WorldWideScience

Sample records for non-templated nucleotide addition

  1. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

    Czech Academy of Sciences Publication Activity Database

    Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla

    2016-01-01

    Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016

  2. Estimating additive and non-additive genetic variances and predicting genetic merits using genome-wide dense single nucleotide polymorphism markers.

    Directory of Open Access Journals (Sweden)

    Guosheng Su

    Full Text Available Non-additive genetic variation is usually ignored when genome-wide markers are used to study the genetic architecture and genomic prediction of complex traits in human, wild life, model organisms or farm animals. However, non-additive genetic effects may have an important contribution to total genetic variation of complex traits. This study presented a genomic BLUP model including additive and non-additive genetic effects, in which additive and non-additive genetic relation matrices were constructed from information of genome-wide dense single nucleotide polymorphism (SNP markers. In addition, this study for the first time proposed a method to construct dominance relationship matrix using SNP markers and demonstrated it in detail. The proposed model was implemented to investigate the amounts of additive genetic, dominance and epistatic variations, and assessed the accuracy and unbiasedness of genomic predictions for daily gain in pigs. In the analysis of daily gain, four linear models were used: 1 a simple additive genetic model (MA, 2 a model including both additive and additive by additive epistatic genetic effects (MAE, 3 a model including both additive and dominance genetic effects (MAD, and 4 a full model including all three genetic components (MAED. Estimates of narrow-sense heritability were 0.397, 0.373, 0.379 and 0.357 for models MA, MAE, MAD and MAED, respectively. Estimated dominance variance and additive by additive epistatic variance accounted for 5.6% and 9.5% of the total phenotypic variance, respectively. Based on model MAED, the estimate of broad-sense heritability was 0.506. Reliabilities of genomic predicted breeding values for the animals without performance records were 28.5%, 28.8%, 29.2% and 29.5% for models MA, MAE, MAD and MAED, respectively. In addition, models including non-additive genetic effects improved unbiasedness of genomic predictions.

  3. Estimating Additive and Non-Additive Genetic Variances and Predicting Genetic Merits Using Genome-Wide Dense Single Nucleotide Polymorphism Markers

    DEFF Research Database (Denmark)

    Su, Guosheng; Christensen, Ole Fredslund; Ostersen, Tage

    2012-01-01

    of genomic predictions for daily gain in pigs. In the analysis of daily gain, four linear models were used: 1) a simple additive genetic model (MA), 2) a model including both additive and additive by additive epistatic genetic effects (MAE), 3) a model including both additive and dominance genetic effects...

  4. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  5. A whole genome association study to detect additive and dominant single nucleotide polymorphisms for growth and carcass traits in Korean native cattle, Hanwoo

    Directory of Open Access Journals (Sweden)

    Yi Li

    2017-01-01

    Full Text Available Objective A whole genome association study was conducted to identify single nucleotide polymorphisms (SNPs with additive and dominant effects for growth and carcass traits in Korean native cattle, Hanwoo. Methods The data set comprised 61 sires and their 486 Hanwoo steers that were born between spring of 2005 and fall of 2007. The steers were genotyped with the 35,968 SNPs that were embedded in the Illumina bovine SNP 50K beadchip and six growth and carcass quality traits were measured for the steers. A series of lack-of-fit tests between the models was applied to classify gene expression pattern as additive or dominant. Results A total of 18 (0, 15 (3, 12 (8, 15 (18, 11 (7, and 21 (1 SNPs were detected at the 5% chromosome (genome - wise level for weaning weight (WWT, yearling weight (YWT, carcass weight (CWT, backfat thickness (BFT, longissimus dorsi muscle area (LMA and marbling score, respectively. Among the significant 129 SNPs, 56 SNPs had additive effects, 20 SNPs dominance effects, and 53 SNPs both additive and dominance effects, suggesting that dominance inheritance mode be considered in genetic improvement for growth and carcass quality in Hanwoo. The significant SNPs were located at 33 quantitative trait locus (QTL regions on 18 Bos Taurus chromosomes (i.e. BTA 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 16, 17, 18, 20, 23, 26, 28, and 29 were detected. There is strong evidence that BTA14 is the key chromosome affecting CWT. Also, BTA20 is the key chromosome for almost all traits measured (WWT, YWT, LMA. Conclusion The application of various additive and dominance SNP models enabled better characterization of SNP inheritance mode for growth and carcass quality traits in Hanwoo, and many of the detected SNPs or QTL had dominance effects, suggesting that dominance be considered for the whole-genome SNPs data and implementation of successive molecular breeding schemes in Hanwoo.

  6. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  7. Studies on the influences of. gamma. -ray irradiation upon food additives, (7). Radiolysis of 5'-nucleotides due to. gamma. -ray irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Hamada, M [Shimonoseki Univ. of Fisheries, Yamaguchi (Japan); Gohya, Y; Ishio, S

    1981-08-01

    The effect of ..gamma..-ray irradiation on inosine-5'-monophosphate (5'-IMP) and guanosine-5'-monophosphate (5'-GMP) in aqueous solution and in ''kamaboko'' was investigated to evaluate the rate of decomposition and to elucidate the safety of the decomposed products, under the concentration of 0.025% and irradiation dose of 3.00 x 10/sup 5/ rad. Ribose-phosphate compound, inorganic phosphate and 2'-, 3'-nucleotides were ascertained when either 5'-IMP or 5'-GMP aqueous solution was irradiated. G value of 5'-IMP and 5'-GMP in aqueous solution were estimated to be 1.29 and 0.97, respectively. The radiolysis of both 5'-IMP and 5'-GMP in ''kamaboko'' was hardly proceeded.

  8. Single Nucleotide Polymorphisms in Regulator-Encoding Genes Have an Additive Effect on Virulence Gene Expression in a Vibrio cholerae Clinical Isolate.

    Science.gov (United States)

    Carignan, Bailey M; Brumfield, Kyle D; Son, Mike S

    2016-01-01

    Vibrio cholerae is the etiological agent of the infectious disease cholera, which is characterized by vomiting and severe watery diarrhea. Recently, V. cholerae clinical isolates have demonstrated increased virulence capabilities, causing more severe symptoms with a much higher rate of disease progression than previously observed. We have identified single nucleotide polymorphisms (SNPs) in four virulence-regulatory genes (hapR, hns, luxO, and vieA) of a hypervirulent V. cholerae clinical isolate, MQ1795. Herein, all SNPs and SNP combinations of interest were introduced into the prototypical El Tor reference strain N16961, and the effects on the production of numerous virulence-related factors, including cholera toxin (CT), the toxin-coregulated pilus (TCP), and ToxT, were analyzed. Our data show that triple-SNP (hapR hns luxO and hns luxO vieA) and quadruple-SNP combinations produced the greatest increases in CT, TCP, and ToxT production. The hns and hns luxO SNP combinations were sufficient for increased TCP and ToxT production. Notably, the hns luxO vieA triple-SNP combination strain produced TCP and ToxT levels similar to those of MQ1795. Certain SNP combinations (hapR and hapR vieA) had the opposite effect on CT, TCP, and ToxT expression. Interestingly, the hns vieA double-SNP combination strain increased TCP production while decreasing CT production. Our findings suggest that SNPs identified in the four regulatory genes, in various combinations, are associated with increased virulence capabilities observed in V. cholerae clinical isolates. These studies provide insight into the evolution of highly virulent strains. IMPORTANCE Cholera, an infectious disease of the small intestine caused by the aquatic bacterium Vibrio cholerae, often results in vomiting and acute watery diarrhea. If left untreated or if the response is too slow, the symptoms can quickly lead to extreme dehydration and ultimately death of the patient. Recent anecdotal evidence of cholera

  9. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  10. PNA binding to the non-template DNA strand interferes with transcription, suggesting a blockage mechanism mediated by R-loop formation.

    Science.gov (United States)

    Belotserkovskii, Boris P; Hanawalt, Philip C

    2015-11-01

    Peptide Nucleic Acids (PNAs) are artificial DNA mimics with superior nucleic acid binding capabilities. T7 RNA polymerase (T7 RNAP) transcription upon encountering PNA bound to the non-template DNA strand was studied in vitro. A characteristic pattern of blockage signals was observed, extending downstream from the PNA binding site, similar to that produced by G-rich homopurine-homopyrimidine (hPu-hPy) sequences and likely caused by R-loop formation. Since blocked transcription complexes in association with stable R-loops may interfere with replication and in some cases trigger apoptosis, targeted R-loop formation might be employed to inactivate selected cells, such as those in tumors, based upon their unique complement of expressed genes. © 2014 The Authors. Molecular Carcinogenesis published by Wiley Periodicals, Inc.

  11. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  12. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  13. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

    2016-01-01

    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  14. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  15. Antinociceptive effect of purine nucleotides.

    Science.gov (United States)

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  16. The possible role of human milk nucleotides as sleep inducers.

    Science.gov (United States)

    Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

    2009-02-01

    Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

  17. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  18. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  19. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

    Science.gov (United States)

    E, Chao; Duan, Baogen; Yu, Jin

    2017-04-20

    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  20. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...

  1. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  2. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  3. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  4. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  5. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  6. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  7. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

    Science.gov (United States)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

  8. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

    Science.gov (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

    2012-01-01

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  9. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

    Science.gov (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

    2012-02-03

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  10. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

    Science.gov (United States)

    Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

    1978-01-01

    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

  11. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  12. Bacterial nucleotide-based second messengers.

    Science.gov (United States)

    Pesavento, Christina; Hengge, Regine

    2009-04-01

    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  13. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  14. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  15. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  16. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  17. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  18. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  19. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

    2013-01-01

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

  20. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  1. Additive manufacturing.

