WorldWideScience

Sample records for nonoverlapping gene pairs

  1. Taxonomic characterization of honey bee (Apis mellifera) pollen foraging based on non-overlapping paired-end sequencing of nuclear ribosomal loci

    Science.gov (United States)

    Cornman, Robert S.; Otto, Clint R.; Iwanowicz, Deborah; Pettis, Jeffery S

    2015-01-01

    Identifying plant taxa that honey bees (Apis mellifera) forage upon is of great apicultural interest, but traditional methods are labor intensive and may lack resolution. Here we evaluate a high-throughput genetic barcoding approach to characterize trap-collected pollen from multiple North Dakota apiaries across multiple years. We used the Illumina MiSeq platform to generate sequence scaffolds from non-overlapping 300-bp paired-end sequencing reads of the ribosomal internal transcribed spacers (ITS). Full-length sequence scaffolds represented ~530 bp of ITS sequence after adapter trimming, drawn from the 5’ of ITS1 and the 3’ of ITS2, while skipping the uninformative 5.8S region. Operational taxonomic units (OTUs) were picked from scaffolds clustered at 97% identity, searched by BLAST against the nt database, and given taxonomic assignments using the paired-read lowest common ancestor approach. Taxonomic assignments and quantitative patterns were consistent with known plant distributions, phenology, and observational reports of pollen foraging, but revealed an unexpected contribution from non-crop graminoids and wetland plants. The mean number of plant species assignments per sample was 23.0 (+/- 5.5) and the mean species diversity (effective number of equally abundant species) was 3.3 (+/- 1.2). Bray-Curtis similarities showed good agreement among samples from the same apiary and sampling date. Rarefaction plots indicated that fewer than 50,000 reads are typically needed to characterize pollen samples of this complexity. Our results show that a pre-compiled, curated reference database is not essential for genus-level assignments, but species-level assignments are hindered by database gaps, reference length variation, and probable errors in the taxonomic assignment, requiring post-hoc evaluation. Although the effective per-sample yield achieved using custom MiSeq amplicon primers was less than the machine maximum, primarily due to lower “read2” quality

  2. Evolution of closely linked gene pairs in vertebrate genomes

    NARCIS (Netherlands)

    Franck, E.; Hulsen, T.; Huynen, M.A.; Jong, de W.W.; Lunsen, N.H.; Madsen, O.

    2008-01-01

    The orientation of closely linked genes in mammalian genomes is not random: there are more head-to-head (h2h) gene pairs than expected. To understand the origin of this enrichment in h2h gene pairs, we have analyzed the phylogenetic distribution of gene pairs separated by less than 600 bp of interge

  3. SWR1 Chromatin-Remodeling Complex Subunits and H2A.Z Have Non-overlapping Functions in Immunity and Gene Regulation in Arabidopsis.

    Science.gov (United States)

    Berriri, Souha; Gangappa, Sreeramaiah N; Kumar, S Vinod

    2016-07-06

    Incorporation of the histone variant H2A.Z into nucleosomes by the SWR1 chromatin remodeling complex is a critical step in eukaryotic gene regulation. In Arabidopsis, SWR1c and H2A.Z have been shown to control gene expression underlying development and environmental responses. Although they have been implicated in defense, the specific roles of the complex subunits and H2A.Z in immunity are not well understood. In this study, we analyzed the roles of the SWR1c subunits, PHOTOPERIOD-INDEPENDENT EARLY FLOWERING1 (PIE1), ACTIN-RELATED PROTEIN6 (ARP6), and SWR1 COMPLEX 6 (SWC6), as well as H2A.Z, in defense and gene regulation. We found that SWR1c components play different roles in resistance to different pathogens. Loss of PIE1 and SWC6 function as well as depletion of H2A.Z led to reduced basal resistance, while loss of ARP6 fucntion resulted in enhanced resistance. We found that mutations in PIE1 and SWC6 resulted in impaired effector-triggered immunity. Mutation in SWR1c components and H2A.Z also resulted in compromised jasmonic acid/ethylene-mediated immunity. Genome-wide expression analyses similarly reveal distinct roles for H2A.Z and SWR1c components in gene regulation, and suggest a potential role for PIE1 in the regulation of the cross talk between defense signaling pathways. Our data show that although they are part of the same complex, Arabidopsis SWR1c components could have non-redundant functions in plant immunity and gene regulation.

  4. Gene pair signatures in cell type transcriptomes reveal lineage control

    Science.gov (United States)

    Heinäniemi, Merja; Nykter, Matti; Kramer, Roger; Wienecke-Baldacchino, Anke; Sinkkonen, Lasse; Zhou, Joseph Xu; Kreisberg, Richard; Kauffman, Stuart A.; Huang, Sui; Shmulevich, Ilya

    2013-01-01

    The distinct cell types of multicellular organisms arise due to constraints imposed by gene regulatory networks on the collective change of gene expression across the genome, creating self-stabilizing expression states, or attractors. We compiled a resource of curated human expression data comprising 166 cell types and 2,602 transcription regulating genes and developed a data driven method built around the concept of expression reversal defined at the level of gene pairs, such as those participating in toggle switch circuits. This approach allows us to organize the cell types into their ontogenetic lineage-relationships and to reflect regulatory relationships among genes that explain their ability to function as determinants of cell fate. We show that this method identifies genes belonging to regulatory circuits that control neuronal fate, pluripotency and blood cell differentiation, thus offering a novel large-scale perspective on lineage specification. PMID:23603899

  5. Nonoverlap Property of the Thue-Morse Sequence

    Science.gov (United States)

    2010-04-20

    Fibonacci Numbers & Applic. 2010. 14. ABSTRACT In this note, we provide a new proof for the nonoverlap property of the Thue- Morse sequence using a...Nonoverlap Property of the Thue-Morse Sequence T.W. Cusicka, P. Stănicăb aDepartment of Mathematics, The State University of New York Buffalo, NY...2010 Abstract In this note, we provide a new proof for the nonoverlap property of the Thue- Morse sequence using a Boolean functions approach and

  6. Identifying concerted evolution and gene conversion in mammalian gene pairs lasting over 100 million years

    Directory of Open Access Journals (Sweden)

    Scherer Stephen W

    2009-07-01

    Full Text Available Abstract Background Concerted evolution occurs in multigene families and is characterized by stretches of homogeneity and higher sequence similarity between paralogues than between orthologues. Here we identify human gene pairs that have undergone concerted evolution, caused by ongoing gene conversion, since at least the human-mouse divergence. Our strategy involved the identification of duplicated genes with greater similarity within a species than between species. These genes were required to be present in multiple mammalian genomes, suggesting duplication early in mammalian divergence. To eliminate genes that have been conserved due to strong purifying selection, our analysis also required at least one intron to have retained high sequence similarity between paralogues. Results We identified three human gene pairs undergoing concerted evolution (BMP8A/B, DDX19A/B, and TUBG1/2. Phylogenetic investigations reveal that in each case the duplication appears to have occurred prior to eutherian mammalian radiation, with exactly two paralogues present in all examined species. This indicates that all three gene duplication events were established over 100 million years ago. Conclusion The extended duration of concerted evolution in multiple distant lineages suggests that there has been prolonged homogenization of specific segments within these gene pairs. Although we speculate that selection for homogenization could have been utilized in order to maintain crucial homo- or hetero- binding domains, it remains unclear why gene conversion has persisted for such extended periods of time. Through these analyses, our results demonstrate additional examples of a process that plays a definite, although unspecified, role in molecular evolution.

  7. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang

    2011-08-01

    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  8. Human T-cell leukemia virus type 1 expressing nonoverlapping tax and rex genes replicates and immortalizes primary human T lymphocytes but fails to replicate and persist in vivo.

    Science.gov (United States)

    Younis, Ihab; Yamamoto, Brenda; Phipps, Andrew; Green, Patrick L

    2005-12-01

    Human T-cell leukemia virus type 1 (HTLV-1) is an oncogenic retrovirus associated primarily with adult T-cell leukemia and neurological disease. HTLV-1 encodes the positive trans-regulatory proteins Tax and Rex, both of which are essential for viral replication. Tax activates transcription initiation from the viral long terminal repeat and modulates the transcription or activity of a number of cellular genes. Rex regulates gene expression posttranscriptionally by facilitating the cytoplasmic expression of incompletely spliced viral mRNAs. Tax and Rex mutants have been identified that have defective activities or impaired biochemical properties associated with their function. To ultimately determine the contribution of specific protein activities on viral replication and cellular transformation of primary T cells, mutants need to be characterized in the context of an infectious molecular clone. Since the tax and rex genes are in partially overlapping reading frames, mutation in one gene frequently disrupts the other, confounding interpretation of mutational analyses in the context of the virus. Here we generated and characterized a unique proviral clone (H1IT) in which the tax and rex genes were separated by expressing Tax from an internal ribosome entry site. We showed that H1IT expresses both functional Tax and Rex. In short- and long-term coculture assays, H1IT was competent to infect and immortalize primary human T cells similar to wild-type HTLV-1. In contrast, H1IT failed to efficiently replicate and persist in inoculated rabbits, thus emphasizing the importance of temporal and quantitative regulation of specific mRNA for viral survival in vivo.

  9. A NONOVERLAPPING DOMAIN DECOMPOSITION METHOD FOR EXTERIOR 3-D PROBLEM

    Institute of Scientific and Technical Information of China (English)

    De-hao Yu; Ji-ming Wu; Ji-ming Wu

    2001-01-01

    In this paper, a nonoverlapping domain decomposition method, which is based on the natural boundary reduction(cf. [4, 13, 15]), is developed to solve the boundary value problem in exterior three-dimensional domain of general shape. Convergence analyses both for the exterior spherical domain and the general exterior domain are made. Some numerical examples are also provided to illustrate the method.

  10. Aldehyde Dehydrogenase Gene Superfamily in Populus: Organization and Expression Divergence between Paralogous Gene Pairs.

    Directory of Open Access Journals (Sweden)

    Feng-Xia Tian

    Full Text Available Aldehyde dehydrogenases (ALDHs constitute a superfamily of NAD(P+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.

  11. A stochastic model for identifying differential gene pair co-expression patterns in prostate cancer progression

    Directory of Open Access Journals (Sweden)

    Mao Yu

    2009-07-01

    Full Text Available Abstract Background The identification of gene differential co-expression patterns between cancer stages is a newly developing method to reveal the underlying molecular mechanisms of carcinogenesis. Most researches of this subject lack an algorithm useful for performing a statistical significance assessment involving cancer progression. Lacking this specific algorithm is apparently absent in identifying precise gene pairs correlating to cancer progression. Results In this investigation we studied gene pair co-expression change by using a stochastic process model for approximating the underlying dynamic procedure of the co-expression change during cancer progression. Also, we presented a novel analytical method named 'Stochastic process model for Identifying differentially co-expressed Gene pair' (SIG method. This method has been applied to two well known prostate cancer data sets: hormone sensitive versus hormone resistant, and healthy versus cancerous. From these data sets, 428,582 gene pairs and 303,992 gene pairs were identified respectively. Afterwards, we used two different current statistical methods to the same data sets, which were developed to identify gene pair differential co-expression and did not consider cancer progression in algorithm. We then compared these results from three different perspectives: progression analysis, gene pair identification effectiveness analysis, and pathway enrichment analysis. Statistical methods were used to quantify the quality and performance of these different perspectives. They included: Re-identification Scale (RS and Progression Score (PS in progression analysis, True Positive Rate (TPR in gene pair analysis, and Pathway Enrichment Score (PES in pathway analysis. Our results show small values of RS and large values of PS, TPR, and PES; thus, suggesting that gene pairs identified by the SIG method are highly correlated with cancer progression, and highly enriched in disease-specific pathways. From

  12. A PARALLEL NONOVERLAPPING DOMAIN DECOMPOSITION METHOD FOR STOKES PROBLEMS

    Institute of Scientific and Technical Information of China (English)

    Mei-qun Jiang; Pei-liang Dai

    2006-01-01

    A nonoverlapping domain decomposition iterative procedure is developed and analyzed for generalized Stokes problems and their finite element approximate problems in RN(N=2,3). The method is based on a mixed-type consistency condition with two parameters as a transmission condition together with a derivative-free transmission data updating technique on the artificial interfaces. The method can be applied to a general multi-subdomain decomposition and implemented on parallel machines with local simple communications naturally.

  13. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  14. Classification between normal and tumor tissues based on the pair-wise gene expression ratio

    Directory of Open Access Journals (Sweden)

    Wong YC

    2004-10-01

    Full Text Available Abstract Background Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Method Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features. The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation as discriminating axes (single gene expression or pair-wise gene expression ratio. Classification results were compared to the original datasets for up to 10-feature model classifiers. Results 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The

  15. Contrasted patterns of selective pressure in three recent paralogous gene pairs in the Medicago genus (L.

    Directory of Open Access Journals (Sweden)

    Ho-Huu Joan

    2012-10-01

    Full Text Available Abstract Background Gene duplications are a molecular mechanism potentially mediating generation of functional novelty. However, the probabilities of maintenance and functional divergence of duplicated genes are shaped by selective pressures acting on gene copies immediately after the duplication event. The ratio of non-synonymous to synonymous substitution rates in protein-coding sequences provides a means to investigate selective pressures based on genic sequences. Three molecular signatures can reveal early stages of functional divergence between gene copies: change in the level of purifying selection between paralogous genes, occurrence of positive selection, and transient relaxed purifying selection following gene duplication. We studied three pairs of genes that are known to be involved in an interaction with symbiotic bacteria and were recently duplicated in the history of the Medicago genus (Fabaceae. We sequenced two pairs of polygalacturonase genes (Pg11-Pg3 and Pg11a-Pg11c and one pair of auxine transporter-like genes (Lax2-Lax4 in 17 species belonging to the Medicago genus, and sought for molecular signatures of differentiation between copies. Results Selective histories revealed by these three signatures of molecular differentiation were found to be markedly different between each pair of paralogs. We found sites under positive selection in the Pg11 paralogs while Pg3 has mainly evolved under purifying selection. The most recent paralogs examined Pg11a and Pg11c, are both undergoing positive selection and might be acquiring new functions. Lax2 and Lax4 paralogs are both under strong purifying selection, but still underwent a temporary relaxation of purifying selection immediately after duplication. Conclusions This study illustrates the variety of selective pressures undergone by duplicated genes and the effect of age of the duplication. We found that relaxation of selective constraints immediately after duplication might promote

  16. Pax8, a murine paired box gene expressed in the developing excretory system and thyroid gland.

    Science.gov (United States)

    Plachov, D; Chowdhury, K; Walther, C; Simon, D; Guenet, J L; Gruss, P

    1990-10-01

    Several mouse genes designated 'Pax genes' contain a highly conserved DNA sequence homologous to the paired box of Drosophila. Here we describe the isolation of Pax8, a novel paired box containing clone from an 8.5 day p.c. mouse embryo cDNA library. An open reading frame of 457 amino acids (aa) contains the 128 aa paired domain near the amino terminus. Another conserved region present in some other paired box genes, the octapeptide Tyr-Ser-Ile-Asn-Gly-Leu-Leu-Gly, is located 43 aa C-terminal to the paired domain. Using an interspecies backcross system, we have mapped the Pax8 gene within the proximal portion of mouse chromosome 2 in a close linkage to the surf locus. Several developmental mutations are located in this region. In situ hybridization was used to determine the pattern of Pax8 expression during mouse embryogenesis. Pax8 is expressed transiently between 11.5 and 12.5 days of gestation along the rostrocaudal axis extending from the myelencephalon throughout the length of the neural tube, predominantly in two parallel regions on either side of the basal plate. We also detected Pax8 expression in the developing thyroid gland beginning at 10.5 days of gestation, during the thyroid evagination. In the mesonephros and metanephros the expression of Pax8 was localized to the mesenchymal condensations, which are induced by the nephric duct and ureter, respectively. These condensations develop to functional units, the nephrons, of the kidney. These data are consistent with a role for Pax8 in the induction of kidney epithelium. The embryonic expression pattern of Pax8 is compared with that of Pax2, another recently described paired box gene expressed in the developing excretory system.

  17. Non-overlapping domain decomposition methods in structural mechanics

    CERN Document Server

    Gosselet, Pierre; 10.1007/BF02905857

    2012-01-01

    The modern design of industrial structures leads to very complex simulations characterized by nonlinearities, high heterogeneities, tortuous geometries... Whatever the modelization may be, such an analysis leads to the solution to a family of large ill-conditioned linear systems. In this paper we study strategies to efficiently solve to linear system based on non-overlapping domain decomposition methods. We present a review of most employed approaches and their strong connections. We outline their mechanical interpretations as well as the practical issues when willing to implement and use them. Numerical properties are illustrated by various assessments from academic to industrial problems. An hybrid approach, mainly designed for multifield problems, is also introduced as it provides a general framework of such approaches.

  18. Diffusion in the two-dimensional nonoverlapping Lorentz gas

    Science.gov (United States)

    James, Corinne P.; Evans, Glenn T.

    1987-10-01

    The self-diffusion coefficient, velocity autocorrelation function, and distribution of collision times for a two-dimensional nonoverlapping Lorentz gas were calculated using molecular dynamics simulation. The systems studied covered a range of densities, from a packing fraction (πNr2/L2) of 0.01 to 0.8. Self-diffusion coefficients were found to agree to all densities with kinetic theory predictions [A. Weijland and J. M. J. van Leeuwen, Physica 38, 35 (1968)] if the radial distribution function (rdf) was taken into account. The density dependence of the decay of the velocity autocorrelation function was qualitatively different from that predicted by kinetic theory. The distribution of collision times was nearly exponential for all but the highest density studied.

  19. Interpersonal perception and metaperception in nonoverlapping social groups.

    Science.gov (United States)

    Malloy, T E; Albright, L; Kenny, D A; Agatstein, F; Winquist, L

    1997-02-01

    Consensus, self-other agreement, and meta-accuracy were studied within and across nonoverlapping social groups. Thirty-one target persons were judged on the Big Five factors by 9 informants: 3 family members, 3 friends, and 3 coworkers. Although well acquainted within groups, informants were unacquainted between groups. A social relations analysis conducted within each social group showed reliable consensus on the Big Five personality factors. A model specified to estimate the consistency of a target person's effect on perceptions by others across social groups showed weaker agreement across groups. That is, targets were perceived consensually within groups, but these consensual perceptions differed between groups. The data suggest that personality and identity are context specific; however, there was some evidence of agreement in perceptions across groups.

  20. Identification of genes that promote or antagonize somatic homolog pairing using a high-throughput FISH-based screen.

    Directory of Open Access Journals (Sweden)

    Eric F Joyce

    Full Text Available The pairing of homologous chromosomes is a fundamental feature of the meiotic cell. In addition, a number of species exhibit homolog pairing in nonmeiotic, somatic cells as well, with evidence for its impact on both gene regulation and double-strand break (DSB repair. An extreme example of somatic pairing can be observed in Drosophila melanogaster, where homologous chromosomes remain aligned throughout most of development. However, our understanding of the mechanism of somatic homolog pairing remains unclear, as only a few genes have been implicated in this process. In this study, we introduce a novel high-throughput fluorescent in situ hybridization (FISH technology that enabled us to conduct a genome-wide RNAi screen for factors involved in the robust somatic pairing observed in Drosophila. We identified both candidate "pairing promoting genes" and candidate "anti-pairing genes," providing evidence that pairing is a dynamic process that can be both enhanced and antagonized. Many of the genes found to be important for promoting pairing are highly enriched for functions associated with mitotic cell division, suggesting a genetic framework for a long-standing link between chromosome dynamics during mitosis and nuclear organization during interphase. In contrast, several of the candidate anti-pairing genes have known interphase functions associated with S-phase progression, DNA replication, and chromatin compaction, including several components of the condensin II complex. In combination with a variety of secondary assays, these results provide insights into the mechanism and dynamics of somatic pairing.

  1. A Simple Method to Control Positive Baseline Trend within Data Nonoverlap

    Science.gov (United States)

    Parker, Richard I.; Vannest, Kimberly J.; Davis, John L.

    2014-01-01

    Nonoverlap is widely used as a statistical summary of data; however, these analyses rarely correct unwanted positive baseline trend. This article presents and validates the graph rotation for overlap and trend (GROT) technique, a hand calculation method for controlling positive baseline trend within an analysis of data nonoverlap. GROT is…

  2. Comprehensive profiling of EBV gene expression in nasopharyngeal carcinoma through paired-end transcriptome sequencing.

    Science.gov (United States)

    Hu, Lijuan; Lin, Zhirui; Wu, Yanheng; Dong, Juqin; Zhao, Bo; Cheng, Yanbing; Huang, Peiyu; Xu, Lihua; Xia, Tianliang; Xiong, Dan; Wang, Hongbo; Li, Manzhi; Guo, Ling; Kieff, Elliott; Zeng, Yixin; Zhong, Qian; Zeng, Musheng

    2016-03-01

    The latent expression pattern of Epstein-Barr Virus (EBV) genes in nasopharyngeal carcinoma (NPC) has been extensively investigated, and the expression of several lytic genes in NPC has been reported. However, comprehensive information through EBV transcriptome analysis in NPC is limited. We performed paired-end RNA-seq to systematically and comprehensively characterize the expression of EBV genes in NPC tissue and C666-1 NPC cell line, which consistently carries EBV. In addition to the transcripts restricted to type II latency infection, the type III latency EBNA3s genes and a substantial number of lytic genes, such as BZLF1, BRLF1, and BMRF1, were detected through RNA-seq and were further verified in C666-1 cells and NPC tissue through realtime PCR.We also performed clustering analysis to classify NPC patient groups in terms of EBV gene expression, which presented two subtypes of NPC samples. Results revealed interesting patterns of EBV gene expression in NPC patients. This clustering was correlated with many signaling pathways, such as those related to heterotrimeric G-protein signaling, inflammation mediated by chemokine and cytokine signaling, ribosomes, protein metabolism, influenza infection, and ECM-receptor interaction. Our combined findings suggested that the expression of EBV genes in NPC is restricted not only to type II latency genes but also to type III latency and lytic genes. This study provided further insights into the potential role of EBV in the development of NPC.

  3. Packing of nonoverlapping cubic particles: Computational algorithms and microstructural characteristics.

    Science.gov (United States)

    Malmir, Hessam; Sahimi, Muhammad; Tabar, M Reza Rahimi

    2016-12-01

    Packing of cubic particles arises in a variety of problems, ranging from biological materials to colloids and the fabrication of new types of porous materials with controlled morphology. The properties of such packings may also be relevant to problems involving suspensions of cubic zeolites, precipitation of salt crystals during CO_{2} sequestration in rock, and intrusion of fresh water in aquifers by saline water. Not much is known, however, about the structure and statistical descriptors of such packings. We present a detailed simulation and microstructural characterization of packings of nonoverlapping monodisperse cubic particles, following up on our preliminary results [H. Malmir et al., Sci. Rep. 6, 35024 (2016)2045-232210.1038/srep35024]. A modification of the random sequential addition (RSA) algorithm has been developed to generate such packings, and a variety of microstructural descriptors, including the radial distribution function, the face-normal correlation function, two-point probability and cluster functions, the lineal-path function, the pore-size distribution function, and surface-surface and surface-void correlation functions, have been computed, along with the specific surface and mean chord length of the packings. The results indicate the existence of both spatial and orientational long-range order as the the packing density increases. The maximum packing fraction achievable with the RSA method is about 0.57, which represents the limit for a structure similar to liquid crystals.

  4. Packing of nonoverlapping cubic particles: Computational algorithms and microstructural characteristics

    Science.gov (United States)

    Malmir, Hessam; Sahimi, Muhammad; Tabar, M. Reza Rahimi

    2016-12-01

    Packing of cubic particles arises in a variety of problems, ranging from biological materials to colloids and the fabrication of new types of porous materials with controlled morphology. The properties of such packings may also be relevant to problems involving suspensions of cubic zeolites, precipitation of salt crystals during CO2 sequestration in rock, and intrusion of fresh water in aquifers by saline water. Not much is known, however, about the structure and statistical descriptors of such packings. We present a detailed simulation and microstructural characterization of packings of nonoverlapping monodisperse cubic particles, following up on our preliminary results [H. Malmir et al., Sci. Rep. 6, 35024 (2016), 10.1038/srep35024]. A modification of the random sequential addition (RSA) algorithm has been developed to generate such packings, and a variety of microstructural descriptors, including the radial distribution function, the face-normal correlation function, two-point probability and cluster functions, the lineal-path function, the pore-size distribution function, and surface-surface and surface-void correlation functions, have been computed, along with the specific surface and mean chord length of the packings. The results indicate the existence of both spatial and orientational long-range order as the the packing density increases. The maximum packing fraction achievable with the RSA method is about 0.57, which represents the limit for a structure similar to liquid crystals.

  5. The association between paired basic amino acid cleaving enzyme 4 gene haplotype and diastolic blood pressure

    Institute of Scientific and Technical Information of China (English)

    李建平; 王晓滨; 陈常忠; 徐新; 洪雪梅; 徐希平; 高炜; 霍勇

    2004-01-01

    Background In a previously identified locus linked to hypertension on chromosome 15q, we identified three blood pressure candidate genes: insulin-like growth factor 1 receptor gene (IGF1R), myocyte specific enhancer factor 2A gene (MEF2A), and paired basic amino acid cleaving enzyme 4 gene (PACE4). In this study, we tested their associations with hypertension using haplotype analysis.Methods A total of 288 unrelated individuals, including 163 high diastolic blood pressure (DBP) subjects and 125 normal DBP subjects were enrolled in this case-control study. Twenty single nucleotide polymorphisms (SNPs) in the three genes were genotyped using polymerase chain reaction followed by restriction enzyme digestion. Haplotype analysis was accomplished in the following stages: (1) pair-wise linkage disequilibrium test among SNPs on the same gene was performed to explore blocks in which recombination is very unlikely to happen; (2) Estimation-Maximization algorithm was applied to estimate haplotype frequencies in each block; (3) the chi-square test was used to examine the specific haplotype difference, and a permutation test was used to examine the overall haplotype profile difference between cases and controls in each block.Results An estimated haplotype "CCCCG" frequency in the haplotype block on the PACE4 gene was significantly higher in high DBP cases than in controls (P<0.01). The overall estimated haplotype profile in this block was also significantly different between the cases and the controls (P<0.001). This association indicates. Conclusions This study for the first time demonstrated that PACE4 gene may play an important role in the regulation of DBP. This association indicates that variations influencing DBP resides in or near this genomic region.

  6. [Using the operonic gene pairs for establishing the treshold for correlation coefficient of differently expressed genes].

    Science.gov (United States)

    Hedge, Sh; Klimova, E Iu; Mande, Sh; Medvedeva, Iu A; Makeev, V Iu; Permina, E A

    2011-01-01

    We developed an approach for effective estimating the correlations in the noise component of gene expression data. An efficent noise reduction technique has been suggested. The resulting technique has been applied to E. coli microarray data and tested on SOS response modulated genes.

  7. Linkage of the VNTR/insulin-gene and type I diabetes mellitus: Increased gene sharing in affected sibling pairs

    Energy Technology Data Exchange (ETDEWEB)

    Owerbach, D.; Gabbay, K.H. (Baylor College of Medicine, Houston, TX (United States))

    1994-05-01

    Ninety-six multiplex type I diabetic families were typed at the 5' flanking region of the insulin gene by using a PCR assay that better resolves the VNTR into multiple alleles. Affected sibling pairs shared 2, 1, and 0 VNTR alleles - identical by descent - at a frequency of .47, .45, and .08, respectively, a ratio that deviated from the expected 1:2:1 ratio (P<.001). These results confirm linkage of the chromosome 11p15.5 region with type I diabetes mellitus susceptibility. 20 refs., 2 tabs.

  8. Nonoverlapping Clinical and Mutational Patterns in Melanomas from the Female Genital Tract and Atypical Genital Nevi.

    Science.gov (United States)

    Yélamos, Oriol; Merkel, Emily A; Sholl, Lauren Meldi; Zhang, Bin; Amin, Sapna M; Lee, Christina Y; Guitart, Gerta E; Yang, Jingyi; Wenzel, Alexander T; Bunick, Christopher G; Yazdan, Pedram; Choi, Jaehyuk; Gerami, Pedram

    2016-09-01

    Genital melanomas (GM) are the second most common cancer of the female external genitalia and may be confused with atypical genital nevi (AGN), which exhibit atypical histological features but have benign behavior. In this study, we compared the clinical, histological, and molecular features of 19 GM and 25 AGN. We described chromosomal copy number aberrations and the mutational status of 50 oncogenes and tumor suppressor genes in both groups. Our study showed that a pigmented lesion occurring in mucosal tissue, particularly in postmenopausal women, was more likely to be a melanoma than a nevus. GM had high levels of chromosomal instability, with many copy number aberrations. Furthermore, we found a completely nonoverlapping pattern of oncogenic mutations when comparing GM and AGN. In GM, we report somatic mutations in KIT and TP53. Conversely, AGN had frequent BRAF V600E mutations, which were not seen in any of the GM. Our results show that GM and AGN have distinct clinical and molecular changes and that GM have a different mutational pattern compared with AGN.

  9. Combinatory microarray and SuperSAGE analyses identify pairing-dependently transcribed genes in Schistosoma mansoni males, including follistatin.

    Directory of Open Access Journals (Sweden)

    Silke Leutner

    2013-11-01

    Full Text Available BACKGROUND: Schistosomiasis is a disease of world-wide importance and is caused by parasitic flatworms of the genus Schistosoma. These parasites exhibit a unique reproduction biology as the female's sexual maturation depends on a constant pairing-contact to the male. Pairing leads to gonad differentiation in the female, and even gene expression of some gonad-associated genes is controlled by pairing. In contrast, no morphological changes have been observed in males, although first data indicated an effect of pairing also on gene transcription in males. METHODOLOGY/PRINCIPAL FINDINGS: To investigate the influence of pairing on males, we performed a combinatory approach applying SuperSAGE and microarray hybridization, generating the most comprehensive data-set on differential transcription available to date. Of 6,326 sense transcripts detected by both analyses, 29 were significantly differentially transcribed. Besides mutual confirmation, the two methods complemented each other as shown by data comparison and real-time PCR, which revealed a number of genes with consistent regulation across all methods. One of the candidate genes, follistatin of S. mansoni (SmFst was characterized in more detail by in situ hybridization and yeast two-hybrid (Y2H interaction analyses with potential binding partners. CONCLUSIONS/SIGNIFICANCE: Beyond confirming previously hypothesized differences in metabolic processes between pairing-experienced (EM and pairing-unexperienced males (UM, our data indicate that neuronal processes are involved in male-female interaction but also TGFβ-signaling. One candidate revealing significant down-regulation in EM was the TGFβ-pathway controlling molecule follistatin (SmFst. First functional analyses demonstrated SmFst interaction with the S. mansoni TGFβ-receptor agonists inhibin/activin (SmInAct and bone morphogenic protein (SmBMP, and all molecules colocalized in the testes. This indicates a yet unknown role of the TGF

  10. Filaggrin gene loss-of-function mutations explain discordance of atopic dermatitis within dizygotic twin pairs

    DEFF Research Database (Denmark)

    Thomsen, Simon Francis; Elmose, Camilla; Szecsi, Pal Bela

    2016-01-01

    OBJECTIVES: This study was designed to examine the association between loss-of-function mutations in the filaggrin gene (FLG) and atopic dermatitis (AD) and asthma in adult twins. METHODS: A previously well-characterized cohort of 575 adult twins were genotyped for the loss-of-function mutations...... in FLG (R501X, 2282del4 and R2447X) most common among northern Europeans. Subjects were examined for symptoms of atopic diseases as well as for lung function, airway responsiveness, and atopy. RESULTS: In the whole population of twins, the risk for AD was significantly increased in individuals with FLG...... no significant differences in risk for asthma by FLG mutation status in individuals with and without AD, respectively (P-value for interaction, 0.595). In 11 dizygotic twin pairs discordant for FLG mutation status, risk for AD was higher in the twin carrying the FLG mutation (five of 11 [45.5%] twins had...

  11. Integrated miRNA-risk gene-pathway pair network analysis provides prognostic biomarkers for gastric cancer

    Directory of Open Access Journals (Sweden)

    Cai H

    2016-05-01

    Full Text Available Hui Cai,1 Jiping Xu,2 Yifang Han,3 Zhengmao Lu,1 Ting Han,1 Yibo Ding,4 Liye Ma1 1Department of General Surgery, Changhai Hospital, Second Military Medical University, Shanghai, 2Department of Medical Administration, Changhai Hospital, Second Military Medical University, Shanghai, 3Department of Epidemiology, Research Institute for Medicine of Nanjing Command, Nanjing, 4Department of Epidemiology, Changhai Hospital, Second Military Medical University, Shanghai, People’s Republic of China Purpose: This study aimed to identify molecular prognostic biomarkers for gastric cancer. Methods: mRNA and miRNA expression profiles of eligible gastric cancer and control samples were downloaded from Gene Expression Omnibus to screen the differentially expressed genes (DEGs and differentially expressed miRNAs (DEmiRs, using MetaDE and limma packages, respectively. Target genes of the DEmiRs were also collected from both predictive and experimentally validated target databases of miRNAs. The overlapping genes between selected targets and DEGs were identified as risk genes, followed by functional enrichment analysis. Human pathways and their corresponding genes were downloaded from the Kyoto Encyclopedia of Genes and Genomes (KEGG database for the expression analysis of each pathway in gastric cancer samples. Next, co-pathway pairs were selected according to the Pearson correlation coefficients. Finally, the co-pathway pairs, miRNA–target pairs, and risk gene–pathway pairs were merged into a complex interaction network, the most important nodes (miRNAs/target genes/co-pathway pairs of which were selected by calculating their degrees.Results: Totally, 1,260 DEGs and 144 DEmiRs were identified. There were 336 risk genes found in the 9,572 miRNA–target pairs. Judging from the pathway expression files, 45 co-pathway pairs were screened out. There were 1,389 interactive pairs and 480 nodes in the integrated network. Among all nodes in the network, focal

  12. Transcriptional regulation of bidirectional gene pairs by 17-β-estradiol in MCF-7 breast cancer cells

    Directory of Open Access Journals (Sweden)

    S.A.B. Garcia

    2011-02-01

    Full Text Available Using cDNA microarray analysis, we previously identified a set of differentially expressed genes in primary breast tumors based on the status of estrogen and progesterone receptors. In the present study, we performed an integrated computer-assisted and manual search of potential estrogen response element (ERE binding sites in the promoter region of these genes to characterize their potential to be regulated by estrogen receptors (ER. Publicly available databases were used to annotate the position of these genes in the genome and to extract a 5’flanking region 2 kb upstream to 2 kb downstream of the transcription start site for transcription binding site analysis. The search for EREs and other binding sites was performed using several publicly available programs. Overall, approximately 40% of the genes analyzed were potentially able to be regulated by estrogen via ER. In addition, 17% of these genes are located very close to other genes organized in a head-to-head orientation with less than 1.0 kb between their transcript units, sharing a bidirectional promoter, and could be classified as bidirectional gene pairs. Using quantitative real-time PCR, we further investigated the effects of 17β-estradiol and antiestrogens on the expression of the bidirectional gene pairs in MCF-7 breast cancer cells. Our results showed that some of these gene pairs, such as TXNDC9/EIF5B, GALNS/TRAPPC2L, and SERINC1/PKIB, are modulated by 17β-estradiol via ER in MCF-7 breast cancer cells. Here, we also characterize the promoter region of potential ER-regulated genes and provide new information on the transcriptional regulation of bidirectional gene pairs.

  13. Expression of miR-98 in myocarditis and its influence on transcription of the FAS/FASL gene pair.

    Science.gov (United States)

    Zhang, B Y; Zhao, Z; Jin, Z

    2016-06-03

    Myocarditis is a common cardiovascular disease and frequently occurs in children and teenagers. It is believed to be caused by both endogenous and exogenous factors, among which FAS/FASL gene pair-induced cell apoptosis is a major mechanism of myocardial cell injury. A previous study has detected low expression of microRNA (miR)-98 in myocarditis patients. Therefore, in this study we investigated the functional implications of miR-98 with respect to the disease. We carried out a case-control study including 50 myocarditis patients and 50 healthy individuals. Total RNA was extracted from peripheral blood plasma. Expression levels of miR-98 and the FAS/FASL gene pair were determined by real-time fluorescent quantitative polymerase chain reaction. The interaction between miR-98 and the FAS/FASL pair was visualized by dual-luciferase reporter assay. The expression of the FAS/FASL gene pair was further detected by transfecting with an miR-98 mimic or an miR-98 inhibitor. The content of miR-98 in the peripheral blood of the myocarditis patients was significantly lower than in the healthy individuals. However, the FAS/FASL genes were upregulated by 1.68-fold in the myocarditis patients. miR-98 was shown to interact with the 3'-untranslated region of the FAS/FASL gene pair. The inhibition/facilitation of miR-98 expression in myocardial cells can modulate apoptosis. miR-98 was downregulated in the peripheral blood of myocarditis patients. It may interact with the FAS/FASL gene pair to further modulate cell apoptosis.

  14. An H3-H4 histone gene pair in the marine copepod Tigriopus californicus, contains an intergenic dyad symmetry element.

    Science.gov (United States)

    Porter, D; Brown, D; Wells, D

    1991-01-01

    Histone genes are one of the most widely studied multigene families in eucaryotes. Over 200 histone genes have been sequenced, primarily in vertebrates, echinoderms, fungi and plants. We present here the structure and genomic orientation of an H3-H4 histone gene pair from the marine copepod, Tigriopus californicus. These histone gene sequences are the first to be determined for the class Crustacea and among the first to be determined for protostomes. The H4 and H3 genes in Tigriopus are shown to be adjacent, to have opposite polarity, and to contain a 26 bp region of dyad symmetry centrally located within the spacer region between the two genes. A similarly located dyad element has been found in yeast which contributes to the coordinated cell cycle control of the adjacent histone genes. The Tigriopus H3-H4 histone gene pair is clustered with one H2A and two H2B histone genes on a 15 kb genomic Bam H1 fragment. The H4 gene sequence predicts an H4 protein with an unusual serine to threonine substitution at the amino terminal residue. The H3 gene sequence predicts an H3 protein which is identical to the vertebrate H3.2 histone.

  15. Targeted mutagenesis of multiple and paralogous genes in Xenopus laevis using two pairs of transcription activator-like effector nucleases.

    Science.gov (United States)

    Sakane, Yuto; Sakuma, Tetsushi; Kashiwagi, Keiko; Kashiwagi, Akihiko; Yamamoto, Takashi; Suzuki, Ken-Ichi T

    2014-01-01

    Transcription activator-like effector nucleases (TALENs) have been extensively used in genome editing in various organisms. In some cases, however, it is difficult to efficiently disrupt both paralogous genes using a single pair of TALENs in Xenopus laevis because of its polyploidy. Here, we report targeted mutagenesis of multiple and paralogous genes using two pairs of TALENs in X. laevis. First, we show simultaneous targeted mutagenesis of three genes, tyrosinase paralogues (tyra and tyrb) and enhanced green fluorescent protein (egfp) by injection of two TALENs pairs in transgenic embryos carrying egfp. Consistent with the high frequency of both severe phenotypic traits, albinism and loss of GFP fluorescence, frameshift mutation rates of tyr paralogues and egfp reached 40-80%. Next, we show early introduction of TALEN-mediated mutagenesis of these target loci during embryogenesis. Finally, we also demonstrate that two different pairs of TALENs can simultaneously introduce mutations to both paralogues encoding histone chaperone with high efficiency. Our results suggest that targeted mutagenesis of multiple genes using TALENs can be applied to analyze the functions of paralogous genes with redundancy in X. laevis.

  16. DNA methylation analysis of chromosome 21 gene promoters at single base pair and single allele resolution.

    Directory of Open Access Journals (Sweden)

    Yingying Zhang

    2009-03-01

    Full Text Available Differential DNA methylation is an essential epigenetic signal for gene regulation, development, and disease processes. We mapped DNA methylation patterns of 190 gene promoter regions on chromosome 21 using bisulfite conversion and subclone sequencing in five human cell types. A total of 28,626 subclones were sequenced at high accuracy using (long-read Sanger sequencing resulting in the measurement of the DNA methylation state of 580427 CpG sites. Our results show that average DNA methylation levels are distributed bimodally with enrichment of highly methylated and unmethylated sequences, both for amplicons and individual subclones, which represent single alleles from individual cells. Within CpG-rich sequences, DNA methylation was found to be anti-correlated with CpG dinucleotide density and GC content, and methylated CpGs are more likely to be flanked by AT-rich sequences. We observed over-representation of CpG sites in distances of 9, 18, and 27 bps in highly methylated amplicons. However, DNA sequence alone is not sufficient to predict an amplicon's DNA methylation status, since 43% of all amplicons are differentially methylated between the cell types studied here. DNA methylation in promoter regions is strongly correlated with the absence of gene expression and low levels of activating epigenetic marks like H3K4 methylation and H3K9 and K14 acetylation. Utilizing the single base pair and single allele resolution of our data, we found that i amplicons from different parts of a CpG island frequently differ in their DNA methylation level, ii methylation levels of individual cells in one tissue are very similar, and iii methylation patterns follow a relaxed site-specific distribution. Furthermore, iv we identified three cases of allele-specific DNA methylation on chromosome 21. Our data shed new light on the nature of methylation patterns in human cells, the sequence dependence of DNA methylation, and its function as epigenetic signal in gene

  17. Lethal osteogenesis imperfecta congenita and a 300 base pair gene deletion for an α1(I)-like collagen.

    NARCIS (Netherlands)

    F.M. Pope; K.S.E. Cheah (Kathryn); A.C. Nicholls; A.B. Price; F.G. Grosveld (Frank)

    1984-01-01

    textabstractBroad boned lethal osteogenesis imperfecta is a severely crippling disease of unknown cause. By means of recombinant DNA technology a 300 base pair deletion in an alpha 1(I)-like collagen gene was detected in six patients and four complete parent-child groups including patients with this

  18. Lethal osteogenesis imperfecta congenita and a 300 base pair gene deletion for an α1(I)-like collagen.

    NARCIS (Netherlands)

    F.M. Pope; K.S.E. Cheah (Kathryn); A.C. Nicholls; A.B. Price; F.G. Grosveld (Frank)

    1984-01-01

    textabstractBroad boned lethal osteogenesis imperfecta is a severely crippling disease of unknown cause. By means of recombinant DNA technology a 300 base pair deletion in an alpha 1(I)-like collagen gene was detected in six patients and four complete parent-child groups including patients with this

  19. Excision of an 11-kilobase-pair DNA element from within the nifD gene in anabaena variabilis heterocysts.

    Science.gov (United States)

    Brusca, J S; Hale, M A; Carrasco, C D; Golden, J W

    1989-01-01

    The 3' region of the Anabaena variabilis nifD gene contains an 11-kilobase-pair element which is excised from the chromosome during heterocyst differentiation. We have sequenced the recombination sites which border the element in vegetative cells and the rearranged heterocyst sequences. In vegetative cells, the element was flanked by 11-base-pair direct repeats which were identical to the repeats present at the ends of the nifD element in Anabaena sp. strain PCC 7120 (Anabaena strain 7120). Although Anabaena strain 7120 and A. variabilis are quite distinct in many ways, the overall sequence similarity between the two strains for the regions sequenced was 96%. Like the Anabaena strain 7120 element, the A. variabilis element was excised in heterocysts to produce a functional nifD gene and a free circularized element which was neither amplified nor degraded. The Anabaena strain 7120 xisA gene is located at the nifK-proximal end of the nifD element and is required for excision of the element in heterocysts. The A. variabilis element also contained an xisA gene which could complement a defective Anabaena strain 7120 xisA gene. A. variabilis did not contain the equivalent of the Anabaena strain 7120 fdxN 55-kilobase-pair element. Images PMID:2502534

  20. Gene expression profiling of lymphoblasts from autistic and nonaffected sib pairs: altered pathways in neuronal development and steroid biosynthesis.

    Science.gov (United States)

    Hu, Valerie W; Nguyen, AnhThu; Kim, Kyung Soon; Steinberg, Mara E; Sarachana, Tewarit; Scully, Michele A; Soldin, Steven J; Luu, Truong; Lee, Norman H

    2009-06-03

    Despite the identification of numerous autism susceptibility genes, the pathobiology of autism remains unknown. The present "case-control" study takes a global approach to understanding the molecular basis of autism spectrum disorders based upon large-scale gene expression profiling. DNA microarray analyses were conducted on lymphoblastoid cell lines from over 20 sib pairs in which one sibling had a diagnosis of autism and the other was not affected in order to identify biochemical and signaling pathways which are differentially regulated in cells from autistic and nonautistic siblings. Bioinformatics and gene ontological analyses of the data implicate genes which are involved in nervous system development, inflammation, and cytoskeletal organization, in addition to genes which may be relevant to gastrointestinal or other physiological symptoms often associated with autism. Moreover, the data further suggests that these processes may be modulated by cholesterol/steroid metabolism, especially at the level of androgenic hormones. Elevation of male hormones, in turn, has been suggested as a possible factor influencing susceptibility to autism, which affects approximately 4 times as many males as females. Preliminary metabolic profiling of steroid hormones in lymphoblastoid cell lines from several pairs of siblings reveals higher levels of testosterone in the autistic sibling, which is consistent with the increased expression of two genes involved in the steroidogenesis pathway. Global gene expression profiling of cultured cells from ASD probands thus serves as a window to underlying metabolic and signaling deficits that may be relevant to the pathobiology of autism.

  1. Gene expression profiling of lymphoblasts from autistic and nonaffected sib pairs: altered pathways in neuronal development and steroid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Valerie W Hu

    Full Text Available Despite the identification of numerous autism susceptibility genes, the pathobiology of autism remains unknown. The present "case-control" study takes a global approach to understanding the molecular basis of autism spectrum disorders based upon large-scale gene expression profiling. DNA microarray analyses were conducted on lymphoblastoid cell lines from over 20 sib pairs in which one sibling had a diagnosis of autism and the other was not affected in order to identify biochemical and signaling pathways which are differentially regulated in cells from autistic and nonautistic siblings. Bioinformatics and gene ontological analyses of the data implicate genes which are involved in nervous system development, inflammation, and cytoskeletal organization, in addition to genes which may be relevant to gastrointestinal or other physiological symptoms often associated with autism. Moreover, the data further suggests that these processes may be modulated by cholesterol/steroid metabolism, especially at the level of androgenic hormones. Elevation of male hormones, in turn, has been suggested as a possible factor influencing susceptibility to autism, which affects approximately 4 times as many males as females. Preliminary metabolic profiling of steroid hormones in lymphoblastoid cell lines from several pairs of siblings reveals higher levels of testosterone in the autistic sibling, which is consistent with the increased expression of two genes involved in the steroidogenesis pathway. Global gene expression profiling of cultured cells from ASD probands thus serves as a window to underlying metabolic and signaling deficits that may be relevant to the pathobiology of autism.

  2. Systems biology-guided identification of synthetic lethal gene pairs and its potential use to discover antibiotic combinations

    DEFF Research Database (Denmark)

    Aziz, Ramy K.; Monk, Jonathan M.; Lewis, R. M.

    2015-01-01

    Mathematical models of metabolism from bacterial systems biology have proven their utility across multiple fields, for example metabolic engineering, growth phenotype simulation, and biological discovery. The usefulness of the models stems from their ability to compute a link between genotype...... and phenotype, but their ability to accurately simulate gene-gene interactions has not been investigated extensively. Here we assess how accurately a metabolic model for Escherichia coli computes one particular type of gene-gene interaction, synthetic lethality, and find that the accuracy rate is between 25......% and 43%. The most common failure modes were incorrect computation of single gene essentiality and biological information that was missing from the model. Moreover, we performed virtual and biological screening against several synthetic lethal pairs to explore whether two-compound formulations could...

  3. Non-overlapped random decrement technique for parameter identification in operational modal analysis

    Science.gov (United States)

    Zhang, Y.; Song, H. W.

    2016-03-01

    The random decrement technique (RDT) is used to estimate free vibration response from output data generated by Gaussian white noise. The principle is to decay the excitation via averaging of segments in output data. With RDT, the triggering condition for determining the initial points of segments causes overlap during averaging; the consequence is a residual excitation, peaking at the first natural frequency. This paper presents a modified RDT with non-overlapped segments to eliminate this peak. Numerical comparison between non-overlapped RDT (NRDT) and RDT shows the accuracy improvement of damping. However, time history data is sometimes not long enough in NRDT, which results in an inevitable overlap. In order to keep the accuracy of NRDT, the first natural period is viewed as the critical length between adjacent initial points to distinguish the inevitable overlap from that in RDT.

  4. NACS: non-overlapping AP's caching scheme to reduce handoff in 802.11 wireless LAN

    CERN Document Server

    Tariq, Usman; Hong, Man-Pyo

    2011-01-01

    With the escalation of the IEEE 802.11 based wireless networks, voice over IP and analogous applications are also used over wireless networks. Recently, the wireless LAN systems are spaciously deployed for public Internet services. In public wireless LAN systems, reliable user authentication and mobility support are indispensable issues. When a mobile device budges out the range of one access point (AP) and endeavor to connect to new AP, it performs handoff. Contemporarily, PNC and SNC were proposed to propagate the MN context to the entire neighboring AP's on the wireless network with the help of neighbor graph. In this paper, we proposed a non-overlapping AP's caching scheme (NACS), which propagates the mobile node context to those AP's which do not overlap with the current AP. To capture the topology of non-overlapping AP's in the wireless network, non-overlapping graph (NOG) is generated at each AP. Simulation results shows that NACS reduces the signaling cost of propagating the MN context to the neighbor...

  5. Short communication: phylodynamics analysis of the human immunodeficiency virus type 1 envelope gene in mother and child pairs.

    Science.gov (United States)

    Santos, Luciane Amorim; Gray, Rebecca R; Monteiro-Cunha, Joana Paixão; Strazza, Evandra; Kashima, Simone; Santos, Edson de Souza; Araújo, Thessika Hialla Almeida; Gonçalves, Marilda de Souza; Salemi, Marco; Alcantara, Luiz Carlos Junior

    2015-09-01

    Characterizing the impact of HIV transmission routes on viral genetic diversity can improve the understanding of the mechanisms of virus evolution and adaptation. HIV vertical transmission can occur in utero, during delivery, or while breastfeeding. The present study investigated the phylodynamics of the HIV-1 env gene in mother-to-child transmission by analyzing one chronically infected pair from Brazil and three acutely infected pairs from Zambia, with three to five time points. Sequences from 25 clones from each sample were obtained and aligned using Clustal X. ML trees were constructed in PhyML using the best evolutionary model. Bayesian analyses testing the relaxed and strict molecular clock were performed using BEAST and a Bayesian Skyline Plot (BSP) was construed. The genetic variability of previously described epitopes was investigated and compared between each individual time point and between mother and child sequences. The relaxed molecular clock was the best-fitted model for all datasets. The tree topologies did not show differentiation in the evolutionary dynamics of the virus circulating in the mother from the viral population in the child. In the BSP, the effective population size was more constant in time in the chronically infected patients while in the acute patients it was possible to detect bottlenecks. The genetic variability within viral epitopes recognized by the human immune system was considerably higher among the chronically infected pair in comparison with acutely infected pairs. These results contribute to a better understanding of HIV-1 evolutionary dynamics in mother-to-child transmission.

  6. dREAM co-operates with insulator-binding proteins and regulates expression at divergently paired genes.

    Science.gov (United States)

    Korenjak, Michael; Kwon, Eunjeong; Morris, Robert T; Anderssen, Endre; Amzallag, Arnaud; Ramaswamy, Sridhar; Dyson, Nicholas J

    2014-08-01

    dREAM complexes represent the predominant form of E2F/RBF repressor complexes in Drosophila. dREAM associates with thousands of sites in the fly genome but its mechanism of action is unknown. To understand the genomic context in which dREAM acts we examined the distribution and localization of Drosophila E2F and dREAM proteins. Here we report a striking and unexpected overlap between dE2F2/dREAM sites and binding sites for the insulator-binding proteins CP190 and Beaf-32. Genetic assays show that these components functionally co-operate and chromatin immunoprecipitation experiments on mutant animals demonstrate that dE2F2 is important for association of CP190 with chromatin. dE2F2/dREAM binding sites are enriched at divergently transcribed genes, and the majority of genes upregulated by dE2F2 depletion represent the repressed half of a differentially expressed, divergently transcribed pair of genes. Analysis of mutant animals confirms that dREAM and CP190 are similarly required for transcriptional integrity at these gene pairs and suggest that dREAM functions in concert with CP190 to establish boundaries between repressed/activated genes. Consistent with the idea that dREAM co-operates with insulator-binding proteins, genomic regions bound by dREAM possess enhancer-blocking activity that depends on multiple dREAM components. These findings suggest that dREAM functions in the organization of transcriptional domains. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Biphasic Hoxd gene expression in shark paired fins reveals an ancient origin of the distal limb domain.

    Directory of Open Access Journals (Sweden)

    Renata Freitas

    Full Text Available The evolutionary transition of fins to limbs involved development of a new suite of distal skeletal structures, the digits. During tetrapod limb development, genes at the 5' end of the HoxD cluster are expressed in two spatiotemporally distinct phases. In the first phase, Hoxd9-13 are activated sequentially and form nested domains along the anteroposterior axis of the limb. This initial phase patterns the limb from its proximal limit to the middle of the forearm. Later in development, a second wave of transcription results in 5' HoxD gene expression along the distal end of the limb bud, which regulates formation of digits. Studies of zebrafish fins showed that the second phase of Hox expression does not occur, leading to the idea that the origin of digits was driven by addition of the distal Hox expression domain in the earliest tetrapods. Here we test this hypothesis by investigating Hoxd gene expression during paired fin development in the shark Scyliorhinus canicula, a member of the most basal lineage of jawed vertebrates. We report that at early stages, 5'Hoxd genes are expressed in anteroposteriorly nested patterns, consistent with the initial wave of Hoxd transcription in teleost and tetrapod paired appendages. Unexpectedly, a second phase of expression occurs at later stages of shark fin development, in which Hoxd12 and Hoxd13 are re-expressed along the distal margin of the fin buds. This second phase is similar to that observed in tetrapod limbs. The results indicate that a second, distal phase of Hoxd gene expression is not uniquely associated with tetrapod digit development, but is more likely a plesiomorphic condition present the common ancestor of chondrichthyans and osteichthyans. We propose that a temporal extension, rather than de novo activation, of Hoxd expression in the distal part of the fin may have led to the evolution of digits.

  8. Perception of the usefulness of drug/gene pairs and barriers for pharmacogenomics in Latin America.

    Science.gov (United States)

    Quinones, Luis Abel; Lavanderos, Maria Alejandra; Cayun, Juan Pablo; Garcia-Martin, Elena; Agundez, Jose Augusto; Caceres, Dante Daniel; Roco, Angela Margarita; Morales, Jorge E; Herrera, Luisa; Encina, Gonzalo; Isaza, Carlos Alberto; Redal, Maria Ana; Larovere, Laura; Soria, Nestor Walter; Eslava-Schmalbach, Javier; Castaneda-Hernandez, Gilberto; Lopez-Cortes, Andres; Magno, Luiz Alexandre; Lopez, Marisol; Chiurillo, Miguel Angel; Rodeiro, Idania; Castro de Guerra, Dinorah; Teran, Enrique; Estevez-Carrizo, Francisco; Lares-Assef, Ismael

    2014-02-01

    Pharmacogenetics and Pharmacogenomics areas are currently emerging fields focused to manage pharmacotherapy that may prevent undertreatment while avoiding associated drug toxicity in patients. Large international differences in the awareness and in the use of pharmacogenomic testing are presumed, but not well assessed to date. In the present study we review the awareness of Latin American scientific community about pharmacogenomic testing and the perceived barriers for their clinical application. In order to that, we have compiled information from 9 countries of the region using a structured survey which is compared with surveys previously performed in USA and Spain. The most relevant group of barriers was related to the need for clear guidelines for the use of pharmacogenomics in clinical practice, followed by insufficient awareness about pharmacogenomics among clinicians and the absence of regulatory institutions that facilitate the use of pharmacogenetic tests. The higher ranked pairs were TPMT/thioguanine, TPMT/azathioprine, CYP2C9/warfarin, UGT1A1/irinotecan, CYP2D6/amitriptiline, CYP2C19/citalopram and CYP2D6/clozapine. The lower ranked pairs were SLCO1B1/simvastatin, CYP2D6/metoprolol and GP6D/chloroquine. Compared with USA and Spanish surveys, 25 pairs were of lower importance for Latin American respondents. Only CYP2C19/esomeprazole, CYP2C19/omeprazole, CYP2C19/celecoxib and G6PD/dapsone were ranked higher or similarly to the USA and Spanish surveys. Integration of pharmacogenomics in clinical practice needs training of healthcare professionals and citizens, but in addition legal and regulatory guidelines and safeguards will be needed. We propose that the approach offered by pharmacogenomics should be incorporated into the decision-making plans in Latin America.

  9. Systems biology-guided identification of synthetic lethal gene pairs and its potential use to discover antibiotic combinations

    Science.gov (United States)

    Aziz, Ramy K.; Monk, Jonathan M.; Lewis, Robert M.; In Loh, Suh; Mishra, Arti; Abhay Nagle, Amrita; Satyanarayana, Chitkala; Dhakshinamoorthy, Saravanakumar; Luche, Michele; Kitchen, Douglas B.; Andrews, Kathleen A.; Fong, Nicole L.; Li, Howard J.; Palsson, Bernhard O.; Charusanti, Pep

    2015-01-01

    Mathematical models of metabolism from bacterial systems biology have proven their utility across multiple fields, for example metabolic engineering, growth phenotype simulation, and biological discovery. The usefulness of the models stems from their ability to compute a link between genotype and phenotype, but their ability to accurately simulate gene-gene interactions has not been investigated extensively. Here we assess how accurately a metabolic model for Escherichia coli computes one particular type of gene-gene interaction, synthetic lethality, and find that the accuracy rate is between 25% and 43%. The most common failure modes were incorrect computation of single gene essentiality and biological information that was missing from the model. Moreover, we performed virtual and biological screening against several synthetic lethal pairs to explore whether two-compound formulations could be found that inhibit the growth of Gram-negative bacteria. One set of molecules was identified that, depending on the concentrations, inhibits E. coli and S. enterica serovar Typhimurium in an additive or antagonistic manner. These findings pinpoint specific ways in which to improve the predictive ability of metabolic models, and highlight one potential application of systems biology to drug discovery and translational medicine. PMID:26531810

  10. Perceived Non-Overlap of Objects in an Audiovisual Stream/Bounce Display

    Directory of Open Access Journals (Sweden)

    Yousuke Kawachi

    2011-10-01

    Full Text Available In a stream/bounce display in which two identical visual objects move toward each other, coincide (completely overlap, and then move apart, the objects can be perceived as either streaming through or bouncing off each other. Despite the perceptual ambiguity in this display, the streaming percept is dominant. However, a sound burst presented at the time that the objects coincide facilitates the bouncing percept. Herein, we report a perceptual phenomenon in which the overlap between objects is illusorily perceived as a non-overlap in the stream/bounce display accompanied with sound. In the experiment, the amount of overlap between two objects was systematically manipulated in the presence/absence of a sound. Observers were asked to judge whether the two objects overlapped with each other and then asked whether the objects appeared to stream through or bounce off each other. The results were consistent with those of previous studies showing that sound promoted the bouncing percept. Most importantly, the sound presentation facilitated the perception of a non-overlap between the objects instead of a physical overlap, suggesting that the momentary overlap was inadequately perceived. We discuss the possibility that an abrupt sound temporally interrupts visual processing such as the formation of dynamic object representations.

  11. MicroRNA-34 directly targets pair-rule genes and cytoskeleton component in the honey bee

    Science.gov (United States)

    Freitas, Flávia C. P.; Pires, Camilla V.; Claudianos, Charles; Cristino, Alexandre S.; Simões, Zilá L. P.

    2017-01-01

    MicroRNAs (miRNAs) are key regulators of developmental processes, such as cell fate determination and differentiation. Previous studies showed Dicer knockdown in honeybee embryos disrupt the processing of functional mature miRNAs and impairs embryo patterning. Here we investigated the expression profiles of miRNAs in honeybee embryogenesis and the role of the highly conserved miR-34-5p in the regulation of genes involved in insect segmentation. A total of 221 miRNAs were expressed in honey bee embryogenesis among which 97 mature miRNA sequences have not been observed before. Interestingly, we observed a switch in dominance between the 5-prime and 3-prime arm of some miRNAs in different embryonic stages; however, most miRNAs present one dominant arm across all stages of embryogenesis. Our genome-wide analysis of putative miRNA-target networks and functional pathways indicates miR-34-5p is one of the most conserved and connected miRNAs associated with the regulation of genes involved in embryonic patterning and development. In addition, we experimentally validated that miR-34-5p directly interacts to regulatory elements in the 3′-untranslated regions of pair-rule (even-skipped, hairy, fushi-tarazu transcription factor 1) and cytoskeleton (actin5C) genes. Our study suggests that miR-34-5p may regulate the expression of pair-rule and cytoskeleton genes during early development and control insect segmentation. PMID:28098233

  12. De novo assembly, gene annotation and marker development using Illumina paired-end transcriptome sequences in celery (Apium graveolens L..

