-Marie

    2016-06-09

    The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

  14. A nine-base pair deletion distinguishes two En/Spm transposon alleles in maize: Their genetic activity and molecular description

    Directory of Open Access Journals (Sweden)

    Menssen Adriane

    2008-01-01

    Full Text Available Two En/Spm-transposable element alleles of the A1 locus in maize (Zea mays are described. One of the alleles is al-m (papu, (PETERSON, 1961. The distinctive phenotype of this allele is characterized with pale and purple sectoring amidst large areas of no sectoring. The other allele, al-m (Au, appears full colored but is heavily mutating and expresses large colorless areas. These two alleles differ in the frequency of derivative products [al-m( papu-colorless and pale exceptions vs al- m(Au-mostly colorless exceptions]. A molecular description is provided in an attempt to explain these differences in phenotypes and derivative products. A nine-base-pair deficiency in Exon 2 of the A1 locus of the a1- m (papu allele originated following the origin of this allele and this deficiency is likely responsible for the differential phenotypes. The possible origin of this nine-base-pair deletion is discussed. .

  15. Interactions

    DEFF Research Database (Denmark)

    The main theme of this anthology is the unique interaction between mathematics, physics and philosophy during the beginning of the 20th century. Seminal theories of modern physics and new fundamental mathematical structures were discovered or formed in this period. Significant physicists...... such as Lorentz and Einstein as well as mathematicians such as Poincare, Minkowski, Hilbert and Weyl contributed to this development. They created the new physical theories and the mathematical disciplines that play such paramount roles in their mathematical formulations. These physicists and mathematicians were...

  16. Laboratory evolution of Geobacter sulfurreducens for enhanced growth on lactate via a single-base-pair substitution in a transcriptional regulator.

    Science.gov (United States)

    Summers, Zarath M; Ueki, Toshiyuki; Ismail, Wael; Haveman, Shelley A; Lovley, Derek R

    2012-05-01

    The addition of organic compounds to groundwater in order to promote bioremediation may represent a new selective pressure on subsurface microorganisms. The ability of Geobacter sulfurreducens, which serves as a model for the Geobacter species that are important in various types of anaerobic groundwater bioremediation, to adapt for rapid metabolism of lactate, a common bioremediation amendment, was evaluated. Serial transfer of five parallel cultures in a medium with lactate as the sole electron donor yielded five strains that could metabolize lactate faster than the wild-type strain. Genome sequencing revealed that all five strains had non-synonymous single-nucleotide polymorphisms in the same gene, GSU0514, a putative transcriptional regulator. Introducing the single-base-pair mutation from one of the five strains into the wild-type strain conferred rapid growth on lactate. This strain and the five adaptively evolved strains had four to eight-fold higher transcript abundance than wild-type cells for genes for the two subunits of succinyl-CoA synthase, an enzyme required for growth on lactate. DNA-binding assays demonstrated that the protein encoded by GSU0514 bound to the putative promoter of the succinyl-CoA synthase operon. The binding sequence was not apparent elsewhere in the genome. These results demonstrate that a single-base-pair mutation in a transcriptional regulator can have a significant impact on the capacity for substrate utilization and suggest that adaptive evolution should be considered as a potential response of microorganisms to environmental change(s) imposed during bioremediation.

  17. Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

    Science.gov (United States)

    Patel, D J; Canuel, L L

    1977-07-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

  18. A single base-pair change in 2009 H1N1 hemagglutinin increases human receptor affinity and leads to efficient airborne viral transmission in ferrets.

    Directory of Open Access Journals (Sweden)

    Akila Jayaraman

    Full Text Available The 2009 H1N1 influenza A virus continues to circulate among the human population as the predominant H1N1 subtype. Epidemiological studies and airborne transmission studies using the ferret model have shown that the transmission efficiency of 2009 H1N1 viruses is lower than that of previous seasonal strains and the 1918 pandemic H1N1 strain. We recently correlated this reduced transmission efficiency to the lower binding affinity of the 2009 H1N1 hemagglutinin (HA to α2→6 sialylated glycan receptors (human receptors. Here we report that a single point mutation (Ile219→Lys; a base pair change in the glycan receptor-binding site (RBS of a representative 2009 H1N1 influenza A virus, A/California/04/09 or CA04/09, quantitatively increases its human receptor-binding affinity. The increased human receptor-affinity is in the same range as that of the HA from highly transmissible seasonal and 1918 pandemic H1N1 viruses. Moreover, a 2009 H1N1 virus carrying this mutation in the RBS (generated using reverse genetics transmits efficiently in ferrets by respiratory droplets thereby reestablishing our previously observed correlation between human receptor-binding affinity and transmission efficiency. These findings are significant in the context of monitoring the evolution of the currently circulating 2009 H1N1 viruses.

  19. In-Phase Assembly of Slim DNA Lattices with Small Circular DNA Motifs via Short Connections of 11 and 16 Base Pairs.

    Science.gov (United States)

    Wang, Meng; Guo, Xin; Jiang, Chuan; Wang, Xuemei; Xiao, Shou-Jun

    2016-06-16

    Two kinds of stable motif were constructed: SAE (semi-crossover, antiparallel, even half-turns) tile from one small circular DNA molecule (42 or 64 nt) and two linear oligonucleotides; and DAE (double-crossover, antiparallel, even half-turns) tile from one small circular DNA molecule (42 or 64 nt) and four linear oligonucleotides. With the SAE tiles, in-phase assembly of SAE-E (SAE tiles with even half-turns as connections (-E)) with the shortest -E of 11 base pairs (bp) generated homogeneous nanotubes with an average length of over 14 μm and a diameter of 16-20 nm; with the DAE tiles, in-phase assembly of DAE-O (DAE tiles with odd half-turns as connections (-O)) with the shortest -O of 16 bp produced slim monolayer nanoyarns (25-30 nm wide), nanoscarfs (100-300 nm wide), and nanoribbons (∼100 nm wide). Interestingly, a phenomenon we term "knitting nanoyarns" into nanoscarfs was observed. Finally a curvature mechanism according to the ring rotation directions is suggested to explain the formation of nanotubes, wavy nanoyarns, nanoscarfs, and nanoribbons.

  20. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    Science.gov (United States)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-09-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology.

  1. CanScript, an 18-Base pair DNA sequence, boosts tumor cell-specific promoter activity: implications for targeted gene therapy.

    Science.gov (United States)

    Huang, Yu-Hung; Cozzitorto, Joseph A; Richards, Nathan G; Eltoukhy, Ahmed A; Yeo, Charles J; Langer, Robert; Anderson, Daniel G; Brody, Jonathan R; Sawicki, Janet A

    2010-11-01

    Gene therapy protocols for the treatment of cancer often employ gene promoter sequences that are known to be over-expressed in specific tumor cell types relative to normal cells. These promoters, while specific, are often weakly active. It would be desirable to increase the activity of such promoters, while at the same time retain specificity, so that the therapeutic gene is more robustly expressed. Using a luciferase reporter DNA construct in both in vitro cell transfection assays and in vivo mouse tumor models, we have determined that in the absence of any other DNA sequence, a previously identified 18-base pair enhancer sequence called CanScript, lying upstream of the MSLN gene, has ~25% of the promoter activity of CAG, a very strong non-specific promoter/enhancer, in tumor cells in which MSLN is highly expressed. Furthermore, tandem repeat copies of CanScript enhance transcription in a dose-dependent manner and, when coupled with promoter sequences that are active in tumor cells, increase promoter activity. These findings suggest that the incorporation of CanScript into gene constructs may have application in enhancing activity of promoters used in cancer-targeting gene therapy strategies, thereby improving therapeutic efficacy.

  2. HIV-1 frameshift efficiency is primarily determined by the stability of base pairs positioned at the mRNA entrance channel of the ribosome.

    Science.gov (United States)

    Mouzakis, Kathryn D; Lang, Andrew L; Vander Meulen, Kirk A; Easterday, Preston D; Butcher, Samuel E

    2013-02-01

    The human immunodeficiency virus (HIV) requires a programmed -1 ribosomal frameshift for Pol gene expression. The HIV frameshift site consists of a heptanucleotide slippery sequence (UUUUUUA) followed by a spacer region and a downstream RNA stem-loop structure. Here we investigate the role of the RNA structure in promoting the -1 frameshift. The stem-loop was systematically altered to decouple the contributions of local and overall thermodynamic stability towards frameshift efficiency. No correlation between overall stability and frameshift efficiency is observed. In contrast, there is a strong correlation between frameshift efficiency and the local thermodynamic stability of the first 3-4 bp in the stem-loop, which are predicted to reside at the opening of the mRNA entrance channel when the ribosome is paused at the slippery site. Insertion or deletions in the spacer region appear to correspondingly change the identity of the base pairs encountered 8 nt downstream of the slippery site. Finally, the role of the surrounding genomic secondary structure was investigated and found to have a modest impact on frameshift efficiency, consistent with the hypothesis that the genomic secondary structure attenuates frameshifting by affecting the overall rate of translation.

  3. Base-pair-resolution genome-wide mapping of active RNA polymerases using precision nuclear run-on (PRO-seq).

    Science.gov (United States)

    Mahat, Dig Bijay; Kwak, Hojoong; Booth, Gregory T; Jonkers, Iris H; Danko, Charles G; Patel, Ravi K; Waters, Colin T; Munson, Katie; Core, Leighton J; Lis, John T

    2016-08-01

    We provide a protocol for precision nuclear run-on sequencing (PRO-seq) and its variant, PRO-cap, which map the location of active RNA polymerases (PRO-seq) or transcription start sites (TSSs) (PRO-cap) genome-wide at high resolution. The density of RNA polymerases at a particular genomic locus directly reflects the level of nascent transcription at that region. Nuclei are isolated from cells and, under nuclear run-on conditions, transcriptionally engaged RNA polymerases incorporate one or, at most, a few biotin-labeled nucleotide triphosphates (biotin-NTPs) into the 3' end of nascent RNA. The biotin-labeled nascent RNA is used to prepare sequencing libraries, which are sequenced from the 3' end to provide high-resolution positional information for the RNA polymerases. PRO-seq provides much higher sensitivity than ChIP-seq, and it generates a much larger fraction of usable sequence reads than ChIP-seq or NET-seq (native elongating transcript sequencing). Similarly to NET-seq, PRO-seq maps the RNA polymerase at up to base-pair resolution with strand specificity, but unlike NET-seq it does not require immunoprecipitation. With the protocol provided here, PRO-seq (or PRO-cap) libraries for high-throughput sequencing can be generated in 4-5 working days. The method has been applied to human, mouse, Drosophila melanogaster and Caenorhabditis elegans cells and, with slight modifications, to yeast.

  4. Use of Nucleic Acid Analogs for the Study of Nucleic Acid Interactions

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2011-01-01

    Full Text Available Unnatural nucleosides have been explored to expand the properties and the applications of oligonucleotides. This paper briefly summarizes nucleic acid analogs in which the base is modified or replaced by an unnatural stacking group for the study of nucleic acid interactions. We also describe the nucleoside analogs of a base pair-mimic structure that we have examined. Although the base pair-mimic nucleosides possess a simplified stacking moiety of a phenyl or naphthyl group, they can be used as a structural analog of Watson-Crick base pairs. Remarkably, they can adopt two different conformations responding to their interaction energies, and one of them is the stacking conformation of the nonpolar aromatic group causing the site-selective flipping of the opposite base in a DNA double helix. The base pair-mimic nucleosides can be used to study the mechanism responsible for the base stacking and the flipping of bases out of a nucleic acid duplex.

  5. UtroUp is a novel six zinc finger artificial transcription factor that recognises 18 base pairs of the utrophin promoter and efficiently drives utrophin upregulation

    Directory of Open Access Journals (Sweden)

    Onori Annalisa

    2013-01-01

    Full Text Available Abstract Background Duchenne muscular dystrophy (DMD is the most common X-linked muscle degenerative disease and it is due to the absence of the cytoskeletal protein dystrophin. Currently there is no effective treatment for DMD. Among the different strategies for achieving a functional recovery of the dystrophic muscle, the upregulation of the dystrophin-related gene utrophin is becoming more and more feasible. Results We have previously shown that the zinc finger-based artificial transcriptional factor “Jazz” corrects the dystrophic pathology in mdx mice by upregulating utrophin gene expression. Here we describe a novel artificial transcription factor, named “UtroUp”, engineered to further improve the DNA-binding specificity. UtroUp has been designed to recognise an extended DNA target sequence on both the human and mouse utrophin gene promoters. The UtroUp DNA-binding domain contains six zinc finger motifs in tandem, which is able to recognise an 18-base-pair DNA target sequence that statistically is present only once in the human genome. To achieve a higher transcriptional activation, we coupled the UtroUp DNA-binding domain with the innovative transcriptional activation domain, which was derived from the multivalent adaptor protein Che-1/AATF. We show that the artificial transcription factor UtroUp, due to its six zinc finger tandem motif, possesses a low dissociation constant that is consistent with a strong affinity/specificity toward its DNA-binding site. When expressed in mammalian cell lines, UtroUp promotes utrophin transcription and efficiently accesses active chromatin promoting accumulation of the acetylated form of histone H3 in the utrophin promoter locus. Conclusions This novel artificial molecule may represent an improved platform for the development of future applications in DMD treatment.

  6. A one base pair deletion in the canine ATP13A2 gene causes exon skipping and late-onset neuronal ceroid lipofuscinosis in the Tibetan terrier.

    Directory of Open Access Journals (Sweden)

    Anne Wöhlke

    2011-10-01

    Full Text Available Neuronal ceroid lipofuscinosis (NCL is a progressive neurodegenerative disease characterized by brain and retinal atrophy and the intracellular accumulation of autofluorescent lysosomal storage bodies resembling lipofuscin in neurons and other cells. Tibetan terriers show a late-onset lethal form of NCL manifesting first visible signs at 5-7 years of age. Genome-wide association analyses for 12 Tibetan-terrier-NCL-cases and 7 Tibetan-terrier controls using the 127K canine Affymetrix SNP chip and mixed model analysis mapped NCL to dog chromosome (CFA 2 at 83.71-84.72 Mb. Multipoint linkage and association analyses in 376 Tibetan terriers confirmed this genomic region on CFA2. A mutation analysis for 14 positional candidate genes in two NCL-cases and one control revealed a strongly associated single nucleotide polymorphism (SNP in the MAPK PM20/PM21 gene and a perfectly with NCL associated single base pair deletion (c.1620delG within exon 16 of the ATP13A2 gene. The c.1620delG mutation in ATP13A2 causes skipping of exon 16 presumably due to a broken exonic splicing enhancer motif. As a result of this mutation, ATP13A2 lacks 69 amino acids. All known 24 NCL cases were homozygous for this deletion and all obligate 35 NCL-carriers were heterozygous. In a sample of 144 dogs from eleven other breeds, the c.1620delG mutation could not be found. Knowledge of the causative mutation for late-onset NCL in Tibetan terrier allows genetic testing of these dogs to avoid matings of carrier animals. ATP13A2 mutations have been described in familial Parkinson syndrome (PARK9. Tibetan terriers with these mutations provide a valuable model for a PARK9-linked disease and possibly for manganese toxicity in synucleinopathies.

  7. Analysis and Simulation of the Simplified Aircraft-Based Paired Approach Concept With the ALAS Alerting Algorithm in Conjunction With Echelon and Offset Strategies

    Science.gov (United States)

    Torres-Pomales, Wilfredo; Madden, Michael M.; Butler, Rickey W.; Perry, Raleigh B.

    2014-01-01

    This report presents analytical and simulation results of an investigation into proposed operational concepts for closely spaced parallel runways, including the Simplified Aircraft-based Paired Approach (SAPA) with alerting and an escape maneuver, MITRE?s echelon spacing and no escape maneuver, and a hybrid concept aimed at lowering the visibility minima. We found that the SAPA procedure can be used at 950 ft separations or higher with next-generation avionics and that 1150 ft separations or higher is feasible with current-rule compliant ADS-B OUT. An additional 50 ft reduction in runway separation for the SAPA procedure is possible if different glideslopes are used. For the echelon concept we determined that current generation aircraft cannot conduct paired approaches on parallel paths using echelon spacing on runways less than 1400 ft apart and next-generation aircraft will not be able to conduct paired approach on runways less than 1050 ft apart. The hybrid concept added alerting and an escape maneuver starting 1 NM from the threshold when flying the echelon concept. This combination was found to be effective, but the probability of a collision can be seriously impacted if the turn component of the escape maneuver has to be disengaged near the ground (e.g. 300 ft or below) due to airport buildings and surrounding terrain. We also found that stabilizing the approach path in the straight-in segment was only possible if the merge point was at least 1.5 to 2 NM from the threshold unless the total system error can be sufficiently constrained on the offset path and final turn.

  8. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni

    2017-06-12

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  9. A novel mechanism of high-level, broad-spectrum antibiotic resistance caused by a single base pair change in Neisseria gonorrhoeae.

    Science.gov (United States)

    Ohneck, Elizabeth A; Zalucki, Yaramah M; Johnson, Paul J T; Dhulipala, Vijaya; Golparian, Daniel; Unemo, Magnus; Jerse, Ann E; Shafer, William M

    2011-01-01

    aid in the development of new antimicrobial therapies and genetic methods for antimicrobial resistance testing. This study was undertaken to characterize a novel mechanism of antibiotic resistance regulation in N. gonorrhoeae. Here we show that a single base pair mutation generates a second, stronger promoter for mtrCDE transcription that acts independently of the known efflux system regulators and results in high-level antimicrobial resistance.

  10. The physico-chemical mechanism of the tautomerisation via the DPT of the long Hyp∗·Hyp Watson-Crick base pair containing rare tautomer: A QM and QTAIM detailed look

    Science.gov (United States)

    Brovarets', Ol'ha O.; Zhurakivsky, Roman O.; Hovorun, Dmytro M.

    2013-07-01

    We showed that biologically important planar Hyp∗·Hyp base pair (Cs) formed by the enol and keto tautomers of the hypoxanthine tautomerises via the synchronous concerted mechanism through the TS (C2v). The five key points were detected and completely investigated along the IRC of the Hyp∗·Hyp ↔ Hyp·Hyp∗ tautomerisation via the DPT. It was found that intermolecular antiparallel О6Н…О6 and N1H…N1 H-bonds are cooperative and mutually reinforce each other. It was proved that the Hyp∗·Hyp/Hyp·Hyp∗ base pair is dynamically stable structure with a lifetime 8.2 × 10-12 s and all its six low-frequency intermolecular vibrations are able to develop during this period of time.

  11. Repairing the Sickle Cell mutation. III. Effect of irradiation wavelength on the specificity and type of photoproduct formed by a 3′-terminal psoralen on a third strand directed to the mutant base pair

    Science.gov (United States)

    Broitman, Steven L.; Amosova, Olga; Fresco, Jacques R.

    2003-01-01

    Using a psoralen delivery system mediated by a DNA third strand that binds selectively to linear target duplexes immediately downstream from the Sickle Cell β-globin gene mutation and the comparable wild-type β-globin gene sequence, the kinetics of formation and yield of psoralen monoadducts and crosslinks with pyrimidine residues at and near the mutant base pair site and its wild-type counterpart were determined. By exploiting irradiation specificities at 300, 365 and 419 nm, it was possible to evaluate the orientation equilibrium of 3′-linked intercalated psoralen and to develop conditions that lead to preferential formation of each type of photoproduct in both the mutant and wild-type sequences. This makes possible the preparation of each type of photoproduct for use as a substrate for DNA repair. In this way, the base pair change(s) that each generates can be established. PMID:12907707

  12. Repairing the Sickle Cell mutation. III. Effect of irradiation wavelength on the specificity and type of photoproduct formed by a 3'-terminal psoralen on a third strand directed to the mutant base pair.

    Science.gov (United States)

    Broitman, Steven L; Amosova, Olga; Fresco, Jacques R

    2003-08-15

    Using a psoralen delivery system mediated by a DNA third strand that binds selectively to linear target duplexes immediately downstream from the Sickle Cell beta-globin gene mutation and the comparable wild-type beta-globin gene sequence, the kinetics of formation and yield of psoralen monoadducts and crosslinks with pyrimidine residues at and near the mutant base pair site and its wild-type counterpart were determined. By exploiting irradiation specificities at 300, 365 and 419 nm, it was possible to evaluate the orientation equilibrium of 3'-linked intercalated psoralen and to develop conditions that lead to preferential formation of each type of photoproduct in both the mutant and wild-type sequences. This makes possible the preparation of each type of photoproduct for use as a substrate for DNA repair. In this way, the base pair change(s) that each generates can be established.

  13. Evidence for Hoogsteen GC Base Pairs in the Proton-Induced Transition from Right-Handed to Left-Handed Poly(dG-dC) . Poly(dG-dC)

    NARCIS (Netherlands)

    Segers-Nolten, Gezina M.J.; Sijtsema, N.M.; Otto, Cornelis

    1997-01-01

    The structure of double-helical poly(dG-dC)·poly(dG-dC) is investigated at various pH values with Raman spectroscopy, absorption spectroscopy, and circular dichroism. A comparison is made between the B-form with Watson−Crick base pairing at 1 mM [Na+] and pH 7.2, the Z-form with Watson−Crick base

  14. Evidence for Hoogsteen GC Base Pairs in the Proton-Induced Transition from Right-Handed to Left-Handed Poly(dG-dC)·Poly(dG-dC)

    NARCIS (Netherlands)

    Segers-Nolten, G.M.J.; Sijtsema, N.M.; Otto, C.

    1997-01-01

    The structure of double-helical poly(dG-dC)·poly(dG-dC) is investigated at various pH values with Raman spectroscopy, absorption spectroscopy, and circular dichroism. A comparison is made between the B-form with Watson−Crick base pairing at 1 mM [Na+] and pH 7.2, the Z-form with Watson−Crick base pa

  15. Site-directed spin-labeling of DNA by the azide-alkyne 'click' reaction: nanometer distance measurements on 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine nitroxide conjugates spatially separated or linked to a 'dA-dT' base pair.

    Science.gov (United States)

    Ding, Ping; Wunnicke, Dorith; Steinhoff, Heinz-Jürgen; Seela, Frank

    2010-12-27

    Nucleobase-directed spin-labeling by the azide-alkyne 'click' (CuAAC) reaction has been performed for the first time with oligonucleotides. 7-Deaza-7-ethynyl-2'-deoxyadenosine (1) and 5-ethynyl-2'-deoxyuridine (2) were chosen to incorporate terminal triple bonds into DNA. Oligonucleotides containing 1 or 2 were synthesized on a solid phase and spin labeling with 4-azido-2,2,6,6-tetramethylpiperidine 1-oxyl (4-azido-TEMPO, 3) was performed by post-modification in solution. Two spin labels (3) were incorporated with high efficiency into the DNA duplex at spatially separated positions or into a 'dA-dT' base pair. Modification at the 5-position of the pyrimidine base or at the 7-position of the 7-deazapurine residue gave steric freedom to the spin label in the major groove of duplex DNA. By applying cw and pulse EPR spectroscopy, very accurate distances between spin labels, within the range of 1-2 nm, were measured. The spin-spin distance was 1.8±0.2 nm for DNA duplex 17(dA*(7,10))⋅11 containing two spin labels that are separated by two nucleotides within one individual strand. A distance of 1.4±0.2 nm was found for the spin-labeled 'dA-dT' base pair 15(dA*(7))⋅16(dT*(6)). The 'click' approach has the potential to be applied to all four constituents of DNA, which indicates the universal applicability of the method. New insights into the structural changes of canonical or modified DNA are expected to provide additional information on novel DNA structures, protein interaction, DNA architecture, and synthetic biology.

  16. Density-fitted open-shell symmetry-adapted perturbation theory and application to π-stacking in benzene dimer cation and ionized DNA base pair steps

    Science.gov (United States)

    Gonthier, Jérôme F.; Sherrill, C. David

    2016-10-01

    Symmetry-Adapted Perturbation Theory (SAPT) is one of the most popular approaches to energy component analysis of non-covalent interactions between closed-shell systems, yielding both accurate interaction energies and meaningful interaction energy components. In recent years, the full open-shell equations for SAPT up to second-order in the intermolecular interaction and zeroth-order in the intramolecular correlation (SAPT0) were published [P. S. Zuchowski et al., J. Chem. Phys. 129, 084101 (2008); M. Hapka et al., ibid. 137, 164104 (2012)]. Here, we utilize density-fitted electron repulsion integrals to produce an efficient computational implementation. This approach is used to examine the effect of ionization on π-π interactions. For the benzene dimer radical cation, comparison against reference values indicates a good performance for open-shell SAPT0, except in cases with substantial charge transfer. For π stacking between hydrogen-bonded pairs of nucleobases, dispersion interactions still dominate binding, in spite of the creation of a positive charge.

  17. RNA-RNA interaction prediction based on multiple sequence alignments

    CERN Document Server

    Li, Andrew X; Qin, Jing; Reidys, Christian M

    2010-01-01

    Recently, $O(N^6)$ time and $O(N^4)$ space dynamic programming algorithms have become available that compute the partition function of RNA-RNA interaction complexes for pairs of RNA sequences. These algorithms and the biological requirement of more reliable interactions motivate to utilize the additional information contained in multiple sequence alignments and to generalize the above framework to the partition function and base pairing probabilities for multiple sequence alignments.

  18. Rapid detection of the H275Y oseltamivir resistance mutation in influenza A/H1N1 2009 by single base pair RT-PCR and high-resolution melting.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available INTRODUCTION: We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses. FINDINGS: A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay. CONCLUSIONS: The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.

  19. Role of Electron-Driven Proton-Transfer Processes in the Ultrafast Deactivation of Photoexcited Anionic 8-oxoGuanine-Adenine and 8-oxoGuanine-Cytosine Base Pairs.

    Science.gov (United States)

    Wu, Xiuxiu; Karsili, Tolga N V; Domcke, Wolfgang

    2017-01-14

    It has been reported that 8-oxo-7,8-dihydro-guanosine (8-oxo-G), which is the main product of oxidative damage of DNA, can repair cyclobutane pyrimidine dimer (CPD) lesions when incorporated into DNA or RNA strands in proximity to such lesions. It has therefore been suggested that the 8-oxo-G nucleoside may have been a primordial precursor of present-day flavins in DNA or RNA repair. Because the electron transfer leading to the splitting of a thymine-thymine pair in a CPD lesion occurs in the photoexcited state, a reasonably long excited-state lifetime of 8-oxo-G is required. The neutral (protonated) form of 8-oxo-G exhibits a very short (sub-picosecond) intrinsic excited-state lifetime which is unfavorable for repair. It has therefore been argued that the anionic (deprotonated) form of 8-oxo-G, which exhibits a much longer excited-state lifetime, is more likely to be a suitable cofactor for DNA repair. Herein, we have investigated the exited-state quenching mechanisms in the hydrogen-bonded complexes of deprotonated 8-oxo-G(-) with adenine (A) and cytosine (C) using ab initio wave-function-based electronic-structure calculations. The calculated reaction paths and potential-energy profiles reveal the existence of barrierless electron-driven inter-base proton-transfer reactions which lead to low-lying S₁/S₀ conical intersections. The latter can promote ultrafast excited-state deactivation of the anionic base pairs. While the isolated deprotonated 8-oxo-G(-) nucleoside may have been an efficient primordial repair cofactor, the excited states of the 8-oxo-G(-)-A and 8-oxo-G(-)-C base pairs are likely too short-lived to be efficient electron-transfer repair agents.

  20. Studies of interaction between safranine T and double helix DNA by spectral methods.

    Science.gov (United States)

    Cao, Y; He, X W

    1998-06-01

    In this paper, the DNA affinity properties of Safranine T (ST), which features a phenazinyl group, were studied. The studies indicated that ST could intercalate into the stack base pairs of DNA. Intrinsic binding constants obtained by different spectral methods were consistent within experimental errors. They were of the order of 10(4) M-1 in DNA base pairs, and the binding site size was about 7 in DNA base pairs. Studies of fluorescence quenching by anionic quenchers and melting temperature of DNA all supported the intercalative binding of ST with DNA. The experiments also showed that electrostatic binding played an important role in the interaction of ST with DNA. This research offers a new intercalation functional group to DNA-targeted drug design.

  1. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  2. Abnormal secretion and function of recombinant human factor VII as the result of modification to a calcium binding site caused by a 15-base pair insertion in the F7 gene.

    Science.gov (United States)

    Peyvandi, F; Carew, J A; Perry, D J; Hunault, M; Khanduri, U; Perkins, S J; Mannucci, P M; Bauer, K A

    2001-02-15

    A case of a novel mutation in the F7 gene that results in factor VII coagulant activity (VII:c) of less than 1% and VII antigen (VII:Ag) levels of 10% is presented. DNA analysis revealed a homozygous 15-base pair (bp) in-frame insertion-type mutation at nucleotide 10554. This insertion consisted of a duplication of residues leucine (L)213 to aspartic acid (D)217 (leucine, serine, glutamic acid, histidine, and aspartic acid), probably arising by slipped mispairing between 2 copies of a direct repeat (GCGAGCACGAC) separated by 4 bp. Molecular graphic analyses showed that the insertion is located at the surface of the catalytic domain in an exposed loop stabilized by extensive salt-bridge and hydrogen bond formation at which the calcium binding site is located. The mutation probably interferes with protein folding during VII biosynthesis and/or diminishes functional activity through the loss of calcium binding. In vitro expression studies demonstrated that the levels of VII:Ag in lysates of cells transfected with wild type VII (VIIWT) were equivalent to those with mutant type VII (VIIMT), but the level of secreted VIIMT was 5% to 10% that of VIIWT. Pulse chase studies demonstrated that VIIMT did not accumulate intracellularly, and studies with inhibitors of protein degradation showed that recombinant VIIMT was partially degraded in the pre-Golgi compartment. Accordingly, only small amounts of VIIMT with undetectable procoagulant activity were secreted into conditioned media. These results demonstrate that a combination of secretion and functional defects is the mechanism whereby this insertion causes VII deficiency.

  3. Fapy-G对碱基氢键复合物影响的理论研究%Theoretical Studies on the Effect of Fapy-G on Base Pair Hydrogen Bond Complexes

    Institute of Scientific and Technical Information of China (English)

    刘翠; 张千慧; 宫利东; 卢丽男; 杨忠志

    2014-01-01

    One of the primary oxidative DNA damage is 2,6-diamino-4-hydroxy-5-formamido pyrimidine, named Fapy-guanine(Fapy-G), which is the product of guanine oxidized at C8. The properties of 20 oxidative base pairs which contains Fapy-G were investigated via quantum chemistry methods. All model molecular structures were optimized with B3 LYP/6-31+G* method and the frequency calculations were carried out to confirm that all the structures obtains were geometrically stable. The energies were determined at the MP2/aug-cc-pVDZ level with BSSE corrections. The calculation results show that N7, N9 became hydrogen bond donor from accepter. Natural atomic charge of N7, N9 and O6 get more negative. The ability of O6 as H-bond donor enhanced. The bond lengths of C5—N7 and N7—C8 were increased by 0. 0045 and 0. 0063 nm, C4—N9 was decreased by 0. 0015 nm. Compared with bases monomers, natural atomic charge of proton acceptors in hydrogen bond complexes increased by 0. 05 e averagely, which is 8% of the original charge;natural atomic charges for proton donors have a decrease of 0. 02 e, which is 4% of the original charge. Com-pared with Fapy-G, when the N atom in Fapy-G six-membered ring was formed H-bond, the ring breathing and N-para-C vibrational frequencies were blue shifts. The vibrational frequencies were related to H-bond red shifts in all the base pairs. NH…N is stronger than NH…O in all the base pairs and in NH…N the hydrogen bond energy of donor N atom in six-membered ring are bigger than donor N atom in NH2 or open-ring. When Fapy-G pairs with base A, the binding energy region order is 1>2>4>3. When Fapy-G pairs with base T(R), the binding energy region order is 3=4>1>2. In water solvent, the binding energies of Fapy-G pairs with base C reduced to 41. 84—58. 58 kJ/mol, and the order of the binding energy was changed.%应用量子化学方法对2,6-二氨基-4-羟基-5-甲酰胺嘧啶( Fapy-G)与正常碱基作用形成的20种氧化碱基对的多种性质进

  4. Influence of packing interactions on the average conformation of B-DNA in crystalline structures.

    Science.gov (United States)

    Tereshko, V; Subirana, J A

    1999-04-01

    The molecular interactions in crystals of oligonucleotides in the B form have been analysed and in particular the end-to-end interactions. Phosphate-phosphate interactions in dodecamers are also reviewed. A strong influence of packing constraints on the average conformation of the double helix is found. There is a strong relationship between the space group, the end-to-end interactions and the average conformation of DNA. Dodecamers must have a B-form average conformation with 10 +/- 0.1 base pairs per turn in order to crystallize in the P212121 and related space groups usually found. Decamers show a wider range of conformational variation, with 9.7-10. 6 base pairs per turn, depending on the terminal sequence and the space group. The influence of the space group in decamers is quite striking and remains unexplained. Only small variations are allowed in each case. Thus, crystal packing is strongly related to the average DNA conformation in the crystals and deviations from the average are rather limited. The constraints imposed by the crystal lattice explain why the average twist of the DNA in solution (10.6 base pairs per turn) is seldom found in oligonucleotides crystallized in the B form.