    Science.gov (United States)

    Mumith, A; Thomas, M; Shah, Z; Coathup, M; Blunn, G

    2018-04-01

    Increasing innovation in rapid prototyping (RP) and additive manufacturing (AM), also known as 3D printing, is bringing about major changes in translational surgical research. This review describes the current position in the use of additive manufacturing in orthopaedic surgery. Cite this article: Bone Joint J 2018;100-B:455-60.

  2. Food additives

    Science.gov (United States)

    ... GO About MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Food additives URL of this page: //medlineplus.gov/ency/article/ ...

  3. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    cells recover. Despite the importance of this process, the broader impact of bacterial nucleotides on the functioning of eukaryotic cells remains poorly defined. To address this, we genetically modified cells of the eukaryote Saccharomyces cerevisiae (baker's yeast) to produce three of these molecules (cdiAMP, cdiGMP, and ppGpp) and used the engineered strains as model systems to characterize the effects of the molecules on the cells. In addition to demonstrating that the nucleotides are each capable of adversely affecting yeast cell function and growth, we also identified the cellular functions important for mitigating the damage caused, suggesting possible modes of action. This study expands our understanding of the molecular interactions that can take place between bacterial and eukaryotic cells. Copyright © 2017 Hesketh et al.

  4. Factor 11 single-nucleotide variants in women with heavy menstrual bleeding

    NARCIS (Netherlands)

    Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene

    2017-01-01

    In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical

  5. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  6. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

    2015-01-01

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  7. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  8. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  9. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  10. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  11. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  12. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    International Nuclear Information System (INIS)

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.

    1988-01-01

    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity [ 3 H]fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity [ 3 H]fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils

  13. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  15. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  16. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  17. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  18. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  19. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  20. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    International Nuclear Information System (INIS)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp

  1. Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

    International Nuclear Information System (INIS)

    Aalto, T.K.; Raivio, K.O.

    1990-01-01

    Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

  2. Ras conformational switching: simulating nucleotide-dependent conformational transitions with accelerated molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Barry J Grant

    2009-03-01

    Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.

  3. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl

    2007-01-03

    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  4. Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

    Science.gov (United States)

    Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

    2013-11-01

    Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

  5. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    Science.gov (United States)

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  6. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  7. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  8. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  9. Implication of SUMO E3 ligases in nucleotide excision repair.

    Science.gov (United States)

    Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji

    2015-08-01

    Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.

  10. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze; Gehring, Christoph A

    2013-01-01

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

  11. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  12. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  13. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  14. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Science.gov (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

    2011-07-01

    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  16. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  17. Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

    Science.gov (United States)

    Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

    2018-05-01

    Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  19. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  20. Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

    Directory of Open Access Journals (Sweden)

    Suravajhala P

    2017-06-01

    Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

  1. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Science.gov (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  2. Roles of phosphorylation and nucleotide binding domains in calcium transport by sarcoplasmic reticulum adenosinetriphosphatase

    International Nuclear Information System (INIS)

    Teruel, J.A.; Inesi, G.

    1988-01-01

    The roles of the phosphorylation (phosphorylated enzyme intermediate) and nucleotide binding domains in calcium transport were studied by comparing acetyl phosphate and ATP as substrates for the Ca 2+ -ATPase of sarcoplasmic reticulum vesicles. The authors found that the maximal level of phosphoenzyme obtained with either substrate is approximately 4 nmol/mg of protein, corresponding to the stoichiometry of catalytic sites in their preparation. The initial burst of phosphoenzyme formation observed in the transient state, following addition of either substrate, is accompanied by internalization of 2 mol of calcium per mole of phosphoenzyme. The internalized calcium is then translocated with a sequential pattern, independent of the substrate used. Following a rate-limiting step, the phosphoenzyme undergoes hydrolytic cleavage and proceeds to the steady-state activity which is soon back inhibited by the rise of Ca 2+ concentration in the lumen of the vesicles. When the back inhibition is released by the addition of oxalate, substrate utilization and calcium transport occur with a ratio of 1:2, independent of the substrate and its concentration. When the nucleotide binding site is derivatized with FITP, the enzyme can still utilize acetyl phosphate (but not ATP) for calcium transport. These observations demonstrate that the basic coupling mechanism of catalysis and calcium transport involves the phosphorylation and calcium binding domains, and not the nucleotide binding domain. On the other hand, occupancy of the FITC-sensitive nucleotide site is involved in kinetic regulation not only with respect to utilization of substrate for the phosphoryl transfer reaction but also for subsequent steps related to calcium translocation and phosphoenzyme turnover

  3. Deregulation of ocular nucleotide homeostasis in patients with diabetic retinopathy.

    Science.gov (United States)

    Loukovaara, Sirpa; Sandholm, Jouko; Aalto, Kristiina; Liukkonen, Janne; Jalkanen, Sirpa; Yegutkin, Gennady G

    2017-02-01

    Clear signaling roles for ATP and adenosine have been established in all tissues, including the eye. The magnitude of signaling responses is governed by networks of enzymes; however, little is known about the regulatory mechanisms of purinergic signaling in the eye. By employing thin-layer chromatographic assays with 3 H-labeled substrates, this study aimed to evaluate the role of nucleotide homeostasis in the pathogenesis of vitreoretinal diseases in humans. We have identified soluble enzymes ecto-5'-nucleotidase/CD73, adenylate kinase-1, and nucleoside diphosphate kinase in the vitreous fluid that control active cycling between pro-inflammatory ATP and anti-inflammatory adenosine. Strikingly, patients with proliferative form of diabetic retinopathy (DR) had higher adenylate kinase activity and ATP concentration, when compared to non-proliferative DR eyes and non-diabetic controls operated for rhegmatogenous retinal detachment, macular hole, and pucker. The non-parametric correlation analysis revealed positive correlations between intravitreal adenylate kinase and concentrations of ATP, ADP, and other angiogenic (angiopoietins-1 and -2), profibrotic (transforming growth factor-β1), and proteolytic (matrix metalloproteinase-9) factors but not erythropoietin and VEGF. Immunohistochemical staining of postmortem human retina additionally revealed selective expression of ecto-5'-nucleotidase/CD73 on the rod-and-cone-containing photoreceptor cells. Collectively, these findings provide novel insights into the regulatory mechanisms that influence purinergic signaling in diseased eye and open up new possibilities in the development of enzyme-targeted therapeutic approaches for prevention and treatment of DR. Ecto-5'-nucleotidase/CD73 and adenylate kinase-1 circulate in human vitreous fluid. Adenylate kinase activity is high in diabetic eyes with proliferative retinopathy. Diabetic eyes display higher intravitreal ATP/ADP ratio than non-diabetic controls. Soluble adenylate

  4. Junctional transfer in cultured vascular endothelium: II. Dye and nucleotide transfer

    International Nuclear Information System (INIS)

    Larson, D.M.; Sheridan, J.D.

    1985-01-01

    Vascular endothelial cultures, derived from large vessels, retain many of the characteristics of their in vivo counterparts. However, the observed reduction in size and complexity of intercellular gap and tight junctions in these cultured cells suggests that important functions, thought to be mediated by these structures, may be altered in vitro. In continuing studies on intercellular communication in vessel wall cells, the authors have quantitated the extent of junctional transfer of small molecular tracers (the fluorescent dye Lucifer Yellow CH and tritiated uridine nucleotides) in confluent cultures of calf aortic (BAEC) and umbilical vein (BVEC) endothelium. Both BAEC and BVEC show extensive (and quantitatively equivalent) dye and nucleotide transfer. As an analogue of intimal endothelium, the authors have also tested dye transfer in freshly isolated sheets of endothelium. Transfer in BAEC and BVEC sheets was more rapid, extensive and homogeneous than in the cultured cells, implying a reduction in molecular coupling as endothelium adapts to culture conditions. In addition, they have documented heterocellular nucleotide transfer between cultured endothelium and vascular smooth muscle cells, of particular interest considering the prevalence of ''myo-endothelial'' junctions in vivo. These data yield further information on junctional transfer in cultured vascular endothelium and have broad implications for the functional integration of the vessel wall in the physiology and pathophysiology of the vasculature

  5. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    Science.gov (United States)

    Chen, Sherry Xi; Seelig, Georg

    2016-04-20

    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  6. The nucleotide-binding domain of NLRC5 is critical for nuclear import and transactivation activity

    International Nuclear Information System (INIS)

    Meissner, Torsten B.; Li, Amy; Liu, Yuen-Joyce; Gagnon, Etienne; Kobayashi, Koichi S.

    2012-01-01

    Highlights: ► NLRC5 requires an intact NLS for its function as MHC class I transactivator. ► Nuclear presence of NLRC5 is required for MHC class I induction. ► Nucleotide-binding controls nuclear import and transactivation activity of NLRC5. -- Abstract: Major histocompatibility complex (MHC) class I and class II are crucial for the function of the human adaptive immune system. A member of the NLR (nucleotide-binding domain, leucine-rich repeat) protein family, NLRC5, has recently been identified as a transcriptional regulator of MHC class I and related genes. While a ‘master regulator’ of MHC class II genes, CIITA, has long been known, NLRC5 specifically associates with and transactivates the proximal promoters of MHC class I genes. In this study, we analyzed the molecular requirements of NLRC5 nuclear import and transactivation activity. We show that NLRC5-mediated MHC class I gene induction requires an intact nuclear localization signal and nuclear distribution of NLRC5. In addition, we find that the nucleotide-binding domain (NBD) of NLRC5 is critical not only for nuclear translocation but also for the transactivation of MHC class I genes. Changing the cellular localization of NLRC5 is likely to immediately impact MHC class I expression as well as MHC class I-mediated antigen presentation. NLRC5 may thus provide a promising target for the modulation of MHC class I antigen presentation, especially in the setting of transplant medicine.