    Directory of Open Access Journals (Sweden)

    Nan Fu

    Full Text Available BACKGROUND: Celery is an increasing popular vegetable species, but limited transcriptome and genomic data hinder the research to it. In addition, a lack of celery molecular markers limits the process of molecular genetic breeding. High-throughput transcriptome sequencing is an efficient method to generate a large transcriptome sequence dataset for gene discovery, molecular marker development and marker-assisted selection breeding. PRINCIPAL FINDINGS: Celery transcriptomes from four tissues were sequenced using Illumina paired-end sequencing technology. De novo assembling was performed to generate a collection of 42,280 unigenes (average length of 502.6 bp that represent the first transcriptome of the species. 78.43% and 48.93% of the unigenes had significant similarity with proteins in the National Center for Biotechnology Information (NCBI non-redundant protein database (Nr and Swiss-Prot database respectively, and 10,473 (24.77% unigenes were assigned to Clusters of Orthologous Groups (COG. 21,126 (49.97% unigenes harboring Interpro domains were annotated, in which 15,409 (36.45% were assigned to Gene Ontology(GO categories. Additionally, 7,478 unigenes were mapped onto 228 pathways using the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG. Large numbers of simple sequence repeats (SSRs were indentified, and then the rate of successful amplication and polymorphism were investigated among 31 celery accessions. CONCLUSIONS: This study demonstrates the feasibility of generating a large scale of sequence information by Illumina paired-end sequencing and efficient assembling. Our results provide a valuable resource for celery research. The developed molecular markers are the foundation of further genetic linkage analysis and gene localization, and they will be essential to accelerate the process of breeding.

  13. Cognitive Functioning in Affected Sibling Pairs with ADHD: Familial Clustering and Dopamine Genes

    Science.gov (United States)

    Loo, Sandra K.; Rich, Erika Carpenter; Ishii, Janeen; McGough, James; McCracken, James; Nelson, Stanley; Smalley, Susan L.

    2008-01-01

    Background: This paper examines familiality and candidate gene associations of cognitive measures as potential endophenotypes in attention-deficit/hyperactivity disorder (ADHD). Methods: The sample consists of 540 participants, aged 6 to 18, who were diagnosed with ADHD from 251 families recruited for a larger genetic study of ADHD. All members of…

  14. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    Science.gov (United States)

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  15. Over half of breakpoints in gene pairs involved in cancer-specific recurrent translocations are mapped to human chromosomal fragile sites

    Directory of Open Access Journals (Sweden)

    Pierce Levi CT

    2009-01-01

    Full Text Available Abstract Background Gene rearrangements such as chromosomal translocations have been shown to contribute to cancer development. Human chromosomal fragile sites are regions of the genome especially prone to breakage, and have been implicated in various chromosome abnormalities found in cancer. However, there has been no comprehensive and quantitative examination of the location of fragile sites in relation to all chromosomal aberrations. Results Using up-to-date databases containing all cancer-specific recurrent translocations, we have examined 444 unique pairs of genes involved in these translocations to determine the correlation of translocation breakpoints and fragile sites in the gene pairs. We found that over half (52% of translocation breakpoints in at least one gene of these gene pairs are mapped to fragile sites. Among these, we examined the DNA sequences within and flanking three randomly selected pairs of translocation-prone genes, and found that they exhibit characteristic features of fragile DNA, with frequent AT-rich flexibility islands and the potential of forming highly stable secondary structures. Conclusion Our study is the first to examine gene pairs involved in all recurrent chromosomal translocations observed in tumor cells, and to correlate the location of more than half of breakpoints to positions of known fragile sites. These results provide strong evidence to support a causative role for fragile sites in the generation of cancer-specific chromosomal rearrangements.

  16. Correlation of global and gene-specific DNA methylation in maternal-infant pairs.

    Directory of Open Access Journals (Sweden)

    Molly L Kile

    Full Text Available The inheritance of DNA methylation patterns is a popular theory to explain the influence of parental genetic and environmental factors on the phenotype of their offspring but few studies have examined this relationship in humans. Using 120 paired maternal-umbilical cord blood samples randomly selected from a prospective birth cohort in Bangladesh, we quantified DNA methylation by pyrosequencing seven CpG positions in the promoter region of p16, four CpG positions in the promoter region of p53, LINE-1 and Alu. Positive correlations were observed between maternal and umbilical cord blood at p16, LINE-1, and Alu but not p53. Multiple linear regression models observed a significant association between maternal and umbilical cord blood at LINE-1 and Alu (LINE-1: β = 0.63, p<0.0001; Alu: β = 0.28, p = 0.009. After adjusting for multiple comparisons, maternal methylation of p16 at position 4 significantly predicted methylation at the same position in umbilical cord blood (β = 0.43, p = <0.0001. These models explained 48%, 5% and 16% of the observed variability in umbilical cord %5mC for LINE-1, Alu and p16 at position 4, respectively. These results suggest that DNA methylation in maternal blood was correlated with her offspring at LINE-1, Alu, and p16 but not p53. Additional studies are needed to confirm whether these observed associations were due to the inheritance of epigenetic events or the shared environment between mother and fetus. Future studies should also use a multi-generational family-based design that would quantify both maternal and paternal contributions to DNA methylation in offspring across more than one generation.

  17. On the convergence rate of a parallel nonoverlapping domain decomposition method

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    In recent years,a nonoverlapping domain decomposition iterative procedure,which is based on using Robin-type boundary conditions as information transmission conditions on the subdomain interfaces,has been developed and analyzed.It is known that the convergence rate of this method is 1-O(h),where h is mesh size.In this paper,the convergence rate is improved to be 1-O(h1/2 H-1/2)sometime by choosing suitable parameter,where H is the subdomain size.Counter examples are constructed to show that our convergence estimates are sharp,which means that the convergence rate cannot be better than 1-O(h1/2H-1/2)in a certain case no matter how parameter is chosen.

  18. Dynamic Principal Component Analysis with Nonoverlapping Moving Window and Its Applications to Epileptic EEG Classification

    Directory of Open Access Journals (Sweden)

    Shengkun Xie

    2014-01-01

    Full Text Available Classification of electroencephalography (EEG is the most useful diagnostic and monitoring procedure for epilepsy study. A reliable algorithm that can be easily implemented is the key to this procedure. In this paper a novel signal feature extraction method based on dynamic principal component analysis and nonoverlapping moving window is proposed. Along with this new technique, two detection methods based on extracted sparse features are applied to deal with signal classification. The obtained results demonstrated that our proposed methodologies are able to differentiate EEGs from controls and interictal for epilepsy diagnosis and to separate EEGs from interictal and ictal for seizure detection. Our approach yields high classification accuracy for both single-channel short-term EEGs and multichannel long-term EEGs. The classification performance of the method is also compared with other state-of-the-art techniques on the same datasets and the effect of signal variability on the presented methods is also studied.

  19. Dynamic principal component analysis with nonoverlapping moving window and its applications to epileptic EEG classification.

    Science.gov (United States)

    Xie, Shengkun; Krishnan, Sridhar

    2014-01-01

    Classification of electroencephalography (EEG) is the most useful diagnostic and monitoring procedure for epilepsy study. A reliable algorithm that can be easily implemented is the key to this procedure. In this paper a novel signal feature extraction method based on dynamic principal component analysis and nonoverlapping moving window is proposed. Along with this new technique, two detection methods based on extracted sparse features are applied to deal with signal classification. The obtained results demonstrated that our proposed methodologies are able to differentiate EEGs from controls and interictal for epilepsy diagnosis and to separate EEGs from interictal and ictal for seizure detection. Our approach yields high classification accuracy for both single-channel short-term EEGs and multichannel long-term EEGs. The classification performance of the method is also compared with other state-of-the-art techniques on the same datasets and the effect of signal variability on the presented methods is also studied.

  20. On the convergence rate of a parallel nonoverlapping domain decomposition method

    Institute of Scientific and Technical Information of China (English)

    QIN LiZhen; SHI ZhongCi; XU XueJun

    2008-01-01

    In recent years, a nonoverlapping domain decomposition iterative procedure, which is based on using Robin-type boundary conditions as information transmission conditions on the subdomain interfaces, has been developed and analyzed. It is known that the convergence rate of this method is 1 - O(h), where h is mesh size. In this paper, the convergence rate is improved to be 1 - O(h1/2H-1/2) sometime by choosing suitable parameter, where H is the subdomain size. Counter examples are constructed to show that our convergence estimates are sharp, which means that the convergence rate cannot be better than 1 - O(h1/2H-1/2) in a certain case no matter how parameter is chosen.

  1. FTO gene SNPs associated with extreme obesity in cases, controls and extremely discordant sister pairs

    Directory of Open Access Journals (Sweden)

    Zhao Hongyu

    2008-01-01

    Full Text Available Abstract Background FTO is a gene located in chromosome region 16q12.2. Recently two studies have found associations of several single nucleotide polymorphisms (SNPs in FTO with body mass index (BMI and obesity, particularly rs1421085, rs17817449, and rs9939609. Methods We examined these three SNPs in 583 extremely obese women with current BMI greater than 35 kg/m2 and lifetime BMI greater than 40 kg/m2, and 544 controls who were currently normal weight (BMI2 and had never been overweight during their lifetimes. Results We detected highly significant associations of obesity with alleles in all three SNPs (p -9. The strongest association was with rs1421085 (p = 3.04 × 10-10, OR = 1.75, CI = 1.47–2.08. A subset of 99 cases had extremely discordant sisters with BMI2. The discordant sisters differed in allele and genotype frequencies in parallel with the overall case and control sample. The strongest association was with rs17817449 (z = 3.57, p = 3.6 × 10-4. Conclusion These results suggest common variability in FTO is associated with increased obesity risk or resistance and may in part account for differences between closely related individuals.

  2. TMPRSS2-ERG Gene Fusion Causing ERG Overexpression Precedes Chromosome Copy Number Changes in Prostate Carcinomas, Paired HGPIN Lesions

    Directory of Open Access Journals (Sweden)

    Nuno Cerveira

    2006-10-01

    Full Text Available TMPRSS2-ETS gene fusions have been found recurrently in prostate carcinomas, but not in the presumed precursor lesion, high-grade prostatic intraepithelial neoplasia (HGPIN. However, HGPIN lesions may share chromosomal changes with prostate cancer. To determine the relative order of genetic events in prostate carcinogenesis, we have analyzed 34 prostate carcinomas, 19 paired HGPIN lesions, 14 benign prostate hyperplasias, 11 morphologically normal prostatic tissues for TMPRSS2-ERG, TMPRSS2-ETV1 rearrangements, genomic imbalances. TMPRSS2 exon 1 was fused in-frame with ERG exon 4 in 17 of 34 (50% prostate carcinomas, in 4 of 19 (21% HGPIN lesions, but in none of controls. The findings were further validated by sequencing analysis, by the real-time polymerase chain reaction quantification of TMPRSS2-ERG fusion transcript, the ERG exons 5/6:exons 1/2 expression ratio. Chromosome copy number changes were detected by comparative genomic hybridization in 42% of clinically confined carcinomas, in none of the 16 HGPIN lesions analyzed. We demonstrate for the first time that the TMPRSS2-ERG fusion gene can be detected in a proportion of HGPIN lesions, that this molecular rearrangement is an early event that may precede chromosome-level alterations in prostate carcinogenesis.

  3. Configuring compute nodes of a parallel computer in an operational group into a plurality of independent non-overlapping collective networks

    Science.gov (United States)

    Archer, Charles J.; Inglett, Todd A.; Ratterman, Joseph D.; Smith, Brian E.

    2010-03-02

    Methods, apparatus, and products are disclosed for configuring compute nodes of a parallel computer in an operational group into a plurality of independent non-overlapping collective networks, the compute nodes in the operational group connected together for data communications through a global combining network, that include: partitioning the compute nodes in the operational group into a plurality of non-overlapping subgroups; designating one compute node from each of the non-overlapping subgroups as a master node; and assigning, to the compute nodes in each of the non-overlapping subgroups, class routing instructions that organize the compute nodes in that non-overlapping subgroup as a collective network such that the master node is a physical root.

  4. A method for identification and analysis of non-overlapping myeloid immunophenotypes in humans.

    Directory of Open Access Journals (Sweden)

    Michael P Gustafson

    Full Text Available The development of flow cytometric biomarkers in human studies and clinical trials has been slowed by inconsistent sample processing, use of cell surface markers, and reporting of immunophenotypes. Additionally, the function(s of distinct cell types as biomarkers cannot be accurately defined without the proper identification of homogeneous populations. As such, we developed a method for the identification and analysis of human leukocyte populations by the use of eight 10-color flow cytometric protocols in combination with novel software analyses. This method utilizes un-manipulated biological sample preparation that allows for the direct quantitation of leukocytes and non-overlapping immunophenotypes. We specifically designed myeloid protocols that enable us to define distinct phenotypes that include mature monocytes, granulocytes, circulating dendritic cells, immature myeloid cells, and myeloid derived suppressor cells (MDSCs. We also identified CD123 as an additional distinguishing marker for the phenotypic characterization of immature LIN-CD33+HLA-DR- MDSCs. Our approach permits the comprehensive analysis of all peripheral blood leukocytes and yields data that is highly amenable for standardization across inter-laboratory comparisons for human studies.

  5. Overlapping and non-overlapping functions of condensins I and II in neural stem cell divisions.

    Directory of Open Access Journals (Sweden)

    Kenji Nishide

    2014-12-01

    Full Text Available During development of the cerebral cortex, neural stem cells (NSCs divide symmetrically to proliferate and asymmetrically to generate neurons. Although faithful segregation of mitotic chromosomes is critical for NSC divisions, its fundamental mechanism remains unclear. A class of evolutionarily conserved protein complexes, known as condensins, is thought to be central to chromosome assembly and segregation among eukaryotes. Here we report the first comprehensive genetic study of mammalian condensins, demonstrating that two different types of condensin complexes (condensins I and II are both essential for NSC divisions and survival in mice. Simultaneous depletion of both condensins leads to severe defects in chromosome assembly and segregation, which in turn cause DNA damage and trigger p53-induced apoptosis. Individual depletions of condensins I and II lead to slower loss of NSCs compared to simultaneous depletion, but they display distinct mitotic defects: chromosome missegregation was observed more prominently in NSCs depleted of condensin II, whereas mitotic delays were detectable only in condensin I-depleted NSCs. Remarkably, NSCs depleted of condensin II display hyperclustering of pericentric heterochromatin and nucleoli, indicating that condensin II, but not condensin I, plays a critical role in establishing interphase nuclear architecture. Intriguingly, these defects are taken over to postmitotic neurons. Our results demonstrate that condensins I and II have overlapping and non-overlapping functions in NSCs, and also provide evolutionary insight into intricate balancing acts of the two condensin complexes.

  6. Extrinsic calibration of a non-overlapping camera network based on close-range photogrammetry.

    Science.gov (United States)

    Dong, Shuai; Shao, Xinxing; Kang, Xin; Yang, Fujun; He, Xiaoyuan

    2016-08-10

    In this paper, an extrinsic calibration method for a non-overlapping camera network is presented based on close-range photogrammetry. The method does not require calibration targets or the cameras to be moved. The visual sensors are relatively motionless and do not see the same area at the same time. The proposed method combines the multiple cameras using some arbitrarily distributed encoded targets. The calibration procedure consists of three steps: reconstructing the three-dimensional (3D) coordinates of the encoded targets using a hand-held digital camera, performing the intrinsic calibration of the camera network, and calibrating the extrinsic parameters of each camera with only one image. A series of experiments, including 3D reconstruction, rotation, and translation, are employed to validate the proposed approach. The results show that the relative error for the 3D reconstruction is smaller than 0.003%, the relative errors of both rotation and translation are less than 0.066%, and the re-projection error is only 0.09 pixels.

  7. Protocadherin 11X/Y a human-specific gene pair: an immunohistochemical survey of fetal and adult brains.

    Science.gov (United States)

    Priddle, Thomas H; Crow, Tim J

    2013-08-01

    Protocadherins 11X and 11Y are cell adhesion molecules of the δ1-protocadherin family. Pcdh11X is present throughout the mammalian radiation; however, 6 million years ago (MYA), a reduplicative translocation of the Xq21.3 block onto what is now human Yp11 created the Homo sapiens-specific PCDH11Y. Therefore, modern human females express PCDH11X whereas males express both PCDH11X and PCDH11Y. PCDH11X/Y has been subject to accelerated evolution resulting in human-specific changes to both proteins, most notably 2 cysteine substitutions in the PCDH11X ectodomain that may alter binding characteristics. The PCDH11X/Y gene pair is postulated to be critical to aspects of human brain evolution related to the neural correlates of language. Therefore, we raised antibodies to investigate the temporal and spatial expression of PCDH11X/Y in cortical and sub-cortical areas of the human fetal brain between 12 and 34 postconceptional weeks. We then used the antibodies to determine if this expression was consistent in a series of adult brains. PCDH11X/Y immunoreactivity was detectable at all developmental stages. Strong expression was detected in the fetal neocortex, ganglionic eminences, cerebellum, and inferior olive. In the adult brain, the cerebral cortex, hippocampal formation, and cerebellum were strongly immunoreactive, with expression also detectable in the brainstem.

  8. Two maize END-1 orthologs, BETL9 and BETL9like, are transcribed in a non-overlapping spatial pattern on the outer surface of the developing endosperm

    Directory of Open Access Journals (Sweden)

    Joaquín eRoyo

    2014-05-01

    Full Text Available In the course of a project aimed to isolate transfer cells-specific genes in maize endosperm we have identified the BETL9 gene. BETL9 encodes for a small protein very similar in sequence to the product of the barley transfer cell-specific gene end-1. Both BETL9 and END-1 proteins are lipid transfer proteins, but their function is currently unknown. In situ hybridization analysis confirms that the BETL9 gene is exclusively transcribed in the basal endosperm transfer cell layer during seed development since 10 days after pollination. However, immunolocalization data indicates that the BETL9 protein accumulates in the maternal placento-chalaza cells located just beside the transfer cell layer. This suggests that the BETL9 protein should be transported to the maternal side to exert its, still unknown, function. In addition, we have identified a second maize gene very similar in sequence to BETL9 and we have named it BETL9like. In situ hybridization shows that BETL9like is also specifically transcribed in the developing maize endosperm within the same time frame that BETL9, but in this case it is exclusively expressed in the aleurone cell layer. Consequently, the BETL9 and BETL9like genes are transcribed in a non-overlapping pattern on the outer surface of the maize endosperm. The BETL9 and BETL9like promoter sequences, fused to the GUS reporter gen, accurately reflected the expression pattern observed for the genes in maize. Finally, we have identified in the Arabidopsis genome a set of four genes orthologous to BETL9 and BETL9like and analysed the activity of their promoters in Arabidopsis transgenic plants carrying fusions of their promoter sequences to the GUS reporter. As in the case of the maize genes, the Arabidopsis orthologs showed highly complementary expression patterns.

  9. Structurally distinct nicotine immunogens elicit antibodies with non-overlapping specificities

    Science.gov (United States)

    Pravetoni, M; Keyler, DE; Pidaparthi, RR; Carroll, FI; Runyon, SP; Murtaugh, MP; Earley, CA; Pentel, PR

    2011-01-01

    Nicotine conjugate vaccine efficacy is limited by the concentration of nicotine-specific antibodies that can be reliably generated in serum. Previous studies suggest that the concurrent use of 2 structurally distinct nicotine immunogens in rats can generate additive antibody responses by stimulating distinct B cell populations. In the current study we investigated whether it is possible to identify a third immunologically distinct nicotine immunogen. The new 1′-SNic immunogen (2S)-N,N′-(disulfanediyldiethane-2,1-diyl)bis[4-(2-pyridin-3-ylpyrrolidin-1-yl)butanamide] conjugated to keyhole limpet hemocyanin (KLH) differed from the existing immunogens 3′-AmNic-rEPA and 6-CMUNic-BSA in linker position, linker composition, conjugation chemistry, and carrier protein. Vaccination of rats with 1′-SNic-KLH elicited high concentrations of high affinity nicotine-specific antibodies. The antibodies produced in response to 1′-SNic-KLH did not appreciably cross-react in ELISA with either 3′-AmNic-rEPA or 6-CMUNic-BSA or vice-versa, showing that the B cell populations activated by each of these nicotine immunogens were non-overlapping and distinct. Nicotine retention in serum was increased and nicotine distribution to brain substantially reduced in rats vaccinated with 1′-SNic-KLH compared to controls. Effects of 1′-SNic-KLH on nicotine distribution were comparable to those of 3′-AmNic-rEPA which has progressed to late stage clinical trials as an adjunct to smoking cessation. These data show that it is possible to design multiple immunogens from a small molecule such as nicotine which elicit independent immune responses. This approach could be applicable to other addiction vaccines or small molecule targets as well. PMID:22100986

  10. Comparison of Patient Outcomes in 3725 Overlapping vs 3633 Nonoverlapping Neurosurgical Procedures Using a Single Institution's Clinical and Administrative Database.

    Science.gov (United States)

    Zygourakis, Corinna C; Keefe, Malla; Lee, Janelle; Barba, Julio; McDermott, Michael W; Mummaneni, Praveen V; Lawton, Michael T

    2017-02-01

    Overlapping surgery is a common practice to improve surgical efficiency, but there are limited data on its safety. To analyze the patient outcomes of overlapping vs nonoverlapping surgeries performed by multiple neurosurgeons. Retrospective review of 7358 neurosurgical procedures, 2012 to 2015, at an urban academic hospital. Collected variables: patient age, gender, insurance, American Society of Anesthesiologists score, severity of illness, mortality risk, admission type, transfer source, procedure type, surgery date, number of cosurgeons, presence of neurosurgery resident/fellow/another attending, and overlapping vs nonoverlapping surgery. Outcomes: procedure time, length of stay, estimated blood loss, discharge location, 30-day mortality, 30-day readmission, return to operating room, acute respiratory failure, and severe sepsis. Statistics: univariate, then multivariate mixed-effect models. Overlapping surgery patients (n = 3725) were younger and had lower American Society of Anesthesiologists scores, severity of illness, and mortality risk (P < .0001) than nonoverlapping surgery patients (n = 3633). Overlapping surgeries had longer procedure times (214 vs 172 min; P < .0001), but shorter length of stay (7.3 vs 7.9 d; P = .010) and lower estimated blood loss (312 vs 363 mL’s; P = .003). Overlapping surgery patients were more likely to be discharged home (73.6% vs 66.2%; P < .0001), and had lower mortality rates (1.3% vs 2.5%; P = .0005) and acute respiratory failure (1.8% vs 2.6%; P = .021). In multivariate models, there was no significant difference between overlapping and nonoverlapping surgeries for any patient outcomes, except for procedure duration, which was longer in overlapping surgery (estimate = 23.03; P < .001). When planned appropriately, overlapping surgery can be performed safely within the infrastructure at our academic institution.

  11. Gene expression analysis of peripheral blood leukocytes from discordant sib-pairs with schizophrenia and bipolar disorder reveals points of convergence between genetic and functional genomic approaches.

    Science.gov (United States)

    Middleton, Frank A; Pato, Carlos N; Gentile, Karen L; McGann, Lindsay; Brown, Andrea M; Trauzzi, Marco; Diab, Heba; Morley, Christopher P; Medeiros, Helena; Macedo, Antonio; Azevedo, M Helena; Pato, Michele T

    2005-07-05

    We performed global RNA transcript analysis and comprehensive gene group analysis of peripheral blood leukocyte (PBL) RNA from two groups of matched sib-pairs that were discordant for either schizophrenia (n = 33 sib-pairs) or bipolar disorder (n = 5 sib-pairs). The pairs chosen for these analyses were selected from families with known patterns of genetic linkage (5q for schizophrenia and 6q for bipolar disorder). At the single gene level, we obtained lists of the transcripts with the most significant changes in expression and from these lists determined those with the highest degree of predictive power for classifying subjects according to diagnosis in these samples. At the gene group level, we comprehensively analyzed pairwise expression changes of more than 4,000 functional groups and cytogenetic locations, and present a novel method of displaying these data that we term "cytogenomic" mapping. Verification of selected changes in expression was performed using quantitative real-time RT-PCR. Our results provide compelling evidence for the utility of analyzing PBL RNA for changes in expression in neuropsychiatric disorders. Copyright 2005 Wiley-Liss, Inc.

  12. Towards a clinical practice guide in pharmacogenomics testing for functional polymorphisms of drug-metabolising enzymes. Gene/drug pairs and barriers perceived in Spain.

    Directory of Open Access Journals (Sweden)

    José A G Agúndez

    2012-11-01

    Full Text Available The development of clinical practice recommendations or guidelines for the clinical use of biomarkers is an issue of great importance with regard to adverse drug reactions. The potential of pharmacogenomic biomarkers has been extensively investigated in recent years. However, several barriers to implementing the use of pharmacogenomics testing exist. We conducted a survey among members of the Spanish Societies of Pharmacology and Clinical Pharmacology to obtain information about the perception of such barriers and to compare the perceptions of participants about the relative importance of major gene/drug pairs.Of 11 potential barriers, the highest importance was attributed to lack of institutional support for pharmacogenomics testing, and to the issues related to the lack of guidelines. Of the proposed gene/drug pairs the highest importance was assigned to HLA-B/abacavir, UGT1A1/irinotecan and CYP2D6/tamoxifen. In this perspective article we compare the relative importance of 29 gene/drug pairs in the Spanish study with that of the same pairs in the American Society for Clinical Pharmacology & Therapeutics study, and we provide suggestions and areas of focus to develop a guide for clinical practice in pharmacogenomics testing.

  13. Gate current modeling and optimal design of nanoscale non-overlapped gate to source/drain MOSFET

    Institute of Scientific and Technical Information of China (English)

    Ashwani K.Rana; Narottam Chand; Vinod Kapoor

    2011-01-01

    A novel nanoscale MOSFET with a source/drain-to-gate non-overlapped and high-k spacer structure has been demonstrated to reduce the gate leakage current for the first time.The gate leakage behaviour of the novel MOSFET structure has been investigated with the help of a compact analytical model and Sentaurus simulation.A fringing gate electric field through the dielectric spacer induces an inversion layer in the non-overlap region to act as an extended S/D (source/drain) region.It is found that an optimal source/drain-to-gate non-overlapped and high-k spacer structure has reduced the gate leakage current to a great extent as compared to those of an overlapped structure.Further,the proposed structure had improved off current,subthreshold slope and drain induced barrier lowering (DIBL) characteristics.It is concluded that this structure solves the problem of high leakage current without introducing extra series resistance.

  14. Analyzing Two-Phase Single-Case Data with Non-overlap and Mean Difference Indices: Illustration, Software Tools, and Alternatives.

    Science.gov (United States)

    Manolov, Rumen; Losada, José L; Chacón-Moscoso, Salvador; Sanduvete-Chaves, Susana

    2016-01-01

    Two-phase single-case designs, including baseline evaluation followed by an intervention, represent the most clinically straightforward option for combining professional practice and research. However, unless they are part of a multiple-baseline schedule, such designs do not allow demonstrating a causal relation between the intervention and the behavior. Although the statistical options reviewed here cannot help overcoming this methodological limitation, we aim to make practitioners and applied researchers aware of the available appropriate options for extracting maximum information from the data. In the current paper, we suggest that the evaluation of behavioral change should include visual and quantitative analyses, complementing the substantive criteria regarding the practical importance of the behavioral change. Specifically, we emphasize the need to use structured criteria for visual analysis, such as the ones summarized in the What Works Clearinghouse Standards, especially if such criteria are complemented by visual aids, as illustrated here. For quantitative analysis, we focus on the non-overlap of all pairs and the slope and level change procedure, as they offer straightforward information and have shown reasonable performance. An illustration is provided of the use of these three pieces of information: visual, quantitative, and substantive. To make the use of visual and quantitative analysis feasible, open source software is referred to and demonstrated. In order to provide practitioners and applied researchers with a more complete guide, several analytical alternatives are commented on pointing out the situations (aims, data patterns) for which these are potentially useful.

  15. A COMPARATIVE ANALYSIS OF METHYLATION STATUS OF TUMOR SUPPRESSOR GENES IN PAIRED BIOPSY AND SERUM SAMPLES FROM CERVICAL CANCER PATIENTS AMONG NORTH INDIAN POPULATION.

    Science.gov (United States)

    Jha, A K; Sharma, V; Nikbakht, M; Jain, V; Sehgal, A; Capalash, N; Kaur, J

    2016-02-01

    Tumor-specific genetic or epigenetic alterations have been detected in serum DNA in case of various types of cancers. In breast cancer, the detection of tumor suppressor gene hypermethylation has been reported in several body fluids. Promoter hypermethylation of some genes like MYOD1, CALCA, hTERT etc. has also been detected in serum samples from cervical cancer. The present study is the first report on the comparison of promoter hypermethylation of tumor suppressor genes likep14, p15, p16, p21, p27, p57, p53, p73, RARβ2, FHIT, DAPK, STAT1 and-RB1 genes in paired biopsy and serum samples from cervical cancer patients among north Indian population. This is also the first report on the hypermethylation of these genes in serum samples from cervical cancer patients among north Indian population. According to the results of the present study, promoter hypermethylation of these genes can also be detected in serum samples of cervical cancer patients. The sensitivity of detection of promoter hypermethylation in serum samples of cervical cancer patients as compared to paired biopsy samples was found to be around 83.3%. It was observed that promoter hypermethylation was mainly observed in the serum samples in the higher stages and very rarely in the lower stages. The present study clearly showed that serum of patients with cervical cancer can also be used to study methylated genes as biomarkers.

  16. Power of non-parametric linkage analysis in mapping genes contributing to human longevity in long-lived sib-pairs

    DEFF Research Database (Denmark)

    Tan, Qihua; Zhao, J H; Iachine, I

    2004-01-01

    This report investigates the power issue in applying the non-parametric linkage analysis of affected sib-pairs (ASP) [Kruglyak and Lander, 1995: Am J Hum Genet 57:439-454] to localize genes that contribute to human longevity using long-lived sib-pairs. Data were simulated by introducing a recently...... developed statistical model for measuring marker-longevity associations [Yashin et al., 1999: Am J Hum Genet 65:1178-1193], enabling direct power comparison between linkage and association approaches. The non-parametric linkage (NPL) scores estimated in the region harboring the causal allele are evaluated...... in case of a dominant effect. Although the power issue may depend heavily on the true genetic nature in maintaining survival, our study suggests that results from small-scale sib-pair investigations should be referred with caution, given the complexity of human longevity....

  17. Transcriptome interrogation of human myometrium identifies differentially expressed sense-antisense pairs of protein-coding and long non-coding RNA genes in spontaneous labor at term.

    Science.gov (United States)

    Romero, Roberto; Tarca, Adi L; Chaemsaithong, Piya; Miranda, Jezid; Chaiworapongsa, Tinnakorn; Jia, Hui; Hassan, Sonia S; Kalita, Cynthia A; Cai, Juan; Yeo, Lami; Lipovich, Leonard

    2014-09-01

    To identify differentially expressed long non-coding RNA (lncRNA) genes in human myometrium in women with spontaneous labor at term. Myometrium was obtained from women undergoing cesarean deliveries who were not in labor (n = 19) and women in spontaneous labor at term (n = 20). RNA was extracted and profiled using an Illumina® microarray platform. We have used computational approaches to bound the extent of long non-coding RNA representation on this platform, and to identify co-differentially expressed and correlated pairs of long non-coding RNA genes and protein-coding genes sharing the same genomic loci. We identified co-differential expression and correlation at two genomic loci that contain coding-lncRNA gene pairs: SOCS2-AK054607 and LMCD1-NR_024065 in women in spontaneous labor at term. This co-differential expression and correlation was validated by qRT-PCR, an experimental method completely independent of the microarray analysis. Intriguingly, one of the two lncRNA genes differentially expressed in term labor had a key genomic structure element, a splice site, that lacked evolutionary conservation beyond primates. We provide, for the first time, evidence for coordinated differential expression and correlation of cis-encoded antisense lncRNAs and protein-coding genes with known as well as novel roles in pregnancy in the myometrium of women in spontaneous labor at term.

  18. Expression of human AID in yeast induces mutations in context similar to the context of somatic hypermutation at G-C pairs in immunoglobulin genes

    Directory of Open Access Journals (Sweden)

    Kunkel Thomas A

    2005-06-01

    Full Text Available Abstract Background Antibody genes are diversified by somatic hypermutation (SHM, gene conversion and class-switch recombination. All three processes are initiated by the activation-induced deaminase (AID. According to a DNA deamination model of SHM, AID converts cytosine to uracil in DNA sequences. The initial deamination of cytosine leads to mutation and recombination in pathways involving replication, DNA mismatch repair and possibly base excision repair. The DNA sequence context of mutation hotspots at G-C pairs during SHM is DGYW/WRCH (G-C is a hotspot position, R = A/G, Y = T/C, W = A/T, D = A/G/T. Results To investigate the mechanisms of AID-induced mutagenesis in a model system, we studied the genetic consequences of AID expression in yeast. We constructed a yeast vector with an artificially synthesized human AID gene insert using codons common to highly expressed yeast genes. We found that expression of the artificial hAIDSc gene was moderately mutagenic in a wild-type strain and highly mutagenic in an ung1 uracil-DNA glycosylase-deficient strain. A majority of mutations were at G-C pairs. In the ung1 strain, C-G to T-A transitions were found almost exclusively, while a mixture of transitions with 12% transversions was characteristic in the wild-type strain. In the ung1 strain mutations that could have originated from deamination of the transcribed stand were found more frequently. In the wild-type strain, the strand bias was reversed. DGYW/WRCH motifs were preferential sites of mutations. Conclusion The results are consistent with the hypothesis that AID-mediated deamination of DNA is a major cause of mutations at G-C base pairs in immunoglobulin genes during SHM. The sequence contexts of mutations in yeast induced by AID and those of somatic mutations at G-C pairs in immunoglobulin genes are significantly similar. This indicates that the intrinsic substrate specificity of AID itself is a primary determinant of mutational hotspots at G

  19. Association of ADH and ALDH Genes With Alcohol Dependence in the Irish Affected Sib Pair Study of Alcohol Dependence (IASPSAD) Sample

    Science.gov (United States)

    Kuo, Po-Hsiu; Kalsi, Gursharan; Prescott, Carol A.; Hodgkinson, Colin A.; Goldman, David; van den Oord, Edwin J.; Alexander, Jeffry; Jiang, Cizhong; Sullivan, Patrick F.; Patterson, Diana G.; Walsh, Dermot; Kendler, Kenneth S.; Riley, Brien P.

    2008-01-01

    Background: The genes coding for ethanol metabolism enzymes [alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH)] have been widely studied for their influence on the risk to develop alcohol dependence (AD). However, the relation between polymorphisms of these metabolism genes and AD in Caucasian subjects has not been clearly established. The present study examined evidence for the association of alcohol metabolism genes with AD in the Irish Affected Sib Pair Study of alcohol dependence. Methods: We conducted a case–control association study with 575 independent subjects who met Diagnostic and Statistical Manual of Mental Disorders, 4th Edition, AD diagnosis and 530 controls. A total of 77 single nucleotide polymorphisms (SNPs) in the seven ADH (ADH1-7) and two ALDH genes (ALDH1A1 and ALDH2) were genotyped using the Illumina GoldenGate protocols. Several statistical procedures were implemented to control for false discoveries. Results: All markers with minor allele frequency greater than 0.01 were in Hardy–Weinberg equilibrium. Numerous SNPs in ADH genes showed association with AD, including one marker in the coding region of ADH1C (rs1693482 in exon6, Ile271Gln). Haplotypic association was observed in the ADH5 and ADH1C genes, and in a long haplotype block formed by the ADH1A and ADH1B loci. We detected two significant interactions between pairs of markers in intron 6 of ADH6 and intron 12 of ALDH2 (p = 5 × 10−5), and 5′ of both ADH4 and ADH1A (p = 2 × 10−4). Conclusion: We found evidence for the association of several ADH genes with AD in a sample of Western European origin. The significant interaction effects between markers in ADH and ALDH genes suggest possible epistatic roles between alcohol metabolic enzymes in the risk for AD. PMID:18331377

  20. Bridging cancer biology with the clinic: relative expression of a GRHL2-mediated gene-set pair predicts breast cancer metastasis.

    Directory of Open Access Journals (Sweden)

    Xinan Yang

    Full Text Available Identification and characterization of crucial gene target(s that will allow focused therapeutics development remains a challenge. We have interrogated the putative therapeutic targets associated with the transcription factor Grainy head-like 2 (GRHL2, a critical epithelial regulatory factor. We demonstrate the possibility to define the molecular functions of critical genes in terms of their personalized expression profiles, allowing appropriate functional conclusions to be derived. A novel methodology, relative expression analysis with gene-set pairs (RXA-GSP, is designed to explore the potential clinical utility of cancer-biology discovery. Observing that Grhl2-overexpression leads to increased metastatic potential in vitro, we established a model assuming Grhl2-induced or -inhibited genes confer poor or favorable prognosis respectively for cancer metastasis. Training on public gene expression profiles of 995 breast cancer patients, this method prioritized one gene-set pair (GRHL2, CDH2, FN1, CITED2, MKI67 versus CTNNB1 and CTNNA3 from all 2717 possible gene-set pairs (GSPs. The identified GSP significantly dichotomized 295 independent patients for metastasis-free survival (log-rank tested p = 0.002; severe empirical p = 0.035. It also showed evidence of clinical prognostication in another independent 388 patients collected from three studies (log-rank tested p = 3.3e-6. This GSP is independent of most traditional prognostic indicators, and is only significantly associated with the histological grade of breast cancer (p = 0.0017, a GRHL2-associated clinical character (p = 6.8e-6, Spearman correlation, suggesting that this GSP is reflective of GRHL2-mediated events. Furthermore, a literature review indicates the therapeutic potential of the identified genes. This research demonstrates a novel strategy to integrate both biological experiments and clinical gene expression profiles for extracting and elucidating the genomic

  1. Obesity induced by a pair-fed high fat sucrose diet: methylation and expression pattern of genes related to energy homeostasis

    Directory of Open Access Journals (Sweden)

    Campión Javier

    2010-06-01

    Full Text Available Abstract Background The expression of some genes controlling energy homeostasis could be regulated by epigenetic mechanisms that may play a role in body weight regulation. Thus, it is known that various nutritional factors affect DNA methylation. In order to assess whether the macronutrient composition of the diet could be related to the epigenetic regulation of gene expression and with obesity development, we investigated the effects on methylation and expression patterns of two pair-fed isocaloric diets in rats: control (rich in starch and HFS (rich in fat and sucrose. Results The pair-fed HFS diet induced higher weight gain and adiposity as compared to the controls as well as liver triglyceride accumulation and oxidative stress. Feeding the HFS diet impaired glucose tolerance and serum triglycerides and cholesterol. Liver glucokinase expression, a key glycolytic gene, remained unaltered, as well as the mRNA values of fatty acid synthase and NADH dehydrogenase (ubiquinone 1 beta subcomplex, 6 (NDUFB6 in liver and visceral adipocytes, which regulate lipogenesis and mitochondrial oxidative metabolism, respectively. Liver expression of hydroxyacyl-coenzyme A dehydrogenase (HADHB, a key gene of β-oxidation pathway, was higher in the HFS-fed animals. However, the methylation status of CpG islands in HADHB and glucokinase genes remained unchanged after feeding the HFS diet. Conclusions These results confirm that the distribution and type of macronutrients (starch vs. sucrose, and percent of fat influence obesity onset and the associated metabolic complications. HFS diets produce obesity independently of total energy intake, although apparently no epigenetic (DNA methylation changes accompanied the modifications observed in gene expression.

  2. Obesity induced by a pair-fed high fat sucrose diet: methylation and expression pattern of genes related to energy homeostasis

    Science.gov (United States)

    2010-01-01

    Background The expression of some genes controlling energy homeostasis could be regulated by epigenetic mechanisms that may play a role in body weight regulation. Thus, it is known that various nutritional factors affect DNA methylation. In order to assess whether the macronutrient composition of the diet could be related to the epigenetic regulation of gene expression and with obesity development, we investigated the effects on methylation and expression patterns of two pair-fed isocaloric diets in rats: control (rich in starch) and HFS (rich in fat and sucrose). Results The pair-fed HFS diet induced higher weight gain and adiposity as compared to the controls as well as liver triglyceride accumulation and oxidative stress. Feeding the HFS diet impaired glucose tolerance and serum triglycerides and cholesterol. Liver glucokinase expression, a key glycolytic gene, remained unaltered, as well as the mRNA values of fatty acid synthase and NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 (NDUFB6) in liver and visceral adipocytes, which regulate lipogenesis and mitochondrial oxidative metabolism, respectively. Liver expression of hydroxyacyl-coenzyme A dehydrogenase (HADHB), a key gene of β-oxidation pathway, was higher in the HFS-fed animals. However, the methylation status of CpG islands in HADHB and glucokinase genes remained unchanged after feeding the HFS diet. Conclusions These results confirm that the distribution and type of macronutrients (starch vs. sucrose, and percent of fat) influence obesity onset and the associated metabolic complications. HFS diets produce obesity independently of total energy intake, although apparently no epigenetic (DNA methylation) changes accompanied the modifications observed in gene expression. PMID:20534152

  3. Weight gain induced by an isocaloric pair-fed high fat diet: a nutriepigenetic study on FASN and NDUFB6 gene promoters.

    Science.gov (United States)

    Lomba, Almudena; Martínez, J Alfredo; García-Díaz, Diego F; Paternain, Laura; Marti, Amelia; Campión, Javier; Milagro, Fermín I

    2010-01-01

    Experimental studies have demonstrated that dietary macronutrient distribution plays an important role in insulin regulation, a risk factor associated to obesity, diabetes and other metabolic disorders. To assess whether the macronutrient composition of the diet could be related to obesity onset by affecting the epigenetic regulation of gene expression, we investigated in rats the metabolic effects of two pair-fed isocaloric diets: control (rich in carbohydrates) and high fat diet (rich in fat; HFD). Compared to controls, HFD induced higher weight gain and adiposity and impaired glucose tolerance, which was accompanied by a slight increase in adiponectin levels and liver steatosis. Epididymal adipose tissue expression of the fatty acid synthase (FASN) gene and NADH dehydrogenase (ubiquinone) 1β-subcomplex 6 (NDUFB6) were significantly reduced in HFD group. These variations in mRNA levels were accompanied by changes in the methylation patterns of several CpG islands located in the promoter region of these genes. However, no correlations were found between gene expression and the methylation status. These results suggest that high fat intake produces overweighted rats independently of total energy intake. These diets could also induce some epigenetic changes in the promoters of key genes that could influence gene expression and may be behind metabolic alterations.

  4. CanScript, an 18-Base pair DNA sequence, boosts tumor cell-specific promoter activity: implications for targeted gene therapy.

    Science.gov (United States)

    Huang, Yu-Hung; Cozzitorto, Joseph A; Richards, Nathan G; Eltoukhy, Ahmed A; Yeo, Charles J; Langer, Robert; Anderson, Daniel G; Brody, Jonathan R; Sawicki, Janet A

    2010-11-01

    Gene therapy protocols for the treatment of cancer often employ gene promoter sequences that are known to be over-expressed in specific tumor cell types relative to normal cells. These promoters, while specific, are often weakly active. It would be desirable to increase the activity of such promoters, while at the same time retain specificity, so that the therapeutic gene is more robustly expressed. Using a luciferase reporter DNA construct in both in vitro cell transfection assays and in vivo mouse tumor models, we have determined that in the absence of any other DNA sequence, a previously identified 18-base pair enhancer sequence called CanScript, lying upstream of the MSLN gene, has ~25% of the promoter activity of CAG, a very strong non-specific promoter/enhancer, in tumor cells in which MSLN is highly expressed. Furthermore, tandem repeat copies of CanScript enhance transcription in a dose-dependent manner and, when coupled with promoter sequences that are active in tumor cells, increase promoter activity. These findings suggest that the incorporation of CanScript into gene constructs may have application in enhancing activity of promoters used in cancer-targeting gene therapy strategies, thereby improving therapeutic efficacy.

  5. The protocadherin 11X/Y (PCDH11X/Y) gene pair as determinant of cerebral asymmetry in modern Homo sapiens.

    Science.gov (United States)

    Priddle, Thomas H; Crow, Timothy J

    2013-06-01

    Annett's right-shift theory proposes that human cerebral dominance (the functional and anatomical asymmetry or torque along the antero-posterior axis) and handedness are determined by a single "right-shift" gene. Familial transmission of handedness and specific deviations of cerebral dominance in sex chromosome aneuploidies implicate a locus within an X-Y homologous region of the sex chromosomes. The Xq21.3/Yp11.2 human-specific region of homology includes the protocadherin 11X/Y (PCDH11X/Y) gene pair, which encode cell adhesion molecules subject to accelerated evolution following the separation of the human and chimpanzee lineages six million years ago. PCDH11X and PCDH11Y, differentially regulated by retinoic acid, are highly expressed in the ventricular zone, subplate, and cortical plate of the developing cerebral cortex. Both proteins interact with β-catenin, a protein that plays a role in determining axis formation and regulating cortical size. In this way, the PCDH11X/Y gene pair determines cerebral asymmetry by initiating the right shift in Homo sapiens.

  6. A pair of two-component regulatory genes ecrA1/A2 in S. coelicolor

    Institute of Scientific and Technical Information of China (English)

    李永泉; 岑沛霖; 陈时飞; 吴凡; 郑静

    2004-01-01

    Two-component genes are kinds of genetic elements involved in regulation of antibiotic production in Streptomyces coelicolor. DNA microarray analysis revealed that ecrA1/A2, which mapped at distant sites from red locus and encode respectively the kinase and regulator, expressed coordinately with genes of Red specific biosynthetic pathway, ecrA1 and ecrA2 gene-disruptive mutants were constructed using homogenotisation by reciprocal double crossover. Fermentation data showed that the undecylprodigiosin (Red) level of production was lower than that of wild-type strain. However, the change of the actinorhodin (Act) production level was not significant compared with wild type. Thus, these experiment results confirmed that the two-component system ecrA 1/A2 was positive regulatory element for red gene cluster.

  7. A pair of two-component regulatory genes ecrA1/A2 in S.coelicolor

    Institute of Scientific and Technical Information of China (English)

    李永泉; 岑沛霖; 陈时飞; 吴丹; 郑静

    2004-01-01

    Two-component genes are kinds of genetic elements involved in regulation of antibiotic production in Streptomyces coelicolor. DNA microarray analysis revealed that ecrA1/A2, which mapped at distant sites from red locus and encode respectively the kinase and regulator, expressed coordinately with genes of Red specific biosynthetic pathway, ecrA1 and ecrA2 gene-disruptive mutants were constructed using homogenotisation by reciprocal double crossover. Fermentation data showed that the undecylprodigiosin (Red) level of production was lower than that of wild-type strain. However, the change of the actinorhodin (Act) production level was not significant compared with wild type. Thus, these experiment results confirmed that the two-component system ecrA 1/A2 was positive regulatory element for red gene cluster.

  8. Gene Expression Profiles in Paired Gingival Biopsies from Periodontitis-Affected and Healthy Tissues Revealed by Massively Parallel Sequencing

    Science.gov (United States)

    Båge, Tove; Lagervall, Maria; Jansson, Leif; Lundeberg, Joakim; Yucel-Lindberg, Tülay

    2012-01-01

    Periodontitis is a chronic inflammatory disease affecting the soft tissue and bone that surrounds the teeth. Despite extensive research, distinctive genes responsible for the disease have not been identified. The objective of this study was to elucidate transcriptome changes in periodontitis, by investigating gene expression profiles in gingival tissue obtained from periodontitis-affected and healthy gingiva from the same patient, using RNA-sequencing. Gingival biopsies were obtained from a disease-affected and a healthy site from each of 10 individuals diagnosed with periodontitis. Enrichment analysis performed among uniquely expressed genes for the periodontitis-affected and healthy tissues revealed several regulated pathways indicative of inflammation for the periodontitis-affected condition. Hierarchical clustering of the sequenced biopsies demonstrated clustering according to the degree of inflammation, as observed histologically in the biopsies, rather than clustering at the individual level. Among the top 50 upregulated genes in periodontitis-affected tissues, we investigated two genes which have not previously been demonstrated to be involved in periodontitis. These included interferon regulatory factor 4 and chemokine (C-C motif) ligand 18, which were also expressed at the protein level in gingival biopsies from patients with periodontitis. In conclusion, this study provides a first step towards a quantitative comprehensive insight into the transcriptome changes in periodontitis. We demonstrate for the first time site-specific local variation in gene expression profiles of periodontitis-affected and healthy tissues obtained from patients with periodontitis, using RNA-seq. Further, we have identified novel genes expressed in periodontitis tissues, which may constitute potential therapeutic targets for future treatment strategies of periodontitis. PMID:23029519

  9. Computer-aided codon-pairs deoptimization of the major envelope GP5 gene attenuates porcine reproductive and respiratory syndrome virus.

    Science.gov (United States)

    Ni, Yan-Yan; Zhao, Zhao; Opriessnig, Tanja; Subramaniam, Sakthivel; Zhou, Lei; Cao, Dianjun; Cao, Qian; Yang, Hanchun; Meng, Xiang-Jin

    2014-02-01

    Synthetic attenuated virus engineering (SAVE) is an emerging technology that enables rapid attenuation of viruses. In this study, by using SAVE we demonstrated rapid attenuation of an arterivirus, porcine reproductive and respiratory syndrome virus (PRRSV). The major envelope GP5 gene of PRRSV was codon-pair deoptimized aided by a computer algorithm. The codon-pair deoptimized virus, designated as SAVE5 with a deoptimized GP5 gene, was successfully rescued in vitro. The SAVE5 virus replicated at a lower level in vitro with a significant decrease of GP5 protein expression compared to the wild-type PRRSV VR2385 virus. Pigs experimentally infected with the SAVE5 virus had significantly lower viremia level up to 14 days post-infection as well as significantly reduced gross and histological lung lesions when compared to wild-type PRRSV VR2385 virus-infected pigs, indicating the attenuation of the SAVE5 virus. This study proved the feasibility of rapidly attenuating PRRSV by SAVE.

  10. Overlapping and non-overlapping brain regions for theory of mind and self reflection in individual subjects.

    Science.gov (United States)

    Saxe, Rebecca; Moran, Joseph M; Scholz, Jonathan; Gabrieli, John

    2006-12-01

    When subjects are required to reason about someone's false belief, a consistent pattern of brain regions are recruited including the medial prefrontal cortex, medial precuneus and bilateral temporo-parietal junction. Previous group analyses suggest that the two medial regions, but not the lateral regions, are also recruited when subjects engage in self-reflection. The current study directly compared the results of the 'false belief' and 'self' tasks in individual subjects. Consistent with previous reports, the medial prefrontal and medial precuneus regions recruited by the two tasks significantly overlap in individual subjects, although there was also evidence for non-overlapping voxels in medial regions. The temporo-parietal regions are only recruited for the 'theory of mind' task. Six possible models of the relationship between theory of mind, self-reflection and autobiographical memory, all consistent with both neurobiological and developmental evidence to date, are discussed.

  11. Rapid pair-wise synteny analysis of large bacterial genomes using web-based GeneOrder4.0

    Directory of Open Access Journals (Sweden)

    Mahadevan Padmanabhan

    2010-02-01

    Full Text Available Abstract Background The growing whole genome sequence databases necessitate the development of user-friendly software tools to mine these data. Web-based tools are particularly useful to wet-bench biologists as they enable platform-independent analysis of sequence data, without having to perform complex programming tasks and software compiling. Findings GeneOrder4.0 is a web-based "on-the-fly" synteny and gene order analysis tool for comparative bacterial genomics (ca. 8 Mb. It enables the visualization of synteny by plotting protein similarity scores between two genomes and it also provides visual annotation of "hypothetical" proteins from older archived genomes based on more recent annotations. Conclusions The web-based software tool GeneOrder4.0 is a user-friendly application that has been updated to allow the rapid analysis of synteny and gene order in large bacterial genomes. It is developed with the wet-bench researcher in mind.

  12. Germline cell death is inhibited by P-element insertions disrupting the dcp-1/pita nested gene pair in Drosophila.

    Science.gov (United States)

    Laundrie, Bonni; Peterson, Jeanne S; Baum, Jason S; Chang, Jeffrey C; Fileppo, Dana; Thompson, Sharona R; McCall, Kimberly

    2003-12-01

    Germline cell death in Drosophila oogenesis is controlled by distinct signals. The death of nurse cells in late oogenesis is developmentally regulated, whereas the death of egg chambers during mid-oogenesis is induced by environmental stress or developmental abnormalities. P-element insertions in the caspase gene dcp-1 disrupt both dcp-1 and the outlying gene, pita, leading to lethality and defective nurse cell death in late oogenesis. By isolating single mutations in the two genes, we have found that the loss of both genes contributes to this ovary phenotype. Mutants of pita, which encodes a C2H2 zinc-finger protein, are homozygous lethal and show dumpless egg chambers and premature nurse cell death in germline clones. Early nurse cell death is not observed in the dcp-1/pita double mutants, suggesting that dcp-1+ activity is required for the mid-oogenesis cell death seen in pita mutants. dcp-1 mutants are viable and nurse cell death in late oogenesis occurs normally. However, starvation-induced germline cell death during mid-oogenesis is blocked, leading to a reduction and inappropriate nuclear localization of the active caspase Drice. These findings suggest that the combinatorial loss of pita and dcp-1 leads to the increased survival of abnormal egg chambers in mutants bearing the P-element alleles and that dcp-1 is essential for cell death during mid-oogenesis.

  13. Meiotic pairing and gene expression disturbance in germ cells from an infertile boar with a balanced reciprocal autosome-autosome translocation.

    Science.gov (United States)

    Barasc, Harmonie; Congras, Annabelle; Mary, Nicolas; Trouilh, Lidwine; Marquet, Valentine; Ferchaud, Stéphane; Raymond-Letron, Isabelle; Calgaro, Anne; Loustau-Dudez, Anne-Marie; Mouney-Bonnet, Nathalie; Acloque, Hervé; Ducos, Alain; Pinton, Alain

    2016-12-01

    Individuals carrying balanced constitutional reciprocal translocations generally have a normal phenotype, but often present reproductive disorders. The aim of our research was to analyze the meiotic process in an oligoasthenoteratospermic boar carrying an asymmetric reciprocal translocation involving chromosomes 1 and 14. Different multivalent structures (quadrivalent and trivalent plus univalent) were identified during chromosome pairing analysis. Some of these multivalents were characterized by the presence of unpaired autosomal segments with histone γH2AX accumulation sometimes associated with the XY body. Gene expression in spermatocytes was studied by RNA-DNA-FISH and microarray-based testis transcriptome analysis. Our results revealed a decrease in gene expression for chromosomes 1 and 14 and an up-regulated expression of X-chromosome genes for the translocated boar compared with normal individuals. We hypothesized that the observed meiotic arrest and reproductive failure in this boar might be due to silencing of crucial autosomal genes (MSUC) and disturbance of meiotic sex chromosome inactivation (MSCI). Further analysis revealed abnormal meiotic recombination (frequency and distribution) and the production of a high rate of unbalanced spermatozoa.

  14. A sib-pair analysis study of 15 candidate genes in French families with morbid obesity: indication for linkage with islet 1 locus on chromosome 5q.

    Science.gov (United States)

    Clément, K; Dina, C; Basdevant, A; Chastang, N; Pelloux, V; Lahlou, N; Berlan, M; Langin, D; Guy-Grand, B; Froguel, P

    1999-02-01

    As part of an ongoing search for susceptibility genes in obese families, we performed linkage analyses in 101 French families between qualitative and quantitative traits related to morbid obesity and polymorphisms located in or near 15 candidate genes whose products are involved in body weight regulation. These included cholecystokinin A and B receptors (CCK-AR and CCK-BR), glucagon-like peptide 1 receptor (GLP-1R), the LIM/homeodomain islet-1 gene (Isl-1), the caudal-type homeodomain 3 (CDX-3), the uncoupling protein 1 (UCP-1), the beta3-adrenoceptor (beta3-AR), the fatty acid-binding protein 2 (FABP-2), the hormone-sensitive lipase (HSL), the lipoprotein lipase (LPL), the apoprotein-C2 (apo-C2), the insulin receptor substrate-1 (IRS-1), the peroxisome proliferator-activated receptor-gamma (PPAR-gamma), tumor necrosis factor-alpha (TNF-alpha), and the liver carnitine palmitoyltransferase-1 (CPT-1). Phenotypes related to obesity such as BMI, adult life body weight gain, fasting leptin, insulin, fasting glycerol, and free fatty acids were used for nonparametric sib-pair analyses. A weak indication for linkage was obtained between the Isl-1 locus and obesity status defined by a z score over one SD of BMI (n = 226 sib pairs, pi = 0.54 +/- 0.02, P = 0.03). Moreover, a suggestive indication for linkage was found between the Isl-1 locus and BMI and leptin values (P = 0.001 and 0.0003, respectively) and leptin adjusted for BMI (P = 0.0001). Multipoint analyses for leptin trait with Isl-1 and two flanking markers (D5S418 and D5S407) showed that the logarithm of odds (LOD) score is 1.73, coinciding with the Isl-1 locus. Although marginally positive indications for linkage in subgroups of families were found with IRS-1, CPT-1, and HSL loci, our data suggested that these genes are not major contributors to obesity. Whether an obesity susceptibility gene (Isl-1 itself or another nearby gene) lies on chromosome 5q should be determined by further analyses.

  15. Microphthalmia in Texel sheep is associated with a missense mutation in the paired-like homeodomain 3 (PITX3) gene.

    Science.gov (United States)

    Becker, Doreen; Tetens, Jens; Brunner, Adrian; Bürstel, Daniela; Ganter, Martin; Kijas, James; Drögemüller, Cord

    2010-01-13

    Microphthalmia in sheep is an autosomal recessive inherited congenital anomaly found within the Texel breed. It is characterized by extremely small or absent eyes and affected lambs are absolutely blind. For the first time, we use a genome-wide ovine SNP array for positional cloning of a Mendelian trait in sheep. Genotyping 23 cases and 23 controls using Illumina's OvineSNP50 BeadChip allowed us to localize the causative mutation for microphthalmia to a 2.4 Mb interval on sheep chromosome 22 by association and homozygosity mapping. The PITX3 gene is located within this interval and encodes a homeodomain-containing transcription factor involved in vertebrate lens formation. An abnormal development of the lens vesicle was shown to be the primary event in ovine microphthalmia. Therefore, we considered PITX3 a positional and functional candidate gene. An ovine BAC clone was sequenced, and after full-length cDNA cloning the PITX3 gene was annotated. Here we show that the ovine microphthalmia phenotype is perfectly associated with a missense mutation (c.338G>C, p.R113P) in the evolutionary conserved homeodomain of PITX3. Selection against this candidate causative mutation can now be used to eliminate microphthalmia from Texel sheep in production systems. Furthermore, the identification of a naturally occurring PITX3 mutation offers the opportunity to use the Texel as a genetically characterized large animal model for human microphthalmia.

  16. Microphthalmia in Texel sheep is associated with a missense mutation in the paired-like homeodomain 3 (PITX3 gene.

    Directory of Open Access Journals (Sweden)

    Doreen Becker

    Full Text Available Microphthalmia in sheep is an autosomal recessive inherited congenital anomaly found within the Texel breed. It is characterized by extremely small or absent eyes and affected lambs are absolutely blind. For the first time, we use a genome-wide ovine SNP array for positional cloning of a Mendelian trait in sheep. Genotyping 23 cases and 23 controls using Illumina's OvineSNP50 BeadChip allowed us to localize the causative mutation for microphthalmia to a 2.4 Mb interval on sheep chromosome 22 by association and homozygosity mapping. The PITX3 gene is located within this interval and encodes a homeodomain-containing transcription factor involved in vertebrate lens formation. An abnormal development of the lens vesicle was shown to be the primary event in ovine microphthalmia. Therefore, we considered PITX3 a positional and functional candidate gene. An ovine BAC clone was sequenced, and after full-length cDNA cloning the PITX3 gene was annotated. Here we show that the ovine microphthalmia phenotype is perfectly associated with a missense mutation (c.338G>C, p.R113P in the evolutionary conserved homeodomain of PITX3. Selection against this candidate causative mutation can now be used to eliminate microphthalmia from Texel sheep in production systems. Furthermore, the identification of a naturally occurring PITX3 mutation offers the opportunity to use the Texel as a genetically characterized large animal model for human microphthalmia.

  17. Atrophic dermatofibrosarcoma protuberans with the fusion gene COL1A1-PDGFB detected by RT-PCR using only a single primer pair.

    Science.gov (United States)

    Xu, Wen-Jun; Wang, Ju-Sheng

    2015-01-01

    Dermatofibrosarcoma protuberans (DFSPs) is an uncommon dermal tumor of intermediate to low-grade malignancy. A few patients have clinically persistent plaques that might be atrophic, and they are difficult to be diagnosed clinically. With the development of cytogenetic and molecular biology techniques, the detection of fusion transcripts of the collagen type 1a1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes has been recognized as a reliable and valuable molecular tool for the diagnosis of DFSPs. We reported a 24-year-old woman who had a 2 years history of atrophic DFSPs, and detected the gene fusion between COL1A1 to PDGFB by one-step method of RT-PCR using only a single primer pair. The gene fusion detected by this rapid and efficient one-step method in our patient appears to be the first report of atrophic DFSPs, and we detected a novel COL1A1 breakpoint between exon 2 and exon 3.

  18. Activity-regulated gene expression in immature neurons in the dentate gyrus following re-exposure to a cocaine-paired environment.