  5. Nonlinear Model of the Specificity of DNA-Protein Interactions and Its Stability

    Science.gov (United States)

    Dwiputra, D.; Hidayat, W.; Khairani, R.; Zen, F. P.

    2016-08-01

    Specific DNA-protein interactions are fundamental processes of living cells. We propose a new model of DNA-protein interactions to explain the site specificity of the interactions. The hydrogen bonds between DNA base pairs and between DNA-protein peptide groups play a significant role in determination of the specific binding site. We adopt the Morse potential with coupling terms to construct the Hamiltonian of coupled oscillators representing the hydrogen bonds in which the depth of the potentials vary in the DNA chain. In this paper we investigate the stability of the model to determine the conditions satisfying the biological circumstances of the DNA-protein interactions.

  6. Optimal definition of inter-residual contact in globular proteins based on pairwise interaction energy calculations, its robustness, and applications.

    Science.gov (United States)

    Fačkovec, Boris; Vondrášek, Jiří

    2012-10-25

    Although a contact is an essential measurement for the topology as well as strength of non-covalent interactions in biomolecules and their complexes, there is no general agreement in the definition of this feature. Most of the definitions work with simple geometric criteria which do not fully reflect the energy content or ability of the biomolecular building blocks to arrange their environment. We offer a reasonable solution to this problem by distinguishing between "productive" and "non-productive" contacts based on their interaction energy strength and properties. We have proposed a method which converts the protein topology into a contact map that represents interactions with statistically significant high interaction energies. We do not prove that these contacts are exclusively stabilizing, but they represent a gateway to thermodynamically important rather than geometry-based contacts. The process is based on protein fragmentation and calculation of interaction energies using the OPLS force field and relies on pairwise additivity of amino acid interactions. Our approach integrates the treatment of different types of interactions, avoiding the problems resulting from different contributions to the overall stability and the different effect of the environment. The first applications on a set of homologous proteins have shown the usefulness of this classification for a sound estimate of protein stability.

  7. Hierarchical folding of multiple sequence alignments for the prediction of structures and RNA-RNA interactions

    Directory of Open Access Journals (Sweden)

    Gorodkin Jan

    2010-05-01

    Full Text Available Abstract Background Many regulatory non-coding RNAs (ncRNAs function through complementary binding with mRNAs or other ncRNAs, e.g., microRNAs, snoRNAs and bacterial sRNAs. Predicting these RNA interactions is essential for functional studies of putative ncRNAs or for the design of artificial RNAs. Many ncRNAs show clear signs of undergoing compensating base changes over evolutionary time. Here, we postulate that a non-negligible part of the existing RNA-RNA interactions contain preserved but covarying patterns of interactions. Methods We present a novel method that takes compensating base changes across the binding sites into account. The algorithm works in two steps on two pre-generated multiple alignments. In the first step, individual base pairs with high reliability are found using the PETfold algorithm, which includes evolutionary and thermodynamic properties. In step two (where high reliability base pairs from step one are constrained as unpaired, the principle of cofolding is combined with hierarchical folding. The final prediction of intra- and inter-molecular base pairs consists of the reliabilities computed from the constrained expected accuracy scoring, which is an extended version of that used for individual multiple alignments. Results We derived a rather extensive algorithm. One of the advantages of our approach (in contrast to other RNA-RNA interaction prediction methods is the application of covariance detection and prediction of pseudoknots between intra- and inter-molecular base pairs. As a proof of concept, we show an example and discuss the strengths and weaknesses of the approach.

  8. Transcription factors mediate long-range enhancer-promoter interactions.

    Science.gov (United States)

    Nolis, Ilias K; McKay, Daniel J; Mantouvalou, Eva; Lomvardas, Stavros; Merika, Menie; Thanos, Dimitris

    2009-12-01

    We examined how remote enhancers establish physical communication with target promoters to activate gene transcription in response to environmental signals. Although the natural IFN-beta enhancer is located immediately upstream of the core promoter, it also can function as a classical enhancer element conferring virus infection-dependent activation of heterologous promoters, even when it is placed several kilobases away from these promoters. We demonstrated that the remote IFN-beta enhancer "loops out" the intervening DNA to reach the target promoter. These chromatin loops depend on sequence-specific transcription factors bound to the enhancer and the promoter and thus can explain the specificity observed in enhancer-promoter interactions, especially in complex genetic loci. Transcription factor binding sites scattered between an enhancer and a promoter can work as decoys trapping the enhancer in nonproductive loops, thus resembling insulator elements. Finally, replacement of the transcription factor binding sites involved in DNA looping with those of a heterologous prokaryotic protein, the lambda repressor, which is capable of loop formation, rescues enhancer function from a distance by re-establishing enhancer-promoter loop formation.

  9. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA.

    Science.gov (United States)

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R

    2009-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure.

  10. Synthesis of Novel Metal Ion Sensors Based on DNA-Metal Interactions

    Institute of Scientific and Technical Information of China (English)

    Akira Ono; Shiqi Cao; Humika Togashi; Yoko Miyake

    2005-01-01

    @@ 1Introduction The interactions of metal ions with nucleic acids, nucleosides, and nucleo-bases have been extensively investigated[1,2]. We have reported that thymine-thymine (T-T) and cytosine-cytosine (C- C) miss base pairs in DNA duplexes highly selectively capture HgⅡ ion and Ag Ⅰ ion, which result in formations of metal-mediated base pairs, T-HgⅡ -T and C-AgⅠ -C, in duplexes[3]. The phenomenon is expected to be useful for a variety of studies such as synthesis of nano-wires containing metal ions, developing metal-ion sensing methods, etc.Here, we report novel oligodeoxyribonucleotide (ODN)-based sensors that detect HgⅡ ions and AgⅠ ions in aqueous solutions.

  11. Study on the interaction of anticancer drug mitoxantrone with DNA by fluorescence and Raman spectroscopies

    Institute of Scientific and Technical Information of China (English)

    Lingjuan Tang; Zhenrong Sun; Jianyu Guo; Zugeng Wang

    2006-01-01

    @@ Mitoxantrone, a clinically useful antitumour antibiotic for leukaemia and breast cancer, has received more attentions. In this paper, the interaction between mitoxantrone and calf thymus DNA is investigated by Raman and fluorescence spectroscopies, and the binding site of mitoxantrone to calf thymus DNA is explored. The results showed that mitoxantrone interacts with calf thymus DNA bases by the intercalation of anthracycline into the base pair plane of adenine (A) and thymine (T), and it results in the disruption of the hydrogen bonds between calf thymus DNA bases, and thus the calf thymus DNA double-strand can be disrupted into the B-form DNA double-strand segments.

  12. A computational approach for the annotation of hydrogen-bonded base interactions in crystallographic structures of the ribozymes

    Energy Technology Data Exchange (ETDEWEB)

    Hamdani, Hazrina Yusof, E-mail: hazrina@mfrlab.org [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi (Malaysia); Advanced Medical and Dental Institute, Universiti Sains Malaysia, Bertam, Kepala Batas (Malaysia); Artymiuk, Peter J., E-mail: p.artymiuk@sheffield.ac.uk [Dept. of Molecular Biology and Biotechnology, Firth Court, University of Sheffield, S10 T2N Sheffield (United Kingdom); Firdaus-Raih, Mohd, E-mail: firdaus@mfrlab.org [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi (Malaysia)

    2015-09-25

    A fundamental understanding of the atomic level interactions in ribonucleic acid (RNA) and how they contribute towards RNA architecture is an important knowledge platform to develop through the discovery of motifs from simple arrangements base pairs, to more complex arrangements such as triples and larger patterns involving non-standard interactions. The network of hydrogen bond interactions is important in connecting bases to form potential tertiary motifs. Therefore, there is an urgent need for the development of automated methods for annotating RNA 3D structures based on hydrogen bond interactions. COnnection tables Graphs for Nucleic ACids (COGNAC) is automated annotation system using graph theoretical approaches that has been developed for the identification of RNA 3D motifs. This program searches for patterns in the unbroken networks of hydrogen bonds for RNA structures and capable of annotating base pairs and higher-order base interactions, which ranges from triples to sextuples. COGNAC was able to discover 22 out of 32 quadruples occurrences of the Haloarcula marismortui large ribosomal subunit (PDB ID: 1FFK) and two out of three occurrences of quintuple interaction reported by the non-canonical interactions in RNA (NCIR) database. These and several other interactions of interest will be discussed in this paper. These examples demonstrate that the COGNAC program can serve as an automated annotation system that can be used to annotate conserved base-base interactions and could be added as additional information to established RNA secondary structure prediction methods.

  13. Ab initio O(N) elongation-counterpoise method for BSSE-corrected interaction energy analyses in biosystems

    Energy Technology Data Exchange (ETDEWEB)

    Orimoto, Yuuichi; Xie, Peng; Liu, Kai [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Yamamoto, Ryohei [Department of Molecular and Material Sciences, Interdisciplinary Graduate School of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Imamura, Akira [Hiroshima Kokusai Gakuin University, 6-20-1 Nakano, Aki-ku, Hiroshima 739-0321 (Japan); Aoki, Yuriko, E-mail: aoki.yuriko.397@m.kyushu-u.ac.jp [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012 (Japan)

    2015-03-14

    An Elongation-counterpoise (ELG-CP) method was developed for performing accurate and efficient interaction energy analysis and correcting the basis set superposition error (BSSE) in biosystems. The method was achieved by combining our developed ab initio O(N) elongation method with the conventional counterpoise method proposed for solving the BSSE problem. As a test, the ELG-CP method was applied to the analysis of the DNAs’ inter-strands interaction energies with respect to the alkylation-induced base pair mismatch phenomenon that causes a transition from G⋯C to A⋯T. It was found that the ELG-CP method showed high efficiency (nearly linear-scaling) and high accuracy with a negligibly small energy error in the total energy calculations (in the order of 10{sup −7}–10{sup −8} hartree/atom) as compared with the conventional method during the counterpoise treatment. Furthermore, the magnitude of the BSSE was found to be ca. −290 kcal/mol for the calculation of a DNA model with 21 base pairs. This emphasizes the importance of BSSE correction when a limited size basis set is used to study the DNA models and compare small energy differences between them. In this work, we quantitatively estimated the inter-strands interaction energy for each possible step in the transition process from G⋯C to A⋯T by the ELG-CP method. It was found that the base pair replacement in the process only affects the interaction energy for a limited area around the mismatch position with a few adjacent base pairs. From the interaction energy point of view, our results showed that a base pair sliding mechanism possibly occurs after the alkylation of guanine to gain the maximum possible number of hydrogen bonds between the bases. In addition, the steps leading to the A⋯T replacement accompanied with replications were found to be unfavorable processes corresponding to ca. 10 kcal/mol loss in stabilization energy. The present study indicated that the ELG-CP method is promising for

  14. A remarkably stable kissing-loop interaction defines substrate recognition by the Neurospora Varkud Satellite ribozyme.

    Science.gov (United States)

    Bouchard, Patricia; Legault, Pascale

    2014-09-01

    Kissing loops are tertiary structure elements that often play key roles in functional RNAs. In the Neurospora VS ribozyme, a kissing-loop interaction between the stem-loop I (SLI) substrate and stem-loop V (SLV) of the catalytic domain is known to play an important role in substrate recognition. In addition, this I/V kissing-loop interaction is associated with a helix shift in SLI that activates the substrate for catalysis. To better understand the role of this kissing-loop interaction in substrate recognition and activation by the VS ribozyme, we performed a thermodynamic characterization by isothermal titration calorimetry using isolated SLI and SLV stem-loops. We demonstrate that preshifted SLI variants have higher affinity for SLV than shiftable SLI variants, with an energetic cost of 1.8-3 kcal/mol for the helix shift in SLI. The affinity of the preshifted SLI for SLV is remarkably high, the interaction being more stable by 7-8 kcal/mol than predicted for a comparable duplex containing three Watson-Crick base pairs. The structural basis of this remarkable stability is discussed in light of previous NMR studies. Comparative thermodynamic studies reveal that kissing-loop complexes containing 6-7 Watson-Crick base pairs are as stable as predicted from comparable RNA duplexes; however, those with 2-3 Watson-Crick base pairs are more stable than predicted. Interestingly, the stability of SLI/ribozyme complexes is similar to that of SLI/SLV complexes. Thus, the I/V kissing loop interaction represents the predominant energetic contribution to substrate recognition by the trans-cleaving VS ribozyme. © 2014 Bouchard and Legault; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  15. SparseMaps—A systematic infrastructure for reduced-scaling electronic structure methods. III. Linear-scaling multireference domain-based pair natural orbital N-electron valence perturbation theory

    Science.gov (United States)

    Guo, Yang; Sivalingam, Kantharuban; Valeev, Edward F.; Neese, Frank

    2016-03-01

    Multi-reference (MR) electronic structure methods, such as MR configuration interaction or MR perturbation theory, can provide reliable energies and properties for many molecular phenomena like bond breaking, excited states, transition states or magnetic properties of transition metal complexes and clusters. However, owing to their inherent complexity, most MR methods are still too computationally expensive for large systems. Therefore the development of more computationally attractive MR approaches is necessary to enable routine application for large-scale chemical systems. Among the state-of-the-art MR methods, second-order N-electron valence state perturbation theory (NEVPT2) is an efficient, size-consistent, and intruder-state-free method. However, there are still two important bottlenecks in practical applications of NEVPT2 to large systems: (a) the high computational cost of NEVPT2 for large molecules, even with moderate active spaces and (b) the prohibitive cost for treating large active spaces. In this work, we address problem (a) by developing a linear scaling "partially contracted" NEVPT2 method. This development uses the idea of domain-based local pair natural orbitals (DLPNOs) to form a highly efficient algorithm. As shown previously in the framework of single-reference methods, the DLPNO concept leads to an enormous reduction in computational effort while at the same time providing high accuracy (approaching 99.9% of the correlation energy), robustness, and black-box character. In the DLPNO approach, the virtual space is spanned by pair natural orbitals that are expanded in terms of projected atomic orbitals in large orbital domains, while the inactive space is spanned by localized orbitals. The active orbitals are left untouched. Our implementation features a highly efficient "electron pair prescreening" that skips the negligible inactive pairs. The surviving pairs are treated using the partially contracted NEVPT2 formalism. A detailed comparison

  16. Interaction of Antitumor Drug Aclacinomycin-A with DNA and Its Specific Sequence Site

    Institute of Scientific and Technical Information of China (English)

    CHENG,Gui-Fang; ZHANG,Fan; TAN,Xue-Lian; HE,Pin-Gang; FANG,Yu-Zhi

    2008-01-01

    Through UV and fluorescence spectrophotometries,the interaction of aclacinomycin-A (ACM-A) with DNA and its specific sequence have been investigated with the aid of circular dichroism spectrophotometry and differential pulse voltammetry method.The results demonstrated that ACM-A was capable of intercalating DNA double helix,the π-π electronic overlapping between π-electrons of ACM-A and base pair of DNA stabilized the ACM-A-DNA adduct,and through electrostatic interaction,the trisaccharide interacted with the minor groove of DNA owing to an amino group at C(3').Electrochemical and spectroelectrochemical studies revealed that the original form of ACM-A had higher affinity for DNA than the reduction form in which the trisaccharide group at C(7) was lost.According to the results obtained in this paper,ACM-A showed preference for AT base pairs of the deoxyribonucleic acid duplex,and it was apt to interact with cytosine and thymine rather than the adenine of oligonucleotide.

  17. A general pairwise interaction model provides an accurate description of in vivo transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Marc Santolini

    Full Text Available The identification of transcription factor binding sites (TFBSs on genomic DNA is of crucial importance for understanding and predicting regulatory elements in gene networks. TFBS motifs are commonly described by Position Weight Matrices (PWMs, in which each DNA base pair contributes independently to the transcription factor (TF binding. However, this description ignores correlations between nucleotides at different positions, and is generally inaccurate: analysing fly and mouse in vivo ChIPseq data, we show that in most cases the PWM model fails to reproduce the observed statistics of TFBSs. To overcome this issue, we introduce the pairwise interaction model (PIM, a generalization of the PWM model. The model is based on the principle of maximum entropy and explicitly describes pairwise correlations between nucleotides at different positions, while being otherwise as unconstrained as possible. It is mathematically equivalent to considering a TF-DNA binding energy that depends additively on each nucleotide identity at all positions in the TFBS, like the PWM model, but also additively on pairs of nucleotides. We find that the PIM significantly improves over the PWM model, and even provides an optimal description of TFBS statistics within statistical noise. The PIM generalizes previous approaches to interdependent positions: it accounts for co-variation of two or more base pairs, and predicts secondary motifs, while outperforming multiple-motif models consisting of mixtures of PWMs. We analyse the structure of pairwise interactions between nucleotides, and find that they are sparse and dominantly located between consecutive base pairs in the flanking region of TFBS. Nonetheless, interactions between pairs of non-consecutive nucleotides are found to play a significant role in the obtained accurate description of TFBS statistics. The PIM is computationally tractable, and provides a general framework that should be useful for describing and predicting

  18. Point Defects in Double Helix Induced by Interaction of Silver Nanoparticles with DNA

    CERN Document Server

    Bregadze, Vasil G; Giorgadze, Tamar G; Monaselidze, Jamlet R; Jaliashvili, Zaza V; Khuskivadze, Temur B

    2012-01-01

    Interaction of DNA-silver nanoparticles (AgNPs) complexes with H3O+, Cu2+ and Cl- has been studied by spectro-photometric, spectro-fluorimetric and differential scanning micro calorimetric methods. It is shown that DNA is a catalyst in redox reactions taking place in AgNPs adsorbed on its surface. We also demonstrate that Ag+ ions that are freed after corrosion of nanoparticles show absorption into the inner part of DNA double helix, i.e. they make the so-called cross-links between complementary base pairs of DNA. The cross-links present point defects of DNA which leads in-vivo to cell death.

  19. Theory of coupled electromagnetic circuits, the connection to quantum mechanical resonance interactions and relevance to chronobiology

    CERN Document Server

    Ulmer, W; Halberg, F; Schwarzkopff, O

    2011-01-01

    The existence of specific biorhythms and the role of geomagnetic and/or solar magnetic activities are well-established by appropriate correlations in chronobiology. From a physical viewpoint, there are two different accesses to biorhythms to set up connections to molecular processes: 1. Diffusion of charged molecules in magnetic fields. 2. Quantum mechanical perturbation theoretical methods and their resonance dominators to characterize specific interactions between constituents. The methods of point 2 permit the treatment of molecular processes by circuits with characteristic resonances and 'beat-frequencies', which result from the primarily fast physical processes. As examples the tunneling processes between DNA base pairs (H bonds) and the ATP decomposition are considered.

  20. RNA LEGO: magnesium-dependent assembly of RNA building blocks through loop-loop interactions.

    Science.gov (United States)

    Horiya, Satoru; Li, Xianglan; Kawai, Gota; Saito, Ryota; Katoh, Akira; Kobayashi, Koh; Harada, Kazuo

    2002-01-01

    We describe the construction of nano-molecular assemblies using RNA building blocks the human immunodeficiency virus type 1 (HIV-1) dimerization initiation site (DIS) RNA, that forms stable base pairing through a magnesium-dependent loop-loop interaction ("kissing"). RNA building blocks containing two DIS or DIS-like hairpins connected by a two nucleotide linker self-assembled to form specific structures as observed by non-denaturing polyacrylamide gel electrophoresis (PAGE). Furthermore, observation of "real time" formation of the molecular assemblies by circular dichroism (CD) spectroscopy was attempted.

  1. Explicit Interaction

    DEFF Research Database (Denmark)

    Löwgren, Jonas; Eriksen, Mette Agger; Linde, Per

    2006-01-01

    as an interpretation of palpability, comprising usability as well as patient empowerment and socially performative issues. We present a prototype environment for video recording during physiotherapeutical consultation which illustrates our current thoughts on explicit interaction and serves as material for further......We report an ongoing study of palpable computing to support surgical rehabilitation, in the general field of interaction design for ubiquitous computing. Through explorative design, fieldwork and participatory design techniques, we explore the design principle of explicit interaction...

  2. Floor interaction

    DEFF Research Database (Denmark)

    Petersen, Marianne Graves; Krogh, Peter; Ludvigsen, Martin;

    2005-01-01

    Within architecture, there is a long tradition of careful design of floors. The design has been concerned with both decorating floors and designing floors to carry information. Ubiquitous computing technology offers new opportunities for designing interactive floors. This paper presents three...... different interactive floor concepts. Through an urban perspective it draws upon the experiences of floors in architecture, and provides a set of design issues for designing interactive floors....

  3. Cationic Noncovalent Interactions: Energetics and Periodic Trends.

    Science.gov (United States)

    Rodgers, M T; Armentrout, P B

    2016-05-11

    In this review, noncovalent interactions of ions with neutral molecules are discussed. After defining the scope of the article, which excludes anionic and most protonated systems, methods associated with measuring thermodynamic information for such systems are briefly recounted. An extensive set of tables detailing available thermodynamic information for the noncovalent interactions of metal cations with a host of ligands is provided. Ligands include small molecules (H2, NH3, CO, CS, H2O, CH3CN, and others), organic ligands (O- and N-donors, crown ethers and related molecules, MALDI matrix molecules), π-ligands (alkenes, alkynes, benzene, and substituted benzenes), miscellaneous inorganic ligands, and biological systems (amino acids, peptides, sugars, nucleobases, nucleosides, and nucleotides). Hydration of metalated biological systems is also included along with selected proton-based systems: 18-crown-6 polyether with protonated peptides and base-pairing energies of nucleobases. In all cases, the literature thermochemistry is evaluated and, in many cases, reanchored or adjusted to 0 K bond dissociation energies. Trends in these values are discussed and related to a variety of simple molecular concepts.

  4. Playful Interaction

    DEFF Research Database (Denmark)

    2003-01-01

    The video Playful Interaction describes a future architectural office, and envisions ideas and concepts for playful interactions between people, materials and appliances in a pervasive and augmented working environment. The video both describes existing developments, technologies and designs...... as well as ideas not yet implemented such as playful modes of interaction with an augmented ball. Playful Interaction has been used as a hybrid of a vision video and a video prototype (1). Externally the video has been used to visualising our new ideas, and internally the video has also worked to inspire...

  5. Non-covalent Interaction of Perfluorooctanoic Acid with DNA

    Institute of Scientific and Technical Information of China (English)

    ZHANG, Xian; SHEN, Rong; CHEN, Ling

    2009-01-01

    Health risk from exposure of perfluorochemicals to wildlife and human has been a subject of concern in many fields such as environmental ecology, toxicology, pathology and life sciences. The interactions of perfluorooctanoic acid (PFOA) with DNA were investigated by equilibrium dialysis, circular dichroism and isothermal titration calorimetry techniques under normal physiological conditions in vitro. The binding of PFOA to DNA was a non-covalent interaction and corresponded to the Langmuir adsorption isotherm in a two-step binding model, in which PFOA climbed along the backbones of DNA and then interacted with the homolateral bases via hydrophobic interactions. The saturation number of PFOA was calculated to be 0.64 per base-pair of DNA. Such an interaction caused the enhancement of circular dichroism spectra of DNA at both 245 and 275 nm, indicating the change of DNA conformation. The acidic media, low electrolyte and temperature ≤35 ℃ are comparatively more favorable for PFOA binding to DNA. This work provides a useful experimental strategy for studying the interactions of perfluorochemicals with biomacromolecules, aiming at a better understanding of the gene toxicity mechanism of perfluorochemicals.

  6. Aesthetic interaction

    DEFF Research Database (Denmark)

    Petersen, Marianne Graves; Iversen, Ole Sejer; Krogh, Peter;

    2004-01-01

    There is a growing interest in considering aesthetic aspects in the design of interactive systems. A set of approaches are emerging each representing different applications of the terminology as well as different inherent assumptions on the role of the user, designer and interaction ideals....... In this paper, we use the concept of Pragmatist Aesthetics to provide a framework for distinguishing between different approaches to aesthetics. Moreover, we use our own design cases to illustrate how pragmatist aesthetics is a promising path to follow in the context of designing interactive systems......, as it promotes aesthetics of use, rather than aesthetics of appearance. We coin this approach in the perspective of aesthetic interaction. Finally we make the point that aesthetics is not re-defining everything known about interactive systems. We provide a framework placing this perspective among other...

  7. Programming Interactivity

    CERN Document Server

    Noble, Joshua

    2012-01-01

    Ready to create rich interactive experiences with your artwork, designs, or prototypes? This is the ideal place to start. With this hands-on guide, you'll explore several themes in interactive art and design-including 3D graphics, sound, physical interaction, computer vision, and geolocation-and learn the basic programming and electronics concepts you need to implement them. No previous experience is necessary. You'll get a complete introduction to three free tools created specifically for artists and designers: the Processing programming language, the Arduino microcontroller, and the openFr

  8. Embarrassing Interactions

    DEFF Research Database (Denmark)

    Deterding, Sebastian; Lucero, Andrés; Holopainen, Jussi;

    2015-01-01

    Wherever the rapid evolution of interactive technologies disrupts standing situational norms, creates new, often unclear situational audiences, or crosses cultural boundaries, embarrassment is likely. This makes embarrassment a fundamental adoption and engagement hurdle, but also a creative design...

  9. Interaction graphs

    DEFF Research Database (Denmark)

    Seiller, Thomas

    2016-01-01

    Interaction graphs were introduced as a general, uniform, construction of dynamic models of linear logic, encompassing all Geometry of Interaction (GoI) constructions introduced so far. This series of work was inspired from Girard's hyperfinite GoI, and develops a quantitative approach that should...... be understood as a dynamic version of weighted relational models. Until now, the interaction graphs framework has been shown to deal with exponentials for the constrained system ELL (Elementary Linear Logic) while keeping its quantitative aspect. Adapting older constructions by Girard, one can clearly define...... "full" exponentials, but at the cost of these quantitative features. We show here that allowing interpretations of proofs to use continuous (yet finite in a measure-theoretic sense) sets of states, as opposed to earlier Interaction Graphs constructions were these sets of states were discrete (and finite...

  10. Neutrino Interactions

    CERN Document Server

    McFarland, Kevin

    2008-01-01

    This manuscript summarizes a series of three lectures on interactions of neutrinos . The lectures begin with a pedagogical foundation and then explore topics of interest to current and future neutrino oscillation and cross-section experiments.

  11. Interactive Workspaces

    DEFF Research Database (Denmark)

    Mogensen, Preben Holst

    augmented reality, interactive building elements, and mobile devices to support new ways of working in a diversity of application domains with work situations ranging from individual work, through local collaboration, to distributed collaboration. The work situations may take place in offices/project rooms...... or in the field. The types of tasks may range from adhoc to more planned forms of interaction. We involve users from specific application domains and use settings continuously in our research following a participatory design approach....

  12. Voltammetry and fluorescence studies on the interaction between Eu (phen)33+ and DNA

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The binding mode of Eu(phen) 33+ with DNA is studied by fluorescence and voltammetric methods. From theScatchard graph and the fluorescence quenching phenomenon, it is concluded that the mode of interaction betweenEu(phen) 33+ and DNA is intercalation bind by inserting the phen π-π conjugate surface between the base pairs of theDNA duplex. Voltammetry was used to confirm the results obtained from the fluorescence method, the result from bothmethods agrees with each other. The binding constant (K) and the binding site size (ns) were calculated from voltammetricdata such as the shifts in potential and limiting currents in the process of adding DNA, according to the positive shifts ofpeak potential. It was considered that the complex of the +2 ion interacted more favorably with the nucleotide bases thanthat of the +3 ion by hydrophobic interaction.

  13. Structural variation and uniformity among tetraloop-receptor interactions and other loop-helix interactions in RNA crystal structures.

    Directory of Open Access Journals (Sweden)

    Li Wu

    Full Text Available Tetraloop-receptor interactions are prevalent structural units in RNAs, and include the GAAA/11-nt and GNRA-minor groove interactions. In this study, we have compiled a set of 78 nonredundant loop-helix interactions from X-ray crystal structures, and examined them for the extent of their sequence and structural variation. Of the 78 interactions in the set, only four were classical GAAA/11-nt motifs, while over half (48 were GNRA-minor groove interactions. The GNRA-minor groove interactions were not a homogeneous set, but were divided into five subclasses. The most predominant subclass is characterized by two triple base pair interactions in the minor groove, flanked by two ribose zipper contacts. This geometry may be considered the "standard" GNRA-minor groove interaction, while the other four subclasses are alternative ways to form interfaces between a minor groove and tetraloop. The remaining 26 structures in the set of 78 have loops interacting with mostly idiosyncratic receptors. Among the entire set, a number of sequence-structure correlations can be identified, which may be used as initial hypotheses in predicting three-dimensional structures from primary sequences. Conversely, other sequence patterns are not predictive; for example, GAAA loop sequences and GG/CC receptors bind to each other with three distinct geometries. Finally, we observe an example of structural evolution in group II introns, in which loop-receptor motifs are substituted for each other while maintaining the larger three-dimensional geometry. Overall, the study gives a more complete view of RNA loop-helix interactions that exist in nature.

  14. Requirement for a conserved, tertiary interaction in the core of 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Aagaard, C; Douthwaite, S

    1994-01-01

    A putative base-pairing interaction that determines the folding of the central region of 23S rRNA has been investigated by mutagenesis. Each of the possible base substitutions has been made at the phylogenetically covariant positions adenine-1262 (A1262) and U2017 in Escherichia coli 23S rRNA....... Every substitution that disrupts the potential for Watson-Crick base pairing between these positions reduces or abolishes the participation of 23S rRNA in protein synthesis. All mutant 23S rRNAs are assembled into 50S subunits, but the mutant subunits are less able to stably interact with 30S subunits...... to form translationally active ribosomes. The function of 23S rRNA is largely reestablished by introduction of an alternative G1262.C2017 or U1262.A2017 pair, although neither of these supports polysome formation quite as effectively as the wild-type pair. A 23S rRNA with a C1262.G2017 pair...

  15. Predicting childhood effortful control from interactions between early parenting quality and children’s dopamine transporter gene haplotypes

    OpenAIRE

    2015-01-01

    Children’s observed effortful control (EC) at 30, 42, and 54 months (n = 145) was predicted from the interaction between mothers’ observed parenting with their 30-month-olds and three variants of the solute carrier family C6, member 3 (SLC6A3) dopamine transporter gene (single nucleotide polymorphisms in intron8 and intron13, and a 40 base pair variable number tandem repeat [VNTR] in the 3′-untranslated region [UTR]), as well as haplotypes of these variants. Significant moderating effects wer...

  16. Interaction Widget

    DEFF Research Database (Denmark)

    Ingstrup, Mads

    2003-01-01

    This pattern describes the idea of making a user interface of discrete, reusable entities---here called interaction widgets. The idea behind widgets is described using two perspectives, that of the user and that of the developer. It is the forces from these two perspectives that are balanced in t...... in the pattern. The intended audience of the pattern is developers and researchers within the field of human computer interaction.......This pattern describes the idea of making a user interface of discrete, reusable entities---here called interaction widgets. The idea behind widgets is described using two perspectives, that of the user and that of the developer. It is the forces from these two perspectives that are balanced...