  7. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  8. Assembling a dual purpose TaqMan-based panel of single-nucleotide polymorphism markers in rainbow trout and steelhead (Oncorhynchus mykiss) for association mapping and population genetics analysis

    DEFF Research Database (Denmark)

    Hansen, Mette H H; Young, Sewall; Jørgensen, Hanne Birgitte Hede

    2011-01-01

    We establish a TaqMan-based assay panel for genotyping single-nucleotide polymorphisms in rainbow trout and steelhead (Oncorhynchus mykiss). We develop 22 novel single-nucleotide polymorphism markers based on new steelhead sequence data and on assays from sister taxa. Additionally, we adapt 154 p...

  9. A single nucleotide change affects fur-dependent regulation of sodB in H. pylori.

    Directory of Open Access Journals (Sweden)

    Beth M Carpenter

    Full Text Available Helicobacter pylori is a significant human pathogen that has adapted to survive the many stresses found within the gastric environment. Superoxide Dismutase (SodB is an important factor that helps H. pylori combat oxidative stress. sodB was previously shown to be repressed by the Ferric Uptake Regulator (Fur in the absence of iron (apo-Fur regulation [1]. Herein, we show that apo regulation is not fully conserved among all strains of H. pylori. apo-Fur dependent changes in sodB expression are not observed under iron deplete conditions in H. pylori strains G27, HPAG1, or J99. However, Fur regulation of pfr and amiE occurs as expected. Comparative analysis of the Fur coding sequence between G27 and 26695 revealed a single amino acid difference, which was not responsible for the altered sodB regulation. Comparison of the sodB promoters from G27 and 26695 also revealed a single nucleotide difference within the predicted Fur binding site. Alteration of this nucleotide in G27 to that of 26695 restored apo-Fur dependent sodB regulation, indicating that a single base difference is at least partially responsible for the difference in sodB regulation observed among these H. pylori strains. Fur binding studies revealed that alteration of this single nucleotide in G27 increased the affinity of Fur for the sodB promoter. Additionally, the single base change in G27 enabled the sodB promoter to bind to apo-Fur with affinities similar to the 26695 sodB promoter. Taken together these data indicate that this nucleotide residue is important for direct apo-Fur binding to the sodB promoter.

  10. Biosynthesis of a hypermodified nucleotide in Saccharomyces carlsbergensis 17S and HeLa-cell 18S ribosomal ribonucleic acid.

    Science.gov (United States)

    Brand, R C; Klootwijk, J; Planta, R J; Maden, B E

    1978-01-01

    The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.

  11. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  12. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  13. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  14. Involvement of cyclic nucleotides in locust flight muscle metabolism

    NARCIS (Netherlands)

    Worm, R.A.A.

    1980-01-01

    1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in

  15. Analysis of single nucleotide polymorphisms in case-control studies.

    Science.gov (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  16. Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy

    NARCIS (Netherlands)

    Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan

    1997-01-01

    The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the

  17. Nucleotide excision repair II: From yeast to mammals

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

  18. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  19. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  20. DNA Nucleotides Detection via capacitance properties of Graphene

    Science.gov (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  1. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  2. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  3. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  4. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  5. Candidate gene analysis using imputed genotypes: cell cycle single-nucleotide polymorphisms and ovarian cancer risk

    DEFF Research Database (Denmark)

    Goode, Ellen L; Fridley, Brooke L; Vierkant, Robert A

    2009-01-01

    Polymorphisms in genes critical to cell cycle control are outstanding candidates for association with ovarian cancer risk; numerous genes have been interrogated by multiple research groups using differing tagging single-nucleotide polymorphism (SNP) sets. To maximize information gleaned from......, and rs3212891; CDK2 rs2069391, rs2069414, and rs17528736; and CCNE1 rs3218036. These results exemplify the utility of imputation in candidate gene studies and lend evidence to a role of cell cycle genes in ovarian cancer etiology, suggest a reduced set of SNPs to target in additional cases and controls....

  6. Reinvestigations of six unusual paternity cases by typing of autosomal single-nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Børsting, Claus; Morling, Niels

    2012-01-01

    and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. RESULTS: Three cases were solved by the SNP investigation without the need for any additional testing....... In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. CONCLUSION...

  7. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

    2015-09-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

  8. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

    2015-01-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  9. Adsorption of nucleotides onto ferromagnesian phyllosilicates: Significance for the origin of life

    Science.gov (United States)

    Pedreira-Segade, Ulysse; Feuillie, Cécile; Pelletier, Manuel; Michot, Laurent J.; Daniel, Isabelle

    2016-03-01

    saturation of lateral surfaces. Below pH 4, swelling clays also adsorb nucleotides through cation exchange on basal surfaces, whereas non-swelling phyllosilicates do not. However, at high surface loadings an additional mechanism stabilizing adsorption occurs. Given the proposed adsorption mechanisms, the possibility of a favorable polymerization at the mineral-water interface is discussed. We propose that Fe-Mg rich phyllosilicates tightly bind nucleotides, under ambient conditions, and concentrate them up to 1000 times the solution concentration upon saturation. Nontronites have the most diverse and favorable adsorption behaviors and could have helped to the concentration and polymerization of nucleotides under primitive Earth-like conditions.

  10. Different effects of guanine nucleotides (GDP and GTP) on protein-mediated mitochondrial proton leak.

    Science.gov (United States)

    Woyda-Ploszczyca, Andrzej M; Jarmuszkiewicz, Wieslawa

    2014-01-01

    In this study, we compared the influence of GDP and GTP on isolated mitochondria respiring under conditions favoring oxidative phosphorylation (OXPHOS) and under conditions excluding this process, i.e., in the presence of carboxyatractyloside, an adenine nucleotide translocase inhibitor, and/or oligomycin, an FOF1-ATP synthase inhibitor. Using mitochondria isolated from rat kidney and human endothelial cells, we found that the action of GDP and GTP can differ diametrically depending on the conditions. Namely, under conditions favoring OXPHOS, both in the absence and presence of linoleic acid, an activator of uncoupling proteins (UCPs), the addition of 1 mM GDP resulted in the state 4 (non-phosphorylating respiration)-state 3 (phosphorylating respiration) transition, which is characteristic of ADP oxidative phosphorylation. In contrast, the addition of 1 mM GTP resulted in a decrease in the respiratory rate and an increase in the membrane potential, which is characteristic of UCP inhibition. The stimulatory effect of GDP, but not GTP, was also observed in inside-out submitochondrial particles prepared from rat kidney mitochondria. However, the effects of GDP and GTP were more similar in the presence of OXPHOS inhibitors. The importance of these observations in connection with the action of UCPs, adenine nucleotide translocase (or other carboxyatractyloside-sensitive carriers), carboxyatractyloside- and purine nucleotide-insensitive carriers, as well as nucleoside-diphosphate kinase (NDPK) are considered. Because the measurements favoring oxidative phosphorylation better reflect in vivo conditions, our study strongly supports the idea that GDP cannot be considered a significant physiological inhibitor of UCP. Moreover, it appears that, under native conditions, GTP functions as a more efficient UCP inhibitor than GDP and ATP.

  11. Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

    Science.gov (United States)

    Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

    2016-01-01

    Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

  12. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal

    1983-01-01

    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  13. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  14. Evolutionary and Structural Perspectives of Plant Cyclic Nucleotide Gated Cation Channels

    Directory of Open Access Journals (Sweden)

    Alice Kira Zelman

    2012-05-01

    Full Text Available Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs. CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide binding domain (CNBD and a calmodulin binding domain (CaMBD as well as a 6 transmembrane/1 pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments.

  15. Anion-exchange analysis of isotopically labelled nucleotides, nucleosides, and bases in metabolic disorders

    International Nuclear Information System (INIS)

    Nissinen, E.A.O.

    1987-01-01

    This paper on the importance of cellular purines and pyrimidines is evidenced by the multitude of diseases, such as hyperuricemia, orotic aciduria, gout, Lesch-Nyhan syndrome, immunodeficiencies with B- and T-cell dysfunctions, etc. which result from aberrant metabolism. In addition, the use of purine and pyrimidine analogs in chemotherapy is of growing interest. Purine metabolism consists of a complex network of biochemical pathway. These pathways are under complicated feedback regulation and there also exists a close relationship between purine and pyrimidine metabolism. In addition, these pathways interact with those of the carbohydrate, amino acid, and energy metabolism. Since metabolic pathways are closely interrelated, a change in the concentration of a particular metabolite may lead to many changes in the overall metabolic profiles. For instance, in the area of nucleotide metabolism, the inhibition of IMP dehydrogenase by mycophenolic acid leads to various changes in both purine and pyrimidine nucleotide pools. Inhibition of de nova purine biosynthesis by methotrexate leads to many changes in purine and pyrimidine ribonucleotides and deoxyribonucleotides. Thus, the simultaneous measurement of all cellular purine and pyrimidine metabolites from individuals whose metabolism is altered, either by a metabolic disease or by the action of drugs, may further our understanding of cellular metabolism

  16. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.

    2012-05-29

    Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs). CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a calmodulin binding domain as well as a six transmembrane/one pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments. 2012 Zelman, Dawe, Gehring and Berkowitz.