    Science.gov (United States)

    Barr, Jeffrey L; Unterwald, Ellen M

    2015-03-01

    Intense craving for drug and relapse are observed in addicts who are exposed to environmental stimuli associated with drug-taking behavior even after long periods of abstinence. The hippocampus is a brain region known to be involved in contextual processing, taking place predominantly in the septal hippocampus, and emotional processing, taking place predominantly in the temporal hippocampus. Conditioned place preference is an animal model of context-conditioned reward. The dentate gyrus is a hippocampal sub-region particularly important for the acquisition of cocaine-induced place preference and is a site of continuous neurogenesis, which has been implicated in the vulnerability to drug-taking behavior. Therefore, these experiments explored the role of newly generated neurons in drug reward-context association by examining the activation, as determined by expression of the immediate early gene cfos, of young and mature granule cells in the septal and temporal dentate gyrus of adult rats that were re-exposed to a drug-paired environment following the development of cocaine place preference. The overall level of cfos expression was increased in both the septal and temporal dentate gyrus of animals that developed place preference and were re-exposed to the drug paired environment compared with re-exposure to a neutral environment. Overall level of neurogenesis, as detected by the S-phase marker 5'-bromo-2'-deoxyuridine (BrdU) and the immature neuron marker doublecortin (DCX), was unaltered by cocaine conditioning. However, the number of activated new neurons (DCX + cfos) was greater in the temporal dentate gyrus of cocaine-conditioned rats re-exposed to the drug-paired environment as compared to those re-exposed to a neutral environment. Further understanding of the role of dentate gyrus neurogenesis on the conditioned effects of drugs of abuse may provide new insights into the role of this process in the expression of addictive behaviors. © 2014 Wiley

  19. Non-overlapping progesterone receptor cistromes contribute to cell-specific transcriptional outcomes.

    Directory of Open Access Journals (Sweden)

    Christine L Clarke

    Full Text Available The transcriptional effects of the ovarian hormone progesterone are pleiotropic, and binding to DNA of the nuclear progesterone receptor (PR, a ligand-activated transcription factor, results in diverse outcomes in a range of target tissues. To determine whether distinct patterns of genomic interaction of PR contribute to the cell specificity of the PR transcriptome, we have compared the genomic binding sites for PR in breast cancer cells and immortalized normal breast cells. PR binding was correlated with transcriptional outcome in both cell lines, with 60% of progestin-regulated genes associated with one or more PR binding regions. There was a remarkably low overlap between the PR cistromes of the two cell lines, and a similarly low overlap in transcriptional targets. A conserved PR binding element was identified in PR binding regions from both cell lines, but there were distinct patterns of enrichment of known cofactor binding motifs, with FOXA1 sites over-represented in breast cancer cell binding regions and NF1 and AP-1 motifs uniquely enriched in the immortalized normal line. Downstream analyses suggested that differential cofactor availability may generate these distinct PR cistromes, indicating that cofactor levels may modulate PR specificity. Taken together these data suggest that cell-specificity of PR binding is determined by the coordinated effects of key binding cofactors.

  20. Light and auxin responsive cytochrome P450s from Withania somnifera Dunal: cloning, expression and molecular modelling of two pairs of homologue genes with differential regulation.

    Science.gov (United States)

    Srivastava, Sudhakar; Sangwan, Rajender Singh; Tripathi, Sandhya; Mishra, Bhawana; Narnoliya, L K; Misra, L N; Sangwan, Neelam S

    2015-11-01

    Cytochrome P450s (CYPs) catalyse a wide variety of oxygenation/hydroxylation reactions that facilitate diverse metabolic functions in plants. Specific CYP families are essential for the biosynthesis of species-specialized metabolites. Therefore, we investigated the role of different CYPs related to secondary metabolism in Withania somnifera, a medicinally important plant of the Indian subcontinent. In this study, complete complementary DNAs (cDNAs) of four different CYP genes were isolated and christened as WSCYP93Id, WSCYP93Sm, WSCYP734B and WSCYP734R. These cDNAs encoded polypeptides comprising of 498, 496, 522 and 550 amino acid residues with their deduced molecular mass of 56.7, 56.9, 59.4 and 62.2 kDa, respectively. Phylogenetic study and molecular modelling analysis of the four cloned WSCYPs revealed their categorization into two CYP families (CYP83B1 and CYP734A1) belonging to CYP71 and CYP72 clans, respectively. BLASTp searches showed similarity of 75 and 56 %, respectively, between the two CYP members of CYP83B1 and CYP734A1 with major variances exhibited in their N-terminal regions. The two pairs of homologues exhibited differential expression profiles in the leaf tissues of selected chemotypes of W. somnifera as well as in response to treatments such as methyl jasmonate, wounding, light and auxin. Light and auxin regulated two pairs of WSCYP homologues in a developing seedling in an interesting differential manner. Their lesser resemblance and homology with other CYP sequences suggested these genes to be more specialized and distinct ones. The results on chemotype-specific expression patterns of the four genes strongly suggested their key/specialized involvement of the CYPs in the biosynthesis of chemotype-specific metabolites, though their further biochemical characterization would reveal the specificity in more detail. It is revealed that WSCYP93Id and WSCYP93Sm may be broadly involved in the oxygenation reactions in the plant and, thereby, control

  1. Association Between Interleukin 4 Gene Seventy-Base-Pair Variable Number of Tandem Repeats Polymorphism and Uterine Leiomyoma

    Directory of Open Access Journals (Sweden)

    Salimi

    2014-06-01

    Full Text Available Background Uterine Leiomyoma (UL is the most common gynecological tumor and a public health problem. Higher serum interleukin 4 (IL-4 level, as an anti-inflammatory cytokine that regulates TH1/TH2 cells balance, has been observed in the uterine cavity. Objectives The aim of this study was to investigate the association between IL4 gene variable number of tandem repeats (VNTR polymorphism and the risk of UL in southeast of Iran. Patients and Methods We compared of 99 patients with UL with that of 102 healthy controls. The IL4 VNTR polymorphism was genotyped by gel electrophoresis after PCR amplification. Results There was no significant association between RP*1/RP*2 and RP*2/RP*2 genotypes and UL; however, a significant association between RP*2/RP*2 genotype and UL was found after adjustment for age (OR, 4; 95% CI, 1.3-12.4; and P = 0.015. The frequency of RP*2 allele was significantly higher in women with UL (OR, 1.9; 95% CI, 1.1-3.5; and P = 0.03. Conclusions The IL4 VNTR RP*2/RP*2 genotype could be an age-related risk factor for UL. Moreover, the frequency of RP*2 allele was significantly higher in women with UL.

  2. Inactivation of the cluster of rRNA genes in the second chromosomal pair of the Aleutian mink

    Energy Technology Data Exchange (ETDEWEB)

    Grafodatskii, A.S.; Lushnikova, T.P.; Vorob' eva, N.V.

    1985-11-01

    The authors present the results of their in situ mapping of the RNA genes in the chromosomes of Aleutian mink. The ribosomal RNA was extracted from the mink liver and analyzed electrophoretically. The 28S and 18S rRNA fractions were separated in 5-25% sucrose gradient containing 10 mM Tris-HCl, pH 7.4, 1.0 mM EDTA, and 100 mM NaCl. Centrifugation was done at 2/sup 0/C for 20 h in rotor SW-27 at 21,000 rpm. The 18S rRNA was used to synthesize cDNA in the system of RNA-dependent DNA polymerase of Escherichia coli with the exception that the template concentration was raised to 40 micrograms/ml and that of enzyme to 1080 units of activity/ml. The electrophoretic analysis in polyacrylamide gel with formamide showed that the size of /sup 3/H-cDNA was 4-10S. Specific radioactivity was 10/sup 8/ disintegrations min x microgram. Hybridization on the chromosomal preparations was done by the method described earlier. /sup 3/H-cDNA of the 18S mink RNA was applied to the preparation at the concentration of 0.05 micrograms/ml and hybridized in 3 x SSC for 24 h at 65/sup 0/C. The preparations were covered with photoemulsion type M and exposed for 4 months. The chromosomal preparations were made from the bone marrow cells by the standard method. The silver-staining of the nucleolus organizing regions (NOR) was done by the method of Bloom and Goodpasture.

  3. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  4. The Wnt and Delta-Notch signalling pathways interact to direct pair-rule gene expression via caudal during segment addition in the spider Parasteatoda tepidariorum.

    Science.gov (United States)

    Schönauer, Anna; Paese, Christian L B; Hilbrant, Maarten; Leite, Daniel J; Schwager, Evelyn E; Feitosa, Natália Martins; Eibner, Cornelius; Damen, Wim G M; McGregor, Alistair P

    2016-07-01

    In short-germ arthropods, posterior segments are added sequentially from a segment addition zone (SAZ) during embryogenesis. Studies in spiders such as Parasteatoda tepidariorum have provided insights into the gene regulatory network (GRN) underlying segment addition, and revealed that Wnt8 is required for dynamic Delta (Dl) expression associated with the formation of new segments. However, it remains unclear how these pathways interact during SAZ formation and segment addition. Here, we show that Delta-Notch signalling is required for Wnt8 expression in posterior SAZ cells, but represses the expression of this Wnt gene in anterior SAZ cells. We also found that these two signalling pathways are required for the expression of the spider orthologues of even-skipped (eve) and runt-1 (run-1), at least in part via caudal (cad). Moreover, it appears that dynamic expression of eve in this spider does not require a feedback loop with run-1, as is found in the pair-rule circuit of the beetle Tribolium Taken together, our results suggest that the development of posterior segments in Parasteatoda is directed by dynamic interactions between Wnt8 and Delta-Notch signalling that are read out by cad, which is necessary but probably not sufficient to regulate the expression of eve and run-1 Our study therefore provides new insights towards better understanding the evolution and developmental regulation of segmentation in other arthropods, including insects.

  5. An Improved Hybrid Genetic Algorithm for Chemical Plant Layout Optimization with Novel Non-overlapping and Toxic Gas Dispersion Constraints

    Institute of Scientific and Technical Information of China (English)

    XU Yuan; WANG Zhenyu; ZHU Qunxiong

    2013-01-01

    New approaches for facility distribution in chemical plants are proposed including an improved non-overlapping constraint based on projection relationships of facilities and a novel toxic gas dispersion constraint.In consideration of the large number of variables in the plant layout model,our new method can significantly reduce the number of variables with their own projection relationships.Also,as toxic gas dispersion is a usual incident in a chemical plant,a simple approach to describe the gas leakage is proposed,which can clearly represent the constraints of potential emission source and sitting facilities.For solving the plant layout model,an improved genetic algorithm (GA) based on infeasible solution fix technique is proposed,which improves the globe search ability of GA.The case study and experiment show that a better layout plan can be obtained with our method,and the safety factors such as gas dispersion and minimum distances can be well handled in the solution.

  6. A one base pair deletion in the canine ATP13A2 gene causes exon skipping and late-onset neuronal ceroid lipofuscinosis in the Tibetan terrier.

    Directory of Open Access Journals (Sweden)

    Anne Wöhlke

    2011-10-01

    Full Text Available Neuronal ceroid lipofuscinosis (NCL is a progressive neurodegenerative disease characterized by brain and retinal atrophy and the intracellular accumulation of autofluorescent lysosomal storage bodies resembling lipofuscin in neurons and other cells. Tibetan terriers show a late-onset lethal form of NCL manifesting first visible signs at 5-7 years of age. Genome-wide association analyses for 12 Tibetan-terrier-NCL-cases and 7 Tibetan-terrier controls using the 127K canine Affymetrix SNP chip and mixed model analysis mapped NCL to dog chromosome (CFA 2 at 83.71-84.72 Mb. Multipoint linkage and association analyses in 376 Tibetan terriers confirmed this genomic region on CFA2. A mutation analysis for 14 positional candidate genes in two NCL-cases and one control revealed a strongly associated single nucleotide polymorphism (SNP in the MAPK PM20/PM21 gene and a perfectly with NCL associated single base pair deletion (c.1620delG within exon 16 of the ATP13A2 gene. The c.1620delG mutation in ATP13A2 causes skipping of exon 16 presumably due to a broken exonic splicing enhancer motif. As a result of this mutation, ATP13A2 lacks 69 amino acids. All known 24 NCL cases were homozygous for this deletion and all obligate 35 NCL-carriers were heterozygous. In a sample of 144 dogs from eleven other breeds, the c.1620delG mutation could not be found. Knowledge of the causative mutation for late-onset NCL in Tibetan terrier allows genetic testing of these dogs to avoid matings of carrier animals. ATP13A2 mutations have been described in familial Parkinson syndrome (PARK9. Tibetan terriers with these mutations provide a valuable model for a PARK9-linked disease and possibly for manganese toxicity in synucleinopathies.

  7. Comparative Genomics Integrated with Association Analysis Identifies Candidate Effector Genes Corresponding to Lr20 in Phenotype-Paired Puccinia triticina Isolates from Australia

    Science.gov (United States)

    Wu, Jing Qin; Sakthikumar, Sharadha; Dong, Chongmei; Zhang, Peng; Cuomo, Christina A.; Park, Robert F.

    2017-01-01

    Leaf rust is one of the most common and damaging diseases of wheat, and is caused by an obligate biotrophic basidiomycete, Puccinia triticina (Pt). In the present study, 20 Pt isolates from Australia, comprising 10 phenotype-matched pairs with contrasting pathogenicity for Lr20, were analyzed using whole genome sequencing. Compared to the reference genome of the American Pt isolate 1-1 BBBD Race 1, an average of 404,690 single nucleotide polymorphisms (SNPs) per isolate was found and the proportion of heterozygous SNPs was above 87% in the majority of the isolates, demonstrating a high level of polymorphism and a high rate of heterozygosity. From the genome-wide SNPs, a phylogenetic tree was inferred, which consisted of a large clade of 15 isolates representing diverse presumed clonal lineages including 14 closely related isolates and the more diverged isolate 670028, and a small clade of five isolates characterized by lower heterozygosity level. Principle component analysis detected three distinct clusters, corresponding exactly to the two major subsets of the small clade and the large clade comprising all 15 isolates without further separation of isolate 670028. While genome-wide association analysis identified 302 genes harboring at least one SNP associated with Lr20 virulence (p epigenetics and small RNA in Pt pathogenicity. Future studies are thus warranted to investigate the biological functions of the candidate effectors as well as the gene regulation mechanisms at epigenetic and post-transcription levels. Our study is the first to integrate phenotype-genotype association with effector prediction in Pt genomes, an approach that may circumvent some of the technical difficulties in working with obligate rust fungi and accelerate avirulence gene identification. PMID:28232843

  8. prx-1 functions cooperatively with another paired-related homeobox gene, prx-2, to maintain cell fates within the craniofacial mesenchyme.

    Science.gov (United States)

    Lu, M F; Cheng, H T; Kern, M J; Potter, S S; Tran, B; Diekwisch, T G; Martin, J F

    1999-02-01

    The paired-related homeobox gene, prx-1, is expressed in the postmigratory cranial mesenchyme of all facial prominences and is required for the formation of proximal first arch derivatives. We introduced lacZ into the prx-1 locus to study the developmental fate of cells destined to express prx-1 in the prx-1 mutant background. lacZ was normally expressed in prx-1(neo); prx-1(lacZ )mutant craniofacial mesenchyme up until 11.5 d.p.c. At later time points, lacZ expression was lost from structures that are defective in the prx-1(neo) mutant mice. A related gene, prx-2, demonstrated overlapping expression with prx-1. To test the idea that prx-1 and prx-2 perform redundant functions, we generated prx-1(neo;)prx-2 compound mutant mice. Double mutant mice had novel phenotypes in which the rostral aspect of the mandible was defective, the mandibular incisor arrested as a single, bud-stage tooth germ and Meckel's cartilage was absent. Expression of two markers for tooth development, pax9 and patched, were downregulated. Using a transgene that marks a subset of prx-1-expressing cells in the craniofacial mesenchyme, we showed that cells within the hyoid arch take on the properties of the first branchial arch. These data suggest that prx-1 and prx-2 coordinately regulate gene expression in cells that contribute to the distal aspects of the mandibular arch mesenchyme and that prx-1 and prx-2 play a role in the maintenance of cell fate within the craniofacial mesenchyme.

  9. Overlap and Nonoverlap Between the ICF Core Sets for Hearing Loss and Otology and Audiology Intake Documentation.

    Science.gov (United States)

    van Leeuwen, Lisette M; Merkus, Paul; Pronk, Marieke; van der Torn, Marein; Maré, Marcel; Goverts, S Theo; Kramer, Sophia E

    Factors). One extra ICF category emerged from the intake documentation that is currently not included in the Core Sets: sleep functions. Various Personal Factors emerged from the intake documentation that are currently not defined in the ICF classification. The results showed substantial overlap between the ICF Core Sets for HL and the intake documentation of otology and audiology, but also revealed areas of nonoverlap. These findings contribute to the evaluation of the content validity of the Core Sets. The overlap can be viewed as supportive of the Core Sets' content validity. The nonoverlap in Core Sets categories indicates that current Dutch intake procedures may not cover all aspects relevant to patients with ear/hearing problems. The identification of extra constructs suggests that the Core Sets may not include all areas of functioning that are relevant to Dutch Otology and Audiology patients. Consideration of incorporating both aspects into future intake practice deserves attention. Operationalization of the ICF Core Sets categories, including the extra constructs identified in this study, into a practical and integral intake instrument seems an important next step.

  10. Conserved regulation of p53 network dosage by microRNA-125b occurs through evolving miRNA-target gene pairs.

    Directory of Open Access Journals (Sweden)

    Minh T N Le

    2011-09-01

    Full Text Available MicroRNAs regulate networks of genes to orchestrate cellular functions. MiR-125b, the vertebrate homologue of the Caenorhabditis elegans microRNA lin-4, has been implicated in the regulation of neural and hematopoietic stem cell homeostasis, analogous to how lin-4 regulates stem cells in C. elegans. Depending on the cell context, miR-125b has been proposed to regulate both apoptosis and proliferation. Because the p53 network is a central regulator of both apoptosis and proliferation, the dual roles of miR-125b raise the question of what genes in the p53 network might be regulated by miR-125b. By using a gain- and loss-of-function screen for miR-125b targets in humans, mice, and zebrafish and by validating these targets with the luciferase assay and a novel miRNA pull-down assay, we demonstrate that miR-125b directly represses 20 novel targets in the p53 network. These targets include both apoptosis regulators like Bak1, Igfbp3, Itch, Puma, Prkra, Tp53inp1, Tp53, Zac1, and also cell-cycle regulators like cyclin C, Cdc25c, Cdkn2c, Edn1, Ppp1ca, Sel1l, in the p53 network. We found that, although each miRNA-target pair was seldom conserved, miR-125b regulation of the p53 pathway is conserved at the network level. Our results lead us to propose that miR-125b buffers and fine-tunes p53 network activity by regulating the dose of both proliferative and apoptotic regulators, with implications for tissue stem cell homeostasis and oncogenesis.

  11. KIR gene variability in cutaneous malignant melanoma: influence of KIR2D/HLA-C pairings on disease susceptibility and prognosis.

    Science.gov (United States)

    Campillo, José A; Legaz, Isabel; López-Álvarez, M Rocío; Bolarín, José Miguel; Las Heras, Beatriz; Muro, Manuel; Minguela, Alfredo; Moya-Quiles, María R; Blanco-García, Rosa; Martínez-Banaclocha, Helios; García-Alonso, Ana M; Alvarez-López, M Rocío; Martínez-Escribano, Jorge A

    2013-05-01

    Natural killer and CD8(+) T cells are believed to be involved in the immune protection against melanoma. Their function may be regulated by a group of receptors defined as killer immunoglobulin-like receptors (KIRs) and their cognate HLA class I ligands. In this study, we analyzed the influence of KIR genes and KIR/HLA-I combinations on melanoma susceptibility and/or prognosis in a Spanish Caucasian population. For this purpose, KIR genotyping by PCR-SSP and HLA-C genotyping by reverse PCR-SSO were performed in 187 melanoma patients and 200 matched controls. We found a significantly low frequency of KIR2DL3 in nodular melanoma (NM) patients (P = 0.001) and in ulcerated melanoma patients (P < 0.0001). Similarly, the KIR2DL3/C1 combination was significantly decreased in melanoma patients (Pc = 0.008) and in patients with sentinel lymph node (SLN) melanoma metastasis (Pc = 0.002). Multivariate logistic regression models showed that KIR2DL3 behaves as a protective marker for NM and ulcerated melanoma (P = 0.02, odds ratio (OR) = 0.14 and P = 0.04, OR = 0.28, respectively), whereas the KIR2DL3/C1 pair acts as a protective marker for melanoma (P = 0.017, OR = 0.54), particularly superficial spreading melanoma (P = 0.02, OR = 0.52), and SLN metastasis (P = 0.0004, OR = 0.14). In contrast, the KIR2DL3(-)/C1C2 genotype seems to be correlated with NM and ulceration. We also report that the KIR2DL1(+)/S1(-)/C2C2 genotype is associated with susceptibility to melanoma and SLN metastasis. Altogether, the study of KIR2D genes and HLA-C ligands may help in assessing cutaneous melanoma risk and prognosis.

  12. A strict error bound with separated contributions of the discretization and of the iterative solver in non-overlapping domain decomposition methods

    CERN Document Server

    Rey, Valentine; Gosselet, Pierre

    2013-01-01

    This paper deals with the estimation of the distance between the solution of a static linear mechanic problem and its approximation by the finite element method solved with a non-overlapping domain decomposition method (FETI or BDD). We propose a new strict upper bound of the error which separates the contribution of the iterative solver and the contribution of the discretization. Numerical assessments show that the bound is sharp and enables us to define an objective stopping criterion for the iterative solver

  13. Affected-sib-pair mapping of a novel susceptibility gene to insulin-dependent diabetes mellitus (IDDM8) on chromosome 6q25-q27

    Energy Technology Data Exchange (ETDEWEB)

    Luo, D.F.; Bui, M.M.; Muir, A. [Univ. of Florida, Gainesville, FL (United States)] [and others

    1995-10-01

    Affected-sib-pair analyses were performed using 104 Caucasian families to map genes that predispose to insulin-dependent diabetes mellitus (IDDM). We have obtained linkage evidence for D6S446 (maximum lod score [MLS] = 2.8) and for D6S264 (MLS = 2.0) on 6q25q27. Together with a previously reported data set, linkage can be firmly established (MLS = 3.4 for D6S264), and the disease locus has been designated IDDM8. With analysis of independent families, we confirmed linkage evidence for the previously identified IDDM3 (15q) and DDM7 (2q). We also typed additional markers in the regions containing IDDM3, IDDM4, IDDM5, and IDDM8. Preliminary linkage evidence for a novel region on chromosome 4q (D4S1566) has been found in 47 Florida families (P < .03). We also found evidence of linkage for two regions previously identified as potential linkages in the Florida subset: D3S1303 on 3q (P < .04) and D7S486 on 7q (P < .03). We could not confirm linkage with eight other regions (D1S191, D1S412, D4S1604, D8S264, D8S556, D1OS193, D13S158, and D18S64) previously identified as potential linkages. 26 refs., 1 fig., 4 tabs.

  14. Pairing Learners in Pair Work Activity

    Science.gov (United States)

    Storch, Neomy; Aldosari, Ali

    2013-01-01

    Although pair work is advocated by major theories of second language (L2) learning and research findings suggest that pair work facilitates L2 learning, what is unclear is how to best pair students in L2 classes of mixed L2 proficiency. This study investigated the nature of pair work in an English as a Foreign Language (EFL) class in a college in…

  15. Mutations in the paired domain of the human PAX3 gene cause Klein-Waardenburg syndrome (WS-III) as well as Waardenburg syndrome type I (WS-I)

    Energy Technology Data Exchange (ETDEWEB)

    Hoth, C.F.; Milunsky, A.; Lipsky, N.; Baldwin, C.T. (Boston Univ. School of Medicine, MA (United States)); Sheffer, R. (Hadassah-Hebrew Univ. Medical Center, Jerusalem (Israel)); Clarren, S.K. (Univ. of Washington School of Medicine, Seattle (United States))

    1993-03-01

    Waardenburg syndrome type I (WS-I) is an autosomal dominant disorder characterized by sensorineural hearing loss, dystopia canthorum, pigmentary disturbances, and other developmental defects. Klein-Waardenburg syndrome (WS-III) is a disorder with many of the same characteristics as WS-I and includes musculoskeletal abnormalities. The authors have recently reported the identification and characterization of one of the first gene defects, in the human PAX3 gene, which causes WS-I. PAX3 is a DNA-binding protein that contains a structural motif known as the paired domain and is believed to regulate the expression of other genes. In this report they describe two new mutations, in the human PAX3 gene, that are associated with WS. One mutation was found in a family with WS-I, while the other mutation was found in a family with WS-III. Both mutations were in the highly conserved paired domain of the human PAX3 gene and are similar to other mutations that cause WS. The results indicate that mutations in the PAX3 gene can cause both WS-I and WS-III. 36 refs., 4 figs.

  16. Expression of the pair-rule gene homologs runt, Pax3/7, even-skipped-1 and even-skipped-2 during larval and juvenile development of the polychaete annelid Capitella teleta does not support a role in segmentation

    Directory of Open Access Journals (Sweden)

    Seaver Elaine C

    2012-04-01

    Full Text Available Abstract Background Annelids and arthropods each possess a segmented body. Whether this similarity represents an evolutionary convergence or inheritance from a common segmented ancestor is the subject of ongoing investigation. Methods To investigate whether annelids and arthropods share molecular components that control segmentation, we isolated orthologs of the Drosophila melanogaster pair-rule genes, runt, paired (Pax3/7 and eve, from the polychaete annelid Capitella teleta and used whole mount in situ hybridization to characterize their expression patterns. Results When segments first appear, expression of the single C. teleta runt ortholog is only detected in the brain. Later, Ct-runt is expressed in the ventral nerve cord, foregut and hindgut. Analysis of Pax genes in the C. teleta genome reveals the presence of a single Pax3/7 ortholog. Ct-Pax3/7 is initially detected in the mid-body prior to segmentation, but is restricted to two longitudinal bands in the ventral ectoderm. Each of the two C. teleta eve orthologs has a unique and complex expression pattern, although there is partial overlap in several tissues. Prior to and during segment formation, Ct-eve1 and Ct-eve2 are both expressed in the bilaterial pair of mesoteloblasts, while Ct-eve1 is expressed in the descendant mesodermal band cells. At later stages, Ct-eve2 is expressed in the central and peripheral nervous system, and in mesoderm along the dorsal midline. In late stage larvae and adults, Ct-eve1 and Ct-eve2 are expressed in the posterior growth zone. Conclusions C. teleta eve, Pax3/7 and runt homologs all have distinct expression patterns and share expression domains with homologs from other bilaterians. None of the pair-rule orthologs examined in C. teleta exhibit segmental or pair-rule stripes of expression in the ectoderm or mesoderm, consistent with an independent origin of segmentation between annelids and arthropods.

  17. Powered Tate Pairing Computation

    Science.gov (United States)

    Kang, Bo Gyeong; Park, Je Hong

    In this letter, we provide a simple proof of bilinearity for the eta pairing. Based on it, we show an efficient method to compute the powered Tate pairing as well. Although efficiency of our method is equivalent to that of the Tate pairing on the eta pairing approach, but ours is more general in principle.

  18. Pairings on hyperelliptic curves

    CERN Document Server

    Balakrishnan, Jennifer; Chisholm, Sarah; Eisentraeger, Kirsten; Stange, Katherine; Teske, Edlyn

    2009-01-01

    We assemble and reorganize the recent work in the area of hyperelliptic pairings: We survey the research on constructing hyperelliptic curves suitable for pairing-based cryptography. We also showcase the hyperelliptic pairings proposed to date, and develop a unifying framework. We discuss the techniques used to optimize the pairing computation on hyperelliptic curves, and present many directions for further research.

  19. Sequences more than 500 base pairs upstream of the human U3 small nuclear RNA gene stimulate the synthesis of U3 RNA in frog oocytes

    Energy Technology Data Exchange (ETDEWEB)

    Suh, D.; Reddy, R. (Baylor Coll. of Medicine, Houston, TX (United States)); Wright, D. (Texas Medical Center, Houston (United States))

    1991-06-04

    Small nuclear RNA (snRNA) genes contain strong promoters capable of initiating transcription once every 4 s. Studies on the human U1 snRNA gene, carried out in other laboratories, showed that sequences within 400 bp of the 5' flanking region are sufficient for maximal levels of transcription both in vivo and in frog oocytes (reviewed in Dahlberg and Lund (1988)). The authors studied the expression of a human U3 snRNA gene by injecting 5' deletion mutants into frog oocytes. The results show that sequences more than 500 bp upstream of the U3 snRNA gene have a 2-3-fold stimulatory effect on the U3 snRNA synthesis. These results indicate that the human U3 snRNA gene is different from human U1 snRNA gene in containing regulatory elements more than 500 bp upstream. The U3 snRNA gene upstream sequences contain an AluI homologous sequence in the {minus}1,200 region; these AluI sequences were transcribed in vitro and in frog oocytes but were not detectable in Hela cells.

  20. Nearly complete rRNA genes assembled from across the metazoan animals: effects of more taxa, a structure-based alignment, and paired-sites evolutionary models on phylogeny reconstruction.

    Science.gov (United States)

    Mallatt, Jon; Craig, Catherine Waggoner; Yoder, Matthew J

    2010-04-01

    This study (1) uses nearly complete rRNA-gene sequences from across Metazoa (197 taxa) to reconstruct animal phylogeny; (2) presents a highly annotated, manual alignment of these sequences with special reference to rRNA features including paired sites (http://purl.oclc.org/NET/rRNA/Metazoan_alignment) and (3) tests, after eliminating as few disruptive, rogue sequences as possible, if a likelihood framework can recover the main metazoan clades. We found that systematic elimination of approximately 6% of the sequences, including the divergent or unstably placed sequences of cephalopods, arrowworm, symphylan and pauropod myriapods, and of myzostomid and nemertodermatid worms, led to a tree that supported Ecdysozoa, Lophotrochozoa, Protostomia, and Bilateria. Deuterostomia, however, was never recovered, because the rRNA of urochordates goes (nonsignificantly) near the base of the Bilateria. Counterintuitively, when we modeled the evolution of the paired sites, phylogenetic resolution was not increased over traditional tree-building models that assume all sites in rRNA evolve independently. The rRNA genes of non-bilaterians contain a higher % AT than do those of most bilaterians. The rRNA genes of Acoela and Myzostomida were found to be secondarily shortened, AT-enriched, and highly modified, throwing some doubt on the location of these worms at the base of Bilateria in the rRNA tree--especially myzostomids, which other evidence suggests are annelids instead. Other findings are marsupial-with-placental mammals, arrowworms in Ecdysozoa (well supported here but contradicted by morphology), and Placozoa as sister to Cnidaria. Finally, despite the difficulties, the rRNA-gene trees are in strong concordance with trees derived from multiple protein-coding genes in supporting the new animal phylogeny.

  1. Identification of a common reference gene pair for qPCR in human mesenchymal stromal cells from different tissue sources treated with VEGF

    DEFF Research Database (Denmark)

    Tratwal, Josefine; Follin, Bjarke; Ekblond, Annette

    2014-01-01

    on reference genes (RGs) for the normalization of qPCR data. RESULTS: BMSCs and ASCs were stimulated with vascular endothelial growth factor A-165 (VEGF) for one week, and compared with un-stimulated cells from the same donor. The stability of nine RGs through VEGF treatment as well as the donor variation...... gene, TBP, was found to be the most stable standalone gene, while TBP and YWHAZ were found to be the best two-RG combination for qPCR analyses for both BMSCs and ASCs through the VEGF stimulation. The presented stepwise elimination procedure was validated, while we found the final normalization...

  2. Microevolution between paired antral and paired antrum and corpus Helicobacter pylori isolates recovered from individual patients.

    Science.gov (United States)

    Carroll, Ian M; Ahmed, Niyaz; Beesley, Sarah M; Khan, Aleem A; Ghousunnissa, Sheikh; Moráin, Colm A O; Habibullah, C M; Smyth, Cyril J

    2004-07-01

    Sequence variations located at the signal sequence and mid-region within the vacA gene, the 3'-end of the cagA gene, the indel motifs at the 3'-end of the cag pathogenicity island and the regions upstream of the vacA and ribA genes were determined by PCR in 19 paired antral or antrum and corpus Helicobacter pylori isolates obtained at the same endoscopic session, and three antral pairs taken sequentially. Random amplification of polymorphic DNA (RAPD)-PCR and fluorescent amplified fragment length polymorphism (FAFLP)-PCR fingerprinting were applied to these paired clinical isolates. The FAFLP-PCR profiles generated were phylogenetically analysed. For the 22 paired isolates there were no differences within pairs at five of the genetic loci studied. However, six pairs of isolates (27%), of which four were antrum and corpus pairs, showed differences in the numbers of repeats located at the 3'-end of the cagA gene. RAPD-PCR fingerprinting showed that 16 (73%) pairs, nine of which were antrum and corpus pairs, possessed identical profiles, while six (27%) displayed distinctly different profiles, indicating mixed infections. Three of the six pairs showing differences at the 3'-end of the cagA gene yielded identical RAPD-PCR fingerprints. FAFLP-PCR fingerprinting and phylogenetic analysis revealed that all 16 pairs that displayed identical RAPD-PCR profiles had highly similar, but not identical, fingerprints, demonstrating that these pairs were ancestrally related but had undergone minor genomic alterations. Two antrum and corpus pairs of isolates, within the latter group, were isolates obtained from two siblings from the same family. This analysis demonstrated that each sibling was colonized by ancestrally related strains that exhibited differences in vacA genotype characteristics.

  3. Casimir light: photon pairs.

    OpenAIRE

    1993-01-01

    Expressions are developed for weak single pair emission probability and strong emission average number of pairs. The water transparency cutoff is closely realized, showing that the fundamental time scale is even shorter.

  4. Ancestral Y-linked genes were maintained by translocation to the X and Y chromosomes fused to an autosomal pair in the Okinawa spiny rat Tokudaia muenninki.

    Science.gov (United States)

    Murata, Chie; Kuroki, Yoko; Imoto, Issei; Kuroiwa, Asato

    2016-09-01

    Two species of the genus Tokudaia lack the Y chromosome and SRY, but several Y-linked genes have been rescued by translocation or transposition to other chromosomes. Tokudaia muenninki is the only species in the genus that maintains the Y owing to sex chromosome-autosome fusions. According to previous studies, many SRY pseudocopies and other Y-linked genes have evolved by excess duplication in this species. Using RNA-seq and RT-PCR, we found that ZFY, EIF2S3Y, TSPY, UTY, DDX3Y, USP9Y, and RBMY, but not UBA1Y, had high deduced amino acid sequence similarity and similar expression patterns with other rodents, suggesting that these genes were functional. Based on FISH and quantitative real-time PCR, all of the genes except for UTY and DDX3Y were amplified on the X and Y chromosomes with approximately 10-66 copies in the male genome. In a comparative analysis of the 372.4-kb BAC sequence and Y-linked gene transcripts from T. muenninki with the mouse Y genomic sequence, we observed that multiple-copy genes in the ancestral Y genome were nonfunctional, indicating that the gene functions were assumed by amplified copies. We also found a LTR sequence at the distal end of a SRY duplication unit, suggesting that unequal sister chromatid exchange mediated by retrotransposable elements could have been involved in SRY amplification. Our results revealed that the Y-linked genes were rescued from degeneration via translocations to other sex chromosomal regions and amplification events in T. muenninki.

  5. Insights into the evolutionary history of tubercle bacilli as disclosed by genetic rearrangements within a PE_PGRS duplicated gene pair

    Directory of Open Access Journals (Sweden)

    Kurepina Natalia

    2006-12-01

    Full Text Available Abstract Background The highly homologous PE_PGRS (Proline-glutamic acid_polymorphic GC-rich repetitive sequence genes are members of the PE multigene family which is found only in mycobacteria. PE genes are particularly abundant within the genomes of pathogenic mycobacteria where they seem to have expanded as a result of gene duplication events. PE_PGRS genes are characterized by their high GC content and extensive repetitive sequences, making them prone to recombination events and genetic variability. Results Comparative sequence analysis of Mycobacterium tuberculosis genes PE_PGRS17 (Rv0978c and PE_PGRS18 (Rv0980c revealed a striking genetic variation associated with this typical tandem duplicate. In comparison to the M. tuberculosis reference strain H37Rv, the variation (named the 12/40 polymorphism consists of an in-frame 12-bp insertion invariably accompanied by a set of 40 single nucleotide polymorphisms (SNPs that occurs either in PE_PGRS17 or in both genes. Sequence analysis of the paralogous genes in a representative set of worldwide distributed tubercle bacilli isolates revealed data which supported previously proposed evolutionary scenarios for the M. tuberculosis complex (MTBC and confirmed the very ancient origin of "M. canettii" and other smooth tubercle bacilli. Strikingly, the identified polymorphism appears to be coincident with the emergence of the post-bottleneck successful clone from which the MTBC expanded. Furthermore, the findings provide direct and clear evidence for the natural occurrence of gene conversion in mycobacteria, which appears to be restricted to modern M. tuberculosis strains. Conclusion This study provides a new perspective to explore the molecular events that accompanied the evolution, clonal expansion, and recent diversification of tubercle bacilli.

  6. A stabilized pairing functional

    CERN Document Server

    Erler, J; Reinhard, P --G

    2008-01-01

    We propose a modified pairing functional for nuclear structure calculations which avoids the abrupt phase transition between pairing and non-pairing states. The intended application is the description of nuclear collective motion where the smoothing of the transition is compulsory to remove singularities. The stabilized pairing functional allows a thoroughly variational formulation, unlike the Lipkin-Nogami (LN) scheme which is often used for the purpose of smoothing. First applications to nuclear ground states and collective excitations prove the reliability and efficiency of the proposed stabilized pairing.

  7. Evidence for multiple promoters of the human IL-5 receptor alpha subunit gene: a novel 6-base pair element determines cell-specific promoter function.

    Science.gov (United States)

    Zhang, J; Kuvelkar, R; Cheewatrakoolpong, B; Williams, S; Egan, R W; Billah, M M

    1997-12-01

    In addition to a previously characterized promoter (P1), we now show the existence of a second promoter for the human IL-5Ralpha gene. Initially, a genomic region (P2) 5' upstream of human IL-5Ralpha exon 2 was cloned by an inverted PCR. The transcriptional start site was then mapped to a deoxycytidine (C) residue within P2 by analyzing cellular mRNA with both the 5' rapid amplification of cDNA end-PCR and S1 nuclease protection assays. Transfection of eosinophilic HL-60 cells with reporter gene constructs in which either P1 or P2 was linked to the bacterial chloramphenicol acetyltransferase (CAT) gene resulted in CAT expression; little or no CAT expression occurred in other myeloid and nonmyeloid cell lines. Deletion studies showed that a 66-bp region, ranging from -31 to +35, was sufficient to promote CAT expression in eosinophilic HL-60 cells. Analysis of linker-scanning mutants identified a novel 6-bp element (5' CTAATT 3') spanning -19 to -14 that was essential for P2 promoter activity. In electrophoretic mobility shift assays, a P2 region from -31 to +1 containing the unique 6-bp element, when used as a probe, formed a complex with a protein(s) that was found only in the eosinophilic cell line. This binding activity was lost upon replacement of the 6-bp element with a 6-bp linker, suggesting that this element likely serves as the binding site for an eosinophilic HL-60 cell-specific transcription factor(s). Together, these data suggest an important role for P2 promoter in the regulation of eosinophil-specific expression of the human IL-5 receptor alpha gene.

  8. A novel 3-base pair deletion of the CRYAA gene identified in a large Chinese pedigree featuring autosomal dominant congenital perinuclear cataract.

    Science.gov (United States)

    Kong, X D; Liu, N; Shi, H R; Dong, J M; Zhao, Z H; Liu, J; Li-Ling, J; Yang, Y X

    2015-01-23

    Congenital cataract is caused by reduced transparency of the lens resulting from metabolic disorders during the fetal period. The disease shows great heterogeneity both clinically and genetically. We identified a 4-generation ethnic Han Chinese family affected by autosomal dominant congenital perinuclear cataract. The patients underwent full clinical and ophthalmologic examinations to rule out any concomitant disorders. Blood samples were collected and genomic DNA was extracted. Potential mutations in the candidate gene alpha A crystallin (CRYAA) were screened. Prenatal diagnosis was then provided for a fetus of the affected proband by chorionic villus sampling. In all patients, DNA sequencing of the CRYAA gene revealed a novel 3-bp deletion mutation in exon 3 (c.246_248delCGC), which led to deletion of codon 117 encoding arginine (p.117delR) in the peptide chain. The same mutation was not found among unaffected and healthy individuals. Bioinformatic analysis revealed that although the c.246_248delCGC is an 'in-frame' mutation, removal of arginine resulted in a significant change in the protein structure. The fetus did not possess this mutation and was confirmed to be healthy at 1-year follow-up. A novel disease-causing mutation, c.246_248delCGC (p.117delR), of the CRYAA gene has been identified in a Chinese family with autosomal-type perinuclear congenital cataracts. This is also the first report of prenatal diagnosis of this type of congenital cataract.

  9. Matched-pair classification

    Energy Technology Data Exchange (ETDEWEB)

    Theiler, James P [Los Alamos National Laboratory

    2009-01-01

    Following an analogous distinction in statistical hypothesis testing, we investigate variants of machine learning where the training set comes in matched pairs. We demonstrate that even conventional classifiers can exhibit improved performance when the input data has a matched-pair structure. Online algorithms, in particular, converge quicker when the data is presented in pairs. In some scenarios (such as the weak signal detection problem), matched pairs can be generated from independent samples, with the effect not only doubling the nominal size of the training set, but of providing the structure that leads to better learning. A family of 'dipole' algorithms is introduced that explicitly takes advantage of matched-pair structure in the input data and leads to further performance gains. Finally, we illustrate the application of matched-pair learning to chemical plume detection in hyperspectral imagery.

  10. Investigation of mRNA expression of collagen genes in oral squamous cell carcinoma and paired normal tissue%胶原类基因mRNA在口腔鳞癌组织中的表达

    Institute of Scientific and Technical Information of China (English)

    吕晓智; 陈万涛; 张陈平

    2011-01-01

    Objective To investigate the mRNA expression of collagen genes in oral squamous cell carcinoma (OSCC) and paired normal oral mucosal tissue. Methods The differential mRNA expressions of collagen genes between 30 OSCC tissues and the paired normal oral mucosal tissues were detected by RT-PCR. Result The relative expression level of COL1 Al mRNA in the 30 cancerous tissues was up-regulated by 2.78 folds as compared with its expression in the paired normal samples, suggesting its significant overexpression in OSCC (P0.001). The expression levels of COL1A2, COL4A1, COL4A2, and COL5A2 mRNA in the cancerous tissues were up-regulated by 1.07, 1.15, 1.27, and 1.16 folds compared to those in paired normal samples (P>0.05). Conclusion COL1A1 mRNA overexpression may play an important role in the carcinogenesis of OSCC and can be a potential molecular marker of OSCC.%目的 研究胶原类基因COL1A1、COL1A2、COL4A1、COL4A2、COL5A2 mRNA在口腔鳞状细胞癌(OSCC)及配对正常口腔黏膜组织中的表达及意义.方法 采用RT-PCR方法检测30例OSCC患者肿瘤组织及其配对的正常口腔黏膜中胶原基因COL1A1、COL1A2、COL4A1、COL4A2、COL5A2 mRNA的表达;所得数据采用SAS6.12软件包进行t检验.结果 RT-PCR检测结果表明,COL1A1 mRNA在OSCC中的表达较其对照粘膜表达上调2.78倍(P0.05).结论 在OSCC癌变过程中,COL1A1 mRNA过表达,可能是OSCC的-个靶基因;COL1A1在OSCC分类诊断中有应用价值.

  11. Frequencies of 32 base pair deletion of the (Delta 32) allele of the CCR5 HIV-1 co-receptor gene in Caucasians: a comparative analysis.

    Science.gov (United States)

    Lucotte, Gérard

    2002-05-01

    The CCR5 gene encodes for the co-receptor for the major macrophage-tropics strains of human immunodeficiency virus (HIV-1), and a mutant allele of this gene (Delta 32) provide to homozygotes a strong resistance against infection by HIV. The frequency of the Delta 32 allele was investigated in 40 populations of 8842 non-infected subjects coming from Europe, the Middle-East and North Africa. A clear north-south decreasing gradient was evident for Delta 32 frequencies, with a significant correlation coefficient (r=0.83). The main frequency value of Delta 32 for Sweden, Norway, Denmark, Finland and Iceland (0.134) is significantly (chi(2)=63.818, PVikings might have been instrumental in disseminating the Delta 32 allele during the eighth to the tenth centuries during historical times. Possibly variola virus has discriminated the Delta 32 carriers in Europe since the eighth century AD, explaining the high frequency of the Delta 32 allele in Europe today.

  12. The Paired-box Homeodomain Transcription Factor Pax6 Binds to the Upstream Region of the TRAP Gene Promoter and Suppresses Receptor Activator of NF-κB Ligand (RANKL)-induced Osteoclast Differentiation*

    Science.gov (United States)

    Kogawa, Masakazu; Hisatake, Koji; Atkins, Gerald J.; Findlay, David M.; Enoki, Yuichiro; Sato, Tsuyoshi; Gray, Peter C.; Kanesaki-Yatsuka, Yukiko; Anderson, Paul H.; Wada, Seiki; Kato, Naoki; Fukuda, Aya; Katayama, Shigehiro; Tsujimoto, Masafumi; Yoda, Tetsuya; Suda, Tatsuo; Okazaki, Yasushi; Matsumoto, Masahito

    2013-01-01

    Osteoclast formation is regulated by balancing between the receptor activator of nuclear factor-κB ligand (RANKL) expressed in osteoblasts and extracellular negative regulatory cytokines such as interferon-γ (IFN-γ) and interferon-β (IFN-β), which can suppress excessive bone destruction. However, relatively little is known about intrinsic negative regulatory factors in RANKL-mediated osteoclast differentiation. Here, we show the paired-box homeodomain transcription factor Pax6 acts as a negative regulator of RANKL-mediated osteoclast differentiation. Electrophoretic mobility shift and reporter assays found that Pax6 binds endogenously to the proximal region of the tartrate acid phosphatase (TRAP) gene promoter and suppresses nuclear factor of activated T cells c1 (NFATc1)-induced TRAP gene expression. Introduction of Pax6 retrovirally into bone marrow macrophages attenuates RANKL-induced osteoclast formation. Moreover, we found that the Groucho family member co-repressor Grg6 contributes to Pax6-mediated suppression of the TRAP gene expression induced by NFATc1. These results suggest that Pax6 interferes with RANKL-mediated osteoclast differentiation together with Grg6. Our results demonstrate that the Pax6 pathway constitutes a new aspect of the negative regulatory circuit of RANKL-RANK signaling in osteoclastogenesis and that the augmentation of Pax6 might therefore represent a novel target to block pathological bone resorption. PMID:23990468

  13. Cooper pairs and bipolarons

    OpenAIRE

    Lakhno, Victor D.

    2016-01-01

    It is shown that Cooper pairs are a solution of the bipolaron problem for model Fr\\"{o}hlich Hamiltonian. The total energy of a pair for the initial Fr\\"{o}hlich Hamiltonian is found. Differences between the solutions for the model and initial two-particle problems are discussed.

  14. Cooper pairs and bipolarons

    Science.gov (United States)

    Lakhno, Victor

    2016-11-01

    It is shown that Cooper pairs are a solution of the bipolaron problem for model Fröhlich Hamiltonian. The total energy of a pair for the initial Fröhlich Hamiltonian is found. Differences between the solutions for the model and initial two-particle problems are discussed.

  15. Critical Schwinger Pair Production.

    Science.gov (United States)

    Gies, Holger; Torgrimsson, Greger

    2016-03-04

    We investigate Schwinger pair production in spatially inhomogeneous electric backgrounds. A critical point for the onset of pair production can be approached by fields that marginally provide sufficient electrostatic energy for an off-shell long-range electron-positron fluctuation to become a real pair. Close to this critical point, we observe features of universality which are analogous to continuous phase transitions in critical phenomena with the pair-production rate serving as an order parameter: electric backgrounds can be subdivided into universality classes and the onset of pair production exhibits characteristic scaling laws. An appropriate design of the electric background field can interpolate between power-law scaling, essential Berezinskii-Kosterlitz-Thouless-type scaling, and a power-law scaling with log corrections. The corresponding critical exponents only depend on the large-scale features of the electric background, whereas the microscopic details of the background play the role of irrelevant perturbations not affecting criticality.

  16. Stereo pairs in Astrophysics

    CERN Document Server

    Vogt, Frédéric

    2011-01-01

    Stereoscopic visualization is seldom used in Astrophysical publications and presentations compared to other scientific fields, e.g., Biochemistry, where it has been recognized as a valuable tool for decades. We put forth the view that stereo pairs can be a useful tool for the Astrophysics community in communicating a truer representation of astrophysical data. Here, we review the main theoretical aspects of stereoscopy, and present a tutorial to easily create stereo pairs using Python. We then describe how stereo pairs provide a way to incorporate 3D data in 2D publications of standard journals. We illustrate the use of stereo pairs with one conceptual and two Astrophysical science examples: an integral field spectroscopy study of a supernova remnant, and numerical simulations of a relativistic AGN jet. We also use these examples to make the case that stereo pairs are not merely an ostentatious way to present data, but an enhancement in the communication of scientific results in publications because they prov...

  17. Critical Schwinger pair production

    CERN Document Server

    Gies, Holger

    2015-01-01

    We investigate Schwinger pair production in spatially inhomogeneous electric backgrounds. A critical point for the onset of pair production can be approached by fields that marginally provide sufficient electrostatic energy for an off-shell long-range electron-positron fluctuation to become a real pair. Close to this critical point, we observe features of universality which are analogous to continuous phase transitions in critical phenomena with the pair-production rate serving as an order parameter: electric backgrounds can be subdivided into universality classes and the onset of pair production exhibits characteristic scaling laws. An appropriate design of the electric background field can interpolate between power-law scaling, essential BKT-type scaling and a power-law scaling with log corrections. The corresponding critical exponents only depend on the large-scale features of the electric background, whereas the microscopic details of the background play the role of irrelevant perturbations not affecting ...

  18. Effects of Light-Emitting Diode Therapy on Muscle Hypertrophy, Gene Expression, Performance, Damage, and Delayed-Onset Muscle Soreness: Case-control Study with a Pair of Identical Twins.

    Science.gov (United States)

    Ferraresi, Cleber; Bertucci, Danilo; Schiavinato, Josiane; Reiff, Rodrigo; Araújo, Amélia; Panepucci, Rodrigo; Matheucci, Euclides; Cunha, Anderson Ferreira; Arakelian, Vivian Maria; Hamblin, Michael R; Parizotto, Nivaldo; Bagnato, Vanderlei

    2016-10-01

    The aim of this study was to verify how a pair of monozygotic twins would respond to light-emitting diode therapy (LEDT) or placebo combined with a strength-training program during 12 weeks. This case-control study enrolled a pair of male monozygotic twins, allocated randomly to LEDT or placebo therapies. Light-emitting diode therapy or placebo was applied from a flexible light-emitting diode array (λ = 850 nm, total energy = 75 J, t = 15 seconds) to both quadriceps femoris muscles of each twin immediately after each strength training session (3 times/wk for 12 weeks) consisting of leg press and leg extension exercises with load of 80% and 50% of the 1-repetition maximum test, respectively. Muscle biopsies, magnetic resonance imaging, maximal load, and fatigue resistance tests were conducted before and after the training program to assess gene expression, muscle hypertrophy and performance, respectively. Creatine kinase levels in blood and visual analog scale assessed muscle damage and delayed-onset muscle soreness, respectively, during the training program. Compared with placebo, LEDT increased the maximal load in exercise and reduced fatigue, creatine kinase, and visual analog scale. Gene expression analyses showed decreases in markers of inflammation (interleukin 1β) and muscle atrophy (myostatin) with LEDT. Protein synthesis (mammalian target of rapamycin) and oxidative stress defense (SOD2 [mitochondrial superoxide dismutase]) were up-regulated with LEDT, together with increases in thigh muscle hypertrophy. Light-emitting diode therapy can be useful to reduce muscle damage, pain, and atrophy, as well as to increase muscle mass, recovery, and athletic performance in rehabilitation programs and sports medicine.

  19. Adaptive Pairing Reversible Watermarking.

    Science.gov (United States)

    Dragoi, Ioan-Catalin; Coltuc, Dinu

    2016-05-01

    This letter revisits the pairwise reversible watermarking scheme of Ou et al., 2013. An adaptive pixel pairing that considers only pixels with similar prediction errors is introduced. This adaptive approach provides an increased number of pixel pairs where both pixels are embedded and decreases the number of shifted pixels. The adaptive pairwise reversible watermarking outperforms the state-of-the-art low embedding bit-rate schemes proposed so far.

  20. Dielectric properties and study of AC electrical conduction mechanisms by non-overlapping small polaron tunneling model in Bis(4-acetylanilinium) tetrachlorocuprate(II) compound

    Science.gov (United States)

    Abkari, A.; Chaabane, I.; Guidara, K.

    2016-09-01

    In the present work, the synthesis and characterization of the Bis(4-acetylanilinium) tetrachlorocuprate(II) compound are presented. The structure of this compound is analyzed by X-ray diffraction which confirms the formation of single phase and is in good agreement the literature. Indeed, the Thermo gravimetric Analysis (TGA) shows that the decomposition of the compound is observed in the range of 420-520 K. However, the differential thermal analysis (DTA) indicates the presence of a phase transition at T=363 k. Furthermore, the dielectric properties and AC conductivity were studied over a temperature range (338-413 K) and frequency range (200 Hz-5 MHz) using complex impedance spectroscopy. Dielectric measurements confirmed such thermal analyses by exhibiting the presence of an anomaly in the temperature range of 358-373 K. The complex impedance plots are analyzed by an electrical equivalent circuit consisting of resistance, constant phase element (CPE) and capacitance. The activation energy values of two distinct regions are obtained from log σT vs 1000/T plot and are found to be E=1.27 eV (Tdependence of ac conductivity, σac, has been analyzed by Jonscher's universal power law σ(ω)=σdc+Aωs. The value of s is to be temperature-dependent, which has a tendency to increase with temperature and the non-overlapping small polaron tunneling (NSPT) model is the most applicable conduction mechanism in the title compound. Complex impedance spectra of [C8H10NO]2CuCl4 at different temperatures.

  1. Stereo pairs in Astrophysics

    Science.gov (United States)

    Vogt, Frédéric; Wagner, Alexander Y.

    2012-01-01

    Stereoscopic visualization is seldom used in Astrophysical publications and presentations compared to other scientific fields, e.g., Biochemistry, where it has been recognized as a valuable tool for decades. We put forth the view that stereo pairs can be a useful tool for the Astrophysics community in communicating a truer representation of astrophysical data. Here, we review the main theoretical aspects of stereoscopy, and present a tutorial to easily create stereo pairs using Python. We then describe how stereo pairs provide a way to incorporate 3D data in 2D publications of standard journals. We illustrate the use of stereo pairs with one conceptual and two Astrophysical science examples: an integral field spectroscopy study of a supernova remnant, and numerical simulations of a relativistic AGN jet. We also use these examples to make the case that stereo pairs are not merely an ostentatious way to present data, but an enhancement in the communication of scientific results in publications because they provide the reader with a realistic view of multi-dimensional data, be it of observational or theoretical nature. In recognition of the ongoing 3D expansion in the commercial sector, we advocate an increased use of stereo pairs in Astrophysics publications and presentations as a first step towards new interactive and multi-dimensional publication methods.

  2. A three base pair gene variation within the distal 5'-flanking region of the interleukin-10 (IL-10) gene is related to the in vitro IL-10 production capacity of lipopolysaccharide-stimulated peripheral blood mononuclear cells.

    NARCIS (Netherlands)

    Rieth, H.; Mormann, M.; Luty, J.F.; Assohou-Luty, C.A.; Roupelieva, M.; Kremsner, P.G.; Kube, D.

    2004-01-01

    Interleukin-10 (IL-10) is an important multifunctional immunmodulator. There is evidence that IL-10 secretion is associated with certain genetic elements of the proximal IL-10 gene 5'-flanking region. The allelic and genotypic comparison of IL-10 expression by lipopolysaccharide (LPS)- stimulated le

  3. Junctionless Cooper pair transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, K. Yu., E-mail: konstantin.yu.arutyunov@jyu.fi [National Research University Higher School of Economics , Moscow Institute of Electronics and Mathematics, 101000 Moscow (Russian Federation); P.L. Kapitza Institute for Physical Problems RAS , Moscow 119334 (Russian Federation); Lehtinen, J.S. [VTT Technical Research Centre of Finland Ltd., Centre for Metrology MIKES, P.O. Box 1000, FI-02044 VTT (Finland)

    2017-02-15

    Highlights: • Junctionless Cooper pair box. • Quantum phase slips. • Coulomb blockade and gate modulation of the Coulomb gap. - Abstract: Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current–voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  4. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  5. Minimal Pairs: Minimal Importance?

    Science.gov (United States)

    Brown, Adam

    1995-01-01

    This article argues that minimal pairs do not merit as much attention as they receive in pronunciation instruction. There are other aspects of pronunciation that are of greater importance, and there are other ways of teaching vowel and consonant pronunciation. (13 references) (VWL)

  6. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send import...... the Danish au pair scheme therefore speaks to current research on domestic work migration, the transnational family relations of young Filipina migrants and the forms of self-transformation that Filipino migration might engender.......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...... ethnographic component of the dissertation consists of four articles, all emphasizing the au pairs’ agency by viewing their migration as a dynamic personal and social experience. Arguing that Filipina au pairs tend to be understood primarily from the perspective of their precarious situation as domestic...

  7. Anchored paired comparisons

    Science.gov (United States)

    Dalal, E. N.; Handley, J. C.; Wu, W.; Wang, J.

    2008-01-01

    The method of paired comparisons is often used in image quality evaluations. Psychometric scale values for quality judgments are modeled using Thurstone's Law of Comparative Judgment in which distance in a psychometric scale space is a function of the probability of preference. The transformation from psychometric space to probability is a cumulative probability distribution. The major drawback of a complete paired comparison experiment is that every treatment is compared to every other, thus the number of comparisons grows quadratically. We ameliorate this difficulty by performing paired comparisons in two stages, by precisely estimating anchors in the psychometric scale space which are spaced apart to cover the range of scale values and comparing treatments against those anchors. In this model, we employ a generalized linear model where the regression equation has a constant offset vector determined by the anchors. The result of this formulation is a straightforward statistical model easily analyzed using any modern statistics package. This enables model fitting and diagnostics. This method was applied to overall preference evaluations of color pictorial hardcopy images. The results were found to be compatible with complete paired comparison experiments, but with significantly less effort.

  8. Aspectual Pairing in Polish

    NARCIS (Netherlands)

    Młynarczyk, A.K.

    2004-01-01

    The received view on Slavic aspect is that it is intrinsically complex, and that there is little hope of discerning any substantial regularity. We argue that this view is mistaken. We argue that the vast majority of Polish verbs really do come in aspectual pairs and that far from being a mysterious

  9. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

    2001-02-01

    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  10. Multi-pair states in electron-positron pair creation

    Science.gov (United States)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-09-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron-positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron-positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron-positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron-positron pairs.

  11. Junctionless Cooper pair transistor

    Science.gov (United States)

    Arutyunov, K. Yu.; Lehtinen, J. S.

    2017-02-01

    Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current-voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  12. Protected Flux Pairing Qubit

    Science.gov (United States)

    Bell, Matthew; Zhang, Wenyuan; Ioffe, Lev; Gershenson, Michael

    2014-03-01

    We have studied the coherent flux tunneling in a qubit containing two submicron Josephson junctions shunted by a superinductor (a dissipationless inductor with an impedance much greater than the resistance quantum). The two low energy quantum states of this device, " open="|"> 0 and " open="|"> 1, are represented by even and odd number of fluxes in the loop, respectively. This device is dual to the charge pairing Josephson rhombi qubit. The spectrum of the device, studied by microwave spectroscopy, reflects the interference between coherent quantum phase slips in the two junctions (the Aharonov-Casher effect). The time domain measurements demonstrate the suppression of the qubit's energy relaxation in the protected regime, which illustrates the potential of this flux pairing device as a protected quantum circuit. Templeton Foundation, NSF, and ARO.

  13. Gene targeting with retroviral vectors

    Energy Technology Data Exchange (ETDEWEB)

    Ellis, J.; Bernstein, A. (Toronto Univ., ON (Canada))

    1989-04-01

    The authors have designed and constructed integration-defective retroviral vectors to explore their potential for gene targeting in mammalian cells. Two nonoverlapping deletion mutants of the bacterial neomycin resistance (neo) gene were used to detect homologous recombination events between viral and chromosomal sequences. Stable neo gene correction events were selected at a frequency of approximately 1 G418/sup r/ cell per 3 x 10/sup 6/ infected cells. Analysis of the functional neo gene in independent targeted cell clones indicated that unintegrated retroviral linear DNA recombined with the target by gene conversion for variable distances into regions of nonhomology. In addition, transient neo gene correction events which were associated with the complete loss of the chromosomal target sequences were observed. These results demonstrated that retroviral vectors can recombine with homologous chromosomal sequences in rodent and human cells.