  17. Hadronic Interactions

    CERN Document Server

    Yamazaki, Takeshi

    2015-01-01

    Understanding hadronic interactions is crucial for investigating the properties of unstable hadrons, since measuring physical quantities for unstable hadrons including the resonance mass and decay width requires simultaneous calculations of final scattering states. Recent studies of hadronic scatterings and decays are reviewed from this point of view. The nuceon-nucleon and multi-nucleon interactions are very important to understand the formation of nucleus from the first principle of QCD. These interactions have been studied mainly by two methods, due originally to L\\"uscher and to HALQCD. The results obtained from the two methods are compared in three channels, $I=2$ two-pion, H-dibaryon, and two-nucleon channels. So far the results from the two methods for the two-nucleon channels are different even at the level of the presence or absence of bound states. We then discuss possible uncertainties in each method. Recent results on the binding energy for helium nuclei are also reviewed.

  18. Interactive governance

    DEFF Research Database (Denmark)

    Sørensen, Eva; Torfing, Jacob; Peters, B. Guy

    Governance has become one of the most commonly used concepts in contemporary political science. It is, however, often used to mean a variety of different things. This book helps to clarify this conceptual muddle by concentrating on one variety of governance-interactive governance. The authors argue...... that although the state may remain important for many aspects of governing, interactions between state and society represent an important, and perhaps increasingly important, dimension of governance. These interactions may be with social actors such as networks, with market actors or with other governments......, but all these forms represent means of governing involving mixtures of state action with the actions of other entities.This book explores thoroughly this meaning of governance, and links it to broader questions of governance. In the process of explicating this dimension of governance the authors also...

  19. Interactive benchmarking

    DEFF Research Database (Denmark)

    Lawson, Lartey; Nielsen, Kurt

    2005-01-01

    distance functions. The frontier is given by an explicit quantile, e.g. “the best 90 %”. Using the explanatory model of the inefficiency, the user can adjust the frontiers by submitting state variables that influence the inefficiency. An efficiency study of Danish dairy farms is implemented......We discuss individual learning by interactive benchmarking using stochastic frontier models. The interactions allow the user to tailor the performance evaluation to preferences and explore alternative improvement strategies by selecting and searching the different frontiers using directional...... in the suggested benchmarking tool. The study investigates how different characteristics on dairy farms influences the technical efficiency....

  20. Programming Interactivity

    CERN Document Server

    Noble, Joshua

    2009-01-01

    Make cool stuff. If you're a designer or artist without a lot of programming experience, this book will teach you to work with 2D and 3D graphics, sound, physical interaction, and electronic circuitry to create all sorts of interesting and compelling experiences -- online and off. Programming Interactivity explains programming and electrical engineering basics, and introduces three freely available tools created specifically for artists and designers: Processing, a Java-based programming language and environment for building projects on the desktop, Web, or mobile phonesArduino, a system t

  1. Collocated Interaction

    DEFF Research Database (Denmark)

    E. Fischer, Joel; Porcheron, Martin; Lucero, Andrés

    2016-01-01

    In the 25 years since Ellis, Gibbs, and Rein proposed the time-space taxonomy, research in the ‘same time, same place’ quadrant has diversified, perhaps even fragmented. This one-day workshop will bring together researchers with diverse, yet convergent interests in tabletop, surface, mobile......, and wearable technologies, spaces and spatial interaction, and those interested in the social aspects of interaction, such as conversation analysis and ethnomethodology. These communities have matured considerably, and produced significant exemplars of systems, methods, and studies concerned with collocated...

  2. Kinesthetic Interaction

    DEFF Research Database (Denmark)

    Fogtmann, Maiken Hillerup; Fritsch, Jonas; Kortbek, Karen Johanne

    2008-01-01

    Within the Human-Computer Interaction community there is a growing interest in designing for the whole body in interaction design. The attempts aimed at addressing the body have very different outcomes spanning from theoretical arguments for understanding the body in the design process, to more...... to reveal bodily potential in relation to three design themes – kinesthetic development, kinesthetic means and kinesthetic disorder; and seven design parameters – engagement, sociality, movability, explicit motivation, implicit motivation, expressive meaning and kinesthetic empathy. The framework is a tool...

  3. Interactive governance

    DEFF Research Database (Denmark)

    Sørensen, Eva; Torfing, Jacob; Peters, B. Guy

    that although the state may remain important for many aspects of governing, interactions between state and society represent an important, and perhaps increasingly important, dimension of governance. These interactions may be with social actors such as networks, with market actors or with other governments...... explore some of the more fundamental questions about governance theory. For example, although governance is talked about a great deal political science has done relatively little about how to measure this concept. Likewise, the term multi-level governance has become widely used but its important...

  4. Interactive Storytelling

    DEFF Research Database (Denmark)

    Schoenau-Fog, Henrik; Reng, Lars

    2015-01-01

    This book constitutes the refereed proceedings of the 8th International Conference on Interactive Digital Storytelling, ICIDS 2015, held in Copenhagen, Denmark, in November/December 2015. The 18 revised full papers and 13 short papers presented together with 9 posters, 9 workshop descriptions, an...

  5. Interactive Astronomy.

    Science.gov (United States)

    Martin, Jean K.

    1997-01-01

    Presents guiding principles for developing interactive lessons for the World Wide Web. Describes "Amazing Space: Education Online from the Hubble Space Telescope", a program where students study spectacular Hubble Space Telescope images of stars and star-forming regions to learn about the life cycle of stars and the creation of atoms. (JRH)

  6. Interactive Storytelling

    DEFF Research Database (Denmark)

    Schoenau-Fog, Henrik; Reng, Lars

    2015-01-01

    This book constitutes the refereed proceedings of the 8th International Conference on Interactive Digital Storytelling, ICIDS 2015, held in Copenhagen, Denmark, in November/December 2015. The 18 revised full papers and 13 short papers presented together with 9 posters, 9 workshop descriptions...

  7. Rigidity of Nominal Wages of Non-Production Workers in Industrial Sector

    Directory of Open Access Journals (Sweden)

    Bambang Sulistiyono

    2016-06-01

    Full Text Available Excess supply of labor leads to low the levels of nominal wages received by workers. The amount of minimum wage rate exceeds the market wage rate. The determination of minimum wage is a factor manifested in the institutional and regulatory Provincial Minimum Wage or a District Minimum Wage. Unfortunately, it has made nominal wages  difficult to drop below the minimum wage level. High or low level of nominal wages are associated with worker productivity. Further, nominal wages are rigid to go down. If they have increased, they can not be dropped in the future even though the company's performance is declined. Knowing that condition, in designing the remuneration system, an employer should pay attention to the rigidity of nominal wages, so that when  company's performance declines, the company will not be interfered because of the wages burden.  Furthermore, unions and government should consider the rigidity impact of nominal wages that go down. Thus, when macroeconomic conditions deteriorate and company's performance drops, the company will not go bankrupt due to high labor costs. If the company goes bankrupt, the workers will loose their jobs as a result of employment termination, while the government will face the unemployment problem. 

  8. Levocloperastine in the treatment of chronic nonproductive cough: comparative efficacy versus standard antitussive agents.

    Science.gov (United States)

    Aliprandi, P; Castelli, C; Bernorio, S; Dell'Abate, E; Carrara, M

    2004-01-01

    The medical and social impact of cough is substantial. Current antitussive agents at effective doses have adverse events such as drowsiness, nausea and constipation that limit their use. There is also recent evidence that standard antitussive agents, such as codeine, may not reduce cough during upper respiratory infections. Therefore, there is a need for more effective and better-tolerated agents. The efficacy of levocloperastine, a novel antitussive, which acts both centrally on the cough center and on peripheral receptors in the tracheobronchial tree in treating chronic cough, was compared with that of other standard antitussive agents (codeine, levodropropizine and DL-cloperastine) in six open clinical trials. The studies enrolled patients of all ages with cough associated with various respiratory disorders including bronchitis, asthma, pneumonia and chronic obstructive pulmonary disease. Levocloperastine significantly improved cough symptoms (intensity and frequency of cough) in all trials, and improvements were observed after the first day of treatment. In children, levocloperastine reduced nighttime awakenings and irritability, and in adults it was effective in treating cough induced by angiotensin-converting enzyme inhibitors. When compared with other antitussive agents, levocloperastine had improved or comparable efficacy, with a more rapid onset of action. Importantly, no evidence of central adverse events was recorded with levocloperastine, whereas drowsiness was reported by a significant number of patients receiving codeine. Levocloperastine is an effective antitussive agent for the treatment of cough in patients of all ages. It has a more rapid onset of action than standard agents with an improved tolerability profile.

  9. Optimizing Fire Department Operations Through Work Schedule Analysis, Alternative Staffing, and Nonproductive Time Reduction

    Science.gov (United States)

    2014-09-01

    Fire Rescue,” St. Anthony Hospitals, October 2006. 17 Leeanna Mims , “Overtime Cost Reduction with Alternative Work Schedules” Executive Fire Officer...Effectiveness: 24-hour schedules may lead to sleep deprivation when an employee’s cognitive skills are inhibited.50 Sleep deprivation may result 48 Mims ...Consecutive Hour Work Limit.” 56 Mims , “Overtime Cost Reduction with Alternative Work Schedules.” 37

  10. On the violation of Bell’s inequality for all non-product quantum states

    Science.gov (United States)

    Cafaro, Carlo; Ali, Sean Alan; Giffin, Adom

    2016-06-01

    We present an explicit reexamination of Gisin’s 1991 original proof concerning the violation of Bell’s inequality for any pure entangled state of two-particle systems. Given the relevance of Gisin’s work, our analysis is motivated by pedagogical reasons and allows the straightening of a few mathematical points in the original proof that in no way change the physical conclusions reached by Gisin.

  11. The folding energy landscape of apoflavodoxin is rugged. hydrogen exchange reveals non-productive misfolded intermediates.

    NARCIS (Netherlands)

    Bollen, Y.J.M.; Kamphuis, M.B.; Mierlo, van C.P.M.

    2006-01-01

    Many native proteins occasionally form partially unfolded forms (PUFs), which can be detected by hydrogen/deuterium exchange and NMR spectroscopy. Knowledge about these metastable states is required to better understand the onset of folding-related diseases. So far, not much is known about where PUF

  12. [Study of aspirin and its interaction with DNA by Raman and UV spectroscopies].

    Science.gov (United States)

    Kang, Qian-qian; Zhou, Guang-ming

    2012-03-01

    Normal Raman spectroscopy and surface-enhanced Raman spectroscopy of aspirin and aspirin tablet were reported, and the vibrational and enhanced peaks were assigned; the interaction of aspirin with DNA was investigated by SERS and UV. The results showed that NRS and SERS of aspirin and aspirin tablet were consistent basically, which indicated that excipient hardly affected the detection of aspirin; in SERS, aspirin was absorbed perpendicularly on silver colloid through the carboxyl group and the benzene ring; The interaction was mainly caused by the inserting-action mode between aspirin and DNA, and the benzene ring and C=O of aspirin were inserted between the base pair of the double helix structure of DNA, which provided important information and useful reference for understanding deeply the mechanism of action of this kind of drug.

  13. Quantum Monte Carlo for Noncovalent Interactions: Analysis of Protocols and Simplified Scheme Attaining Benchmark Accuracy

    CERN Document Server

    Dubecký, Matúš; Jurečka, Petr; Mitas, Lubos; Hobza, Pavel; Otyepka, Michal

    2014-01-01

    Reliable theoretical predictions of noncovalent interaction energies, which are important e.g. in drug-design and hydrogen-storage applications, belong to longstanding challenges of contemporary quantum chemistry. In this respect, the fixed-node diffusion Monte Carlo (FN-DMC) is a promising alternative to the commonly used ``gold standard'' coupled-cluster CCSD(T)/CBS method for its benchmark accuracy and favourable scaling, in contrast to other correlated wave function approaches. This work is focused on the analysis of protocols and possible tradeoffs for FN-DMC estimations of noncovalent interaction energies and proposes a significantly more efficient yet accurate computational protocol using simplified explicit correlation terms. Its performance is illustrated on a number of weakly bound complexes, including water dimer, benzene/hydrogen, T-shape benzene dimer and stacked adenine-thymine DNA base pair complex. The proposed protocol achieves excellent agreement ($\\sim$0.2 kcal/mol) with respect to the reli...

  14. Many-Body Coarse-Grained Interactions using Gaussian Approximation Potentials

    CERN Document Server

    John, S T

    2016-01-01

    This thesis introduces a framework that is able to describe general many-body coarse-grained interactions. We make use of this to describe the free energy surface as a cluster expansion in terms of monomer, dimer, and trimer terms. The contributions to the free energy due to these terms are inferred from MD results of the underlying all-atom model using Gaussian Approximation Potentials, a type of machine-learning potential based on Gaussian process regression. This provides CG interactions that are much more accurate than is possible with site-based pair potentials. While slower than these, it can still be faster than all-atom simulations for solvent-free CG models of systems with a large amount of solvent, as is common in biomolecular simulations.

  15. NMR detection of intermolecular interaction sites in the dimeric 5'-leader of the HIV-1 genome.

    Science.gov (United States)

    Keane, Sarah C; Van, Verna; Frank, Heather M; Sciandra, Carly A; McCowin, Sayo; Santos, Justin; Heng, Xiao; Summers, Michael F

    2016-11-15

    HIV type-1 (HIV-1) contains a pseudodiploid RNA genome that is selected for packaging and maintained in virions as a noncovalently linked dimer. Genome dimerization is mediated by conserved elements within the 5'-leader of the RNA, including a palindromic dimer initiation signal (DIS) that has been proposed to form kissing hairpin and/or extended duplex intermolecular contacts. Here, we have applied a (2)H-edited NMR approach to directly probe for intermolecular interactions in the full-length, dimeric HIV-1 5'-leader (688 nucleotides; 230 kDa). The interface is extensive and includes DIS:DIS base pairing in an extended duplex state as well as intermolecular pairing between elements of the upstream Unique-5' (U5) sequence and those near the gag start site (AUG). Other pseudopalindromic regions of the leader, including the transcription activation (TAR), polyadenylation (PolyA), and primer binding (PBS) elements, do not participate in intermolecular base pairing. Using a (2)H-edited one-dimensional NMR approach, we also show that the extended interface structure forms on a time scale similar to that of overall RNA dimerization. Our studies indicate that a kissing dimer-mediated structure, if formed, exists only transiently and readily converts to the extended interface structure, even in the absence of the HIV-1 nucleocapsid protein or other RNA chaperones.

  16. Interacting Electrons

    Science.gov (United States)

    Martin, Richard M.; Reining, Lucia; Ceperley, David M.

    2016-06-01

    Preface; Part I. Interacting Electrons: Beyond the Independent-Particle Picture: 1. The many electron problem: introduction; 2. Signatures of electron correlation; 3. Concepts and models for interacting electrons; Part II. Foundations of Theory for Many-Body Systems: 4. Mean fields and auxiliary systems; 5. Correlation functions; 6. Many-body wavefunctions; 7. Particles and quasi-particles; 8. Functionals in many-particle physics; Part III. Many-Body Green's Function Methods: 9. Many-body perturbation theory: expansion in the interaction; 10. Many-body perturbation theory via functional derivatives; 11. The RPA and the GW approximation for the self-energy; 12. GWA calculations in practice; 13. GWA calculations: illustrative results; 14. RPA and beyond: the Bethe-Salpeter equation; 15. Beyond the GW approximation; 16. Dynamical mean field theory; 17. Beyond the single-site approximation in DMFT; 18. Solvers for embedded systems; 19. Characteristic hamiltonians for solids with d and f states; 20. Examples of calculations for solids with d and f states; 21. Combining Green's functions approaches: an outlook; Part IV. Stochastic Methods: 22. Introduction to stochastic methods; 23. Variational Monte Carlo; 24. Projector quantum Monte Carlo; 25. Path integral Monte Carlo; 26. Concluding remarks; Part V. Appendices: A. Second quantization; B. Pictures; C. Green's functions: general properties; D. Matsubara formulation for Green's functions for T ̸= 0; E. Time-ordering, contours, and non-equilibrium; F. Hedin's equations in a basis; G. Unique solutions in Green's function theory; H. Properties of functionals; I. Auxiliary systems and constrained search; J. Derivation of the Luttinger theorem; K. Gutzwiller and Hubbard approaches; References; Index.

  17. Multiple DNA Interactions Contribute to the Initiation of Telomerase Elongation.

    Science.gov (United States)

    Karademir Andersson, Ahu; Gustafsson, Cecilia; Krishnankutty, Roopesh; Cohn, Marita

    2017-07-07

    Telomerase maintains telomere length and chromosome integrity by adding short tandem repeats of single-stranded DNA to the 3' ends, via reverse transcription of a defined template region of its RNA subunit. To further understand the telomerase elongation mechanism, we studied the primer utilization and extension activity of the telomerase from the budding yeast Naumovozyma castellii (Saccharomyces castellii), which displays a processive nucleotide and repeat addition polymerization. For the efficient initiation of canonical elongation, telomerase required 4-nt primer 3' end complementarity to the template RNA. This DNA-RNA hybrid formation was highly important for the stabilization of an initiation-competent telomerase-DNA complex. Anchor site interactions with the DNA provided additional stabilization to the complex. Our studies indicate three additional separate interactions along the length of the DNA primer, each providing different and distinct contributions to the initiation event. A sequence-independent anchor site interaction acts immediately adjacent to the base-pairing 3' end, indicating a protein anchor site positioned very close to the catalytic site. Two additional anchor regions further 5' on the DNA provide sequence-specific contributions to the initiation of elongation. Remarkably, a non-telomeric sequence in the distal 25- to 32-nt region negatively influences the initiation of telomerase elongation, suggesting an anchor site with a regulatory role in the telomerase elongation decision. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Interactive Governance

    DEFF Research Database (Denmark)

    Bang, Henrik

    2016-01-01

    Governance analysis has exploded in recent years, and it has become nearly impossible to tell what difference the concept and practice of governance makes from those of government and state. In addition governance analysis has been placed more and more in the shadow of the new institutionalisms and...... and growth. However, interactive governance is not a property or effect of institutions; nor does it apply solely to those individuals who seek success above everything else. It is connective more than individualistic or collectivistic in nature; and it manifests a governability capacity which...

  19. Sibling interaction.

    Science.gov (United States)

    Balsam, Rosemary H

    2013-01-01

    Sibling interactions traditionally were conceived psychoanalytically in "vertical" and parentified oedipal terms and overlooked in their own right, for complicated reasons (Colonna and Newman 1983). Important work has been done to right this, from the 1980s and onward, with conferences and writings. Juliet Mitchell's 2000 and, in particular, her 2003 books, for example, have brought "lateral" sibling relations forcefully to the forefront of insights, especially about sex and violence, with the added interdisciplinary impact of illuminating upheaval in global community interactions as well as having implications for clinicians. A clinical example from the analysis of an adult woman with a ten-years-younger sister will show here how we need both concepts to help us understand complex individual psychic life. The newer "lateral" sibling emphasis, including Mitchell's "Law of the Mother" and "seriality," can be used to inform the older "vertical" take, to enrich the full dimensions of intersubjective oedipal and preoedipal reciprocities that have been foundational in shaping that particular analysand's inner landscape. Some technical recommendations for heightening sensitivity to the import of these dynamics will be offered along the way here, by invoking Hans Loewald's useful metaphor of the analytic situation as theater.

  20. Electromagnetic interactions

    CERN Document Server

    Bosanac, Slobodan Danko

    2016-01-01

    This book is devoted to theoretical methods used in the extreme circumstances of very strong electromagnetic fields. The development of high power lasers, ultrafast processes, manipulation of electromagnetic fields and the use of very fast charged particles interacting with other charges requires an adequate theoretical description. Because of the very strong electromagnetic field, traditional theoretical approaches, which have primarily a perturbative character, have to be replaced by descriptions going beyond them. In the book an extension of the semi-classical radiation theory and classical dynamics for particles is performed to analyze single charged atoms and dipoles submitted to electromagnetic pulses. Special attention is given to the important problem of field reaction and controlling dynamics of charges by an electromagnetic field.

  1. Electromagnetic interactions

    Energy Technology Data Exchange (ETDEWEB)

    Bosanac, Slobodan Danko [Ruder Boskovic Institute, Zagreb (Croatia). Physical Chemistry

    2016-07-01

    This book is devoted to theoretical methods used in the extreme circumstances of very strong electromagnetic fields. The development of high power lasers, ultrafast processes, manipulation of electromagnetic fields and the use of very fast charged particles interacting with other charges requires an adequate theoretical description. Because of the very strong electromagnetic field, traditional theoretical approaches, which have primarily a perturbative character, have to be replaced by descriptions going beyond them. In the book an extension of the semi-classical radiation theory and classical dynamics for particles is performed to analyze single charged atoms and dipoles submitted to electromagnetic pulses. Special attention is given to the important problem of field reaction and controlling dynamics of charges by an electromagnetic field.

  2. Audiovisual Interaction

    DEFF Research Database (Denmark)

    Karandreas, Theodoros-Alexandros

    Product sound quality evaluation aims to identify relevant attributes and assess their influence on the overall auditory impression. This results in an accurate representation of the product in a singular modality - usually the one primarily associated with the product's main function. However, any...... given product is rarely perceived in isolation, but rather judged within a global context which includes information from all modalities (senses). This PhD thesis investigates the relative importance of audio and visual information in subjective evaluations of a product. A multimodal setup was developed...... importance of each modality with respect to the overall quality evaluation. The results show that this was not due to specific interactions between stimuli but rather because the auditory modality dominated over the visual modality. Furthermore, for all experiments where less than optimal stimuli...

  3. Designing "Interaction": How Do Interaction Design Students Address Interaction?

    Science.gov (United States)

    Karlgren, Klas; Ramberg, Robert; Artman, Henrik

    2016-01-01

    Interaction design is usually described as being concerned with interactions with and through artifacts but independent of a specific implementation. Design work has been characterized as a conversation between the designer and the situation and this conversation poses a particular challenge for interaction design as interactions can be elusive…

  4. DNA hosted and aligned in aqueous interstitia of a lamellar liquid crystal – a membrane–biomacromolecule interaction model system

    KAUST Repository

    Carlsson, Nils

    2013-01-01

    We report that DNA molecules can be intercalated and macroscopically oriented in the aqueous interstitia of a lyotropic lamellar liquid crystal. Using UV-vis linear dichroism and fluorescence spectroscopy we show that double-stranded oligonucleotides (25 base pairs) in the water-octanoate-decanol system remain base-paired in the B conformation and are confined in two dimensions, with the helix axis preferentially parallel to the lipid bilayer surfaces but free to rotate within this plane. The degree of helix confinement and the corresponding 2-D orientation can be improved by decreasing the thickness of the water interstitia via the fraction of water in the ternary mixture. Not surprisingly, the corresponding single-stranded oligonucleotides are not aligned, with their persistence length being short in comparison to the lamellar interstitium thickness. We propose this as a model system for studying interactions of DNA-ligand complexes near a lipid bilayer membrane which we demonstrate by using dye probes that are either covalently attached to one end of the oligonucleotide or reversibly bound by intercalation between the base pairs. Three cationic dyes, all strongly bound by intercalation to DNA when free in solution, are found to not bind to DNA but to prefer the membrane surface. The covalently attached Cy5 also binds to the bilayer while Cy3 tends to end-stack to the oligonucleotide duplex. The orientation of Cy5 parallel to the membrane indicates that electrostatic surface binding predominates over insertion into the hydrophobic interior of the membrane. Anionic and zwitterionic dyes (FAM and ROX) are found to remain randomly oriented in the water between the lipid bilayer surfaces. © The Royal Society of Chemistry.

  5. Cloud Interactions

    Science.gov (United States)

    2004-01-01

    [figure removed for brevity, see original site] Released 1 July 2004 The atmosphere of Mars is a dynamic system. Water-ice clouds, fog, and hazes can make imaging the surface from space difficult. Dust storms can grow from local disturbances to global sizes, through which imaging is impossible. Seasonal temperature changes are the usual drivers in cloud and dust storm development and growth. Eons of atmospheric dust storm activity has left its mark on the surface of Mars. Dust carried aloft by the wind has settled out on every available surface; sand dunes have been created and moved by centuries of wind; and the effect of continual sand-blasting has modified many regions of Mars, creating yardangs and other unusual surface forms. This image was acquired during mid-spring near the North Pole. The linear water-ice clouds are now regional in extent and often interact with neighboring cloud system, as seen in this image. The bottom of the image shows how the interaction can destroy the linear nature. While the surface is still visible through most of the clouds, there is evidence that dust is also starting to enter the atmosphere. Image information: VIS instrument. Latitude 68.4, Longitude 258.8 East (101.2 West). 38 meter/pixel resolution. Note: this THEMIS visual image has not been radiometrically nor geometrically calibrated for this preliminary release. An empirical correction has been performed to remove instrumental effects. A linear shift has been applied in the cross-track and down-track direction to approximate spacecraft and planetary motion. Fully calibrated and geometrically projected images will be released through the Planetary Data System in accordance with Project policies at a later time. NASA's Jet Propulsion Laboratory manages the 2001 Mars Odyssey mission for NASA's Office of Space Science, Washington, D.C. The Thermal Emission Imaging System (THEMIS) was developed by Arizona State University, Tempe, in collaboration with Raytheon Santa Barbara

  6. Interaction mechanism of 2-aminobenzothiazole with herring sperm DNA

    Energy Technology Data Exchange (ETDEWEB)

    Sun Yajing [Shandong Key Laboratory of Water Pollution Control and Resource Reuse, School of Environmental Science and Engineering, Shandong University, China-America CRC for Environment and Health, Shandong Province, 27 Shanda South Road, Jinan 250100 (China); Ji Fanying [Affiliated Hospital of Shandong University, People' s Hospital of Linyi City, No. 27 Jiefang, Road, Linyi, Shandong Province 276003 (China); Liu Rutao, E-mail: rutaoliu@sdu.edu.cn [Shandong Key Laboratory of Water Pollution Control and Resource Reuse, School of Environmental Science and Engineering, Shandong University, China-America CRC for Environment and Health, Shandong Province, 27 Shanda South Road, Jinan 250100 (China); Lin Jing; Xu Qifei; Gao Canzhu [Shandong Key Laboratory of Water Pollution Control and Resource Reuse, School of Environmental Science and Engineering, Shandong University, China-America CRC for Environment and Health, Shandong Province, 27 Shanda South Road, Jinan 250100 (China)

    2012-02-15

    The toxic interaction of 2-aminobenzothiazole (2-ABT) with herring sperm DNA (hs-DNA) was investigated in vitro under simulated physiological conditions by multi-spectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated that 2-ABT interacted with hs-DNA in a minor groove binding mode. The binding constant and the number of binding sites were 7.2 Multiplication-Sign 10{sup 3} L mol{sup -1} and 0.95, respectively. Circular dichroism spectroscopy (CD) was employed to measure the conformation change of hs-DNA in the presence of 2-ABT, which verified the minor groove binding mode. The molecular modeling results illustrated that 2-ABT tended to bind in the region of rich A-T base pairs through the hydrogen bond between A 18 and amino group of 2-ABT. Sequence specificity was confirmed by comparison on the interactions of 2-ABT with four kinds of bases. This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the toxic interaction of small molecular pollutants and drugs with biomacromolecules, which contributes to clarify the molecular mechanism of toxicity or side effect in vivo. - Highlights: Black-Right-Pointing-Pointer 2-ABT interacts with hs-DNA in minor groove binding mode to form complex in the ratio 1:1. Black-Right-Pointing-Pointer DNA conformation changes after binding with 2-ABT. Black-Right-Pointing-Pointer ABT-DNA complex is simulated using Autodock and binding free energy is also calculated. Black-Right-Pointing-Pointer Besides Van der Waals force, hydrogen bond between adenine and 2-ABT plays an important role. Black-Right-Pointing-Pointer Sequence specificity of the binding is verified by the effect of DNA bases on 2-ABT.

  7. Unification of Electromagnetic Interactions and Gravitational Interactions

    Institute of Scientific and Technical Information of China (English)

    WUNing

    2002-01-01

    Unified theory of gravitational interactions and electromagnetic interactions is discussed in this paper.Based on gauge principle,electromagnetic interactions and gravitational interactions are formulated in the same manner and are unified in a semi-direct product group of U(1) Abelian gauge group and gravitational gauge group.

  8. Unification of Electromagnetic Interactions and Gravitational Interactions

    Institute of Scientific and Technical Information of China (English)

    WU Ning

    2002-01-01

    Unified theory of gravitational interactions and electromagnetic interactions is discussed in this paper.Based on gauge principle, electromagnetic interactions and gravitational interactions are formulated in the same mannerand are unified in a semi-direct product group of U(1) Abelian gauge group and gravitational gauge group.

  9. Study of Cytochrome c-DNA Interaction - Evaluation of Binding Sites on the Redox Protein

    Science.gov (United States)

    Wettstein, Christoph; Kyne, Ciara; M. Doolan, Aishling; Möhwald, Helmuth; Crowley, Peter B.; Lisdat, Fred

    2014-10-01

    Artificial assemblies consisting of the cationic cytochrome c (cyt c) and double-stranded DNA are interesting for the field of biohybrid systems because of the high electro-activity of the incorporated redox protein. However, little is known about the interactions between these two biomolecules. Here, the complex of reduced cyt c and a 41 base pair oligonucleotide was characterized in solution as a function of pH and ionic strength. Persistent cyt c-DNA agglomerates were observed by UV-vis and DLS (dynamic light scattering) at pH 5.0 and low ionic strength. The strength of the interaction was attenuated by raising the pH or the ionic strength. At pH 7.0 agglomerates were not formed, allowing interaction analysis by NMR spectroscopy. Using TROSY (transverse relaxation-optimized spectroscopy)-HSQC (heteronuclear single quantum coherence) experiments it was possible to identify the DNA binding site on the cyt c surface. Numerous residues surrounding the exposed heme edge of cyt c were involved in transient binding to DNA under these conditions. This result was supported by SEC (size exclusion chromatography) experiments at pH 7.0 showing that the interaction is sufficient for co-elution of cyt c and DNA.Artificial assemblies consisting of the cationic cytochrome c (cyt c) and double-stranded DNA are interesting for the field of biohybrid systems because of the high electro-activity of the incorporated redox protein. However, little is known about the interactions between these two biomolecules. Here, the complex of reduced cyt c and a 41 base pair oligonucleotide was characterized in solution as a function of pH and ionic strength. Persistent cyt c-DNA agglomerates were observed by UV-vis and DLS (dynamic light scattering) at pH 5.0 and low ionic strength. The strength of the interaction was attenuated by raising the pH or the ionic strength. At pH 7.0 agglomerates were not formed, allowing interaction analysis by NMR spectroscopy. Using TROSY (transverse relaxation

  10. Interaction of Chelerythrine Choloride in Acid Buffer with Calf-thymus DNA

    Institute of Scientific and Technical Information of China (English)

    Yan Jing SU; Xiong Hui WEI

    2006-01-01

    The binding of chelerythrine (CHE) iminium to calf-thymus (CT) DNA is characterized by hypochromism and bathochromism in the absorption band, enhancement of fluorescence intensity, increase in fluorescence polarization, and the perturbation of the CD spectra of DNA.These changes are characteristic of intercalation. Scatchard plots constructed from fluorescence titration data gave a binding constant of 5.77×105 and a binding site size of 3,4 base pairs at 25℃.The intercalative interaction is exothermic with a Van't Hoff enthalpy of -33.7 kJ/mol. In addition, △G =-32.9 kJ/mol, and △S =-2.9 J/mol/K. The intercalation of CHE into the DNA helix is enthalpy-driven.

  11. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1993-01-01

    can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site.......Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...