  17. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  18. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  19. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  20. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  1. Single nucleotide polymorphisms as susceptibility, prognostic, and therapeutic markers of nonsmall cell lung cancer

    Directory of Open Access Journals (Sweden)

    Zienolddiny S

    2011-12-01

    Full Text Available Shanbeh Zienolddiny, Vidar SkaugSection for Toxicology and Biological Work Environment, National Institute of Occupational Health, Oslo, NorwayAbstract: Lung cancer is a major public health problem throughout the world. Among the most frequent cancer types (prostate, breast, colorectal, stomach, lung, lung cancer is the leading cause of cancer-related deaths worldwide. Among the two major subtypes of small cell lung cancer and nonsmall cell lung cancer (NSCLC, 85% of tumors belong to the NSCLC histological types. Small cell lung cancer is associated with the shortest survival time. Although tobacco smoking has been recognized as the major risk factor for lung cancer, there is a great interindividual and interethnic difference in risk of developing lung cancer given exposure to similar environmental and lifestyle factors. This may indicate that in addition to chemical and environmental factors, genetic variations in the genome may contribute to risk modification. A common type of genetic variation in the genome, known as single nucleotide polymorphism, has been found to be associated with susceptibility to lung cancer. Interestingly, many of these polymorphisms are found in the genes that regulate major pathways of carcinogen metabolism (cytochrome P450 genes, detoxification (glutathione S-transferases, adduct removal (DNA repair genes, cell growth/apoptosis (TP53/MDM2, the immune system (cytokines/chemokines, and membrane receptors (nicotinic acetylcholine and dopaminergic receptors. Some of these polymorphisms have been shown to alter the level of mRNA, and protein structure and function. In addition to being susceptibility markers, several of these polymorphisms are emerging to be important for response to chemotherapy/radiotherapy and survival of patients. Therefore, it is hypothesized that single nucleotide polymorphisms will be valuable genetic markers in individual-based prognosis and therapy in future. Here we will review some of the most

  2. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  4. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John

    2004-04-01

    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  5. Inhibitory effect of extracellular purine nucleotide and nucleoside concentrations on T cell proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Weiler, Monica [Department of Medicine III and Transfusion Medicine, University Hospital Grosshadern, Ludwig-Maximilians-University, Munich (Germany); Schmetzer, Helga [Helmholtz Center Munich (Germany); German Research Center for Environmental Health, Munich (Germany); Braeu, Marion; Buhmann, Raymund [Helmholtz Center Munich (Germany); German Research Center for Environmental Health, Munich (Germany); Department of Medicine III and Transfusion Medicine, University Hospital Grosshadern, Ludwig-Maximilians-University, Munich (Germany)

    2016-11-15

    The release of nucleic acids and derivatives after tissue-injury may affect cellular immune-response. We studied the impact of extracellular ribo-, desoxyribonucleotides and nucleosides on T-cell immunity. Peripheral-blood-mononuclear-cells (PBMCs) or isolated CD3{sup +}T-cells obtained from 6 healthy donors were stimulated via CD3/CD28 Dynabeads or dendritic cells (DCs) in the presence or absence of pyrimidine-, purine-nucleotides and -nucleosides (range 2–200 µM). Addition of deoxy-, guanosine-triphosphate (dGTP, GTP) and guanosine resulted concentration dependent in a complete, adenosine-triphosphate (ATP) in a partial inhibition of the induced T-cell-proliferation. Deoxyadenosine-triphosphate (dATP), adenosine and the pyrimidine-ribo- and -deoxyribonucleotides displayed no inhibitory capacity. Inhibitory effects of dGTP and GTP, but not of guanosine and ATP were culture-media-dependent and could be almost abrogated by use of the serum-free lymphocyte-culture-media X-Vivo15 instead of RPMI1640 with standard-supplementation. In contrast to RPMI1640, X-Vivo15 resulted in a significant down-regulation of the cell-surface-located ectonucleotidases CD39 (Ecto-Apyrase) and CD73 (Ecto-5′-Nucleotidase), critical for the extracellular nucleotides-hydrolysis to nucleosides, explaining the loss of inhibition mediated by dGTP and GTP, but not Guanosine. In line with previous findings ATP was found to exert immunosuppressive effects on T-cell-proliferation. Purine-nucleotides, dGTP and GTP displayed a higher inhibitory capacity, but seem to be strictly dependent on the microenvironmental conditions modulating the responsiveness of the respective T-lymphocytes. Further evaluation of experimental and respective clinical settings should anticipate these findings.

  6. Inhibitory effect of extracellular purine nucleotide and nucleoside concentrations on T cell proliferation

    International Nuclear Information System (INIS)

    Weiler, Monica; Schmetzer, Helga; Braeu, Marion; Buhmann, Raymund

    2016-01-01

    The release of nucleic acids and derivatives after tissue-injury may affect cellular immune-response. We studied the impact of extracellular ribo-, desoxyribonucleotides and nucleosides on T-cell immunity. Peripheral-blood-mononuclear-cells (PBMCs) or isolated CD3 + T-cells obtained from 6 healthy donors were stimulated via CD3/CD28 Dynabeads or dendritic cells (DCs) in the presence or absence of pyrimidine-, purine-nucleotides and -nucleosides (range 2–200 µM). Addition of deoxy-, guanosine-triphosphate (dGTP, GTP) and guanosine resulted concentration dependent in a complete, adenosine-triphosphate (ATP) in a partial inhibition of the induced T-cell-proliferation. Deoxyadenosine-triphosphate (dATP), adenosine and the pyrimidine-ribo- and -deoxyribonucleotides displayed no inhibitory capacity. Inhibitory effects of dGTP and GTP, but not of guanosine and ATP were culture-media-dependent and could be almost abrogated by use of the serum-free lymphocyte-culture-media X-Vivo15 instead of RPMI1640 with standard-supplementation. In contrast to RPMI1640, X-Vivo15 resulted in a significant down-regulation of the cell-surface-located ectonucleotidases CD39 (Ecto-Apyrase) and CD73 (Ecto-5′-Nucleotidase), critical for the extracellular nucleotides-hydrolysis to nucleosides, explaining the loss of inhibition mediated by dGTP and GTP, but not Guanosine. In line with previous findings ATP was found to exert immunosuppressive effects on T-cell-proliferation. Purine-nucleotides, dGTP and GTP displayed a higher inhibitory capacity, but seem to be strictly dependent on the microenvironmental conditions modulating the responsiveness of the respective T-lymphocytes. Further evaluation of experimental and respective clinical settings should anticipate these findings.

  7. Nucleotide Excision DNA Repair is Associated with Age-Related Vascular Dysfunction

    Science.gov (United States)

    Durik, Matej; Kavousi, Maryam; van der Pluijm, Ingrid; Isaacs, Aaron; Cheng, Caroline; Verdonk, Koen; Loot, Annemarieke E.; Oeseburg, Hisko; Musterd-Bhaggoe, Usha; Leijten, Frank; van Veghel, Richard; de Vries, Rene; Rudez, Goran; Brandt, Renata; Ridwan, Yanto R.; van Deel, Elza D.; de Boer, Martine; Tempel, Dennie; Fleming, Ingrid; Mitchell, Gary F.; Verwoert, Germaine C.; Tarasov, Kirill V.; Uitterlinden, Andre G.; Hofman, Albert; Duckers, Henricus J.; van Duijn, Cornelia M.; Oostra, Ben A.; Witteman, Jacqueline C.M.; Duncker, Dirk J.; Danser, A.H. Jan; Hoeijmakers, Jan H.; Roks, Anton J.M.

    2012-01-01

    Background Vascular dysfunction in atherosclerosis and diabetes, as observed in the aging population of developed societies, is associated with vascular DNA damage and cell senescence. We hypothesized that cumulative DNA damage during aging contributes to vascular dysfunction. Methods and Results In mice with genomic instability due to the defective nucleotide excision repair genes ERCC1 and XPD (Ercc1d/− and XpdTTD mice), we explored age-dependent vascular function as compared to wild-type mice. Ercc1d/− mice showed increased vascular cell senescence, accelerated development of vasodilator dysfunction, increased vascular stiffness and elevated blood pressure at very young age. The vasodilator dysfunction was due to decreased endothelial eNOS levels as well as impaired smooth muscle cell function, which involved phosphodiesterase (PDE) activity. Similar to Ercc1d/− mice, age-related endothelium-dependent vasodilator dysfunction in XpdTTD animals was increased. To investigate the implications for human vascular disease, we explored associations between single nucleotide polymorphisms (SNPs) of selected nucleotide excision repair genes and arterial stiffness within the AortaGen Consortium, and found a significant association of a SNP (rs2029298) in the putative promoter region of DDB2 gene with carotid-femoral pulse wave velocity. Conclusions Mice with genomic instability recapitulate age-dependent vascular dysfunction as observed in animal models and in humans, but with an accelerated progression, as compared to wild type mice. In addition, we found associations between variations in human DNA repair genes and markers for vascular stiffness which is associated with aging. Our study supports the concept that genomic instability contributes importantly to the development of cardiovascular disease. PMID:22705887

  8. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Valerio Costa

    2016-06-01

    Full Text Available Type 2 diabetes (T2D is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9 or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG. However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP, currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing.

  9. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  10. Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

    International Nuclear Information System (INIS)

    Vetter, I.R.; Reinstein, J.; Roesch, P.

    1990-01-01

    One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

  11. AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

    DEFF Research Database (Denmark)

    Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg

    2009-01-01

    is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

  12. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  13. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Tools and drugs for uracil nucleotide-activated P2Y receptors.