  14. The novel regulatory ncRNA, NfiS, optimizes nitrogen fixation via base pairing with the nitrogenase gene nifK mRNA in Pseudomonas stutzeri A1501

    Science.gov (United States)

    Zhan, Yuhua; Yan, Yongliang; Deng, Zhiping; Chen, Ming; Lu, Wei; Lu, Chao; Shang, Liguo; Yang, Zhimin; Zhang, Wei; Wang, Wei; Li, Yun; Ke, Qi; Lu, Jiasi; Xu, Yuquan; Zhang, Liwen; Xie, Zhihong; Cheng, Qi; Elmerich, Claudine; Lin, Min

    2016-01-01

    Unlike most Pseudomonas, the root-associated bacterium Pseudomonas stutzeri A1501 fixes nitrogen after the horizontal acquisition of a nitrogen-fixing (nif) island. A genome-wide search for small noncoding RNAs (ncRNAs) in P. stutzeri A1501 identified the novel P. stutzeri-specific ncRNA NfiS in the core genome, whose synthesis was significantly induced under nitrogen fixation or sorbitol stress conditions. The expression of NfiS was RNA chaperone Hfq-dependent and activated by the sigma factor RpoN/global nitrogen activator NtrC/nif-specific activator NifA regulatory cascade. The nfiS-deficient mutant displayed reduced nitrogenase activity, as well as increased sensitivity to multiple stresses, such as osmotic and oxidative stresses. Secondary structure prediction and complementation studies confirmed that a stem-loop structure was essential for NfiS to regulate the nitrogenase gene nifK mRNA synthesis and thus nitrogenase activity. Microscale thermophoresis and physiological analysis showed that NfiS directly pairs with nifK mRNA and ultimately enhances nitrogenase activity by increasing the translation efficiency and the half-life of nifK mRNA. Our data also suggest structural and functional divergence of NfiS evolution in diazotrophic and nondiazotrophic backgrounds. It is proposed that NfiS was recruited by nifK mRNA as a novel regulator to integrate the horizontally acquired nif island into host global networks. PMID:27407147

  15. Abnormal secretion and function of recombinant human factor VII as the result of modification to a calcium binding site caused by a 15-base pair insertion in the F7 gene.

    Science.gov (United States)

    Peyvandi, F; Carew, J A; Perry, D J; Hunault, M; Khanduri, U; Perkins, S J; Mannucci, P M; Bauer, K A

    2001-02-15

    A case of a novel mutation in the F7 gene that results in factor VII coagulant activity (VII:c) of less than 1% and VII antigen (VII:Ag) levels of 10% is presented. DNA analysis revealed a homozygous 15-base pair (bp) in-frame insertion-type mutation at nucleotide 10554. This insertion consisted of a duplication of residues leucine (L)213 to aspartic acid (D)217 (leucine, serine, glutamic acid, histidine, and aspartic acid), probably arising by slipped mispairing between 2 copies of a direct repeat (GCGAGCACGAC) separated by 4 bp. Molecular graphic analyses showed that the insertion is located at the surface of the catalytic domain in an exposed loop stabilized by extensive salt-bridge and hydrogen bond formation at which the calcium binding site is located. The mutation probably interferes with protein folding during VII biosynthesis and/or diminishes functional activity through the loss of calcium binding. In vitro expression studies demonstrated that the levels of VII:Ag in lysates of cells transfected with wild type VII (VIIWT) were equivalent to those with mutant type VII (VIIMT), but the level of secreted VIIMT was 5% to 10% that of VIIWT. Pulse chase studies demonstrated that VIIMT did not accumulate intracellularly, and studies with inhibitors of protein degradation showed that recombinant VIIMT was partially degraded in the pre-Golgi compartment. Accordingly, only small amounts of VIIMT with undetectable procoagulant activity were secreted into conditioned media. These results demonstrate that a combination of secretion and functional defects is the mechanism whereby this insertion causes VII deficiency.

  16. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... that engagement with Facebook as a methodological tool can be useful in research among migrants in highly politicised fields. Pointing to a discursive construction of Filipina au pairs as victims of labour exploitation, the article shows how fieldwork on Facebook enables the exploration of the ways in which...... and on Facebook....

  17. Multispecies pair annihilation reactions.

    Science.gov (United States)

    Deloubrière, Olivier; Hilhorst, Henk J; Täuber, Uwe C

    2002-12-16

    We consider diffusion-limited reactions A(i)+A(j)--> (12 and d> or =2, we argue that the asymptotic density decay for such mutual annihilation processes with equal rates and initial densities is the same as for single-species pair annihilation A+A-->. In d=1, however, particle segregation occurs for all q< infinity. The total density decays according to a q dependent power law, rho(t) approximately t(-alpha(q)). Within a simplified version of the model alpha(q)=(q-1)/2q can be determined exactly. Our findings are supported through Monte Carlo simulations.

  18. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... that engagement with Facebook as a methodological tool can be useful in research among migrants in highly politicised fields. Pointing to a discursive construction of Filipina au pairs as victims of labour exploitation, the article shows how fieldwork on Facebook enables the exploration of the ways in which...... and on Facebook....

  19. Searching for Pair Halos

    Science.gov (United States)

    Fallon, Lisa; Abramowski, A.; Acero, F.; Aharonian, F.; Akhperjanian, A. G.; Anton, G.; Barres de Almeida, U.; Bazer-Bachi, A. R.; Becherini, Y.; Behera, B.; Bernlühr, K.; Bochow, A.; Boisson, C.; Bolmont, J.; Borrel, V.; Brucker, J.; Brun, F.; Brun, P.; Bühler, R.; Bulik, T.; Büsching, I.; Boutelier, T.; Chadwick, P. M.; Charbonnier, A.; Chaves, R. C. G.; Cheesebrough, A.; Conrad, J.; Chounet, L.-M.; Clapson, A. C.; Coignet, G.; Dalton, M.; Daniel, M. K.; Davids, I. D.; Degrange, B.; Deil, C.; Dickinson, H. J.; Domainko, A. Djannati-Ataü W.; Drury, L. O'c.; Dubois, F.; Dubus, G.; Dyks, J.; Dyrda, M.; Egberts, K.; Eger, P.; Espigat, P.; Fallon, L.; Farnier, C.; Fegan, S.; Feinstein, F.; Fernandes, M. V.; Fiasson, A.; Fürster, A.; Fontaine, G.; Füssling, M.; Gabici, S.; Gallant, Y. A.; Gérard, L.; Gerbig, D.; Giebels, B.; Glicenstein, J. F.; Glück, B.; Goret, P.; Güring, D.; Hampf, D.; Hauser, M.; Heinz, S.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hinton, J. A.; Hoffmann, A.; Hofmann, W.; Hofverberg, P.; Holleran, M.; Hoppe, S.; Horns, D.; Jacholkowska, A.; de Jager, O. C.; Jahn, C.; Jung, I.; Katarzynski, K.; Katz, U.; Kaufmann, S.; Kerschhaggl, M.; Khangulyan, D.; Khálifi, B.; Keogh, D.; Klochkov, D.; Kluzniak, W.; Kneiske, T.; Komin, Nu.; Kosack, K.; Kossakowski, R.; Lamanna, G.; Lenain, J.-P.; Lohse, T.; Lu, C.-C.; Marandon, V.; Marcowith, A.; Masbou, J.; Mau-Rin, D.; McComb, T. J. L.; Medina, M. C.; Méhault, J.; Moderski, R.; Moulin, E.; Naumann-Godo, M.; de Naurois, M.; Nedbal, D.; Nekrassov, D.; Nguyen, N.; Nicholas, B.; Niemiec, J.; Nolan, S. J.; Ohm, S.; Olive, J.-F.; de Ona Wilhelmi, E.; Opitz, B.; Orford, K. J.; Ostrowski, M.; Panter, M.; Paz Arribas, M.; Pedaletti, G.; Pelletier, G.; Petrucci, P.-O.; Pita, S.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raubenheimer, B. C.; Raue, M.; Rayner, S. M.; Reimer, O.; Renaud, M.; de Los Reyes, R.; Rieger, F.; Ripken, J.; Rob, L.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Ruppel, J.; Ryde, F.; Sahakian, V.; Santangelo, A.; Schlickeiser, R.; Schück, F. M.; Schünwald, A.; Schwanke, U.; Schwarzburg, S.; Schwemmer, S.; Shalchi, A.; Sushch, I.; Sikora, M.; Skilton, J. L.; Sol, H.; Stawarz, L.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Szostek, A.; Tam, P. H.; Tavernet, J.-P.; Terrier, R.; Tibolla, O.; Tluczykont, M.; Valerius, K.; van Eldik, C.; Vasileiadis, G.; Venter, C.; Venter, L.; Vialle, J. P.; Viana, A.; Vincent, P.; Vivier, M.; Vülk, H. J.; Volpe, F.; Vorobiov, S.; Wagner, S. J.; Ward, M.; Zdziarski, A. A.; Zech, A.; Zechlin, H.-S.

    We have conducted a search for the giant Pair Halo structures which are inevitably formed around TeV sources due to interactions of very high energy gamma-rays with the Extragalactic Background Light (EBL). The resulting electron/positron pairs are Compton upscattered on photons of the 2.7 K Cosmic Microwave Background Radiation to produce a second generation of gamma-rays which again interact with the EBL; thus an electromagnetic cascade develops. If the magnetic fields on Mpc scales surrounding the central source are sufficiently strong (10-11 G or more), electrons are effectively isotropised before interacting with radiation fields. In this case an extended halo is produced around the source. Using H.E.S.S. observations of Active Galactic Nuclei, including data from PKS 2155-304, 1ES 1101-232 and 1ES 0229+200, we have completed a detailed analysis of these sources. I will present and discuss the astrophysical implications of these results.

  20. Fission: statistical nucleon pair breaking

    Energy Technology Data Exchange (ETDEWEB)

    Montoya, M. (Instituto Peruano de Energia Nuclear, Lima (Peru))

    1984-06-01

    In order to explain the odd-even effect observed in low energy fission fragment distributions it has been recently required a double mechanism of nucleon pair breaking: before scission (early pair breaking) and at scission (late pair breaking), respectively. In the present work we show that, using the same formulae but considering only the early pair breaking mechanism, one can reproduce fairly well all the available experimental data on the odd-even effects.

  1. Diffractive charged meson pair production

    CERN Document Server

    Lehmann-Dronke, B; Schäfer, S; Stein, E; Schäfer, A

    1999-01-01

    We investigate the possibility to measure the nonforward gluon distribution function by means of diffractively produced charged pion and kaon pairs in polarized lepton nucleon scattering. The resulting cross sections are sizable and are dominated by the gluonic contribution. We find large spin asymmetries, both for pion pairs and for kaon pairs.

  2. Application of Acupoints in Pairs

    Institute of Scientific and Technical Information of China (English)

    季扬

    2004-01-01

    @@ Application of acupoints in pairs is a kind of point association in which only a pair of compatible points is used. Based on the principle of compatibility, the author of this article often uses the "pair-point needling" to treat some common diseases, and have obtained very good therapeutic results. Some examples are introduced below.

  3. Cotorsion Pair Extensions

    Institute of Scientific and Technical Information of China (English)

    De Xu ZHOU

    2009-01-01

    Assume that S is an almost excellent extension of R. Using functors Hom R(S,-) and -(×)R S, we establish some connections between classes of modules (L)R and (L)S, cotorsion pairs ((A)R, (A)R)and ((A)S, (B)S). If (L)S is a T-extension or (and) H-extension of (L)R, we show that (L)S is a (resp., monomorphic, epimorphic, special) preenveloping class if and only if so is (L)R. If (S, S) is a TH-extension of ((A)R,(B)R), we obtain that ((A)S,(B)S) is complete (resp., of finite type, of cofinite type, hereditary, perfect, n-tilting) if and only if so is ((A)R,(B)R).

  4. Multi-pair states in electron–positron pair creation

    Directory of Open Access Journals (Sweden)

    Anton Wöllert

    2016-09-01

    Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  5. Experimental many-pairs nonlocality

    Science.gov (United States)

    Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian

    2017-08-01

    Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

  6. Vortex-Antivortex Pair Production in a First Order Phase Transition

    CERN Document Server

    Digal, S; Srivastava, A M; Digal, Sanatan; Sengupta, Supratim; Srivastava, Ajit M.

    1997-01-01

    We carry out numerical simulation of a first order phase transition in 2+1 dimensions by randomly nucleating bubbles, and study the formation of global U(1) vortices. Bubbles grow and coalesce and vortices are formed at junctions of bubbles via standard Kibble mechanism as well as due to a new mechanism, recently proposed by us, where defect-antidefect pairs are produced due to field oscillations. We make a comparative study of the contribution of both of these mechanisms for vortex production. We find that, for high nucleation rate of bubbles, vortex-antivortex pairs produced via the new mechanism have overlapping configurations, and annihilate quickly; so only those vortices survive till late which are produced via the Kibble mechanism. However, for low nucleation rates, bubble collisions are energetic enough to lead to many well separated vortex-antivortex pairs being produced via the new mechanism. For example, in a simulation involving nucleation of 20 bubbles, a total of 14 non-overlapping vortices and ...

  7. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  8. Pairing the Volcano

    CERN Document Server

    Ionica, Sorina

    2011-01-01

    Isogeny volcanoes are graphs whose vertices are elliptic curves and whose edges are $\\ell$-isogenies. Algorithms allowing to travel on these graphs were developed by Kohel in his thesis (1996) and later on, by Fouquet and Morain (2001). However, up to now, no method was known, to predict, before taking a step on the volcano, the direction of this step. Hence, in Kohel's and Fouquet-Morain algorithms, many steps are taken before choosing the right direction. In particular, ascending or horizontal isogenies are usually found using a trial-and-error approach. In this paper, we propose an alternative method that efficiently finds all points $P$ of order $\\ell$ such that the subgroup generated by $P$ is the kernel of an horizontal or an ascending isogeny. In many cases, our method is faster than previous methods. This is an extended version of a paper published in the proceedings of ANTS 2010. In addition, we treat the case of 2-isogeny volcanoes and we derive from the group structure of the curve and the pairing ...

  9. Multiple origins of asteroid pairs

    CERN Document Server

    Jacobson, Seth A

    2015-01-01

    Rotationally fissioned asteroids produce unbound daughter asteroids that have very similar heliocentric orbits. Backward integration of their current heliocentric orbits provides an age of closest proximity that can be used to date the rotational fission event. Most asteroid pairs follow a predicted theoretical relationship between the primary spin period and the mass ratio of the two pair members that is a direct consequence of the YORP-induced rotational fission hypothesis. If the progenitor asteroid has strength, asteroid pairs may have high mass ratios with possibly fast rotating primaries. However, secondary fission leaves the originally predicted trend unaltered. We also describe the characteristics of pair members produced by four alternative routes from a rotational fission event to an asteroid pair. Unlike direct formation from the event itself, the age of closest proximity of these pairs cannot generally be used to date the rotational fission event since considerable time may have passed.

  10. Object Matching Across Multiple Non-overlapping Fields of View Using Fuzzy Logic%基于模糊逻辑的多相机非重叠场景的物体匹配

    Institute of Scientific and Technical Information of China (English)

    LOKE Yuan Ren; KUMAR Pankaj; RANGANATH Surendra; 黄为民

    2006-01-01

    An approach based on fuzzy logic for matching both articulated and non-articulated objects across multiple non-overlapping field of views (FoVs) from multiple cameras is proposed.We call it fuzzy logic matching algorithm (FLMA). The approach uses the information of object motion, shape and camera topology for matching objects across camera views. The motion and shape information of targets are obtained by tracking them using a combination of ConDensation and CAMShift tracking algorithms. The information of camera topology is obtained and used by calculating the projective transformation of each view with the common ground plane. The algorithm is suitable for tracking non-rigid objects with both linear and non-linear motion. We show videos of tracking objects across multiple cameras based on FLMA. From our experiments, the system is able to correctly match the targets across views with a high accuracy.

  11. 无交叠垂直梳齿平动微镜的驱动特性%Driving characteristics of non-overlap vertical electrostatic combdriver for optical translational micromirror

    Institute of Scientific and Technical Information of China (English)

    翟雷应; 徐静; 钟少龙; 吴亚明

    2012-01-01

    To design a non-overlap vertical electrostatic combdriver for the optical translational micromirror of ..an optical phase modulator, a mathematic model based on the conformal mapping was built to research the driving performance of the combdriver in detail. According to the theory of complex variable function, an analytical model was established for the electrostatic field of comb actuator by conformal mapping. Then, the electrostatic force in a certain displacement range was deduced by the analytical model for researching the movable comb finger. The results were compared with the corresponding resolution by the Finite Element Method (FEM). Finally, a non-overlap vertical combdriver was successfully fabricated by Micro Electronic Mechanic System(MEMS) process, and an optical Michelson interference system was constructed to measure the static driving charateristics of thecomb driver. The result shows that the displacement of proposed non-overlap vertical electrostatic combdriver is 325 nm (phase difference 2-n) with a dc driving voltage of 28 V and the offset vertical comb actuator can be actuated to 2. 07 pm under a dc driving voltage of 90 V. The measured results accord excellently with the simulated results using the conformal mapping and FEM method, which proves proposed analytical model to be correct. It can provide theoretical and pratical bases for design of non-overlap vertical electrostatic combdrivers.%为了设计用于光相位调制器平动微镜的无交叠梳齿驱动器,建立了保角变换数学模型,研究了驱动器的驱动特性.从复变函数理论出发,建立了驱动器的保角变换静电场解析模型;以动齿受力为研究对象,根据不同情形下的动齿受力特点,求解了一定区间内动齿的静电力并与有限元模拟计算结果进行了对比分析.采用微机电系统(MEMS)工艺制作出了无交叠梳齿驱动器,搭建了Michelson干涉仪光学测试系统,测试了无交叠梳齿驱动器的静态驱

  12. PERIODIC COMPLEMENTARY BINARY SEQUENCE PAIRS

    Institute of Scientific and Technical Information of China (English)

    XuChengqian; ZhaoXiaoqun

    2002-01-01

    A new set of binary sequences-Periodic Complementary Binary Sequence Pair (PCSP)is proposed .A new class of block design-Difference Family Pair (DFP)is also proposed .The relationship between PCSP and DFP,the properties and exising conditions of PCSP and the recursive constructions for PCSP are given.

  13. PERIODIC COMPLEMENTARY BINARY SEQUENCE PAIRS

    Institute of Scientific and Technical Information of China (English)

    Xu Chengqian; Zhao Xiaoqun

    2002-01-01

    A new set of binary sequences-Periodic Complementary Binary Sequence Pair (PCSP) is proposed. A new class of block design-Difference Family Pair (DFP) is also proposed.The relationship between PCSP and DFP, the properties and existing conditions of PCSP and the recursive constructions for PCSP are given.

  14. Assessment Strategies for Pair Programming

    Science.gov (United States)

    Hahn, Jan Hendrik; Mentz, Elsa; Meyer, Lukas

    2009-01-01

    Although pair programming has proved its usefulness in teaching and learning programming skills, it is difficult to assess the individual roles and abilities of students whilst programming in pairs. (Note that within this manuscript, the term assessment refers to evaluating individual student performance.) Assessing only the outcomes of a pair…

  15. Instability of vortex pair leapfrogging

    DEFF Research Database (Denmark)

    Tophøj, Laust; Aref, Hassan

    2013-01-01

    pairs fly off to infinity, and a "walkabout" mode, where the vortices depart from leapfrogging but still remain within a finite distance of one another. We show numerically that this transition is more gradual, a result that we relate to earlier investigations of chaotic scattering of vortex pairs [L...

  16. Kramers Pairs in configuration interaction

    DEFF Research Database (Denmark)

    Avery, John Scales; Avery, James Emil

    2003-01-01

    The theory of symmetry-preserving Kramers pair creation operators is reviewed and formulas for applying these operators to configuration interaction calculations are derived. A new and more general type of symmetry-preserving pair creation operator is proposed and shown to commute with the total...

  17. Stereo Pair: Patagonia, Argentina

    Science.gov (United States)

    2000-01-01

    This view of northern Patagonia, near El Cain, Argentina shows complexly eroded volcanic terrain, with basalt mesas, sinkholes, landslide debris, playas, and relatively few integrated drainage channels. Surrounding this site (but also extending far to the east) is a broad plateau capped by basalt, the Meseta de Somuncura. Here, near the western edge of the plateau, erosion has broken through the basalt cap in a variety of ways. On the mesas, water-filled sinkholes (lower left) are most likely the result of the collapse of old lava tubes. Along the edges of the mesas (several locations) the basalt seems to be sliding away from the plateau in a series of slices. Water erosion by overland flow is also evident, particularly in canyons where vegetation blankets the drainage channels (green patterns, bottom of image). However, overland water flow does not extend very far at any location. This entire site drains to local playas, some of which are seen here (blue). While the water can reach the playas and then evaporate, what becomes of the eroded rock debris? Wind might excavate some of the finer eroded debris, but the fate of much of the missing bedrock remains mysterious.This cross-eyed stereoscopic image pair was generated using topographic data from the Shuttle Radar Topography Mission, combined with an enhanced Landsat 7 satellite color image. The topography data are used to create two differing perspectives of a single image, one perspective for each eye. In doing so, each point in the image is shifted slightly, depending on its elevation. When stereoscopically merged, the result is a vertically exaggerated view of the Earth's surface in its full three dimensions.Landsat satellites have provided visible light and infrared images of the Earth continuously since 1972. SRTM topographic data match the 30-meter (99-foot) spatial resolution of most Landsat images and provide a valuable complement for studying the historic and growing Landsat data archive. The Landsat 7

  18. Pairing correlations in exotic nuclei

    CERN Document Server

    Sagawa, H

    2012-01-01

    The BCS and HFB theories which can accommodate the pairing correlations in the ground states of atomic nuclei are presented. As an application of the pairing theories, we investigate the spatial extension of weakly bound Ne and C isotopes by taking into account the pairing correlation with the Hartree-Fock-Bogoliubov (HFB) method and a 3-body model, respectively. We show that the odd-even staggering in the reaction cross sections of $^{30,31,32}$Ne and $^{14,15,16}$C are successfully reproduced, and thus the staggering can be attributed to the unique role of pairing correlations in nuclei far from the stability line. A correlation between a one-neutron separation energy and the anti-halo effect is demonstrated for $s$- and p-waves using the HFB wave functions. We also propose effective density-dependent pairing interactions which reproduce both the neutron-neutron ($nn$) scattering length at zero density and the neutron pairing gap in uniform matter. Then, we apply these interactions to study pairing gaps in ...

  19. Pairing Correlations at High Spins

    Science.gov (United States)

    Ma, Hai-Liang; Dong, Bao-Guo; Zhang, Yan; Fan, Ping; Yuan, Da-Qing; Zhu, Shen-Yun; Zhang, Huan-Qiao; Petrache, C. M.; Ragnarsson, I.; Carlsson, B. G.

    The pairing correcting energies at high spins in 161Lu and 138Nd are studied by comparing the results of the cranked-Nilsson-Strutinsky (CNS) and cranked-Nilsson-Strutinsky-Bogoliubov (CNSB) models. It is concluded that the Coriolis effect rather than the rotational alignment effect plays a major role in the reduction of the pairing correlations in the high spin region. Then we proposed an average pairing correction method which not only better reproduces the experimental data comparing with the CNS model but also enables a clean-cut tracing of the configurations thus the full-spin-range discussion on the various rotating bands.

  20. Exact solution for generalized pairing

    OpenAIRE

    Pan, Feng; J.P. Draayer

    1997-01-01

    An infinite dimensional algebra, which is useful for deriving exact solutions of the generalized pairing problem, is introduced. A formalism for diagonalizing the corresponding Hamiltonian is also proposed. The theory is illustrated with some numerical examples.

  1. Pairing versus quarteting coherence length

    CERN Document Server

    Delion, Doru S

    2015-01-01

    We systematically analyse the coherence length in even-even nuclei. The pairing coherence length in the spin-singlet channel for the effective density dependent delta (DDD) and Gaussian interaction is estimated. We consider in our calculations bound states as well as narrow resonances. It turns out that the pairing gaps given by the DDD interaction are similar to those of the Gaussian potential if one renormalizes the radial width to the nuclear radius. The correlations induced by the pairing interaction have in all considered cases a long range character inside the nucleus and decrease towards the surface. The mean coherence length is larger than the geometrical radius for light nuclei and approaches this value for heavy nuclei. The effect of the temperature and states in continuum is investigated. Strong shell effects are evidenced, especially for protons. We generalize this concept to quartets by considering similar relations, but between proton and neutron pairs. The quartet coherence length has a similar...

  2. Pairing mechanisms for binary stars

    CERN Document Server

    Kouwenhoven, M B N; Goodwin, S P; Zwart, S F Portegies; Kaper, L; 10.1002/asna.200811061

    2008-01-01

    Knowledge of the binary population in stellar groupings provides important information about the outcome of the star forming process in different environments. Binarity is also a key ingredient in stellar population studies and is a prerequisite to calibrate the binary evolution channels. In these proceedings we present an overview of several commonly used methods to pair individual stars into binary systems, which we refer to as the pairing function. Many pairing functions are frequently used by observers and computational astronomers, either for the mathematical convenience, or because they roughly describe the expected outcome of the star forming process. We discuss the consequences of each pairing function for the interpretation of observations and numerical simulations. The binary fraction and mass ratio distribution generally depend strongly on the selection of the range in primary spectral type in a sample. These quantities, when derived from a binary survey with a mass-limited sample of target stars, ...

  3. Atomic pair-state interferometer

    DEFF Research Database (Denmark)

    Nipper, J.; Balewski, Jonathan B.; Krupp, Alexander T.

    2012-01-01

    to measure the phase shift. Although the coupling between pair states is coherent on the time scale of the experiment, a loss of visibility occurs as a pair-state interferometer involves three simultaneously interfering paths and only one of them is phase shifted by the mutual interaction. Despite additional...... dephasing mechanisms, a pulsed Förster coupling sequence allows for observation of coherent dynamics around the Förster resonance....

  4. Dual pairs in fluid dynamics

    CERN Document Server

    Gay-Balmaz, François

    2010-01-01

    This paper is a rigorous study of the dual pair structure of the ideal fluid and the dual pair structure for the $n$-dimensional Camassa-Holm (EPDiff) equation, including the proofs of the necessary transitivity results. In the case of the ideal fluid, we show that a careful definition of the momentum maps leads naturally to central extensions of diffeomorphism groups such as the group of quantomorphisms and the Ismagilov central extension.

  5. Pair programming: more than just working together in pairs.

    Directory of Open Access Journals (Sweden)

    Elsa Mentz

    2012-03-01

    Full Text Available Pair programming originated in the industry where focus is placed on the development of a programme at the most costand time-effective manner, and within the parameters of quality. In this context, a specific programming code is not developed individually; rather, two people work together in order to ensure a higher quality programming code and to motivate each other to work at a faster pace. The problem with this approach was that novice programmers lacked the social skills to work in pairs as they had not been exposed to this sufficiently at tertiary level. The demand of the industry, especially in terms of programmers needing to be able to programme together, led to the incorporation of pair programming at tertiary level in the late nineties. The pedagogical principles on which any teaching-learning strategy should be built were, however, largely overlooked during this process. This article firstly looks into the semantic and ontological differences between co-operative and collaborative learning and secondly argues that pair programming, within the context of a social constructivist approach to teaching and learning, can be seen as a co-operative teaching-learning strategy. Pair programming is more than just allowing two students to work together on a programming task. The more structured way, in which pair programming needs to be implemented, concur with the principles of co-operative learning. The article concludes that the correct pedagogical application of pair programming as a co-operative teaching-learning strategy in tertiary education will result in improved learning capital.

  6. A disease causing deletion of 29 base pairs in intron 15 in the MKS1 gene is highly associated with the campomelic variant of the Meckel-Gruber syndrome.

    Science.gov (United States)

    Auber, B; Burfeind, P; Herold, S; Schoner, K; Simson, G; Rauskolb, R; Rehder, H

    2007-11-01

    Meckel-Gruber syndrome (MKS) is an autosomal recessive disorder causing severe defects in the developing central nervous system and other organs. Recently, mutations in the MKS1 gene have been identified as disease causing in individuals of Finnish MKS families. The primary aim of the present study was to assess the frequency of the 'Finnish founder mutation' (29 bp IVS15-7_35) in the MKS1 gene in 20 aborted fetuses with a diagnosis of MKS. The secondary aim was to screen for novel mutations in the coding sequence of the MKS1 gene of MKS fetuses and to obtain genotype-phenotype correlations where possible. Furthermore, we evaluated the carrier rate of a deletion of 29 bp in intron 15 of the MKS1 gene in a German population. To identify and characterize mutations in the MKS1 gene, sequence analyses and quantitative real time polymerase chain reaction studies were performed. We could identify the same type of mutation, a deletion of 29 bp in intron 15 of the MKS1 gene, in 8 out of the 20 cases studied. Six out of the eight cases with such a mutation displayed the campomelic variant of MKS. The carrier frequency among 519 healthy German individuals was 1:260. This deletion in the MKS1 gene is highly associated with a distinct subtype of the MKS, namely the campomelic variant. In individuals of European origin suffering from the campomelic MKS variant, the described deletion is highly likely to be causative. Regarding the results of our study, the incidence of MKS in Germany can be estimated as 1:135,000. In families with a known mutation in the MKS1 gene, it is now possible to offer an early prenatal testing, for example with chorionic villus sampling and mutation analysis.

  7. Counting pairs of faint galaxies

    CERN Document Server

    Woods, D; Richer, H B; Woods, David; Fahlman, Gregory G; Richer, Harvey B

    1995-01-01

    The number of close pairs of galaxies observed to faint magnitude limits, when compared to nearby samples, determines the interaction or merger rate as a function of redshift. The prevalence of mergers at intermediate redshifts is fundamental to understanding how galaxies evolve and the relative population of galaxy types. Mergers have been used to explain the excess of galaxies in faint blue counts above the numbers expected from no-evolution models. Using deep CFHT (I\\leq24) imaging of a ``blank'' field we find a pair fraction which is consistent with the galaxies in our sample being randomly distributed with no significant excess of ``physical'' close pairs. This is contrary to the pair fraction of 34\\%\\pm9\\% found by Burkey {\\it et al.} for similar magnitude limits and using an identical approach to the pair analysis. Various reasons for this discrepancy are discussed. Colors and morphologies of our close pairs are consistent with the bulk of them being random superpositions although, as indicators of int...

  8. Three carbon pairs in Si

    Energy Technology Data Exchange (ETDEWEB)

    Docaj, A. [Physics Department, Texas Tech University, Lubbock, TX 79409-1051 (United States); Estreicher, S.K., E-mail: Stefan.Estreicher@ttu.edu [Physics Department, Texas Tech University, Lubbock, TX 79409-1051 (United States)

    2012-08-01

    Carbon impurities in Si are common in floating-zone and cast-Si materials. The simplest and most discussed carbon complex is the interstitial-substitutional C{sub i}C{sub s} pair, which readily forms when self-interstitials are present in the material. This pair has three possible configurations, each of which is electrically active. The less common C{sub s}C{sub s} pair has been studied in irradiated material but has also recently been seen in as-grown C-rich cast-Si, which is commonly used to fabricate solar cells. The third pair consists of two interstitial C atoms: C{sub i}C{sub i}. Although its formation probability is low for several reasons, the C{sub i}C{sub i} pair is very stable and electrically inactive. In this contribution, we report preliminary results of first-principles calculations of these three C pairs in Si. The structures, binding energies, vibrational spectra, and electrical activity are predicted.

  9. Superconductivity: The persistence of pairs

    Energy Technology Data Exchange (ETDEWEB)

    Edelman, Alex; Littlewood, Peter

    2015-05-20

    Superconductivity stems from a weak attraction between electrons that causes them to form bound pairs and behave much like bosons. These so-called Cooper pairs are phase coherent, which leads to the astonishing properties of zero electrical resistance and magnetic flux expulsion typical of superconducting materials. This coherent state may be qualitatively understood within the Bose–Einstein condensate (BEC) model, which predicts that a gas of interacting bosons will become unstable below a critical temperature and condense into a phase of matter with a macroscopic, coherent population in the lowest energy state, as happens in 4He or cold atomic gases. The successful theory proposed by Bardeen, Cooper and Schrieffer (BCS) predicts that at the superconducting transition temperature Tc, electrons simultaneously form pairs and condense, with no sign of pairing above Tc. Theorists have long surmised that the BCS and BEC models are opposite limits of a single theory and that strong interactions or low density can, in principle, drive the system to a paired state at a temperature Tpair higher than Tc, making the transition to the superconducting state BEC-like (Fig. 1). Yet most superconductors to date are reasonably well described by BCS theory or its extensions, and there has been scant evidence in electronic materials for the existence of pairing independent of the full superconducting state (though an active debate rages over the cuprate superconductors). Writing in Nature, Jeremy Levy and colleagues have now used ingenious nanostructured devices to provide evidence for electron pairing1. Perhaps surprisingly, the material they have studied is a venerable, yet enigmatic, low-temperature superconductor, SrTiO3.

  10. Paired structures in knowledge representation

    DEFF Research Database (Denmark)

    Montero, J.; Bustince, H.; Franco de los Ríos, Camilo;

    2016-01-01

    In this position paper we propose a consistent and unifying view to all those basic knowledge representation models that are based on the existence of two somehow opposite fuzzy concepts. A number of these basic models can be found in fuzzy logic and multi-valued logic literature. Here it is clai......In this position paper we propose a consistent and unifying view to all those basic knowledge representation models that are based on the existence of two somehow opposite fuzzy concepts. A number of these basic models can be found in fuzzy logic and multi-valued logic literature. Here...... of paired structures, generated from two paired concepts together with their associated neutrality, all of them to be modeled as fuzzy sets. In this way, paired structures can be viewed as a standard basic model from which different models arise. This unifying view should therefore allow a deeper analysis...

  11. Organometallic frustrated Lewis pair chemistry.

    Science.gov (United States)

    Erker, Gerhard

    2011-08-07

    Frustrated Lewis pairs are playing an increasingly important role in organometallic chemistry. Examples are presented and discussed where organometallic systems themselves serve as the Lewis base or Lewis acid components in frustrated Lewis pair chemistry, mostly through their attached functional groups. Activation of dihydrogen takes place easily in many of these systems. This may lead to the generation of novel catalyst systems but also in many cases to the occurrence of specific reactions at the periphery of the organometallic frameworks. Increasingly, FLP reactions are used to carry out functional group conversions in organometallic systems under mild reaction conditions. The limits of typical FLP reactivity are explored with selected organometallic examples, a discussion that points toward new developments, such as the discovery of facile new 1,1-carboboration reactions. Learning more and more about the broad spectrum of frustrated Lewis pair chemistry helps us to find novel reactions and applications.

  12. Exlusive charmed meson pair production

    CERN Document Server

    Berezhnoy, A V

    2004-01-01

    The experimental data of BELLE Collaboration on the exclusive charmed meson pair production in the process of monophotonic $e^+e^-$-annihilation ($e^+e^-\\to \\gamma^* \\to D\\bar D$) has been studied. It has been shown that these data is described satisfactorily in the frame work of constituent quark model. Our studies have demonstrated that the central production process $e^+e^-\\to e^+e^-\\gamma\\gamma \\to e^+e^-D\\bar D +X$ and the process of monophotonic $e^+e^-$-annihilation yield comparable numbers of the charmed meson pairs.

  13. Instantons in lepton pair production

    Energy Technology Data Exchange (ETDEWEB)

    Brandenburg, A.; Ringwald, A. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Utermann, A. [Vrije Univ., Amsterdam (Netherlands). Dept. of Physics and Astronomy

    2006-05-15

    We consider QCD instanton-induced contributions to lepton pair production in hadron-hadron collisions. We relate these contributions to those known from deep inelastic scattering and demonstrate that they can be calculated reliably for sufficiently large momentum transfer. We observe that the instanton contribution to the angular distribution of the lepton pairs at finite momentum transfer strongly violates the Lam-Tung relation - a relation between coefficient functions of the angular distribution which is valid within the framework of ordinary perturbation theory. The drastic violation of this relation, as seen in experimental data, might be related to such instanton-induced effects. (Orig.)

  14. Electron pair creation by photons

    NARCIS (Netherlands)

    Holtwijk, Theodoor

    1960-01-01

    In our experiment on the creation of electron pairs a 5 MeV betatron was used as radiation source and a cloud chamber (with magnetic field) was used as detection instrument. The experimental arrangement is described in section 2.1. The cloud chamber was of the overcompression type so that the recove

  15. Pairs of dual periodic frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Goh, Say Song

    2012-01-01

    is needed. The purpose of the present paper is to provide constructions of dual pairs of frames in the setting of the Hilbert space of periodic functions L2(0,2π). The frames constructed are given explicitly as trigonometric polynomials, which allows for an efficient calculation of the coefficients...

  16. Electron pair creation by photons

    NARCIS (Netherlands)

    Holtwijk, Theodoor

    1960-01-01

    In our experiment on the creation of electron pairs a 5 MeV betatron was used as radiation source and a cloud chamber (with magnetic field) was used as detection instrument. The experimental arrangement is described in section 2.1. The cloud chamber was of the overcompression type so that the recove

  17. Evolutionary Transitions of MicroRNA-Target Pairs

    KAUST Repository

    Nozawa, Masafumi

    2016-04-27

    How newly generated microRNA (miRNA) genes are integrated into gene regulatory networks during evolution is fundamental in understanding the molecular and evolutionary bases of robustness and plasticity in gene regulation. A recent model proposed that after the birth of a miRNA, the miRNA is generally integrated into the network by decreasing the number of target genes during evolution. However, this decreasing model remains to be carefully examined by considering in vivo conditions. In this study, we therefore compared the number of target genes among miRNAs with different ages, combining experiments with bioinformatics predictions. First, we focused on three Drosophila miRNAs with different ages. As a result, we found that an older miRNA has a greater number of target genes than a younger miRNA, suggesting the increasing number of targets for each miRNA during evolution (increasing model). To further confirm our results, we also predicted all target genes for all miRNAs in D. melanogaster, considering co-expression of miRNAs and mRNAs in vivo. The results obtained also do not support the decreasing model but are reasonably consistent with the increasing model of miRNA-target pairs. Furthermore, our large-scale analyses of currently available experimental data of miRNA-target pairs also showed a weak but the same trend in humans. These results indicate that the current decreasing model of miRNA-target pairs should be reconsidered and the increasing model may be more appropriate to explain the evolutionary transitions of miRNA-target pairs in many organisms.

  18. Generation of non-overlapping fiber architecture

    DEFF Research Database (Denmark)

    Chapelle, Lucie; Lévesque, M.; Brøndsted, Povl

    2015-01-01

    of overlapping sphero-cylinders. At the end of the first step, a system of overlapping fibers is obtained. In order to obtain a hard-core configuration where fibers cannot overlap other fibers, we use an iterative method called the force-biased algorithm. It applies virtual forces on each point of the fiber...

  19. Finding nonoverlapping substructures of a sparse matrix

    Energy Technology Data Exchange (ETDEWEB)

    Pinar, Ali; Vassilevska, Virginia

    2004-08-09

    Many applications of scientific computing rely on computations on sparse matrices, thus the design of efficient implementations of sparse matrix kernels is crucial for the overall efficiency of these applications. Due to the high compute-to-memory ratio and irregular memory access patterns, the performance of sparse matrix kernels is often far away from the peak performance on a modern processor. Alternative data structures have been proposed, which split the original matrix A into A{sub d} and A{sub s}, so that A{sub d} contains all dense blocks of a specified size in the matrix, and A{sub s} contains the remaining entries. This enables the use of dense matrix kernels on the entries of A{sub d} producing better memory performance. In this work, we study the problem of finding a maximum number of non overlapping rectangular dense blocks in a sparse matrix, which has not been studied in the sparse matrix community. We show that the maximum non overlapping dense blocks problem is NP-complete by using a reduction from the maximum independent set problem on cubic planar graphs. We also propose a 2/3-approximation algorithm for 2 times 2 blocks that runs in linear time in the number of nonzeros in the matrix. We discuss alternatives to rectangular blocks such as diagonal blocks and cross blocks and present complexity analysis and approximation algorithms.

  20. Skew Pairs of Idempotents in Transformation Semigroups

    Institute of Scientific and Technical Information of China (English)

    T. S. BLYTH; M. H. ALMEIDA SANTOS

    2006-01-01

    An ordered pair (e, f) of idempotents of a regular semigroup is called a skew pair if ef is not idempotent whereas fe is idempotent. We have shown previously that there are four distinct types of skew pairs of idempotents. Here we investigate the ubiquity of such skew pairs in full transformation semigroups.

  1. Application of Non-overlapping Mortar Finite Element Method to Electromagnetic Analysis%非重叠Mortar有限元法在电磁分析中的应用

    Institute of Scientific and Technical Information of China (English)

    刘守豹; 阮江军; 彭迎; 杜志叶; 黄道春; 王栋

    2011-01-01

    The mortar element method (MEM) is a new domain decomposition technique. MEM allows to take benefit of the presence of the subdomains in order to choose the discretization method, which is best adapted to the local behavior of the solution of the partial differential equation. In mortar finite element method (MFEI~I) a discretized mortar space is introduced to approximate the original continuous function space. The continuity of degree of freedoms across the non-conforming interface is ensured by the surface integration in a weak sense. The MFEM could "Mortar" the inter face between subdomains effectively. This paper gave the fundamental of non-overlapping MFEM (NO-MFEM); the procedures of calculating the mortar condition were discussed; the calculation and construction of the global matrix was proposed. By two dimensional static magnetic model and three dimensional electrostatic model, the validity of NO-MFEM was proved. This work is fundamental for extending MFEM to the other applications in computational electromagnetics.%Mortar元法(mortarelement method,MEM)是一种新型区域分解算法,它允许将求解区域分解为多个子域,在各个区域以最适合子域特征的方式离散。在各个区域的交界面上,边界节点不要求逐点匹配,而是通过建立加权积分形式的Mortar条件使得交界面上的传递条件在分布意义上满足。Mortar有限元法(mortar finite element method,MFEM)将MEM和有限元法(finite element method,FEM)相结合,在各区域中分别使用FEM网格离散,区域的交界面上通

  2. Pairing theory of striped superconductivity

    Energy Technology Data Exchange (ETDEWEB)

    Loder, Florian; Kampf, Arno P.; Kopp, Thilo; Graser, Siegfried [Center for Electronic Correlations and Magnetism, Institute of Physics, Augsburg (Germany)

    2011-07-01

    Striped high-T{sub c} superconductors such as La{sub 7/8}Ba{sub 1/8}CuO{sub 4} show a fascinating competition between spin and charge order on the one hand and superconductivity on the other. A theory for these systems therefore has to capture both the spin correlations in an antiferromagnet and the pair-correlation of a superconductor. For this purpose we have developed an effective Hartree-Fock theory by merging electron pairing with finite center-of-mass momentum and antiferromagnetism. We show that this theory reproduces the key experimental features such as the formation of the antiferromagnetic stripe patterns at 7/8 band filling or the quasi one-dimensional electronic structure observed by photoemission spectroscopy.

  3. Collisions of Vortex Filament Pairs

    Science.gov (United States)

    Banica, Valeria; Faou, Erwan; Miot, Evelyne

    2014-12-01

    We consider the problem of collisions of vortex filaments for a model introduced by Klein et al. (J Fluid Mech 288:201-248, 1995) and Zakharov (Sov Phys Usp 31(7):672-674, 1988, Lect. Notes Phys 536:369-385, 1999) to describe the interaction of almost parallel vortex filaments in three-dimensional fluids. Since the results of Crow (AIAA J 8:2172-2179, 1970) examples of collisions are searched as perturbations of antiparallel translating pairs of filaments, with initial perturbations related to the unstable mode of the linearized problem; most results are numerical calculations. In this article, we first consider a related model for the evolution of pairs of filaments, and we display another type of initial perturbation leading to collision in finite time. Moreover, we give numerical evidence that it also leads to collision through the initial model. We finally study the self-similar solutions of the model.

  4. Septin pairs, a complex choreography.

    Science.gov (United States)

    Ewers, Helge

    2011-06-13

    Septins form a filamentous collar at the mother-bud neck in budding yeast. In cytokinesis, this collar splits into two rings and the septin complexes undergo a dramatic reorientation. Using fluorescence polarization microscopy, DeMay et al. (2011. J. Cell Biol. doi:10.1083/jcb.201012143) now demonstrate that septin complexes assemble as paired filaments in vivo and reveal new insights into septin organization during cytokinesis.

  5. Triplet Pairing in Neutron Matter

    CERN Document Server

    Khodel, V V; Clark, J W

    2001-01-01

    The separation method developed earlier by us [Nucl. Phys. {\\bf A598} 390 (1996)] to calculate and analyze solutions of the BCS gap equation for $^1$S$_0$ pairing is extended and applied to $^3$P$_2$--$^3$F$_2$ pairing in pure neutron matter. The pairing matrix elements are written as a separable part plus a remainder that vanishes when either momentum variable is on the Fermi surface. This decomposition effects a separation of the problem of determining the dependence of the gap components in a spin-angle representation on the magnitude of the momentum (described by a set of functions independent of magnetic quantum number) from the problem of determining the dependence of the gap on angle or magnetic projection. The former problem is solved through a set of nonsingular, quasilinear integral equations, providing inputs for solution of the latter problem through a coupled system of algebraic equations for a set of numerical coefficients. An incisive criterion is given for finding the upper critical density fo...

  6. Morse theory and stable pairs

    CERN Document Server

    Wentworth, Richard A

    2010-01-01

    We study the Morse theory of the Yang-Mills-Higgs functional on the space of pairs $(A,\\Phi)$, where $A$ is a unitary connection on a rank 2 hermitian vector bundle over a compact Riemann surface, and $\\Phi$ is a holomorphic section of $(E, d_A")$. We prove that a certain explicitly defined substratification of the Morse stratification is perfect in the sense of $\\G$-equivariant cohomology, where $\\G$ denotes the unitary gauge group. As a consequence, Kirwan surjectivity holds for pairs. It also follows that the twist embedding into higher degree induces a surjection on equivariant cohomology. This may be interpreted as a rank 2 version of the analogous statement for symmetric products of Riemann surfaces. Finally, we compute the $\\G$-equivariant Poincar\\'e polynomial of the space of $\\tau$-semistable pairs. In particular, we recover an earlier result of Thaddeus. The analysis provides an interpretation of the Thaddeus flips in terms of a variation of Morse functions.

  7. Mediators of homologous DNA pairing.

    Science.gov (United States)

    Zelensky, Alex; Kanaar, Roland; Wyman, Claire

    2014-10-09

    Homologous DNA pairing and strand exchange are at the core of homologous recombination. These reactions are promoted by a DNA-strand-exchange protein assembled into a nucleoprotein filament comprising the DNA-pairing protein, ATP, and single-stranded DNA. The catalytic activity of this molecular machine depends on control of its dynamic instability by accessory factors. Here we discuss proteins known as recombination mediators that facilitate formation and functional activation of the DNA-strand-exchange protein filament. Although the basics of homologous pairing and DNA-strand exchange are highly conserved in evolution, differences in mediator function are required to cope with differences in how single-stranded DNA is packaged by the single-stranded DNA-binding protein in different species, and the biochemical details of how the different DNA-strand-exchange proteins nucleate and extend into a nucleoprotein filament. The set of (potential) mediator proteins has apparently expanded greatly in evolution, raising interesting questions about the need for additional control and coordination of homologous recombination in more complex organisms. Copyright © 2014 Cold Spring Harbor Laboratory Press; all rights reserved.

  8. [The pairing, synapsis and recombination of meiosis in plant].

    Science.gov (United States)

    Liu, Chun-Xia; He, Qun-Yan; Jin, Wei-Wei

    2010-12-01

    Meiosis is the crucial step for sexual reproduction, while the pairing, synapsis and recombination are the key events in this process and have become the hotspots in meiosis studies. In recent years, with the development of the molecular biology and cell biology, associated with the mutant screened from mutant libraries, much advances were achieved in pairing, synapsis and recombination of meiosis in plant. In this review, we have gave an overview of the genes identification in this field and further studies of its molecular mechanism in plant.

  9. Pair interaction of bilayer-coated nanoscopic particles

    Institute of Scientific and Technical Information of China (English)

    Zhang Qi-Yi

    2009-01-01

    The pair interaction between bilayer membrane-coated nanosized particles has been explored by using the self-consistent field (SCF) theory. The bilayer membranes are composed of amphiphilic polymers. For different system parameters, the pair-interaction free energies are obtained. Particular emphasis is placcd on the analysis of a sequence of structural transformations of bilayers on spherical particles, which occur during their approaching processes. For different head fractions of amphiphilcs, the asymmetrical morphologies between bilayers on two particles and the inverted micellar intermediates have been found in the membrane fusion pathway. These results can benefit the fabrication of vesicles as encapsulation vectors for drug and gene delivery.

  10. Class II genes of miniature swine. II. Molecular identification and characterization of B (beta) genes from the SLAc haplotype.

    Science.gov (United States)

    Pratt, K; Sachs, D H; Germana, S; el-Gamil, M; Hirsch, F; Gustafsson, K; LeGuern, C

    1990-01-01

    Genomic clones corresponding to class II beta genes of the SLAc haplotype of miniature swine have been isolated and characterized. These genes have been grouped into seven non-overlapping clusters on the basis of restriction mapping. Ordering of exons within each cluster was accomplished by hybridization of Southern blots of restriction fragments with exon-specific probes. The two clusters (clusters 2 and 3) encoding the DRB and DQB genes were identified on the basis of hybridization with locus-specific 3' untranslated cDNA probes. Cluster 4 contained exons of both DOB and DQB genes, the basis for which remains to be determined. The remaining four clusters (1, 5, 6, 7) were identified as containing DP, DR, and DO coding sequences, respectively, on the basis of sequence analysis. The porcine class II region appears very similar to that of man in number and nature of the class II genes identified and in the intron/exon organization of corresponding genes.

  11. Germline progenitors escape the widespread phenomenon of homolog pairing during Drosophila development.

    Directory of Open Access Journals (Sweden)

    Eric F Joyce

    Full Text Available Homolog pairing, which plays a critical role in meiosis, poses a potential risk if it occurs in inappropriate tissues or between nonallelic sites, as it can lead to changes in gene expression, chromosome entanglements, and loss-of-heterozygosity due to mitotic recombination. This is particularly true in Drosophila, which supports organismal-wide pairing throughout development. Discovered over a century ago, such extensive pairing has led to the perception that germline pairing in the adult gonad is an extension of the pairing established during embryogenesis and, therefore, differs from the mechanism utilized in most species to initiate pairing specifically in the germline. Here, we show that, contrary to long-standing assumptions, Drosophila meiotic pairing in the gonad is not an extension of pairing established during embryogenesis. Instead, we find that homologous chromosomes are unpaired in primordial germ cells from the moment the germline can be distinguished from the soma in the embryo and remain unpaired even in the germline stem cells of the adult gonad. We further establish that pairing originates immediately after the stem cell stage. This pairing occurs well before the initiation of meiosis and, strikingly, continues through the several mitotic divisions preceding meiosis. These discoveries indicate that the spatial organization of the Drosophila genome differs between the germline and the soma from the earliest moments of development and thus argue that homolog pairing in the germline is an active process as versus a passive continuation of pairing established during embryogenesis.

  12. Charge Aspects of Composite Pair Superconductivity

    Science.gov (United States)

    Flint, Rebecca

    2014-03-01

    Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.

  13. Pair Tunneling through Single Molecules

    Science.gov (United States)

    Raikh, Mikhail

    2007-03-01

    Coupling to molecular vibrations induces a polaronic shift, and can lead to a negative charging energy, U. For negative U, the occupation of the ground state of the molecule is even. In this situation, virtual pair transitions between the molecule and the leads can dominate electron transport. At low temperature, T, these transitions give rise to the charge-Kondo effect [1]. We developed the electron transport theory through the negative-U molecule [2] at relatively high T, when the Kondo correlations are suppressed. Two physical ingredients distinguish our theory from the transport through a superconducting grain coupled to the normal leads [3]: (i) in parallel with sequential pair-tunneling processes, single-particle cotunneling processes take place; (ii) the electron pair on the molecule can be created (or annihilated) by two electrons tunneling in from (or out to) opposite leads. We found that, even within the rate-equation description, the behavior of differential conductance through the negative-U molecule as function of the gate voltage is quite peculiar: the height of the peak near the degeneracy point is independent of temperature, while its width is proportional to T. This is in contrast to the ordinary Coulomb-blockade conductance peak, whose integral strength is T-independent. At finite source-drain bias, V>>T, the width of the conductance peak is ˜V, whereas the conventional Coulomb-blockade peak at finite V splits into two sharp peaks at detunings V/2, and -V/2. Possible applications to the gate-controlled current rectification and switching will be discussed. [1] A. Taraphder and P. Coleman, Phys. Rev. Lett. 66, 2814 (1991). [2] J. Koch, M. E. Raikh, and F. von Oppen, Phys. Rev. Lett. 96, 056803 (2006). [3] F. W. J. Hekking, L. I. Glazman, K. A. Matveev, and R. I. Shekhter, Phys. Rev. Lett. 70, 4138 (1993).

  14. Endocrine factors of pair bonding.

    Science.gov (United States)

    Stárka, L

    2007-01-01

    Throughout literature--fiction and poetry, fine arts and music--falling in love and enjoying romantic love plays a central role. While several psychosocial conceptions of pair attachment consider the participation of hormones, human endocrinology has dealt with this theme only marginally. According to some authors in addictology, falling in love shows some signs of hormonal response to stressors with changes in dopamine and serotonin signalling and neurotrophin (transforming growth factor b) concentration. Endorphins, oxytocin and vasopressin may play a role during the later phases of love. However, proof of hormonal events associated with love in humans has, until recently, been lacking.

  15. Top pair production at ATLAS

    Directory of Open Access Journals (Sweden)

    Loginov Andrey

    2013-05-01

    Full Text Available An overview of latest ATLAS measurements of top pair (tt̅ production in proton-proton collisions at the LHC at centre-of-mass energies of 7 and 8 TeV is presented. Measurements of the tt̅ production cross section (σtt̅ in various decay channels, including analyses of differential σtt̅ distributions and a study of jet multiplicity in tt̅ production, as well as searches for tt̅ resonances using boosted top techniques and standard methods, are discussed.

  16. Filipino au pairs on the move

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial interdep......Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial...

  17. Bound Polaron Pair Formation in Poly (phenylenevinylenes)

    Science.gov (United States)

    Rothberg, Lewis

    The following sections are included: * INTRODUCTION * PHOTOGENERATED YIELD OF SINGLET EXCITONS * AGGREGRATION EFFECTS ON EXCITED STATE PHOTO-GENERATION * ASSIGNMENT TO BOUND POLARON PAIRS AND DISCUSSION * PROBLEMS WITH THE BOUND POLARON PAIR PICTURE AND CONCLUSION * REFERENCES

  18. Fision: Nucleon pair breaking before scission

    OpenAIRE

    Montoya, Modesto

    1984-01-01

    In order to explain the odd-even effect observed in low energy fission fragment distributions it has been recently required a double mechanism of nucleon pair breaking: before scission (early pair breaking) and at scission (late pair breaking), respectively. In the present work we show that, using the same formulae but considering only the early pair breaking mechanism, one can reproduce fairly well all the available experimental data on the odd-even effects.

  19. The cytogenetics of homologous chromosome pairing in meiosis in plants.

    Science.gov (United States)

    Bozza, C G; Pawlowski, W P

    2008-01-01

    Three activities hallmark meiotic cell division: homologous chromosome pairing, synapsis, and recombination. Recombination and synapsis are well-studied but homologous pairing still holds many black boxes. In the past several years, many studies in plants have yielded insights into the mechanisms of chromosome pairing interactions. Research in several plant species showed the importance of telomere clustering on the nuclear envelope (telomere bouquet formation) in facilitating alignment of homologous chromosomes. Homologous pairing was also shown to be tied to the early stages of recombination by mutant analyses in Arabidopsis and maize. In contrast, little is known about the mechanisms that guide homolog interaction after their rough alignment by the bouquet and before the close-range recombination-dependent homology search. The relatively large and complex genomes of plants may require additional mechanisms, not needed in small genome eukaryotes, to distinguish between local homology of duplicated genes or transposable elements and global chromosomal homology. Plants provide an excellent large genome model for the study of homologous pairing and dissection of this process. 2008 S. Karger AG, Basel

  20. Drift wave in pair-ion plasma

    Indian Academy of Sciences (India)

    Samiran Ghosh; Nikhil Chakrabarti; Manoranjan Khan; M R Gupta

    2013-02-01

    The conditions for the existence of low-frequency electrostatic drift wave in pair-ion plasma are discussed. It is shown that the temperature and/or mass difference of both species could produce drift wave in a pair-ion plasma. The results are discussed in the context of the fullerene pair-ion plasma experiment.

  1. On one-sided torsion pair

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Motivated by the concept of a torsion pair in a pre-triangulated category induced by Beligiannis and Reiten, the notion of a left (right) torsion pair in the left (right) triangulated category is introduced and investigated. We provide new connections between different aspects of torsion pairs in one-sided triangulated categories, pre-triangulated categories, stable categories and derived categories.

  2. Homolog pairing and segregation in Drosophila meiosis.

    Science.gov (United States)

    McKee, B D

    2009-01-01

    Pairing of homologous chromosomes is fundamental to their reliable segregation during meiosis I and thus underlies sexual reproduction. In most eukaryotes homolog pairing is confined to prophase of meiosis I and is accompanied by frequent exchanges, known as crossovers, between homologous chromatids. Crossovers give rise to chiasmata, stable interhomolog connectors that are required for bipolar orientation (orientation to opposite poles) of homologs during meiosis I. Drosophila is unique among model eukaryotes in exhibiting regular homolog pairing in mitotic as well as meiotic cells. I review the results of recent molecular studies of pairing in both mitosis and meiosis in Drosophila. These studies show that homolog pairing is continuous between pre-meiotic mitosis and meiosis but that pairing frequencies and patterns are altered during the mitotic-meiotic transition. They also show that, with the exception of X-Y pairing in male meiosis, which is mediated specifically by the 240-bp rDNA spacer repeats, chromosome pairing is not restricted to specific sites in either mitosis or meiosis. Instead, virtually all chromosome regions, both heterochromatic and euchromatic, exhibit autonomous pairing capacity. Mutations that reduce the frequencies of both mitotic and meiotic pairing have been recently described, but no mutations that abolish pairing completely have been discovered, and the genetic control of pairing in Drosophila remains to be elucidated.

  3. LOD wars: The affected-sib-pair paradigm strikes back!

    Energy Technology Data Exchange (ETDEWEB)

    Farrall, M. [Wellcome Trust Centre for Human Genetics, Oxford (United Kingdom)

    1997-03-01

    In a recent letter, Greenberg et al. aired their concerns that the affected-sib-pair (ASP) approach was becoming excessively popular, owing to misconceptions and ignorance of the properties and limitations of both the ASP and the classic LOD-score approaches. As an enthusiast of using the ASP approach to map susceptibility genes for multifactorial traits, I would like to contribute a few comments and explanatory notes in defense of the ASP paradigm. 18 refs.

  4. QUANTUM CRYPTOGRAPHY WITH PHOTON PAIRS

    Directory of Open Access Journals (Sweden)

    Anand Sharma,

    2010-07-01

    Full Text Available Quantum cryptographic systems use quantum mechanical concepts that are based on qubit superposition of states, and on the no cloning or no copying theorem to establish unbreakable cipher keys. The basic idea of quantum cryptography is to send the key in the form of photons over a public channel, encoding the zeros and one on quantum states in such a way that any eavesdropping attempt can be detected. Using optical communications the most commonly quantum mechanical property used is the polarization state of photon. However, in most quantum cryptographic algorithms a random polarization state is required. The photons are ideal for low loss transport, either in free space or in optical fibers, i.e. we have the full arsenal of fiber optic technology at our disposal. In this paper we are describing the process of quantum cryptography with photon pairs.

  5. Perturbations of vortex ring pairs

    CERN Document Server

    Gubser, Steven S; Parikh, Sarthak

    2015-01-01

    We study pairs of co-axial vortex rings starting from the action for a classical bosonic string in a three-form background. We complete earlier work on the phase diagram of classical orbits by explicitly considering the case where the circulations of the two vortex rings are equal and opposite. We then go on to study perturbations, focusing on cases where the relevant four-dimensional transfer matrix splits into two-dimensional blocks. When the circulations of the rings have the same sign, instabilities are mostly limited to wavelengths smaller than a dynamically generated length scale at which single-ring instabilities occur. When the circulations have the opposite sign, larger wavelength instabilities can occur.

  6. Paired states on a torus

    Energy Technology Data Exchange (ETDEWEB)

    Cristofano, Gerardo E-mail: gerardo.cristofano@na.infn.it; Maiella, Giuseppe E-mail: giuseppe.maiella@na.infn.it; Marotta, Vincenzo E-mail: vincenzo.marotta@na.infn.it; Niccoli, Giuliano E-mail: giuliano.niccoli@na.infn.it

    2002-10-14

    We analyze the modular properties of the effective CFT description for paired states, proposed in G. Cristofano, G. Maiella, V. Marrota, Mod. Phys. Lett. A 15 (2000) 1679, corresponding to the non-standard filling {nu}=((1)/(p+1)). We construct its characters for the twisted and the untwisted sector and the diagonal partition function. We show that the degrees of freedom entering our partition function naturally go to complete a Z{sub 2}-orbifold construction of the CFT for the Halperin state. Different behaviours for the p even and p odd cases are also studied. Finally it is shown that the tunneling phenomenon selects out a twist invariant CFT which is identified with the Moore-Read model.

  7. The identification of physical close galaxy pairs

    CERN Document Server

    Soares, D S L

    2007-01-01

    A classification scheme for close pairs of galaxies is proposed. The scheme is motivated by the fact that the majority of apparent close pairs are in fact wide pairs in three-dimensional space. This is demonstrated by means of numerical simulations of random samples of binary galaxies and the scrutiny of the resulting projected and spatial separation distributions. Observational strategies for classifying close pairs according to the scheme are suggested. As a result, physical -- i.e., bound and spatially -- close pairs are identified.