  12. Synthesis of dihydromyricetin-manganese (II) complex and interaction with DNA

    Science.gov (United States)

    Guo, Qingquan; Yuan, Juan; Zeng, Jinhua; He, Xiangzhu; Li, Daguang

    2012-11-01

    Dihydromyricetin has many physiological functions and its metal complex could have better effects. DNA is very important in biological body, but little attention has been devoted to the relationship between dihydromyricetin-metal complex and the DNA. In this paper, dihydromyricetin-Mn (II) complex has been prepared and characterized using UV-vis absorption spectrophotometry, IR spectroscopy, elemental analysis, and thermal gravimetric analysis (TG-DTA Analysis). The interaction of dihydromyricetin-Mn (II) complex with DNA was investigated using UV-vis spectra, fluorescence measurements and viscosity measurements. The results indicate that the dihydromyricetin-manganese (II) complex can intercalate into the stacked base pairs of DNA with binding constant Kb = 5.64 × 104 M and compete with the strong intercalator ethidium bromide for the intercalative binding sites with Stern-Volmer quenching constant, Ksq = 1.16.

  13. Analysis of In Vitro DNA Interactions of Brassinosteroid-Controlled Transcription Factors Using Electrophoretic Mobility Shift Assay.

    Science.gov (United States)

    Unterholzner, Simon J; Rozhon, Wilfried; Poppenberger, Brigitte

    2017-01-01

    Most signaling cascades ultimately lead to changes in gene expression by modulating the activity of transcription factors (TFs). The electrophoretic mobility shift assay (EMSA) is a simple but powerful in vitro method for investigation of specific protein-DNA interactions. It makes use of the fact that protein-DNA complexes have a lower electrophoretic mobility in gels than free DNA has. The application of labeled probes in combination with unlabeled competitors allows investigation of DNA-binding specificity and identification of binding motifs with single base-pair resolution. Here we describe the application of EMSAs for the study of interactions of the brassinosteroid-regulated TFs, BRASSINAZOLE-RESISTANT1, (BZR1), BRI1-ETHYL METHANESULFONATE-SUPPRESSOR1 (BES1)/BZR2, and CESTA with putative binding sites. The classical approach using radiolabeled probes, as well as the more recent application of fluorescent probes, is described and the advantages and disadvantages of both methods are discussed.

  14. Fluorescent probes based on side-chain chlorinated benzo[a]phenoxazinium chlorides: Studies of interaction with DNA

    Science.gov (United States)

    Raju, B. Rama; Gonçalves, M. Sameiro T.; Coutinho, Paulo J. G.

    2017-01-01

    The interaction of DNA with six water soluble benzo[a]phenoxazinium chlorides mono- or di-substituted with 3-chloropropyl groups at the O and N of 2- and 9-positions, along with methyl, hydroxyl and amine terminal groups at 5-positions, was investigated by photophysical techniques. The results indicated that almost all compounds intercalated in DNA base pairs at phosphate to dye ratio higher than 5. At lower values of this ratio, electrostatic binding mode with DNA was observed. Groove binding was detected mainly for the benzo[a]phenoxazinium dye with NH2·HBr terminal. The set of six benzo[a]phenoxazinium chlorides proved successful to label the migrating DNA in agarose gel electrophoresis assays. These finding proves the ability of these benzo[a]phenoxazinium dyes to strongly interact with DNA.

  15. RNA tertiary interactions in the large ribosomal subunit: The A-minor motif

    Energy Technology Data Exchange (ETDEWEB)

    Nissen, Poul; Ippolito, Joseph A.; Ban, Nenad; Moore, Peter B.; Steitz, Thomas A. (Yale University); (Yale University); (Yale Unversity)

    2009-10-07

    Analysis of the 2.4-{angstrom} resolution crystal structure of the large ribosomal subunit from Haloarcula marismortui reveals the existence of an abundant and ubiquitous structural motif that stabilizes RNA tertiary and quaternary structures. This motif is termed the A-minor motif, because it involves the insertion of the smooth, minor groove edges of adenines into the minor groove of neighboring helices, preferentially at C-G base pairs, where they form hydrogen bonds with one or both of the 2' OHs of those pairs. A-minor motifs stabilize contacts between RNA helices, interactions between loops and helices, and the conformations of junctions and tight turns. The interactions between the 3' terminal adenine of tRNAs bound in either the A site or the P site with 23S rRNA are examples of functionally significant A-minor interactions. The A-minor motif is by far the most abundant tertiary structure interaction in the large ribosomal subunit; 186 adenines in 23S and 5S rRNA participate, 68 of which are conserved. It may prove to be the universally most important long-range interaction in large RNA structures.

  16. Spectroscopic and structural studies on the interaction of an anticancer β-carboline alkaloid, harmine with GC and AT specific DNA oligonucleotides.

    Science.gov (United States)

    Sharma, Shweta; Yadav, Monika; Gupta, Surendra P; Pandav, Kumud; Kumar, Surat

    2016-12-25

    Harmine, a tricyclic β-carboline alkaloid possesses anticancer properties. Thus, its binding studies with DNA are considerably important because mechanism of action of anticancer drug involves DNA binding. On the other hand, the DNA binding study is also useful in drug designing and synthesis of new compounds with enhanced biological properties. Hence, the binding of harmine with sequence specific DNA oligonucleotides has been studied using various biophysical techniques i.e. absorption, fluorescence and molecular docking techniques. UV absorption study, Fluorescence quenching and Iodide quenching experiments revealed intercalation type of binding of harmine with short sequence specific DNA oligonucleotides. Fluorescence and absorption studies also concluded binding constants of harmine with GC rich DNA sequence in the order of 10(5) M(-1) while with AT rich sequences it was in the order of 10(3) M(-1) which clearly indicated that harmine showed greater intercalation with GC rich sequences as compared to AT rich sequences. From thermodynamic studies, it was concluded that harmine-DNA complex formation was spontaneous, exothermic and energetically favorable process. Molecular docking studies confirmed that harmine intercalates between the base pairs of DNA structure but energetically prefers intercalation between GC base pairs. Molecular docking studies and the calculated thermodynamic parameters, i.e. Gibbs free energy (ΔG), Enthalpy change (ΔH) and Entropy change (ΔS) indicated that H-bonds, van der Waals interactions and hydrophobic interactions play a major role in the binding of harmine to DNA oligomers.

  17. Drug Interaction API

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Interaction API is a web service for accessing drug-drug interactions. No license is needed to use the Interaction API. Currently, the API uses DrugBank for its...

  18. DNA condensation by high-affinity interaction with avidin.

    Science.gov (United States)

    Morpurgo, Margherita; Radu, Aurelian; Bayer, Edward A; Wilchek, Meir

    2004-01-01

    Avidin, the basic biotin-binding glycoprotein from chicken egg white, is known to interact with DNA, whereas streptavidin, its neutral non-glycosylated bacterial analog, does not. In the present study we investigated the DNA-binding properties of avidin. Its affinity for DNA in the presence and absence of biotin was compared with that of other positively charged molecules, namely the protein lysozyme, the cationic polymers polylysine and polyarginine and an avidin derivative with higher isoelectric point (pI approximately 11) in which most of the lysine residues were converted to homoarginines. Gel-shift assays, transmission electron microscopy and dynamic light scattering experiments demonstrated an unexpectedly strong interaction between avidin and DNA. The most pronounced gel-shift retardation occurred with the avidin-biotin complex, followed by avidin alone and then guanidylated avidin. Furthermore, ultrastructural and light-scattering studies showed that avidin assembles on the DNA molecule in an organized manner. The assembly leads to the formation of nanoparticles that are about 50-100 nm in size (DNA approximately 5 kb) and have a rod-like or toroidal shape. In these particles the DNA is highly condensed and one avidin is bound to each 18 +/- 4 DNA base pairs. The complexes are very stable even at high dilution ([DNA] =10 pM) and are not disrupted in the presence of buffers or salt (up to 200 mM NaCl). The other positively charged molecules also condense DNA and form particles with a globular shape. However, in this case, these particles disassemble by dilution or in the presence of low salt concentration. The results indicate that the interaction of avidin with DNA may also occur under physiological conditions, further enhanced by the presence of biotin. This DNA-binding property of avidin may thus shed light on a potentially new physiological role for the protein in its natural environment.

  19. Study on the interaction of anthracenyl-methyl homospermidine conjugate (ANTMHspd) with DNA by spectroscopic methods.

    Science.gov (United States)

    Tian, Zhiyong; Zhao, Luyao; Dong, Huanyang; Zhang, Yan; Zhang, Yijuan; Ren, Qianlei; Shao, Shuangyu; Huang, Yingying; Song, Lina; Guo, Tao; Xu, Xuejun; Wang, Chaojie

    2017-04-01

    The interaction between anthracenyl-methyl homospermidine conjugate (ANTMHspd) with herring sperm DNA was investigated by UV/vis absorption, fluorescent spectra, circular dichroism (CD) spectroscopy and (1)HNMR under physiological conditions (pH=7.4). The observed hypochromism effect and fluorescence quenching of ANTMHspd by DNA, and the displacement of EB from DNA-EB system by ANTMHspd suggested that ANTMHspd might interact with DNA by the combined mode of intercalation and groove binding. Further fluorescent tests at different temperatures revealed that the quenching mechanism was a static type. The quenching constant, binding constant and thermodynamic parameter obtained from fluorescence showed that the type of interaction force included mainly hydrogen bonding and van der Waals, which promoted the binding process. The CD test revealed that ANTMHspd could cause the B to A-like conformational change while ANTMHspd is not a typical DNA intercalator. The (1)H NMR tests showed that ANTMHspd partially intercalated DNA. The effect of NaCl and KI on ANTMHspd-DNA interaction provided additional evidences of intercalation. Molecular docking simulation was carried out and the docking model in silico suggested that the binding modes of ANTMHspd and DNA were groove binding and intercalation, with the anthracene moiety inserted in DNA base pairs and the polyamine chain embedded in the DNA groove. Copyright © 2017. Published by Elsevier B.V.

  20. Analysis of interaction between tamoxifen and ctDNA in vitro by multi-spectroscopic methods

    Science.gov (United States)

    Cai, Changqun; Chen, Xiaoming; Ge, Fei

    2010-07-01

    Multi-spectroscopic methods including resonance light scattering (RLS), ultraviolet spectra (UV), fluorescence spectra, 1H NMR spectroscopy, coupled with thermo-denaturation experiments were firstly used to study the interaction of antitumor drug tamoxifen (TMX) with calf thymus (ctDNA) in acetate buffer solutions (pH 4.55). The interaction of TMX with ctDNA could cause a significant enhancement of RLS intensity, the hyperchromic effect, red shift of absorption spectra and the fluorescence quenching of TMX, indicating that there is an inserting interaction between TMX and ctDNA. This inference was confirmed by 1H NMR spectroscopy. The chemical shift of the benzene proton changes significantly which indicates that TMX could insert into the base pairs of ctDNA. These studies are valuable for a better understanding the mode of TMX-ctDNA interaction further, which are important and useful for designing of new ctDNA targeted drug. And the antitumor drug TMX inserted directly into ctDNA in vitro, which can provide a lot of useful information to explore the development of new and highly effective anti-cancer drugs.

  1. Study of cytochrome c-DNA interaction--evaluation of binding sites on the redox protein.

    Science.gov (United States)

    Wettstein, Christoph; Kyne, Ciara; Doolan, Aishling M; Möhwald, Helmuth; Crowley, Peter B; Lisdat, Fred

    2014-11-21

    Artificial assemblies consisting of the cationic cytochrome c (cyt c) and double-stranded DNA are interesting for the field of biohybrid systems because of the high electro-activity of the incorporated redox protein. However, little is known about the interactions between these two biomolecules. Here, the complex of reduced cyt c and a 41 base pair oligonucleotide was characterized in solution as a function of pH and ionic strength. Persistent cyt c-DNA agglomerates were observed by UV-vis and DLS (dynamic light scattering) at pH 5.0 and low ionic strength. The strength of the interaction was attenuated by raising the pH or the ionic strength. At pH 7.0 agglomerates were not formed, allowing interaction analysis by NMR spectroscopy. Using TROSY (transverse relaxation-optimized spectroscopy)-HSQC (heteronuclear single quantum coherence) experiments it was possible to identify the DNA binding site on the cyt c surface. Numerous residues surrounding the exposed heme edge of cyt c were involved in transient binding to DNA under these conditions. This result was supported by SEC (size exclusion chromatography) experiments at pH 7.0 showing that the interaction is sufficient for co-elution of cyt c and DNA.

  2. Problem of interactions: electromagnetic particles interaction

    CERN Document Server

    Sannikov-Proskuryakov, S S

    2001-01-01

    The electromagnetic interactions between charged particles are derived on the basis of the particles dynamic theory, proposed in the work of Sannikov. The electromagnetic interactions exist only in the relativistic model of the bihamiltonian system, based on the Heisenberg algebra. Existence of this type of interactions is connected with the U sub e (1)-degeneration of the basic state of the relativistic bihamiltonian system, lying in the basis of the given theory

  3. Occurrence and stability of lone pair–π stacking interactions between ribose and nucleobases in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2017-08-18

    The specific folding pattern and function of RNA molecules lies in various weak interactions, in addition to the strong base-base pairing and stacking. One of these relatively weak interactions, characterized by the stacking of the O4′ atom of a ribose on top of the heterocycle ring of a nucleobase, has been known to occur but has largely been ignored in the description of RNA structures. We identified 2015 ribose–base stacking interactions in a high-resolution set of non-redundant RNA crystal structures. They are widespread in structured RNA molecules and are located in structural motifs other than regular stems. Over 50% of them involve an adenine, as we found ribose-adenine contacts to be recurring elements in A-minor motifs. Fewer than 50% of the interactions involve a ribose and a base of neighboring residues, while approximately 30% of them involve a ribose and a nucleobase at least four residues apart. Some of them establish inter-domain or inter-molecular contacts and often implicate functionally relevant nucleotides. In vacuo ribose-nucleobase stacking interaction energies were calculated by quantum mechanics methods. Finally, we found that lone pair–π stacking interactions also occur between ribose and aromatic amino acids in RNA–protein complexes.

  4. PIC: Protein Interactions Calculator.

    Science.gov (United States)

    Tina, K G; Bhadra, R; Srinivasan, N

    2007-07-01

    Interactions within a protein structure and interactions between proteins in an assembly are essential considerations in understanding molecular basis of stability and functions of proteins and their complexes. There are several weak and strong interactions that render stability to a protein structure or an assembly. Protein Interactions Calculator (PIC) is a server which, given the coordinate set of 3D structure of a protein or an assembly, computes various interactions such as disulphide bonds, interactions between hydrophobic residues, ionic interactions, hydrogen bonds, aromatic-aromatic interactions, aromatic-sulphur interactions and cation-pi interactions within a protein or between proteins in a complex. Interactions are calculated on the basis of standard, published criteria. The identified interactions between residues can be visualized using a RasMol and Jmol interface. The advantage with PIC server is the easy availability of inter-residue interaction calculations in a single site. It also determines the accessible surface area and residue-depth, which is the distance of a residue from the surface of the protein. User can also recognize specific kind of interactions, such as apolar-apolar residue interactions or ionic interactions, that are formed between buried or exposed residues or near the surface or deep inside.

  5. Designing for mobile interaction

    DEFF Research Database (Denmark)

    Nazzi, Elena

    2009-01-01

    The theme of this PhD project is designing for mobile interaction with devices and services, for the accessing, making, and sharing of information, taking into account the dynamic physical and social settings that embrace this interaction. To narrow down this theme, the whole project focuses...... on the exploitation of social interaction --- in particular among senior citizens --- to enhance and support mobile interaction....

  6. Interactive pinball business

    DEFF Research Database (Denmark)

    Buur, Jacob; Gudiksen, Sune Klok

    2012-01-01

    Interaction design expands into new fields. Interaction design and business model innovation is a promising meeting of disciplines: Many businesses see the need to rethink their ways of doing business, and, as business models pose highly dynamic and interactive problems, interaction design has much...

  7. Interaction for visualization

    CERN Document Server

    Tominski, Christian

    2015-01-01

    Visualization has become a valuable means for data exploration and analysis. Interactive visualization combines expressive graphical representations and effective user interaction. Although interaction is an important component of visualization approaches, much of the visualization literature tends to pay more attention to the graphical representation than to interaction.The goal of this work is to strengthen the interaction side of visualization. Based on a brief review of general aspects of interaction, we develop an interaction-oriented view on visualization. This view comprises five key as

  8. Interactive CFD simulations

    OpenAIRE

    Duque Lombana, Juan Fernando

    2007-01-01

    This project is about the development of an implementable Interactive Computer Fluid Dynamics methodology -- The range of this work begins with an overview of the current status of computational fluid dynamics simulation software and methodologies, continues with an introduction to what interactive and interactivity mean, develops an all original interactive CFD methodology to follow for the solution of fluid scenarios and finally, the description of the implementation of an interactive solve...

  9. Synthesis of 5,10,15,20-Tetra[4-(N-ethylpiperazinyl)phenyl]-porphyrin and Its Interaction with DNA

    Institute of Scientific and Technical Information of China (English)

    郭灿城; 李和平; 张晓兵

    2005-01-01

    Piperazinyl-porphyrin, 5,10,15,20-tetra[4-(N-ethylpiperazinyl)phenyl]porphyrin (TEPPH2), was synthesized based on the special affinity of porphyrin to cancer cells and the antitumor activity of piperazine compounds. Its structure was characterized by UV-vis and 1H NMR spectra and elemental analysis. A model for the interaction between TEPPH2 and calf thymus DNA was built, and the binding mechanism was investigated by W-vis and fluorescence spectra. The results indicated that TEPPH2 could intercalate into the base pairs of DNA strongly. One calf thymus DNA molecule could bind 88 TEPPH2 molecules, and the binding constant K is 8.4×106 L-mol-1. The binding number and binding constant of TEPPH2 with DNA are higher than those of the known anti-tumor drugs,tetrakis(4-N-methylpyridyl)porphine and the Schiff bases Ca/sal-his and Ni/sal-aln.

  10. Analysis of the interaction of surfactants oleic acid and oleylamine with iron oxide nanoparticles through molecular mechanics modeling.

    Science.gov (United States)

    Harris, Richard Anthony; Shumbula, Poslet Morgan; van der Walt, Hendriëtte

    2015-04-07

    The interface interactions between surfactants oleic acid and oleylamine and magnetic nanoparticles are studied via molecular mechanics and dynamics. Mixtures of these two surfactants are widely advocated in the chemical synthesis of nanoparticles. However, the exact dynamic mechanism remains unclear. Here we report, for the first time, a comprehensive qualitative model showing the importance of acid-base complex formation between oleic acid and oleylamine as well as the presence of free protons in the engineering of nanoparticles of specific shapes and sizes. We show why critical parameters such as surfactant concentration may modify iron oxide nanoparticle shape and size and how this can be understood in the light of acid-base complex pair formation. We report on the influence these parameters have on both the in situ nanoparticle surface charge and zeta potential. Transmission electron microscopy (TEM), FTIR, and pH studies are used to confirm the validity of the calculated binding energies and number of acid-base pairs.

  11. Joint interaction of ethidium bromide and methylene blue with DNA. The effect of ionic strength on binding thermodynamic parameters.

    Science.gov (United States)

    Vardevanyan, Poghos O; Antonyan, Ara P; Parsadanyan, Marine A; Torosyan, Margarita A; Karapetian, Armen T

    2016-07-01

    Large amount of data of experimental and theoretical studies have shown that ethidium bromide (EtBr) and methylene blue (MB) may bind to nucleic acids via three modes: intercalation between two adjacent base pairs, insertion into the plane between neighboring bases in the same strand (semi-intercalation), and outside binding with negatively charged backbone phosphate groups. The aim of the given research is to examine the behavior of these two ligands at both separate and joint DNA binding. The obtained experimental data show that the effect of simultaneous binding of EtBr and MB on double-stranded DNA has a non-additive effect of separate binding. The analyses of the melting thermodynamic parameters of DNA complexes with two bound ligands suggest competitive mechanism of interaction.

  12. Interactive Pinball Business

    DEFF Research Database (Denmark)

    Buur, Jacob; Gudiksen, Sune

    2012-01-01

    Interaction design expands into new fields. Interaction design and business model innovation is a promising meeting of disciplines: Many businesses see the need to rethink their ways of doing business, and, as business models pose highly dynamic and interactive problems, interaction design has much...... to offer. This paper compares ‘tangible business models’ in the form of pinball-like contraptions, designed by interaction design students with those developed by groups of professionals around concrete business issues. We will show how the interactive models encourage business people to play...... with hypotheses and experiment with scenarios as a way of innovating their business models, and why this is so....

  13. Charge-transfer pipi* excited state in the 7-azaindole dimer. A hybrid configuration interactions singles/time-dependent density functional theory description.

    Science.gov (United States)

    Gelabert, Ricard; Moreno, Miquel; Lluch, José M

    2006-01-26

    The hybrid configuration interaction singles/time dependent density functional theory approach of Dreuw and Head-Gordon [Dreuw, A.; Head-Gordon, M. J. Am. Chem. Soc. 2004, 126, 4007] has been applied to study the potential energy landscape and accessibility of the charge-transfer pipi* excited state in the dimer of 7-azaindole, which has been traditionally considered a model for DNA base pairing. It is found that the charge-transfer pipi* excited state preferentially stabilizes the product of a single proton transfer. In this situation, the crossing between this state and the photoactive electronic state of the dimer is accessible. It is found that the charge-transfer pipi* excited state has a very steep potential energy profile with respect to any single proton-transfer coordinate and, in contrast, an extremely flat potential energy profile with respect to the stretch of the single proton-transfer complex. This is predicted to bring about a pair of rare fragments of the 7-azaindole dimer, physically separated and hence having very long lifetimes. This could have implications in the DNA base pairs of which the system is an analogue, in the form of replication errors.

  14. Theoretical studies on interactions between low energy electrons and protein-DNA fragments: valence anions of AT-amino acids side chain complexes.

    Science.gov (United States)

    Szyperska, Anna; Gajewicz, Agnieszka; Mazurkiewicz, Kamil; Leszczynski, Jerzy; Rak, Janusz

    2011-11-21

    Electron attachment to trimeric complexes that mimic most frequent hydrogen bonding interactions between an amino acid side chain (AASC) and the Watson-Crick (WC) 9-methyladenine-1-methylthymine (MAMT) base pair has been studied at the B3LYP/6-31++G(d,p) level of theory. Although the neutral trimers will not occur in the gas phase due to unfavorable free energy of stabilization (G(stab)) they should form a protein-DNA complex where entropy changes related to formation of such a complex will more than balance its disadvantageous G(stab). The most stable neutrals possess an identical pattern of hydrogen bonds (HBs). In addition, the proton-acceptor (N7) and proton-donor (N10) atoms of adenine involved in those HBs are located in the main groove of DNA. All neutral structures support the adiabatically stable valence anions in which the excess electron is localized on a π* orbital of thymine. The vertical detachment energies (VDEs) of anions corresponding to the most stable neutrals are substantially smaller than that of the isolated WC MAMT base pair. Hence, electron transfer from the anionic thymine to the phosphate group and as a consequence formation of a single strand break (SSB) should proceed more efficiently in a protein-dsDNA complex than in the naked dsDNA as far as electron attachment to thymine is concerned. This journal is © the Owner Societies 2011

  15. Binding interaction between sorafenib and calf thymus DNA: Spectroscopic methodology, viscosity measurement and molecular docking

    Science.gov (United States)

    Shi, Jie-Hua; Chen, Jun; Wang, Jing; Zhu, Ying-Yao

    2015-02-01

    The binding interaction of sorafenib with calf thymus DNA (ct-DNA) was studied using UV-vis absorption spectroscopy, fluorescence emission spectroscopy, circular dichroism (CD), viscosity measurement and molecular docking methods. The experimental results revealed that there was obvious binding interaction between sorafenib and ct-DNA. The binding constant (Kb) of sorafenib with ct-DNA was 5.6 × 103 M-1 at 298 K. The enthalpy and entropy changes (ΔH0 and ΔS0) in the binding process of sorafenib with ct-DNA were -27.66 KJ mol-1 and -21.02 J mol-1 K-1, respectively, indicating that the main binding interaction forces were van der Waals force and hydrogen bonding. The docking results suggested that sorafenib preferred to bind on the minor groove of A-T rich DNA and the binding site of sorafenib was 4 base pairs long. The conformation change of sorafenib in the sorafenib-DNA complex was obviously observed and the change was close relation with the structure of DNA, implying that the flexibility of sorafenib molecule played an important role in the formation of the stable sorafenib-ct-DNA complex.

  16. Studies on the interaction of apigenin with calf thymus DNA by spectroscopic methods

    Science.gov (United States)

    Zhang, Shufang; Sun, Xuejun; Kong, Rongmei; Xu, Mingming

    2015-02-01

    The interaction between apigenin and calf thymus deoxyribonucleic acid (ctDNA) in a pH 7.4 Tris-HCl buffer solution was investigated by UV-Vis spectroscopy, fluorescence spectroscopy, DNA melting techniques, and viscosity measurements. It was found that apigenin molecules could intercalate into the base pairs of DNA, forming a apigenin-DNA complex with a binding constant of K310K = 6.4 × 104 L mol-1. The thermodynamic parameters enthalpy change (ΔH), entropy change (ΔS) and Gibbs free energy (ΔG) were calculated to be 7.36 × 104 J mol-1, 329 J K-1 mol-1 and -2.84 × 104 J mol-1 at 310 K, respectively. Hydrophobic interaction was the predominant intermolecular force in stabilizing the apigenin-DNA complex. Thermal denaturation study suggested that the stabilization of the ctDNA helix was increased when the apigenin binding to ctDNA as indicated by the increase in thermal denaturation temperature of ctDNA at around 5.0 °C in the presence of apigenin. Spectroscopic techniques together with melting techniques and viscosity determination provided evidences of intercalation mode of binding for the interaction between apigenin and ctDNA.

  17. Sequence-specific DNA interactions with calixarene-based langmuir monolayers.

    Science.gov (United States)

    Rullaud, Vanessa; Moridi, Negar; Shahgaldian, Patrick

    2014-07-29

    The interactions of an amphiphilic calixarene, namely p-guanidino-dodecyloxy-calix[4]arene, 1, self-assembled as Langmuir monolayers, with short double stranded DNA, were investigated by surface pressure-area (π-A) isotherms, surface ellipsometry and Brewster angle microscopy (BAM). Three DNA 30mers were used as models, poly(AT), poly(GC) and a random DNA sequence with 50% of G:C base pairs. The interactions of these model DNA duplexes with 1-based Langmuir monolayers were studied by measuring compression isotherms using increasing DNA concentrations (10(-6), 10(-5), 10(-4), and 5 × 10(-4) g L(-1)) in the aqueous subphase. The isotherms of 1 showed an expansion of the monolayer with, interestingly, significant differences depending on the duplex DNA sequence studied. Indeed, the interactions of 1-based monolayers with poly(AT) led to an expansion of the monolayer that was significantly more pronounced that for monolayers on subphases of poly(GC) and the random DNA sequence. The structure and thickness of 1-based Langmuir monolayers were investigated by BAM and surface ellipsometry that showed differences in thickness and structure between a monolayer formed on pure water or on a DNA subphase, with here again relevant dissimilarities depending on the DNA composition.

  18. Genome-wide mapping of in vivo protein-DNA interactions.

    Science.gov (United States)

    Johnson, David S; Mortazavi, Ali; Myers, Richard M; Wold, Barbara

    2007-06-08

    In vivo protein-DNA interactions connect each transcription factor with its direct targets to form a gene network scaffold. To map these protein-DNA interactions comprehensively across entire mammalian genomes, we developed a large-scale chromatin immunoprecipitation assay (ChIPSeq) based on direct ultrahigh-throughput DNA sequencing. This sequence census method was then used to map in vivo binding of the neuron-restrictive silencer factor (NRSF; also known as REST, for repressor element-1 silencing transcription factor) to 1946 locations in the human genome. The data display sharp resolution of binding position [+/-50 base pairs (bp)], which facilitated our finding motifs and allowed us to identify noncanonical NRSF-binding motifs. These ChIPSeq data also have high sensitivity and specificity [ROC (receiver operator characteristic) area >/= 0.96] and statistical confidence (P <10(-4)), properties that were important for inferring new candidate interactions. These include key transcription factors in the gene network that regulates pancreatic islet cell development.

  19. Interacting dark sector with transversal interaction

    Energy Technology Data Exchange (ETDEWEB)

    Chimento, Luis P.; Richarte, Martín G. [Departamento de Física, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires and IFIBA, CONICET, Ciudad Universitaria, Pabellón I, Buenos Aires 1428 (Argentina)

    2015-03-26

    We investigate the interacting dark sector composed of dark matter, dark energy, and dark radiation for a spatially flat Friedmann-Robertson-Walker (FRW) background by introducing a three-dimensional internal space spanned by the interaction vector Q and solve the source equation for a linear transversal interaction. Then, we explore a realistic model with dark matter coupled to a scalar field plus a decoupled radiation term, analyze the amount of dark energy in the radiation era and find that our model is consistent with the recent measurements of cosmic microwave background anisotropy coming from Planck along with the future constraints achievable by CMBPol experiment.

  20. Sea Turtle Interaction Report

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Sea Turtle Interaction Report is a report sent out in pdf format to authorized individuals that summarizes sea turtle interactions in the longline fishery. The...

  1. Sea Turtle Interaction Report

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Sea Turtle Interaction Report is a report sent out in pdf format to authorized individuals that summarizes sea turtle interactions in the longline fishery. The...

  2. Interacting agents in finance

    NARCIS (Netherlands)

    C. Hommes

    2008-01-01

    Interacting agents in finance represent a behavioural, agent-based approach in which financial markets are viewed as complex adaptive systems consisting of many boundedly rational agents interacting through simple heterogeneous investment strategies, constantly adapting their behaviour in response t

  3. Gestalt Interactional Groups

    Science.gov (United States)

    Harman, Robert L.; Franklin, Richard W.

    1975-01-01

    Gestalt therapy in groups is not limited to individual work in the presence of an audience. Describes several ways to involve gestalt groups interactionally. Interactions described focus on learning by doing and discovering, and are noninterpretive. (Author/EJT)

  4. Interactions in multispecies biofilms

    DEFF Research Database (Denmark)

    Burmølle, Mette; Ren, Dawei; Bjarnsholt, Thomas

    2014-01-01

    The recent focus on complex bacterial communities has led to the recognition of interactions across species boundaries. This is particularly pronounced in multispecies biofilms, where synergistic interactions impact the bacterial distribution and overall biomass produced. Importantly, in a number...

  5. Health Data Interactive (HDI)

    Data.gov (United States)

    U.S. Department of Health & Human Services — Health Data Interactive (HDI) presents a broad range of important public health indicators through an interactive web-based application that provides access to...

  6. Interacting agents in finance

    NARCIS (Netherlands)

    Hommes, C.; Durlauf, S.N.; Blume, L.E.

    2008-01-01

    Interacting agents in finance represent a behavioural, agent-based approach in which financial markets are viewed as complex adaptive systems consisting of many boundedly rational agents interacting through simple heterogeneous investment strategies, constantly adapting their behaviour in response

  7. Diachronic Perspective and Interaction

    DEFF Research Database (Denmark)

    Marchetti, Emanuela; Valente, Andrea

    . An ongoing participatory inquiry is being conducted, to explore deeper forms of learning and communication for historical museums. Our hypothesis is that the diachronic perspective on historical processes, defined as social interaction within the environment through time, is a key missing element....... Explorations of more interactive representations of the diachronic perspective, through play and tangible interaction, may foster a dialogue with young visitors. Therefore, a new interactive installation is being designed, intended as a tool to enrich learning, allowing children to experience historical...

  8. Dynamic Interactive Learning Systems

    Science.gov (United States)

    Sabry, Khaled; Barker, Jeff

    2009-01-01

    This paper reviews and discusses the notions of interactivity and dynamicity of learning systems in relation to information technologies and design principles that can contribute to interactive and dynamic learning. It explores the concept of dynamic interactive learning systems based on the emerging generation of information as part of a…

  9. Interactive Reactor Simulation.

    Science.gov (United States)

    Nuttall, Herbert E., Jr.; Himmelblau, David M.