    Science.gov (United States)

    Rafehi, Muhammad; Müller, Christa E

    2018-04-13

    P2Y receptors (P2YRs) are a family of G protein-coupled receptors activated by extracellular nucleotides. Physiological P2YR agonists include purine and pyrimidine nucleoside di- and triphosphates, such as ATP, ADP, UTP, UDP, nucleotide sugars, and dinucleotides. Eight subtypes exist, P2Y 1 , P2Y 2 , P2Y 4 , P2Y 6 , P2Y 11 , P2Y 12 , P2Y 13 , and P2Y 14 , which represent current or potential future drug targets. Here we provide a comprehensive overview of ligands for the subgroup of the P2YR family that is activated by uracil nucleotides: P2Y 2 (UTP, also ATP and dinucleotides), P2Y 4 (UTP), P2Y 6 (UDP), and P2Y 14 (UDP, UDP-glucose, UDP-galactose). The physiological agonists are metabolically unstable due to their fast hydrolysis by ectonucleotidases. A number of agonists with increased potency, subtype-selectivity and/or enzymatic stability have been developed in recent years. Useful P2Y 2 R agonists include MRS2698 (6-01, highly selective) and PSB-1114 (6-05, increased metabolic stability). A potent and selective P2Y 2 R antagonist is AR-C118925 (10-01). For studies of the P2Y 4 R, MRS4062 (3-15) may be used as a selective agonist, while PSB-16133 (10-06) represents a selective antagonist. Several potent P2Y 6 R agonists have been developed including 5-methoxyuridine 5'-O-((R p )α-boranodiphosphate) (6-12), PSB-0474 (3-11), and MRS2693 (3-26). The isocyanate MRS2578 (10-08) is used as a selective P2Y 6 R antagonist, although its reactivity and low water-solubility are limiting. With MRS2905 (6-08), a potent and metabolically stable P2Y 14 R agonist is available, while PPTN (10-14) represents a potent and selective P2Y 14 R antagonist. The radioligand [ 3 H]UDP can be used to label P2Y 14 Rs. In addition, several fluorescent probes have been developed. Uracil nucleotide-activated P2YRs show great potential as drug targets, especially in inflammation, cancer, cardiovascular and neurodegenerative diseases. Copyright © 2018. Published by Elsevier Inc.

  15. NU-IN: Nucleotide evolution and input module for the EvolSimulator genome simulation platform

    Directory of Open Access Journals (Sweden)

    Barker Michael S

    2010-08-01

    Full Text Available Abstract Background There is increasing demand to test hypotheses that contrast the evolution of genes and gene families among genomes, using simulations that work across these levels of organization. The EvolSimulator program was developed recently to provide a highly flexible platform for forward simulations of amino acid evolution in multiple related lineages of haploid genomes, permitting copy number variation and lateral gene transfer. Synonymous nucleotide evolution is not currently supported, however, and would be highly advantageous for comparisons to full genome, transcriptome, and single nucleotide polymorphism (SNP datasets. In addition, EvolSimulator creates new genomes for each simulation, and does not allow the input of user-specified sequences and gene family information, limiting the incorporation of further biological realism and/or user manipulations of the data. Findings We present modified C++ source code for the EvolSimulator platform, which we provide as the extension module NU-IN. With NU-IN, synonymous and non-synonymous nucleotide evolution is fully implemented, and the user has the ability to use real or previously-simulated sequence data to initiate a simulation of one or more lineages. Gene family membership can be optionally specified, as well as gene retention probabilities that model biased gene retention. We provide PERL scripts to assist the user in deriving this information from previous simulations. We demonstrate the features of NU-IN by simulating genome duplication (polyploidy in the presence of ongoing copy number variation in an evolving lineage. This example is initiated with real genomic data, and produces output that we analyse directly with existing bioinformatic pipelines. Conclusions The NU-IN extension module is a publicly available open source software (GNU GPLv3 license extension to EvolSimulator. With the NU-IN module, users are now able to simulate both drift and selection at the nucleotide

  16. Processing closely spaced lesions during Nucleotide Excision Repair triggers mutagenesis in E. coli

    Science.gov (United States)

    Isogawa, Asako; Fujii, Shingo

    2017-01-01

    It is generally assumed that most point mutations are fixed when damage containing template DNA undergoes replication, either right at the fork or behind the fork during gap filling. Here we provide genetic evidence for a pathway, dependent on Nucleotide Excision Repair, that induces mutations when processing closely spaced lesions. This pathway, referred to as Nucleotide Excision Repair-induced Mutagenesis (NERiM), exhibits several characteristics distinct from mutations that occur within the course of replication: i) following UV irradiation, NER-induced mutations are fixed much more rapidly (t ½ ≈ 30 min) than replication dependent mutations (t ½ ≈ 80–100 min) ii) NERiM specifically requires DNA Pol IV in addition to Pol V iii) NERiM exhibits a two-hit dose-response curve that suggests processing of closely spaced lesions. A mathematical model let us define the geometry (infer the structure) of the toxic intermediate as being formed when NER incises a lesion that resides in close proximity of another lesion in the complementary strand. This critical NER intermediate requires Pol IV / Pol II for repair, it is either lethal if left unrepaired or mutation-prone when repaired. Finally, NERiM is found to operate in stationary phase cells providing an intriguing possibility for ongoing evolution in the absence of replication. PMID:28686598

  17. Ciliate telomerase RNA loop IV nucleotides promote hierarchical RNP assembly and holoenzyme stability.

    Science.gov (United States)

    Robart, Aaron R; O'Connor, Catherine M; Collins, Kathleen

    2010-03-01

    Telomerase adds simple-sequence repeats to chromosome 3' ends to compensate for the loss of repeats with each round of genome replication. To accomplish this de novo DNA synthesis, telomerase uses a template within its integral RNA component. In addition to providing the template, the telomerase RNA subunit (TER) also harbors nontemplate motifs that contribute to the specialized telomerase catalytic cycle of reiterative repeat synthesis. Most nontemplate TER motifs function through linkage with the template, but in ciliate and vertebrate telomerases, a stem-loop motif binds telomerase reverse transcriptase (TERT) and reconstitutes full activity of the minimal recombinant TERT+TER RNP, even when physically separated from the template. Here, we resolve the functional requirements for this motif of ciliate TER in physiological RNP context using the Tetrahymena thermophila p65-TER-TERT core RNP reconstituted in vitro and the holoenzyme reconstituted in vivo. Contrary to expectation based on assays of the minimal recombinant RNP, we find that none of a panel of individual loop IV nucleotide substitutions impacts the profile of telomerase product synthesis when reconstituted as physiological core RNP or holoenzyme RNP. However, loop IV nucleotide substitutions do variably reduce assembly of TERT with the p65-TER complex in vitro and reduce the accumulation and stability of telomerase RNP in endogenous holoenzyme context. Our results point to a unifying model of a conformational activation role for this TER motif in the telomerase RNP enzyme.

  18. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    Science.gov (United States)

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. The effect of ultraviolet light on the cyclic nucleotide system of human fibroblasts

    International Nuclear Information System (INIS)

    Fertel, R.H.; Tejwani, G.A.; Albrightson, C.R.; Hart, R.W.

    1981-01-01

    The concentrations of cyclic AMP and cyclic GMP in in human skin fibroblasts in culture were determined after exposing the cells to varying fluences of UV (254 nm) light. The cyclic nucleotide concentrations of cells irradiated in the log phase of growth were unchanged relative to controls. In contrast, there was a rise in the concentration of cyclic AMP in cells irradiated after they reached confluency. The increase in concentration was observed as early as 30 min after irradiation, reached a maximum of about 200% of control at 4 to 6 h after exposure, and returned to control values by 24 h after irradiation. The effect was proportional to a UV fluence from 5 to 20 J/m 2 , and was blocked by the addition of the UV absorbing agent para-aminobenzoic acid. In contrast, the results indicated that UV light had no effect on the concentration of cyclic GMP in human fibroblast cell cultures. Because of the importance of cyclic nucleotides in the regulation of cellular function, it is reasonable to hypothesize that changes in cyclic AMP induced by UV light may effect the extranuclear functions of irradiated cells. (author)

  20. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  1. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  2. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  3. Direct demonstration of guanine nucleotide sensitive receptors for vasoactive intestinal peptide in the anterior lobe of the rat pituitary gland

    International Nuclear Information System (INIS)

    Agui, T.; Matsumoto, K.

    1990-01-01

    The vasoactive intestinal peptide (VIP) receptors were identified on the membranes from the rat anterior pituitary gland with [ 125 I]VIP. The dissociation constant (Kd) and the maximal binding capacity (Bmax) values were estimated from the competitive inhibition data. The Kd and Bmax values were 1.05 +/- 0.75 nM and 103 +/- 11 fmol/mg protein, respectively. The order of molar potency of related peptides to inhibit [ 125 I]VIP binding was VIP greater than peptide histidine isoleucine (PHI) greater than secretin greater than glucagon. Glucagon was not effective to inhibit the binding. [ 125 I]VIP binding was effectively inhibited by the addition of guanine nucleotides. The order of molar potency to inhibit the binding was Gpp(NH)p greater than GTP greater than GDP greater than GMP greater than ATP. These results directly suggest the coupling of VIP receptors with guanine nucleotide binding proteins in the anterior pituitary gland

  4. A human homolog of the yeast nucleotide excision repair gene MMS19 interacts with transcription repair factor TFIIH through the XPB and XPD helicases.

    NARCIS (Netherlands)

    T. Seroz; G.S. Winkler (Sebastiaan); J. Auriol; R.A. Verhage; W. Vermeulen (Wim); B. Smit (Bep); J. Brouwer (Jaap); A.P.M. Eker (André); G. Weeda (Geert); J-M. Egly (Jean-Marc); J.H.J. Hoeijmakers (Jan)

    2000-01-01

    textabstractNucleotide excision repair (NER) removes UV-induced photoproducts and numerous other DNA lesions in a highly conserved 'cut-and-paste' reaction that involves approximately 25 core components. In addition, several other proteins have been identified which are dispensable for NER in vitro

  5. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1988-01-01

    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

  6. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  7. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis

    2018-03-01

    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  8. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  9. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A; Turek, Ilona S.

    2017-01-01

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  10. Modification of synthesis nucleotides [γ-32P] ATP

    International Nuclear Information System (INIS)

    Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti

    2013-01-01

    In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  11. Nucleobases, nucleosides, and nucleotides: versatile biomolecules for generating functional nanomaterials.