  8. Pairing correlations and transitions in nuclear systems

    CERN Document Server

    Belic, A; Hjorth-Jensen, M

    2004-01-01

    We discuss several pairing-related phenomena in nuclear systems, ranging from superfluidity in neutron stars to the gradual breaking of pairs in finite nuclei. We describe recent experimental evidence that points to a relation between pairing and phase transitions (or transformations) in finite nuclear systems. A simple pairing interaction model is used in order to study and classify an eventual pairing phase transition in finite fermionic systems such as nuclei. We show that systems with as few as 10-16 fermions can exhibit clear features reminiscent of a phase transition.

  9. Factors affecting home range of mallard pairs

    Energy Technology Data Exchange (ETDEWEB)

    Riechmann, J.H.

    1976-06-01

    Certain habitat and social factors were investigated for their effect on home range size of mallard (Anas platyhynchos) pairs breeding in a forested region of north-central Minnesota during the spring of 1971--72. Data from 31 radio-marked hens and drakes were used, but primary emphasis was placed on 8 pairs (5 with both members of the pair marked). Pairs were radio-tracked on river marsh areas, river channels, and large sand lakes to provide comparative data for evaluating home range size differences. Home ranges varied from an average of 53 ha for pairs using primarily river habitat to 871 ha for pairs using only large sand lakes. River and lake shorelines varied considerably in species and density of vegetation. Interaction between pairs as well as density of flocked males appeared to be influenced by these habitat differences with resultant effects on home range sizes.

  10. On Minus Paired-Domination in Graphs

    Institute of Scientific and Technical Information of China (English)

    邢化明; 孙良

    2003-01-01

    The study of minus paired-domination of a graph G=(V,E) is initiated. Let SV be any paired-dominating set of G, a minus paired-dominating function is a function of the form f∶V→{-1,0,1} such that f(v)=1 for v∈S, f(v)≤0 for v∈V-S, and f(N[v])≥1 for all v∈V. The weight of a minus paired-dominating function f is w(f)=∑f(v), over all vertices v∈V. The minus paired-domination number of a graph G is γ-p(G)=min{w(f)|f is a minus paired-dominating function of G}. On the basis of the minus paired-domination number of a graph G defined, some of its properties are discussed.

  11. Cumulative Paired φ-Entropy

    Directory of Open Access Journals (Sweden)

    Ingo Klein

    2016-07-01

    Full Text Available A new kind of entropy will be introduced which generalizes both the differential entropy and the cumulative (residual entropy. The generalization is twofold. First, we simultaneously define the entropy for cumulative distribution functions (cdfs and survivor functions (sfs, instead of defining it separately for densities, cdfs, or sfs. Secondly, we consider a general “entropy generating function” φ, the same way Burbea et al. (IEEE Trans. Inf. Theory 1982, 28, 489–495 and Liese et al. (Convex Statistical Distances; Teubner-Verlag, 1987 did in the context of φ-divergences. Combining the ideas of φ-entropy and cumulative entropy leads to the new “cumulative paired φ-entropy” ( C P E φ . This new entropy has already been discussed in at least four scientific disciplines, be it with certain modifications or simplifications. In the fuzzy set theory, for example, cumulative paired φ-entropies were defined for membership functions, whereas in uncertainty and reliability theories some variations of C P E φ were recently considered as measures of information. With a single exception, the discussions in the scientific disciplines appear to be held independently of each other. We consider C P E φ for continuous cdfs and show that C P E φ is rather a measure of dispersion than a measure of information. In the first place, this will be demonstrated by deriving an upper bound which is determined by the standard deviation and by solving the maximum entropy problem under the restriction of a fixed variance. Next, this paper specifically shows that C P E φ satisfies the axioms of a dispersion measure. The corresponding dispersion functional can easily be estimated by an L-estimator, containing all its known asymptotic properties. C P E φ is the basis for several related concepts like mutual φ-information, φ-correlation, and φ-regression, which generalize Gini correlation and Gini regression. In addition, linear rank tests for scale that

  12. Pulsational-Pair Instability Supernovae

    CERN Document Server

    Woosley, S E

    2016-01-01

    The final evolution of stars in the mass range 60 - 150 solar masses is explored. Depending upon their mass loss and rotation rates, many of these stars will end their lives as pulsational pair-instability supernovae. Even a non-rotating 70 solar mass star is pulsationally unstable during oxygen shell burning and can power a sub-luminous supernova. Rotation decreases the limit further. For more massive stars, the pulsations are less frequent, span a longer time, and are more powerful. Violent pulsations eject not only any residual low density envelope, but also that fraction of the helium core mass outside about 35 - 50 solar masses. The remaining core of helium and heavy elements continues to evolve, ultimately forming an iron core of about 2.5 solar masses that probably collapses to a black hole. A variety of observational transients result with total durations ranging from days to 10,000 years, and luminosities from 10$^{41}$ to 10$^{44}$ erg s$^{-1}$. Many transients resemble ordinary Type IIp supernovae,...

  13. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  14. Genome filtering using methylation-sensitive restriction enzymes with six-base pair recognition sites

    Science.gov (United States)

    The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl sensitive restriction enzymes with six base pair recognition sites...

  15. Ensemble treatments of thermal pairing in nuclei

    Science.gov (United States)

    Hung, Nguyen Quang; Dang, Nguyen Dinh

    2009-10-01

    A systematic comparison is conducted for pairing properties of finite systems at nonzero temperature as predicted by the exact solutions of the pairing problem embedded in three principal statistical ensembles, namely the grandcanonical ensemble, canonical ensemble and microcanonical ensemble, as well as the unprojected (FTBCS1+SCQRPA) and Lipkin-Nogami projected (FTLN1+SCQRPA) theories that include the quasiparticle number fluctuation and coupling to pair vibrations within the self-consistent quasiparticle random-phase approximation. The numerical calculations are performed for the pairing gap, total energy, heat capacity, entropy, and microcanonical temperature within the doubly-folded equidistant multilevel pairing model. The FTLN1+SCQRPA predictions are found to agree best with the exact grand-canonical results. In general, all approaches clearly show that the superfluid-normal phase transition is smoothed out in finite systems. A novel formula is suggested for extracting the empirical pairing gap in reasonable agreement with the exact canonical results.

  16. Filipino au pairs on the move

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial interdep...... by including the migrants’ broader social network within the frame of research.......Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial...... interdependence, whilst they continuously form their trajectories in relation to opportunities and restraints posed along the way by their local and transnational social relations. The article argues that examinations of migration trajectories benefit from broadening the research out in both time and space...

  17. Pair programming in education: a literature review

    Science.gov (United States)

    Hanks, Brian; Fitzgerald, Sue; McCauley, Renée; Murphy, Laurie; Zander, Carol

    2011-06-01

    This article provides a review of educational research literature focused on pair programming in the undergraduate computer science curriculum. Research suggests that the benefits of pair programming include increased success rates in introductory courses, increased retention in the major, higher quality software, higher student confidence in solutions, and improvement in learning outcomes. Moreover, there is some evidence that women, in particular, benefit from pair programming. The literature also provides evidence that the transition from paired to solo programming is easy for students. The greatest challenges for paired students appear to concern scheduling and partner compatibility. This review also considers practical issues such as assigning partners, teaching students to work in pairs, and assessing individual contributions, and concludes with a discussion of open research questions.

  18. Ordered pairing in liquid metallic hydrogen

    Science.gov (United States)

    Carlsson, A. E.; Ashcroft, N. W.

    1983-01-01

    We study two possible types of pairing involving the protons of a proposed low-temperature liquid phase metallic hydrogen. Electron-proton pairing, which can result in an insulating phase, is investigated by using an approximate solution of an Eliashberg-type equation for the anomalous self-energy. A very low estimate of the transition temperature is obtained by including proton correlations in the effective interaction. For proton-proton pairing, we derive a new proton pair potential based on the Abrikosov wave function. This potential includes the electron-proton interaction to all orders and has a much larger well depth than is obtained with linear screening methods. This suggests the possibility of either a superfluid paired phase analogous to that in He-3, or alternatively a phase with true molecular pairing.

  19. Galaxy pairs align with galactic filaments

    CERN Document Server

    Tempel, Elmo

    2015-01-01

    Context. Gravitational collapse theory and numerical simulations suggest that the velocity field within large-scale galaxy filaments is dominated by motions along the filaments. Aims. Our aim is to check whether observational data reveal any preferred orientation of galaxy pairs with respect to the underlying filaments as a result of the expectedly anisotropic velocity field. Methods. We use galaxy pairs and galaxy filaments identified from the Sloan Digital Sky Survey data. For filament extraction, we use the Bisous model that is based the marked point process technique. During the filament detection, we use the centre point of each pair instead of the positions of galaxies to avoid a built-in influence of pair orientation on the filament construction. For pairs lying within filaments (3012 cases), we calculate the angle between the line connecting galaxies of each pair and their host filament. To avoid redshift-space distortions, the angle is measured in the plain of the sky. Results. The alignment analysis...

  20. Multipair approach to pairing in nuclei

    CERN Document Server

    Sambataro, M

    2012-01-01

    The ground state of a general pairing Hamiltonian for a finite nuclear system is constructed as a product of collective, real, distinct pairs. These are determined sequentially via an iterative variational procedure that resorts to diagonalizations of the Hamiltonian in restricted model spaces. Different applications of the method are provided that include comparisons with exact and projected BCS results. The quantities that are examined are correlation energies, occupation numbers and pair transfer matrix elements. In a first application within the picket-fence model, the method is seen to generate the exact ground state for pairing strengths confined in a given range. Further applications of the method concern pairing in spherically symmetric mean fields and include simple exactly solvable models as well as some realistic calculations for middle-shell Sn isotopes. In the latter applications, two different ways of defining the pairs are examined: either with J=0 or with no well-defined angular momentum. The ...

  1. An Entropic Approach for Pair Trading

    Directory of Open Access Journals (Sweden)

    Daisuke Yoshikawa

    2017-06-01

    Full Text Available In this paper, we derive the optimal boundary for pair trading. This boundary defines the points of entry into or exit from the market for a given stock pair. However, if the assumed model contains uncertainty, the resulting boundary could result in large losses. To avoid this, we develop a more robust strategy by accounting for the model uncertainty. To incorporate the model uncertainty, we use the relative entropy as a penalty function in the expected profit from pair trading.

  2. Top pair production distributions at the Tevatron

    Directory of Open Access Journals (Sweden)

    Takeuchi Yuji

    2013-05-01

    Full Text Available At the Tevatron, the top quark is mainly produced in pairs through the strong interaction and decays before forming hadrons. Thus the kinematical distributions at top pair production possess rich information on the tt¯$tar t$ production vertex including polarizations of top and anti-top quarks. In this article, recent measurements on top quark pair production distributions at Tevatron (CDF and DO are presented.

  3. An Entropic Approach for Pair Trading

    OpenAIRE

    Daisuke Yoshikawa

    2017-01-01

    In this paper, we derive the optimal boundary for pair trading. This boundary defines the points of entry into or exit from the market for a given stock pair. However, if the assumed model contains uncertainty, the resulting boundary could result in large losses. To avoid this, we develop a more robust strategy by accounting for the model uncertainty. To incorporate the model uncertainty, we use the relative entropy as a penalty function in the expected profit from pair trading.

  4. PANDAseq: paired-end assembler for illumina sequences

    Directory of Open Access Journals (Sweden)

    Masella Andre P

    2012-02-01

    Full Text Available Abstract Background Illumina paired-end reads are used to analyse microbial communities by targeting amplicons of the 16S rRNA gene. Publicly available tools are needed to assemble overlapping paired-end reads while correcting mismatches and uncalled bases; many errors could be corrected to obtain higher sequence yields using quality information. Results PANDAseq assembles paired-end reads rapidly and with the correction of most errors. Uncertain error corrections come from reads with many low-quality bases identified by upstream processing. Benchmarks were done using real error masks on simulated data, a pure source template, and a pooled template of genomic DNA from known organisms. PANDAseq assembled reads more rapidly and with reduced error incorporation compared to alternative methods. Conclusions PANDAseq rapidly assembles sequences and scales to billions of paired-end reads. Assembly of control libraries showed a 4-50% increase in the number of assembled sequences over naïve assembly with negligible loss of "good" sequence.

  5. Dual origin of pairing in nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Idini, A. [University of Jyvaskyla, Department of Physics (Finland); Potel, G. [Michigan State University, National Superconducting Cyclotron Laboratory (United States); Barranco, F. [Escuela Superior de Ingenieros, Universidad de Sevilla, Departamento de Fìsica Aplicada III (Spain); Vigezzi, E., E-mail: enrico.vigezzi@mi.infn.it [INFN Sezione di Milano (Italy); Broglia, R. A. [Università di Milano, Dipartimento di Fisica (Italy)

    2016-11-15

    The pairing correlations of the nucleus {sup 120}Sn are calculated by solving the Nambu–Gor’kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong {sup 1}S{sub 0} short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- (v{sub p}{sup bare}) and long-range (v{sub p}{sup ind}) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.

  6. Lax pairs for deformed Minkowski spacetimes

    CERN Document Server

    Kyono, Hideki; Yoshida, Kentaroh

    2015-01-01

    We proceed to study Yang-Baxter deformations of 4D Minkowski spacetime based on a conformal embedding. We first revisit a Melvin background and argue a Lax pair by adopting a simple replacement law invented in 1509.00173. This argument enables us to deduce a general expression of Lax pair. Then the anticipated Lax pair is shown to work for arbitrary classical $r$-matrices with Poinca\\'e generators. As other examples, we present Lax pairs for pp-wave backgrounds, the Hashimoto-Sethi background, the Spradlin-Takayanagi-Volovich background.

  7. Lax pairs for deformed Minkowski spacetimes

    Energy Technology Data Exchange (ETDEWEB)

    Kyono, Hideki; Sakamoto, Jun-ichi; Yoshida, Kentaroh [Department of Physics, Kyoto University,Kitashirakawa Oiwake-cho, Kyoto 606-8502 (Japan)

    2016-01-25

    We proceed to study Yang-Baxter deformations of 4D Minkowski spacetime based on a conformal embedding. We first revisit a Melvin background and argue a Lax pair by adopting a simple replacement law invented in 1509.00173. This argument enables us to deduce a general expression of Lax pair. Then the anticipated Lax pair is shown to work for arbitrary classical r-matrices with Poincaré generators. As other examples, we present Lax pairs for pp-wave backgrounds, the Hashimoto-Sethi background, the Spradlin-Takayanagi-Volovich background.

  8. Transrelativistic pair plasmas in AGN jets

    DEFF Research Database (Denmark)

    Bottcher, M.; Pohl, M.; Schlickeiser, R.

    1999-01-01

    Models of relativistic jets filled with ultrarelativistic pair plasma are very successful in explaining the broadband radiation of gamma-ray blazars. Assuming that the initial injection and cooling of ultrarelativistic pair plasma in an AGN jet has occurred, producing the observed high-energy gamma......-ray radiation, we investigate the further evolution of the pair plasma as it continues to move out from the central engine. The effects of thermalization and reacceleration, the emission of pair bremsstrahlung and annihilation radiation and the bulk Compton process, and the possible application to MeV blazars...

  9. COTORSION PAIRS OVER FINITE GROUP GRADED RINGS

    Institute of Scientific and Technical Information of China (English)

    MENG Fan-yun; SUN Ju-xiang

    2015-01-01

    In this paper, we study the relation of cotorsion pairs between the graded and ungraded cases. By using the graded theory and the relative homological algebra, we first consider the relationship of cotorsion pairs in R-mod and S = R∗G-mod when R is any ring and G is a finite group. Then we study rigid cotorsion pairs in R-gr and consider the relationship of cotorsion pairs between R-gr and R-mod when R is a ring graded by a finite group G with|G|−1 ∈R.

  10. Copy number variation distribution in six monozygotic twin pairs discordant for schizophrenia.

    Science.gov (United States)

    Castellani, Christina A; Awamleh, Zain; Melka, Melkaye G; O'Reilly, Richard L; Singh, Shiva M

    2014-04-01

    We have evaluated copy number variants (CNVs) in six monozygotic twin pairs discordant for schizophrenia. The data from Affymetrix® Human SNP 6.0 arrays™ were analyzed using Affymetrix® Genotyping Console™, Partek® Genomics Suite™, PennCNV, and Golden Helix SVS™. This yielded both program-specific and overlapping results. Only CNVs called by Affymetrix Genotyping Console, Partek Genomics Suite, and PennCNV were used in further analysis. This analysis included an assessment of calls in each of the six twin pairs towards identification of unique CNVs in affected and unaffected co-twins. Real time polymerase chain reaction (PCR) experiments confirmed one CNV loss at 7q11.21 that was found in the affected patient but not in the unaffected twin. The results identified CNVs and genes that were previously implicated in mental abnormalities in four of the six twin pairs. It included PYY (twin pairs 1 and 5), EPHA3 (twin pair 3), KIAA1211L (twin pair 4), and GPR139 (twin pair 5). They represent likely candidate genes and CNVs for the discordance of four of the six monozygotic twin pairs for this heterogeneous neurodevelopmental disorder. An explanation for these differences is ontogenetic de novo events that differentiate in the monozygotic twins during development.

  11. Open string pair creation from worldsheet instantons

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, Christian [Max-Planck-Institut fuer Gravitationsphysik, Albert-Einstein-Institut, Muehlenberg 1, D-14476 Potsdam (Germany); Torrielli, Alessandro [Institute for Theoretical Physics and Spinoza Institute, Utrecht University, Leuvenlaan 4, 3584 CE Utrecht (Netherlands)

    2010-10-08

    Worldline instantons provide a particularly elegant way to derive Schwinger's well-known formula for the pair creation rate due to a constant electric field in quantum electrodynamics. In this communication, we show how to extend this method to the corresponding problem of open string pair creation. (fast track communication)

  12. Exploring Pair Programming Benefits for MIS Majors

    Science.gov (United States)

    Dongo, Tendai; Reed, April H.; O'Hara, Margaret

    2016-01-01

    Pair programming is a collaborative programming practice that places participants in dyads, working in tandem at one computer to complete programming assignments. Pair programming studies with Computer Science (CS) and Software Engineering (SE) majors have identified benefits such as technical productivity, program/design quality, academic…

  13. Prime pairs and the zeta function

    NARCIS (Netherlands)

    Korevaar, J.

    2009-01-01

    Are there infinitely many prime pairs with given even difference? Most mathematicians think so. Using a strong arithmetic hypothesis, Goldston, Pintz and Yildirim have recently shown that there are infinitely many pairs of primes differing by at most sixteen. There is extensive numerical support for

  14. Bidirectional Synonym Ratings of 464 Noun Pairs.

    Science.gov (United States)

    Whitten, William B.; And Others

    1979-01-01

    Each of 464 noun pairs was rated for synonymy on a seven-point scale by college students to provide an extensive set of synonym pairs for use as stimuli in experiments, and to evaluate the effects of word encoding order on perceived synonymy. (SW)

  15. Kinetic energy driven pairing in cuprate superconductors

    NARCIS (Netherlands)

    Maier, TA; Jarrell, M; Macridin, A; Slezak, C

    2004-01-01

    Pairing occurs in conventional superconductors through a reduction of the electronic potential energy accompanied by an increase in kinetic energy. In the underdoped cuprates, optical experiments show that pairing is driven by a reduction of the electronic kinetic energy. Using the dynamical cluster

  16. Exploring Pair Programming Benefits for MIS Majors

    Science.gov (United States)

    Dongo, Tendai; Reed, April H.; O'Hara, Margaret

    2016-01-01

    Pair programming is a collaborative programming practice that places participants in dyads, working in tandem at one computer to complete programming assignments. Pair programming studies with Computer Science (CS) and Software Engineering (SE) majors have identified benefits such as technical productivity, program/design quality, academic…

  17. Prime pairs and the zeta function

    NARCIS (Netherlands)

    Korevaar, J.

    2009-01-01

    Are there infinitely many prime pairs with given even difference? Most mathematicians think so. Using a strong arithmetic hypothesis, Goldston, Pintz and Yildirim have recently shown that there are infinitely many pairs of primes differing by at most sixteen. There is extensive numerical support for

  18. Optimal scaling of paired comparison data

    NARCIS (Netherlands)

    van de Velden, M.

    2004-01-01

    In this paper we consider the analysis of paired comparisons using optimal scaling techniques. In particular, we will, inspired by Guttman's approach for quantifying paired comparisons, formulate a new method to obtain optimal scaling values for the subjects. We will compare our results with those o

  19. Muon pair production in relativistic nuclear collisions

    CERN Document Server

    Hencken, K; Serbo, V G

    2006-01-01

    The exclusive production of one $\\mu^+\\mu^-$ pair in collisions of two ultra-relativistic nuclei is considered. We present the simple method for calculation of the Born cross section for this process. Then we found that the Coulomb corrections to this cross section (which correspond to multi-photon exchange of the produced $\\mu^{\\pm}$ with nuclei) are small while the unitarity corrections are large. This is in sharp contrast to the exclusive $e^+e^-$ pair production where the Coulomb corrections to the Born cross section are large while the unitarity corrections are small. We calculated also the cross section for the production of one $\\mu^+\\mu^-$ pair and several $e^+e^-$ pairs in the leading logarithmic approximation. Using this cross section we found that the inclusive production of $\\mu^+\\mu^-$ pair coincides in this approximation with its Born value.

  20. Pairing in a dry Fermi sea.

    Science.gov (United States)

    Maier, T A; Staar, P; Mishra, V; Chatterjee, U; Campuzano, J C; Scalapino, D J

    2016-06-17

    In the traditional Bardeen-Cooper-Schrieffer theory of superconductivity, the amplitude for the propagation of a pair of electrons with momentum k and -k has a log singularity as the temperature decreases. This so-called Cooper instability arises from the presence of an electron Fermi sea. It means that an attractive interaction, no matter how weak, will eventually lead to a pairing instability. However, in the pseudogap regime of the cuprate superconductors, where parts of the Fermi surface are destroyed, this log singularity is suppressed, raising the question of how pairing occurs in the absence of a Fermi sea. Here we report Hubbard model numerical results and the analysis of angular-resolved photoemission experiments on a cuprate superconductor. In contrast to the traditional theory, we find that in the pseudogap regime the pairing instability arises from an increase in the strength of the spin-fluctuation pairing interaction as the temperature decreases rather than the Cooper log instability.

  1. The bovine T cell receptor alpha/delta locus contains over 400 V genes and encodes V genes without CDR2.

    Science.gov (United States)

    Reinink, Peter; Van Rhijn, Ildiko

    2009-07-01

    Alphabeta T cells and gammadelta T cells perform nonoverlapping immune functions. In mammalian species with a high percentage of very diverse gammadelta T cells, like ruminants and pigs, it is often assumed that alphabeta T cells are less diverse than gammadelta T cells. Based on the bovine genome, we have created a map of the bovine TRA/TRD locus and show that, in cattle, in addition to the anticipated >100 TRDV genes, there are also >300 TRAV or TRAV/DV genes. Among the V genes in the TRA/TRD locus, there are several genes that lack a CDR2 and are functionally rearranged and transcribed and, in some cases, have an extended CDR1. The number of bovine V genes is a multiple of the number in mice and humans and may encode T cell receptors that use a novel way of interacting with antigen.

  2. Solubilization and fractionation of paired helical filaments.

    Science.gov (United States)

    González, P J; Correas, I; Avila, J

    1992-09-01

    Paired helical filaments isolated from brains of two different patients with Alzheimer's disease were extensively treated with the ionic detergent, sodium dodecyl sulphate. Filaments were solubilized at different extents, depending on the brain examined, thus suggesting the existence of two types of paired helical filaments: sodium dodecyl sulphate-soluble and insoluble filaments. In the first case, the number of structures resembling paired helical filaments greatly decreased after the detergent treatment, as observed by electron microscopy. Simultaneously, a decrease in the amount of sedimentable protein was also observed upon centrifugation of the sodium dodecyl sulfate-treated paired helical filaments. A sodium dodecyl sulphate-soluble fraction was isolated as a supernatant after low-speed centrifugation of the sodium dodecyl sulphate-treated paired helical filaments. The addition of the non-ionic detergent Nonidet-P40 to this fraction resulted in the formation of paired helical filament-like structures. When the sodium dodecyl sulphate-soluble fraction was further fractionated by high-speed centrifugation, three subfractions were observed: a supernatant, a pellet and a thin layer between these two subfractions. No paired helical filaments were observed in any of these subfractions, even after addition of Nonidet P-40. However, when they were mixed back together, the treatment with Nonidet P-40 resulted in the visualization of paired helical filament-like structures. These results suggest that at least two different components are needed for the reconstitution of paired helical filaments as determined by electron microscopy. The method described here may allow the study of the components involved in the formation of paired helical filaments and the identification of possible factors capable of blocking this process.

  3. Genotypic variation in tetraploid wheat affecting homoeologous pairing in hybrids with Aegilops peregrina.

    Science.gov (United States)

    Ozkan, H; Feldman, M

    2001-12-01

    The Ph1 gene has long been considered the main factor responsible for the diploid-like meiotic behavior of polyploid wheat. This dominant gene, located on the long arm of chromosome 5B (5BL), suppresses pairing of homoeologous chromosomes in polyploid wheat and in their hybrids with related species. Here we report on the discovery of genotypic variation among tetraploid wheats in the control of homoeologous pairing. Compared with the level of homoeologous pairing in hybrids between Aegilops peregrina and the bread wheat cultivar Chinese Spring (CS), significantly higher levels of homoeologous pairing were obtained in hybrids between Ae. peregrina and CS substitution lines in which chromosome 5B of CS was replaced by either 5B of Triticum turgidum ssp. dicoccoides line 09 (TTD09) or 5G of Triticum timopheevii ssp. timopheevii line 01 (TIMO1). Similarly, a higher level of homoeologous pairing was found in the hybrid between Ae. peregrina and a substitution line of CS in which chromosome arm 5BL of line TTD140 substituted for 5BL of CS. It appears that the observed effect on the level of pairing is exerted by chromosome arm 5BL of T turgidum ssp. dicoccoides, most probably by an allele of Ph1. Searching for variation in the control of homoeologous pairing among lines of wild tetraploid wheat, either T turgidum ssp. dicoccoides or T timopheevii ssp. armeniacum, showed that hybrids between Ae. peregrina and lines of these two wild wheats exhibited three different levels of homoeologous pairing: low, low intermediate, and high intermediate. The low-intermediate and high-intermediate genotypes may possess weak alleles of Ph1. The three different T turgidum ssp. dicoccoides pairing genotypes were collected from different geographical regions in Israel, indicating that this trait may have an adaptive value. The availability of allelic variation at the Ph1 locus may facilitate the mapping, tagging, and eventually the isolation of this important gene.

  4. P-wave Cooper pair splitting

    Directory of Open Access Journals (Sweden)

    Henning Soller

    2012-07-01

    Full Text Available Background: Splitting of Cooper pairs has recently been realized experimentally for s-wave Cooper pairs. A split Cooper pair represents an entangled two-electron pair state, which has possible application in on-chip quantum computation. Likewise the spin-activity of interfaces in nanoscale tunnel junctions has been investigated theoretically and experimentally in recent years. However, the possible implications of spin-active interfaces in Cooper pair splitters so far have not been investigated.Results: We analyze the current and the cross correlation of currents in a superconductor–ferromagnet beam splitter, including spin-active scattering. Using the Hamiltonian formalism, we calculate the cumulant-generating function of charge transfer. As a first step, we discuss characteristics of the conductance for crossed Andreev reflection in superconductor–ferromagnet beam splitters with s-wave and p-wave superconductors and no spin-active scattering. In a second step, we consider spin-active scattering and show how to realize p-wave splitting using only an s-wave superconductor, through the process of spin-flipped crossed Andreev reflection. We present results for the conductance and cross correlations.Conclusion: Spin-activity of interfaces in Cooper pair splitters allows for new features in ordinary s-wave Cooper pair splitters, that can otherwise only be realized by using p-wave superconductors. In particular, it provides access to Bell states that are different from the typical spin singlet state.

  5. Pure Pairing Modes in Trapped Fermion Systems

    Science.gov (United States)

    Capuzzi, P.; Hernández, E. S.; Szybisz, L.

    2013-05-01

    We present numerical predictions for the shape of the pairing fluctuations in harmonically trapped atomic 6Li with two spin projections, based on the fluiddynamical description of cold fermions with pairing interactions. In previous works it has been shown that when the equilibrium of a symmetric mixture is perturbed, the linearized fluiddynamic equations decouple into two sets, one containing the sound mode of fermion superfluids and the other the pairing mode. The latter corresponds to oscillations of the modulus of the complex gap and is driven by the kinetic energy densities of the particles and of the pairs. Assuming proportionality between the heat flux and the energy gradient, the particle kinetic energy undergoes a diffusive behavior and the diffusion parameter is the key parameter for the relaxation time scale. We examine a possible range of values for this parameter and find that the shape of the pairing oscillation is rather insensitive to the precise value of the transport coefficient. Moreover, the pairing fluctuation is largely confined to the center of the trap, and the energy of the pairing mode is consistent with the magnitude of the equilibrium gap.

  6. String pair production in non homogeneous backgrounds

    Energy Technology Data Exchange (ETDEWEB)

    Bolognesi, S. [Department of Physics “E. Fermi” University of Pisa, and INFN - Sezione di Pisa,Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Rabinovici, E. [Racah Institute of Physics, The Hebrew University of Jerusalem,91904 Jerusalem (Israel); Tallarita, G. [Departamento de Ciencias, Facultad de Artes Liberales,Universidad Adolfo Ibáñez, Santiago 7941169 (Chile)

    2016-04-28

    We consider string pair production in non homogeneous electric backgrounds. We study several particular configurations which can be addressed with the Euclidean world-sheet instanton technique, the analogue of the world-line instanton for particles. In the first case the string is suspended between two D-branes in flat space-time, in the second case the string lives in AdS and terminates on one D-brane (this realizes the holographic Schwinger effect). In some regions of parameter space the result is well approximated by the known analytical formulas, either the particle pair production in non-homogeneous background or the string pair production in homogeneous background. In other cases we see effects which are intrinsically stringy and related to the non-homogeneity of the background. The pair production is enhanced already for particles in time dependent electric field backgrounds. The string nature enhances this even further. For spacial varying electrical background fields the string pair production is less suppressed than the rate of particle pair production. We discuss in some detail how the critical field is affected by the non-homogeneity, for both time and space dependent electric field backgrouds. We also comment on what could be an interesting new prediction for the small field limit. The third case we consider is pair production in holographic confining backgrounds with homogeneous and non-homogeneous fields.

  7. Exploring Pair Programming Benefits for MIS Majors

    Directory of Open Access Journals (Sweden)

    April H. Reed

    2016-12-01

    Full Text Available Pair programming is a collaborative programming practice that places participants in dyads, working in tandem at one computer to complete programming assignments. Pair programming studies with Computer Science (CS and Software Engineering (SE majors have identified benefits such as technical productivity, program/design quality, academic performance, and increased satisfaction for their participants. In this paper, pair programming is studied with Management Information Systems (MIS majors, who (unlike CS and SE majors taking several programming courses typically take only one programming course and often struggle to develop advanced programming skills within that single course. The researchers conducted two pair programming experiments in an introductory software development course for MIS majors over three semesters to determine if pair programming could enhance learning for MIS students. The program results, researchers’ direct observations, and participants’ responses to a survey questionnaire were analyzed after each experiment. The results indicate that pair programming appears to be beneficial to MIS students’ technical productivity and program design quality, specifically the ability to create programs using high-level concepts. Additionally, results confirmed increased student satisfaction and reduced frustration, as the pairs worked collaboratively to produce a program while actively communicating and enjoying the process.

  8. An Easy-To-Use Combination Four-Terminal-Pair/Two-Terminal-Pair AC Transformer Bridge.

    Science.gov (United States)

    Jeffery, A; Shields, J Q; Lee, L H

    1998-01-01

    A new four-terminal-pair bridge, capable of achieving a relative standard uncertainty of 1×10(-9), was constructed at the National Institute of Standards and Technology by converting a two-terminal-pair bridge. The conversion requires only the addition of components which are easily removed if two-terminal-pair measurements are to be made. The design and testing of this bridge is described. The new four-terminal-pair bridge requires fewer auxiliary balances than the present four-terminal-pair bridge employed at NIST, which makes it much easier to use. This new design can be used to compare capacitance, resistance, and inductance standards.

  9. English for au pairs the au pair's guide to learning English

    CERN Document Server

    Curtis, Lucy

    2014-01-01

    English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.

  10. Pair supersolid with atom-pair hopping on the state-dependent triangular lattice

    Science.gov (United States)

    Zhang, Wanzhou; Yin, Ruoxi; Wang, Yancheng

    2013-11-01

    We systematically study an extended Bose-Hubbard model with atom hopping and atom-pair hopping in the presence of a three-body constraint on the triangular lattice. By means of large-scale quantum Monte Carlo simulations, the ground-state phase diagram is studied. We find a first-order transition between the atomic superfluid phase and the pair superfluid phase when the ratio of the atomic hopping and the atom-pair hopping is adapted. The first-order transition remains unchanged under various conditions. We then focus on the interplay among the atom-pair hopping, the on-site repulsion, and the nearest-neighbor repulsion. With on-site repulsion present, we observe first-order transitions between the Mott insulators and pair superfluid driven by the pair hopping. With the nearest-neighbor repulsion turning on, three typical solid phases with 2/3, 1, and 4/3 filling emerge at small atom-pair hopping region. A stable pair supersolid phase is found at small on-site repulsion. This is due to the three-body constraint and the pair hopping, which essentially make the model a quasihardcore boson system. Thus the pair supersolid state emerges basing on the order-by-disorder mechanism, by which hardcore bosons avoid classical frustration on the triangular lattice. Without on-site repulsion, the transitions between the pair supersolid and the atom superfluid or pair superfluid are first order, except for the particle-hole symmetric point. With weak on-site repulsion and atom hopping turning on, the transition between the pair supersolid and pair superfluid phase becomes continuous. The transition between solid and pair supersolid is three-dimensional XY university, with dynamical exponent z=1 and correlation exponent ν=0.67155. The thermal melting of pair supersolid belongs to the two-dimensional Ising university. We check both energetic and mechanical balance of pair supersolid phase. Lowering the three-body constraint, no pair supersolid is found due to the absence of

  11. Pair Creation at Large Inherent Angles

    Energy Technology Data Exchange (ETDEWEB)

    Chen, P.; Tauchi, T.; Schroeder, D.V.; /SLAC

    2007-04-25

    In the next-generation linear colliders, the low-energy e{sup +}e{sup -} pairs created during the collision of high-energy e{sup +}e{sup -} beams would cause potential deleterious background problems to the detectors. At low collider energies, the pairs are made essentially by the incoherent process, where the pair is created by the interaction of beamstrahlung photons on the individual particles in the oncoming beam. This problem was first identified by Zolotarev, et al[1]. At energies where the beamstrahlung parameter {Upsilon} lies approximately in the range 0.6 {approx}< {Upsilon} {approx}< 100, pair creation from the beamstrahlung photons is dominated by a coherent process, first noted by Chen[2]. The seriousness of this pair creation problem lies in the transverse momenta that the pair particles carry when leaving the interaction point (IP) with large angles. One source of transverse momentum is from the kick by the field of the oncoming beam which results in an outcoming angle {theta} {proportional_to} 1/{radical}x, where x is the fractional energy of the particle relative to the initial beam particle energy[2,3]. As was shown in Ref. 131, there in fact exists an energy threshold for the coherent pairs, where x{sub th} {approx}> 1/2{Upsilon}. Thus within a tolerable exiting angle, there exists an upper limit for {Upsilon} where all coherent pairs would leave the detector through the exhaust port[4]. A somewhat different analysis has been done by Schroeder[5]. In the next generation of linear colliders, as it occurs, the coherent pairs can be exponentially suppressed[2] by properly choosing the {Upsilon}({approx}< 0.6). When this is achieved, the incoherent pairs becomes dominant. Since the central issue is the transverse momentum for particles with large angles, we notice that there is another source for it. Namely, when the pair particles are created at low energies, the intrinsic angles of these pairs when produced may already be large. This issue was

  12. Pair creation in heavy ion channeling

    Directory of Open Access Journals (Sweden)

    N.A. Belov

    2016-04-01

    Full Text Available Heavy ions channeled through crystals with multi-GeV kinetic energies can create electron–positron pairs. In the framework of the ion, the energy of virtual photons arising from the periodic crystal potential may exceed the threshold 2mec2. The repeated periodic collisions with the crystal ions yield high pair production rates. When the virtual photon frequency matches a nuclear transition in the ion, the production rate can be resonantly increased. In this two-step excitation-pair conversion scheme, the excitation rates are coherently enhanced, and scale approximately quadratically with the number of crystal sites along the channel.

  13. Implementation of Cryptosystems Based on Tate Pairing

    Institute of Scientific and Technical Information of China (English)

    Lei Hu; Jun-Wu Dong; Ding-Yi Pei

    2005-01-01

    Tate pairings over elliptic curves are important in cryptography since they can be used to construct efficient identity-based cryptosystems, and their implementation dominantly determines the efficiencies of the cryptosystems. In this paper, the implementation of a cryptosystem is provided based on the Tate pairing over a supersingular elliptic curve of MOV degree 3. The implementation is primarily designed to re-use low-level codes developed in implementation of usual elliptic curve cryptosystems. The paper studies how to construct the underlying ground field and its extension to accelerate the finite field arithmetic, and presents a technique to speedup the time-consuming powering in the Tate pairing algorithm.

  14. Becoming independent through au pair migration

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    . This article argues that, despite this critique, au pairing does play an important formative role for young Filipinas because it opens up for experiences abroad that enable them to be recognised as independent adults in Philippine society. Rather than autonomy, however, au pairs define their independence...... in terms of their capacity to assume responsibility for others, thereby achieving a position of social respect. Based on ethnographic fieldwork in Denmark and the Philippines, this article explores how young Filipinas use the social, economic, and cultural resources they gain from their au pair stay abroad...

  15. Amplification of Cooper pair splitting current in a graphene-based Cooper pair beam splitter geometry

    Science.gov (United States)

    Islam, SK Firoz; Saha, Arijit

    2017-09-01

    Motivated by the recent experiments [Scientific Reports 6, 23051 (2016), 10.1038/srep23051; Phys. Rev. Lett. 114, 096602 (2015), 10.1103/PhysRevLett.114.096602], we theoretically investigate Cooper pair splitting current in a graphene-based Cooper pair beam splitter geometry. By considering the graphene-based superconductor as an entangler device, instead of normal [two-dimensional (2D)] BCS superconductor, we show that the Cooper pair splitting current mediated by the crossed Andreev process is amplified compared to its normal superconductor counterpart. This amplification is attributed to the strong suppression of the local normal Andreev reflection process (arising from the Cooper pair splitting) from the graphene-based superconductor to lead via the same quantum dot, in comparison to the usual 2D superconductor. Due to the vanishing density of states at the Dirac point of undoped graphene, a doped graphene-based superconductor is considered here and it is observed that Cooper pair splitting current is very insensitive to the doping level in comparison to the usual 2D superconductor. The transport process of nonlocal spin-entangled electrons also depends on the type of pairing, i.e., whether the electron-hole pairing is onsite, intersublattice or the combination of both. The intersublattice pairing of graphene causes the maximum nonlocal Cooper pair splitting current, whereas the presence of both pairings reduces the Cooper pair splitting current.

  16. Implementation of New Pairing Technique for Studying the Effectiveness of Pairs on Persona and Programming

    Directory of Open Access Journals (Sweden)

    HARSIMARJEET KHURANA

    2011-01-01

    Full Text Available This paper reports on a study in which persona for the category of paired and solo students were compared on the parameter like program clarity, presentation, satisfaction level and confidence level, also the effectiveness of pairs in a JAVA programming language and the impact of pairs on each other. In this study same programs were given to all the category of paired and solo students. Finding reported in this paper are that pairing students were more likely to turn in working programs, and these programs were correctly implemented with more required features as compared to solo students. It has been observed that pairing of intelligent, average and poor with themselves has not shown significant differences but we have seen significant differences with combination of pairs.

  17. Somatic pairing of chromosome 19 in renal oncocytoma is associated with deregulated EGLN2-mediated [corrected] oxygen-sensing response.

    Directory of Open Access Journals (Sweden)

    Julie M Koeman

    Full Text Available Chromosomal abnormalities, such as structural and numerical abnormalities, are a common occurrence in cancer. The close association of homologous chromosomes during interphase, a phenomenon termed somatic chromosome pairing, has been observed in cancerous cells, but the functional consequences of somatic pairing have not been established. Gene expression profiling studies revealed that somatic pairing of chromosome 19 is a recurrent chromosomal abnormality in renal oncocytoma, a neoplasia of the adult kidney. Somatic pairing was associated with significant disruption of gene expression within the paired regions and resulted in the deregulation of the prolyl-hydroxylase EGLN2 [corrected] a key protein that regulates the oxygen-dependent degradation of hypoxia-inducible factor (HIF. Overexpression of EGLN2 [corrected] in renal oncocytoma increased ubiquitin-mediated destruction of HIF and concomitantly suppressed the expression of several HIF-target genes, including the pro-death BNIP3L gene. The transcriptional changes that are associated with somatic pairing of chromosome 19 mimic the transcriptional changes that occur following DNA amplification. Therefore, in addition to numerical and structural chromosomal abnormalities, alterations in chromosomal spatial dynamics should be considered as genomic events that are associated with tumorigenesis. The identification of EGLN2 as a significantly deregulated gene that maps within the paired chromosome region directly implicates defects in the oxygen-sensing network to the biology of renal oncocytoma.

  18. Rho GTPase-formin pairs in cytoskeletal remodelling.

    Science.gov (United States)

    Eisenmann, Kathryn M; Peng, Jun; Wallar, Bradley J; Alberts, Arthur S

    2005-01-01

    Diaphanous-related formins (Drfs) are members of a conserved formin family of actin-nucleating proteins and are thought to act as Rho GTPase effectors in signal transduction pathways that govern gene expression, cytoskeletal remodelling and cell division. In vitro evidence suggests that the three mammalian Drf proteins--mDia1, mDia2 and mDia3-have distinct GTPase-binding specificities. However, much of our current understanding of GTPase-Drf partnerships in mammalian cell signalling is based on expression studies using Drfs missing their unique GTPase-binding domains. We have employed fluorescence resonance energy transfer (FRET) and gene targeting approaches to identify the function of different GTPase-formin pairs in cell signalling. These studies have allowed us to uncover new roles for Drf proteins in cytoskeletal remodelling and novel regulatory mechanisms whereby GTPases influence formin function. Our genetic experiments strongly suggest that Drfs cooperate with other GTPase effector proteins, including the gene product of the Wiskott-Aldrich syndrome gene, WASP, during the regulation of cell proliferation. Further, the Drf gene knockout experiments indicate that this family of formins has a role in cancer pathophysiology.

  19. 22 CFR 62.31 - Au pairs.

    Science.gov (United States)

    2010-04-01

    ... equivalent and a personality profile. Such personality profile will be based upon a psychometric test... such academic course work in an amount not to exceed $1,000 for EduCare au pair participants and in an...

  20. On the concept of frustrated Lewis pairs.

    Science.gov (United States)

    Fontaine, Frédéric-Georges; Stephan, Douglas W

    2017-08-28

    In this concept article, we consider the notion of 'frustrated Lewis pairs' (FLPs). While the original use of the term referred to steric inhibition of dative bond formation in a Lewis pair, work in the intervening decade demonstrates the limitation of this simplistic view. Analogies to known transition metal chemistry and the applications in other areas of chemistry are considered. In the light of these findings, we present reflections on the criteria for a definition of the term 'frustrated Lewis pair'. Segregation of the Lewis acid and base and the kinetic nature of FLP reactivity are discussed. We are led to the conclusion that, while an all-inclusive definition of FLP is challenging, the notion of 'FLP chemistry' is more readily recognized.This article is part of the themed issue 'Frustrated Lewis pair chemistry'. © 2017 The Author(s).

  1. Pairing properties of realistic effective interactions

    Directory of Open Access Journals (Sweden)

    Gargano A.

    2016-01-01

    Full Text Available We investigate the pairing properties of an effective shell-model interaction defined within a model space outside 132Sn and derived by means of perturbation theory from the CD-Bonn free nucleon-nucleon potential. It turns out that the neutron pairing component of the effective interaction is significantly weaker than the proton one, which accounts for the large pairing gap difference observed in the two-valence identical particle nuclei 134Sn and 134Te. The role of the contribution arising from one particle-one hole excitations in determining the pairing force is discussed and its microscopic structure is also analyzed in terms of the multipole decomposition.

  2. Colors of Dynamically Associated Asteroid Pairs

    CERN Document Server

    Moskovitz, Nicholas

    2012-01-01

    Recent dynamical studies have identified pairs of asteroids that reside in nearly identical heliocentric orbits. Possible formation scenarios for these systems include dissociation of binary asteroids, collisional disruption of a single parent body, or spin-up and rotational fission of a rubble-pile. Aside from detailed dynamical analyses and measurement of rotational light curves, little work has been done to investigate the colors or spectra of these unusual objects. A photometric and spectroscopic survey was conducted to determine the reflectance properties of asteroid pairs. New observations were obtained for a total of 34 individual asteroids. Additional photometric measurements were retrieved from the Sloan Digital Sky Survey Moving Object Catalog. Colors or spectra for a total of 42 pair components are presented here. The main findings of this work are: (1) the components in the observed pair systems have the same colors within the uncertainties of this survey, and (2) the color distribution of asteroi...

  3. Comments on Coulomb pairing in aromatic hydrocarbons

    CERN Document Server

    Huber, D L

    2013-01-01

    Recently reported anomalies in the double-photonionization spectra of aromatic molecules such as benzene, naphthalene, anthracene and coronene are attributed to Coulomb-pair resonances of pi electrons.

  4. Four square mile survey pair count instructions

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This standard operating procedure (SOP) provides guidance for conducting bird pair count measurements on wetlands for the HAPETs Four-Square-Mile survey. This set of...

  5. Array-Based Discovery of Aptamer Pairs

    Science.gov (United States)

    2014-12-11

    18460−18465. (25) Liu, Y.; Adams, J. D.; Turner, K.; Cochran, F. V.; Gambhir, S. S.; Soh, H. T. Lab Chip 2009, 9, 1033−1036. (26) Katilius, E.; Flores, C...discovery of aptamer pairs. We use microfluidic selection and high-throughput sequencing to obtain an enriched pool of aptamer sequences. Next, we...overcomes this problem to achieve efficient discovery of aptamer pairs. We use microfluidic selection and high- throughput sequencing to obtain an

  6. Alternative DNA base pairing through metal coordination.

    Science.gov (United States)

    Clever, Guido H; Shionoya, Mitsuhiko

    2012-01-01

    Base-pairing in the naturally occurring DNA and RNA oligonucleotide duplexes is based on π-stacking, hydrogen bonding, and shape complementarity between the nucleobases adenine, thymine, guanine, and cytosine as well as on the hydrophobic-hydrophilic balance in aqueous media. This complex system of multiple supramolecular interactions is the product of a long-term evolutionary process and thus highly optimized to serve its biological functions such as information storage and processing. After the successful implementation of automated DNA synthesis, chemists have begun to introduce artificial modifications inside the core of the DNA double helix in order to study various aspects of base pairing, generate new base pairs orthogonal to the natural ones, and equip the biopolymer with entirely new functions. The idea to replace the hydrogen bonding interactions with metal coordination between ligand-like nucleosides and suitable transition metal ions culminated in the development of a plethora of artificial base-pairing systems termed "metal base-pairs" which were shown to strongly enhance the DNA duplex stability. Furthermore, they show great potential for the use of DNA as a molecular wire in nanoscale electronic architectures. Although single electrons have proven to be transmitted by natural DNA over a distance of several base pairs, the high ohmic resistance of unmodified oligonucleotides was identified as a serious obstacle. By exchanging some or all of the Watson-Crick base pairs in DNA with metal complexes, this problem may be solved. In the future, these research efforts are supposed to lead to DNA-like materials with superior conductivity for nano-electronic applications. Other fields of potential application such as DNA-based supramolecular architecture and catalysis may be strongly influenced by these developments as well. This text is meant to illustrate the basic concepts of metal-base pairing and give an outline over recent developments in this field.

  7. Subthreshold pair production in short laser pulses

    OpenAIRE

    Nousch, T.; Seipt, D.; Kampfer, B.; Titov, A. I.

    2012-01-01

    The $e^+e^-$ pair production by a probe photon traversing a linearly polarized laser pulse is treated as generalized nonlinear Breit-Wheeler process. For short laser pulses with very few oscillations of the electromagnetic field we find below the perturbative weak-field threshold $\\sqrt{s} = 2m$ a similar enhancement of the pair production rate as for circular polarization. The strong subthreshold enhancement is traced back to the finite bandwidth of the laser pulse. A folding model is develo...

  8. Marcus Theory of Ion-Pairing

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Santanu; Baer, Marcel D.; Mundy, Christopher J.; Schenter, Gregory K.

    2017-08-08

    We present a theory for ion pair dissociation and association, motivated by the concepts of the Marcus theory of electron transfer. Despite the extensive research on ion-pairing in many chemical and biological processes, much can be learned from the exploration of collective reaction coordinates. To this end, we explore two reaction coordinates, ion pair distance and coordination number. The study of the correlation between these reaction coordinates provides a new insight into the mechanism and kinetics of ion pair dissociation and association in water. The potential of mean force on these 2D-surfaces computed from molecular dynamics simulations of different monovalent ion pairs reveal a Marcus-like mechanism for ion-pairing: Water molecules rearrange forming an activated coordination state prior to ion pair dissociation or association, followed by relaxation of the coordination state due to further water rearrangement. Like Marcus theory, we find the existence of an inverted region where the transition rates are slower with increasing exergonicity. This study provides a new perspective for the future investigations of ion-pairing and transport. SR, CJM, and GKS were supported by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences, and Biosciences. MDB was supported by MS3 (Materials Synthesis and Simulation Across Scales) Initiative, a Laboratory Directed Research and Development Program at Pacific Northwest National Laboratory (PNNL). The research was performed using PNNL Institutional Computing. PNNL is a multi-program national laboratory operated by Battelle for the U.S. Department of Energy.

  9. Pair Production in Low Luminosity Galactic Nuclei

    CERN Document Server

    Moscibrodzka, Monika; Dolence, Joshua C; Shiokawa, Hotaka

    2011-01-01

    Electron-positron pairs may be produced near accreting black holes by a variety of physical processes, and the resulting pair plasma may be accelerated and collimated into a relativistic jet. Here we use a self-consistent dynamical and radiative model to investigate pair production by \\gamma\\gamma collisions in weakly radiative accretion flows around a black hole of mass M and accretion rate \\dot{M}. Our flow model is drawn from general relativistic magnetohydrodynamic simulations, and our radiation field is computed by a Monte Carlo transport scheme assuming the electron distribution function is thermal. We argue that the pair production rate scales as r^{-6} M^{-1} \\dot{M}^{6}. We confirm this numerically and calibrate the scaling relation. This relation is self-consistent in a wedge in M, \\dot{M} parameter space. If \\dot{M} is too low the implied pair density over the poles of the black hole is below the Goldreich-Julian density and \\gamma\\gamma pair production is relatively unimportant; if \\dot{M} is too ...

  10. Migration of helium-pair in metals

    Energy Technology Data Exchange (ETDEWEB)

    Cao, J.L.; Geng, W.T., E-mail: geng@ustb.edu.cn

    2016-09-15

    We have carried out a first-principles density functional theory investigation into the migration of both a single interstitial He and an interstitial He-pair in Fe, Mo, W, Cu, Pd, and Pt. We find the migration trajectories and barriers are determined predominantly by low-energy He-pair configurations which depend mainly on the energy state of a single He in different interstices. The migration barrier for a He-pair in bcc metals is always slightly higher than for a single He. Configurations of a He-pair in fcc metals are very complicated, due to the existence of interstitial sites with nearly identical energy for a single He. The migration barrier for a He-pair is slightly lower than (in Cu), or similar to (in Pd and Pt) a single He. The collective migrations of a He-pair are ensured by strong He−He interactions with strength-versus-distance forms resembling chemical bonds and can be described with Morse potentials.

  11. Seniority zero pair coupled cluster doubles theory.

    Science.gov (United States)

    Stein, Tamar; Henderson, Thomas M; Scuseria, Gustavo E

    2014-06-07

    Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems.

  12. Formation of asteroid pairs by rotational fission.

    Science.gov (United States)

    Pravec, P; Vokrouhlický, D; Polishook, D; Scheeres, D J; Harris, A W; Galád, A; Vaduvescu, O; Pozo, F; Barr, A; Longa, P; Vachier, F; Colas, F; Pray, D P; Pollock, J; Reichart, D; Ivarsen, K; Haislip, J; Lacluyze, A; Kusnirák, P; Henych, T; Marchis, F; Macomber, B; Jacobson, S A; Krugly, Yu N; Sergeev, A V; Leroy, A

    2010-08-26

    Pairs of asteroids sharing similar heliocentric orbits, but not bound together, were found recently. Backward integrations of their orbits indicated that they separated gently with low relative velocities, but did not provide additional insight into their formation mechanism. A previously hypothesized rotational fission process may explain their formation-critical predictions are that the mass ratios are less than about 0.2 and, as the mass ratio approaches this upper limit, the spin period of the larger body becomes long. Here we report photometric observations of a sample of asteroid pairs, revealing that the primaries of pairs with mass ratios much less than 0.2 rotate rapidly, near their critical fission frequency. As the mass ratio approaches 0.2, the primary period grows long. This occurs as the total energy of the system approaches zero, requiring the asteroid pair to extract an increasing fraction of energy from the primary's spin in order to escape. We do not find asteroid pairs with mass ratios larger than 0.2. Rotationally fissioned systems beyond this limit have insufficient energy to disrupt. We conclude that asteroid pairs are formed by the rotational fission of a parent asteroid into a proto-binary system, which subsequently disrupts under its own internal system dynamics soon after formation.

  13. Fundamental aspects of recoupled pair bonds. I. Recoupled pair bonds in carbon and sulfur monofluoride

    Energy Technology Data Exchange (ETDEWEB)

    Dunning, Thom H., E-mail: thdjr@uw.edu; Xu, Lu T.; Takeshita, Tyler Y. [Department of Chemistry, University of Illinois at Urbana-Champaign, 600 S. Mathews Avenue, Urbana, Illinois 61801 (United States)

    2015-01-21

    The number of singly occupied orbitals in the ground-state atomic configuration of an element defines its nominal valence. For carbon and sulfur, with two singly occupied orbitals in their {sup 3}P ground states, the nominal valence is two. However, in both cases, it is possible to form more bonds than indicated by the nominal valence—up to four bonds for carbon and six bonds for sulfur. In carbon, the electrons in the 2s lone pair can participate in bonding, and in sulfur the electrons in both the 3p and 3s lone pairs can participate. Carbon 2s and sulfur 3p recoupled pair bonds are the basis for the tetravalence of carbon and sulfur, and 3s recoupled pair bonds enable sulfur to be hexavalent. In this paper, we report generalized valence bond as well as more accurate calculations on the a{sup 4}Σ{sup −} states of CF and SF, which are archetypal examples of molecules that possess recoupled pair bonds. These calculations provide insights into the fundamental nature of recoupled pair bonds and illustrate the key differences between recoupled pair bonds formed with the 2s lone pair of carbon, as a representative of the early p-block elements, and recoupled pair bonds formed with the 3p lone pair of sulfur, as a representative of the late p-block elements.

  14. Effect of Drug Pair of Coptis Chinensis and Evodia Rutatecarpa on Blood Pressure,Plasma Endothelin and Calcitonin Gene - related Peptide in Spontaneous Hypertension Rats%药对黄连、吴茱萸对高血压大鼠血压和血浆ET、CGRP的影响

    Institute of Scientific and Technical Information of China (English)

    卜宪峥; 吴华芹; 胡元会; 褚瑜光; 宋庆桥; 王师菡

    2011-01-01

    Objective To investigate the effects of drug pair of coptis chinensis and evodia rutatecarpa on blood pressure.the content of plasma endothelin(ET) .and calcitonin gene - related peptide (CGRP) in spontaneous hypertension rats(SHR). Methods Twenty - four SHR were randomly divided into model group(n = 8) .nifedipine group(n = 8) given nifedipine .and Lianyu decoction group(w=8) given Lianyu oral liquid by continuously gavages. Eight normal Wistar - Kyoto rats(WKY) were as control (WKY group). WKY group and Model group were given normal saline. After treatment for 4 weeks* blood pressure,the content of plasma ET and CGRP were measured. Results Compared with model group, the blood pressure in Lian - Yu decoction group was significantly lower (P<0. 01). The content of ET was decreased (P<0. 05) .while the content of plasma CGRP was greatly increased (P<0. 01) in Lianyu decoction group. Conclusion Drug pair of coptis chinensis and evodia rutatecarpa could significantly reduce blood pressure in SHR, which might be related to reduce the content of plasma ET and increase the content of plasma CGRP.%目的 观察药对黄连、吴茱萸对自发性高血压大鼠(SHR)血压和血管活性物质内皮素(ET)、降钙素基因相关肽(CGRP)含量的影响.方法将24只SHR随机分为模型组(Model组)、硝苯地平组(Nif组)、连萸药对组(LY组),每组8只,以正常WKY大鼠为对照组(WKY组),8只,共4组.WKY组和Model组予以生理盐水,Nif组予以硝苯地平溶液,中药组予以相应配伍剂量的浓煎剂,连续灌胃4周,测量大鼠灌胃前和灌胃4周末大鼠尾动脉的收缩压.第4周末同时测定大鼠血浆中ET、CGRP的含量.结果 与Model组比较,中药组大鼠4周后血压水平明显降低(P<0.05),血浆ET含量降低(P<0.05),CGRP的含量明显升高(P<0.05),但与Nif组相比无统计学意义.结论 药对黄连、吴茱萸对SHR有明显的降压作用,其机制可能与降低血浆中ET的含量,增加CGRP的含量有关.

  15. Coevolution of paired receptors in Xenopus carcinoembryonic antigen-related cell adhesion molecule families suggests appropriation as pathogen receptors.

    Science.gov (United States)

    Zimmermann, Wolfgang; Kammerer, Robert

    2016-11-16

    In mammals, CEACAM1 and closely related members represent paired receptors with similar extracellular ligand-binding regions and cytoplasmic domains with opposing functions. Human CEACAM1 and CEACAM3 which have inhibitory ITIM/ITSM and activating ITAM-like motifs, respectively, in their cytoplasmic regions are such paired receptors. Various bacterial pathogens bind to CEACAM1 on epithelial and immune cells facilitating both entry into the host and down-regulation of the immune response whereas interaction with granulocyte-specific CEACAM3 leads to their uptake and destruction. It is unclear whether paired CEACAM receptors also exist in other vertebrate clades. We identified more than 80 ceacam genes in Xenopus tropicalis and X. laevis. They consist of two subgroups containing one or two putative paired receptor pairs each. Analysis of genomic sequences of paired receptors provide evidence that their highly similar ligand binding domains were adjusted by recent gene conversion events. In contrast, selection for diversification is observed among inhibitory receptor orthologs of the two frogs which split some 60 million years ago. The allotetraploid X. laevis arose later by hybridization of two closely related species. Interestingly, despite the conservation of the genomic landscape surrounding the homeologous ceacam loci only one locus resembles the one found in X. tropicalis. From the second X. laevis locus more than 80 % of the ceacam genes were lost including 5 of the 6 paired receptor genes. This suggests that once the gene for one of the paired receptors is lost the remaining gene cluster degrades rapidly probably due to lack of selection pressure exerted by pathogens. The presence of paired receptors and selection for diversification suggests that also in amphibians CEACAM1-related inhibitory proteins are or were used as pathogen receptors.

  16. Heterogeneity between primary colon carcinoma and paired lymphatic and hepatic metastases.

    Science.gov (United States)

    Lan, Huanrong; Jin, Ketao; Xie, Bojian; Han, Na; Cui, Binbin; Cao, Feilin; Teng, Lisong

    2012-11-01

    Heterogeneity is one of the recognized characteristics of human tumors, and occurs on multiple levels in a wide range of tumors. A number of studies have focused on the heterogeneity found in primary tumors and related metastases with the consideration that the evaluation of metastatic rather than primary sites could be of clinical relevance. Numerous studies have demonstrated particularly high rates of heterogeneity between primary colorectal tumors and their paired lymphatic and hepatic metastases. It has also been proposed that the heterogeneity between primary colon carcinomas and their paired lymphatic and hepatic metastases may result in different responses to anticancer therapies. The heterogeneity in primary colon carcinoma and corresponding metastases by genome‑wide gene expression analysis has not been extensively studied. In the present study, we investigated the differentially expressed genes between a primary colon carcinoma specimen (obtained from a 40-year-old female colon carcinoma patient with lymphatic and hepatic metastases) and its paired lymphatic and hepatic metastases by genome-wide gene expression analysis using GeneChip HGU133Plus2.0 expression arrays. Our results demonstrate that genome-wide gene expression varies between primary colon carcinoma and its paired lymphatic and hepatic metastases.

  17. Generalized pairing strategies-a bridge from pairing strategies to colorings

    Directory of Open Access Journals (Sweden)

    Győrffy Lajos

    2016-12-01

    Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.