    In the field of chemical engineering, interactive process models can simulate the dynamic behavior and analysis of chemical processes. DYFLO was the process simulation program selected as a foundation for development of interactive programs for computer-assisted instruction (CAI) in chemical engineering. Interactive Computing and time sharing…

  10. Interactivity: A Forgotten Art?

    Science.gov (United States)

    Sims, Rod

    1997-01-01

    This paper promotes further discussion and analysis of interactivity in learning environments and contains a classification of interaction types appropriate for consideration in multimedia settings. Through an examination of related factors associated with navigation and control, a matrix of interactive dimensions is proposed. (Author)

  11. Device-less interaction

    NARCIS (Netherlands)

    Monaci, G.; Triki, M.; Sarroukh, B.E.

    2009-01-01

    This document describes the results of a technology survey for device-less interaction. The Device-less Interaction project (2007-307) aims at providing interaction options for future home appliances without resorting to a remote control or any other dedicated control device. The target home applia

  12. Interaction and Language Acquisition

    Institute of Scientific and Technical Information of China (English)

    孙红叶

    2016-01-01

    Based on Long's Interaction Hypothesis (IH), the paper examines the aspects of interaction that might facilitate natu-ralistic language development and goes further to propose features of interaction that could encourage classroom second lan-guage acquisition, in the hope that improved classroom interation will enhance teaching effectiveness in language classroom.

  13. Gaze Interactive Building Instructions

    DEFF Research Database (Denmark)

    Hansen, John Paulin; Ahmed, Zaheer; Mardanbeigi, Diako

    We combine eye tracking technology and mobile tablets to support hands-free interaction with digital building instructions. As a proof-of-concept we have developed a small interactive 3D environment where one can interact with digital blocks by gaze, keystroke and head gestures. Blocks may be moved...

  14. [The presence of non-integrated SV40 viral DNA in nonproductive cells transformed by this virus].

    Science.gov (United States)

    Daya-Grosjean, L; Bénichou, D; Monier, R

    1975-09-08

    The hot phenol extraction of nuclic acids reveals the presence of small amounts of nonintegrated SV 40 DNA in transformed syrian hamster or mouse cells. The extractibility of the viral DNA is influenced by its conformation; SV 40 DNA, form I is preferentially extracted by contrast with form III DNA.

  15. Firm, non-tender mass in right breast · worsening, nonproductive cough · pleuritic pain · Dx?

    Science.gov (United States)

    Lehman, Trang D; Damania, Zubin; Tschetter, Clifford N; Lehman, Norman L

    2017-01-01

    Granulomatous lesions, such as foreign body granuloma, idiopathic granulomatous mastitis (IGM), and sarcoidosis can mimic breast carcinoma. IGM is associated with elevated prolactin (eg, pregnancy or oral contraceptive use) and is usually subareolar. Infection, however, is also commonly subareolar.

  16. Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

    Science.gov (United States)

    Kittler, L; Baguley, B C; Löber, G; Waring, M J

    1999-01-01

    A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

  17. One possible interaction-inertial interaction

    CERN Document Server

    Yang, Xuejun

    2012-01-01

    Proposed in this paper is a possible interaction which exists in nature - inertial interaction. It gives matter an inertia and inertial mass. The formula of inertial mass has been derived. It is possible that inertial interaction leads to the redshifts of quasars, the rotation curve of spiral galaxy, the accelerating expansion of the universe, and the stronger gravitational lens effects of quasars, galaxies, or clusters of galaxies. Einstein's Gravitational Equation has been modified. Gravitational redshift, perihelion precession, and bending of light in spherically symmetric vacuum gravitational field are calculated. The differential equations of static spherically symmetric star's internal evolution are given. The accelerating expansion stage of the universe evolution equations are derived. The evolution of the universe is periodic. Time does not have an origin. There is no Big Bang. Although there is divergent singularity, there is no universe's singularity of incomplete geodesic. There are no horizon prob...

  18. The Interactive Learning Toolkit: supporting interactive classrooms

    Science.gov (United States)

    Dutta, S.; McCauley, V.; Mazur, E.

    2004-05-01

    Research-based interactive learning techniques have dramatically improved student understanding. We have created the 'Interactive Learning Toolkit' (ILT), a web-based learning management system, to help implement two such pedagogies: Just in Time Teaching and Peer Instruction. Our main goal in developing this toolkit is to save the instructor time and effort and to use technology to facilitate the interaction between the students and the instructor (and between students themselves). After a brief review of both pedagogies, we will demonstrate the many exciting new features of the ILT. We will show how technology can not only implement, but also supplement and improve these pedagogies. We would like acknowdge grants from NSF and DEAS, Harvard University

  19. Accurate prediction of polarised high order electrostatic interactions for hydrogen bonded complexes using the machine learning method kriging

    Science.gov (United States)

    Hughes, Timothy J.; Kandathil, Shaun M.; Popelier, Paul L. A.

    2015-02-01

    As intermolecular interactions such as the hydrogen bond are electrostatic in origin, rigorous treatment of this term within force field methodologies should be mandatory. We present a method able of accurately reproducing such interactions for seven van der Waals complexes. It uses atomic multipole moments up to hexadecupole moment mapped to the positions of the nuclear coordinates by the machine learning method kriging. Models were built at three levels of theory: HF/6-31G**, B3LYP/aug-cc-pVDZ and M06-2X/aug-cc-pVDZ. The quality of the kriging models was measured by their ability to predict the electrostatic interaction energy between atoms in external test examples for which the true energies are known. At all levels of theory, >90% of test cases for small van der Waals complexes were predicted within 1 kJ mol-1, decreasing to 60-70% of test cases for larger base pair complexes. Models built on moments obtained at B3LYP and M06-2X level generally outperformed those at HF level. For all systems the individual interactions were predicted with a mean unsigned error of less than 1 kJ mol-1.

  20. Food-drug interactions

    DEFF Research Database (Denmark)

    Schmidt, Lars E; Dalhoff, Kim

    2002-01-01

    Interactions between food and drugs may inadvertently reduce or increase the drug effect. The majority of clinically relevant food-drug interactions are caused by food-induced changes in the bioavailability of the drug. Since the bioavailability and clinical effect of most drugs are correlated......, the bioavailability is an important pharmacokinetic effect parameter. However, in order to evaluate the clinical relevance of a food-drug interaction, the impact of food intake on the clinical effect of the drug has to be quantified as well. As a result of quality review in healthcare systems, healthcare providers...... are increasingly required to develop methods for identifying and preventing adverse food-drug interactions. In this review of original literature, we have tried to provide both pharmacokinetic and clinical effect parameters of clinically relevant food-drug interactions. The most important interactions are those...

  1. Grasp interaction with tablets

    CERN Document Server

    Wolf, Katrin

    2015-01-01

    This book presents guidelines for a future device type: a tablet that allows ergonomic front- and back-of-device interaction. These guidelines help designers and developers of user interfaces to build ergonomic applications for tablet devices, in particular for devices that enable back-of-device interaction. In addition, manufacturers of tablet devices obtain arguments that back-of-device interaction is a promising extension of the interaction design space and results in increased input capabilities, enriched design possibilities, and proven usability. The guidelines are derived from empirical studies and developed to fit the users’ skills to the way the novel device type is held. Three particular research areas that are relevant to develop design guidelines for tablet interaction are investigated: ergonomic gestures, interaction areas, and pointing techniques.

  2. Multiactivity in Social Interaction

    DEFF Research Database (Denmark)

    Doing more than one thing at the same time – a phenomenon that is often called ‘multitasking’ – is characteristic to many situations in everyday and professional life. Although we all experience it, its real time features remain understudied. Multiactivity in Social Interaction: Beyond multitasking...... by using video recordings of real-life interactions from a range of different contexts, such as medical settings, office workplaces and car driving. With the companion collection Interacting with Objects: Language, materiality, and social activity, the book advances understanding of the complex...... organisation and accomplishment of social interaction, especially the significance of embodiment, materiality, participation and temporality. A close appreciation of how people use language and interact for and during multiactivity will not only interest researchers in language and social interaction...

  3. Two interacting Hofstadter butterflies

    OpenAIRE

    Barelli, Armelle; Bellissard, Jean; Jacquod, Philippe; Shepelyansky, Dima L.

    1996-01-01

    The problem of two interacting particles in a quasiperiodic potential is addressed. Using analytical and numerical methods, we explore the spectral properties and eigenstates structure from the weak to the strong interaction case. More precisely, a semiclassical approach based on non commutative geometry techniques permits to understand the intricate structure of such a spectrum. An interaction induced localization effect is furthermore emphasized. We discuss the application of our results on...

  4. Succeeding with interactive research

    DEFF Research Database (Denmark)

    Krogh, Andreas Hagedorn; Nielsen, Morten Velsing

    2017-01-01

    with and about society, and provides a set of systematic reflections on how to manage opposing pressures, tensions and dilemmas in interactive research projects. We formulate and address three major interactive research management tasks: ensuring continual commitment from external stakeholders, maintaining...... the capacity for critique and ensuring that scientific standards are met. Based on our own experience and theories of interactive governance, network management and collaborative leadership, as well as on existing methodological literature, we provide guidance and suggest concrete tools and methods...

  5. Food-Drug Interactions

    Directory of Open Access Journals (Sweden)

    Arshad Yar Khan

    2011-03-01

    Full Text Available The effect of drug on a person may be different than expected because that drug interacts with another drug the person is taking (drug-drug interaction, food, beverages, dietary supplements the person is consuming (drug-nutrient/food interaction or another disease the person has (drug-disease interaction. A drug interaction is a situation in which a substance affects the activity of a drug, i.e. the effects are increased or decreased, or they produce a new effect that neither produces on its own. These interactions may occur out of accidental misuse or due to lack of knowledge about the active ingredients involved in the relevant substances. Regarding food-drug interactions physicians and pharmacists recognize that some foods and drugs, when taken simultaneously, can alter the body's ability to utilize a particular food or drug, or cause serious side effects. Clinically significant drug interactions, which pose potential harm to the patient, may result from changes in pharmaceutical, pharmacokinetic, or pharmacodynamic properties. Some may be taken advantage of, to the benefit of patients, but more commonly drug interactions result in adverse drug events. Therefore it is advisable for patients to follow the physician and doctors instructions to obtain maximum benefits with least fooddrug interactions. The literature survey was conducted by extracting data from different review and original articles on general or specific drug interactions with food. This review gives information about various interactions between different foods and drugs and will help physicians and pharmacists prescribe drugs cautiously with only suitable food supplement to get maximum benefit for the patient.

  6. Quantum interaction. Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Bruza, Peter [Queensland Univ. of Technology, Brisbane (Australia). Faculty of Science and Technology; Sofge, Donald [Navy Center for Applied Research in Artificial Intelligence, Washington, DC (United States). Naval Research Lab.; Lawless, William [Paine Coll., Augusta, GA (United States); Rijsbergen, Keith van [Glasgow Univ. (United Kingdom). Dept. of Computing Science; Klusch, Matthias (eds.) [German Research Center for Artificial Intelligence, Saarbruecken (Germany)

    2009-07-01

    This book constitutes the refereed proceedings of the Third International Symposium on Quantum Interaction, QI 2009, held in Saarbruecken, Germany, in March 2009. The 21 revised full papers presented together with the 3 position papers were carefully reviewed and selected from numerous submissions. The papers show the cross-disciplinary nature of quantum interaction covering topics such as computation, cognition, decision theory, information retrieval, information systems, social interaction, computational linguistics and finance. (orig.)

  7. DBD-Hunter: a knowledge-based method for the prediction of DNA-protein interactions.

    Science.gov (United States)

    Gao, Mu; Skolnick, Jeffrey

    2008-07-01

    The structures of DNA-protein complexes have illuminated the diversity of DNA-protein binding mechanisms shown by different protein families. This lack of generality could pose a great challenge for predicting DNA-protein interactions. To address this issue, we have developed a knowledge-based method, DNA-binding Domain Hunter (DBD-Hunter), for identifying DNA-binding proteins and associated binding sites. The method combines structural comparison and the evaluation of a statistical potential, which we derive to describe interactions between DNA base pairs and protein residues. We demonstrate that DBD-Hunter is an accurate method for predicting DNA-binding function of proteins, and that DNA-binding protein residues can be reliably inferred from the corresponding templates if identified. In benchmark tests on approximately 4000 proteins, our method achieved an accuracy of 98% and a precision of 84%, which significantly outperforms three previous methods. We further validate the method on DNA-binding protein structures determined in DNA-free (apo) state. We show that the accuracy of our method is only slightly affected on apo-structures compared to the performance on holo-structures cocrystallized with DNA. Finally, we apply the method to approximately 1700 structural genomics targets and predict that 37 targets with previously unknown function are likely to be DNA-binding proteins. DBD-Hunter is freely available at http://cssb.biology.gatech.edu/skolnick/webservice/DBD-Hunter/.

  8. Interaction of tRNA with domain II of 23S rRNA.

    Science.gov (United States)

    Hill, W E; Tassanakajohn, A; Tapprich, W E

    1990-08-27

    The interaction of tRNA with domain II of 23S rRNA in E. coli ribosomes has been probed using short, complementary DNA oligodeoxyribonucleotides. Specifically, cDNA oligomers to the region 801-811 of the 23S rRNA were used to ascertain the interaction of this region with tRNA. It was found that when tRNA was bound to the P site, considerable competition occurred between tRNA and the cDNA oligomers which base paired with the nucleotides 807-811. However, A-site bound tRNA neither displaced, nor was displaced, by cDNA oligomers to this region. Additionally, the binding of tRNA lacking the CACCA nucleotides on the 3' terminus was unaffected by the presence a cDNA oligomer complementary to nucleotides 803-811, indicating that the cDNA-tRNA competition was dependent on the 3' terminal nucleotides of tRNA.

  9. Antibacterial effect of cationic porphyrazines and anionic phthalocyanine and their interaction with plasmid DNA

    Science.gov (United States)

    Hassani, Leila; Hakimian, Fatemeh; Safaei, Elham; Fazeli, Zahra

    2013-11-01

    Resistance to antibiotics is a public health issue and identification of new antibacterial agents is one of the most important goals of pharmacological research. Among the novel developed antibacterial agents, porphyrin complexes and their derivatives are ideal candidates for use in medical applications. Phthalocyanines differ from porphyrins by having nitrogen atoms link the individual pyrrol units. The aza analogues of the phthalocyanines (azaPcs) such as tetramethylmetalloporphyrazines are heterocyclic Pc analogues. In this investigation, interaction of an anionic phthalocyanine (Cu(PcTs)) and two cationic tetrapyridinoporphyrazines including [Cu(2,3-tmtppa)]4+ and [Cu(3,4-tmtppa)]4+ complexes with plasmid DNA was studied using spectroscopic and gel electrophoresis methods. In addition, antibacterial effect of the complexes against Gram-positive (Staphylococcus aureus) and Gram-negative (Escherichia coli) bacteria was investigated using dilution test method. The results indicated that both porphyrazines have significant antibacterial properties, but Cu(PcTs) has weak antibacterial effect. Compairing the binding of the phthalocyanine and the porphyrazines to DNA demonstrated that the interaction of cationic porphyrazines is stronger than the anionic phthalocyanine remarkably. The extent of hypochromicity and red shift of absorption spectra indicated preferential intercalation of the two porphyrazine into the base pairs of DNA helix. Gel electrophoresis result implied Cu(2,3-tmtppa) and Cu(3,4-tmtppa) are able to perform cleavage of the plasmid DNA. Consequently, DNA binding and cleavage might be one of the antibacterial mechanisms of the complexes.

  10. Dissecting non-canonical interactions in frameshift-stimulating mRNA pseudoknots

    Energy Technology Data Exchange (ETDEWEB)

    Cornish, Peter V. [University of Illinois at Urbana-Champaign, Department of Physics (United States); Giedroc, David P. [2128 TAMU, Texas A and M University, Department of Biochemistry and Biophysics (United States); Hennig, Mirko [Scripps Research Institute, MB33, Department of Molecular Biology (United States)], E-mail: hennig@musc.edu

    2006-07-15

    A variety of powerful NMR experiments have been introduced over the last few years that allow for the direct identification of different combinations of donor and acceptor atoms involved in hydrogen bonds in biomolecules. This ability to directly observe tertiary structural hydrogen bonds in solution tremendously facilitates structural studies of nucleic acids. We show here that an adiabatic HNN-COSY pulse scheme permits observation and measurement of J(N,N) couplings for nitrogen sites that are separated by up to 140 ppm in a single experiment at a proton resonance frequency of 500 MHz. Crucial hydrogen bond acceptor sites in nucleic acids, such as cytidine N3 nitrogens, can be unambiguously identified even in the absence of detectable H41 and H42 amino protons using a novel triple-resonance two-dimensional experiment, denoted H5(C5C4)N3. The unambiguous identification of amino nitrogen donor and aromatic nitrogen acceptor sites associated with both major groove as well as minor groove triple base pairs reveal the details of hydrogen bonding networks that stabilize the complex architecture of frameshift-stimulating mRNA pseudoknots. Another key tertiary interaction involving a 2'-OH hydroxyl proton that donates a hydrogen bond to an aromatic nitrogen acceptor in a cis Watson-Crick/sugar edge interaction can also be directly detected using a quantitative J(H,N) {sup 1}H,{sup 15}N-HSQC experiment.

  11. Vision-based interaction

    CERN Document Server

    Turk, Matthew

    2013-01-01

    In its early years, the field of computer vision was largely motivated by researchers seeking computational models of biological vision and solutions to practical problems in manufacturing, defense, and medicine. For the past two decades or so, there has been an increasing interest in computer vision as an input modality in the context of human-computer interaction. Such vision-based interaction can endow interactive systems with visual capabilities similar to those important to human-human interaction, in order to perceive non-verbal cues and incorporate this information in applications such

  12. Philosophy of Interaction

    DEFF Research Database (Denmark)

    Svanæs, Dag

    2011-01-01

    This is an encyclopedia entry for the Interaction-Design.org free IxD encyclopedia. The topic of the entry is the application of the philosophy of Heidegger and Merleau-Ponty to a theory of interactivity. Comments by Don Norman and Eva Hornecker.......This is an encyclopedia entry for the Interaction-Design.org free IxD encyclopedia. The topic of the entry is the application of the philosophy of Heidegger and Merleau-Ponty to a theory of interactivity. Comments by Don Norman and Eva Hornecker....

  13. Framing interactive methods

    DEFF Research Database (Denmark)

    2011-01-01

    Two paradigms of organization and leadership is outlined and compared. A theoretical model of interactive leadership is developed, combining learning, knowledge flow, leadership and organizational principles....

  14. Two interacting Hofstadter butterflies

    Energy Technology Data Exchange (ETDEWEB)

    Barelli, A.; Bellissard, J. [Laboratoire de Physique Quantique, UMR 5626 du CNRS, Universite Paul Sabatier, F-31062 Toulouse Cedex (France); Jacquod, P. [Institut de Physique, Universite de Neuchatel, CH-2000 Neuchatel (Switzerland), Confederation Helvetique; Shepelyansky, D.L. [Laboratoire de Physique Quantique, UMR 5626 du CNRS, Universite Paul Sabatier, F-31062 Toulouse Cedex (France)

    1997-04-01

    The problem of two interacting particles in a quasiperiodic potential is addressed. Using analytical and numerical methods, we explore the spectral properties and eigenstates structure from the weak to the strong interaction case. More precisely, a semiclassical approach based on noncommutative geometry techniques is used to understand the intricate structure of such a spectrum. An interaction induced localization effect is furthermore emphasized. We discuss the application of our results on a two-dimensional model of two particles in a uniform magnetic field with on-site interaction. {copyright} {ital 1997} {ital The American Physical Society}

  15. Proxemic Mobile Collocated Interactions

    DEFF Research Database (Denmark)

    Porcheron, Martin; Lucero, Andrés; Quigley, Aaron

    2016-01-01

    and their digital devices (i.e. the proxemic relationships). Building on the ideas of proxemic interactions, this workshop is motivated by the concept of ‘proxemic mobile collocated interactions’, to harness new or existing technologies to create engaging and interactionally relevant experiences. Such approaches......Recent research on mobile collocated interactions has been looking at situations in which collocated users engage in collaborative activities using their mobile devices. However, existing practices fail to fully account for the culturally-dependent spatial relationships between people...... in exploring proxemics and mobile collocated interactions....

  16. Functional roles of a tetraloop/receptor interacting module in a cyclic di-GMP riboswitch.

    Science.gov (United States)

    Fujita, Yuki; Tanaka, Takahiro; Furuta, Hiroyuki; Ikawa, Yoshiya

    2012-02-01

    Riboswitches are a class of structural RNAs that regulate transcription and translation through specific recognition of small molecules. Riboswitches are attractive not only as drug targets for novel antibiotics but also as modular tools for controlling gene expression. Sequence comparison of a class of riboswitches that sense cyclic di-GMP (type-I c-di-GMP riboswitches) revealed that this type of riboswitch frequently shows a GAAA loop/receptor interaction between P1 and P3 elements. In the crystal structures of a type-I c-di-GMP riboswitch from Vibrio cholerae (the Vc2 riboswitch), the GNRA loop/receptor interaction assembled P2 and P3 stems to organize a ligand-binding pocket. In this study, the functional importance of the GAAA loop-receptor interaction in the Vc2 riboswitch was examined. A series of variant Vc2 riboswitches with mutations in the GAAA loop/receptor interaction were assayed for their switching abilities. In mutants with mutations in the P2 GAAA loop, expression of the reporter gene was reduced to approximately 40% - 60% of that in the wild-type. However, mutants in which the P3 receptor motif was substituted with base pairs were as active as the wild-type. These results suggested that the GAAA loop/receptor interaction does not simply establish the RNA 3D structure but docking of P2 GAAA loop reduces the flexibility of the GAAA receptor motif in the P3 element. This mechanism was supported by a variant riboswitch bearing a theophylline aptamer module in P3 the structural rigidity of which could be modulated by the small molecule theophylline.

  17. Nonlinear effects in the torsional adjustment of interacting DNA.

    Science.gov (United States)

    Kornyshev, A A; Wynveen, A

    2004-04-01

    DNA molecules in solution, having negatively charged phosphates and countercations readsorbed on its surface, possess a distinct charge separation motif to interact electrostatically. If their double-helical structure were ideal, duplexes in parallel juxtaposition could choose azimuthal alignment providing attraction, or at least a reduction of repulsion, between them. But duplexes are not perfect staircases and the distortions of their helical structure correlate with their base pair texts. If the patterns of distortions on the opposing molecules are uncorrelated, the mismatch will accumulate as a random walk and attraction vanishes. Based on this idea, a model of recognition of homologous sequences has been proposed [A. A. Kornyshev and S. Leikin, Phys. Rev. Lett. 86, 3666 (2001)]. But DNA has torsional elasticity. How will this help to relax a mismatch between the charge distributions on two nonhomologous DNA's? In the same work, the solution of this problem has been mapped onto a frustrated sine Gordon equation in a nonlocal random field (where the latter represents a pattern of twist angle distortions on the opposing molecules), but the results had been obtained in the limit of torsionally rigid molecules. In the present paper, by solving this equation numerically, we find a strongly nonlinear relaxation mechanism which utilizes static kink-soliton modes triggered by the "random field." In the range of parameters where the solitons do not emerge, we find good agreement with the results of a variational study [A. G. Cherstvy, A. A. Kornyshev, and S. Leikin, J. Phys. Chem. B (to be published)]. We reproduce the first-order transitions in the interaxial separation dependence, but detect also second-order or weak first-order transitions for shorter duplexes. The recognition energy between two nonhomologous DNA sequences is calculated as a function of interaxial separation and the length of juxtaposition. The soliton-caused kinky length dependence is discussed in

  18. Nonlinear effects in the torsional adjustment of interacting DNA

    Science.gov (United States)

    Kornyshev, A. A.; Wynveen, A.

    2004-04-01

    DNA molecules in solution, having negatively charged phosphates and countercations readsorbed on its surface, possess a distinct charge separation motif to interact electrostatically. If their double-helical structure were ideal, duplexes in parallel juxtaposition could choose azimuthal alignment providing attraction, or at least a reduction of repulsion, between them. But duplexes are not perfect staircases and the distortions of their helical structure correlate with their base pair texts. If the patterns of distortions on the opposing molecules are uncorrelated, the mismatch will accumulate as a random walk and attraction vanishes. Based on this idea, a model of recognition of homologous sequences has been proposed [A. A. Kornyshev and S. Leikin, Phys. Rev. Lett. 86, 3666 (2001)]. But DNA has torsional elasticity. How will this help to relax a mismatch between the charge distributions on two nonhomologous DNA’s? In the same work, the solution of this problem has been mapped onto a frustrated sine Gordon equation in a nonlocal random field (where the latter represents a pattern of twist angle distortions on the opposing molecules), but the results had been obtained in the limit of torsionally rigid molecules. In the present paper, by solving this equation numerically, we find a strongly nonlinear relaxation mechanism which utilizes static kink-soliton modes triggered by the “random field.” In the range of parameters where the solitons do not emerge, we find good agreement with the results of a variational study [A. G. Cherstvy, A. A. Kornyshev, and S. Leikin, J. Phys. Chem. B (to be published)]. We reproduce the first-order transitions in the interaxial separation dependence, but detect also second-order or weak first-order transitions for shorter duplexes. The recognition energy between two nonhomologous DNA sequences is calculated as a function of interaxial separation and the length of juxtaposition. The soliton-caused kinky length dependence is

  19. The transcriptome of compatible and incompatible interactions of potato (Solanum tuberosum with Phytophthora infestans revealed by DeepSAGE analysis.

    Directory of Open Access Journals (Sweden)

    Gabor Gyetvai

    Full Text Available Late blight, caused by the oomycete Phytophthora infestans, is the most important disease of potato (Solanum tuberosum. Understanding the molecular basis of resistance and susceptibility to late blight is therefore highly relevant for developing resistant cultivars, either by marker-assissted selection or by transgenic approaches. Specific P. infestans races having the Avr1 effector gene trigger a hypersensitive resistance response in potato plants carrying the R1 resistance gene (incompatible interaction and cause disease in plants lacking R1 (compatible interaction. The transcriptomes of the compatible and incompatible interaction were captured by DeepSAGE analysis of 44 biological samples comprising five genotypes, differing only by the presence or absence of the R1 transgene, three infection time points and three biological replicates. 30,859 unique 21 base pair sequence tags were obtained, one third of which did not match any known potato transcript sequence. Two third of the tags were expressed at low frequency (<10 tag counts/million. 20,470 unitags matched to approximately twelve thousand potato transcribed genes. Tag frequencies were compared between compatible and incompatible interactions over the infection time course and between compatible and incompatible genotypes. Transcriptional changes were more numerous in compatible than in incompatible interactions. In contrast to incompatible interactions, transcriptional changes in the compatible interaction were observed predominantly for multigene families encoding defense response genes and genes functional in photosynthesis and CO(2 fixation. Numerous transcriptional differences were also observed between near isogenic genotypes prior to infection with P. infestans. Our DeepSAGE transcriptome analysis uncovered novel candidate genes for plant host pathogen interactions, examples of which are discussed with respect to possible function.

  20. Drug-nutrient interactions.

    Science.gov (United States)

    Chan, Lingtak-Neander

    2013-07-01

    Drug-nutrient interactions are defined as physical, chemical, physiologic, or pathophysiologic relationships between a drug and a nutrient. The causes of most clinically significant drug-nutrient interactions are usually multifactorial. Failure to identify and properly manage drug-nutrient interactions can lead to very serious consequences and have a negative impact on patient outcomes. Nevertheless, with thorough review and assessment of the patient's history and treatment regimens and a carefully executed management strategy, adverse events associated with drug-nutrient interactions can be prevented. Based on the physiologic sequence of events after a drug or a nutrient has entered the body and the mechanism of interactions, drug-nutrient interactions can be categorized into 4 main types. Each type of interaction can be managed using similar strategies. The existing data that guide the clinical management of most drug-nutrient interactions are mostly anecdotal experience, uncontrolled observations, and opinions, whereas the science in understanding the mechanism of drug-nutrient interactions remains limited. The challenge for researchers and clinicians is to increase both basic and higher level clinical research in this field to bridge the gap between the science and practice. The research should aim to establish a better understanding of the function, regulation, and substrate specificity of the nutrient-related enzymes and transport proteins present in the gastrointestinal tract, as well as assess how the incidence and management of drug-nutrient interactions can be affected by sex, ethnicity, environmental factors, and genetic polymorphisms. This knowledge can help us develop a true personalized medicine approach in the prevention and management of drug-nutrient interactions.

  1. INTERACT Station Catalogue - 2015

    DEFF Research Database (Denmark)

    INTERACT stations are located in all major environmental envelopes of the Arctic providing an ideal platform for studying climate change and its impact on the environment and local communities. Since alpine environments face similar changes and challenges as the Arctic, the INTERACT network also ...

  2. Visualizing Dispersion Interactions

    Science.gov (United States)

    Gottschalk, Elinor; Venkataraman, Bhawani

    2014-01-01

    An animation and accompanying activity has been developed to help students visualize how dispersion interactions arise. The animation uses the gecko's ability to walk on vertical surfaces to illustrate how dispersion interactions play a role in macroscale outcomes. Assessment of student learning reveals that students were able to develop…

  3. Interactive Visualization of Dependencies

    Science.gov (United States)

    Moreno, Camilo Arango; Bischof, Walter F.; Hoover, H. James

    2012-01-01

    We present an interactive tool for browsing course requisites as a case study of dependency visualization. This tool uses multiple interactive visualizations to allow the user to explore the dependencies between courses. A usability study revealed that the proposed browser provides significant advantages over traditional methods, in terms of…

  4. Moving into an interaction

    DEFF Research Database (Denmark)

    Mortensen, Kristian; Hazel, Spencer

    2014-01-01

    Opening an interaction is a crucial step in establishing and maintaining social relationships. In this paper we describe how participants in an institutional setting, a help desk counter for exchange students at an international university, literally move into interaction. This is accomplished...

  5. Sketches in Embodied Interaction

    DEFF Research Database (Denmark)

    Erkut, Cumhur; Dahl, Sofia; Triantafyllidis, Georgios

    2014-01-01

    We present an approach for teaching and designing embodied interaction based on interactive sketches. We have combined the mover perspective and felt experiences of movement with advanced technologies (multi-agents, physical simulations) in a generative design session. We report our activities...

  6. Interactive Visualization of Dependencies

    Science.gov (United States)

    Moreno, Camilo Arango; Bischof, Walter F.; Hoover, H. James

    2012-01-01

    We present an interactive tool for browsing course requisites as a case study of dependency visualization. This tool uses multiple interactive visualizations to allow the user to explore the dependencies between courses. A usability study revealed that the proposed browser provides significant advantages over traditional methods, in terms of…

  7. Storyboarding Multimedia Interactions.

    Science.gov (United States)

    Martin, Linda C.

    2000-01-01

    Understanding how to include interactivity when designing multimedia-based training (MBT) storyboards is a major key for a successful MBT. Discusses the basic formats of interactions and when to use each format. Describes how to storyboard and areas to address, including: the display area, prompts, branching, programming and graphics notes,…

  8. Child Computer Interaction SIG

    DEFF Research Database (Denmark)

    Read, Janet; Hourcade, Juan Pablo; Markopoulos, Panos

    The discipline of Child Computer Interaction (CCI) has been steadily growing and it is now firmly established as a community in its own right, having the annual IDC (Interaction and Design for Children) conference and its own journal and also enjoying its role as a highly recognisable and vibrant...

  9. Visualizing Dispersion Interactions

    Science.gov (United States)

    Gottschalk, Elinor; Venkataraman, Bhawani

    2014-01-01

    An animation and accompanying activity has been developed to help students visualize how dispersion interactions arise. The animation uses the gecko's ability to walk on vertical surfaces to illustrate how dispersion interactions play a role in macroscale outcomes. Assessment of student learning reveals that students were able to develop…

  10. Philosophy of Interaction

    DEFF Research Database (Denmark)

    Svanæs, Dag

    2011-01-01

    This is an encyclopedia entry for the Interaction-Design.org free IxD encyclopedia. The topic of the entry is the application of the philosophy of Heidegger and Merleau-Ponty to a theory of interactivity. Comments by Don Norman and Eva Hornecker....