    Science.gov (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2018-02-21

    The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.

  12. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Manganiello, V.C.

    1988-01-01

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  13. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  14. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  15. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  16. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Science.gov (United States)

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  17. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  18. Implementation of anion-receptor macrocycles in supramolecular tandem assays for enzymes involving nucleotides as substrates, products, and cofactors.

    Science.gov (United States)

    Florea, Mara; Nau, Werner M

    2010-03-07

    A supramolecular tandem assay for direct continuous monitoring of nucleotide triphosphate-dependent enzymes such as potato apyrase is described. The underlying principle of the assay relies on the use of anion-receptor macrocycles in combination with fluorescent dyes as reporter pairs. A combinatorial approach was used to identify two complementary reporter pairs, i.e. an amino-gamma-cyclodextrin with 2-anilinonaphtalene-6-sulfonate (ANS) as dye (fluorescence enhancement factor of 17 upon complexation) and a polycationic cyclophane with 8-hydroxy-1,3,6-pyrene trisulfonate (HPTS) as dye (fluorescence decrease by a factor of more than 2000), which allow the kinetic monitoring of potato apyrase activity at different ATP concentration ranges (microM and mM) with different types of photophysical responses (switch-ON and switch-OFF). Competitive fluorescence titrations revealed a differential binding of ATP (strongest competitor) versus ADP and AMP, which constitutes the prerequisite for monitoring enzymatic conversions (dephosphorylation or phosphorylation) involving nucleotides. The assay was tested for different enzyme and substrate concentrations and exploited for the screening of activating additives, namely divalent transition metal ions (Ni(2+), Mg(2+), Mn(2+), and Ca(2+)). The transferability of the assay could be demonstrated by monitoring the dephosphorylation of other nucleotide triphosphates (GTP, TTP, and CTP).

  19. Turn-on fluorescence probes based on pyranine/viologen charge-transfer complexes for the determination of nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Schäferling, Michael, E-mail: Michael.schaeferling@utu.fi; Lang, Thomas; Schnettelker, Annette

    2014-10-15

    The formation of ground state charge-transfer complexes between pyranine (8-hydroxypyrene-1,3,6-trisulfonic acid) and viologen (paraquat) derivatives is utilized for the design of novel fluoroionophores for the determination of phosphate species, particularly of nucleotides. The strong quenching of the pyranine fluorescence by viologen-type charge transfer acceptors can be countermanded if these are functionalized with triethylammonium groups that serve as recognition elements for phosphate anions. We report on the fluorogenic responses of these water-soluble molecular probes in presence of different phosphates. Absorbance measurements give additional information on the charge transfer complex formation and the interaction with nucleotides. The experimental data show that these aggregates form attractive, simple and versatile fluorescence turn-on probes for nucleoside triphosphates. The reversibility of the fluorescence response is demonstrated by means of an enzymatic model assay using ATPase for the decomposition of adenosine triphosphate. - Highlights: • Pyranine/viologen charge-transfer complexes as molecular probe for ATP recognition. • Fluorescence turn on mechanism. • Selective compared to other nucleotides and phosphate anions. • Fast and reversible response applicable to monitor enzymatic reactions.

  20. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    Przybytniak, G.

    2004-01-01

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  1. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

    Science.gov (United States)

    Berti, Lorenzo; Burley, Glenn A.

    2008-02-01

    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  2. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    ) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pheat stress trial (P

  3. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...

  4. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  5. High pressure {sup 31}P NMR spectroscopy on guanine nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)

    2017-01-15

    The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.

  6. Recovering probabilities for nucleotide trimming processes for T cell receptor TRA and TRG V-J junctions analyzed with IMGT tools

    Directory of Open Access Journals (Sweden)

    Lefranc Marie-Paule

    2008-10-01

    Full Text Available Abstract Background Nucleotides are trimmed from the ends of variable (V, diversity (D and joining (J genes during immunoglobulin (IG and T cell receptor (TR rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT® sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output". However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." Results A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA and TR gamma (TRG V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT®, the international ImMunoGeneTics information system®, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. Conclusion By

  7. Recovering probabilities for nucleotide trimming processes for T cell receptor TRA and TRG V-J junctions analyzed with IMGT tools.

    Science.gov (United States)

    Bleakley, Kevin; Lefranc, Marie-Paule; Biau, Gérard

    2008-10-02

    Nucleotides are trimmed from the ends of variable (V), diversity (D) and joining (J) genes during immunoglobulin (IG) and T cell receptor (TR) rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides) of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output"). However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA) and TR gamma (TRG) V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT, the international ImMunoGeneTics information system, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. By using trimming of rearranged TR genes as a benchmark, we

  8. Additive Manufacturing Infrared Inspection

    Science.gov (United States)

    Gaddy, Darrell; Nettles, Mindy

    2015-01-01

    The Additive Manufacturing Infrared Inspection Task started the development of a real-time dimensional inspection technique and digital quality record for the additive manufacturing process using infrared camera imaging and processing techniques. This project will benefit additive manufacturing by providing real-time inspection of internal geometry that is not currently possible and reduce the time and cost of additive manufactured parts with automated real-time dimensional inspections which deletes post-production inspections.

  9. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Science.gov (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  10. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  11. [Food additives and healthiness].

    Science.gov (United States)

    Heinonen, Marina

    2014-01-01

    Additives are used for improving food structure or preventing its spoilage, for example. Many substances used as additives are also naturally present in food. The safety of additives is evaluated according to commonly agreed principles. If high concentrations of an additive cause adverse health effects for humans, a limit of acceptable daily intake (ADI) is set for it. An additive is a risk only when ADI is exceeded. The healthiness of food is measured on the basis of nutrient density and scientifically proven effects.

  12. The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

    International Nuclear Information System (INIS)

    Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

    1977-01-01

    In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

  13. Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

    Science.gov (United States)

    Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

    2013-07-01

    Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

  14. Non-additive Effects in Genomic Selection

    Directory of Open Access Journals (Sweden)

    Luis Varona

    2018-03-01

    Full Text Available In the last decade, genomic selection has become a standard in the genetic evaluation of livestock populations. However, most procedures for the implementation of genomic selection only consider the additive effects associated with SNP (Single Nucleotide Polymorphism markers used to calculate the prediction of the breeding values of candidates for selection. Nevertheless, the availability of estimates of non-additive effects is of interest because: (i they contribute to an increase in the accuracy of the prediction of breeding values and the genetic response; (ii they allow the definition of mate allocation procedures between candidates for selection; and (iii they can be used to enhance non-additive genetic variation through the definition of appropriate crossbreeding or purebred breeding schemes. This study presents a review of methods for the incorporation of non-additive genetic effects into genomic selection procedures and their potential applications in the prediction of future performance, mate allocation, crossbreeding, and purebred selection. The work concludes with a brief outline of some ideas for future lines of that may help the standard inclusion of non-additive effects in genomic selection.

  15. One-Pot, One-Step Production of Dietary Nucleotides by Magnetic Biocatalysts

    Directory of Open Access Journals (Sweden)

    Jon del Arco

    2018-04-01

    Full Text Available The enzymatic synthesis of nucleotides offers several advantages over traditional multistep chemical methods, such as stereoselectivity, regioselectivity, enantioselectivity, simple downstream processing, and the use of mild reaction conditions. However, in order to scale up these bioprocesses, several drawbacks, such as the low enzyme stability and recycling, must be considered. Enzyme immobilization may overcome these cost-related problems by enhancing protein stability and facilitating the separation of products. In this regard, tetrameric hypoxanthine–guanine–xanthine phosphoribosyltransferase (HGXPRT from Thermus thermophilus HB8 was covalently immobilized onto glutaraldehyde-activated MagReSyn®Amine magnetic iron oxide porous microparticles (MTtHGXPRT. In this context, two different strategies were followed: (a an enzyme immobilization through its N-terminus residues at pH 8.5 (derivatives MTtHGXPRT1-3; and (b a multipoint covalent immobilization through the surface lysine residues at pH 10 (derivatives MTtHGXPRT4-5. The immobilized derivatives of MTtHGXPRT3 (activity 1581 international units per gram of support, IU/g; retained activity 29% and MTtHGXPRT5 (activity 1108 IU/g; retained activity 23% displayed the best wet biocatalyst activity, and retained activity values in the enzymatic synthesis of inosine-5′-monophosphate (IMP. In addition, the dependence of the activities and stabilities of both derivatives on pH and temperature was tested, as well as their reusability potential. Taking these results into account, MTtHGXPRT3 was chosen as the best biocatalyst (negligible loss of activity at 60 °C during 24 h; reusable up to seven cycles. Finally, as proof of concept, the enzymatic production of dietary nucleotides from high concentrations of low soluble bases was achieved.

  16. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    International Nuclear Information System (INIS)

    Fenati, Renzo A.; Connolly, Ashley R.; Ellis, Amanda V.

    2017-01-01

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  17. Targeting of nucleotide-binding proteins by HAMLET--a conserved tumor cell death mechanism.