  18. Population genetic structure, gene flow and sex-biased dispersal in frillneck lizards (Chlamydosaurus kingii).

    Science.gov (United States)

    Ujvari, Beata; Dowton, Mark; Madsen, Thomas

    2008-08-01

    By using both mitochondrial and nuclear multiloci markers, we explored population genetic structure, gene flow and sex-specific dispersal of frillneck lizards (Chlamydosaurus kingii) sampled at three locations, separated by 10 to 50 km, in a homogenous savannah woodland in tropical Australia. Apart from a recombinant lizard, the mitochondrial analyses revealed two nonoverlapping haplotypes/populations, while the nuclear markers showed that the frillneck lizards represented three separate clusters/populations. Due to the small population size of the mtDNA, fixation may occur via founder effects and/or drift. We therefore suggest that either of these two processes, or a combination of the two, are the most likely causes of the discordant results obtained from the mitochondrial and the nuclear markers. In contrast to the nonoverlapping mitochondrial haplotypes, in 12 out of 74 lizards, mixed nuclear genotypes were observed, hence revealing a limited nuclear gene flow. Although gene flow should ultimately result in a blending of the populations, we propose that the distinct nuclear population structure is maintained by frequent fires resulting in local bottlenecks, and concomitant spatial separation of the frillneck lizard populations. Limited mark-recapture data and the difference in distribution of the mitochondrial and nuclear markers suggest that the mixed nuclear genotypes were caused by juvenile male-biased dispersal.

  19. Theoretical study of pair density wave superconductors

    Science.gov (United States)

    Zheng, Zhichao

    In conventional superconductors, the Cooper pairs are formed from quasiparticles. We explore another type of superconducting state, a pair density wave (PDW) order, which spontaneously breaks some of the translational and point group symmetries. In a PDW superconductor, the order parameter is a periodic function of the center-of-mass coordinate, and the spatial average value of the superconducting order parameter vanishes. In the early 1960s, following the success of the BCS theory of superconductivity, Fulde and Ferrell and Larkin and Ovchinnikov (FFLO) developed theories of inhomogeneous superconducting states. Because of this Zeeman splitting in a magnetic field, the Cooper pairs having a nonzero center-of-mass momentum are more stable than the normal pairing, leading to the FFLO state. Experiments suggest possible occurrence of the FFLO state in the heavy-fermion compound CeCoIn5, and in quasi-low-dimensional organic superconductors. FFLO phases have also been argued to be of importance in understanding ultracold atomic Fermi gases and in the formation of color superconductivity in high density quark matter. In all Fermi superfluids known at the present time, Cooper pairs are composed of particles with spin 1/2. The spin component of a pair wave function can be characterized by its total spin S = 0 (singlet) and S = 1 (triplet). In the discovered broken inversion superconductors CePt3Si, Li2Pt3B, and Li2Pd3B, the magnetic field leads to novel inhomogeneous superconducting states, namely the helical phase and the multiple-q phase. Its order parameter exhibits periodicity similar to FFLO phase, and the consequences of both phases are same: the enhancement of transition temperature as a function of magnetic field. We have studied the PDW phases in broken parity superconductors with vortices included. By studying PDW vortex states, we find the usual Abrikosov vortex solution is unstable against a new solution with fractional vortex pairs. We have also studied the

  20. String pair production in non homogeneous backgrounds

    CERN Document Server

    Bolognesi, Stefano; Tallarita, Gianni

    2016-01-01

    We consider string pair production in non homogeneous electric backgrounds. We study several particular configurations which can be addressed with the Euclidean world-sheet instanton technique, the analogue of the world-line instanton for particles. In the first case the string is suspended between two D-branes in flat space-time, in the second case the string lives in AdS and terminates on one D-brane (this realizes the holographic Schwinger effect). In some regions of parameter space the result is well approximated by the known analytical formulas, either the particle pair production in non-homogeneous background or the string pair production in homogeneous background. In other cases we see effects which are intrinsically stringy and related to the non-homogeneity of the background. The pair production is enhanced already for particles in time dependent electric field backgrounds. The string nature enhances this even further. For spacial varying electrical background fields the string pair production is les...

  1. Pairing instabilities of Dirac composite fermions

    Science.gov (United States)

    Milovanović, M. V.; Ćirić, M. Dimitrijević; Juričić, V.

    2016-09-01

    Recently, a Dirac (particle-hole symmetric) description of composite fermions in the half-filled Landau level (LL) was proposed [D. T. Son, Phys. Rev. X 5, 031027 (2015), 10.1103/PhysRevX.5.031027], and we study its possible consequences on BCS (Cooper) pairing of composite fermions (CFs). One of the main consequences is the existence of anisotropic states in single-layer and bilayer systems, which was previously suggested in Jeong and Park [J. S. Jeong and K. Park, Phys. Rev. B 91, 195119 (2015), 10.1103/PhysRevB.91.195119]. We argue that in the half-filled LL in the single-layer case the gapped states may sustain anisotropy, because isotropic pairings may coexist with anisotropic ones. Furthermore, anisotropic pairings with the addition of a particle-hole symmetry-breaking mass term may evolve into rotationally symmetric states, i.e., Pfaffian states of Halperin-Lee-Read (HLR) ordinary CFs. On the basis of the Dirac formalism, we argue that in the quantum Hall bilayer at total filling factor 1, with decreasing distance between the layers, weak pairing of p -wave paired CFs is gradually transformed from Dirac to ordinary, HLR-like, with a concomitant decrease in the CF number. Global characterization of low-energy spectra based on the Dirac CFs agrees well with previous calculations performed by exact diagonalization on a torus. Finally, we discuss features of the Dirac formalism when applied in this context.

  2. Pairing and specific heat in hot nuclei

    CERN Document Server

    Gambacurta, Danilo; Sandulescu, Nicu

    2013-01-01

    The thermodynamics of pairing phase-transition in nuclei is studied in the canonical ensemble and treating the pairing correlations in a finite-temperature variation after projection BCS approach (FT-VAP). Due to the restoration of particle number conservation, the pairing gap and the specific heat calculated in the FT-VAP approach vary smoothly with the temperature, indicating a gradual transition from the superfluid to the normal phase, as expected in finite systems. We have checked that the predictions of the FT-VAP approach are very accurate when compared to the results obtained by an exact diagonalization of the pairing Hamiltonian. The influence of pairing correlations on specific heat is analysed for the isotopes $^{161,162}$Dy and $^{171,172}$Yb. It is shown that the FT-VAP approach, applied with a level density provided by mean field calculations and supplemented, at high energies, by the level density of the back-shifted Fermi gas model, can approximate reasonably well the main properties of specifi...

  3. The environment of low redshift quasar pairs

    CERN Document Server

    Sandrinelli, Angela; Treves, Aldo; Farina, Emanuele Paolo; Uslenghi, Michela

    2014-01-01

    We investigate the properties of the galaxy environment of a sample of 14 low redshift (z $<$ 0.85) quasar physical pairs extracted from SDSS DR10 archives. The pairs have a systemic radial velocity difference $\\Delta V_\\parallel \\leqslant$ 600 $km \\ s^{-1}$ (based on [OIII]5007 \\AA \\ line) and projected distance $ R_\\bot \\leqslant$ 600 kpc. The physical association of the pairs is statistically confirmed at a level of $\\sim$ 90 %. For most of the images of these quasars we are able to resolve their host galaxies that turn out to be on average similar to those of quasars not in pairs. We also found that quasars in a pair are on average in region of modest galaxy overdensity extending up 0.5 Mpc from the QSO. This galaxy overdensity is indistinguishable from that of a homogeneous sample of isolated quasars at the same redshift and with similar host galaxy luminosity. These results, albeit derived from a small (but homogeneous) sample of objects, suggest that the rare activation of two quasars with small phy...

  4. Vector boson pair production at hadron colliders

    CERN Document Server

    Adamson, K L

    2002-01-01

    We calculate the contribution of gluon-gluon induced processes to vector boson pair production at hadron colliders, specifically the production of WZ, W gamma and Z gamma pairs. We calculate the tree level processes gg -> WZqq-bqr, gg -> W gamma qq-bar and gg -> Z gamma qq-bar, and the one loop process gg -> Z gamma. We use the helicity method and include the decay of the W and Z bosons into leptons in the narrow width approximation. We include anomalous triple gauge couplings in all of our vector boson pair production calculations. In order to integrate over the qq-bar final state phase space we use an extended version of the subtraction method to NNLO and cancel collinear singularities explicitly. The general subtraction terms that are obtained apply to all vector boson pair production processes. Due to the large gluon density at low x, the gluon induced terms of vector boson pair production are expected to be the dominant NNLO QCD correction, relevant at LHC energies. However, we show that due to a cancell...

  5. Gene Cluster Statistics with Gene Families

    Science.gov (United States)

    Durand, Dannie

    2009-01-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such “gene clusters” is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  6. Mad-Maximized Higgs Pair Analyses

    CERN Document Server

    Kling, Felix; Schichtel, Peter

    2016-01-01

    We study Higgs pair production with a subsequent decay to a pair of photons and a pair of bottoms at the LHC. We use the log-likelihood ratio to identify the kinematic regions which either allow us to separate the di-Higgs signal from backgrounds or to determine the Higgs self-coupling. We find that both regions are separate enough to ensure that details of the background modelling will not affect the determination of the self-coupling. Assuming dominant statistical uncertainties we determine the best precision with which the Higgs self- coupling can be probed in this channel. We finally comment on the same questions at a future 100 TeV collider.

  7. Schwinger Pair Production in Pulsed Electric Fields

    CERN Document Server

    Kim, Sang Pyo; Ruffini, Remo

    2012-01-01

    We numerically investigate the temporal behavior and the structure of longitudinal momentum spectrum and the field polarity effect on pair production in pulsed electric fields in scalar quantum electrodynamics (QED). Using the evolution operator expressed in terms of the particle and antiparticle operators, we find the exact quantum states under the influence of electric pulses and measure the number of pairs of the Minkowski particle and antiparticle. The number of pairs, depending on the configuration of electric pulses, exhibits rich structures in the longitudinal momentum spectrum and undergoes diverse dynamical behaviors at the onset of the interaction but always either converges to a momentum-dependent constant or oscillates around a momentum-dependent time average after the completion of fields.

  8. Hard photodisintegration of a proton pair

    Science.gov (United States)

    Pomerantz, I.; Bubis, N.; Allada, K.; Beck, A.; Beck, S.; Berman, B. L.; Boeglin, W.; Camsonne, A.; Canan, M.; Chirapatpimol, K.; Cisbani, E.; Cusanno, F.; de Jager, C. W.; Dutta, C.; Garibaldi, F.; Geagla, O.; Gilman, R.; Glister, J.; Higinbotham, D. W.; Jiang, X.; Katramatou, A. T.; Khrosinkova, E.; Lee, B. W.; LeRose, J. J.; Lindgren, R.; McCullough, E.; Meekins, D.; Michaels, R.; Moffit, B.; Petratos, G. G.; Piasetzky, E.; Qian, X.; Qiang, Y.; Rodriguez, I.; Ron, G.; Saha, A.; Sarty, A. J.; Sawatzky, B.; Schulte, E.; Shneor, R.; Sparveris, N.; Subedi, R.; Strauch, S.; Sulkosky, V.; Wang, Y.; Wojtsekhowski, B.; Yan, X.; Yao, H.; Zhan, X.; Zheng, X.

    2010-02-01

    We present a study of high energy photodisintegration of proton-pairs through the γ+He3→p+p+n channel. Photon energies, Eγ, from 0.8 to 4.7 GeV were used in kinematics corresponding to a proton pair with high relative momentum and a neutron nearly at rest. The s scaling of the cross section, as predicted by the constituent counting rule for two nucleon photodisintegration, was observed for the first time. The onset of the scaling is at a higher energy and the cross section is significantly lower than for deuteron (pn pair) photodisintegration. For Eγ below the scaling region, the scaled cross section was found to present a strong energy-dependent structure not observed in deuteron photodisintegration.

  9. The inverse problem for Schwinger pair production

    Energy Technology Data Exchange (ETDEWEB)

    Hebenstreit, F., E-mail: hebenstreit@itp.unibe.ch

    2016-02-10

    The production of electron–positron pairs in time-dependent electric fields (Schwinger mechanism) depends non-linearly on the applied field profile. Accordingly, the resulting momentum spectrum is extremely sensitive to small variations of the field parameters. Owing to this non-linear dependence it is so far unpredictable how to choose a field configuration such that a predetermined momentum distribution is generated. We show that quantum kinetic theory along with optimal control theory can be used to approximately solve this inverse problem for Schwinger pair production. We exemplify this by studying the superposition of a small number of harmonic components resulting in predetermined signatures in the asymptotic momentum spectrum. In the long run, our results could facilitate the observation of this yet unobserved pair production mechanism in quantum electrodynamics by providing suggestions for tailored field configurations.

  10. Narrowband Photon Pair Source for Quantum Networks

    CERN Document Server

    Monteiro, F; Sanguinetti, B; Zbinden, H; Thew, R T

    2013-01-01

    We demonstrate a compact photon pair source based on a periodically poled lithium niobate nonlinear crystal in a cavity. The cavity parameters are chosen such that the emitted photon pair modes can be matched in the region of telecom ultra dense wavelength division multiplexing (U-DWDM) channel spacings. This approach provides efficient, low-loss, mode selection that is compatible with standard telecommunication networks. Photons with a coherence time of 8.6 ns (116 MHz) are produced and their purity is demonstrated. A source brightness of 134 pairs(s.mW.MHz)$^{-1}$ is reported. The high level of purity and compatibility with standard telecom networks is of great importance for complex quantum communication networks.

  11. An inverse problem for Schwinger pair production

    CERN Document Server

    Hebenstreit, Florian

    2016-01-01

    The production of electron-positron pairs in time-dependent electric fields (Schwinger mechanism) depends non-linearly on the applied field profile. Accordingly, the resulting momentum spectrum is extremely sensitive to small variations of the field parameters. Owing to this non-linear dependence it is so far unpredictable how to choose a field configuration such that a predetermined momentum distribution is generated. We show that quantum kinetic theory along with optimal control theory can be used to approximately solve this inverse problem for Schwinger pair production. We exemplify this by studying the superposition of a small number of harmonic components resulting in predetermined signatures in the asymptotic momentum spectrum. In the long run, our results could facilitate the observation of this yet unobserved pair production mechanism in quantum electrodynamics by providing suggestions for tailored field configurations.

  12. Holographic EPR Pairs, Wormholes and Radiation

    CERN Document Server

    Chernicoff, Mariano; Pedraza, Juan F

    2013-01-01

    As evidence for the ER=EPR conjecture, it has recently been observed that the string that is holographically dual to an entangled quark-antiquark pair separating with (asymptotically) uniform acceleration has a wormhole on its worldsheet. We point out that a two-sided horizon and a wormhole actually appear for much more generic quark-antiquark trajectories, which is consistent with the fact that the members of an EPR pair need not be permanently out of causal contact. The feature that determines whether the causal structure of the string worldsheet is trivial or not turns out to be the emission of gluonic radiation by the dual quark and antiquark. In the strongly-coupled gauge theory, it is only when radiation is emitted that one obtains an unambiguous separation of the pair into entangled subsystems, and this is what is reflected on the gravity side by the existence of the worldsheet horizon.

  13. Categorical Pairs and the Indicative Shift

    CERN Document Server

    Kauffman, Louis H

    2011-01-01

    This paper introduces the notion of a categorical pair, a pair of categories (C,C') such that every morphism in C is an object in C'. Categorical pairs are precursors to 2-categories. Arrows in C' can express relationships among the morphisms of C. In particular we show that by using a model of the linguistic process of naming, we can ensure that every morphism in C has an indirect self-reference of the form a -----> Fa where this arrow occurs in the category C'. This result is shown to generalize and clarify known fixed point theorems in logic and categories, and is applied to Goedel's Incompleteness Theorem, the Cantor Diagonal Process and the Lawvere Fixed Point Theorem. In particular we show that the indirect self-reference that is central to Goedel's Theorem is an instance of a general pattern here called the indicative shift.

  14. The inverse problem for Schwinger pair production

    Directory of Open Access Journals (Sweden)

    F. Hebenstreit

    2016-02-01

    Full Text Available The production of electron–positron pairs in time-dependent electric fields (Schwinger mechanism depends non-linearly on the applied field profile. Accordingly, the resulting momentum spectrum is extremely sensitive to small variations of the field parameters. Owing to this non-linear dependence it is so far unpredictable how to choose a field configuration such that a predetermined momentum distribution is generated. We show that quantum kinetic theory along with optimal control theory can be used to approximately solve this inverse problem for Schwinger pair production. We exemplify this by studying the superposition of a small number of harmonic components resulting in predetermined signatures in the asymptotic momentum spectrum. In the long run, our results could facilitate the observation of this yet unobserved pair production mechanism in quantum electrodynamics by providing suggestions for tailored field configurations.

  15. The structure of two distinct pancreatic amylase genes in mouse strain YBR

    DEFF Research Database (Denmark)

    Mikkelsen, BM; Clark, ME; Christiansen, Gunna;

    1985-01-01

    The amylase complex on mouse chromosome 3 encodes both salivary and pancreatic amylase. It appears that one active gene is present for salivary amylase, whereas pancreatic amylase in some strains is coded by at least 4, and perhaps by more than 10, genes. Strain YBR is different from other strains...... in that it produces twice as much salivary amylase. Pancreatic amylase in YBR is present as two different protein forms, A beta and B beta, the sum of which amounts to only one-third of that in, for instance, strain A/J. YBR chromosomal DNA was cloned in phage gamma, followed by restriction and heteroduplex analysis...... of recombinant phages carrying amylase genes. Among 32 phage isolates, 5 carried parts of the salivary amylase sequence. The remaining phage isolates contained pancreatic amylase-like sequences and represented three nonoverlapping genomic regions, i.e., one of 34 kb containing a complete gene, PAN-II beta...

  16. The structure of two distinct pancreatic amylase genes in mouse strain YBR

    DEFF Research Database (Denmark)

    Mikkelsen, BM; Clark, ME; Christiansen, Gunna

    1985-01-01

    in that it produces twice as much salivary amylase. Pancreatic amylase in YBR is present as two different protein forms, A beta and B beta, the sum of which amounts to only one-third of that in, for instance, strain A/J. YBR chromosomal DNA was cloned in phage gamma, followed by restriction and heteroduplex analysis......The amylase complex on mouse chromosome 3 encodes both salivary and pancreatic amylase. It appears that one active gene is present for salivary amylase, whereas pancreatic amylase in some strains is coded by at least 4, and perhaps by more than 10, genes. Strain YBR is different from other strains...... of recombinant phages carrying amylase genes. Among 32 phage isolates, 5 carried parts of the salivary amylase sequence. The remaining phage isolates contained pancreatic amylase-like sequences and represented three nonoverlapping genomic regions, i.e., one of 34 kb containing a complete gene, PAN-II beta...

  17. Pairing of Homologous Regions in the Mouse Genome Is Associated with Transcription but Not Imprinting Status

    Science.gov (United States)

    Krueger, Christel; King, Michelle R.; Krueger, Felix; Branco, Miguel R.; Osborne, Cameron S.; Niakan, Kathy K.; Higgins, Michael J.; Reik, Wolf

    2012-01-01

    Although somatic homologous pairing is common in Drosophila it is not generally observed in mammalian cells. However, a number of regions have recently been shown to come into close proximity with their homologous allele, and it has been proposed that pairing might be involved in the establishment or maintenance of monoallelic expression. Here, we investigate the pairing properties of various imprinted and non-imprinted regions in mouse tissues and ES cells. We find by allele-specific 4C-Seq and DNA FISH that the Kcnq1 imprinted region displays frequent pairing but that this is not dependent on monoallelic expression. We demonstrate that pairing involves larger chromosomal regions and that the two chromosome territories come close together. Frequent pairing is not associated with imprinted status or DNA repair, but is influenced by chromosomal location and transcription. We propose that homologous pairing is not exclusive to specialised regions or specific functional events, and speculate that it provides the cell with the opportunity of trans-allelic effects on gene regulation. PMID:22802932

  18. Breaking of Cooper pairs in 108Pd

    Science.gov (United States)

    Rahmatinejad, A.; Kakavand, T.; Razavi, R.

    2016-04-01

    In this paper, breaking of Cooper pairs in 108Pd is investigated within the canonical ensemble framework and the BCS model. Our results show an evidence of two phase transitions, which are related to neutron and proton systems. Also, with consideration of pairing interaction, the role of neutron and proton systems in entropy, spin cutoff parameter and as a result in the moment of inertia are investigated. The results show minor role for the proton system at low temperatures and approximately equal roles for both neutron and proton systems after the critical temperature. Good agreement was observed between obtained results and the experimental data.

  19. Subthreshold pair production in short laser pulses

    CERN Document Server

    Nousch, T; Kampfer, B; Titov, A I

    2012-01-01

    The $e^+e^-$ pair production by a probe photon traversing a linearly polarized laser pulse is treated as generalized nonlinear Breit-Wheeler process. For short laser pulses with very few oscillations of the electromagnetic field we find below the perturbative weak-field threshold $\\sqrt{s} = 2m$ a similar enhancement of the pair production rate as for circular polarization. The strong subthreshold enhancement is traced back to the finite bandwidth of the laser pulse. A folding model is developed which accounts for the interplay of the frequency spectrum and the intensity distribution in the course of the pulse.

  20. Nilpotent orbits in real symmetric pairs

    CERN Document Server

    Dietrich, Heiko; Ruggeri, Daniele; Trigiante, Mario

    2016-01-01

    In the classification of stationary solutions in extended supergravities with symmetric scalar manifolds, the nilpotent orbits of a real symmetric pair play an important role. In this paper we discuss two approaches to determining the nilpotent orbits of a real symmetric pair. We apply our methods to an explicit example, and thereby classify the nilpotent orbits of SL_2(R)^4 acting on the fourth tensor power of the natural 2-dimensional SL_2(R)-module. This makes it possible to classify all stationary solutions of the so-called STU-supergravity model.

  1. Fostering multiculturalism: the English Conversation Pairs Program.

    Science.gov (United States)

    Smith, B E; Elander, E

    1995-01-01

    Exposure to and personal interactions with people of diverse cultures foster an acceptance of multiculturalism. To this end, the English Conversation Pairs Program provides weekly conversation sessions between students who are native speakers of English (NSE) and students who speak English as a second language (ESL). Attitudes of twenty-two NSE students are surveyed before and after participation in the Conversation Pairs Program. This paper discusses (a) NSE students' perceptions of the program, (b) perceived changes in cultural sensitivity of NSE students, (c) activities which enhance and/or hamper program effectiveness, and (d) variables which influence program effectiveness.

  2. Pairing Phase Transitions of Matter under Rotation

    CERN Document Server

    Jiang, Yin

    2016-01-01

    The phases and properties of matter under global rotation have attracted much interest recently. In this paper we investigate the pairing phenomena in a system of fermions under the presence of rotation. We find that there is a generic suppression effect on pairing states with zero angular momentum. We demonstrate this effect with the chiral condensation and the color superconductivity in hot dense QCD matter as explicit examples. In the case of chiral condensation, a new phase diagram in the temperature-rotation parameter space is found, with a nontrivial critical point.

  3. Age-dependent trajectories differ between within-pair and extra-pair paternity success.

    Science.gov (United States)

    Hsu, Y-H; Simons, M J P; Schroeder, J; Girndt, A; Winney, I S; Burke, T; Nakagawa, S

    2017-02-24

    Reproductive success is associated with age in many taxa, increasing in early life followed by reproductive senescence. In socially monogamous but genetically polygamous species, this generates the interesting possibility of differential trajectories of within-pair and extra-pair siring success with age in males. We investigate these relationships simultaneously using within-individual analyses with 13 years of data from an insular house sparrow (Passer domesticus) population. As expected, we found that both within- and extra-pair paternity success increased with age, followed by a senescence-like decline. However, the age trajectories of within- and extra-pair paternity successes differed significantly, with the extra-pair paternity success increasing faster, although not significantly, in early life, and showing a delayed decline by 1.5 years on average later in life compared to within-pair paternity success. These different trajectories indicate that the two alternative mating tactics should have age-dependent pay-offs. Males may partition their reproductive effort between within- and extra-pair matings depending on their current age to reap the maximal combined benefit from both strategies. The interplay between these mating strategies and age-specific mortality may explain the variation in rates of extra-pair paternity observed within and between species.

  4. Communication: Multipole approximations of distant pair energies in local correlation methods with pair natural orbitals

    Science.gov (United States)

    Werner, Hans-Joachim

    2016-11-01

    The accuracy of multipole approximations for distant pair energies in local second-order Møller-Plesset perturbation theory (LMP2) as introduced by Hetzer et al. [Chem. Phys. Lett. 290, 143 (1998)] is investigated for three chemical reactions involving molecules with up to 92 atoms. Various iterative and non-iterative approaches are compared, using different energy thresholds for distant pair selection. It is demonstrated that the simple non-iterative dipole-dipole approximation, which has been used in several recent pair natural orbitals (PNO)-LMP2 and PNO-LCCSD (local coupled-cluster with singles and doubles) methods, may underestimate the distant pair energies by up to 50% and can lead to significant errors in relative energies, unless very tight thresholds are used. The accuracy can be much improved by including higher multipole orders and by optimizing the distant pair amplitudes iteratively along with all other amplitudes. A new approach is presented in which very small special PNO domains for distant pairs are used in the iterative approach. This reduces the number of distant pair amplitudes by 3 orders of magnitude and keeps the additional computational effort for the iterative optimization of distant pair amplitudes minimal.

  5. DNA pairing is an important step in the process of targeted nucleotide exchange.

    Science.gov (United States)

    Drury, Miya D; Kmiec, Eric B

    2003-02-01

    Modified single-stranded DNA oligonucleotides can direct the repair of genetic mutations in yeast, plant and mammalian cells. The mechanism by which these molecules exert their effect is being elucidated, but the first phase is likely to involve the homologous alignment of the single strand with its complementary sequence in the target gene. In this study, we establish the importance of such DNA pairing in facilitating the gene repair event. Oligonucleotide-directed repair occurs at a low frequency in an Escherichia coli strain (DH10B) lacking the RECA DNA pairing function. Repair activity can be rescued by using purified RecA protein to catalyze the assimilation of oligonucleotide vectors into a plasmid containing a mutant kanamycin resistance gene in vitro. Electroporation of the preformed complex into DH10B cells results in high levels of gene repair activity, evidenced by the appearance of kanamycin-resistant colonies. Gene repair is dependent on the formation of a double-displacement loop (double-D-loop), a recombination intermediate containing two single-stranded oligonucleotides hybridized to opposite strands of the plasmid at the site of the point mutation. The heightened level of stability of the double-D-loop enables it to serve as an active template for the DNA repair events. The data establish DNA pairing and the formation of the double-D-loop as important first steps in the process of gene repair.

  6. Extracting an entangled photon pair from collectively decohered pairs at a telecommunication wavelength.

    Science.gov (United States)

    Tsujimoto, Yoshiaki; Sugiura, Yukihiro; Ando, Makoto; Katsuse, Daisuke; Ikuta, Rikizo; Yamamoto, Takashi; Koashi, Masato; Imoto, Nobuyuki

    2015-05-18

    We experimentally demonstrated entanglement extraction scheme by using photons at the telecommunication band for optical-fiber-based quantum communications. We generated two pairs of non-degenerate polarization entangled photons at 780 nm and 1551 nm by spontaneous parametric down-conversion and distributed the two photons at 1551 nm through a collective phase damping channel which gives the same amount of random phase shift on the two photons. Through local operation and classical communication, we extracted an entangled photon pair from two phase-disturbed photon pairs. An observed fidelity of the extracted photon pair to a maximally entangled photon pair was 0.73 ± 0.07 which clearly shows the recovery of entanglement.

  7. Comparing complexities of pairs of modules

    CERN Document Server

    Dao, Hailong

    2009-01-01

    Let $R$ be a local ring and $M,N$ be finitely generated $R$-modules. The complexity of $(M,N)$, denoted by $\\cxx RMN$, measures the polynomial growth rate of the number of generators of the modules $\\Ext nRMN$. In this paper we study several basic equalities and inequalities involving complexities of different pairs of modules.

  8. Evacuation dynamics of asymmetrically coupled pedestrian pairs

    CERN Document Server

    Müller, Frank

    2016-01-01

    We propose and analyze extended floor field cellular automaton models for evacuation dynamics of inhomogeneous pedestrian pairs which are coupled by asymmetric group interactions. Such pairs consist of a leader, who mainly determines the couple's motion and a follower, who has a defined tendency to follow the leader. Examples for such pairs are mother and child or two siblings of different age. We examine the system properties and compare them to the case of a homogeneous crowd. We find a strong impact on evacuation times for the regime of strong pair coupling due to the occurrence of a clogging phenomenon. In addition we obtain a non-trivial dependence of evacuation times on the followers' coupling to the static floor field, which carries the information of the shortest way to the exit location. In particular we find that systems with fully passive followers, who are solely coupled to their leaders, show lower evacuation times than homogeneous systems where all pedestrians have an equal tendency to move towa...

  9. Near-Ring Radicals and Class Pairs

    Institute of Scientific and Technical Information of China (English)

    L.Godloza; N.J.Groenewald; W.A.Olivier

    2005-01-01

    For near-ring ideal mappings p1 and p2, we investigate radical theoretical properties of and the relationship among the class pairs (p1: p2), (Sp2: Sp1) and (Rp2:Rp1). Conditions on p1 and p2 are given for a general class pair to form a radical class of various types. These types include the Plotkin and KA-radical varieties. A number of examples are shown to motivate the suitability of the theory of Hoehnke-radicals over KA-radicals when radical pairs of near-rings are studied. In particular, it is shown that (pc: P3) forms a KA-radical class, where Pc denotes the class of completely prime nearrings and P3 the class of 3-prime near-rings. This gives another near-ring generalization of the 2-primal ring concept. The theory of radical pairs are also used to show that in general the class of 3-semiprime near-rings is not the semisimple class of the 3-prime radical.

  10. RNA Matchmaking: Finding Cellular Pairing Partners.

    Science.gov (United States)

    Graveley, Brenton R

    2016-07-21

    RNA structure is intimately related to function, yet methods to identify base-paired RNA strands in a transcriptome-wide manner in cells have remained elusive. One recent paper in Cell and two in Molecular Cell describe related methods to identify RNA sequences that interact in living cells, setting the stage for breakthroughs in our understanding of RNA structure and function.

  11. Computing Hypercrossed Complex Pairings in Digital Images

    Directory of Open Access Journals (Sweden)

    Simge Öztunç

    2013-01-01

    Full Text Available We consider an additive group structure in digital images and introduce the commutator in digital images. Then we calculate the hypercrossed complex pairings which generates a normal subgroup in dimension 2 and in dimension 3 by using 8-adjacency and 26-adjacency.

  12. Chemical Nonlinearities and Radical Pair Lifetime Estimation

    Science.gov (United States)

    Robinson, Gregory

    2013-03-01

    Much attention has recently developed around chemical reactions that depend on applied static magnetic fields as weak as earth's. This interest is largely motivated by experiments that implicate the role of spin-selective radical pair recombination in biological magnetic sensing. Existing literature uses a straightforward calculation to approximate the expected lifetime of coherent radical pairs as a function of the minimum RF amplitude that is observed to disrupt magnetic navigation, apparently by decohering the radical pair via electronic Zeeman excitations. But we show that chemical nonlinearities can preclude direct computation of coherent pair lifetime without considering the cellular signalling mechanisms involved, and discuss whether it can explain the surprising fragility of some animals' compass sense. In particular, we demonstrate that an autocatalytic cycle can introduce threshold effects on the disruption sensitivity to applied oscillatory magnetic fields. We will show examples in the mean-field limit and consider the consequences of noise and fluctuations in the Freidlin-Wentzell picture of perturbed dynamical systems.

  13. Pair Negotiation When Developing English Speaking Tasks

    Science.gov (United States)

    Bohórquez Suárez, Ingrid Liliana; Gómez Sará, Mary Mily; Medina Mosquera, Sindy Lorena

    2011-01-01

    This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students'…

  14. Diagnostics for conformity of paired quantitative measurements.

    Science.gov (United States)

    Hawkins, Douglas M

    2002-07-15

    Matched pairs data arise in many contexts - in case-control clinical trials, for example, and from cross-over designs. They also arise in experiments to verify the equivalence of quantitative assays. This latter use (which is the main focus of this paper) raises difficulties not always seen in other matched pairs applications. Since the designs deliberately vary the analyte levels over a wide range, issues of variance dependent on mean, calibrations of differing slopes, and curvature all need to be added to the usual model assumptions such as normality. Violations in any of these assumptions invalidate the conventional matched pairs analysis. A graphical method, due to Bland and Altman, of looking at the relationship between the average and the difference of the members of the pairs is shown to correspond to a formal testable regression model. Using standard regression diagnostics, one may detect and diagnose departures from the model assumptions and remedy them - for example using variable transformations. Examples of different common scenarios and possible approaches to handling them are shown.

  15. The mother of all pair potentials

    DEFF Research Database (Denmark)

    Dyre, J. C.; Bacher, Andreas Kvist

    2014-01-01

    This paper presents a computer simulation study of the exponentially repulsive pair potential system. The simulations show that the system has strong virial potential energy correlations in a large part of its thermodynamic phase diagram. Consequences of this are briefly discussed; these include ...

  16. Quantum physics: Photons paired with phonons

    Science.gov (United States)

    Blencowe, Miles

    2016-02-01

    The force exerted by light on an object has been used to pair photons with quantum units of mechanical vibration. This paves the way for mechanical oscillators to act as interfaces between photons and other quantum systems. See Letter p.313

  17. Externally definable sets and dependent pairs

    CERN Document Server

    Chernikov, Artem

    2010-01-01

    We prove that externally definable sets in first order NIP theories have honest definitions, giving a new proof of Shelah's expansion theorem. Also we discuss a weak notion of stable embeddedness true in this context. Those results are then used to prove a general theorem on dependent pairs, which in particular answers a question of Baldwin and Benedikt on naming an indiscernible sequence.

  18. Ion Pairing in Alkali Nitrate Electrolyte Solutions.

    Science.gov (United States)

    Xie, Wen Jun; Zhang, Zhen; Gao, Yi Qin

    2016-03-10

    In this study, we investigate the thermodynamics of alkali nitrate salt solutions, especially the formation of contact ion pairs between alkali cation and nitrate anion. The ion-pairing propensity shows an order of LiNO3 activity coefficients and suggest that the empirical "law of matching water affinity" is followed by these alkali nitrate salt solutions. The spatial patterns of contact ion pairs are different in the three salt solutions studied here: Li(+) forms the contact ion pair with only one oxygen of the nitrate while Na(+) and K(+) can also be shared by two oxygens of the nitrate. In reproducing the salt activity coefficient using Kirkwood-Buff theory, we find that it is essential to include electronic polarization for Li(+) which has a high charge density. The electronic continuum correction for nonpolarizable force field significantly improves the agreement between the calculated activity coefficients and their experimental values. This approach also improves the performance of the force field on salt solubility. From these two aspects, this study suggests that electronic continuum correction can be a promising approach to force-field development for ions with high charge densities.

  19. Degenerated differential pair with controllable transconductance

    NARCIS (Netherlands)

    Mensink, Clemens; Mensink, Clemens H.J.; Nauta, Bram

    1998-01-01

    A differential pair with input transistors and provided with a variable degeneration resistor. The degeneration resistor comprises a series arrangement of two branches of coupled resistors which are shunted in mutually corresponding points by respective control transistors whose gates are interconne

  20. A Novel Approach for Collaborative Pair Programming

    Science.gov (United States)

    Goel, Sanjay; Kathuria, Vanshi

    2010-01-01

    The majority of an engineer's time in the software industry is spent working with other programmers. Agile methods of software development like eXtreme Programming strongly rely upon practices like daily meetings and pair programming. Hence, the need to learn the skill of working collaboratively is of primary importance for software developers.…

  1. Two New CPM Pairs in Libra

    Science.gov (United States)

    Ahad, Abdul

    2014-10-01

    In this paper two new double stars are reported in the constellation of Libra that are currently not in the WDS catalog, the components of which share common proper motions. On observed photometric characteristics, calibration of distances, and other assumptions, all the indications are that both pairs comprise possible wide physical systems.

  2. Building a control sample for galaxy pairs

    CERN Document Server

    Perez, Josefa; Blaizot, Jeremy

    2009-01-01

    Several observational works have attempted to isolate the effects of galaxy interactions by comparing galaxies in pairs with isolated galaxies. However, different authors have proposed different ways to build these so-called control samples (CS). By using mock galaxy catalogues of the SDSS-DR4 built up from the Millennium Simulation, we explore how the way of building a CS might introduce biases which could affect the interpretation of results. We make use of the fact that the physics of interactions is not included in the semianalytic model, to infer that any difference between the mock control and pair samples can be ascribed to selection biases. Thus, we find that galaxies in pairs artificially tend to be older and more bulge-dominated, and to have less cold gas and different metallicities than their isolated counterparts. Also because of a biased selection, galaxies in pairs tend to live in higher density environments, and in haloes of larger masses. We find that imposing constraints on redshift, stellar ...

  3. Multiconfiguration Pair-Density Functional Theory.

    Science.gov (United States)

    Li Manni, Giovanni; Carlson, Rebecca K; Luo, Sijie; Ma, Dongxia; Olsen, Jeppe; Truhlar, Donald G; Gagliardi, Laura

    2014-09-09

    We present a new theoretical framework, called Multiconfiguration Pair-Density Functional Theory (MC-PDFT), which combines multiconfigurational wave functions with a generalization of density functional theory (DFT). A multiconfigurational self-consistent-field (MCSCF) wave function with correct spin and space symmetry is used to compute the total electronic density, its gradient, the on-top pair density, and the kinetic and Coulomb contributions to the total electronic energy. We then use a functional of the total density, its gradient, and the on-top pair density to calculate the remaining part of the energy, which we call the on-top-density-functional energy in contrast to the exchange-correlation energy of Kohn-Sham DFT. Because the on-top pair density is an element of the two-particle density matrix, this goes beyond the Hohenberg-Kohn theorem that refers only to the one-particle density. To illustrate the theory, we obtain first approximations to the required new type of density functionals by translating conventional density functionals of the spin densities using a simple prescription, and we perform post-SCF density functional calculations using the total density, density gradient, and on-top pair density from the MCSCF calculations. Double counting of dynamic correlation or exchange does not occur because the MCSCF energy is not used. The theory is illustrated by applications to the bond energies and potential energy curves of H2, N2, F2, CaO, Cr2, and NiCl and the electronic excitation energies of Be, C, N, N(+), O, O(+), Sc(+), Mn, Co, Mo, Ru, N2, HCHO, C4H6, c-C5H6, and pyrazine. The method presented has a computational cost and scaling similar to MCSCF, but a quantitative accuracy, even with the present first approximations to the new types of density functionals, that is comparable to much more expensive multireference perturbation theory methods.

  4. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  5. Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells

    KAUST Repository

    Wong, Ka-Chun

    2015-09-27

    Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.

  6. Asynchronous replication and autosome-pair non-equivalence in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Devkanya Dutta

    Full Text Available A number of mammalian genes exhibit the unusual properties of random monoallelic expression and random asynchronous replication. Such exceptional genes include genes subject to X inactivation and autosomal genes including odorant receptors, immunoglobulins, interleukins, pheromone receptors, and p120 catenin. In differentiated cells, random asynchronous replication of interspersed autosomal genes is coordinated at the whole chromosome level, indicative of chromosome-pair non-equivalence. Here we have investigated the replication pattern of the random asynchronously replicating genes in undifferentiated human embryonic stem cells, using fluorescence in situ hybridization based assay. We show that allele-specific replication of X-linked genes and random monoallelic autosomal genes occur in human embryonic stem cells. The direction of replication is coordinated at the whole chromosome level and can cross the centromere, indicating the existence of autosome-pair non-equivalence in human embryonic stem cells. These results suggest that epigenetic mechanism(s that randomly distinguish between two parental alleles are emerging in the cells of the inner cell mass, the source of human embryonic stem cells.

  7. Modelling of top quark pairs production in association with Standard Model bosons or heavy quark pairs.

    CERN Document Server

    Moreno Llacer, Maria; The ATLAS collaboration

    2016-01-01

    Production of top quark pairs in association with heavy Standard Model bosons or with heavy flavour quark-pairs is important both as a signal and a background in several ATLAS analyses. Strong constraints on such processes cannot at present be obtained from data, and therefore their modeling by Monte Carlo simulation as well as the associated uncertainties are important. This poster documents the Monte Carlo samples currently being used in ATLAS for the ttH and ttV (V=W,Z vector bosons) and tt+bottom and charm quark pairs processes for sqrt(s)=13 TeV proton-proton collisions.

  8. A context dependent pair hidden Markov model for statistical alignment

    CERN Document Server

    Arribas-Gil, Ana

    2011-01-01

    This article proposes a novel approach to statistical alignment of nucleotide sequences by introducing a context dependent structure on the substitution process in the underlying evolutionary model. We propose to estimate alignments and context dependent mutation rates relying on the observation of two homologous sequences. The procedure is based on a generalized pair-hidden Markov structure, where conditional on the alignment path, the nucleotide sequences follow a Markov distribution. We use a stochastic approximation expectation maximization (saem) algorithm to give accurate estimators of parameters and alignments. We provide results both on simulated data and vertebrate genomes, which are known to have a high mutation rate from CG dinucleotide. In particular, we establish that the method improves the accuracy of the alignment of a human pseudogene and its functional gene.

  9. A search for resonant Z pair production

    Energy Technology Data Exchange (ETDEWEB)

    Boveia, Antonio [Univ. of California, Santa Barbara, CA (United States)

    2008-12-01

    I describe a search for anomalous production of Z pairs through a new massive resonance X in 2.5-2.9 fb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV using the CDFII Detector at the Fermilab Tevatron. I reconstruct Z pairs through their decays to electrons, muons, and quarks. To achieve perhaps the most efficient lepton reconstruction ever used at CDF, I apply a thorough understanding of the detector and new reconstruction software heavily revised for this purpose. In particular, I have designed and employ new general-purpose algorithms for tracking at large η in order to increase muon acceptance. Upon analyzing the unblinded signal samples, I observe no X → ZZ candidates and set upper limits on the production cross section using a Kaluza-Klein graviton-like acceptance.

  10. Seismic interferometry with antipodal station pairs

    Science.gov (United States)

    Lin, Fan-Chi; Tsai, Victor C.

    2013-09-01

    In this study, we analyze continuous data from all Global Seismographic Network stations between year 2000 and 2009 and demonstrate that several body wave phases (e.g., PP, PcPPKP, SKSP, and PPS) propagating between nearly antipodal station pairs can be clearly observed without array stacking using the noise/coda cross-correlation method. Based on temporal correlations with global seismicity, we show that the observed body waves are clearly earthquake related. Moreover, based on single-earthquake analysis, we show that the earthquake coda energy observed between ~10,000 and 30,000 s after a large earthquake contributes the majority of the signal. We refine our method based on these observations and show that the signal can be significantly improved by selecting only earthquake coda times. With our improved processing, the PKIKP phase, which does not benefit from the focusing effect near the antipode, can now also clearly be observed for long-distance station pairs.

  11. Transmission properties of cryogenic twisted pair filters

    Energy Technology Data Exchange (ETDEWEB)

    Song, Woon; Rehman, Mushtaq; Chong, Yonuk [Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of); Ryu, Sangwan [Chonnam National University, Gwangju (Korea, Republic of)

    2010-12-15

    We fabricated a cryogenic low pass filter that consists of twisted pairs of manganin wires wrapped in copper tape and measured its transmission characteristics at frequencies up to 18 GHz. The dependence of the microwave transmission characteristics on the filter length was studied, which showed that a filter of length 1.0 m had a 70-dB attenuation at 1 GHz. We also studied the dependence of common- and differential-mode transmission on the number of twists per unit length and found that the number of twists per unit length affects differential-mode transmission but not common-mode transmission. Because the shielded twisted pair filter is more compact than a conventional copper powder filter, it can solve the space and thermal load issues when many cables are required for precision electronic transport experiments at low temperatures.

  12. Locomotion gaits of a rotating cylinder pair

    Science.gov (United States)

    van Rees, Wim M.; Novati, Guido; Koumoutsakos, Petros; Mahadevan, L.

    2015-11-01

    Using 2D numerical simulations of the Navier-Stokes equations, we demonstrate that a simple pair of rotating cylinders can display a range of locomotion patterns of biological and engineering interest. Steadily counter-rotating the cylinders causes the pair to move akin to a vortex dipole for low rotation rates, but as the rotational velocity is increased the direction of motion reverses. Unsteady rotations lead to different locomotion gaits that resemble jellyfish (for in-phase rotations) and undulating swimmers (for out-of-phase rotations). The small number of parameters for this simple system allows us to systematically map the phase space of these gaits, and allows us to understand the underlying physical mechanisms using a minimal model with implications for biological locomotion and engineered analogs.

  13. Schwinger pair production with ultracold atoms

    Science.gov (United States)

    Kasper, V.; Hebenstreit, F.; Oberthaler, M. K.; Berges, J.

    2016-09-01

    We consider a system of ultracold atoms in an optical lattice as a quantum simulator for electron-positron pair production in quantum electrodynamics (QED). For a setup in one spatial dimension, we investigate the nonequilibrium phenomenon of pair production including the backreaction leading to plasma oscillations. Unlike previous investigations on quantum link models, we focus on the infinite-dimensional Hilbert space of QED and show that it may be well approximated by experiments employing Bose-Einstein condensates interacting with fermionic atoms. Numerical calculations based on functional integral techniques give a unique access to the physical parameters required to realize QED phenomena in a cold atom experiment. In particular, we use our approach to consider quantum link models in a yet unexplored parameter regime and give bounds for their ability to capture essential features of the physics. The results suggest a paradigmatic change towards realizations using coherent many-body states for quantum simulations of high-energy particle physics phenomena.

  14. Construction of Sziklai Pair using Mixed Components

    Science.gov (United States)

    Singh, Ramendra; Tripathi, Ankit; Anand, Vartika

    2017-08-01

    To design Sziklai pair topology for small-signal amplifier circuit with RC coupled voltage divider bias, both BJT and JFET are used. Such a design amplifier circuit can be tuned in the frequency range of 108Hz-620 KHz. The circuit proposed in this paper can amplify audio range signal excursions swinging in the range of 0.1-12mV at 1KHz. Features like high voltage gain, current gain greater than unity, wider bandwidth and considerably low harmonic distortion makes this amplifier superior than earlier announced small-signal Sziklai pair amplifier. Various applications for this proposed amplifier is in Radio/TV receivers, low frequency power sources and other audible range communication applications

  15. Top pair production measurements at ATLAS.

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00445370

    2016-01-01

    Measurements of the inclusive and differential top-quark pair cross sections in proton-proton collisions at both 8 TeV and 13 TeV with the ATLAS detector at the Large Hadron Collider are presented. The inclusive measurements reach high precision and are compared to the best available theoretical calculations. Differential measurements of the kinematic properties of the top quark production are also discussed. These measurements, including results using boosted tops, probe our understanding of top pair production in the TeV regime. The results, extrapolated to particle and parton level, are compared to Monte Carlo generators implementing LO and NLO matrix elements matched with parton showers and NNLO QCD calculations.

  16. Asymmetric pair distribution functions in catalysts

    DEFF Research Database (Denmark)

    Clausen, B. S.; Nørskov, Jens Kehlet

    2000-01-01

    The structural parameters, i.e., coordination numbers, bond distances and disorder obtained from the analysis of EXAFS spectra may sometimes be significantly influenced by errors introduced due to the inadequacy of the analysis method applied. Especially in the case of heterogeneous catalysts...... it has been realized that often there is a need to use an improved EXAFS data analysis compared to the simple harmonic approach which works well for well-defined bulk structures. This is due to the fact that catalysts contain highly dispersed or disordered structures with pair distribution functions......, will be described. The method is based on an analysis of the pair distribution functions derived from molecular dynamics simulations of small metal particles and its reliability is demonstrated by comparing structural parameters obtained from independent X-ray diffraction experiments....

  17. Dual Resolution Images from Paired Fingerprint Cards

    Science.gov (United States)

    NIST Dual Resolution Images from Paired Fingerprint Cards (PC database for purchase)   NIST Special Database 30 is being distributed for use in development and testing of fingerprint compression and fingerprint matching systems. The database allows the user to develop and evaluate data compression algorithms for fingerprint images scanned at both 19.7 ppmm (500 dpi) and 39.4 ppmm (1000 dpi). The data consist of 36 ten-print paired cards with both the rolled and plain images scanned at 19.7 and 39.4 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  18. Superrotations and Black Hole Pair Creation

    CERN Document Server

    Strominger, Andrew

    2016-01-01

    Recent work has shown that the symmetries of classical gravitational scattering in asymptotically flat spacetimes include, at the linearized level, infinitesimal superrotations. These act like Virasoro generators on the celestial sphere at null infinity. However, due to the singularities in these generators, the physical status of finite superrotations has remained unclear. Here we address this issue in the context of the breaking of a cosmic string via quantum black hole pair nucleation. This process is described by a gravitational instanton known as the $C$-metric. After pair production, the black holes are pulled by the string to null infinity with a constant acceleration. At late times the string decays and the spacetime settles into a vacuum state. We show that the early and late spacetimes before and after string decay differ by a finite superrotation. This provides a physical interpretation of superrotations. They act on spacetimes which are asymptotically flat everywhere except at isolated singulariti...

  19. Pair distribution of ions in Coulomb lattice

    CERN Document Server

    Witt, H E D; Chugunov, A I; Baiko, D A; Yakovlev, D G

    2003-01-01

    The pair distribution function g(r) ident to g(x, y, z) and the radial pair distribution function g(r) of ions in body-centred-cubic and face-centred-cubic Coulomb crystals are calculated within the harmonic-lattice (HL) approximation in a wide temperature range, from the high-temperature classical limit (T >> h-bar w sub p , w sub p being the ion plasma frequency) to the low-temperature quantum limit (T || h-bar w sub p). In the classical limit, g(r) is also calculated by the Monte Carlo (MC) method. MC and HL results are demonstrated to be in good agreement. With decreasing T, the correlation peaks of g(r) and g(r) become narrower. At T || h-bar w sub p they become temperature independent (determined by zero-point ion vibrations).

  20. Paired Comparisons-based Interactive Differential Evolution

    CERN Document Server

    Takagi, Hideyuki

    2009-01-01

    We propose Interactive Differential Evolution (IDE) based on paired comparisons for reducing user fatigue and evaluate its convergence speed in comparison with Interactive Genetic Algorithms (IGA) and tournament IGA. User interface and convergence performance are two big keys for reducing Interactive Evolutionary Computation (IEC) user fatigue. Unlike IGA and conventional IDE, users of the proposed IDE and tournament IGA do not need to compare whole individuals each other but compare pairs of individuals, which largely decreases user fatigue. In this paper, we design a pseudo-IEC user and evaluate another factor, IEC convergence performance, using IEC simulators and show that our proposed IDE converges significantly faster than IGA and tournament IGA, i.e. our proposed one is superior to others from both user interface and convergence performance points of view.

  1. Quantum Computation by Pairing Trapped Ultracold Ions

    Institute of Scientific and Technical Information of China (English)

    冯芒; 朱熙文; 高克林; 施磊

    2001-01-01

    Superpositional wavefunction oscillations for the implementation of quantum algorithms modify the desired interference required for the quantum computation. We propose a scheme with trapped ultracold ion-pairs beingqubits to diminish the detrimental effect of the wavefunction oscillations, which is applied to the two-qubitGrover's search. It can be also found that the qubits in our scheme are more robust against the decoherencecaused by the environment, and the model is scalable.

  2. Are all Linear Paired Comparison Models Equivalent

    Science.gov (United States)

    1990-09-01

    Previous authors (Jackson and Fleckenstein 1957, Mosteller 1958, Noether 1960) have found that different models of paired comparisons data lead to simi...ponential distribution with a location parameter (Mosteller 1958, Noether 1960). Formal statements describing the limiting behavior of the gamma...that are not convolu- tion type linear models (the uniform model considered by Smith (1956), Mosteller (1958), Noether (1960)) and other convolution

  3. On the pairing effects in triaxial nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Oudih, M. R. [Laboratoire de Physique Théorique, Faculté de Physique,USTHB BP 32, El Alia, 16111 Bab Ezzouar, Algiers (Algeria); Fellah, M.; Allal, N. H. [Centre de Recherche Nucléaire d' Alger, 2 Bd. Frantz Fanon, BP. 399 Alger-Gare, Algiers, Algeria and Laboratoire de Physique Théorique, Faculté de Physique,USTHB BP 32, El Alia, 16111 Bab Ezzouar, Algiers (Algeria)

    2014-03-05

    Triaxial deformation effect on the pairing correlations is studied in the framework of the Skyrme Hartree-Fock-Bogoliubov theory. Quantities such as binding energy, gap parameter and particle-number fluctuation are considered in neutron-rich Mo isotopes. The results are compared with those of axially symmetric calculation and with available experimental data. The role played by the particle-number projection is outlined.

  4. Radiation damping in metal nanoparticle pairs.

    Science.gov (United States)

    Dahmen, Christian; Schmidt, Benjamin; von Plessen, Gero

    2007-02-01

    The radiation damping rate of plasmon resonances in pairs of spherical gold nanoparticles is calculated. The radiative line width of the plasmon resonance indicates significant far-field coupling between the nanoparticles over distances many times the particle diameter. The radiation damping of the coupled particle-plasmon mode alternates between superradiant and subradiant behavior when the particle spacing is varied. At small particle spacings where near-field coupling occurs, the radiation damping rate lies far below that of an isolated particle.

  5. Search for Scalar Leptoquark Pairs Decaying to $\

    CERN Document Server

    Acosta, D; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, J F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Ben-Haim, E; Benjamin, D; Beretvas, A; Bhatti, A A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bölla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canepa, A; Casarsa, M; Carlsmith, D; Carron, S; Carosi, R; Cavalli-Sforza, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, M L; Chuang, S; Chung, J Y; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cooper, B; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas-Maestro, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; De Barbaro, P; De Cecco, S; De Lentdecker, G; Dell'Agnello, S; Dell'Orso, Mauro; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Doerr, C; Doksus, P; Dominguez, A; Donati, S; Donega, M; Donini, J; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferretti, C; Field, R D; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallas, A; Galyardt, J; Gallinaro, M; García-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Griffiths, M; Grosso-Pilcher, C; Grundler, U; Günther, M; Guimarães da Costa, J; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Höcker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A J; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; LeCompte, T; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, M; Martin, A; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; NcNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miller, L; Miller, R; Miller, J S; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Mohr, B; Moore, R; Morello, M; Mukherjee, A; Mulhearn, M; Müller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Naumov, D V; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nicollerat, A S; Nigmanov, T; Nodulman, L; Norniella, O; Österberg, K; Ogawa, T; Oh, S H; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R G C; Orava, R; Orejudos, W; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Plager, C; Pompos, A; Pondrom, L; Pope, G; Poukhov, O; Prakoshyn, F; Pratt, T; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Rademacker, J; Rahaman, A; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reichold, A; Reisert, B; Rekovic, V; Renton, P B; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Rosenson, L; Roser, R; Rossin, R; Rott, C; Russ, J; Rusu, V; Ruiz, A; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; Saint-Denis, R; Sakumoto, W K; Salamanna, G; Saltzberg, D; Sánchez, C; Sansoni, A; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Siegrist, J; Siket, M; Sill, A; Sinervo, P; Sissakian, A N; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S V; Spalding, J; Spezziga, M; Spiegel, L; Spinella, F; Spiropulu, M; Squillacioti, P; Stadie, H; Stelzer, B; Stelzer-Chilton, O; Strologas, J; Stuart, D; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A C; Tafirout, R; Takach, S F; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tapprogge, Stefan; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Turner, M; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A W; Varganov, A; Vataga, E; Vejcik, S; Velev, G V; Veszpremi, V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobuev, I P; Von der Mey, M; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Yamashita, T; Yamamoto, K; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolter, M; Worcester, M; Worm, S; Wright, T; Wu, X; Würthwein, F; Wyatt, A; Yagil, A; Yang, U K; Yao, W; Yeh, G P; Yi, K; Yoh, J; Yoon, P; Yorita, K; Yoshida, T; Yu, I; Yu, S; Yu, Z; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhou, J; Zsenei, A; Zucchelli, S

    2004-01-01

    We report on a search for the pair production of scalar leptoquarks, $LQ$, using 191 pb$^{-1}$ of proton-antiproton collision data recorded by the CDF experiment during Run II of the Tevatron. The leptoquarks are sought via their decay into a neutrino and quark yielding missing transverse energy and several jets of large transverse energy. No evidence for leptoquark production is observed, and limits are set on $\\sigma(p\\bar p\\to LQ\\bar{LQ} X \\to \

  6. Na+ Cl- ion pair association in water-DMSO mixtures: Effect of ion pair model potentials

    Indian Academy of Sciences (India)

    ATANU SARKAR; ANUPAM CHATTERJEE; S C TIWARI; B L TEMBE

    2016-06-01

    Potentials of Mean Force (PMF) for the Na+ Cl- ion pair in water–dimethyl sulfoxide (DMSO)mixtures for three DMSO mole fractions have been computed using constrained Molecular Dynamics (MD)simulations and confirmed by dynamical trajectories and residence times of the ion pair at various inter-ionicseparations. The three ion-ion direct potentials used are 12-6-1, exp-6-1 and exp-8-6-1. The physical picturethat emerges is that there is a strong contact ion pair (CIP) and strong to moderate solvent separated ion pair(SSIP) in these solutions. Analysis of local ion clusters shows that ions are dominantly solvated by watermolecules. The 12-6-1 potential model predicts running coordination numbers closest to experimental data.

  7. General pairing interactions and pair truncation approximations for fermions in a single-j shell

    CERN Document Server

    Zhao, Y M; Ginocchio, J N; Yoshinaga, N

    2003-01-01

    We investigate Hamiltonians with attractive interactions between pairs of fermions coupled to angular momentum J. We show that pairs with spin J are reasonable building blocks for the low-lying states. For systems with only a J = Jmax pairing interaction, eigenvalues are found to be approximately integers for a large array of states, in particular for those with total angular momenta I le 2j. For I=0 eigenstates of four fermions in a single-j shell we show that there is only one non-zero eigenvalue. We address these observations using the nucleon pair approximation of the shell model and relate our results with a number of currently interesting problems.

  8. Chiral baryon in the coherent pair approximation

    CERN Document Server

    Aly, T S T

    1999-01-01

    We revisit the work of K. Goeke, M. Harvey, F. Grümmer, and J. N. Urbano (Phys. Rev. {\\bf D37}, 754 (1988)) who considered a chiral model for the nucleon based on the linear sigma model with scalar-isoscalar scalar-isovector mesons coupled to quarks and solved using the coherent-pair approximation. In this way the quantum pion field can be treated in a non-perturbative fashion. In this work we review this model and the coherent pair approximation correcting several errors in the earlier work. We minimize the expectation value of the chiral hamiltonian in the ansatz coherent-pair ground state configuration and solve the resulting equations for nucleon quantum numbers. We calculate the canonical set of nucleon observables and compare with the Hedgehog model and experiment. Using the corrected equations yield slightly different values for nucleon observables but do not correct the large virial deviation in the $\\pi$-nucleon coupling. Our results therefore do not significantly alter the conclusions of Goeke, et ...

  9. Pair fireball precursors of neutron star mergers

    Science.gov (United States)

    Metzger, Brian D.; Zivancev, Charles

    2016-10-01

    If at least one neutron star (NS) is magnetized in a binary NS merger, then the orbital motion of the conducting companion during the final inspiral induces a strong voltage and current along the magnetic field lines connecting the NSs. If a modest fraction η of the extracted electromagnetic power extracted accelerates relativistic particles, the resulting gamma-ray emission a compact volume will result in the formation of an electron-positron pair fireball. Applying a steady-state pair wind model, we quantify the detectability of the precursor fireball with gamma-ray satellites. For η ˜ 1 the gamma-ray detection horizon of Dmax ≈ 10(Bd/1014 G)3/4 Mpc is much closer than the Advanced Laser Interferometer Gravitational-Wave Observatory (LIGO)/Virgo horizon of 200 Mpc, unless the NS surface magnetic field strength is very large, B_d ≲ 10^{15} G. Given the quasi-isotropic nature of the emission, mergers with weaker NS fields could contribute a nearby population of short gamma-ray bursts. Power not dissipated close to the binary is carried to infinity along the open field lines by a large-scale Poynting flux. Reconnection within this outflow, well outside of the pair photosphere, provides a potential site for non-thermal emission, such as a coherent millisecond radio burst.

  10. Exclusive production of W pairs in CMS

    Directory of Open Access Journals (Sweden)

    Silveira Da

    2014-04-01

    Full Text Available We report the results on the search for exclusive production of W pairs in the LHC with data collected by the Compact Muon Solenoid detector in proton-proton collisions at √s = 7 TeV. The analysis comprises the two-photon production of a W pairs, pp → pW+ W− p → p νe± νµ∓ p. Two events are observed in data for pT(ℓ > 4 GeV, |η(ℓ| 20 GeV, in agreement with the standard model prediction of 2.2 ± 0.4 signal events with 0.84 ± 0.15 background events. Moreover, a study of the tail of the lepton pair transverse momentum distribution is performed to search for an evidence of anomalous quartic gauge couplings in the γγ → W+ W− vertex. As no events are observed in data, it results in a model-independent upper limits for the anomalous W quartic gauge couplings aW0,C/Λ2, which are of the order of 10−4.