  11. Progress on Multiple Interactions

    CERN Document Server

    Skands, P Z

    2004-01-01

    We report on the development of a new model for the underlying event in hadron-hadron collisions. The model includes parton showers for all interactions, as well as non-trivial flavour, momentum, and colour correlations between interaction initiators and beam remnant partons.

  12. Aspects, Dependencies, and Interactions

    NARCIS (Netherlands)

    Chitchyan, R; Fabry, J.; Bergmans, Lodewijk; Südholt, M.; Consel, C.

    2007-01-01

    For Aspect-Oriented Software Development (AOSD) the topic of Aspects, Dependencies and Interactions is of high importance across the whole range of development activities – from requirements engineering through to language design. Aspect interactions must be adequately addressed all across the softw

  13. An innovative monolithic column preparation for the isolation of 25 kilo base pairs DNA.

    Science.gov (United States)

    Ongkudon, Clarence M; Pan, Sharadwata; Danquah, Michael K

    2013-11-29

    The use of large DNAs in preparing multivalent vaccines that will eventually give protective immunity against multiple pathogenic microbes is becoming a major debate nowadays. One of the important issues in ensuring the successful implementation of the new vaccine technology is the development of a chromatographic technique that can handle larger DNAs. This paper reports the development of a novel conical monolithic column format with pore and surface characteristics engineered for the isolation of 25 kbp DNA in a single step fashion. An effective method of eliminating wall channelling, a defect of most conventional monolithic chromatography systems which has caused significant loss of product, was applied to maximise DNA recovery. This method was based on a systematic reduction of wall channel size based on a predetermined correlation between column’s back pressure and wall channel size of a particular monolith pore size.

  14. Torque spectroscopy of DNA: base-pair stability, boundary effects, backbending, and breathing dynamics

    Science.gov (United States)

    Oberstrass, Florian C.; Fernandes, Louis E.; Lebel, Paul; Bryant, Zev

    2013-01-01

    Changes in global DNA linking number can be accommodated by localized changes in helical structure. We have used single-molecule torque measurements to investigate sequence-specific strand separation and Z-DNA formation. By controlling the boundary conditions at the edges of sequences of interest, we have confirmed theoretical predictions of distinctive boundary-dependent backbending patterns in torque-twist relationships. Abrupt torque jumps are associated with the formation and collapse of DNA bubbles, permitting direct observations of DNA breathing dynamics. PMID:23679785

  15. Structure of 2,4-Diaminopyrimidine-Theobromine Alternate Base Pairs

    NARCIS (Netherlands)

    Gengeliczki, Z.; Callahan, M. P.; Kabelac, M.; Rijs, A. M.; de Vries, M. S.

    2011-01-01

    We report the structure of dusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate

  16. Beyond ketonization: selective conversion of carboxylic acids to olefins over balanced Lewis acid-base pairs.

    Science.gov (United States)

    Baylon, Rebecca A L; Sun, Junming; Martin, Kevin J; Venkitasubramanian, Padmesh; Wang, Yong

    2016-04-11

    We report the direct conversion of mixed carboxylic acids to C-C olefins with up to 60 mol% carbon yield through cascade (cross) ketonization, (cross) aldolization and self-deoxygenation reactions. Co-feeding hydrogen provides an additional ketone hydrogenation/dehydration pathway to a wider range of olefins.

  17. CREST maps somatic structural variation in cancer genomes with base-pair resolution.

    Science.gov (United States)

    Wang, Jianmin; Mullighan, Charles G; Easton, John; Roberts, Stefan; Heatley, Sue L; Ma, Jing; Rusch, Michael C; Chen, Ken; Harris, Christopher C; Ding, Li; Holmfeldt, Linda; Payne-Turner, Debbie; Fan, Xian; Wei, Lei; Zhao, David; Obenauer, John C; Naeve, Clayton; Mardis, Elaine R; Wilson, Richard K; Downing, James R; Zhang, Jinghui

    2011-06-12

    We developed 'clipping reveals structure' (CREST), an algorithm that uses next-generation sequencing reads with partial alignments to a reference genome to directly map structural variations at the nucleotide level of resolution. Application of CREST to whole-genome sequencing data from five pediatric T-lineage acute lymphoblastic leukemias (T-ALLs) and a human melanoma cell line, COLO-829, identified 160 somatic structural variations. Experimental validation exceeded 80%, demonstrating that CREST had a high predictive accuracy.

  18. CREST maps somatic structural variation in cancer genomes with base-pair resolution

    OpenAIRE

    2011-01-01

    We developed CREST (Clipping REveals STructure), an algorithm that uses next-generation sequencing reads with partial alignments to a reference genome to directly map structural variations at the nucleotide level of resolution. Application of CREST to whole-genome sequencing data from five pediatric T-lineage acute lymphoblastic leukemias (T-ALLs) and a human melanoma cell line, COLO-829, identified 160 somatic structural variations. Experimental validation exceeded 80% demonstrating that CRE...

  19. Structure of 2,4-Diaminopyrimidine-Theobromine Alternate Base Pairs

    NARCIS (Netherlands)

    Gengeliczki, Z.; Callahan, M. P.; Kabelac, M.; Rijs, A. M.; de Vries, M. S.

    2011-01-01

    We report the structure of dusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucle

  20. Deep RNA sequencing at single base-pair resolution reveals high complexity of the rice transcriptome

    DEFF Research Database (Denmark)

    Zhang, Guojie; Guo, Guangwu; Hu, Xueda

    2010-01-01

    present the first transcriptome atlas for eight organs of cultivated rice. Using high-throughput paired-end RNA-seq, we unambiguously detected transcripts expressing at an extremely low level, as well as a substantial number of novel transcripts, exons, and untranslated regions. An analysis of alternative...... fusion events are more common than expected. In-depth analysis revealed a multitude of fusion transcripts that might be by-products of alternative splicing. Validation and chimeric transcript structural analysis provided evidence that some of these transcripts are likely to be functional in the cell...

  1. Amplification of a 500-Base-Pair Fragment from Cultured Isolates of Mycobacterium bovis

    Science.gov (United States)

    Rodríguez, Juan Germán; Fissanoti, Juan Carlos; Del Portillo, Patricia; Patarroyo, Manuel Elkin; Romano, María Isabel; Cataldi, Angel

    1999-01-01

    The presence of a 500-bp fragment which amplifies a region from the genome of Mycobacterium bovis (J. G. Rodriguez, G. A. Meija, P. Del Portillo, M. E. Patarroyo, and L. A. Murillo, Microbiology 141:2131–2138, 1995) was evaluated by carrying out PCR on 121 M. bovis isolates. The M. bovis strains, previously characterized by culture and biochemical tests, were isolated from cattle in different regions of Argentina, Mexico, and Colombia. Four additional strains isolated from sea lions that belong to the M. tuberculosis complex were also included in the study. All of the isolates tested were PCR positive, rendering the expected 500-bp band and giving a correlation of 100% with previous microbiological characterization. Southern blot analysis revealed a common band of 1,800 bp and a polymorphic high-molecular-mass hybridization pattern. The results show that this assay may be useful for diagnosis and identification of M. bovis in cattle. PMID:10364607

  2. Comparison of Three Cre-LoxP Based Paired-End Library Construction Methods

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Ze; Nath, Nandita; Tritt, Andrew; Liang, Shoudan; Han, James; Pennacchio, Len; Chen, Feng

    2013-03-26

    Paired-end library sequencing has been proven useful in scaffold construction during de novo whole genome shotgun assembly. The ability of generating mate pairs with > 8 Kb insert sizes is especially important for genomes containing long repeats. To make mate paired libraries for next generation sequencing, DNA fragments need to be circularized to bring the ends together. There are several methods that can be used for DNA circulation, namely ligation, hybridization and Cre-LoxP recombination. With higher circularization efficiency with large insert DNA fragments, Cre-LoxP recombination method generally has been used for constructing >8 kb insert size paired-end libraries. Second fragmentation step is also crucial for maintaining high library complexity and uniform genome coverage. Here we will describe the following three fragmentation methods: restriction enzyme digestion, random shearing and nick translation. We will present the comparison results for these three methods. Our data showed that all three methods are able to generate paired-end libraries with greater than 20 kb insert. Advantages and disadvantages of these three methods will be discussed as well.

  3. Distance-dependent proton transfer along water wires connecting acid-base pairs

    NARCIS (Netherlands)

    Cox, M.J.; Timmer, R.L.A.; Bakker, H.J.; Park, S.; Agmon, N.

    2009-01-01

    We report time-resolved mid-IR kinetics for the ultrafast acid−base reaction between photoexcited 8-hydroxypyrene-1,3,6-trisulfonic acid trisodium salt (HPTS), and acetate at three concentrations (0.5, 1.0, and 2.0 M) and three temperatures (5, 30, and 65 °C) in liquid D2O. The observed proton-trans

  4. Beyond ketonization: selective conversion of carboxylic acids to olefins over balanced Lewis acid–base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Baylon, Rebecca A. L.; Sun, Junming; Martin, Kevin J.; Venkitasubramanian, Padmesh; Wang, Yong

    2016-01-01

    Dwindling petroleum reserves combined with increased energy demand and political factors encouraging an increase in energy independence have led to a large amount of research on sustainable alternatives. To this end, biomass conversion has been recognized as themost readily viable technology to produce biofuel concerning our reliance on liquid fuels for transportation and has the advantage of being easily integrated into our heavy use of combustion engines. The interest in biomass conversion has also resulted in reduced costs and a greater abundance of bio-oil, a mixture of hundreds of oxygenates including alcohols, aldehydes, carboxylic acids, and ketones. However, the presence of carboxylic acids in bio-oil derived from lignocellulose pyrolysis leads to low pH, instability, and corrosiveness. In addition, carboxylic acids (i.e. acetic acid) can also be produced via fermentation of sugars. This can be accomplished by a variety of homoacetogenic microorganisms that can produce acetic acid with 100% carbon yield.

  5. Conjugate Acid-Base Pairs, Free Energy, and the Equilibrium Constant

    Science.gov (United States)

    Beach, Darrell H.

    1969-01-01

    Describes a method of calculating the equilibrium constant from free energy data. Values of the equilibrium constants of six Bronsted-Lowry reactions calculated by the author's method and by a conventional textbook method are compared. (LC)

  6. New ab initio based pair potential for accurate simulation of phase transitions in ZnO

    NARCIS (Netherlands)

    Wang, Shuaiwei; Fan, Zhaochuan; Koster, Rik S.; Fang, Changming; Van Huis, Marijn A.; Yalcin, Anil O.; Tichelaar, Frans D.; Zandbergen, Henny W.; Vlugt, Thijs J H

    2014-01-01

    A set of interatomic pair potentials is developed for ZnO based on the partially charged rigid ion model (PCRIM). The derivation of the potentials combines lattice inversion, empirical fitting, and ab initio energy surface fitting. We show that, despite the low number of parameters in this model (8)

  7. Extrasolar Planet Interactions

    CERN Document Server

    Barnes, Rory

    2008-01-01

    The dynamical interactions of planetary systems may be a clue to their formation histories. Therefore, the distribution of these interactions provides important constraints on models of planet formation. We focus on each system's apsidal motion and proximity to dynamical instability. Although only ~25 multiple planet systems have been discovered to date, our analyses in these terms have revealed several important features of planetary interactions. 1) Many systems interact such that they are near the boundary between stability and instability. 2) Planets tend to form such that at least one planet's eccentricity periodically drops to near zero. 3) Mean-motion resonant pairs would be unstable if not for the resonance. 4) Scattering of approximately equal mass planets is unlikely to produce the observed distribution of apsidal behavior. 5) Resonant interactions may be identified through calculating a system's proximity to instability, regardless of knowledge of angles such as mean longitude and longitude of peri...

  8. Laser-surface interactions

    CERN Document Server

    Ganeev, Rashid A

    2014-01-01

    This book is about the interaction of laser radiation with various surfaces at variable parameters of radiation. As a basic principle of classification we chose the energetic or intensity level of interaction of laser radiation with the surfaces. These two characteristics of laser radiation are the most important parameters defining entire spectrum of the processes occurring on the surfaces during interaction with electromagnetic waves. This is a first book containing a whole spectrum of the laser-surface interactions distinguished by the ranges of used laser intensity. It combines the surface response starting from extremely weak laser intensities (~1 W cm-2) up to the relativistic intensities (~1020 W cm-2 and higher). The book provides the basic information about lasers and acquaints the reader with both common applications of laser-surface interactions (laser-related printers, scanners, barcode readers, discs, material processing, military, holography, medicine, etc) and unusual uses of the processes on t...

  9. Magnetic interactions between nanoparticles

    DEFF Research Database (Denmark)

    Mørup, Steen; Hansen, Mikkel Fougt; Frandsen, Cathrine

    2010-01-01

    We present a short overview of the influence of inter-particle interactions on the properties of magnetic nanoparticles. Strong magnetic dipole interactions between ferromagnetic or ferrimagnetic particles, that would be superparamagnetic if isolated, can result in a collective state...... of nanoparticles. This collective state has many similarities to spin-glasses. In samples of aggregated magnetic nanoparticles, exchange interactions are often important and this can also lead to a strong suppression of superparamagnetic relaxation. The temperature dependence of the order parameter in samples...... of strongly interacting hematite nanoparticles or goethite grains is well described by a simple mean field model. Exchange interactions between nanoparticles with different orientations of the easy axes can also result in a rotation of the sub-lattice magnetization directions....

  10. Interaction English Teaching Model

    Institute of Scientific and Technical Information of China (English)

    穆宇娜

    2013-01-01

      Malash—Thomas pointed out“Interaction is a process in which people and things act upon each other through their ac⁃tions.”According to different subjects, interaction can be divided into human-computer interaction, people-people interaction and learner-content interaction. According to different forms, interactions can be divided into one-one interaction, one-more interac⁃tion and more-more interaction.“Interaction Education”means that teachers are leading parts and students are the center of class. During teaching process, teachers must lead students to discover. Demands from students can encourage teachers to inspire con⁃versely.Thus it can form a close communication between teachers and students. Teaching and learning are realized in a happy and harmonious atmosphere. Successful English teaching must take new bilateral teaching as the first part, which should let the func⁃tion of the two most important elements develop fully. Teachers should grasp opportunities to guide. Teaching methods need to be flexible, and contents of teaching need to be vivid;students should be keen to think, to participate actively, and can break the tradi⁃tion to produce fresh ideas, and in that situation the capability of students can develop fully. The educational model refers to the simplified description of detailed teaching activities. Possessing dual functions of theory and practice, the educational model is the manifestation of theoretical teaching method. The combination of interaction and educational model which are mentioned above form the“interactive teaching”model. With the coming of economic globalization and integration of science and technology, now communications are increasing with each passing day. If you want to take part in or to get in touch with others, you must use lan⁃guage. English has been learnt for 10 years in Middle school and in college, but it can’t be spoken very fluently. That is a realistic picture as the result of an

  11. Interactive Strategy-Making

    DEFF Research Database (Denmark)

    Andersen, Torben Juul

    2015-01-01

    This article outlines an interactive strategy-making model that combines central reasoning with ongoing learning from decentralised responses. The management literature often presents strategy as implementing an optimal plan identified through rational analysis and ascribes potential shortcomings...... to failed communication and execution of the planned actions. However, effective strategy-making comprises both central reasoning from forward-looking planning considerations and decentralised responses to emerging events as interacting elements in a dynamic adaptive system. The interaction between...... these central and decentralised processes explains how strategic adaptation can thrive under turbulent conditions in the interface between central reasoning and decentralised responses....

  12. Media Facades beyond Interaction

    DEFF Research Database (Denmark)

    Fritsch, Jonas

    2008-01-01

    As part of a the research project Digital Urban Living [www.digitalurbanliving.dk], we have taken part in the design of two large-scale installations that employ interactive technologies to facilitate participation and foster social interactions in public, urban settings. We present the two cases......, Aarhus by Light and Projected Poetry, and discuss the future trajectory of our work in this field, as well as some of our findings regarding the challenges of designing large-scale public interactive installations. In doing so, we specifically highlight the possibilities in relation to designing...

  13. Dendrimer-surfactant interactions.

    Science.gov (United States)

    Cheng, Yiyun; Zhao, Libo; Li, Tianfu

    2014-04-28

    In this article, we reviewed the interactions between dendrimers and surfactants with particular focus on the interaction mechanisms and physicochemical properties of the yielding dendrimer-surfactant aggregates. In order to provide insight into the behavior of dendrimers in biological systems, the interactions of dendrimers with bio-surfactants such as phospholipids in bulk solutions, in solid-supported bilayers and at the interface of phases or solid-states were discussed. Applications of the dendrimer-surfactant aggregates as templates to guide the synthesis of nanoparticles and in drug or gene delivery were also mentioned.

  14. Fibronectin-cell interactions

    DEFF Research Database (Denmark)

    Couchman, J R; Austria, M R; Woods, A

    1990-01-01

    Fibronectins are widespread extracellular matrix and body fluid glycoproteins, capable of multiple interactions with cell surfaces and other matrix components. Their structure at a molecular level has been resolved, yet there are still many unanswered questions regarding their biologic activity...... in vivo. Much data suggests that fibronectins may promote extracellular matrix assembly, and cell adhesion to those matrices. However, one outstanding enigma is that fibronectins may, under different circumstances, promote both cell migration and anchorage. An analysis of the interaction of fibroblasts...... with proteolytically derived and purified domains of plasma fibronectin revealed that the type of adhesion and the correlated cytoskeletal organization depended on multiple interactions of fibronectin domains with the cell surface. Human dermal fibroblasts were capable of interacting with the integrin-binding domain...

  15. Interactive Sample Book (ISB)

    DEFF Research Database (Denmark)

    Heimdal, Elisabeth Jacobsen; Lenau, Torben Anker; Guglielmi, Michel

    2009-01-01

    involving designers and engineers. It is carried out by Elisabeth Heimdal as her Master thesis from Design & Innovation, The Technical University of Denmark. Collaboration partners are the design bureau Diffus, textile designer Priya Mani, master student in medialogy at AAU Marija Andonovska and DTU......, with the aim of exploring and communicating some of the possibilities within interactive textiles. The applications for interactive textiles range from medical applications to architecture, and from the fashion industry to costume design. In relation to the sample book, focus will be on texture, lightning...... and senses in relation to integrated decoration and function primarily to indoor applications. The result of the project will be a number of interactive textiles, to be gathered in an interactive sample book (ISB), in a similar way as the sample books of wallpapers one can take home from the shop and choose...

  16. Theory of gravitational interactions

    CERN Document Server

    Gasperini, Maurizio

    2013-01-01

    This reference textbook is an up-to-date and self-contained introduction to the theory of gravitational interactions. The first part of the book follows the traditional presentation of general relativity as a geometric theory of the macroscopic gravitational field. A second, advanced part then discusses the deep analogies (and differences) between a geometric theory of gravity and the gauge theories of the other fundamental interactions. This fills a gap which is present in the context of the traditional approach to general relativity, and which usually makes students puzzled about the role of gravity. The necessary notions of differential geometry are reduced to the minimum, leaving more room for those aspects of gravitational physics of current phenomenological and theoretical interest, such as the properties of gravitational waves, the gravitational interactions of spinors, and the supersymmetric and higher-dimensional generalization of the Einstein equations. Theory of Gravitational Interactions will be o...

  17. Neutrino Self-Interactions

    CERN Document Server

    Hasenkamp, Jasper

    2016-01-01

    We propose a theory that equips the active neutrinos with interactions among themselves that are at least three orders of magnitude stronger than the weak interaction. We introduce an Abelian gauge group $U(1)_x$ with vacuum expectation value $v_x \\lesssim \\mathcal{O}(100 \\textrm{ MeV})$. An asymmetric mass matrix implements the active neutrinos as massless mass eigenstates carrying "effective" charges. To stabilize $v_x$, supersymmetry breaking is mediated via loops to the additional sector with the only exception of xHiggs terms. No Standard Model interaction eigenstate carries $U(1)_x$ charge. Thus the dark photon's kinetic mixing is two-loop suppressed.With only simple and generic values of dimensionless parameters, our theory might explain the high-energy neutrino spectrum observed by IceCube including the PeV neutrinos. We comment on the imposing opportunity to incorporate a self-interacting dark matter candidate.

  18. Patient - patient interaction

    DEFF Research Database (Denmark)

    Birkelund, Regner; Søndergaard Larsen, Lene

    2013-01-01

    Aim:  The aim of this study is to provide an understanding of the significance of hospitalized patients’ interpersonal interaction with fellow patients in an infectious disease ward in a large Danish hospital. Method:  A qualitative approach was selected using participant observation and semi...... subcategories representing significance of patients’ interaction with fellow patients. Results:  The qualitative analysis resulted in two main categories: (i) Caring for fellow patients and (ii) Sharing illness information with fellow patients. Each of the main categories was elucidated through several...... subcategories. Our findings clearly showed that interpersonal interaction with fellow patients was of utmost importance when it came to care and support and when they needed information about their illness. Typically, the interpersonal interaction was experienced as giving and referred to in positive terms...

  19. Unparticle self-interactions

    CERN Document Server

    Georgi, Howard

    2009-01-01

    We develop techniques for studying the effects of self-interactions in the conformal sector of an unparticle model. Their physics is encoded in the higher n-point functions of the conformal theory. We study inclusive processes and argue that the inclusive production of unparticle stuff in standard model processes due to the unparticle self-interactions can be decomposed using the conformal partial wave expansion and its generalizations into a sum over contributions from the production of various kinds of unparticle stuff, corresponding to different primary conformal operators. Such processes typically involve the production of unparticle stuff associated with operators other than those to which the standard model couples directly. Thus just as interactions between particles allow scattering processes to produce new particles in the final state, so unparticle self-interactions cause the production of various kinds of unparticle stuff. We discuss both inclusive and exclusive methods for computing these processe...

  20. Interactive Office user's manual

    Science.gov (United States)

    Montgomery, Edward E.; Lowers, Benjamin; Nabors, Terri L.

    1990-01-01

    Given here is a user's manual for Interactive Office (IO), an executive office tool for organization and planning, written specifically for Macintosh. IO is a paperless management tool to automate a related group of individuals into one productive system.

  1. Interactive Design Activism

    Science.gov (United States)

    Goulev, Petar; Farrer, Joan

    The following sections are included: * Introduction * Computers and Human Well-being * To Fuzzy or Yes (No)! * Interactive Design Activism * Sensing the Sun * Personalised Public Health Advice * Modifying Human Behaviour * Transdisciplinarity, Knowledge Transfer and Multi-domain

  2. Learning to Interact

    DEFF Research Database (Denmark)

    Fusaroli, Riccardo; Weed, Ethan; Naigles, Letitia

    Background : Interactive alignment (IA) has been argued to underlie not only successful social interactions (Pickering & Garrod, 2004), but also language development. By re-using each other’s words, the child and the caregiver engage each other, and the child acquires new linguistic items......=1.94, p=0.05) and lower syntactic alignment (β=-1.16, SE=0.33, t-stat=-3.48, pGender had no impact. None of these factors interacted...... about how the ability to align develops, and whether it is impaired in everyday unstructured interactions. Objectives : We ask two questions: i) does IA evolve over time as children becomes a more competent speakers? and ii) is IA impaired in children with ASD? Methods : We analyzed spontaneous speech...

  3. Chasing Ecological Interactions

    Science.gov (United States)

    2016-01-01

    Basic research on biodiversity has concentrated on individual species—naming new species, studying distribution patterns, and analyzing their evolutionary relationships. Yet biodiversity is more than a collection of individual species; it is the combination of biological entities and processes that support life on Earth. To understand biodiversity we must catalog it, but we must also assess the ways species interact with other species to provide functional support for the Tree of Life. Ecological interactions may be lost well before the species involved in those interactions go extinct; their ecological functions disappear even though they remain. Here, I address the challenges in studying the functional aspects of species interactions and how basic research is helping us address the fast-paced extinction of species due to human activities. PMID:27631692

  4. Atomic & Molecular Interactions

    Energy Technology Data Exchange (ETDEWEB)

    None

    2002-07-12

    The Gordon Research Conference (GRC) on Atomic & Molecular Interactions was held at Roger Williams University, Bristol, RI. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  5. ENTREPRENEURSHIP AS SOCIAL INTERACTION

    DEFF Research Database (Denmark)

    Larsen, Henry; Lima, Patricia; Olsen, Bente

    2013-01-01

    This paper aims to explore how entrepreneurs work with innovation; to explore and develop attention points in understanding entrepreneurship as social processes of interaction between people. Through interviews and engagement with entrepreneurs and key stakeholders, their actual social practices...... and the influence on the progress as innovators are explored. It is focused on a new local activity in a Danish town, named the I-factory which has within a year gathered almost 40 entrepreneurs. As a part of the interaction, there were created activities to encourage even more collaboration. We see...... entrepreneurship as socially constructed through local interactions between players and identify key themes in these interactions within the organisation, such as leadership, becoming part of the initiative and trust/mistrust. By doing so, this paper contributes to an understanding of entrepreneurship as social...

  6. Interaction as Negotiation

    DEFF Research Database (Denmark)

    Kristensen, Jannie Friis; Nielsen, Christina

    In this paper we discuss recent developments in interaction design principles for ubiquitous computing environments, specifically implications related to situated and mobile aspects of work. We present 'Interaction through Negotiation' as a general Human-Computer Interaction (HCI) paradigm, aimed...... at ubiquitous/pervasive technology and environments, with focus on facilitating negotiation in and between webs of different artifacts, humans and places. This approach is concerned with the way technology presents itself to us, both as physical entities and as conceptual entities, as well as the relations...... on several extensive empirical case studies, as well as co-operative design-sessions, we present a reflective analysis providing insights into results of the "Interaction through Negotiation" design approach in action. A very promising area of application is exception handling in pervasive computing...

  7. Mobile Collocated Interactions

    DEFF Research Database (Denmark)

    Lucero, Andrés; Clawson, James; Lyons, Kent

    2015-01-01

    Mobile devices such as smartphones and tablets were originally conceived and have traditionally been utilized for individual use. Research on mobile collocated interactions has been looking at situations in which collocated users engage in collaborative activities using their mobile devices, thus...... going from personal/individual toward shared/multiuser experiences and interactions. However, computers are getting smaller, more powerful, and closer to our bodies. Therefore, mobile collocated interactions research, which originally looked at smartphones and tablets, will inevitably include ever......-smaller computers, ones that can be worn on our wrists or other parts of the body. The focus of this workshop is to bring together a community of researchers, designers and practitioners to explore the potential of extending mobile collocated interactions to the use of wearable devices....

  8. Large-scale symmetry-adapted perturbation theory computations via density fitting and Laplace transformation techniques: Investigating the fundamental forces of DNA-intercalator interactions

    Science.gov (United States)

    Hohenstein, Edward G.; Parrish, Robert M.; Sherrill, C. David; Turney, Justin M.; Schaefer, Henry F.

    2011-11-01

    Symmetry-adapted perturbation theory (SAPT) provides a means of probing the fundamental nature of intermolecular interactions. Low-orders of SAPT (here, SAPT0) are especially attractive since they provide qualitative (sometimes quantitative) results while remaining tractable for large systems. The application of density fitting and Laplace transformation techniques to SAPT0 can significantly reduce the expense associated with these computations and make even larger systems accessible. We present new factorizations of the SAPT0 equations with density-fitted two-electron integrals and the first application of Laplace transformations of energy denominators to SAPT. The improved scalability of the DF-SAPT0 implementation allows it to be applied to systems with more than 200 atoms and 2800 basis functions. The Laplace-transformed energy denominators are compared to analogous partial Cholesky decompositions of the energy denominator tensor. Application of our new DF-SAPT0 program to the intercalation of DNA by proflavine has allowed us to determine the nature of the proflavine-DNA interaction. Overall, the proflavine-DNA interaction contains important contributions from both electrostatics and dispersion. The energetics of the intercalator interaction are are dominated by the stacking interactions (two-thirds of the total), but contain important contributions from the intercalator-backbone interactions. It is hypothesized that the geometry of the complex will be determined by the interactions of the intercalator with the backbone, because by shifting toward one side of the backbone, the intercalator can form two long hydrogen-bonding type interactions. The long-range interactions between the intercalator and the next-nearest base pairs appear to be negligible, justifying the use of truncated DNA models in computational studies of intercalation interaction energies.

  9. Beam-Material Interaction

    Energy Technology Data Exchange (ETDEWEB)

    Mokhov, N. V. [Fermilab; Cerutti, F. [CERN

    2016-01-01

    Th is paper is motivated by the growing importance of better understanding of the phenomena and consequences of high-intensity energetic particle beam interactions with accelerator, generic target, and detector components. It reviews the principal physical processes of fast-particle interactions with matter, effects in materials under irradiation, materials response, related to component lifetime and performance, simulation techniques, and methods of mitigating the impact of radiation on the components and environment in challenging current and future applications.

  10. Macroeconomic Policies Interaction

    Directory of Open Access Journals (Sweden)

    Nasir Muhammad Ali

    2016-01-01

    Full Text Available This concise study analyses the symmetry of financial markets’ responses to macroeconomic policy interaction in the United Kingdom. Employing the Vector Auto-regression (VAR model on monthly data of the British financial sector and macroeconomic policies from January 1985 to August 2008, this study found that the equity and sovereign debt markets showed identical symmetry in response to macroeconomic policy interaction.

  11. Human-machine interactions

    Science.gov (United States)

    Forsythe, J. Chris; Xavier, Patrick G.; Abbott, Robert G.; Brannon, Nathan G.; Bernard, Michael L.; Speed, Ann E.

    2009-04-28

    Digital technology utilizing a cognitive model based on human naturalistic decision-making processes, including pattern recognition and episodic memory, can reduce the dependency of human-machine interactions on the abilities of a human user and can enable a machine to more closely emulate human-like responses. Such a cognitive model can enable digital technology to use cognitive capacities fundamental to human-like communication and cooperation to interact with humans.

  12. Interacting Agegraphic Dark Energy

    OpenAIRE

    Wei, Hao; Cai, Rong-Gen

    2007-01-01

    A new dark energy model, named "agegraphic dark energy", has been proposed recently, based on the so-called K\\'{a}rolyh\\'{a}zy uncertainty relation, which arises from quantum mechanics together with general relativity. In this note, we extend the original agegraphic dark energy model by including the interaction between agegraphic dark energy and pressureless (dark) matter. In the interacting agegraphic dark energy model, there are many interesting features different from the original agegrap...

  13. Interactive Biplot Construction

    OpenAIRE

    Frederic Udina

    2005-01-01

    We analyze and discuss how a generic software to produce biplot graphs should be designed. We describe a data structure appropriate to include the biplot description and we specify the algorithm(s) to be used for several biplot types. We discuss the options the software should offer to the user in two different environments. In a highly interactive environment the user should be able to specify many graphical options and also to change them using the usual interactive tools. The resulting gra...

  14. Interaction with geospatial data

    OpenAIRE

    SCHOENING, Johannes

    2015-01-01

    My research interest lies at the interaction between human-computer interaction (HCI) and geoinformatics. I am interested in developing new methods and novel user interfaces to navigate through spatial information. This article will give a brief overview on my past and current research topics and streams. Generally speaking, geography is playing an increasingly important role in computer science and also in the field of HCI ranging from social computing to natural user interfaces (NUIs). At t...