    Science.gov (United States)

    Ho, J C S; Nadeem, A; Rydström, A; Puthia, M; Svanborg, C

    2016-02-18

    HAMLET (Human Alpha-lactalbumin Made LEthal to Tumor cells) kills tumor cells broadly suggesting that conserved survival pathways are perturbed. We now identify nucleotide-binding proteins as HAMLET binding partners, accounting for about 35% of all HAMLET targets in a protein microarray comprising 8000 human proteins. Target kinases were present in all branches of the Kinome tree, including 26 tyrosine kinases, 10 tyrosine kinase-like kinases, 13 homologs of yeast sterile kinases, 4 casein kinase 1 kinases, 15 containing PKA, PKG, PKC family kinases, 15 calcium/calmodulin-dependent protein kinase kinases and 13 kinases from CDK, MAPK, GSK3, CLK families. HAMLET acted as a broad kinase inhibitor in vitro, as defined in a screen of 347 wild-type, 93 mutant, 19 atypical and 17 lipid kinases. Inhibition of phosphorylation was also detected in extracts from HAMLET-treated lung carcinoma cells. In addition, HAMLET recognized 24 Ras family proteins and bound to Ras, RasL11B and Rap1B on the cytoplasmic face of the plasma membrane. Direct cellular interactions between HAMLET and activated Ras family members including Braf were confirmed by co-immunoprecipitation. As a consequence, oncogenic Ras and Braf activity was inhibited and HAMLET and Braf inhibitors synergistically increased tumor cell death in response to HAMLET. Unlike most small molecule kinase inhibitors, HAMLET showed selectivity for tumor cells in vitro and in vivo. The results identify nucleotide-binding proteins as HAMLET targets and suggest that dysregulation of the ATPase/kinase/GTPase machinery contributes to cell death, following the initial, selective recognition of HAMLET by tumor cells. The findings thus provide a molecular basis for the conserved tumoricidal effect of HAMLET, through dysregulation of kinases and oncogenic GTPases, to which tumor cells are addicted.

  18. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator

    Energy Technology Data Exchange (ETDEWEB)

    Fenati, Renzo A.; Connolly, Ashley R. [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Chemical and Biomolecular Engineering, The University of Melbourne, Parkville, VIC 3010 (Australia)

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.

  19. Additives in yoghurt production

    Directory of Open Access Journals (Sweden)

    Milna Tudor

    2008-02-01

    Full Text Available In yoghurt production, mainly because of sensory characteristics, different types of additives are used. Each group, and also each substance from the same group has different characteristics and properties. For that reason, for improvement of yoghurt sensory characteristics apart from addition selection, the quantity of the additive is very important. The same substance added in optimal amount improves yoghurt sensory attributes, but too small or too big addition can reduce yoghurt sensory attributes. In this paper, characteristics and properties of mostly used additives in yoghurt production are described; skimmed milk powder, whey powder, concentrated whey powder, sugars and artificial sweeteners, fruits, stabilizers, casein powder, inulin and vitamins. Also the impact of each additive on sensory and physical properties of yoghurt, syneresis and viscosity, are described, depending on used amount added in yoghurt production.

  20. Polylactides in additive biomanufacturing.

    Science.gov (United States)

    Poh, Patrina S P; Chhaya, Mohit P; Wunner, Felix M; De-Juan-Pardo, Elena M; Schilling, Arndt F; Schantz, Jan-Thorsten; van Griensven, Martijn; Hutmacher, Dietmar W

    2016-12-15

    New advanced manufacturing technologies under the alias of additive biomanufacturing allow the design and fabrication of a range of products from pre-operative models, cutting guides and medical devices to scaffolds. The process of printing in 3 dimensions of cells, extracellular matrix (ECM) and biomaterials (bioinks, powders, etc.) to generate in vitro and/or in vivo tissue analogue structures has been termed bioprinting. To further advance in additive biomanufacturing, there are many aspects that we can learn from the wider additive manufacturing (AM) industry, which have progressed tremendously since its introduction into the manufacturing sector. First, this review gives an overview of additive manufacturing and both industry and academia efforts in addressing specific challenges in the AM technologies to drive toward AM-enabled industrial revolution. After which, considerations of poly(lactides) as a biomaterial in additive biomanufacturing are discussed. Challenges in wider additive biomanufacturing field are discussed in terms of (a) biomaterials; (b) computer-aided design, engineering and manufacturing; (c) AM and additive biomanufacturing printers hardware; and (d) system integration. Finally, the outlook for additive biomanufacturing was discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Identification of Single Nucleotide Polymorphisms and analysis of Linkage Disequilibrium in sunflower elite inbred lines using the candidate gene approach

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A

    2008-01-01

    Full Text Available Abstract Background Association analysis is a powerful tool to identify gene loci that may contribute to phenotypic variation. This includes the estimation of nucleotide diversity, the assessment of linkage disequilibrium structure (LD and the evaluation of selection processes. Trait mapping by allele association requires a high-density map, which could be obtained by the addition of Single Nucleotide Polymorphisms (SNPs and short insertion and/or deletions (indels to SSR and AFLP genetic maps. Nucleotide diversity analysis of randomly selected candidate regions is a promising approach for the success of association analysis and fine mapping in the sunflower genome. Moreover, knowledge of the distance over which LD persists, in agronomically meaningful sunflower accessions, is important to establish the density of markers and the experimental design for association analysis. Results A set of 28 candidate genes related to biotic and abiotic stresses were studied in 19 sunflower inbred lines. A total of 14,348 bp of sequence alignment was analyzed per individual. In average, 1 SNP was found per 69 nucleotides and 38 indels were identified in the complete data set. The mean nucleotide polymorphism was moderate (θ = 0.0056, as expected for inbred materials. The number of haplotypes per region ranged from 1 to 9 (mean = 3.54 ± 1.88. Model-based population structure analysis allowed detection of admixed individuals within the set of accessions examined. Two putative gene pools were identified (G1 and G2, with a large proportion of the inbred lines being assigned to one of them (G1. Consistent with the absence of population sub-structuring, LD for G1 decayed more rapidly (r2 = 0.48 at 643 bp; trend line, pooled data than the LD trend line for the entire set of 19 individuals (r2 = 0.64 for the same distance. Conclusion Knowledge about the patterns of diversity and the genetic relationships between breeding materials could be an invaluable aid in crop

  2. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  3. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  4. Myristoylated α subunits of guanine nucleotide-binding regulatory proteins

    International Nuclear Information System (INIS)

    Buss, J.E.; Mumby, S.M.; Casey, P.J.; Gilman, A.G.; Sefton, B.M.

    1987-01-01

    Antisera directed against specific subunits of guanine nucleotide-binding regulatory proteins (G proteins) were used to immunoprecipitate these polypeptides from metabolically labeled cells. This technique detects, in extracts of a human astrocytoma cell line, the α subunits of G/sub s/ (stimulatory) (α 45 and α 52 ), a 41-kDa subunit of G/sub i/ (inhibitory) (α 41 ), a 40-kDa protein (α 40 ), and the 36-kDa β subunit. No protein that comigrated with the α subunit of G 0 (unknown function) (α 39 ) was detected. In cells grown in the presence of [ 3 H]myristic acid, α 41 and α 40 contained 3 H label, while the β subunit did not. Chemical analysis of lipids attached covalently to purified α 41 and α 39 from bovine brain also revealed myristic acid. Similar analysis of brain G protein β and γ subunits and of G/sub t/ (Transducin) subunits (α, β, and γ) failed to reveal fatty acids. The fatty acid associated with α 41 , α 40 , and α 39 was stable to treatment with base, suggesting that the lipid is linked to the polypeptide via an amide bond. These GTP binding proteins are thus identified as members of a select group of proteins that contains myristic acid covalently attached to the peptide backbone. Myristate may play an important role in stabilizing interactions of G proteins with phospholipid or with membrane-bound proteins

  5. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  6. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  7. Adenine nucleotide translocator transports haem precursors into mitochondria.

    Directory of Open Access Journals (Sweden)

    Motoki Azuma

    2008-08-01

    Full Text Available Haem is a prosthetic group for haem proteins, which play an essential role in oxygen transport, respiration, signal transduction, and detoxification. In haem biosynthesis, the haem precursor protoporphyrin IX (PP IX must be accumulated into the mitochondrial matrix across the inner membrane, but its mechanism is largely unclear. Here we show that adenine nucleotide translocator (ANT, the inner membrane transporter, contributes to haem biosynthesis by facilitating mitochondrial accumulation of its precursors. We identified that haem and PP IX specifically bind to ANT. Mitochondrial uptake of PP IX was inhibited by ADP, a known substrate of ANT. Conversely, ADP uptake into mitochondria was competitively inhibited by haem and its precursors, suggesting that haem-related porphyrins are accumulated into mitochondria via ANT. Furthermore, disruption of the ANT genes in yeast resulted in a reduction of haem biosynthesis by blocking the translocation of haem precursors into the matrix. Our results represent a new model that ANT plays a crucial role in haem biosynthesis by facilitating accumulation of its precursors into the mitochondrial matrix.

  8. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  9. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  10. Domestication rewired gene expression and nucleotide diversity patterns in tomato.

    Science.gov (United States)

    Sauvage, Christopher; Rau, Andrea; Aichholz, Charlotte; Chadoeuf, Joël; Sarah, Gautier; Ruiz, Manuel; Santoni, Sylvain; Causse, Mathilde; David, Jacques; Glémin, Sylvain

    2017-08-01

    Plant domestication has led to considerable phenotypic modifications from wild species to modern varieties. However, although changes in key traits have been well documented, less is known about the underlying molecular mechanisms, such as the reduction of molecular diversity or global gene co-expression patterns. In this study, we used a combination of gene expression and population genetics in wild and crop tomato to decipher the footprints of domestication. We found a set of 1729 differentially expressed genes (DEG) between the two genetic groups, belonging to 17 clusters of co-expressed DEG, suggesting that domestication affected not only individual genes but also regulatory networks. Five co-expression clusters were enriched in functional terms involving carbohydrate metabolism or epigenetic regulation of gene expression. We detected differences in nucleotide diversity between the crop and wild groups specific to DEG. Our study provides an extensive profiling of the rewiring of gene co-expression induced by the domestication syndrome in one of the main crop species. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  11. Nucleotide diversity and linkage disequilibrium in five Lolium perenne genes with putative role in shoot branching

    DEFF Research Database (Denmark)

    Brazauskas, Gintaras; Pašakinskienė, Izolda; Asp, Torben

    2010-01-01

    Knowledge on nucleotide diversity and linkage disequilibrium (LD) patterns is prerequisite for association analyses. However, little is known about the nucleotide diversity in the evolutionary important ryegrass shoot morphology genes. Five candidate genes, LpIAA1, LpRUB1, LpBRI1, LpSHOOT1 and Lp...