  11. Estimating Eulerian spectra from pairs of drifters

    Science.gov (United States)

    LaCasce, Joe

    2017-04-01

    GPS-tracked surface drifters offer the possibility of sampling energetic variations at the ocean surface on scales of only 10s of meters, much less than that resolved by satellite. Here we investigate whether velocity differences between pairs of drifters can be used to estimate kinetic energy spectra. Theoretical relations between the spectrum and the second-order longitudinal structure function for 2D non-divergent flow are derived. The structure function is a natural statistic for particle pairs and is easily calculated. However it integrates contributions across wavenumber, and this tends to obscure the spectral dependencies when turbulent inertial ranges are of finite extent. Nevertheless, the transform from spectrum to structure function is robust, as illustrated with Eulerian data collected from aircraft. The inverse transform, from structure function to spectrum, is much less robust, yielding poor results in particular at large wavenumbers. This occurs because the transform involves a filter function which magnifies contributions from large pair separations, which tend to be noisy. Fitting the structure function to a polynomial improves the spectral estimate, but not sufficiently to distinguish correct inertial range dependencies. Thus with Lagrangian data, it is appears preferable to focus on structure functions, despite their shortcomings.

  12. Classifier-assisted metric for chromosome pairing.

    Science.gov (United States)

    Ventura, Rodrigo; Khmelinskii, Artem; Sanches, J

    2010-01-01

    Cytogenetics plays a central role in the detection of chromosomal abnormalities and in the diagnosis of genetic diseases. A karyogram is an image representation of human chromosomes arranged in order of decreasing size and paired in 23 classes. In this paper we propose an approach to automatically pair the chromosomes into a karyogram, using the information obtained in a rough SVM-based classification step, to help the pairing process mainly based on similarity metrics between the chromosomes. Using a set of geometric and band pattern features extracted from the chromosome images, the algorithm is formulated on a Bayesian framework, combining the similarity metric with the results from the classifier. The solution is obtained solving a mixed integer program. Two datasets with contrasting quality levels and 836 chromosomes each were used to test and validate the algorithm. Relevant improvements with respect to the algorithm described by the authors in [1] were obtained with average paring rates above 92%, close to the rates obtained by human operators.

  13. Differing von Hippel Lindau genotype in paired primary and metastatic tumors in patients with clear cell renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Susan A.J. Vaziri

    2012-05-01

    Full Text Available In sporadic clear cell renal cell carcinoma (CCRCC, the von Hippel Lindau (VHL gene is inactivated by mutation or methylation in the majority of primary (P tumors. Due to differing effects of wild-type (WT and mutant (MT VHL gene on downstream signaling pathways regulating angiogenesis, VHL gene status could impact clinical outcome. In CCRCC, comparative genomic hybridization (CGH analysis studies have reported genetic differences between paired P and metastatic (M tumors. We thus sequenced the VHL gene in paired tumor specimens from 10 patients to determine a possible clonal relationship between the P tumor and M lesion(s in patients with CCRCC. Using paraffin embedded specimens, genomic DNA from microdissected samples (>80% tumor of paired P tumor and M lesions from all 10 patients, as well as in normal tissue from 6 of these cases, was analyzed. The DNA was used for PCR-based amplification of each of the 3 exons of the VHL gene. Sequences derived from amplified samples were compared to the wild-type VHL gene sequence (GeneBank Accession No. AF010238. Methylation status of the VHL gene was determined using VHL methylation-specific PCR primers after DNA bisulfite modification. In 4/10 (40% patients the VHL gene status differed between the P tumor and the M lesion. As expected, when the VHL gene was mutated in both the P tumor and M lesion, the mutation was identical. Further, while the VHL genotype differed between the primary tumor in different kidneys or multiple metastatic lesions in the same patient, the VHL germline genotype in the normal adjacent tissue was always wild-type irrespective of the VHL gene status in the P tumor. These results demonstrate for the first time that the VHL gene status can be different between paired primary and metastatic tissue in patients with CCRCC.

  14. Does base-pairing strength play a role in microRNA repression?

    OpenAIRE

    2012-01-01

    In this paper, the authors explore the possibility that the base-pairing strength of miRNA–mRNA target plays a role in microRNA-mediated gene regulation. The authors found a significant correlation between the physiological temperature of the organism and the average G/C content of its miRNAs. This study suggests that an organism adapts its miRNA–target free energy according to its physiological temperature, thus highlighting the importance of base-pairing strength in miRNA activity.

  15. Gene Ontology

    Directory of Open Access Journals (Sweden)

    Gaston K. Mazandu

    2012-01-01

    Full Text Available The wide coverage and biological relevance of the Gene Ontology (GO, confirmed through its successful use in protein function prediction, have led to the growth in its popularity. In order to exploit the extent of biological knowledge that GO offers in describing genes or groups of genes, there is a need for an efficient, scalable similarity measure for GO terms and GO-annotated proteins. While several GO similarity measures exist, none adequately addresses all issues surrounding the design and usage of the ontology. We introduce a new metric for measuring the distance between two GO terms using the intrinsic topology of the GO-DAG, thus enabling the measurement of functional similarities between proteins based on their GO annotations. We assess the performance of this metric using a ROC analysis on human protein-protein interaction datasets and correlation coefficient analysis on the selected set of protein pairs from the CESSM online tool. This metric achieves good performance compared to the existing annotation-based GO measures. We used this new metric to assess functional similarity between orthologues, and show that it is effective at determining whether orthologues are annotated with similar functions and identifying cases where annotation is inconsistent between orthologues.

  16. Systematically fragmented genes in a multipartite mitochondrial genome

    Science.gov (United States)

    Vlcek, Cestmir; Marande, William; Teijeiro, Shona; Lukeš, Julius; Burger, Gertraud

    2011-01-01

    Arguably, the most bizarre mitochondrial DNA (mtDNA) is that of the euglenozoan eukaryote Diplonema papillatum. The genome consists of numerous small circular chromosomes none of which appears to encode a complete gene. For instance, the cox1 coding sequence is spread out over nine different chromosomes in non-overlapping pieces (modules), which are transcribed separately and joined to a contiguous mRNA by trans-splicing. Here, we examine how many genes are encoded by Diplonema mtDNA and whether all are fragmented and their transcripts trans-spliced. Module identification is challenging due to the sequence divergence of Diplonema mitochondrial genes. By employing most sensitive protein profile search algorithms and comparing genomic with cDNA sequence, we recognize a total of 11 typical mitochondrial genes. The 10 protein-coding genes are systematically chopped up into three to 12 modules of 60–350 bp length. The corresponding mRNAs are all trans-spliced. Identification of ribosomal RNAs is most difficult. So far, we only detect the 3′-module of the large subunit ribosomal RNA (rRNA); it does not trans-splice with other pieces. The small subunit rRNA gene remains elusive. Our results open new intriguing questions about the biochemistry and evolution of mitochondrial trans-splicing in Diplonema. PMID:20935050

  17. Morphology Transformation in Pairs of Galaxies The Local Sample

    CERN Document Server

    Junqueira, S; Infante, L; Junqueira, Selma; Mello, Duilia F. de; Infante, Leopoldo

    1997-01-01

    We present photometric analysis of a local sample of 14 isolated pairs of galaxies. The photometric properties analyzed in the local pairs are: colors, morphology, tidal effects and activity. We verify that close pairs have an excess of early-type galaxies and many elliptical galaxies in this pairs are, in fact, lenticular galaxies. Many late-pairs in our sample show strong tidal damage and blue star formation regions. We conclude that pairs of different morphologies may have passed through different evolution processes which violently transformed their morphology. Pairs with at least one early-type component may be descendents of groups of galaxies. However, late-type pairs are probably long-lived showing clearly signs of interaction. Some of them could be seen as an early stage of mergers. These photometric database will be used for future comparison with more distant pairs in order to study galaxy evolution.

  18. Physical Galaxy Pairs and Their Effects on Star Formation

    CERN Document Server

    Selim, I M; Bendary, R

    2014-01-01

    We present 776 truly physical galaxy pairs, 569 of them are close pairs and 208 false pairs from Karachentsev (1972) and Reduzzi & Rampazzo (1995) catalogues, which contains 1012 galaxy pairs. Also we carried out star formation activity through the far-infrared emission (FIR) in physical (truly) interacting galaxies in some galaxy pairs and compared them with projection (optical) interacting galaxy pairs. We focused on the triggering of star formation by interactions and analyzed the enhancement of star formation activity in terms of truly physical galaxy pairs. The large fraction of star formation activity is probably due to the activity in the exchange of matter between the truly companions. The star formation rate (SFR) of galaxies in truly galaxy pairs is found to be more enhanced than the apparent pairs.

  19. Isolated Main Galaxy Pairs from the SDSS Data Release 4

    Institute of Scientific and Technical Information of China (English)

    Xin-Fa Deng; Yi-Qing Chen; Ping Wu; Cheng-Hong Luo; Ji-Zhou He

    2006-01-01

    From the Main galaxy data of the SDSS Data Release 4 (SDSS4), we have identified close galaxy pairs at neighbourhood radius R = 100 kpc by three-dimensional cluster analysis. Using the criterion that an "isolated galaxy pair" must be separated from its "nearest neighbor" by more than 500 kpc, we constructed an isolated galaxy pair sample of 1158 pairs.We also constructed a random pair sample by randomly selecting 1158 galaxy pairs from the Main galaxy sample, which has the same redshift distribution as the isolated galaxy pair sample, and in which the two components of any pair have the same redshifts. Comparative studies of luminosity and size between the members of the galaxy pairs are performed. We find and further confirm there is no tendency for paired galaxies to have similar luminosities or sizes. From the isolated pair sample we also selected a subsample with the magnitude limit of the primary raised by 2 magnitudes, so as to include pairs in which the secondary is 2 magnitudes fainter than the primary. This subsample contains 82 pairs. A random pair sample is similarly constructed.

  20. Reduced rDNA Copy Number Does Not Affect “Competitive” Chromosome Pairing in XYY Males of Drosophila melanogaster

    OpenAIRE

    Keith A. Maggert

    2014-01-01

    The ribosomal DNA (rDNA) arrays are causal agents in X-Y chromosome pairing in meiosis I of Drosophila males. Despite broad variation in X-linked and Y-linked rDNA copy number, polymorphisms in regulatory/spacer sequences between rRNA genes, and variance in copy number of interrupting R1 and R2 retrotransposable elements, there is little evidence that different rDNA arrays affect pairing efficacy. I investigated whether induced rDNA copy number polymorphisms affect chromosome pairing in a “co...

  1. Top quark pair production at the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Baernreuther, Peter

    2012-06-28

    One of the most interesting and manifold processes in the Standard Model of elementary particle physics is the top quark pair production. It enabled the discovery of the top quark at the Tevatron in 1995 and the determination of many of its properties. By means of a precise measurement and calculation of the cross section of top quark pair production it is possible to extract the top quark mass. Improvements in the gluon parton distribution functions (important for the Higgs boson production) or improvements in the prediction of the Higgs mass are also closely linked with the top quark pair production. Furthermore, the production process plays an important role in the discovery of new physics. On the one hand the top quark pair decays form the largest part of the background in many BSM models, on the other hand BSM physics can be detected directly in the decay process by investigating the charge symmetry or the invariant mass spectrum. At the LHC it will be possible for the first time to produce a large amount of top quarks; thereby the statistical errors of the observables will be strongly reduced. The enormous increase in the production rate has two reasons. On the one hand, the acceleration energy of the LHC (14 TeV and 7 TeV) is significantly greater than that of the Tevatron (1.96 Tev). This leads to an increase of the cross section by a factor of 100 ({proportional_to}7.3 pb at the Tevatron to {proportional_to}800 pb at 14 TeV LHC). On the other hand, the luminosity of the LHC outperforms the Tevatron by a factor of 10-100. The reduced experimental errors for the observables demand an improvement of the theoretical error. The experimental accuracy of the LHC and the great relevance of the process led to an intensive activity of different research groups in order to improve the calculation of the cross section of top quark pair production. This work presents for the first time a complete numerical result for the full NNLO correction for the top quark pair

  2. Series-Coupled Pairs of Silica Microresonators

    Science.gov (United States)

    Savchenkov, Anatoliy; Iltchenko, Vladimir; Maleki, Lute; Handley, Tim

    2009-01-01

    Series-coupled pairs of whispering-gallery-mode optical microresonators have been demonstrated as prototypes of stable, narrow-band-pass photonic filters. Characteristics that are generally considered desirable in a photonic or other narrow-band-pass filter include response as nearly flat as possible across the pass band, sharp roll-off, and high rejection of signals outside the pass band. A single microresonator exhibits a Lorentzian filter function: its peak response cannot be made flatter and its roll-off cannot be made sharper. However, as a matter of basic principle applicable to resonators in general, it is possible to (1) use multiple resonators, operating in series or parallel, to obtain a roll-off sharper, and out-of-band rejection greater, relative to those of a Lorentzian filter function and (2) to make the peak response (the response within the pass band) flatter by tuning the resonators to slightly different resonance frequencies that span the pass band. The first of the two microresonators in each series-coupled pair was a microtorus made of germania-doped silica (containing about 19 mole percent germania), which is a material used for the cores of some optical fibers. The reasons for choosing this material is that exposing it to ultraviolet light causes it to undergo a chemical change that changes its index of refraction and thereby changes the resonance frequency. Hence, this material affords the means to effect the desired slight relative detuning of the two resonators. The second microresonator in each pair was a microsphere of pure silica. The advantage of making one of the resonators a torus instead of a sphere is that its spectrum of whispering-gallery-mode resonances is sparser, as needed to obtain a frequency separation of at least 100 GHz between resonances of the filter as a whole.

  3. Augmenting Think-Pair-Share with Simulations

    Science.gov (United States)

    Lee, Kevin M.; Siedell, C. M.; Prather, E. E.; CATS

    2009-01-01

    Computer simulations are valuable tools for the teaching and learning of introductory astronomy. They enable students to link together small pieces of information into mental models of complex physical systems that are far beyond their everyday experience. They can also be used to authentically test a student's conceptual understanding of a physical system by asking the student to make predictions regarding its behavior. Students receive formative feedback by testing their predictions in simulations. Think-Pair-Share - the posing of conceptual questions to students and having them vote on the answer before and after discussion with their peers - can benefit considerably from the incorporation of simulations. Simulations can be used for delivering content that precedes Think-Pair-Share, as the prompt the questions is based upon, or as a feedback tool to illustrate the answer to a question. These techniques are utilized in ClassAction - a collection of materials designed to enhance the metacognitive skills of Astro 101 students by promoting interactive engagement and providing rapid feedback. The main focus is dynamic conceptual questions largely based upon graphics that can be projected in the classroom. Many questions are available in a Flash computer database and instructors have the capability to recast these questions into alternate permutations based on their own preferences and student responses. Outlines, graphics, and simulations are included which instructors can use to provide feedback. This poster provides examples of simulation usage in Think-Pair-Share related to sky motions, lunar phases, and stellar properties. A multi-institutional classroom validation study of ClassAction is currently underway as a Collaboration of Astronomy Teaching Scholars (CATS) research project. All materials are publicly available at http://astro.unl.edu. We would like to thank the NSF for funding under Grant Nos. 0404988 and 0715517, a CCLI Phase III Grant for the

  4. Invisible Decays in Higgs Pair Production

    CERN Document Server

    Banerjee, Shankha; Spannowsky, Michael

    2016-01-01

    Observation of Higgs pair production is an important long term objective of the LHC physics program as it will shed light on the scalar potential of the Higgs field and the nature of electroweak symmetry breaking. While numerous studies have examined the impact of new physics on di-Higgs production, little attention has been given to the well-motivated possibility of exotic Higgs decays in this channel. Here we investigate the consequences of exotic invisible Higgs decays in di-Higgs production. We outline a search sensitive to such invisible decays in the $b\\bar b+{\

  5. Nuclear orbital and spin scissors with pairing

    Directory of Open Access Journals (Sweden)

    Balbutsev Evgeny

    2016-01-01

    Full Text Available Nuclear scissors modes are considered in the frame of the Wigner function moments method generalized to take into account spin degrees of freedom and pair correlations simultaneously. A new source of nuclear magnetism, connected with counter-rotation of spins up and down around the symmetry axis (hidden angular momenta, is discovered. Its inclusion into the theory allows one to improve substantially the agreement with experimental data in the description of energies and transition probabilities of scissors modes in rare earth nuclei.

  6. Generalized magnetofluid connections in pair plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Asenjo, Felipe A., E-mail: felipe.asenjo@uai.cl [Facultad de Ingeniería y Ciencias, Universidad Adolfo Ibáñez, Santiago 7941169 (Chile); Comisso, Luca, E-mail: lcomisso@princeton.edu [Department of Astrophysical Sciences and Princeton Plasma Physics Laboratory, Princeton University, Princeton, New Jersey 08544 (United States); Dipartimento Energia, Politecnico di Torino, Torino 10129, Italy and Istituto dei Sistemi Complessi-CNR, Roma 00185 (Italy); Mahajan, Swadesh M., E-mail: mahajan@mail.utexas.edu [Institute for Fusion Studies, The University of Texas at Austin, Austin, Texas 78712 (United States)

    2015-12-15

    We extend the magnetic connection theorem of ideal magnetohydrodynamics to nonideal relativistic pair plasmas. Adopting a generalized Ohm's law, we prove the existence of generalized magnetofluid connections that are preserved by the plasma dynamics. We show that these connections are related to a general antisymmetric tensor that unifies the electromagnetic and fluid fields. The generalized magnetofluid connections set important constraints on the plasma dynamics by forbidding transitions between configurations with different magnetofluid connectivity. An approximated solution is explicitly shown where the corrections due to current inertial effects are found.

  7. Catalysis of Schwinger Vacuum Pair Production

    CERN Document Server

    Dunne, Gerald V; Schützhold, Ralf

    2009-01-01

    We propose a new catalysis mechanism for non-perturbative vacuum electron-positron pair production, by superimposing a plane-wave X-ray probe beam with a strongly focused optical laser pulse, such as is planned at the Extreme Light Infrastructure (ELI) facility. We compute the absorption coefficient arising from vacuum polarization effects for photons below threshold in a strong electric field. This set-up should facilitate the (first) observation of this non-perturbative QED effect with planned light sources such as ELI yielding an envisioned intensity of order 10^{26}W/cm^2.

  8. Pair Negotiation When Developing English Speaking Tasks

    Directory of Open Access Journals (Sweden)

    Ingrid Liliana Bohórquez Suárez

    2011-12-01

    Full Text Available This study analyzes what characterizes the negotiations of seventh graders at a public school in Bogotá when working in pairs to develop speaking tasks in EFL classes. The inquiry is a descriptive case study that follows the qualitative paradigm. As a result of analyzing the data, we obtained four consecutive steps that characterize students’ negotiations: Establishing a connection with a partner to work with, proposing practical alternatives, refusing mates’ propositions, and making practical decisions. Moreover, we found that the constant performance of the process of negotiation provokes students to construct a sociolinguistic identity that allows agreements to emerge.

  9. Symmetries, Supersymmetries, and Pairing in Nuclei

    CERN Document Server

    Balantekin, A B

    2011-01-01

    These summer school lectures cover the use of algebraic techniques in various subfields of nuclear physics. After a brief description of groups and algebras, concepts of dynamical symmetry, dynamical supersymmetry, and supersymmetric quantum mechanics are introduced. Appropriate tools such as quasiparticles, quasispin, and Bogoliubov transformations are discussed with an emphasis on group theoretical foundations of these tools. To illustrate these concepts three physics applications are worked out in some detail: i) Pairing in nuclear physics; ii) Subbarrier fusion and associated group transformations; and iii) Symmetries of neutrino mass and of a related neutrino many-body problem.

  10. Pairs trading the commodity futures curve

    OpenAIRE

    Nikkanen, A. (Antti)

    2013-01-01

    I create a pairs trade on the commodity futures curve, which captures the roll returns of commodity futures and minimizes the standard deviation of the returns. The end results is a strategy that has an annualized arithmetic return of 6,04% and an annualized standard deviation of 2,01%. Transaction costs and liquidity are also accounted for. The goal was to create and backtest a trading strategy that tries to capture the roll return component of commodity futures returns. In order to redu...

  11. Efficient Certificateless Signcryption Scheme from Weil Pairing

    Directory of Open Access Journals (Sweden)

    Gang Yu

    2011-08-01

    Full Text Available Certificateless signcryption has both the advantage of certificateless public key cryptography, which overcome the escrow problem inherited from identity based cryptography without the use of certificates as in traditional public key cryptography, and signcryption which can fulfill both the functions of signature and encryption in a logical signal step. In this paper, we explicit the security model for certificateless signcryption and propose an efficient certificateless signcryption scheme from Weil pairings. The new scheme not only can be proved to be secure in our model but also can simultaneously provide public verifiability and forward security. Furthermore, compared with existing schemes, the new scheme is more efficient.

  12. A biometric signcryption scheme without bilinear pairing

    Science.gov (United States)

    Wang, Mingwen; Ren, Zhiyuan; Cai, Jun; Zheng, Wentao

    2013-03-01

    How to apply the entropy in biometrics into the encryption and remote authentication schemes to simplify the management of keys is a hot research area. Utilizing Dodis's fuzzy extractor method and Liu's original signcryption scheme, a biometric identity based signcryption scheme is proposed in this paper. The proposed scheme is more efficient than most of the previous proposed biometric signcryption schemes for that it does not need bilinear pairing computation and modular exponentiation computation which is time consuming largely. The analysis results show that under the CDH and DL hard problem assumption, the proposed scheme has the features of confidentiality and unforgeability simultaneously.

  13. Mated Fingerprint Card Pairs 2 (MFCP2)

    Science.gov (United States)

    NIST Mated Fingerprint Card Pairs 2 (MFCP2) (PC database for purchase)   NIST Special Database 14 is being distributed for use in development and testing of automated fingerprint classification and matching systems on a set of images which approximate a natural horizontal distribution of the National Crime Information Center (NCIC) fingerprint classes. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  14. Pair creation in noncommutative space-time

    Science.gov (United States)

    Hamil, B.; Chetouani, L.

    2016-09-01

    By taking two interactions, the Volkov plane wave and a constant electromagnetic field, the probability related to the process of pair creation from the vacuum is exactly and analytically determined via the Schwinger method in noncommutative space-time. For the plane wave, it is shown that the probability is simply null and for the electromagnetic wave it is found that the expression of the probability has a similar form to that obtained by Schwinger in a commutative space-time. For a certain critical value of H, the probability is simply equal to 1.

  15. Pair correlation function for spin glasses

    Science.gov (United States)

    Fernández, Julio F.; Alonso, Juan J.

    2012-10-01

    We extract a pair correlation function (PCF) from probability distributions of the spin-overlap parameter q. The distributions come from Monte Carlo simulations. A measure, w, of the thermal fluctuations of magnetic patterns follows from the PCFs. We also obtain rms deviations (over different system samples) δp away from average probabilities for q. For the linear system sizes L that we have studied, w and δp are independent of L in the Edwards-Anderson model but scale as 1/L and L, respectively, in the Sherrington-Kirkpatrick model.

  16. Cooper pairs spintronics in triplet spin valves.

    Science.gov (United States)

    Romeo, F; Citro, R

    2013-11-27

    We study a spin valve with a triplet superconductor spacer intercalated between two ferromagnets with noncollinear magnetizations. We show that the magnetoresistance of the triplet spin valve depends on the relative orientations of the d vector, characterizing the superconducting order parameter, and the magnetization directions of the ferromagnetic layers. For devices characterized by a long superconductor, the effects of a polarized current sustained by Cooper pairs only are observed. In this regime, a supermagnetoresistance effect emerges, and the chiral symmetry of the order parameter of the superconducting spacer is easily recognized. Our findings open new perspectives in designing spintronics devices based on the cooperation of ferromagnetic and triplet correlations.

  17. Paired structures and bipolar knowledge representation

    DEFF Research Database (Denmark)

    Montero, Javier; Bustince, Humberto; Franco, Camilo

    In this strictly positional paper we propose a general approach to bipolar knowledge representation, where the meaning of concepts can be modelled by examining their decomposition into opposite and neutral categories. In particular, it is the semantic relationship between the opposite categories...... and at the same time the type of neutrality rising in between opposites. Based on this first level of bipolar knowledge representation, paired structures in fact offer the means to characterize a specific bipolar valuation scale depending on the meaning of the concept that has to be verified. In this sense...

  18. Z Boson Pair-Production at LEP

    CERN Document Server

    Achard, P; Aguilar-Benítez, M; Alcaraz, J; Alemanni, G; Allaby, James V; Aloisio, A; Alviggi, M G; Anderhub, H; Andreev, V P; Anselmo, F; Arefev, A; Azemoon, T; Aziz, T; Bagnaia, P; Bajo, A; Baksay, G; Baksay, L; Baldew, S V; Banerjee, S; Banerjee, Sw; Barczyk, A; Barillère, R; Bartalini, P; Basile, M; Batalova, N; Battiston, R; Bay, A; Becattini, F; Becker, U; Behner, F; Bellucci, L; Berbeco, R; Berdugo, J; Berges, P; Bertucci, B; Betev, B L; Biasini, M; Biglietti, M; Biland, A; Blaising, J J; Blyth, S C; Bobbink, Gerjan J; Böhm, A; Boldizsar, L; Borgia, B; Bottai, S; Bourilkov, D; Bourquin, Maurice; Braccini, S; Branson, J G; Brochu, F; Burger, J D; Burger, W J; Cai, X D; Capell, M; Cara Romeo, G; Carlino, G; Cartacci, A M; Casaus, J; Cavallari, F; Cavallo, N; Cecchi, C; Cerrada, M; Chamizo-Llatas, M; Chang, Y H; Chemarin, M; Chen, A; Chen, G; Chen, G M; Chen, H F; Chen, H S; Chiefari, G; Cifarelli, Luisa; Cindolo, F; Clare, I; Clare, R; Coignet, G; Colino, N; Costantini, S; de la Cruz, B; Cucciarelli, S; van Dalen, J A; De Asmundis, R; Déglon, P L; Debreczeni, J; Degré, A; Dehmelt, K; Deiters, K; Della Volpe, D; Delmeire, E; Denes, P; De Notaristefani, F; De Salvo, A; Diemoz, M; Dierckxsens, M; Dionisi, C; Dittmar, M; Doria, A; Dova, M T; Duchesneau, D; Duda, M; Echenard, B; Eline, A; El-Hage, A; El-Mamouni, H; Engler, A; Eppling, F J; Extermann, P; Falagán, M A; Falciano, S; Favara, A; Fay, J; Fedin, O; Felcini, M; Ferguson, T; Fesefeldt, H S; Fiandrini, E; Field, J H; Filthaut, Frank; Fisher, P H; Fisher, W; Fisk, I; Forconi, G; Freudenreich, Klaus; Furetta, C; Galaktionov, Yu; Ganguli, S N; García-Abia, P; Gataullin, M; Gentile, S; Giagu, S; Gong, Z F; Grenier, G; Grimm, O; Grünewald, M W; Guida, M; van Gulik, R; Gupta, V K; Gurtu, A; Gutay, L J; Haas, D; Hatzifotiadou, D; Hebbeker, T; Hervé, A; Hirschfelder, J; Hofer, H; Hohlmann, M; Holzner, G; Hou, S R; Hu, Y; Jin, B N; Jones, L W; de Jong, P; Josa-Mutuberria, I; Käfer, D; Kaur, M; Kienzle-Focacci, M N; Kim, J K; Kirkby, Jasper; Kittel, E W; Klimentov, A; König, A C; Kopal, M; Koutsenko, V F; Kräber, M H; Krämer, R W; Krüger, A; Kunin, A; Ladrón de Guevara, P; Laktineh, I; Landi, G; Lebeau, M; Lebedev, A; Lebrun, P; Lecomte, P; Lecoq, P; Le Coultre, P; Le Goff, J M; Leiste, R; Levtchenko, M; Levchenko, P M; Li, C; Likhoded, S; Lin, C H; Lin, W T; Linde, Frank L; Lista, L; Liu, Z A; Lohmann, W; Longo, E; Lü, Y S; Luci, C; Luminari, L; Lustermann, W; Ma Wen Gan; Malgeri, L; Malinin, A; Maña, C; Mans, J; Martin, J P; Marzano, F; Mazumdar, K; McNeil, R R; Mele, S; Merola, L; Meschini, M; Metzger, W J; Mihul, A; Milcent, H; Mirabelli, G; Mnich, J; Mohanty, G B; Muanza, G S; Muijs, A J M; Musicar, B; Musy, M; Nagy, S; Natale, S; Napolitano, M; Nessi-Tedaldi, F; Newman, H; Nisati, A; Novák, T; Nowak, H; Ofierzynski, R A; Organtini, G; Pal, I; Palomares, C; Paolucci, P; Paramatti, R; Passaleva, G; Patricelli, S; Paul, T; Pauluzzi, M; Paus, C; Pauss, Felicitas; Pedace, M; Pensotti, S; Perret-Gallix, D; Petersen, B; Piccolo, D; Pierella, F; Pioppi, M; Piroué, P A; Pistolesi, E; Plyaskin, V; Pohl, M; Pozhidaev, V; Pothier, J; Prokofev, D; Prokofiev, D O; Quartieri, J; Rahal-Callot, G; Rahaman, M A; Raics, P; Raja, N; Ramelli, R; Rancoita, P G; Ranieri, R; Raspereza, A V; Razis, P A; Ren, D; Rescigno, M; Reucroft, S; Riemann, S; Riles, K; Roe, B P; Romero, L; Rosca, A; Rosier-Lees, S; Roth, S; Rosenbleck, C; Roux, B; Rubio, J A; Ruggiero, G; Rykaczewski, H; Sakharov, A; Saremi, S; Sarkar, S; Salicio, J; Sánchez, E; Schäfer, C; Shchegelskii, V; Schopper, Herwig Franz; Schotanus, D J; Sciacca, C; Servoli, L; Shevchenko, S; Shivarov, N; Shoutko, V; Shumilov, E; Shvorob, A V; Son, D; Souga, C; Spillantini, P; Steuer, M; Stickland, D P; Stoyanov, B; Strässner, A; Sudhakar, K; Sultanov, G G; Sun, L Z; Sushkov, S; Suter, H; Swain, J D; Szillási, Z; Tang, X W; Tarjan, P; Tauscher, Ludwig; Taylor, L; Tellili, B; Teyssier, D; Timmermans, C; Ting, Samuel C C; Ting, S M; Tonwar, S C; Tóth, J; Tully, C; Tung, K L; Ulbricht, J; Valente, E; Van de Walle, R T; Vásquez, R; Veszpremi, V; Vesztergombi, G; Vetlitskii, I; Vicinanza, D; Viertel, Gert M; Villa, S; Vivargent, M; Vlachos, S; Vodopyanov, I; Vogel, H; Vogt, H; Vorobev, I; Vorobyov, A A; Wadhwa, M; Wang, Q; Wang, X L; Wang, Z M; Weber, M; Wienemann, P; Wilkens, H; Wynhoff, S; Xia, L; Xu, Z Z; Yamamoto, J; Yang, B Z; Yang, C G; Yang, H J; Yang, M; Yeh, S C; Zalite, A; Zalite, Yu; Zhang, Z P; Zhao, J; Zhu, G Y; Zhu, R Y; Zhuang, H L; Zichichi, A; Zimmermann, B; Zöller, M

    2003-01-01

    Events stemming from the pair-production of Z bosons in e^+e^- collisions are studied using 217.4 pb^-1 of data collected with the L3 detector at centre-of-mass energies from 200 GeV up to 209 GeV. The special case of events with b quarks is also investigated. Combining these events with those collected at lower centre-of-mass energies, the Standard Model predictions for the production mechanism are verified. In addition, limits are set on anomalous couplings of neutral gauge bosons and on effects of extra space dimensions.

  19. HIV-1 sequence variation between isolates from mother-infant transmission pairs

    Energy Technology Data Exchange (ETDEWEB)

    Wike, C.M.; Daniels, M.R.; Furtado, M.; Wolinsky, M.; Korber, B.; Hutto, C.; Munoz, J.; Parks, W.; Saah, A.

    1991-12-31

    To examine the sequence diversity of human immunodeficiency virus type 1 (HIV-1) between known transmission sets, sequences from the V3 and V4-V5 region of the env gene from 4 mother-infant pairs were analyzed. The mean interpatient sequence variation between isolates from linked mother-infant pairs was comparable to the sequence diversity found between isolates from other close contacts. The mean intrapatient variation was significantly less in the infants` isolates then the isolates from both their mothers and other characterized intrapatient sequence sets. In addition, a distinct and characteristic difference in the glycosylation pattern preceding the V3 loop was found between each linked transmission pair. These findings indicate that selection of specific genotypic variants, which may play a role in some direct transmission sets, and the duration of infection are important factors in the degree of diversity seen between the sequence sets.

  20. Gene therapy in periodontics

    Directory of Open Access Journals (Sweden)

    Anirban Chatterjee

    2013-01-01

    Full Text Available GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person′s genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is ′the use of genes as medicine′. It involves the transfer of a therapeutic or working gene copy into specific cells of an individual in order to repair a faulty gene copy. Thus it may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. It has a promising era in the field of periodontics. Gene therapy has been used as a mode of tissue engineering in periodontics. The tissue engineering approach reconstructs the natural target tissue by combining four elements namely: Scaffold, signaling molecules, cells and blood supply and thus can help in the reconstruction of damaged periodontium including cementum, gingival, periodontal ligament and bone.

  1. Gene therapy in periodontics.

    Science.gov (United States)

    Chatterjee, Anirban; Singh, Nidhi; Saluja, Mini

    2013-03-01

    GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person's genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is 'the use of genes as medicine'. It involves the transfer of a therapeutic or working gene copy into specific cells of an individual in order to repair a faulty gene copy. Thus it may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. It has a promising era in the field of periodontics. Gene therapy has been used as a mode of tissue engineering in periodontics. The tissue engineering approach reconstructs the natural target tissue by combining four elements namely: Scaffold, signaling molecules, cells and blood supply and thus can help in the reconstruction of damaged periodontium including cementum, gingival, periodontal ligament and bone.

  2. Pair formation in the herbivorous rabbitfish Siganus doliatus.

    Science.gov (United States)

    Brandl, S J; Bellwood, D R

    2013-06-01

    This study investigated the basis of pair formation in the abundant herbivorous rabbitfish Siganus doliatus on Orpheus Island, Great Barrier Reef. Pair formation was the most common social system in S. doliatus, with 67.4% of all individuals occurring in pairs. Pairs were stable (i.e. individuals remained with the same partner throughout the study) and pair members were found within 5 m of each other 82.9% of the time. Of the examined pairs, 25% were homosexual resulting in a proportion of heterosexual pairs (75%) that was significantly lower than expected if pairs were formed solely for reproductive reasons. Therefore, although reproduction appears to be the main driver of pair formation in S. doliatus, other factors are likely to influence this behaviour. The high density of individuals on the reef crest (5.7 ± 0 .9 individuals 200 m(-2); mean ± s.e.) and extensively overlapping home ranges of pairs indicated that the defence of territories plays no role in pair formation. Instead, it appears that pair formation in S. doliatus is driven, in part, by other, non-reproductive, ecological factors. It is suggested that pair formation allows for increased vigilance against predation and enables S. doliatus to execute a novel feeding behaviour.

  3. Pair Fireball Precursors of Neutron Star Mergers

    CERN Document Server

    Metzger, Brian D

    2016-01-01

    If at least one neutron star (NS) is magnetized in a binary NS merger, then the orbital motion of the conducting companion through its dipole field during the final inspiral induces a strong voltage and current along the magnetic field lines connecting the two objects. If a modest fraction eta of the electromagnetic power extracted during the inspiral is used to accelerate relativistic particles, the resulting gamma-ray emission in such a compact volume will result in the formation of a thermal electron-positron pair fireball. Applying the steady-state pair wind model of Paczynski (1986), we quantify the luminosities and temperatures of the precursor fireball and its detectability with gamma-ray satellites. Under the assumption that eta ~ 1, the gamma-ray detection horizon of Dmax ~ 20(Bd/1e14 G) is much closer than the Advanced LIGO/Virgo horizon of 200 Mpc, unless the surface magnetic field of the NS is very strong, Bd > 1e15 G. Given the quasi-isotropic nature of the emission, a sub-population of mergers w...

  4. Schwinger pair production with ultracold atoms

    Directory of Open Access Journals (Sweden)

    V. Kasper

    2016-09-01

    Full Text Available We consider a system of ultracold atoms in an optical lattice as a quantum simulator for electron–positron pair production in quantum electrodynamics (QED. For a setup in one spatial dimension, we investigate the nonequilibrium phenomenon of pair production including the backreaction leading to plasma oscillations. Unlike previous investigations on quantum link models, we focus on the infinite-dimensional Hilbert space of QED and show that it may be well approximated by experiments employing Bose–Einstein condensates interacting with fermionic atoms. Numerical calculations based on functional integral techniques give a unique access to the physical parameters required to realize QED phenomena in a cold atom experiment. In particular, we use our approach to consider quantum link models in a yet unexplored parameter regime and give bounds for their ability to capture essential features of the physics. The results suggest a paradigmatic change towards realizations using coherent many-body states for quantum simulations of high-energy particle physics phenomena.

  5. Optimisation of a quantum pair space thruster

    Directory of Open Access Journals (Sweden)

    Valeriu DRAGAN

    2012-06-01

    Full Text Available The paper addresses the problem of propulsion for long term space missions. Traditionally a space propulsion unit has a propellant mass which is ejected trough a nozzle to generate thrust; this is also the case with inert gases energized by an on-board power unit. Unconventional methods for propulsion include high energy LASERs that rely on the momentum of photons to generate thrust. Anti-matter has also been proposed for energy storage. Although the momentum of ejected gas is significantly higher, the LASER propulsion offers the perspective of unlimited operational time – provided there is a power source. The paper will propose the use of the quantum pair formation for generating a working mass, this is different than conventional anti-matter thrusters since the material particles generated are used as propellant not as energy storage.Two methods will be compared: LASER and positron-electron, quantum pair formation. The latter will be shown to offer better momentum above certain energy levels.For the demonstrations an analytical solution is obtained and provided in the form of various coefficients. The implications are, for now, theoretical however the practicality of an optimized thruster using such particles is not to be neglected for long term space missions.

  6. Pair Production Constraints on Superluminal Neutrinos Revisited

    Energy Technology Data Exchange (ETDEWEB)

    Brodsky, Stanley J.; /SLAC; Gardner, Susan; /Kentucky U.

    2012-02-16

    We revisit the pair creation constraint on superluminal neutrinos considered by Cohen and Glashow in order to clarify which types of superluminal models are constrained. We show that a model in which the superluminal neutrino is effectively light-like can evade the Cohen-Glashow constraint. In summary, any model for which the CG pair production process operates is excluded because such timelike neutrinos would not be detected by OPERA or other experiments. However, a superluminal neutrino which is effectively lightlike with fixed p{sup 2} can evade the Cohen-Glashow constraint because of energy-momentum conservation. The coincidence involved in explaining the SN1987A constraint certainly makes such a picture improbable - but it is still intrinsically possible. The lightlike model is appealing in that it does not violate Lorentz symmetry in particle interactions, although one would expect Hughes-Drever tests to turn up a violation eventually. Other evasions of the CG constraints are also possible; perhaps, e.g., the neutrino takes a 'short cut' through extra dimensions or suffers anomalous acceleration in matter. Irrespective of the OPERA result, Lorentz-violating interactions remain possible, and ongoing experimental investigation of such possibilities should continue.

  7. Parenting and Psychopathology in Sibling Pairs

    Directory of Open Access Journals (Sweden)

    Jiri Modestin

    2008-06-01

    Full Text Available Background: The current study explored the relationship between parenting experience in childhood as a specific aspect of the non-shared environment and the amount of psychopathology in adulthood. Sampling and Methods: 27 same-sex sibling pairs were studied. In each pair, one proband was a psychiatric outpatient, the other proband a non-patient. All probands filled in the Parental Bonding Instrument (PBI and the Symptom Checklist-90-Revised (SCL-90-R. Results: The patients rated higher on practically all SCL-90-R scales whereas no significant differences were found with regard to the PBI ratings. With only one exception, there were no significant correlations between PBI and SCL-90-R ratings in the group of patients. In contrast, all SCL-90-R subscales correlated negatively with paternal care and half of them positively with paternal control in patients' healthy siblings. Conclusions: The degree of paternal care seems to be most closely related with lack of mental symptoms in psychiatric non-patients. In contrast, parenting does not seem to play a substantial role in patients, presenting with a higher degree of psychopathology. Obviously, environmental factors become less important, the more pronounced the pathology.

  8. Nuclear Pairing from Two-body Microscopic Forces: Analysis of the Cooper Pair Wavefunctions

    CERN Document Server

    Finelli, P; Holt, J W

    2014-01-01

    In a recent paper we studied the behavior of the pairing gaps $\\Delta_F$ as a function of the Fermi momentum $k_F$ for neutron and nuclear matter in all relevant angular momentum channels where superfluidity is believed to naturally emerge. The calculations employed realistic chiral nucleon-nucleon potentials with the inclusion of three-body forces and self-energy effects. In this contribution, after a detailed description of the numerical method we employed in the solution of the BCS equations, we will show a preliminary analysis of the Cooper pair wavefunctions.

  9. Review Article Ion-paired Drug Delivery: An Avenue for ...

    African Journals Online (AJOL)

    2011-08-09

    Aug 9, 2011 ... application of ion paired system to delivery of drugs through various routes of ... octanol/water partition coefficient of the ion pairs ... Physical stability of these preparations .... complex was lyophilized and directly encapsulated.

  10. Physicochemical Properties of Ion Pairs of Biological Macromolecules.

    Science.gov (United States)

    Iwahara, Junji; Esadze, Alexandre; Zandarashvili, Levani

    2015-09-30

    Ion pairs (also known as salt bridges) of electrostatically interacting cationic and anionic moieties are important for proteins and nucleic acids to perform their function. Although numerous three-dimensional structures show ion pairs at functionally important sites of biological macromolecules and their complexes, the physicochemical properties of the ion pairs are not well understood. Crystal structures typically show a single state for each ion pair. However, recent studies have revealed the dynamic nature of the ion pairs of the biological macromolecules. Biomolecular ion pairs undergo dynamic transitions between distinct states in which the charged moieties are either in direct contact or separated by water. This dynamic behavior is reasonable in light of the fundamental concepts that were established for small ions over the last century. In this review, we introduce the physicochemical concepts relevant to the ion pairs and provide an overview of the recent advancement in biophysical research on the ion pairs of biological macromolecules.

  11. Superluminal Spot Pair Events in Astronomical Settings: Sweeping Beams

    CERN Document Server

    Nemiroff, Robert J

    2014-01-01

    Sweeping beams of light can cast spots moving with superluminal speeds across scattering surfaces. Such faster-than-light speeds are well-known phenomena that do not violate special relativity. It is shown here that under certain circumstances, superluminal spot pair creation and annihilation events can occur that provide unique information to observers. These spot pair events are {\\it not} particle pair events -- they are the sudden creation or annihilation of a pair of relatively illuminated spots on a scattering surface. Real spot pair illumination events occur unambiguously on the scattering surface when spot speeds diverge, while virtual spot pair events are observer dependent and perceived only when real spot radial speeds cross the speed of light. Specifically, a virtual spot pair creation event will be observed when a real spot's speed toward the observer drops below $c$, while a virtual spot pair annihilation event will be observed when a real spot's radial speed away from the observer rises above $c...

  12. A Search for pair production of the LSP $\\tilde{\

    CERN Document Server

    Sahin, M; Sultansoy, S; Yilmaz, M

    2012-01-01

    In this work we consider pair production of LSP tau-sneutrinos at the Compact Lineer Collider. We assume that tau-sneutrinos decays in to e\\textmu pair via RPV interactions. Backgroundless subprocess $e{}^{-}e^{+}\\rightarrow\\tilde{\

  13. Paired Expression Analysis of Tumor Cell Surface Antigens

    Directory of Open Access Journals (Sweden)

    Rimas J. Orentas

    2017-08-01

    Full Text Available Adoptive immunotherapy with antibody-based therapy or with T cells transduced to express chimeric antigen receptors (CARs is useful to the extent that the cell surface membrane protein being targeted is not expressed on normal tissues. The most successful CAR-based (anti-CD19 or antibody-based therapy (anti-CD20 in hematologic malignancies has the side effect of eliminating the normal B cell compartment. Targeting solid tumors may not provide a similar expendable marker. Beyond antibody to Her2/NEU and EGFR, very few antibody-based and no CAR-based therapies have seen broad clinical application for solid tumors. To expand the way in which the surfaceome of solid tumors can be analyzed, we created an algorithm that defines the pairwise relative overexpression of surface antigens. This enables the development of specific immunotherapies that require the expression of two discrete antigens on the surface of the tumor target. This dyad analysis was facilitated by employing the Hotelling’s T-squared test (Hotelling–Lawley multivariate analysis of variance for two independent variables in comparison to a third constant entity (i.e., gene expression levels in normal tissues. We also present a unique consensus scoring mechanism for identifying transcripts that encode cell surface proteins. The unique application of our bioinformatics processing pipeline and statistical tools allowed us to compare the expression of two membrane protein targets as a pair, and to propose a new strategy based on implementing immunotherapies that require both antigens to be expressed on the tumor cell surface to trigger therapeutic effector mechanisms. Specifically, we found that, for MYCN amplified neuroblastoma, pairwise expression of ACVR2B or anaplastic lymphoma kinase (ALK with GFRA3, GFRA2, Cadherin 24, or with one another provided the strongest hits. For MYCN, non-amplified stage 4 neuroblastoma, neurotrophic tyrosine kinase 1, or ALK paired with GFRA2, GFRA3, SSK

  14. THE NUCLEAR RECEPTOR E75A HAS A NOVEL PAIR-RULE-LIKE FUNCTION IN PATTERNING THE MILKWEED BUG, ONCOPELTUS FASCIATUS

    Science.gov (United States)

    Erezyilmaz, Deniz F.; Kelstrup, Hans C.; Riddiford, Lynn M.

    2009-01-01

    Genetic studies of the fruit fly Drosophila have revealed a hierarchy of segmentation genes (maternal, gap, pair-rule and HOX) that subdivide the syncytial blastoderm into sequentially finer scale coordinates. Within this hierarchy, the pair-rule genes translate gradients of information into periodic stripes of expression. How pair-rule genes function during the progressive mode of segmentation seen in short and intermediate-germ insects is an ongoing question. Here we report that the nuclear receptor Of’E75A is expressed with double segment periodicity in the head and thorax. In the abdomen, Of’E75A is expressed in a unique pattern during posterior elongation, and briefly resembles a sequence that is typical of pair-rule genes. Depletion of Of’E75A mRNA caused loss of a subset of odd-numbered parasegments, as well as parasegment 6. Because these parasegments straddle segment boundaries, we observe fusions between adjacent segments. Finally, expression of Of’E75A in the blastoderm requires even-skipped, which is a gap gene in Oncopeltus. These data show that the function of Of’E75A during embryogenesis shares many properties with canonical pair-rule genes in other insects. They further suggest that parasegment specification may occur through irregular and episodic pair-rule-like activity. PMID:19580803

  15. The nuclear receptor E75A has a novel pair-rule-like function in patterning the milkweed bug, Oncopeltus fasciatus.

    Science.gov (United States)

    Erezyilmaz, Deniz F; Kelstrup, Hans C; Riddiford, Lynn M

    2009-10-01

    Genetic studies of the fruit fly Drosophila have revealed a hierarchy of segmentation genes (maternal, gap, pair-rule and HOX) that subdivide the syncytial blastoderm into sequentially finer-scale coordinates. Within this hierarchy, the pair-rule genes translate gradients of information into periodic stripes of expression. How pair-rule genes function during the progressive mode of segmentation seen in short and intermediate-germ insects is an ongoing question. Here we report that the nuclear receptor Of'E75A is expressed with double segment periodicity in the head and thorax. In the abdomen, Of'E75A is expressed in a unique pattern during posterior elongation, and briefly resembles a sequence that is typical of pair-rule genes. Depletion of Of'E75A mRNA caused loss of a subset of odd-numbered parasegments, as well as parasegment 6. Because these parasegments straddle segment boundaries, we observe fusions between adjacent segments. Finally, expression of Of'E75A in the blastoderm requires even-skipped, which is a gap gene in Oncopeltus. These data show that the function of Of'E75A during embryogenesis shares many properties with canonical pair-rule genes in other insects. They further suggest that parasegment specification may occur through irregular and episodic pair-rule-like activity.

  16. Higher derived brackets, strong homotopy associative algebras and Loday pairs

    CERN Document Server

    Uchino, K

    2009-01-01

    We give a quick method of constructing strong homotopy associative algebras. This method is an associative version of (higher) derived bracket construction in the category of Lie/Leibniz algebras. We try to unify the two derived bracket constructions. For that aim we introduce a new type of algebra ``Loday pair", which is a noncommutative version of classical Leibniz pair. We give a coalgebra description of Loday pairs and study a derived bracket construction for Loday pairs.

  17. Extensions of Bessel sequences to dual pairs of frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Kim, Hong Oh; Kim, Rae Young

    2013-01-01

    Tight frames in Hilbert spaces have been studied intensively for the past years. In this paper we demonstrate that it often is an advantage to use pairs of dual frames rather than tight frames. We show that in any separable Hilbert space, any pairs of Bessel sequences can be extended to a pair of...... be extended to a pair of dual frames. © 2012 Elsevier Inc. All rights reserved....

  18. Photon pair source via two coupling single quantum emitters

    Institute of Scientific and Technical Information of China (English)

    彭勇刚; 郑雨军

    2015-01-01

    We study the two coupling two-level single molecules driven by an external field as a photon pair source. The proba-bility of emitting two photons, P2, is employed to describe the photon pair source quality in a short time, and the correlation coefficient RAB is employed to describe the photon pair source quality in a long time limit. The results demonstrate that the coupling single quantum emitters can be considered as a stable photon pair source.

  19. Low level of extra-pair paternity between nearest neighbors results from female preference for high-quality males in the yellow-rumped flycatcher (Ficedula zanthopygia)

    Science.gov (United States)

    E, Mingju; Gong, Ye; Yu, Jiangping; Zhang, Siyu; Fan, Qianxi; Jiang, Yunlei

    2017-01-01

    Extra-pair copulation is considered to be a means by which females can modify their initial mate choice, and females might obtain indirect benefits to offspring fitness by engaging in this behavior. Here, we examined the patterns of extra-pair paternity and female preferences in the yellow-rumped flycatcher (Ficedula zanthopygia). We found that female yellow-rumped flycatchers are more likely to choose larger and relatively highly heterozygous males than their social mates as extra-pair mates, that the genetic similarity of pairs that produced mixed-paternity offspring did not differ from the similarity of pairs producing only within-pair offspring, and that extra-pair offspring were more heterozygous than their half-siblings. These findings support the good genes hypothesis but do not exclude the compatibility hypothesis. Most female yellow-rumped flycatchers attained extra-pair paternity with distant males rather than their nearest accessible neighboring males, and no differences in genetic and phenotypic characteristics were detected between cuckolded males and their nearest neighbors. There was no evidence that extra-pair mating by female flycatchers reduced inbreeding. Moreover, breeding density, breeding synchrony and their interaction did not affect the occurrence of extra-pair paternity in this species. Our results suggest that the variation in extra-pair paternity distribution between nearest neighbors in some passerine species might result from female preference for highly heterozygous males. PMID:28257431

  20. Influence of pairing in double beta decay of48Ca

    Indian Academy of Sciences (India)

    Prianka Roy; Shashi K Dhiman

    2010-03-01

    Two-neutrino decay matrix elements and half-life of 48Ca are calculated after including neutron–proton pairing correlations in projected Hartree–Fock–Bogoliubov (PHFB) formalism. The GT matrix elements in 2 decay are reduced due to broader smearing of Fermi surfaces. Half-life results for 2 decay of 48Ca with np pairing are better than without pairing.

  1. Au pair på ulige vilkår

    DEFF Research Database (Denmark)

    Christiansen, Connie Carøe

    2008-01-01

    Antallet af au pairs i Danmark fra Fillipinerne er steget markant i de seneste år. Mens danske myndigheder betragter au pair-ordningen som kulturudveksling blandt unge mennesker, ser fillipinske au pairs derimod den som en mulighed for at tjene penge så de kan forsørge deres egen familie i Fillip...

  2. Using Pair Programming to Teach CAD Based Engineering Graphics

    Science.gov (United States)

    Leland, Robert P.

    2010-01-01

    Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

  3. On extensions of wavelet systems to dual pairs of frames

    DEFF Research Database (Denmark)

    Christensen, Ole; Kim, Hong Oh; Kim, Rae Young

    2015-01-01

    It is an open problem whether any pair of Bessel sequences with wavelet structure can be extended to a pair of dual frames by adding a pair of singly generated wavelet systems. We consider the particular case where the given wavelet systems are generated by the multiscale setup with trigonometric...

  4. Three-photon annihilation of the electron-positron pairs

    OpenAIRE

    Frolov, A. M.

    2008-01-01

    Three-photon annihilation of the electron-positron pairs (= $(e^{-}, e^{+})-$pairs) is considered in the electron rest frame. The energy of the incident positron can be arbitrary. The analytical expression for the cross-section of three-photon annihilation of the $(e^{-},e^{+})-$pair has been derived and investigated.

  5. Fountain-Gould Left Orders for Associative Pairs

    Institute of Scientific and Technical Information of China (English)

    José A. ANQUELA; Teresa CORT(E)S; Miguel G(O)MEZ LOZANO; Mercedes SILES MOLINA

    2006-01-01

    In this paper, we introduce a notion of weak Fountain-Gould left order for associative pairs and give a Goldie-like theory of associative pairs which are weak Fountain-Gould left orders in semiprime pairs coinciding with their socles.

  6. Using Pair Programming to Teach CAD Based Engineering Graphics

    Science.gov (United States)

    Leland, Robert P.

    2010-01-01

    Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

  7. Differentially Methylated DNA Regions in Monozygotic Twin Pairs Discordant for Rheumatoid Arthritis

    DEFF Research Database (Denmark)

    Svendsen, Anders J; Gervin, Kristina; Lyle, Robert;

    2016-01-01

    OBJECTIVES: In an explorative epigenome-wide association study (EWAS) to search for gene independent, differentially methylated DNA positions and regions (DMRs) associated with rheumatoid arthritis (RA) by studying monozygotic (MZ) twin pairs discordant for RA. METHODS: Genomic DNA was isolated......: We identified several differentially methylated regions associated with RA, which may represent environmental effects or consequences of the disease and plausible biological pathways pertinent to the pathogenesis of RA....

  8. A chemical approach to mapping nucleosomes at base pair resolution in yeast.

    Science.gov (United States)

    Brogaard, Kristin R; Xi, Liqun; Wang, Ji-Ping; Widom, Jonathan

    2012-01-01

    Most eukaryotic DNA exists in DNA-protein complexes known as nucleosomes. The exact locations of nucleosomes along the genome play a critical role in chromosome functions and gene regulation. However, the current methods for nucleosome mapping do not provide the necessary accuracy to identify the precise nucleosome locations. Here we describe a new experimental approach that directly maps nucleosome center locations in vivo genome-wide at single base pair resolution.

  9. The Treeterbi and Parallel Treeterbi algorithms: efficient, optimal decoding for ordinary, generalized and pair HMMs

    DEFF Research Database (Denmark)

    Keibler, Evan; Arumugam, Manimozhiyan; Brent, Michael R

    2007-01-01

    MOTIVATION: Hidden Markov models (HMMs) and generalized HMMs been successfully applied to many problems, but the standard Viterbi algorithm for computing the most probable interpretation of an input sequence (known as decoding) requires memory proportional to the length of the sequence, which can......, our pair HMM based cDNA-to-genome aligner. AVAILABILITY: The TWINSCAN/N-SCAN/PAIRAGON open source software package is available from http://genes.cse.wustl.edu....

  10. Disruption, beamstrahlung, and beamstrahlung pair creation

    Energy Technology Data Exchange (ETDEWEB)

    Chen, P.

    1988-12-01

    The two major effects from the interaction of e/sup /minus//e/sup +/ beams---beamstrahlung and disruption---are reviewed, with emphasis on flat beam collisions. For the disruption effects we discuss the luminosity enhancement factor, the maximum and rms disruption angles, and the ''kink instability''. All the results are obtained from computer simulations, and scaling laws based on these are deduced whenever possible. For the beamstrahlung effects, we concentrate only on the final electron energy spectrum and the deflection angle associated with low energy particles. In addition to the generic studies on the beam-beam effects, we also list the relevant beam-beam parameters obtained from simulations on two sample designs: the TLC and the ILC. As an addendum, the newly discovered phenomenon of coherent beamstrahlung pair creation, together with the incoherent process, are discussed. 18 refs., 15 figs., 1 tab.

  11. Neutron area monitor with TLD pairs

    Energy Technology Data Exchange (ETDEWEB)

    Guzman G, K. A.; Borja H, C. G.; Valero L, C.; Hernandez D, V. M.; Vega C, H. R., E-mail: ing_karen_guzman@yahoo.com.mx [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Calle Cipres No. 10. Fracc. La Penuela, 98068 Zacatecas (Mexico)

    2011-11-15

    The response of a passive neutron area monitor with pairs of thermoluminescent dosimeters has been calculated using the Monte Carlo code MCNP5. The response was calculated for one TLD 600 located at the center of a polyethylene cylinder, as moderator. When neutrons collide with the moderator lose their energy reaching the TLD with thermal energies where the ambient dose equivalent is calculated. The response was calculated for 47 monoenergetic neutron sources ranging from 1E(-9) to 20 MeV. Response was calculated using two irradiation geometries, one with an upper source and another with a lateral source. For both irradiation schemes the response was calculated with the TLDs in two positions, one parallel to the source and another perpendicular to the source. The advantage of this passive neutron monitor area is that can be used in locations with intense, pulsed and mixed radiation fields. (Author)

  12. Passive neutron area monitor with TLD pairs

    Energy Technology Data Exchange (ETDEWEB)

    Guzman G, K. A.; Borja H, C. G.; Valero L, C.; Hernandez D, V. M.; Vega C, H. R., E-mail: fermineutron@yahoo.com [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)

    2012-06-15

    The response of a passive neutron area monitor with pairs of thermoluminescent dosimeters (TLD) has been calculated using the Monte Carlo code MCNP5. The response was calculated for one TLD 600 located at the center of a polyethylene moderator. The response was calculated for 47 monoenergetic neutron sources ranging from 1E(-9) to 20 MeV. Response was calculated using two irradiation geometries, one with an upper source and another with a lateral source. For both irradiation schemes the response was calculated with the TLD in two positions, one parallel to the source and another perpendicular to the source. The advantage of this passive neutron monitor area is that can be used in locations with intense, pulsed and mixed radiation fields like those in radiotherapy vault rooms with linear accelerators. (Author)

  13. Holographic Vortex Pair Annihilation in Superfluid Turbulence

    CERN Document Server

    Du, Yiqiang; Tian, Yu; Zhang, Hongbao

    2014-01-01

    We make a first principles investigation of the dynamical evolution of vortex number in a two-dimensional (2D) turbulent superfluid by holography through numerically solving its highly non-trivial gravity dual. With the randomly placed vortices and antivortices prepared as initial states, we find that the temporal evolution of the vortex number can be well fit statistically by two-body decay due to the vortex pair annihilation featured relaxation process remarkably from a very early time on. In particular, subtracted by the universal offset, the power law fit indicates that our holographic turbulent superfluid exhibits an apparently different decay pattern from the superfluid recently experimented in highly oblate Bose-Einstein condensates.

  14. Homologous pairing in stretched supercoiled DNA

    Science.gov (United States)

    Strick, T. R.; Croquette, V.; Bensimon, D.

    1998-01-01

    By using elastic measurements on single DNA molecules, we show that stretching a negatively supercoiled DNA activates homologous pairing in physiological conditions. These experiments indicate that a stretched unwound DNA locally denatures to alleviate the force-driven increase in torsional stress. This is detected by hybridization with 1 kb of homologous single-stranded DNA probes. The stretching force involved (≈2 pN) is small compared with those typically developed by molecular motors, suggesting that this process may be relevant to DNA processing in vivo. We used this technique to monitor the progressive denaturation of DNA as it is unwound and found that distinct, stable denaturation bubbles formed, beginning in A+T-rich regions. PMID:9724746

  15. Ultracompact quantum splitter of degenerate photon pairs

    CERN Document Server

    He, Jiakun; Casas-Bedoya, Alvaro; Zhang, Yanbing; Xiong, Chunle; Eggleton, Benjamin J

    2015-01-01

    Integrated sources of indistinguishable photons have attracted a lot of attention because of their applications in quantum communication and optical quantum computing. Here, we demonstrate an ultra-compact quantum splitter for degenerate single photons based on a monolithic chip incorporating Sagnac loop and a micro-ring resonator with a footprint of 0.011 mm2, generating and deterministically splitting indistinguishable photon pairs using time-reversed Hong-Ou-Mandel interference. The ring resonator provides enhanced photon generation rate, and the Sagnac loop ensures the photons travel through equal path lengths and interfere with the correct phase to enable the reversed HOM effect to take place. In the experiment, we observed a HOM dip visibility of 94.5 +- 3.3 %, indicating the photons generated by the degenerate single photon source are in a suitable state for further integration with other components for quantum applications, such as controlled-NOT gates.

  16. Imaging with power controlled source pairs

    CERN Document Server

    Bardsley, Patrick

    2015-01-01

    Scatterers in a homogeneous medium are imaged by probing the medium with two point sources of waves modulated by correlated signals and by measuring only intensities at one single receiver. For appropriately chosen source pairs, we show that full waveform array measurements can be recovered from such intensity measurements by solving a linear least squares problem. The least squares solution can be used to image with Kirchhoff migration, even if the solution is determined only up to a known one-dimensional nullspace. The same imaging strategy can be used when the medium is probed with point sources driven by correlated Gaussian processes and autocorrelations are measured at a single location. Since autocorrelations are robust to noise, this can be used for imaging when the probing wave is drowned in background noise.