  15. Extrasolar planet interactions

    Science.gov (United States)

    Barnes, Rory; Greenberg, Richard

    2008-05-01

    The dynamical interactions of planetary systems may be a clue to their formation histories. Therefore, the distribution of these interactions provides important constraints on models of planet formation. We focus on each system's apsidal motion and proximity to dynamical instability. Although only 25 multiple planet systems have been discovered to date, our analyses in these terms have revealed several important features of planetary interactions. 1) Many systems interact such that they are near the boundary between stability and instability. 2) Planets tend to form such that at least one planet's eccentricity periodically drops to near zero. 3) Mean-motion resonant pairs would be unstable if not for the resonance. 4) Scattering of approximately equal mass planets is unlikely to produce the observed distribution of apsidal behavior. 5) Resonant interactions may be identified through calculating a system's proximity to instability, regardless of knowledge of angles such as mean longitude and longitude of periastron (e.g. GJ 317 b and c are probably in a 4:1 resonance). These properties of planetary systems have been identified through calculation of two parameters that describe the interaction. The apsidal interaction can be quantified by determining how close a planet is to an apsidal separatrix (a boundary between qualitatively different types of apsidal oscillations, e.g. libration or circulation of the major axes). This value can be calculated through short numerical integrations. The proximity to instability can be measured by comparing the observed orbital elements to an analytic boundary that describes a type of stability known as Hill stability. We have set up a website dedicated to presenting the most up-to-date information on dynamical interactions: http://www.lpl.arizona.edu/~rory/research/xsp/dynamics.

  16. Beam-Material Interaction

    CERN Document Server

    Mokhov, N.V.

    2016-01-01

    Th is paper is motivated by the growing importance of better understanding of the phenomena and consequences of high- intensity energetic particle beam interactions with accelerator, generic target , and detector components. It reviews the principal physical processes of fast-particle interactions with matter, effects in materials under irradiation, materials response, related to component lifetime and performance, simulation techniques, and methods of mitigating the impact of radiation on the components and envir onment in challenging current and future application

  17. Sperm-egg interaction.

    Science.gov (United States)

    Evans, Janice P

    2012-01-01

    A crucial step of fertilization is the sperm-egg interaction that allows the two gametes to fuse and create the zygote. In the mouse, CD9 on the egg and IZUMO1 on the sperm stand out as critical players, as Cd9(-/-) and Izumo1(-/-) mice are healthy but infertile or severely subfertile due to defective sperm-egg interaction. Moreover, work on several nonmammalian organisms has identified some of the most intriguing candidates implicated in sperm-egg interaction. Understanding of gamete membrane interactions is advancing through characterization of in vivo and in vitro fertilization phenotypes, including insights from less robust phenotypes that highlight potential supporting (albeit not absolutely essential) players. An emerging theme is that there are varied roles for gamete molecules that participate in sperm-egg interactions. Such roles include not only functioning as fusogens, or as adhesion molecules for the opposite gamete, but also functioning through interactions in cis with other proteins to regulate membrane order and functionality.

  18. Interaction with Machine Improvisation

    Science.gov (United States)

    Assayag, Gerard; Bloch, George; Cont, Arshia; Dubnov, Shlomo

    We describe two multi-agent architectures for an improvisation oriented musician-machine interaction systems that learn in real time from human performers. The improvisation kernel is based on sequence modeling and statistical learning. We present two frameworks of interaction with this kernel. In the first, the stylistic interaction is guided by a human operator in front of an interactive computer environment. In the second framework, the stylistic interaction is delegated to machine intelligence and therefore, knowledge propagation and decision are taken care of by the computer alone. The first framework involves a hybrid architecture using two popular composition/performance environments, Max and OpenMusic, that are put to work and communicate together, each one handling the process at a different time/memory scale. The second framework shares the same representational schemes with the first but uses an Active Learning architecture based on collaborative, competitive and memory-based learning to handle stylistic interactions. Both systems are capable of processing real-time audio/video as well as MIDI. After discussing the general cognitive background of improvisation practices, the statistical modelling tools and the concurrent agent architecture are presented. Then, an Active Learning scheme is described and considered in terms of using different improvisation regimes for improvisation planning. Finally, we provide more details about the different system implementations and describe several performances with the system.

  19. MiRNATIP: a SOM-based miRNA-target interactions predictor.

    Science.gov (United States)

    Fiannaca, Antonino; Rosa, Massimo La; Paglia, Laura La; Rizzo, Riccardo; Urso, Alfonso

    2016-09-22

    MicroRNAs (miRNAs) are small non-coding RNA sequences with regulatory functions to post-transcriptional level for several biological processes, such as cell disease progression and metastasis. MiRNAs interact with target messenger RNA (mRNA) genes by base pairing. Experimental identification of miRNA target is one of the major challenges in cancer biology because miRNAs can act as tumour suppressors or oncogenes by targeting different type of targets. The use of machine learning methods for the prediction of the target genes is considered a valid support to investigate miRNA functions and to guide related wet-lab experiments. In this paper we propose the miRNA Target Interaction Predictor (miRNATIP) algorithm, a Self-Organizing Map (SOM) based method for the miRNA target prediction. SOM is trained with the seed region of the miRNA sequences and then the mRNA sequences are projected into the SOM lattice in order to find putative interactions with miRNAs. These interactions will be filtered considering the remaining part of the miRNA sequences and estimating the free-energy necessary for duplex stability. We tested the proposed method by predicting the miRNA target interactions of both the Homo sapiens and the Caenorhbditis elegans species; then, taking into account validated target (positive) and non-target (negative) interactions, we compared our results with other target predictors, namely miRanda, PITA, PicTar, mirSOM, TargetScan and DIANA-microT, in terms of the most used statistical measures. We demonstrate that our method produces the greatest number of predictions with respect to the other ones, exhibiting good results for both species, reaching the for example the highest percentage of sensitivity of 31 and 30.5 %, respectively for Homo sapiens and for C. elegans. All the predicted interaction are freely available at the following url: http://tblab.pa.icar.cnr.it/public/miRNATIP/ . Results state miRNATIP outperforms or is comparable to the other six state

  20. Interactions between photodegradation components

    Directory of Open Access Journals (Sweden)

    Abdollahi Yadollah

    2012-09-01

    Full Text Available Abstract Background The interactions of p-cresol photocatalytic degradation components were studied by response surface methodology. The study was designed by central composite design using the irradiation time, pH, the amount of photocatalyst and the p-cresol concentration as variables. The design was performed to obtain photodegradation % as actual responses. The actual responses were fitted with linear, two factor interactions, cubic and quadratic model to select an appropriate model. The selected model was validated by analysis of variance which provided evidences such as high F-value (845.09, very low P-value (2 = 0.999, adjusted R-squared (Radj2 = 0.998, predicted R-squared (Rpred2 = 0.994 and the adequate precision (95.94. Results From the validated model demonstrated that the component had interaction with irradiation time under 180 min of the time while the interaction with pH was above pH 9. Moreover, photocatalyst and p-cresol had interaction at minimal amount of photocatalyst (p-cresol. Conclusion These variables are interdependent and should be simultaneously considered during the photodegradation process, which is one of the advantages of the response surface methodology over the traditional laboratory method.

  1. Strongly interacting Fermi gases

    Directory of Open Access Journals (Sweden)

    Bakr W.

    2013-08-01

    Full Text Available Strongly interacting gases of ultracold fermions have become an amazingly rich test-bed for many-body theories of fermionic matter. Here we present our recent experiments on these systems. Firstly, we discuss high-precision measurements on the thermodynamics of a strongly interacting Fermi gas across the superfluid transition. The onset of superfluidity is directly observed in the compressibility, the chemical potential, the entropy, and the heat capacity. Our measurements provide benchmarks for current many-body theories on strongly interacting fermions. Secondly, we have studied the evolution of fermion pairing from three to two dimensions in these gases, relating to the physics of layered superconductors. In the presence of p-wave interactions, Fermi gases are predicted to display toplogical superfluidity carrying Majorana edge states. Two possible avenues in this direction are discussed, our creation and direct observation of spin-orbit coupling in Fermi gases and the creation of fermionic molecules of 23Na 40K that will feature strong dipolar interactions in their absolute ground state.

  2. Electromagnetic cellular interactions.

    Science.gov (United States)

    Cifra, Michal; Fields, Jeremy Z; Farhadi, Ashkan

    2011-05-01

    Chemical and electrical interaction within and between cells is well established. Just the opposite is true about cellular interactions via other physical fields. The most probable candidate for an other form of cellular interaction is the electromagnetic field. We review theories and experiments on how cells can generate and detect electromagnetic fields generally, and if the cell-generated electromagnetic field can mediate cellular interactions. We do not limit here ourselves to specialized electro-excitable cells. Rather we describe physical processes that are of a more general nature and probably present in almost every type of living cell. The spectral range included is broad; from kHz to the visible part of the electromagnetic spectrum. We show that there is a rather large number of theories on how cells can generate and detect electromagnetic fields and discuss experimental evidence on electromagnetic cellular interactions in the modern scientific literature. Although small, it is continuously accumulating. Copyright © 2010 Elsevier Ltd. All rights reserved.

  3. riDOM, a cell-penetrating peptide. Interaction with DNA and heparan sulfate.

    Science.gov (United States)

    Québatte, Gabriela; Kitas, Eric; Seelig, Joachim

    2013-09-19

    DNA condensation in the presence of polycationic molecules is a well-known phenomenon exploited in gene delivery. riDOM (retro-inverso dioleoylmelittin) is a cell-penetrating peptide with excellent transporter properties for DNA. It is a chimeric molecule where ri-melittin is fused to dioleoylphosphoethanolamine. The physical-chemical properties of riDOM in solution and in the presence of DNA and heparan sulfate were investigated with spectroscopic and thermodynamic methods. Dynamic light scattering shows that riDOM in solution aggregates to well-defined nanoparticles with a diameter of ∼13 nm and a ζ-potential of 22 mV, composed of about 220-270 molecules. Binding of riDOM to DNA was studied with dynamic light scattering, ζ-potential measurements, and isothermal titration calorimetry and was compared with authentic melittin-DNA interaction. riDOM binds tightly to DNA with a microscopic binding constant of 5 × 10(7) M(-1) and a stoichiometry of 12 riDOM per 10 DNA base pairs. In the complex the DNA double strand is completely shielded by the more hydrophobic riDOM molecules. Authentic melittin binds to DNA with a much lower binding constant of 5 × 10(6) M(-1) and lower stoichiometry of 5 melittin per 10 DNA base pairs. The binding enthalpies for riDOM and melittin are small and the binding reactions are entropy-driven. Sulfated glycosaminoglycans such as heparan sulfate are also linear molecules with a negative charge. riDOM binding to heparan sulfate on cell surfaces can therefore interfere with DNA-riDOM binding. riDOM-heparan sulfate complex formation was characterized by isothermal titration calorimetry and spectroscopic methods. The binding constant of riDOM for heparan sulfate is K ≈ 2 × 10(6) M(-1). Authentic melittin has a similar binding constant but riDOM shows a 3-fold higher packing density on heparan sulfate than the distinctly smaller melittin.

  4. Study on the interaction of morphine chloride with deoxyribonucleic acid by fluorescence method

    Science.gov (United States)

    Li, J. F.; Dong, C.

    2009-01-01

    The mode and mechanism of the interaction of morphine chloride, an important alkaloid compound to calf thymus deoxyribonucleic acid (ct DNA) was investigated from absorption and fluorescence titration techniques. Hypochromic effect was founded in the absorption spectra of morphine when concentration of DNA increased. The decreased fluorescence study revealed non-cooperative binding of the morphine to DNA with an affinity of 3.94 × 10 3 M -1, and the stoichiometry of binding was characterized to be about one morphine molecule per nucleotide. Stern-Volmer plots at different temperatures proved that the quenching mechanism was static. Ferrocyanide quenching study showed that the magnitude of KSV of the bound morphine was lower than that of the free one. In addition, it was found that ionic strength could affect the binding of morphine and DNA. Fluorescence polarization and denatured DNA studies also applied strong evidences that morphine molecule was partially intercalated between every alternate base pairs of ct DNA. As observed from above experiments, intercalation was well supported as the binding mode of morphine and ct DNA.

  5. Titantium Dioxide Nanoparticles Assembled by DNA Molecules Hybridization and Loading of DNA Interacting Proteins.

    Science.gov (United States)

    Wu, Aiguo; Paunesku, Tatjana; Brown, Eric M B; Babbo, Angela; Cruz, Cecille; Aslam, Mohamed; Dravid, Vinayak; Woloschak, Gayle E

    2008-02-01

    This work demonstrates the assembly of TiO(2) nanoparticles with attached DNA oligonucleotides into a 3D mesh structure by allowing base pairing between oligonucleotides. A change of the ratio of DNA oligonucleotide molecules and TiO(2) nanoparticles regulates the size of the mesh as characterized by UV-visible light spectra, transmission electron microscopy and atomic force microscopy images. This type of 3D mesh, based on TiO(2)-DNA oligonucleotide nanoconjugates, can be used for studies of nanoparticle assemblies in material science, energy science related to dye-sensitized solar cells, environmental science as well as characterization of DNA interacting proteins in the field of molecular biology. As an example of one such assembly, proliferating cell nuclear antigen protein (PCNA) was cloned, its activity verified, and the protein was purified, loaded onto double strand DNA oligonucleotide-TiO(2) nanoconjugates, and imaged by atomic force microscopy. This type of approach may be used to sample and perhaps quantify and/or extract specific cellular proteins from complex cellular protein mixtures affinity based on their affinity for chosen DNA segments assembled into the 3D matrix.

  6. Predicting childhood effortful control from interactions between early parenting quality and children's dopamine transporter gene haplotypes.

    Science.gov (United States)

    Li, Yi; Sulik, Michael J; Eisenberg, Nancy; Spinrad, Tracy L; Lemery-Chalfant, Kathryn; Stover, Daryn A; Verrelli, Brian C

    2016-02-01

    Children's observed effortful control (EC) at 30, 42, and 54 months (n = 145) was predicted from the interaction between mothers' observed parenting with their 30-month-olds and three variants of the solute carrier family C6, member 3 (SLC6A3) dopamine transporter gene (single nucleotide polymorphisms in intron8 and intron13, and a 40 base pair variable number tandem repeat [VNTR] in the 3'-untranslated region [UTR]), as well as haplotypes of these variants. Significant moderating effects were found. Children without the intron8-A/intron13-G, intron8-A/3'-UTR VNTR-10, or intron13-G/3'-UTR VNTR-10 haplotypes (i.e., haplotypes associated with the reduced SLC6A3 gene expression and thus lower dopamine functioning) appeared to demonstrate altered levels of EC as a function of maternal parenting quality, whereas children with these haplotypes demonstrated a similar EC level regardless of the parenting quality. Children with these haplotypes demonstrated a trade-off, such that they showed higher EC, relative to their counterparts without these haplotypes, when exposed to less supportive maternal parenting. The findings revealed a diathesis-stress pattern and suggested that different SLC6A3 haplotypes, but not single variants, might represent different levels of young children's sensitivity/responsivity to early parenting.

  7. Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA

    Directory of Open Access Journals (Sweden)

    Eric R. Gamache

    2017-04-01

    Full Text Available The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT. To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1, a 1-nucleotide interhelical loop and an 8-bp stem (S2 that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging.

  8. Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA.

    Science.gov (United States)

    Gamache, Eric R; Doh, Jung H; Ritz, Justin; Laederach, Alain; Bellaousov, Stanislav; Mathews, David H; Curcio, M Joan

    2017-04-26

    The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5' terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT). To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1), a 1-nucleotide interhelical loop and an 8-bp stem (S2) that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging.

  9. Interactive Karyotyping Training

    Directory of Open Access Journals (Sweden)

    Ashwin Kotwaliwale

    2013-01-01

    Full Text Available Despite the wide use of newer techniques in genetic diagnostics, there remains a need for technologists to learn human chromosome morphology, identify abnormal metaphases and report clinical abnormalities. Global short age of cytogenetic trainers and a time consuming training process makes Karyotyping training difficult. We have developed a web based interactive Karyotyping training tool, KaryoTutor©, that allows technologists to learn karyotyping in an interactive environment and aids the trainer in the training process. KaryoTutor©provides visual clues for identifying abnormal chromosomes, provides instant test scores and includes a reference library of ideograms,sample chromosome images and reference materials. Trainees are able to recursively work on a case till a satisfactory result is achieved,with KaryoTutor providing interactive inputs.Additionally, trainers can assign cases and monitor trainee progress using audit trail management and other administrative features.

  10. Interactive Information Retrieval

    DEFF Research Database (Denmark)

    Borlund, Pia

    2013-01-01

    The paper introduces the research area of interactive information retrieval (IIR) from a historical point of view. Further, the focus here is on evaluation, because much research in IR deals with IR evaluation methodology due to the core research interest in IR performance, system interaction...... and satisfaction with retrieved information. In order to position IIR evaluation, the Cranfield model and the series of tests that led to the Cranfield model are outlined. Three iconic user-oriented studies and projects that all have contributed to how IIR is perceived and understood today are presented......: The MEDLARS test, the Book House fiction retrieval system, and the OKAPI project. On this basis the call for alternative IIR evaluation approaches motivated by the three revolutions (the cognitive, the relevance, and the interactive revolutions) put forward by Robertson & Hancock-Beaulieu (1992) is presented...

  11. Gene-environment interaction.

    Science.gov (United States)

    Manuck, Stephen B; McCaffery, Jeanne M

    2014-01-01

    With the advent of increasingly accessible technologies for typing genetic variation, studies of gene-environment (G×E) interactions have proliferated in psychological research. Among the aims of such studies are testing developmental hypotheses and models of the etiology of behavioral disorders, defining boundaries of genetic and environmental influences, and identifying individuals most susceptible to risk exposures or most amenable to preventive and therapeutic interventions. This research also coincides with the emergence of unanticipated difficulties in detecting genetic variants of direct association with behavioral traits and disorders, which may be obscured if genetic effects are expressed only in predisposing environments. In this essay we consider these and other rationales for positing G×E interactions, review conceptual models meant to inform G×E interpretations from a psychological perspective, discuss points of common critique to which G×E research is vulnerable, and address the role of the environment in G×E interactions.

  12. Dike/Drift Interactions

    Energy Technology Data Exchange (ETDEWEB)

    E. Gaffiney

    2004-11-23

    This report presents and documents the model components and analyses that represent potential processes associated with propagation of a magma-filled crack (dike) migrating upward toward the surface, intersection of the dike with repository drifts, flow of magma in the drifts, and post-magma emplacement effects on repository performance. The processes that describe upward migration of a dike and magma flow down the drift are referred to as the dike intrusion submodel. The post-magma emplacement processes are referred to as the post-intrusion submodel. Collectively, these submodels are referred to as a conceptual model for dike/drift interaction. The model components and analyses of the dike/drift interaction conceptual model provide the technical basis for assessing the potential impacts of an igneous intrusion on repository performance, including those features, events, and processes (FEPs) related to dike/drift interaction (Section 6.1).

  13. Neutrino interactions with nuclei

    CERN Document Server

    Leitner, T; Mosel, U; Alvarez-Ruso, L

    2008-01-01

    Current long baseline experiments aim at measuring neutrino oscillation parameters with a high precision. A critical quantity is the neutrino energy which can not be measured directly but has to be reconstructed from the observed hadrons. A good knowledge of neutrino-nucleus interactions is thus necessary to minimize the systematic uncertainties in neutrino fluxes, backgrounds and detector responses. In particular final-state interactions inside the target nucleus modify considerably the particle yields through rescattering, charge-exchange and absorption. Nuclear effects can be described with our coupled channel GiBUU transport model where the neutrino first interacts with a bound nucleon producing secondary particles which are then transported out of the nucleus. In this contribution, we give some examples for the application of our model focusing in particular on the MiniBooNE and K2K experiments.

  14. Electroweak interactions at LEP

    CERN Document Server

    Swain, J D

    2000-01-01

    The electroweak interactions are based on an extension of the electromagnetic (Maxwell) interactions, realized in a rather odd way so that the symmetries of the theory are not immediately obvious. This "broken" theory has been the subject of intense investigation at LEP, and has passed all tests with flying colours. These lectures are meant to complement the many excellent presentations of the standard SU(2)/sub L/*U(1)/sub Y/ electroweak interactions in three main ways: first to clarify the physical meaning of symmetries in particle physics, second, to summarize the recent tests of the standard model using LEP data, and finally to look at possible roles of gravity in understanding mass. (10 refs).

  15. Sonic Interaction Design

    DEFF Research Database (Denmark)

    created for such contexts as mobile music, sensorimotor learning, rehabilitation, and gaming. The goal is not only to extend the existing research and pedagogical approaches to SID but also to foster domains of practice for sound designers, architects, interaction designers, media artists, product......Sound is an integral part of every user experience but a neglected medium in design disciplines. Design of an artifact’s sonic qualities is often limited to the shaping of functional, representational, and signaling roles of sound. The interdisciplinary field of sonic interaction design (SID...... aspects of sonic experience. Sonic Interaction Design gathers contributions from scholars, artists, and designers working at the intersections of fields ranging from electronic music to cognitive science. They offer both theoretical considerations of key themes and case studies of products and systems...

  16. Multimodal Interaction Control

    Science.gov (United States)

    Beskow, Jonas; Carlson, Rolf; Edlund, Jens; Granström, Björn; Heldner, Mattias; Hjalmarsson, Anna; Skantze, Gabriel

    No matter how well hidden our systems are and how well they do their magic unnoticed in the background, there are times when direct interaction between system and human is a necessity. As long as the interaction can take place unobtrusively and without techno-clutter, this is desirable. It is hard to picture a means of interaction less obtrusive and techno-cluttered than spoken communication on human terms. Spoken face-to-face communication is the most intuitive and robust form of communication between humans imaginable. In order to exploit such human spoken communication to its full potential as an interface between human and machine, we need a much better understanding of how the more human-like aspects of spoken communication work.

  17. Interactive Topology Optimization

    DEFF Research Database (Denmark)

    Nobel-Jørgensen, Morten

    software where the users are assumed to be well-educated both in the finite element method and topology optimization. This dissertation describes how various topology optimization methods have been used for creating cross-platform applications with high performance. The user interface design is based......Interactivity is the continuous interaction between the user and the application to solve a task. Topology optimization is the optimization of structures in order to improve stiffness or other objectives. The goal of the thesis is to explore how topology optimization can be used in applications...... in an interactive and intuitive way. By creating such applications with an intuitive and simple user interface we allow non-engineers like designers and architects to easily experiment with boundary conditions, design domains and other optimization settings. This is in contrast to commercial topology optimization...

  18. Urban Interaction Design

    DEFF Research Database (Denmark)

    Brynskov, Martin; Bermúdez, Juan Carlos Carvajal; Fernández, Manu;

    This book is an effort to explore the newly emerging field of urban interaction design that addresses these issues. In the first part of the book, 'Foundations', we look into its origins. Where do its practitioners come from? How are they working together? What methodologies do they bring...... to the table? What are the key concepts they are addressing in their work? In the second part of the book named 'Trends', we go into current developments in the networked city and how urban interaction design as a field addresses these. Taken together, these sections will not give the definite definition...

  19. Interacting binary stars

    CERN Document Server

    Sahade, Jorge; Ter Haar, D

    1978-01-01

    Interacting Binary Stars deals with the development, ideas, and problems in the study of interacting binary stars. The book consolidates the information that is scattered over many publications and papers and gives an account of important discoveries with relevant historical background. Chapters are devoted to the presentation and discussion of the different facets of the field, such as historical account of the development in the field of study of binary stars; the Roche equipotential surfaces; methods and techniques in space astronomy; and enumeration of binary star systems that are studied

  20. Generalized interaction in multigravity

    CERN Document Server

    Duplij, Steven

    2013-01-01

    A general approach to description of multigravity models in D-dimensional space-time is presented. Different possibilities of generalization of the invariant volume are given. Then a most general form of the interaction potential is constructed, which for bigravity coincides with the Pauli-Fierz model. A thorough analysis of the model along the 3+1 expansion formalism is done. It is shown that the absence of ghosts the considered bigravity model is equivalent in the weak field limit to the massive gravity (the Pauli-Fierz model). Thus, on the concrete example it is shown, that the interaction between metrics leads to nonvanishing mass of graviton.

  1. Urban Interaction Design

    DEFF Research Database (Denmark)

    Brynskov, Martin; Bermúdez, Juan Carlos Carvajal; Fernández, Manu

    This book is an effort to explore the newly emerging field of urban interaction design that addresses these issues. In the first part of the book, 'Foundations', we look into its origins. Where do its practitioners come from? How are they working together? What methodologies do they bring...... to the table? What are the key concepts they are addressing in their work? In the second part of the book named 'Trends', we go into current developments in the networked city and how urban interaction design as a field addresses these. Taken together, these sections will not give the definite definition...

  2. Empowered interaction through creativity

    DEFF Research Database (Denmark)

    Hasselblad, Stefan; Petersson, Eva; Brooks, Tony

    2007-01-01

    This paper reflects upon a case study where exploration, play and empowerment in interactive therapy sessions with audio and visual stimuli resulted in achievement, self-esteem and a shared pride between a young adult with profound and multiple learning disabilities (PMLD), his mother and the spe......This paper reflects upon a case study where exploration, play and empowerment in interactive therapy sessions with audio and visual stimuli resulted in achievement, self-esteem and a shared pride between a young adult with profound and multiple learning disabilities (PMLD), his mother...

  3. Interactive Shape Design

    CERN Document Server

    Cani, Marie-Paule; Wyvill, Geoff

    2008-01-01

    Providing an intuitive modeling system, which would enable us to communicate about any free-form shape we have in mind at least as quickly as with real-world tools, is one of the main challenges of digital shape design. The user should ideally be able to create, deform, and progressively add details to a shape, without being aware of the underlying mathematical representation nor being tied by any constraint on the geometrical or topological nature of the model. This book presents the field of interactive shape design from this perspective. Since interactively creating a shape builds on the hu

  4. Sonic Interaction Design

    DEFF Research Database (Denmark)

    created for such contexts as mobile music, sensorimotor learning, rehabilitation, and gaming. The goal is not only to extend the existing research and pedagogical approaches to SID but also to foster domains of practice for sound designers, architects, interaction designers, media artists, product...... aspects of sonic experience. Sonic Interaction Design gathers contributions from scholars, artists, and designers working at the intersections of fields ranging from electronic music to cognitive science. They offer both theoretical considerations of key themes and case studies of products and systems...

  5. Thoughts on Interaction Design

    CERN Document Server

    Kolko, Jon

    2009-01-01

    Interaction Designers-whether practicing as Usability Engineers, Visual Interface Designers, or Information Architects-attempt to understand and shape human behavior in order to design products that are at once usable, useful, and desirable. Although the value of design is now recognized as essential to product development, the field is often misunderstood by managers and other team members, who don't understand a designer's role in a team. This can cause inefficient and ineffective products. Thoughts on Interaction Design gives individuals engaged in this profession the dialogue to justify t

  6. Child Computer Interaction SIG

    DEFF Research Database (Denmark)

    Read, Janet; Hourcade, Juan Pablo; Markopoulos, Panos

    The discipline of Child Computer Interaction (CCI) has been steadily growing and it is now firmly established as a community in its own right, having the annual IDC (Interaction and Design for Children) conference and its own journal and also enjoying its role as a highly recognisable and vibrant...... contributor to the ACM CHI conference. Having recently been given status as an IFIP (International Federation for Information Processing) TC13 working group, the community now needs to make plans around its academic themes and its coherence as a developing academic community. The CCI SIG at CHI aims to use...

  7. Loop-loop interaction in an adenine-sensing riboswitch: a molecular dynamics study.

    Science.gov (United States)

    Allnér, Olof; Nilsson, Lennart; Villa, Alessandra

    2013-07-01

    Riboswitches are mRNA-based molecules capable of controlling the expression of genes. They undergo conformational changes upon ligand binding, and as a result, they inhibit or promote the expression of the associated gene. The close connection between structural rearrangement and function makes a detailed knowledge of the molecular interactions an important step to understand the riboswitch mechanism and efficiency. We have performed all-atom molecular dynamics simulations of the adenine-sensing add A-riboswitch to study the breaking of the kissing loop, one key tertiary element in the aptamer structure. We investigated the aptamer domain of the add A-riboswitch in complex with its cognate ligand and in the absence of the ligand. The opening of the hairpins was simulated using umbrella sampling using the distance between two loops as the reaction coordinate. A two-step process was observed in all the simulated systems. First, a general loss of stacking and hydrogen bond interactions is seen. The last interactions that break are the two base pairs G37-C61 and G38-C60, but the break does not affect the energy profile, indicating their pivotal role in the tertiary structure formation but not in the structure stabilization. The junction area is partially organized before the kissing loop formation and residue A24 anchors together the loop helices. Moreover, when the distance between the loops is increased, one of the hairpins showed more flexibility by changing its orientation in the structure, while the other conserved its coaxial arrangement with the rest of the structure.

  8. Interactions between interactions: predator-prey, parasite-host, and mutualistic interactions.

    Science.gov (United States)

    Møller, Anders Pape

    2008-01-01

    Ecological interactions such as those between predators and prey, parasites and hosts, and pollinators and plants are usually studied on their own while neglecting that one category of interactions can have dramatic effects on another. Such interactions between interactions will have both ecological and evolutionary effects because the actions of one party will influence interactions among other parties, thereby eventually causing feedback on the first party. Examples of such interactions include the effects of predators and parasites on the evolution of host sexual selection, the effects of parasites and predators on the evolution of virulence, and the effects of parasites and predators on the evolution of pollinator mutualisms. Such interactions among interactions will generally prevent simple cases of coevolution, because any single case of interaction between two parties may be affected by an entire range of additional interacting factors. These phenomena will have implications not only for how ecologists and evolutionary biologists empirically study interactions but also on how such interactions are modeled.

  9. Binding of the biogenic polyamines to deoxyribonucleic acids of varying base composition: base specificity and the associated energetics of the interaction.

    Directory of Open Access Journals (Sweden)

    Ayesha Kabir

    Full Text Available BACKGROUND: The thermodynamics of the base pair specificity of the binding of the polyamines spermine, spermidine, putrescine, and cadaverine with three genomic DNAs Clostridium perfringens, 27% GC, Escherichia coli, 50% GC and Micrococcus lysodeikticus, 72% GC have been studied using titration calorimetry and the data supplemented with melting studies, ethidium displacement and circular dichroism spectroscopy results. METHODOLOGY/PRINCIPAL FINDINGS: Isothermal titration calorimetry, differential scanning calorimetry, optical melting studies, ethidium displacement, circular dichroism spectroscopy are the various techniques employed to characterize the interaction of four polyamines, spermine, spermidine, putersine and cadaverine with the DNAs. Polyamines bound stronger with AT rich DNA compared to the GC rich DNA and the binding varied depending on the charge on the polyamine as spermine>spermidine >putrescine>cadaverine. Thermodynamics of the interaction revealed that the binding was entropy driven with small enthalpy contribution. The binding was influenced by salt concentration suggesting the contribution from electrostatic forces to the Gibbs energy of binding to be the dominant contributor. Each system studied exhibited enthalpy-entropy compensation. The negative heat capacity changes suggested a role for hydrophobic interactions which may arise due to the non polar interactions between DNA and polyamines. CONCLUSION/SIGNIFICANCE: From a thermodynamic analysis, the AT base specificity of polyamines to DNAs has been elucidated for the first time and supplemented by structural studies.

  10. A tabletop interactive storytelling system: designing for social interaction

    NARCIS (Netherlands)

    Alofs, Thijs; Theune, Mariet; Swartjes, I.M.T.

    This paper presents the Interactive Storyteller, a multi-user interface for AI-based interactive storytelling, where stories emerge from the interaction of human players with intelligent characters in a simulated story world. To support face-to-face contact and social interaction, we position users

  11. TIDE-TSUNAMI INTERACTIONS

    Directory of Open Access Journals (Sweden)

    Zygmunt Kowalik

    2006-01-01

    Full Text Available In this paper we investigate important dynamics defining tsunami enhancement in the coastal regions and related to interaction with tides. Observations and computations of the Indian Ocean Tsunami usually show amplifications of the tsunami in the near-shore regions due to water shoaling. Additionally, numerous observations depicted quite long ringing of tsunami oscillations in the coastal regions, suggesting either local resonance or the local trapping of the tsunami energy. In the real ocean, the short-period tsunami wave rides on the longer-period tides. The question is whether these two waves can be superposed linearly for the purpose of determining the resulting sea surface height (SSH or rather in the shallow water they interact nonlinearly, enhancing/reducing the total sea level and currents. Since the near–shore bathymetry is important for the run-up computation, Weisz and Winter (2005 demonstrated that the changes of depth caused by tides should not be neglected in tsunami run-up considerations. On the other hand, we hypothesize that much more significant effect of the tsunami-tide interaction should be observed through the tidal and tsunami currents. In order to test this hypothesis we apply a simple set of 1-D equations of motion and continuity to demonstrate the dynamics of tsunami and tide interaction in the vicinity of the shelf break for two coastal domains: shallow waters of an elongated inlet and narrow shelf typical for deep waters of the Gulf of Alaska.