  17. Frustrated Lewis pairs: Design and reactivity

    Indian Academy of Sciences (India)

    Sanjoy Mukherjee; Pakkirisamy Thilagar

    2015-02-01

    The interaction of a Lewis acid with a Lewis base results in the formation of a Lewis acid–base adduct. Understanding Lewis acids and bases is central to conceptualizing chemical interactions and constitutes a major portion of metal–ligand chemistry. Sterically encumbered/constrained Lewis pairs cannot form acid–base adducts, but such ‘Frustrated Lewis Pairs’ (FLPs), with their unquenched electronic demands can be elegantly used to simultaneously react with a third species, resulting in unusual reactivity of small molecules. Such unusual reactions, explored only in the last few years, have found several applications, e.g., heterolytic splitting of H2, activation of small molecules (CO2, N2O, etc.). FLPs have opened new opportunities in synthetic chemistry, covering organic, main group as well as transition metal chemistry. The design strategies adopted for FLP systems and their unique reactivity are discussed here.

  18. Authenticating Tripartite Key Agreement Protocol with Pairings

    Institute of Scientific and Technical Information of China (English)

    Sheng-Li Liu; Fang-Guo Zhang; Ke-Fei Chen

    2004-01-01

    In this paper, an authenticated tripartite key agreement protocol is proposed, which is an ID-based one with pairings. This protocol involves only one round. The authenticity of the protocol is assured by a special signature scheme, so that messages carrying the information of two ephemeral keys can be broadcasted authentically by an entity. Consequently, one instance of the protocol results in eight session keys for three entities. In other word, one instance of the protocol generates a session key, which is eight times longer than those obtained from traditional key agreement protocols. Security attributes of the protocol are presented, and the computational overhead and bandwidth of the broadcast messages are analyzed as well.

  19. Aluminium Diphosphamethanides: Hidden Frustrated Lewis Pairs.

    Science.gov (United States)

    Styra, Steffen; Radius, Michael; Moos, Eric; Bihlmeier, Angela; Breher, Frank

    2016-07-04

    The synthesis and characterisation of two aluminium diphosphamethanide complexes, [Al(tBu)2 {κ(2) P,P'-Mes*PCHPMes*}] (3) and [Al(C6 F5 )2 {κ(2) P,P'-Mes*PCHPMes*}] (4), and the silylated analogue, Mes*PCHP(SiMe3 )Mes* (5), are reported. The aluminium complexes feature four-membered PCPAl core structures consisting of diphosphaallyl ligands. The silylated phosphine 5 was found to be a valuable precursor for the synthesis of 4 as it cleanly reacts with the diaryl aluminium chloride [(C6 F5 )2 AlCl]2 . The aluminium complex 3 reacts with molecular dihydrogen at room temperature under formation of the acyclic σ(2) λ(3) ,σ(3) λ(3) -diphosphine Mes*PCHP(H)Mes* and the corresponding dialkyl aluminium hydride [tBu2 AlH]3 . Thus, 3 belongs to the family of so-called hidden frustrated Lewis pairs.

  20. Pairing in bulk nuclear matter beyond BCS

    CERN Document Server

    Ding, D; Dickhoff, W H; Dussan, H; Rios, A; Polls, A

    2014-01-01

    The influence of short-range correlations on the spectral distribution of neutrons is incorporated in the solution of the gap equation for the ${}^3P_2-{}^3F_2$ coupled channel in pure neutron matter. This effect is studied for different realistic interactions including one based on chiral perturbation theory. The gap in this channel vanishes at all relevant densities due to the treatment of these correlations. We also consider the effect of long-range correlations by including polarization terms in addition to the bare interaction which allow the neutrons to exchange density and spin fluctuations governed by the strength of Landau parameters allowed to have reasonable values consistent with the available literature. Preliminary results indicate that reasonable values of these parameters do not generate a gap in the ${}^3P_2-{}^3F_2$ coupled channel either for all three realistic interactions although the pairing interaction becomes slightly more attractive.

  1. An advanced KB mirror pair for microfocusing

    CERN Document Server

    Ferme, J J

    2001-01-01

    A new range of micro-focusing mirrors based on KB pairs has been developed by SESO for Beamline Nanospectroscopy at the Elettra Storage Ring in Trieste, Italy. Both the focusing and the aspheric shape are adjustable with stepper motors. The goal of the beamline is to have a high photon density spot with a variable size in the experimental chamber over the whole soft X-ray range. The estimated dimension of the final spot should be smaller than 4 mu m sup 2 FWHM, with a photon density of the order of 10 sup 1 sup 3 photons/s mu m sup 2; this may be achieved only by accepting an angular divergence on these mirrors of between 5 and 10 mrad. This condition can be fulfilled only with elliptical (or plane elliptical) mirrors with very limited residual slope errors (below 1 mu rad RMS) that are able to correct even small focal distance errors.

  2. Dust trapping in inviscid vortex pairs

    CERN Document Server

    Angilella, Jean-Regis

    2010-01-01

    The motion of tiny heavy particles transported in a co-rotating vortex pair, with or without particle inertia and sedimentation, is investigated. The dynamics of non-inertial sedimenting particles is shown to be chaotic, under the combined effect of gravity and of the circular displacement of the vortices. This phenomenon is very sensitive to particle inertia, if any. By using nearly hamiltonian dynamical system theory for the particle motion equation written in the rotating reference frame, one can show that small inertia terms of the particle motion equation strongly modify the Melnikov function of the homoclinic trajectories and heteroclinic cycles of the unperturbed system, as soon as the particle response time is of the order of the settling time (Froude number of order unity). The critical Froude number above which chaotic motion vanishes and a regular centrifugation takes place is obtained from this Melnikov analysis and compared to numerical simulations. Particles with a finite inertia, and in the abs...

  3. Photogeneration of polaron pairs in conducting polymers

    Science.gov (United States)

    Conwell, E. M.; Mizes, H. A.

    1995-03-01

    It is usually assumed that when photogeneration in a conducting polymer results in an electron and hole on separate chains they form negative and positive polarons that can move independently of each other. We show, on the basis of the small carrier yield per photon seen in picosecond photoconductivity, the different behavior of photoinduced absorption (PA) in dilute solution and thin films, and the spectral distribution of the PA in thin films, that photogenerated positive and negative polarons in poly(p-phenylene vinylene), polythiophene, and polyacetylene are, for the most part, bound in pairs by their Coulomb attraction. We also show that PA data give evidence for a gap of 2.8 eV, and thus an exciton binding energy of 0.4 eV, in poly(p-phenylene vinylene).

  4. Indium-carbon pairs in germanium

    Energy Technology Data Exchange (ETDEWEB)

    Tessema, G; Vianden, R [Helmholtz Institut fuer Strahlen-und Kernphysik, Universitaet Bonn, Nussallee 14-16, 53115 Bonn (Germany)

    2003-08-06

    The interactions of carbon with the probe nucleus {sup 111}In have been studied in germanium using the perturbed angular correlation method, which has the ability to detect the microscopic environments of the probe atom by means of the interaction of the nuclear moments of the probe with the surrounding electromagnetic fields. At high dose carbon implantation in germanium two complexes have been identified by their unique quadrupole interaction frequencies. An interaction frequency of {nu}{sub Q1} = 207(1) MHz ({eta} = 0.16(3)) appeared at annealing temperatures below 650 deg. C. Above 650 deg. C, it was replaced by a second interaction frequency of {nu}{sub Q2} 500(1) MHz ({eta} = 0). The frequencies are attributed to two different carbon-indium pairs. The orientation of the corresponding electric field gradients and the thermal stability of the defect complexes are studied.

  5. Kink pair production and dislocation motion

    Science.gov (United States)

    Fitzgerald, S. P.

    2016-12-01

    The motion of extended defects called dislocations controls the mechanical properties of crystalline materials such as strength and ductility. Under moderate applied loads, this motion proceeds via the thermal nucleation of kink pairs. The nucleation rate is known to be a highly nonlinear function of the applied load, and its calculation has long been a theoretical challenge. In this article, a stochastic path integral approach is used to derive a simple, general, and exact formula for the rate. The predictions are in excellent agreement with experimental and computational investigations, and unambiguously explain the origin of the observed extreme nonlinearity. The results can also be applied to other systems modelled by an elastic string interacting with a periodic potential, such as Josephson junctions in superconductors.

  6. Depicting the MeV realm with the Compton Pair-Production Telescope (ComPair)

    Science.gov (United States)

    Ferrara, Elizabeth C.; Buson, Sara; ComPair Mission Team

    2017-01-01

    The energy band from a few hundred keV to a few hundred MeV offers a unique window for studying both thermal and the non-thermal astrophysical processes. Important science can be gleaned from investigations of emission mechanisms and environments of the most extreme objects that populate this mostly unexplored energy range.The Compton-Pair Telescope (ComPair) is a next-generation mission concept building on the pioneering observations by COMPTEL, on the Compton Gamma-Ray Observatory, and the heritage of recent successful missions, such as Fermi-LAT, AGILE, AMS and PAMELA. With its capability of detecting both Compton-scattering events at lower energy and pair-production events at higher energy, ComPair can explore the energy regime from 0.2 keV to > 500 MeV with unprecedented sensitivity. We describe the concept of this wide-aperture instrument and discuss its power to address fundamental questions from a broad variety of astrophysical topics.

  7. Local pair natural orbitals for excited states.

    Science.gov (United States)

    Helmich, Benjamin; Hättig, Christof

    2011-12-07

    We explore how in response calculations for excitation energies with wavefunction based (e.g., coupled cluster) methods the number of double excitation amplitudes can be reduced by means of truncated pair natural orbital (PNO) expansions and localized occupied orbitals. Using the CIS(D) approximation as a test model, we find that the number of double excitation amplitudes can be reduced dramatically with minor impact on the accuracy if the excited state wavefunction is expanded in state-specific PNOs generated from an approximate first-order guess wavefunction. As for ground states, the PNO truncation error can also for excitation energies be controlled by a single threshold related to generalized natural occupation numbers. The best performance is found with occupied orbitals which are localized by the Pipek-Mezey localization. For a large test set of excited states we find with this localization that already a PNO threshold of 10(-8)-10(-7), corresponding to an average of only 40-80 PNOs per pair, is sufficient to keep the PNO truncation error for vertical excitation energies below 0.01 eV. This is a significantly more rapid convergence with the number doubles amplitudes than in domain-based local response approaches. We demonstrate that the number of significant excited state PNOs scales asymptotically linearly with the system size in the worst case of completely delocalized excitations and sub-linearly whenever the chromophore does not increase with the system size. Moreover, we observe that the flexibility of state-specific PNOs to adapt to the character of an excitation allows for an almost unbiased treatment of local, delocalized and charge transfer excited states.

  8. Local pair natural orbitals for excited states

    Science.gov (United States)

    Helmich, Benjamin; Hättig, Christof

    2011-12-01

    We explore how in response calculations for excitation energies with wavefunction based (e.g., coupled cluster) methods the number of double excitation amplitudes can be reduced by means of truncated pair natural orbital (PNO) expansions and localized occupied orbitals. Using the CIS(D) approximation as a test model, we find that the number of double excitation amplitudes can be reduced dramatically with minor impact on the accuracy if the excited state wavefunction is expanded in state-specific PNOs generated from an approximate first-order guess wavefunction. As for ground states, the PNO truncation error can also for excitation energies be controlled by a single threshold related to generalized natural occupation numbers. The best performance is found with occupied orbitals which are localized by the Pipek-Mezey localization. For a large test set of excited states we find with this localization that already a PNO threshold of 10-8-10-7, corresponding to an average of only 40-80 PNOs per pair, is sufficient to keep the PNO truncation error for vertical excitation energies below 0.01 eV. This is a significantly more rapid convergence with the number doubles amplitudes than in domain-based local response approaches. We demonstrate that the number of significant excited state PNOs scales asymptotically linearly with the system size in the worst case of completely delocalized excitations and sub-linearly whenever the chromophore does not increase with the system size. Moreover, we observe that the flexibility of state-specific PNOs to adapt to the character of an excitation allows for an almost unbiased treatment of local, delocalized and charge transfer excited states.

  9. Evidence for homosexuality gene

    Energy Technology Data Exchange (ETDEWEB)

    Pool, R.

    1993-07-16

    A genetic analysis of 40 pairs of homosexual brothers has uncovered a region on the X chromosome that appears to contain a gene or genes for homosexuality. When analyzing the pedigrees of homosexual males, the researcheres found evidence that the trait has a higher likelihood of being passed through maternal genes. This led them to search the X chromosome for genes predisposing to homosexuality. The researchers examined the X chromosomes of pairs of homosexual brothers for regions of DNA that most or all had in common. Of the 40 sets of brothers, 33 shared a set of five markers in the q28 region of the long arm of the X chromosome. The linkage has a LOD score of 4.0, which translates into a 99.5% certainty that there is a gene or genes in this area that predispose males to homosexuality. The chief researcher warns, however, that this one site cannot explain all instances of homosexuality, since there were some cases where the trait seemed to be passed paternally. And even among those brothers where there was no evidence that the trait was passed paternally, seven sets of brothers did not share the Xq28 markers. It seems likely that homosexuality arises from a variety of causes.

  10. Simplified approaches to some nonoverlapping domain decomposition methods

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Jinchao

    1996-12-31

    An attempt will be made in this talk to present various domain decomposition methods in a way that is intuitively clear and technically coherent and concise. The basic framework used for analysis is the {open_quotes}parallel subspace correction{close_quotes} or {open_quotes}additive Schwarz{close_quotes} method, and other simple technical tools include {open_quotes}local-global{close_quotes} and {open_quotes}global-local{close_quotes} techniques, the formal one is for constructing subspace preconditioner based on a preconditioner on the whole space whereas the later one for constructing preconditioner on the whole space based on a subspace preconditioner. The domain decomposition methods discussed in this talk fall into two major categories: one, based on local Dirichlet problems, is related to the {open_quotes}substructuring method{close_quotes} and the other, based on local Neumann problems, is related to the {open_quotes}Neumann-Neumann method{close_quotes} and {open_quotes}balancing method{close_quotes}. All these methods will be presented in a systematic and coherent manner and the analysis for both two and three dimensional cases are carried out simultaneously. In particular, some intimate relationship between these algorithms are observed and some new variants of the algorithms are obtained.

  11. Testing Dependent Correlations with Nonoverlapping Variables: A Monte Carlo Simulation

    Science.gov (United States)

    Silver, N. Clayton; Hittner, James B.; May, Kim

    2004-01-01

    The authors conducted a Monte Carlo simulation of 4 test statistics or comparing dependent correlations with no variables in common. Empirical Type 1 error rates and power estimates were determined for K. Pearson and L. N. G. Filon's (1898) z, O. J. Dunn and V. A. Clark's (1969) z, J. H. Steiger's (1980) original modification of Dunn and Clark's…

  12. Scheduler for multiprocessor system switch with selective pairing

    Energy Technology Data Exchange (ETDEWEB)

    Gara, Alan; Gschwind, Michael Karl; Salapura, Valentina

    2015-01-06

    System, method and computer program product for scheduling threads in a multiprocessing system with selective pairing of processor cores for increased processing reliability. A selective pairing facility is provided that selectively connects, i.e., pairs, multiple microprocessor or processor cores to provide one highly reliable thread (or thread group). The method configures the selective pairing facility to use checking provide one highly reliable thread for high-reliability and allocate threads to corresponding processor cores indicating need for hardware checking. The method configures the selective pairing facility to provide multiple independent cores and allocate threads to corresponding processor cores indicating inherent resilience.

  13. Finite size effects in stimulated laser pair production

    CERN Document Server

    Heinzl, Thomas; Marklund, Mattias

    2010-01-01

    We consider stimulated pair production in a strong laser background, using the language of lightcone field theory. In an infinite plane wave, we show that the lightcone momentum transfer to the pair must be a multiple of the laser frequency, which results in the usual interpretation of multi-photon production of pairs with an effective mass. In a pulse, the momentum transfer is continuous, exhibiting resonant behaviour for effective mass pair production. We show that this is completely analogous to a diffraction process, and that the fine structure of the emission rate is that of a diffraction pattern resulting from interference of the produced pairs' wavefunctions.

  14. NMR analysis of base-pair opening kinetics in DNA

    Science.gov (United States)

    Szulik, Marta W.; Voehler, Markus; Stone, Michael P.

    2014-01-01

    Base pairing in nucleic acids plays a crucial role in their structure and function. Differences in the base pair opening and closing kinetics of individual double stranded DNA sequences or between chemically modified base pairs provide insight into the recognition of these base pairs by DNA processing enzymes. This unit describes how to quantify the kinetics for localized base pairs by observing changes in the imino proton signals by nuclear magnetic resonance spectroscopy. The determination of all relevant parameters using state of the art techniques and NMR instrumentation, including cryoprobes, is discussed. PMID:25501592

  15. Pairing reentrance in warm rotating $^{104}$Pd nucleus

    CERN Document Server

    Hung, N Quang; Agrawal, B K; Datar, V M; Mitra, A; Chakrabarty, D R

    2015-01-01

    Pairing reentrance phenomenon in the warm rotating $^{104}$Pd nucleus is studied within the Bardeen-Cooper-Schrieffer (BCS)-based approach (the FTBCS1). The theory takes into account the effect of quasiparticle number fluctuations on the pairing field at finite temperature and angular momentum within the pairing model plus noncollective rotation along the symmetry axis. The numerical calculations for the pairing gaps and nuclear level densities (NLD), of which an anomalous enhancement has been experimentally observed at low excitation energy $E^*$ and high angular momentum $J$, show that the pairing reentrance is seen in the behavior of pairing gap obtained within the FTBCS1 at low $E$ and high $J$. This leads to the enhancement of the FTBCS1 level densities, in good agreement with the experimental observation. This agreement indicates that the observed enhancement of the NLD might be the first experimental detection of the pairing reentrance in a finite nucleus.

  16. Les livres pairs d’Alfred Jarry

    Directory of Open Access Journals (Sweden)

    Julien Schuh

    2008-10-01

    Full Text Available Dans les Gestes et opinions du Dr Faustroll, pataphysicien, Alfred Jarry décrit une bibliothèque idéale, composée de 27 ouvrages qu’il nomme mystérieusement des « livres pairs ». Dans cette liste, on trouve aussi bien des œuvres canoniques du symbolisme (Mallarmé, Verlaine, Poe traduit par Baudelaire, des titres des amis de Jarry et des piliers des revues de l’époque (Rachilde, Gustave Kahn, Léon Bloy, que des ouvrages que l’on assimile davantage aux lectures enfantines (un conte de Marceline Desbordes-Valmore, les Mille et une Nuits, le théâtre de Florian ou des textes hors-catégorie (l’œuvre de Rabelais, l’évangile de Luc, les Chants de Maldoror. Beaucoup de critiques se sont interrogés sur la notion de « parité », sur l’égalité supposée entre ces ouvrages n’appartenant pas aux mêmes catégories littéraires. Mais l’intérêt de cette liste n’est pas de fournir un classement, ou d’affirmer l’équivalence de toutes les formes textuelles, comme on l’analyse souvent, en faisant de Jarry un chantre du nihilisme qui chercherait à pervertir les hiérarchies littéraires pour montrer la vacuité du sens. Au contraire, en faisant débuter le Faustroll par une liste d’ouvrages, Jarry met en place les conditions de réception de son texte, dans une posture très littéraire. L’espace délimité par la liste des auteurs pairs fonctionne comme un portrait spirituel de Jarry-littérateur, et livre le contexte selon lequel son discours doit être reçu. La bibliothèque du Dr Faustroll fixe les références que le lecteur pourra voir convoquer dans le texte, et circonscrit l’espace littéraire dans lequel peut fonctionner cet ouvrage.

  17. Predicting co-complexed protein pairs using genomic and proteomic data integration

    Directory of Open Access Journals (Sweden)

    King Oliver D

    2004-04-01

    Full Text Available Abstract Background Identifying all protein-protein interactions in an organism is a major objective of proteomics. A related goal is to know which protein pairs are present in the same protein complex. High-throughput methods such as yeast two-hybrid (Y2H and affinity purification coupled with mass spectrometry (APMS have been used to detect interacting proteins on a genomic scale. However, both Y2H and APMS methods have substantial false-positive rates. Aside from high-throughput interaction screens, other gene- or protein-pair characteristics may also be informative of physical interaction. Therefore it is desirable to integrate multiple datasets and utilize their different predictive value for more accurate prediction of co-complexed relationship. Results Using a supervised machine learning approach – probabilistic decision tree, we integrated high-throughput protein interaction datasets and other gene- and protein-pair characteristics to predict co-complexed pairs (CCP of proteins. Our predictions proved more sensitive and specific than predictions based on Y2H or APMS methods alone or in combination. Among the top predictions not annotated as CCPs in our reference set (obtained from the MIPS complex catalogue, a significant fraction was found to physically interact according to a separate database (YPD, Yeast Proteome Database, and the remaining predictions may potentially represent unknown CCPs. Conclusions We demonstrated that the probabilistic decision tree approach can be successfully used to predict co-complexed protein (CCP pairs from other characteristics. Our top-scoring CCP predictions provide testable hypotheses for experimental validation.

  18. PairWise Neighbours database: overlaps and spacers among prokaryote genomes

    Directory of Open Access Journals (Sweden)

    Garcia-Vallvé Santiago

    2009-06-01

    Full Text Available Abstract Background Although prokaryotes live in a variety of habitats and possess different metabolic and genomic complexity, they have several genomic architectural features in common. The overlapping genes are a common feature of the prokaryote genomes. The overlapping lengths tend to be short because as the overlaps become longer they have more risk of deleterious mutations. The spacers between genes tend to be short too because of the tendency to reduce the non coding DNA among prokaryotes. However they must be long enough to maintain essential regulatory signals such as the Shine-Dalgarno (SD sequence, which is responsible of an efficient translation. Description PairWise Neighbours is an interactive and intuitive database used for retrieving information about the spacers and overlapping genes among bacterial and archaeal genomes. It contains 1,956,294 gene pairs from 678 fully sequenced prokaryote genomes and is freely available at the URL http://genomes.urv.cat/pwneigh. This database provides information about the overlaps and their conservation across species. Furthermore, it allows the wide analysis of the intergenic regions providing useful information such as the location and strength of the SD sequence. Conclusion There are experiments and bioinformatic analysis that rely on correct annotations of the initiation site. Therefore, a database that studies the overlaps and spacers among prokaryotes appears to be desirable. PairWise Neighbours database permits the reliability analysis of the overlapping structures and the study of the SD presence and location among the adjacent genes, which may help to check the annotation of the initiation sites.

  19. Heterologous microsatellite primer pairs informative for the whole genus Arachis

    Directory of Open Access Journals (Sweden)

    Andrea Akemi Hoshino

    2006-01-01

    Full Text Available The genus Arachis currently comprises 69 described species, some of which have potential and real value as human and animal foods. These Arachis species have been collected and maintained in germplasm banks to provide material that can be used as sources of genes in breeding programs and for the selection of new cultivars. One of the principal objectives of germplasm conservation is the evaluation of genetic variability, which is best conducted using molecular markers. We investigated the use of heterologous primers to amplify microsatellite loci that could be used to evaluate genetic variability in Arachis germplasm. Fifteen microsatellite primer pairs were tested in 76 accessions of 34 species from the nine Arachis sections. The data indicated that heterologous primers were very useful in Arachis since they had high transferability among the species (91% and allowed the amplification of very polymorphic putative loci, which allowed both the characterization of most accessions and to make inferences about the mating systems of some species analyzed. Our data also revealed that the germplasm analyzed showed high variability, even when represented by few accessions.

  20. AGT, Burge pairs and minimal models

    CERN Document Server

    Bershtein, M

    2014-01-01

    We consider the AGT correspondence in the context of the conformal field theory M^{p, p'} x M^H, where M^{p, p'} is the minimal model based on the Virasoro algebra V^{p, p'} labeled by two co-prime integers {p, p'}, 1 < p < p', and M^H is the free boson theory based on the Heisenberg algebra H. Using Nekrasov's instanton partition functions without modification to compute conformal blocks in M^{p, p'} x M^H leads to ill-defined or incorrect expressions. Let B^{p, p', H}_n be a conformal block in M^{p, p'} x M^H, with n consecutive channels \\chi_{\\i}, \\i = 1, ..., n, and let \\chi_{\\i} carry states from H^{p, p'}_{r_{\\i}, s_{\\i}} x F, where H^{p, p'}_{r_{\\i}, s_{\\i}} is an irreducible highest-weight V^{p, p'}-representation, labeled by two integers {r_{\\i}, s_{\\i}}, 0 < r_{\\i} < p, 0 < s_{\\i} < p', and F is the Fock space of H. We show that restricting the states that flow in \\chi_{\\i}, \\i = 1, ..., n, to states labeled by partition pairs {Y_1^{\\i}, Y_2^{\\i}} that satisfy Y^{\\i, T}_{2, \\sigma}...

  1. Invisible decays in Higgs boson pair production

    Science.gov (United States)

    Banerjee, Shankha; Batell, Brian; Spannowsky, Michael

    2017-02-01

    Observation of Higgs pair production is an important long term objective of the LHC physics program as it will shed light on the scalar potential of the Higgs field and the nature of electroweak symmetry breaking. While numerous studies have examined the impact of new physics on di-Higgs production, little attention has been given to the well-motivated possibility of exotic Higgs decays in this channel. Here we investigate the consequences of exotic invisible Higgs decays in di-Higgs production. We outline a search sensitive to such invisible decays in the b b ¯+ ET channel. We demonstrate that probing invisible branching ratios of order 10% during the LHC's high-luminosity run will be challenging, but in resonance enhanced di-Higgs production, this final state can become crucial to establish the existence of physics beyond the Standard Model at collider energies. We also briefly discuss the outlook for other exotic Higgs decay modes and the potential to observe such exotic decays in the di-Higgs channel.

  2. Top Quark Pair Production in ATLAS

    CERN Document Server

    Gellerstedt, Karl

    2012-10-05

    The Large Hadron Collider (LHC) at the international particle physics laboratory CERN in Switzerland is currently the most powerful particle accelerator on earth. This thesis presents analyses of proton-proton collisions at the energy sqrt{s} = 7 TeV, recorded by ATLAS, one of the detectors at the LHC. The goal of the LHC and its detectors is to find new phenomena not described by the Standard Model (SM) of particle physics. The top quark is the heaviest known elementary particle and it is produced in very large numbers at the LHC. Measuring the production cross-section of top pairs (ttbar) is important for many reasons: for validating the strong production mechanism of the SM, for commissioning and calibration of the detector and analysis software and because several scenarios for physics beyond the SM predict changes to the ttbar production cross-section. Five different measurements of the ttbar cross-section will be presented in this thesis. The first three are measurements of the total cross-section, the ...

  3. Multidimensional Simulations of Rotating Pair Instability Supernovae

    CERN Document Server

    Chatzopoulos, E; Couch, S M

    2013-01-01

    We study the effects of rotation on the dynamics, energetics and Ni-56 production of Pair Instability Supernova explosions by performing rotating two-dimensional ("2.5-D") hydrodynamics simulations. We calculate the evolution of eight low metallicity (Z = 10^-3, 10^-4 Zsun) massive (135-245 Msun) PISN progenitors with initial surface rotational velocities 50% that of the critical Keplerian value using the stellar evolution code MESA. We allow for both the inclusion and the omission of the effects of magnetic fields in the angular momentum transport and in chemical mixing, resulting in slowly-rotating and rapidly-rotating final carbon-oxygen cores, respectively. Increased rotation for carbon-oxygen cores of the same mass and chemical stratification leads to less energetic PISN explosions that produce smaller amounts of Ni-56 due to the effect of the angular momentum barrier that develops and slows the dynamical collapse. We find a non-monotonic dependence of Ni-56 production on rotational velocity in situation...

  4. Arbitrated Quantum Signature protocol using EPR pairs

    Directory of Open Access Journals (Sweden)

    Jun Zhang

    2012-11-01

    Full Text Available Arbitrated signature provides that the signatory signs a message with his private key by quantum cryptography, while the signature receiver verifies the signature with the arbitrator’s assistance. In this work, security analysis was given to the arbitrated quantum signature (AQS and results showed that the receiver Bob and the attacker can forge the signature. Then this paper gives a new quantum one-time pads encryption method, which is suit for the quantum signature. At last, a new AQS protocol using Einstein-Podoisky-Rosen (EPR pairs is proposed. By using of  quantum key distribution (QKD and new quantum one-time pads, the new scheme can resist Shor’s attack. The new scheme has following advantages: (1 The scheme reduces the complexity of implementation and provides a higher efficiency in transmission; (2 Compares with some AQS schemes, the scheme can avoid being disavowed by the receiver; (3 Compares with other AQS schemes, the scheme also guarantees the arbitrator cannot forge the signature and it also ensure the receiver and other attacker cannot forge the signature.

  5. Pair Triplet Association Rule Generation in Streams

    Directory of Open Access Journals (Sweden)

    Manisha Thool

    2013-08-01

    Full Text Available Many applications involve the generation and analysis of a new kind of data, called stream data, where data flows in and out of an observation platform or window dynamically. Such data streams have the unique features such as huge or possibly infinite volume, dynamically changing, flowing in or out in a fixed order, allowing only one or a small number of scans. An important problem in data stream mining is that of finding frequent items in the stream. This problem finds application across several domains such as financial systems, web traffic monitoring, internet advertising, retail and e-business. This raises new issues that need to be considered when developing association rule mining technique for stream data. The Space-Saving algorithm reports both frequent and top-k elements with tight guarantees on errors. We also develop the notion of association rules in streams of elements. The Streaming-Rules algorithm is integrated with Space-Saving algorithm to report 1-1 association rules with tight guarantees on errors, using minimal space, and limited processing per element and we are using Apriori algorithm for static datasets and generation of association rules and implement Streaming-Rules algorithm for pair, triplet association rules. We compare the top- rules of static datasets with output of stream datasets and find percentage of error.

  6. Spin- and Pair-Density-Wave Glasses

    Directory of Open Access Journals (Sweden)

    David F. Mross

    2015-07-01

    Full Text Available Spontaneous breaking of translational symmetry, known as density-wave order, is common in nature. However, such states are strongly sensitive to impurities or other forms of frozen disorder leading to fascinating glassy phenomena. We analyze impurity effects on a particularly ubiquitous form of broken translation symmetry in solids: a spin-density wave (SDW with spatially modulated magnetic order. Related phenomena occur in pair-density-wave (PDW superconductors where the superconducting order is spatially modulated. For weak disorder, we find that the SDW or PDW order can generically give way to a SDW or PDW glass—new phases of matter with a number of striking properties, which we introduce and characterize here. In particular, they exhibit an interesting combination of conventional (symmetry-breaking and spin-glass (Edwards-Anderson order. This is reflected in the dynamic response of such a system, which—as expected for a glass—is extremely slow in certain variables, but, surprisingly, is fast in others. Our results apply to all uniaxial metallic SDW systems where the ordering vector is incommensurate with the crystalline lattice. In addition, the possibility of a PDW glass has important consequences for some recent theoretical and experimental work on La_{2−x}Ba_{x}Cu_{2}O_{4}.

  7. An Identity Based Aggregate Signature from Pairings

    Directory of Open Access Journals (Sweden)

    Yike Yu

    2011-04-01

    Full Text Available An aggregate signature is a useful digital signature that supports aggregation: Given n signatures on n distinct messages from n distinct users, aggregate signature scheme is possible to aggregate all these signature into a single short signature. This single signature, along with the n original messages will convince any verifier that the n users did indeed sign the n original messages respectively (i.e., for i=1,...,n user i signed message  mi. In this paper, we propose an identity based aggregate signature scheme which requires constant pairing operations in the verification and the size of aggregate signature is independent of the number of signers. We prove that the proposed signature scheme is secure against existential forgery under adaptively chosen message and identity attack in the random oracle model assuming the intractability of the computational Diffie-Hellman problem.

  8. Frustrated Lewis Pair Behavior of Intermolecular Annine/B(C6F5)(3) Pairs

    NARCIS (Netherlands)

    Voss, Tanja; Mahdi, Tayseer; Otten, Edwin; Froehlich, Roland; Kehr, Gerald; Stephan, Douglas W.; Erker, Gerhard

    2012-01-01

    Reactions of N,N-dimethylaniline, N-isopropyl-aniline, 1,4-C6H4(CH(2)NHtBu)(2), and benzyldimethylamine with the Lewis acid B(C6F5)(3) have been studied. In the case of N,N-dirnethylaniline the combination of the Lewis acid and base forms an almost completely noninteracting frustrated Lewis pair, wh

  9. Observing Pair-Work Task in an English Speaking Class

    Directory of Open Access Journals (Sweden)

    Diana Achmad

    2014-01-01

    Full Text Available This paper reports on students’ pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger with the less competent ones (hereafter, weaker; therefore, eight pairs were observed during the lesson. The task given to the students was to express ‘Agree and Disagree’ in the context of giving opinions related to social life. Based on the observations, the task was successfully implemented by six pairs; thus, the two others faced some problems. From the first pair, it was seen that the stronger student had intimated the weaker one into speaking during the task. The other pair, who was both of the same native, did not converse in English as expected and mostly used their native language to speak with one another presumably due to respect from the stronger student towards the weaker one. In situations like this, when pair-work becomes unproductive, rotating pairs is recommended to strengthen information sharing and assigning roles to avoid a student from taking over the activity from his or her pair. In conclusion, pairing international learners with mixed speaking proficiency by teachers must be conducted as effectively as possible by initially identifying their ability and learning culture to profoundly expand the students’ language resources.

  10. Adaptive value of same-sex pairing in Laysan albatross.

    Science.gov (United States)

    Young, Lindsay C; VanderWerf, Eric A

    2014-01-22

    Same-sex pairing is widespread among animals but is difficult to explain in an evolutionary context because it does not result in reproduction, and thus same-sex behaviour often is viewed as maladaptive. Here, we compare survival, fecundity and transition probabilities of female Laysan albatross in different pair types, and we show how female-female pairing could be an adaptive alternative mating strategy, albeit one that resulted in lower fitness than male-female pairing. Females in same-sex pairs produced 80% fewer chicks, had lower survival and skipped breeding more often than those in male-female pairs. Females in same-sex pairs that raised a chick sometimes acquired a male mate in the following year, but females in failed same-sex pairs never did, suggesting that males exert sexual selection by assessing female quality and relegating low-quality females into same-sex pairs. Sexual selection by males in a monomorphic, non-ornamented species is rare and suggests that reconsideration is needed of the circumstances in which alternative reproductive behaviour evolves. Given the lack of males and obligate biparental care in this species, this research demonstrates how same-sex pairing was better than not breeding and highlights how it could be an adaptive strategy under certain demographic conditions.

  11. Efficient Implementation of the Pairing on Mobilephones Using BREW

    Science.gov (United States)

    Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

    Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

  12. Natural versus artificial creation of base pairs in DNA: origin of nucleobases from the perspectives of unnatural base pair studies.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko; Yamashige, Rie

    2012-12-18

    Since life began on Earth, the four types of bases (A, G, C, and T(U)) that form two sets of base pairs have remained unchanged as the components of nucleic acids that replicate and transfer genetic information. Throughout evolution, except for the U to T modification, the four base structures have not changed. This constancy within the genetic code raises the question of how these complicated nucleotides were generated from the molecules in a primordial soup on the early Earth. At some prebiotic stage, the complementarity of base pairs might have accelerated the generation and accumulation of nucleotides or oligonucleotides. We have no clues whether one pair of nucleobases initially appeared on the early Earth during this process or a set of two base pairs appeared simultaneously. Recently, researchers have developed new artificial pairs of nucleobases (unnatural base pairs) that function alongside the natural base pairs. Some unnatural base pairs in duplex DNA can be efficiently and faithfully amplified in a polymerase chain reaction (PCR) using thermostable DNA polymerases. The addition of unnatural base pair systems could expand the genetic alphabet of DNA, thus providing a new mechanism for the generation novel biopolymers by the site-specific incorporation of functional components into nucleic acids and proteins. Furthermore, the process of unnatural base pair development might provide clues to the origin of the natural base pairs in a primordial soup on the early Earth. In this Account, we describe the development of three representative types of unnatural base pairs that function as a third pair of nucleobases in PCR and reconsider the origin of the natural nucleic acids. As researchers developing unnatural base pairs, they use repeated "proof of concept" experiments. As researchers design new base pairs, they improve the structures that function in PCR and eliminate those that do not. We expect that this process is similar to the one functioning in the

  13. Pulsar Pair Cascades in Magnetic Fields with Offset Polar Caps

    Science.gov (United States)

    Harding, Alice K.; Muslimov, Alex G.

    2012-01-01

    Neutron star magnetic fields may have polar caps (PC) that are offset from the dipole axis, through field-line sweepback near the light cylinder or non-symmetric currents within the star. The effects of such offsets on electron-positron pair cascades are investigated, using simple models of dipole magnetic fields with small distortions that shift the PCs by different amounts or directions. Using a Monte Carlo pair cascade simulation, we explore the changes in the pair spectrum, multiplicity and energy flux across the PC, as well as the trends in pair flux and pair energy flux with spin-down luminosity, L(sub sd). We also give an estimate of the distribution of heating flux from returning positrons on the PC for different offsets. We find that even modest offsets can produce significant increases in pair multiplicity, especially for pulsars that are near or beyond the pair death lines for centered PCs, primarily because of higher accelerating fields. Pair spectra cover several decades in energy, with the spectral range of millisecond pulsars (MSPs) two orders of magnitude higher than for normal pulsars, and PC offsets allow significant extension of all spectra to lower pair energies. We find that the total PC pair luminosity L(sub pair) is proportional to L(sub sd), with L(sub pair) approximates 10(exp -3) L(sub sd) for normal pulsars and L(sub pair) approximates 10(exp -2) L(sub sd) for MSPs. Remarkably, the total PC heating luminosity for even large offsets increases by less than a factor of two, even though the PC area increases by much larger factors, because most of the heating occurs near the magnetic axis.

  14. Four pairs of gene–gene interactions associated with increased risk for type 2 diabetes (CDKN2BAS–KCNJ11, obesity (SLC2A9–IGF2BP2, FTO–APOA5, and hypertension (MC4R–IGF2BP2 in Chinese women

    Directory of Open Access Journals (Sweden)

    M.H. Wang

    2014-12-01

    Full Text Available Metabolic disorders including type 2 diabetes, obesity and hypertension have growing prevalence globally every year. Genome-wide association studies have successfully identified many genetic markers associated to these diseases, but few studied their interaction effects. In this study, twenty candidate SNPs from sixteen genes are selected, and a lasso-multiple regression approach is implemented to consider the SNP–SNP interactions among them in an Asian population. It is found out that the main effects of the markers are weak but the interactions among the candidates showed a significant association to diseases. SNPs from genes CDKN2BAS and KCNJ11 are significantly associated to risk for developing diabetes, and SNPs from FTO and APOA5 might interact to play an important role for the onset of hypertension.

  15. Stereo Pair, Salt Lake City, Utah

    Science.gov (United States)

    2002-01-01

    The 2002 Winter Olympics are hosted by Salt Lake City at several venues within the city, in nearby cities, and within the adjacent Wasatch Mountains. This image pair provides a stereoscopic map view of north central Utah that includes all of these Olympic sites. In the south, next to Utah Lake, Provo hosts the ice hockey competition. In the north, northeast of the Great Salt Lake, Ogden hosts curling and the nearby Snowbasin ski area hosts the downhill events. In between, southeast of the Great Salt Lake, Salt Lake City hosts the Olympic Village and the various skating events. Further east, across the Wasatch Mountains, the Park City ski resort hosts the bobsled, ski jumping, and snowboarding events. The Winter Olympics are always hosted in mountainous terrain. This view shows the dramatic landscape that makes the Salt Lake City region a world-class center for winter sports.This stereoscopic image was generated by draping a Landsat satellite image over a Shuttle Radar Topography Mission digital elevation model. Two differing perspectives were then calculated, one for each eye. They can be seen in 3-D by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing or by downloading and printing the image pair and viewing them with a stereoscope. When stereoscopically merged, the result is a vertically exaggerated view of Earth's surface in its full three dimensions.Landsat has been providing visible and infrared views of the Earth since 1972. SRTM elevation data matches the 30-meter (98-foot) resolution of most Landsat images and will substantially help in analyzing the large and growing Landsat image archive, managed by the U.S. Geological Survey (USGS).Elevation data used in this image was acquired by the Shuttle Radar Topography Mission (SRTM) aboard the Space Shuttle Endeavour, launched on Feb. 11, 2000. SRTM used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR

  16. PLANNING IN ARTIFICIAL INTELLIGENCE AND ROBOTICS (PAIR

    Directory of Open Access Journals (Sweden)

    Editorial, Foreword

    2016-11-01

    Full Text Available September 18th, 2016Deggendorf, Germanyhttp://robotics.fel.cvut.cz/pair16/Organized by: Artificial Intelligence Center Department of Computer Science Faculty of Electrical Engineering Czech Technical University in PragueTechnicka 2, Prague 6, 166 27, Czech RepublicGuest editors:Jan Faigl (Artificial Intelligence Center, Department of Computer Science, Faculty of Electrical Engineering, Czech Technical University in PragueJiří Vokřínek (Artificial Intelligence Center, Department of Computer Science, Faculty of Electrical Engineering, Czech Technical University in PragueScientific comittee:D. Belter (Poznań University of Technology, PolandW. Dorner (Technische Hochschule Deggendorf, GermanyJ. Faigl (Czech Technical University in PragueT. Krajník (University of Lincoln, United KingdomA. Komenda (Czech Technical University in PragueG. Kupris (Technische Hochschule Deggendorf, GermanyM. Rollo (Czech Technical University in PragueM. Saska (Czech Technical University in PragueJ. Vokřínek (Czech Technical University in PragueV. Vonásek (Czech Technical University in PragueK. Walas (Poznań University of Technology, Poland Foreword:The third year of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR continues in joining young researchers and students interested in robotics and artificial intelligence. In 2016, we follow the schema of the last year as a joint event with the RoboTour competition in Deggendorf, Germany. Thanks to the great collaboration with Gerald Kupris and Wolfgang Donner from Technische Hochschule Deggendorf and support from Czech Technical University under project No. SVK 26/16/F3 and Bayerisches Staatsministerium der Finanzen, für Landesentwicklung und Heimat, we have been able to provide accommodations and travel support to participants and an invited speaker. Fourteen papers have accepted and listed in the conference program. The papers have been authored by students from Central Europe

  17. Paired Straight Hearth Furnace - Transformational Ironmaking Process

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Wei-Kao [McMaster Univ., Hamilton, ON (Canada); Debski, Paul [Andritz Metals Inc.,Canonsburg, PA (United States)

    2014-11-19

    The U. S. steel industry has reduced its energy intensity per ton of steel shipped by 33% since 1990. However, further significant gains in energy efficiency will require the development of new, transformational iron and steelmaking processes. The Paired Straight Hearth Furnace (PSH) process is an emerging alternative high productivity, direct reduced iron (DRI) technology that may achieve very low fuel rates and has the potential to replace blast furnace ironmaking. The PSH furnace can operate independently or may be coupled with other melting technologies to produce liquid hot metal that is both similar to blast furnace iron and suitable as a feedstock for basic oxygen steelmaking furnaces. The PSH process uses non-metallurgical coal as a reductant to convert iron oxides such as iron ore and steelmaking by-product oxides to DRI pellets. In this process, a multi-layer, nominally 120mm tall bed of composite “green balls” made from oxide, coal and binder is built up and contained within a moving refractory hearth. The pellet bed absorbs radiant heat energy during exposure to the high temperature interior refractory surfaces of the PSH while generating a strongly reducing gas atmosphere in the bed that yields a highly metalized DRI product. The PSH concept has been well tested in static hearth experiments. A moving bed design is being developed. The process developers believe that if successful, the PSH process has the potential to replace blast furnaces and coke ovens at a fraction of the operating and capital cost while using about 30% less energy relative to current blast furnace technology. DRI output could also feed electric arc furnaces (EAFs) by displacing a portion of the scrap charge.

  18. The interacting pair MKN 305/306

    Science.gov (United States)

    Dietrich, Matthias

    1990-11-01

    Direct images and spectra at different slit positions of the interacting system Mkn 305/306 are discussed. Both galaxies show starburst properties due to tidal interaction. The morphology and velocity structure of Mkn 306 reveals the strongest warp of a stellar disk so far known. The galaxies Mkn 305 and Mkn 306 form a double system with 30 arcsec separation and having a common envelope at mB greater than or equal to 24.5. Furthermore a small tidal tail west of Mkn 305A, an isophote twist of Mkn 305 and the near identical redshifts of the two galaxies prove that this is a physical pair. Mkn 306 itself was classified as a double nucleus galaxy (Petrosyan et al., 1978). The optical morphology of Mkn 306 has the form of an integral sign which is similar to the radio morphology of strongly warped galaxies (Bottema et al., 1987). But in the optical the warp of the stellar component is normally far weaker than in the radio for the HI-gas. Therefore the authors investigate whether the double nucleus structure of Mkn 306 is real or an artifact due to an extreme warp in the optical. The origin for the warp phenomenon is not clear yet. Direct images of the galaxy system were taken with the Calar Alto 2.2m telescope in the B-band and at La Silla in the r-band using the 2.2m telescope; low dispersion spectra (240 A/mm) as well as high dispersion spectra (56 A/mm) for studying the velocity field were taken with the Calar Alto 3.5m telescope at different position angles. Also a spectrum of Mkn 305 was taken at Calar Alto with the 3.5m telescope covering the whole spectral range (240 A/mm).

  19. Pairing Nambu-Goldstone modes within nuclear density functional theory

    CERN Document Server

    Hinohara, Nobuo

    2016-01-01

    We show that the Nambu-Goldstone formalism of the broken gauge symmetry in the presence of the $T=1$ pairing condensate offers a quantitative description of the binding energy differences of open-shell superfluid nuclei. We conclude that the pairing rotational moments of inertia are excellent pairing indicators, which are free from ambiguities attributed to odd-mass systems. We offer a new, unified interpretation of the binding-energy differences traditionally viewed in the shell model picture as signatures of the valence nucleon properties. We present the first systematic analysis of the off-diagonal pairing rotational moments of inertia, and demonstrate the mixing of the neutron and proton pairing rotational modes in the ground states of even-even nuclei. Finally, we discuss the importance of mass measurements of neutron-rich nuclei for constraining the pairing energy density functional.

  20. Analysis of food pairing in regional cuisines of India

    CERN Document Server

    Jain, Anupam; Bagler, Ganesh

    2015-01-01

    Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient ...

  1. Paired-permanent approach to valence bond theory

    Institute of Scientific and Technical Information of China (English)

    吴玮; 吴安安; 莫亦荣; 张乾二

    1996-01-01

    A new function called paired-permanent is defined and widely discussed, and a practicable procedure for evaluations of paired-permanents is proposed, which is similar to the Laplace method for determinants. Using the concept of paired-permanents, an efficient algorithm is presented for evaluating the Hamiltonian and overlap matrix elements in the spin-free form of valence bond (VB) theory. With the new algorithm, a spin-free wavefunction is simply written as a paired-permanent, and an overlap matrix element may be obtained by evaluating a corresponding paired-permanent. Meanwhile, the Hamiltonian matrix element is expressed in terms of the summation of the products of electronic integrals and the corresponding sub-paired-permanents

  2. Paired teaching for faculty professional development in teaching

    CERN Document Server

    Stang, Jared B

    2015-01-01

    Paired (or co-)teaching is an arrangement in which two faculty are collaboratively responsible for all aspects of teaching a course. By pairing an instructor experienced in research-based instructional strategies (RBIS) with an instructor with little or no experience in RBIS, paired teaching can be used to promote the adoption of RBIS. Using data from post-course interviews with the novice instructors of four such arrangements, we seek to understand the factors that make for effective professional development in teaching via paired teaching. Learning about teaching for the novice instructors was found to be mediated both by the approach of the novice instructor to the paired teaching and the previous teaching experience of the novice instructor. Additionally, the structure of the pair-taught course and the sequence of teaching assignments for the novice instructor both play roles in lowering the barrier to novice instructors adopting RBIS.

  3. Pair distribution functions of silicon/silicon nitride interfaces

    Science.gov (United States)

    Cao, Deng; Bachlechner, Martina E.

    2006-03-01

    Using molecular dynamics simulations, we investigate different mechanical and structural properties of the silicon/silicon nitride interface. One way to characterize the structure as tensile strain is applied parallel to the interface is to calculate pair distribution functions for specific atom types. The pair distribution function gives the probability of finding a pair of atoms a distance r apart, relative to the probability expected for a completely random distribution at the same density. The pair distribution functions for bulk silicon nitride reflect the fracture of the silicon nitride film at about 8 % and the fact that the centerpiece of the silicon nitride film returns to its original structure after fracture. The pair distribution functions for interface silicon atoms reveal the formation of bonds for originally unbound atom pairs, which is indicative of the interstitial-vacancy defect that causes failure in silicon.

  4. Classes of source pairs in interference and diffraction

    CERN Document Server

    Castaneda, R

    2003-01-01

    A description of interference and diffraction based on the concept of class of source pairs is presented. It is the set of pairs of sources whose contributions to the interference or diffraction patterns exhibit the same phase difference. Each class of source pairs provides a specific cosine-like modulation on the intensity distribution of pattern, in such a way that the set provides an expansion of the intensity distribution of the pattern in an orthogonal basis. From this point of view, the classes of source pairs are the effective elementary sources for those intensity distributions. The characteristics of the classes of source pairs can be accurately determined by Fourier transforming the intensity distribution of the patterns. The central value of this Fourier spectrum is related to the number of individual sources. The remaining values will provide two crucial descriptors of the classes: their positions on the Fourier transform domain will be corresponding to the separation vector of the class of pairs ...

  5. Diffraction of collinear correlated photon pairs by an ultrasonic wave

    CERN Document Server

    Kwiek, Piotr

    2013-01-01

    The phenomenon of collinear photon pairs diffraction by an ultrasonic wave is investigated for Bragg incidence. A BBO crystal was used for producing collinear correlated photon pairs via type-I spontaneous parametric down-conversion. The experimental setup for diffraction of collinear correlated photon pairs was tested based on Malus' law for pairs of photons. The obtained results do not support the L. B. Deng's theory of 2012, presented in his work entitled "Diffraction of entangled photon pairs by ultrasonic waves" [Front. Phys. 7, 239 (2012)] . An alternative simple theoretical description of interaction of collinear photon pairs with ultrasonic waves is shown in the present paper which reveals very good agreement with corresponding experimental data.

  6. Spin polarization transfer by the radical pair mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Zarea, Mehdi, E-mail: m-zarea@northwestern.edu; Ratner, Mark A.; Wasielewski, Michael R. [Department of Chemistry and Argonne-Northwestern Solar Energy Research (ANSER) Center, Northwestern University, Evanston, Illinois 60208-3113 (United States)

    2015-08-07

    In a three-site representation, we study a spin polarization transfer from radical pair spins to a nearby electron or nuclear spin. The quantum dynamics of the radical pair spins is governed by a constant exchange interaction between the radical pair spins which have different Zeeman frequencies. Radical pair spins can recombine to the singlet ground state or to lower energy triplet states. It is then shown that the coherent dynamics of the radical pair induces spin polarization on the nearby third spin in the presence of a magnetic field. The spin polarization transfer depends on the difference between Zeeman frequencies, the singlet and triplet recombination rates, and on the exchange and dipole-dipole interactions between the different spins. In particular, the sign of the polarization depends on the exchange coupling between radical pair spins and also on the difference between singlet and triplet recombination rate constants.

  7. On the polar cap cascade pair multiplicity of young pulsars

    CERN Document Server

    Timokhin, A N

    2015-01-01

    We study the efficiency of pair production in polar caps of young pulsars under a variety of conditions to estimate the maximum possible multiplicity of pair plasma in pulsar magnetospheres. We develop a semi-analytic model for calculation of cascade multiplicity which allows efficient exploration of the parameter space and corroborate it with direct numerical simulations. Pair creation processes are considered separately from particle acceleration in order to assess different factors affecting cascade efficiency, with acceleration of primary particles described by recent self-consistent non-stationary model of pair cascades. We argue that the most efficient cascades operate in the curvature radiation/synchrotron regime, the maximum multiplicity of pair plasma in pulsar magnetospheres is ~few x 10^5. The multiplicity of pair plasma in magnetospheres of young energetic pulsars weakly depends on the strength of the magnetic field and the radius of curvature of magnetic field lines and has a stronger dependence ...

  8. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

    2015-01-01

    to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...... as a particular paired structure when the classical fuzzy negation is considered; on the other hand, the relationship of this model with bipolarity is reconsidered from our paired view....

  9. Pair potential trend of alkali metals under external pressure

    Science.gov (United States)

    Rahman, S. M. Mujibur

    1987-09-01

    Structural phase stability of certain alkali metals under external pressure is investigated by looking at their pair potential trend. The effective pair potentials occurring in the real space representation of the band structure contribution relevant to a second-order theory are calculated by using an appropriate dielectric function and a simple empty-core pseudopotential. The relative positions of the neighboring atoms with respect to the minima in the pair potentials uphold a qualitative picture of the phase stability in these systems.

  10. Can Cooper pairs in benzene lead to Efimov states?

    Science.gov (United States)

    Squire, R. H.; March, N. H.; Rubio, A.

    2015-02-01

    Cooper pairs have been experimentally verified in benzene at 38.3 eV. We have proposed previously that the six most loosely bound electrons in benzene form three equivalent Cooper pairs. We further propose in this manuscript that these three weakly interacting bosons (Cooper pairs) should form an infinite number of Efimov states (possibly Booromean rings) which is what a photon of high energy will then encounter.

  11. Marker-based filtering of bilingual phrase pairs for SMT

    OpenAIRE

    Sánchez-Martínez, Felipe; Way, Andy

    2009-01-01

    State-of-the-art statistical machine translation systems make use of a large translation table obtained after scoring a set of bilingual phrase pairs automatically extracted from a parallel corpus. The number of bilingual phrase pairs extracted from a pair of aligned sentences grows exponentially as the length of the sentences increases; therefore, the number of entries in the phrase table used to carry out the translation may become unmanageable, especially when online, ‘on demand’ translati...

  12. ROTATION CURVES IN (E+S ISOLATED GALAXY PAIRS

    Directory of Open Access Journals (Sweden)

    E. M. Huerta

    2009-01-01

    Full Text Available As part of a broad investigation to quantify the effects of interaction in the evolution of disk galaxies, we measured rotation curves of 102 spirals in mixed morphology pairs (E+S, drawn from the Karachantsev catalogue of isolated pairs of galaxies. In this summary we simply present characteristic rotation curves of spirals in isolated (E+S pairs, in preparation for a future comparison with isolated spirals in a Tully-Fisher diagram.

  13. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel;

    2015-01-01

    In this paper we present a new class of fuzzy sets, paired fuzzy sets, that tries to overcome any conflict between families of fuzzy sets that share a main characteristic: that they are generated from two basic opposite fuzzy sets. Hence, the first issue is to formalize the notion of opposition, ...... as a particular paired structure when the classical fuzzy negation is considered; on the other hand, the relationship of this model with bipolarity is reconsidered from our paired view....

  14. ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.

    Directory of Open Access Journals (Sweden)

    Alexandra Peacock-Villada

    Full Text Available Accurate sequence dependent pairing of single-stranded DNA (ssDNA molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones.

  15. Theory of phase segregation in DNA assemblies containing two different base-pair sequence types

    Science.gov (United States)

    (O’ Lee, Dominic J.; Wynveen, Aaron; Kornyshev, Alexei A.

    2017-01-01

    Spontaneous pairing of homologous DNA sequences—a challenging subject in molecular biophysics, often referred to as ‘homology recognition’—has been observed in vitro for several DNA systems. One of these experiments involved liquid crystalline quasi-columnar phases formed by a mixture of two kinds of double stranded DNA oligomer. Both oligomer types were of the same length and identical stoichiometric base-pair composition, but the base-pairs followed a different order. Phase segregation of the two DNA types was observed in the experiments, with the formation of boundaries between domains rich in molecules of one type (order) of base pair sequence. We formulate here a modified ‘X–Y model’ for phase segregation in such assemblies, obtain approximate solutions of the model, compare analytical results to Monte Carlo simulations, and rationalise past experimental observations. This study, furthermore, reveals the factors that affect the degree of segregation. Such information could be used in planning new versions of similar segregation experiments, needed for deepening our understanding of forces that might be involved, e.g., in gene–gene recognition.

  16. Codon Pair Bias Is a Direct Consequence of Dinucleotide Bias

    Directory of Open Access Journals (Sweden)

    Dusan Kunec

    2016-01-01

    Full Text Available Codon pair bias is a remarkably stable characteristic of a species. Although functionally uncharacterized, robust virus attenuation was achieved by recoding of viral proteins using underrepresented codon pairs. Because viruses replicate exclusively inside living cells, we posited that their codon pair preferences reflect those of their host(s. Analysis of many human viruses showed, however, that the encoding of viruses is influenced only marginally by host codon pair preferences. Furthermore, examination of codon pair preferences of vertebrate, insect, and arthropod-borne viruses revealed that the latter do not utilize codon pairs overrepresented in arthropods more frequently than other viruses. We found, however, that codon pair bias is a direct consequence of dinucleotide bias. We conclude that codon pair bias does not play a major role in the encoding of viral proteins and that virus attenuation by codon pair deoptimization has the same molecular underpinnings as attenuation based on an increase in CpG/TpA dinucleotides.

  17. Heterospecific pairing and hybridization between Nasutitermes corniger and N. ephratae

    Science.gov (United States)

    Hartke, Tamara R.; Rosengaus, Rebeca B.

    2011-09-01

    The sympatric neotropical termites Nasutitermes corniger and Nasutitermes ephratae are clearly distinguishable based on morphology, nest architecture, defensive secretion composition, and molecular markers. However, given the extensive ecological, geographical, and behavioral overlap of these closely related species, the potential for interbreeding may exist. To explore this possibility, heterospecific pairs were formed experimentally to examine courtship and colony-establishment behaviors, and reproductive potential. Courtship and nest construction behavior occurred in heterospecific pairs in a similar manner to that of conspecific pairs. Survival of pairs depended upon the species of the female partner. N. ephratae females paired with N. corniger males produced as many offspring as conspecific pairs. N. corniger females mated to N. ephratae males, however, produced significantly fewer offspring at 60 days post-establishment than the reciprocal cross or conspecific N. ephratae or N. corniger pairs. This was also the only pairing in which any aggression was observed. Heterospecific pairs and groups formed in mate choice mesocosms, suggesting that species recognition between these two termites is not an important aspect of mate choice. Overall, species mismatch tolerance and hybrid offspring viability are high. The present data, together with previous evidence from defensive secretions and isozyme analysis, suggest that hybridization may periodically occur in nature, and that reproductive barriers between these two species may be incomplete. Hybridization could provide a rare but important source of genetic diversity and may ensure mating opportunities for the more abundant sex of alates in each species.

  18. Excluded volume effect enhances the homology pairing of model chromosomes

    CERN Document Server

    Takamiya, Kazunori; Isami, Shuhei; Nishimori, Hiraku; Awazu, Akinori

    2015-01-01

    To investigate the structural dynamics of the homology pairing of polymers, we mod- eled the scenario of homologous chromosome pairings during meiosis in Schizosaccharomyces pombe, one of the simplest model organisms of eukaryotes. We consider a simple model consist- ing of pairs of homologous polymers with the same structures that are confined in a cylindrical container, which represents the local parts of chromosomes contained in an elongated nucleus of S. pombe. Brownian dynamics simulations of this model showed that the excluded volume effects among non-homological chromosomes and the transitional dynamics of nuclear shape serve to enhance the pairing of homologous chromosomes.

  19. Winter pairs of ruddy shelducks at Lashihai Lake, southwest China.

    Science.gov (United States)

    Quan, Ruichang; Cui, Liangwei

    2013-04-01

    It has been suggested that pairing behavior during winter in migratory ducks represents a trade-off between costs (defense of the female) and benefits (early access to females). To investigate the benefits and costs for both sexes in wintering pairs of ruddy shelducks (Tadorna ferruginea), we compared time budgets for paired males and females, and surveyed the sex ratio of the birds wintering at Lashihai Lake, southwest China. The behavior of the paired ruddy shelducks was monitored for 5 activity types: feeding, resting (including sleeping), preening, drinking and warning. Feeding was the most dominant activity. The feeding time of both sexes increased as the winter season progressed. However, the paired females always spent significantly more time feeding and less time warning than the paired males. Paired ruddy shelducks had access to better feeding grounds than unpaired individuals, resulting in a food benefit for paired individuals over single individuals. Because the sex ratio of the wintering population was strongly male biased (M:F = 1.44:1.00), the paired male also gained the benefit of accessing a female in advance of the breeding season.

  20. Excluded volume effect enhances the homology pairing of model chromosomes

    Science.gov (United States)

    Takamiya, Kazunori; Yamamoto, Keisuke; Isami, Shuhei; Nishimori, Hiraku; Awazu, Akinori

    To investigate the structural dynamics of the homology pairing of polymers, we mod- eled the scenario of homologous chromosome pairings during meiosis in Schizosaccharomyces pombe, one of the simplest model organisms of eukaryotes. We consider a simple model consist- ing of pairs of homologous polymers with the same structures that are confined in a cylindrical container, which represents the local parts of chromosomes contained in an elongated nucleus of S. pombe. Brownian dynamics simulations of this model showed that the excluded volume effects among non-homological chromosomes and the transitional dynamics of nuclear shape serve to enhance the pairing of homologous chromosomes.