  12. CONCEPT OF DRUG INTERACTION

    Directory of Open Access Journals (Sweden)

    Singh Nidhi

    2012-07-01

    Full Text Available Drug interaction is an increasingly important cause of adverse reactions (ADR, and is the modification of the effect of one drug (object by the prior or concomitant administration of another drug (precipitant drug. Drug interaction may either enhance or diminish the intended effect of one or both drugs. For example severe haemorrhage may occur if warfarin and salicylates (asprin are combined. Precipitant drugs modify the object drug's absorption, distribution, metabolism, excretion or actual clinical effect. Nonsteroidal anti-inflammatory drugs, antibiotics and, in particular, rifampin are common precipitant drugs prescribed in primary care practice. Drugs with a narrow therapeutic range or low therapeutic index are more likely to be the objects for serious drug interactions. Object drugs in common use include warfarin, fluoroquinolones, antiepileptic drugs, oral contraceptives, cisapride and 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors. Many other drugs, act as precipitants or objects, and a number of drugs act as both. The aim of present review is to throw light on the concept of drug interaction.

  13. Human Work Interaction Design

    DEFF Research Database (Denmark)

    2015-01-01

    In this paper, we review research in the emerging practice and research field of Human Work Interaction Design (HWID). We present a HWID frame-work, and a sample of 54 papers from workshops, conferences and journals from the period 2009-2014. We group the papers into six topical groups, and then ...

  14. Human Work Interaction Design

    DEFF Research Database (Denmark)

    2015-01-01

    In this paper, we review research in the emerging practice and research field of Human Work Interaction Design (HWID). We present a HWID framework, and a sample of 54 HWID related papers from workshops, conferences and journals from the period 2009–2014. We group the papers into six topical group...

  15. Interactions of cosmic superstrings

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Mark G.; /Fermilab

    2007-06-01

    We develop methods by which cosmic superstring interactions can be studied in detail. These include the reconnection probability and emission of radiation such as gravitons or small string loops. Loop corrections to these are discussed, as well as relationships to (p; q)-strings. These tools should allow a phenomenological study of string models in anticipation of upcoming experiments sensitive to cosmic string radiation.

  16. Interactive Digital Signal Processor

    Science.gov (United States)

    Mish, W. H.

    1985-01-01

    Interactive Digital Signal Processor, IDSP, consists of set of time series analysis "operators" based on various algorithms commonly used for digital signal analysis. Processing of digital signal time series to extract information usually achieved by applications of number of fairly standard operations. IDSP excellent teaching tool for demonstrating application for time series operators to artificially generated signals.

  17. Gaze interaction from bed

    DEFF Research Database (Denmark)

    Hansen, John Paulin; San Agustin, Javier; Jensen, Henrik Tomra Skovsgaard Hegner

    2011-01-01

    This paper presents a low-cost gaze tracking solution for bedbound people composed of free-ware tracking software and commodity hardware. Gaze interaction is done on a large wall-projected image, visible to all people present in the room. The hardware equipment leaves physical space free to assist...

  18. Alkane dimers interaction

    DEFF Research Database (Denmark)

    Ferrighi, Lara; Madsen, Georg Kent Hellerup; Hammer, Bjørk

    2010-01-01

    The interaction energies of a series of n-alkane dimers, from methane to decane, have been investigated with Density Functional Theory (DFT), using the MGGA-M06-L density functional. The results are compared both to the available wavefunction-based values as well as to dispersion corrected DFT...

  19. Interactive Playgrounds for Children

    NARCIS (Netherlands)

    Poppe, Ronald; Delden, van Robby; Moreno, Alejandro; Reidsma, Dennis; Nijholt, Anton

    2014-01-01

    Play is an important factor in the life of children. It plays a role in their cognitive, social, and physical development, and provides entertaining and fulfilling activities in itself. As with any field of human endeavor, interactive technology has a huge potential for transforming and enhancing pl

  20. Interactive Tabletops in Education

    Science.gov (United States)

    Dillenbourg, Pierre; Evans, Michael

    2011-01-01

    Interactive tabletops are gaining increased attention from CSCL researchers. This paper analyses the relation between this technology and teaching and learning processes. At a global level, one could argue that tabletops convey a socio-constructivist flavor: they support small teams that solve problems by exploring multiple solutions. The…

  1. Interactive Playgrounds for Children

    NARCIS (Netherlands)

    Poppe, Ronald Walter; van Delden, Robertus Wilhelmus; Moreno Celleri, Alejandro Manuel; Reidsma, Dennis; Nijholt, A.; Nijholt, Antinus

    2014-01-01

    Play is an important factor in the life of children. It plays a role in their cognitive, social, and physical development, and provides entertaining and fulfilling activities in itself. As with any field of human endeavor, interactive technology has a huge potential for transforming and enhancing pl

  2. [Fluoroquinolones. Drug interactions].

    Science.gov (United States)

    Rusu, G; Dănilă, G

    2000-01-01

    This review summarizes clinically relevant drug-drug interactions for fluoroquinolones: antiacids containing aluminum and magnesium salts, iron or zinc preparations, sucralfate, cimetidine, ranitidine, warfarina, cyclosporin, rifampin, oral contraceptive steroids, benzodiazepine, probenecid, beta-lactam antibiotics, nonsteroidal anti-inflammatory drugs, metronidazole, theophylline, caffeine.

  3. Socially aware interactive playgrounds

    NARCIS (Netherlands)

    Moreno, Alejandro; Delden, van Robby; Poppe, Ronald; Reidsma, Dennis

    2013-01-01

    Interactive playgrounds are technology-enhanced installations that aim to provide rich game experiences for children by combining the benefits of traditional playgrounds with those of digital games. These game experiences could be attained by addressing three design considerations: context-awareness

  4. Interaction and mindreading

    DEFF Research Database (Denmark)

    Michael, John

    2011-01-01

    In recent years, a number of theorists have developed approaches to social cognition that highlight the centrality of social interaction as opposed to mindreading (e.g. Gallagher and Zahavi 2008; Gallagher 2001, 2007, 2008; Hobson 2002; Reddy 2008; Hutto 2004; De Jaegher 2009; De Jaegher and Di P...

  5. Experiencing affective interactive art

    NARCIS (Netherlands)

    Bialoskorski, Leticia S.S.; Westerink, Joyce H.D.M.; Broek, van den Egon L.

    2010-01-01

    The progress in the field of affective computing enables the realization of affective art. This paper describes the affective interactive art system Mood Swings, which interprets and visualizes affect expressed by a person. Mood Swings is founded on the integration of a framework for affective move

  6. Interaction Before Agriculture

    DEFF Research Database (Denmark)

    Richter, Tobias; Garrard, Andrew; Allcock, Samantha

    2011-01-01

    This article discusses social interaction in the Epipalaeolithic of southwest Asia. Discussions of contact, social relationships and social organization have primarily focused on the Pre-Pottery Neolithic and are often considered to represent typical hallmarks of emergent farming societies. The h...

  7. Unparticle self-interactions

    Science.gov (United States)

    Georgi, Howard; Kats, Yevgeny

    2010-02-01

    We develop techniques for studying the effects of self-interactions in the conformal sector of an unparticle model. Their physics is encoded in the higher n-point functions of the conformal theory. We study inclusive processes and argue that the inclusive production of unparticle stuff in standard model processes due to the unparticle self-interactions can be decomposed using the conformal partial wave expansion and its generalizations into a sum over contributions from the production of various kinds of unparticle stuff, corresponding to different primary conformal operators. Such processes typically involve the production of unparticle stuff associated with operators other than those to which the standard model couples directly. Thus just as interactions between particles allow scattering processes to produce new particles in the final state, so unparticle self-interactions cause the production of various kinds of unparticle stuff. We discuss both inclusive and exclusive methods for computing these processes. The resulting picture, we believe, is a step towards understanding what unparticle stuff “looks like” because it is quite analogous to way we describe the production and scattering of ordinary particles in quantum field theory, with the primary conformal operators playing the role of particles and the coefficients in the conformal partial wave expansion (and its generalization to include more fields) playing the role of amplitudes. We exemplify our methods in the 2D toy model that we discussed previously in which the Banks-Zaks theory is exactly solvable.

  8. Highly interactive distributed visualization

    NARCIS (Netherlands)

    Scarpa, M.; Belleman, R.G.; Sloot, P.M.A.; de Laat, C.T.A.M.

    2006-01-01

    We report on our iGrid2005 demonstration, called the "Dead Cat Demo"; an example of a highly interactive augmented reality application consisting of software services distributed over a wide-area, high-speed network. We describe our design decisions, analyse the implications of the design on applica

  9. Exploring governmentality as interaction

    DEFF Research Database (Denmark)

    Fahnøe, Kristian

    2010-01-01

    Based on my ongoing work in relation my PhD thesis this paper examines how the Foucauldian concept of governmentality as social control can be understood as interaction among individuals in institutional settings. In theoretical terms the paper examines how governmentality can be conceptualized f...

  10. Connectionist Interaction Information Retrieval.

    Science.gov (United States)

    Dominich, Sandor

    2003-01-01

    Discussion of connectionist views for adaptive clustering in information retrieval focuses on a connectionist clustering technique and activation spreading-based information retrieval model using the interaction information retrieval method. Presents theoretical as well as simulation results as regards computational complexity and includes…

  11. Interactive Playgrounds for Children

    NARCIS (Netherlands)

    Poppe, Ronald Walter; van Delden, Robertus Wilhelmus; Moreno Celleri, Alejandro Manuel; Reidsma, Dennis; Nijholt, A.; Nijholt, Antinus

    Play is an important factor in the life of children. It plays a role in their cognitive, social, and physical development, and provides entertaining and fulfilling activities in itself. As with any field of human endeavor, interactive technology has a huge potential for transforming and enhancing

  12. Towards Directional Colloidal Interactions

    NARCIS (Netherlands)

    Kamp, M.

    2015-01-01

    Colloids are particles with a size on the scale of microns in at least one dimension. The central theme of this thesis is the synthesis of model colloids with anisotropic interactions - often called `patchy' colloids, as well as the search for new ways to assemble such colloids. Methods to build

  13. Diachronic Perspective and Interaction

    DEFF Research Database (Denmark)

    Marchetti, Emanuela; Valente, Andrea

    . Although this interaction style may appeal to teachers, as it reminds of school teaching, it has several disadvantages: a dialogue never occurs between adults and children, who listen in silence, hence it becomes hard to evaluate what has being learnt and how deeply, and finally it is not very engaging...

  14. Aesthetics of Mundane Interactions

    NARCIS (Netherlands)

    Vyas, D.M.; Hassenzahl, M.

    2008-01-01

    John Dewey’s pragmatist aesthetics is used as a conceptual basis for designing new technologies that support staff-members’ mundane social interactions in an academic department. From this perspective, aesthetics is seen as a broader phenomenon that encompasses experiential aspects of staff-members’

  15. Electromagnetic interaction of metamaterials

    Science.gov (United States)

    Canales, Peter R.

    The observation of extraordinary transmission through subwavelength apertures has propelled a great interest in understanding its nature. It defies classical theories of electromagnetic interaction by demanding a closer examination of the surface properties. Traditionally, as surface features become much smaller in size than a single wavelength of interest, the structure is essentially continuous. Any periodic subwavelength corrugation or aperture array should not interact strongly with an incident field and therefore not contribute to any significant transmission through the film. We find that this is not always the case and that we may tune the surface geometry at these scales to affect the overall medium behavior. It is possible that a material may transcend its own natural properties and, in essence, become a metamaterial. The following analysis examines the concepts of metamaterials from a fundamental viewpoint. It does not seek to disrupt classical theories but instead demonstrates their validity to describe a new phenomenon. Several theories have been proposed that offer unique surface interactions as evidence of enhanced transmission. It is proposed that a fundamental Maxwell representation is sufficient in predicting the interaction of an electromagnetic wave with a metamaterial. In particular, a formalism has been developed to analyze enhanced transmission through a metallic grating structure. To experimentally validate this model, a fabrication procedure has been developed that allows for the production of quality thick film structures with subwavelength features. Finally, the analysis of metamaterials looks towards the RF spectrum to demonstrate a novel design to achieve conformal waveguides and antennas.

  16. Dimensions of Group Interaction

    Science.gov (United States)

    Dawidowicz, Paula

    2008-01-01

    The correlation between positive and negative group interactions and one or another of individuals' attitudes or characteristics--moral development, critical thinking, resilience, and self efficacy--has been examined previously. However, no systemic examination of individuals' development of patterns of these characteristics and those patterns'…

  17. Interactive Architecture #1

    NARCIS (Netherlands)

    Oosterhuis, K.; Xia, X.

    2007-01-01

    The iA bookzine series will consist of twelve issues, bi-annually published over a period of six years under the supervision of Prof. ir. Kas Oosterhuis, director of the Hperbody at the Delft University of Technology. Interactive Architecture - from here on abbreviated as iA - is NOT simply archite

  18. Interactive Purchasing Situations

    NARCIS (Netherlands)

    Groote Schaarsberg, M.; Borm, P.E.M.; Hamers, H.J.M.; Reijnierse, J.H.

    2012-01-01

    Abstract: This paper introduces a new class of interactive cooperative purchasing situations and provides an explicit alternative characterization of the nucleolus of cooperative games, which offers an alternative to Kohlberg (1971). In our cooperative purchasing situation, the unit price of a commo

  19. Electronically Enhanced Classroom Interaction.

    Science.gov (United States)

    Draper, Stephen; Cargill, Julie; Cutts, Quintin

    A design rationale for introducing electronic equipment (a group response system) for student interaction in lecture theaters is presented, linking the instructional design to theory. The effectiveness of the equipment for learning depends mostly on what pedagogic method is employed. Various alternative types are introduced, including: assessment;…

  20. Interactive Foresight Simulation

    DEFF Research Database (Denmark)

    Hansen, Mette Sanne; Rasmussen, Lauge Baungaard; Jacobsen, Peter

    2016-01-01

    The Combined Simulation Approach (CSA) is a way to evaluate risks and address potential unforeseen problems in a more interactive way than what is often observed in practice in companies or sectors. The approach is based on a combination of scenario analysis and discrete-event computer simulation...

  1. Human Work Interaction Design

    DEFF Research Database (Denmark)

    Lopes, Arminda; Ørngreen, Rikke

    This book constitutes the thoroughly refereed post-conference proceedings of the Third IFIP WG 13.6 Working Conference on Human Work Interaction Design, HWID 2012, held in Copenhagen, Denmark, in December 2012. The 16 revised papers presented were carefully selected for inclusion in this volume...

  2. Virtual Interactive Space (VIS)

    DEFF Research Database (Denmark)

    Brooks, Anthony Lewis

    2015-01-01

    This paper shares code that enables the making of a Virtual Interactive Space (VIS) where the skin of the invisible active sensor area is dynamically responsive to the velocity of a limb e.g. hand. Used in proprioception training of movement the patch is at the core of the author’s Reafferentation...

  3. Interaction in Information Systems - Beyond Human-Computer Interaction

    DEFF Research Database (Denmark)

    Bækgaard, Lars

    The purpose of this paper is to discuss and analyze the role of interaction in information systems. Interaction represents dynamic relations between actors and other elements in information systems. We introduce a semi-formal notation that we use to describe a set of interaction patterns and we...... illustrate how the notation can be used to describe mediated interaction. We use the interaction patterns to evaluate a set of modeling languages. No single language supports all relevant aspects of interaction modeling. We use the interaction patterns to identify to general and supplementary forms...... of interaction-interaction based on exchange of objects and interaction based on exchange of commands. None of the modeling languages that we analyze support both forms in a rich way....

  4. Parenting quality interacts with genetic variation in dopamine receptor D4 to influence temperament in early childhood.

    Science.gov (United States)

    Sheese, Brad E; Voelker, Pascale M; Rothbart, Mary K; Posner, Michael I

    2007-01-01

    We examined the influence of a common allelic variation in the dopamine receptor D4 (DRD4) gene and caregiver quality on temperament in early childhood. Children 18-21 months of age were genotyped for the DRD4 48 base pair tandem repeat polymorphism, which has been implicated in the development of attention, sensation seeking, and attention-deficit/hyperactivity disorder. The children also interacted with their caregiver for 10 min in a laboratory setting, and these videotaped interactions were coded for parenting quality using an observational rating procedure. The presence of the DRD4 7-repeat allele was associated with differences in the influence of parenting on a measure of temperamental sensation seeking constructed from caregiver reports on children's activity level, impulsivity, and high-intensity pleasure. Children with the 7-repeat allele were influenced by parenting quality, with lower quality parenting associated with higher levels of sensation seeking; children without the 7-repeat allele were uninfluenced by parenting quality. Differences between alleles were not related to the child's self-regulation as assessed by the effortful control measure. Previous studies have indicated that the 7-repeat allele is under positive selective pressure, and our results are consistent with the hypothesis that the DRD4 7-repeat allele increased children's sensitivity to environmental factors such as parenting. This study shows that genes influence the relation between parenting and temperament in ways that are important to normal development and psychopathology.

  5. Pleiotropic effect of disrupting a conserved sequence involved in a long-range compensatory interaction in the Drosophila Adh gene.

    Science.gov (United States)

    Baines, John F; Parsch, John; Stephan, Wolfgang

    2004-01-01

    Recent advances in experimental analyses of the evolution of RNA secondary structures suggest a more complex scenario than that typically considered by Kimura's classical model of compensatory evolution. In this study, we examine one such case in more detail. Previous experimental analysis of long-range compensatory interactions between the two ends of Drosophila Adh mRNA failed to fit the classical model of compensatory evolution. To further investigate and verify long-range pairing in Drosophila Adh with respect to models of compensatory evolution and its potential functional role, we introduced site-directed mutations in the Drosophila melanogaster Adh gene. We explore two alternative hypotheses for why previous analysis of long-range compensatory interactions failed to fit the classical model. Specifically, we investigate whether the disruption of a conserved short-range pairing within Adh exon 2 has an effect on Adh expression or if there is a dual functional role of a conserved sequence in the 3'-UTR in both long-range pairing and the negative regulation of Adh expression. We find that a classical result was not observed due to the pleiotropic effect of changing a nucleotide involved in both long-range base pairing and the negative regulation of gene expression. PMID:15020421

  6. Mammalian splicing factor SF1 interacts with SURP domains of U2 snRNP-associated proteins.

    Science.gov (United States)

    Crisci, Angela; Raleff, Flore; Bagdiul, Ivona; Raabe, Monika; Urlaub, Henning; Rain, Jean-Christophe; Krämer, Angela

    2015-12-02

    Splicing factor 1 (SF1) recognizes the branch point sequence (BPS) at the 3' splice site during the formation of early complex E, thereby pre-bulging the BPS adenosine, thought to facilitate subsequent base-pairing of the U2 snRNA with the BPS. The 65-kDa subunit of U2 snRNP auxiliary factor (U2AF65) interacts with SF1 and was shown to recruit the U2 snRNP to the spliceosome. Co-immunoprecipitation experiments of SF1-interacting proteins from HeLa cell extracts shown here are consistent with the presence of SF1 in early splicing complexes. Surprisingly almost all U2 snRNP proteins were found associated with SF1. Yeast two-hybrid screens identified two SURP domain-containing U2 snRNP proteins as partners of SF1. A short, evolutionarily conserved region of SF1 interacts with the SURP domains, stressing their role in protein-protein interactions. A reduction of A complex formation in SF1-depleted extracts could be rescued with recombinant SF1 containing the SURP-interaction domain, but only partial rescue was observed with SF1 lacking this sequence. Thus, SF1 can initially recruit the U2 snRNP to the spliceosome during E complex formation, whereas U2AF65 may stabilize the association of the U2 snRNP with the spliceosome at later times. In addition, these findings may have implications for alternative splicing decisions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Interaction Design for Public Spaces

    DEFF Research Database (Denmark)

    Kortbek, Karen Johanne

    2008-01-01

    In this abstract I describe the doctorial research project "Interaction Design for Public Spaces". The objective of the project is to explore and design interaction contexts in culture related public spaces such as museums, experience centres and festivals. As a perspective on this domain, I...... will help interaction designers when designing for bodily movement, and communicating and staging interactive content in public spaces....

  8. Contribution of Partial Charge Interactions and Base Stacking to the Efficiency of Primer Extension at and beyond Abasic Sites in DNA

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Shuangluo; Vashishtha, Ashwani; Bulkley, David; Eom, Soo Hyun; Wang, Jimin; Konigsberg, William H. (Yale); (Gwangju)

    2012-08-31

    During DNA synthesis, base stacking and Watson-Crick (WC) hydrogen bonding increase the stability of nascent base pairs when they are in a ternary complex. To evaluate the contribution of base stacking to the incorporation efficiency of dNTPs when a DNA polymerase encounters an abasic site, we varied the penultimate base pairs (PBs) adjacent to the abasic site using all 16 possible combinations. We then determined pre-steady-state kinetic parameters with an RB69 DNA polymerase variant and solved nine structures of the corresponding ternary complexes. The efficiency of incorporation for incoming dNTPs opposite an abasic site varied between 2- and 210-fold depending on the identity of the PB. We propose that the A rule can be extended to encompass the fact that DNA polymerase can bypass dA/abasic sites more efficiently than other dN/abasic sites. Crystal structures of the ternary complexes show that the surface of the incoming base was stacked against the PB's interface and that the kinetic parameters for dNMP incorporation were consistent with specific features of base stacking, such as surface area and partial charge-charge interactions between the incoming base and the PB. Without a templating nucleotide residue, an incoming dNTP has no base with which it can hydrogen bond and cannot be desolvated, so that these surrounding water molecules become ordered and remain on the PB's surface in the ternary complex. When these water molecules are on top of a hydrophobic patch on the PB, they destabilize the ternary complex, and the incorporation efficiency of incoming dNTPs is reduced.

  9. Packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA depends upon conserved long-range interactions (LRIs) between U5 and gag sequences.

    Science.gov (United States)

    Kalloush, Rawan M; Vivet-Boudou, Valérie; Ali, Lizna M; Mustafa, Farah; Marquet, Roland; Rizvi, Tahir A

    2016-06-01

    MPMV has great potential for development as a vector for gene therapy. In this respect, precisely defining the sequences and structural motifs that are important for dimerization and packaging of its genomic RNA (gRNA) are of utmost importance. A distinguishing feature of the MPMV gRNA packaging signal is two phylogenetically conserved long-range interactions (LRIs) between U5 and gag complementary sequences, LRI-I and LRI-II. To test their biological significance in the MPMV life cycle, we introduced mutations into these structural motifs and tested their effects on MPMV gRNA packaging and propagation. Furthermore, we probed the structure of key mutants using SHAPE (selective 2'hydroxyl acylation analyzed by primer extension). Disrupting base-pairing of the LRIs affected gRNA packaging and propagation, demonstrating their significance to the MPMV life cycle. A double mutant restoring a heterologous LRI-I was fully functional, whereas a similar LRI-II mutant failed to restore gRNA packaging and propagation. These results demonstrate that while LRI-I acts at the structural level, maintaining base-pairing is not sufficient for LRI-II function. In addition, in vitro RNA dimerization assays indicated that the loss of RNA packaging in LRI mutants could not be attributed to the defects in dimerization. Our findings suggest that U5-gag LRIs play an important architectural role in maintaining the structure of the 5' region of the MPMV gRNA, expanding the crucial role of LRIs to the nonlentiviral group of retroviruses.

  10. Interactive Parallel and Distributed Processing

    DEFF Research Database (Denmark)

    Lund, Henrik Hautop; Pagliarini, Luigi

    2010-01-01

    We present the concept of interactive parallel and distributed processing, and the challenges that programmers face in designing interactive parallel and distributed systems. Specifically, we introduce the challenges that are met and the decisions that need to be taken with respect...... to distributedness, master dependency, software behavioural models, adaptive interactivity, feedback, connectivity, topology, island modeling, and user interaction. We introduce the system of modular interactive tiles as a tool for easy, fast, and flexible exploration of these issues, and through examples show how...... to implement interactive parallel and distributed processing with different software behavioural models such as open loop, randomness based, rule based, user interaction based, AI and ALife based software....

  11. Theory of gravitational interactions

    CERN Document Server

    Gasperini, Maurizio

    2017-01-01

    This is the second edition of a well-received book that is a modern, self-contained introduction to the theory of gravitational interactions. The new edition includes more details on gravitational waves of cosmological origin, the so-called brane world scenario, and gravitational time-delay effects. The first part of the book follows the traditional presentation of general relativity as a geometric theory of the macroscopic gravitational field, while the second, more advanced part discusses the deep analogies (and differences) between a geometric theory of gravity and the “gauge” theories of the other fundamental interactions. This fills a gap within the traditional approach to general relativity which usually leaves students puzzled about the role of gravity. The required notions of differential geometry are reduced to the minimum, allowing room for aspects of gravitational physics of current phenomenological and theoretical interest, such as the properties of gravitational waves, the gravitational inter...

  12. Ultrahigh energy neutrino interactions

    Science.gov (United States)

    Domokos, G.; Elliot, B.; Kovesi-Domokos, S.; Mrenna, S.

    1990-03-01

    Ultrahigh energy neutrinos are valuable probes of physics beyond the Standard Model. Neutrinos of the highest energies are emitted by point sources in the sky. We review briefly the predictions of the Standard Model concerning neutrino interactions. We further argue that a number of preon models designed to overcome some difficulties of the Standard Model leads to a blurring of the distinction between leptons and quarks. As a consequence, at sufficiently high energies neutrinos acquire ``anomalous'' interactions. While this phenomenon can probably explain the observed muon excess in extensive air showers (EAS), it can be also tested by studying the absorption of the primaries on the cosmic microwave background. We discuss some observations to be performed in the search of such ``new physics'' beyond the Standard Model.

  13. Interactive Energy Planning

    DEFF Research Database (Denmark)

    Blarke, Morten Boje

    2006-01-01

    Though it is being questioned whether planning theory should be fitted into neat typologies, some have described evolving planning theory as a journey away from ethnocentrism, through the lands of rationalism, pragmatism, socio-ecological idealism, political-economic mobilization, currently...... anchoring along the shores of the land of communications and collaboration. Whether or not a particular typology is applicable, theory and praxis are establishing standpoints, which strengthens our understanding of the planning complex, and which should inspire improved energy planning methodologies...... and tools. This paper presents an “Interactive Energy Planning” framework, which is intended to support interactivity in planning, building on important theoretical and experimental advances in planning. In particular, the paper explores the potential significance of allowing a critical perspective...

  14. Interactional Expertise and Embodiment

    CERN Document Server

    Collins, Harry

    2016-01-01

    In Part 1 of this paper, I introduce the idea of interactional expertise while in Part 2, I focus on its implications for philosophical theories of the importance of the body in forming our conceptual world. I argue that the way philosophers have dealt with the body turns attention away from the most important questions and that we cannot answer these questions without making the notion of socialisation, and therefore interactional expertise, a central concept in our thinking. This makes language at least as important, and often more important than bodily practice in our understanding of the world. The notion of a disembodied socialised agent leads in the direction of interesting questions while the notion of an embodied but unsocialised human actor is unimaginable.

  15. Interactive protein manipulation

    Energy Technology Data Exchange (ETDEWEB)

    SNCrivelli@lbl.gov

    2003-07-01

    We describe an interactive visualization and modeling program for the creation of protein structures ''from scratch''. The input to our program is an amino acid sequence -decoded from a gene- and a sequence of predicted secondary structure types for each amino acid-provided by external structure prediction programs. Our program can be used in the set-up phase of a protein structure prediction process; the structures created with it serve as input for a subsequent global internal energy minimization, or another method of protein structure prediction. Our program supports basic visualization methods for protein structures, interactive manipulation based on inverse kinematics, and visualization guides to aid a user in creating ''good'' initial structures.

  16. Dynamics of interacting diseases

    CERN Document Server

    Sanz, Joaquín; Meloni, Sandro; Moreno, Yamir

    2014-01-01

    Current modeling of infectious diseases allows for the study of complex and realistic scenarios that go from the population to the individual level of description. Most epidemic models however assume that the spreading process takes place on a single level (be it a single population, a meta-population system or a network of contacts). The latter is in part a consequence of our still limited knowledge about the interdependency of the many mechanisms and factors involved in disease spreading. In particular, interdependent contagion phenomena can only be addressed if we go beyond the scheme one pathogen-one network. In this paper, we study a model that allows describing the spreading dynamics of two concurrent diseases and apply it to a paradigmatic case of disease-disease interaction: the interaction between AIDS and Tuberculosis. Specifically, we characterize analytically the epidemic thresholds of the two diseases for different scenarios and also compute the temporal evolution characterizing the unfolding dyn...

  17. Interactive Information Retrieval

    DEFF Research Database (Denmark)

    Borlund, Pia

    2013-01-01

    The paper introduces the research area of interactive information retrieval (IIR) from a historical point of view. Further, the focus here is on evaluation, because much research in IR deals with IR evaluation methodology due to the core research interest in IR performance, system interaction...... and satisfaction with retrieved information. In order to position IIR evaluation, the Cranfield model and the series of tests that led to the Cranfield model are outlined. Three iconic user-oriented studies and projects that all have contributed to how IIR is perceived and understood today are presented....... As a response to this call the ‘IIR evaluation model’ by Borlund (e.g., 2003a) is introduced. The objective of the IIR evaluation model is to facilitate IIR evaluation as close as possible to actual information searching and IR processes, though still in a relatively controlled evaluation environment, in which...

  18. Gravitationally Generated Interactions

    CERN Document Server

    Capozziello, Salvatore; Fabbri, Luca; Vignolo, Stefano

    2012-01-01

    Starting from a 5D-Riemannian manifold, we show that a reduction mechanism to 4D-spacetimes reproduces Extended Theories of Gravity (ETGs) that are direct generalizations of Einstein's gravity. In this context, the gravitational degrees of freedom can be dealt under the standard of spacetime deformations. Besides, such deformations can be related to the mass spectra of particles. The intrinsic non-linearity of ETGs gives an energy-dependent running coupling, while torsion gives rise to interactions among spinors displaying the structure of the weak forces among fermions. We discuss how this scheme is compatible with the known observational evidence and suggest that eventual discrepancies could be detected in experiments, as ATLAS and CMS, today running at LHC (CERN). We finally discuss the consequences of the present approach in view of unification of physical interactions.

  19. Student interaction in workshops

    DEFF Research Database (Denmark)

    Evers, Winie

    2014-01-01

    A kind of teaching for active learning has been experimented with at SDU Sønderborg as part of the course Supply Chain Dynamics. In this course the students learn about complex systems, system dynamics as well as supply chain instability and oscillation, the course lecturer invited the author...... to experiment with novel workshop methods and techniques, where objects are used to illustrate and model business issues (Heinemann et al, 2011, Buur et al, 2013). The idea was to see how students could be engaged in a different and more interactive way to learn about these topics, by assigning the students...... teaching should reflect this diversity by embracing and experimenting with multiple forms, including activation of students by students’ interaction and manipulation with objects....

  20. Interacting Galaxies with MOND

    CERN Document Server

    Tiret, O

    2007-01-01

    We compare N-body simulations performed in MOND with analogs in Newtonian gravity with dark matter (DM). We have developed a code which solves the Poisson equation in both gravity models. It is a grid solver using adaptive mesh refinement techniques, allowing us to study isolated galaxies as well as interacting galaxies. Galaxies in MOND are found to form bars faster and stronger than in the DM model. In Newton dynamics, it is difficult to reproduce the observed high frequency of strong bars, while MOND appears to fit better the observations. Galaxy interactions and mergers, such as the Antennae, are also simulated with Newton and MOND dynamics. In the latter, dynamical friction is much weaker, and merging time-scales are longer. The formation of tidal dwarf galaxies in tidal tails are also compared in MOND and Newton+DM models.