  12. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  13. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  14. Additive and polynomial representations

    CERN Document Server

    Krantz, David H; Suppes, Patrick

    1971-01-01

    Additive and Polynomial Representations deals with major representation theorems in which the qualitative structure is reflected as some polynomial function of one or more numerical functions defined on the basic entities. Examples are additive expressions of a single measure (such as the probability of disjoint events being the sum of their probabilities), and additive expressions of two measures (such as the logarithm of momentum being the sum of log mass and log velocity terms). The book describes the three basic procedures of fundamental measurement as the mathematical pivot, as the utiliz

  15. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  16. Food Additives and Hyperkinesis

    Science.gov (United States)

    Wender, Ester H.

    1977-01-01

    The hypothesis that food additives are causally associated with hyperkinesis and learning disabilities in children is reviewed, and available data are summarized. Available from: American Medical Association 535 North Dearborn Street Chicago, Illinois 60610. (JG)

  17. Groups – Additive Notation

    Directory of Open Access Journals (Sweden)

    Coghetto Roland

    2015-06-01

    Full Text Available We translate the articles covering group theory already available in the Mizar Mathematical Library from multiplicative into additive notation. We adapt the works of Wojciech A. Trybulec [41, 42, 43] and Artur Korniłowicz [25].

  18. Groups – Additive Notation

    OpenAIRE

    Coghetto Roland

    2015-01-01

    We translate the articles covering group theory already available in the Mizar Mathematical Library from multiplicative into additive notation. We adapt the works of Wojciech A. Trybulec [41, 42, 43] and Artur Korniłowicz [25].

  19. A multistep damage recognition mechanism for global genomic nucleotide excision repair.

    Science.gov (United States)

    Sugasawa, K; Okamoto, T; Shimizu, Y; Masutani, C; Iwai, S; Hanaoka, F

    2001-03-01

    A mammalian nucleotide excision repair (NER) factor, the XPC-HR23B complex, can specifically bind to certain DNA lesions and initiate the cell-free repair reaction. Here we describe a detailed analysis of its binding specificity using various DNA substrates, each containing a single defined lesion. A highly sensitive gel mobility shift assay revealed that XPC-HR23B specifically binds a small bubble structure with or without damaged bases, whereas dual incision takes place only when damage is present in the bubble. This is evidence that damage recognition for NER is accomplished through at least two steps; XPC-HR23B first binds to a site that has a DNA helix distortion, and then the presence of injured bases is verified prior to dual incision. Cyclobutane pyrimidine dimers (CPDs) were hardly recognized by XPC-HR23B, suggesting that additional factors may be required for CPD recognition. Although the presence of mismatched bases opposite a CPD potentiated XPC-HR23B binding, probably due to enhancement of the helix distortion, cell-free excision of such compound lesions was much more efficient than expected from the observed affinity for XPC-HR23B. This also suggests that additional factors and steps are required for the recognition of some types of lesions. A multistep mechanism of this sort may provide a molecular basis for ensuring the high level of damage discrimination that is required for global genomic NER.

  20. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    Science.gov (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

  1. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Mostapha, Sarah

    2013-01-01

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  2. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin

    2008-01-01

    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  3. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  4. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  5. Alternative additives; Alternative additiver

    Energy Technology Data Exchange (ETDEWEB)

    2007-08-15

    In this project a number of industrial and agricultural waste products have been characterised and evaluated in terms of alkali-getter performance. The intended use is for biomass-fired power stations aiming at reducing corrosion or slagging related problems. The following products have been obtained, characterised and evaluated: 1) Brewery draff 2) Danish de-gassed manure 3) Paper sludge 4) Moulding sand 5) Spent bleaching earth 6) Anorthosite 7) Sand 8) Clay-sludge. Most of the above alternative additive candidates are deemed unsuitable due to insufficient chemical effect and/or expensive requirements for pre-treatment (such as drying and transportation). 3 products were selected for full-scale testing: de-gassed manure, spent bleaching earth and clay slugde. The full scale tests were undertaken at the biomass-fired power stations in Koege, Slagelse and Ensted. Spent bleaching earth (SBE) and clay sludge were the only tested additive candidates that had a proven ability to react with KCl, to thereby reduce Cl-concentrations in deposits, and reduce the deposit flux to superheater tubes. Their performance was shown to nearly as good as commercial additives. De-gassed manure, however, did not evaluate positively due to inhibiting effects of Ca in the manure. Furthermore, de-gassed manure has a high concentration of heavy metals, which imposes a financial burden with regard to proper disposal of the ash by-products. Clay-sludge is a wet clay slurring, and drying and transportation of this product entails substantial costs. Spent bleaching does not require much pre-treatment and is therefore the most promising alternative additive. On the other hand, bleaching earth contains residual plant oil which means that a range of legislation relating to waste combustion comes into play. Not least a waste combustion fee of 330 DKK/tonne. For all alternative (and commercial) additives disposal costs of the increase ash by-products represents a significant cost. This is

  6. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  7. Model Additional Protocol

    International Nuclear Information System (INIS)

    Rockwood, Laura

    2001-01-01

    Since the end of the cold war a series of events has changed the circumstances and requirements of the safeguards system. The discovery of a clandestine nuclear weapons program in Iraq, the continuing difficulty in verifying the initial report of Democratic People's Republic of Korea upon entry into force of their safeguards agreement, and the decision of the South African Government to give up its nuclear weapons program and join the Treaty on the Non-Proliferation of Nuclear Weapons have all played a role in an ambitious effort by IAEA Member States and the Secretariat to strengthen the safeguards system. A major milestone in this effort was reached in May 1997 when the IAEA Board of Governors approved a Model Protocol Additional to Safeguards Agreements. The Model Additional Protocol was negotiated over a period of less than a year by an open-ended committee of the Board involving some 70 Member States and two regional inspectorates. The IAEA is now in the process of negotiating additional protocols, State by State, and implementing them. These additional protocols will provide the IAEA with rights of access to information about all activities related to the use of nuclear material in States with comprehensive safeguards agreements and greatly expanded physical access for IAEA inspectors to confirm or verify this information. In conjunction with this, the IAEA is working on the integration of these measures with those provided for in comprehensive safeguards agreements, with a view to maximizing the effectiveness and efficiency, within available resources, the implementation of safeguards. Details concerning the Model Additional Protocol are given. (author)

  8. Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

    Directory of Open Access Journals (Sweden)

    Tobias Fromme

    2018-02-01

    Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

  9. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  10. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  11. Subnanomole detection and quantitation of high specific activity 32P-nucleotides

    International Nuclear Information System (INIS)

    Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

    1991-01-01

    Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

  12. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  13. Additive manufacturing of metals

    International Nuclear Information System (INIS)

    Herzog, Dirk; Seyda, Vanessa; Wycisk, Eric; Emmelmann, Claus

    2016-01-01

    Additive Manufacturing (AM), the layer-by layer build-up of parts, has lately become an option for serial production. Today, several metallic materials including the important engineering materials steel, aluminium and titanium may be processed to full dense parts with outstanding properties. In this context, the present overview article describes the complex relationship between AM processes, microstructure and resulting properties for metals. It explains the fundamentals of Laser Beam Melting, Electron Beam Melting and Laser Metal Deposition, and introduces the commercially available materials for the different processes. Thereafter, typical microstructures for additively manufactured steel, aluminium and titanium are presented. Special attention is paid to AM specific grain structures, resulting from the complex thermal cycle and high cooling rates. The properties evolving as a consequence of the microstructure are elaborated under static and dynamic loading. According to these properties, typical applications are presented for the materials and methods for conclusion.

  14. Additive manufactured serialization

    Science.gov (United States)

    Bobbitt, III, John T.

    2017-04-18

    Methods for forming an identifying mark in a structure are described. The method is used in conjunction with an additive manufacturing method and includes the alteration of a process parameter during the manufacturing process. The method can form in a unique identifying mark within or on the surface of a structure that is virtually impossible to be replicated. Methods can provide a high level of confidence that the identifying mark will remain unaltered on the formed structure.

  15. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  16. Association of single nucleotide polymorphisms with carcass traits in Nellore cattle.

    Science.gov (United States)

    Ferraz, J B S; Pinto, L F B; Meirelles, F V; Eler, J P; de Rezende, F M; Oliveira, E C M; Almeida, H B; Woodward, B; Nkrumah, D

    2009-11-17

    The association between two single nucleotide polymorphisms (SNPs), T945M and UCP1SNP1, with hot carcass weight (HCW, kg, N = 618), longissimus dorsi muscle area (REA, cm(2), N = 633), and backfat thickness (BF, mm, N = 625), measured in Nellore cattle in Brazil, was evaluated. Likelihood ratio tests were used to evaluate reduced (fixed effects of general mean, contemporary group, yearling weight, age at slaughter, and random effect of infinitesimal genetic value) and full model (reduced model effects plus quantitative trait locus effects). Additive and dominance effects were tested for each SNP. Genotypic and gene frequencies were also obtained for the SNPs and a descriptive phenotype analysis was made. Mean values for HCW, REA and BF were equal to 288.13 +/- 0.55 kg, 73.14 +/- 0.27 cm(2), and 4.28 +/- 0.07 mm, respectively; the coefficients of variation were 4.74, 9.24, and 42.43%, respectively. Gene frequencies for T945M and UCP1SNP1 were f(C) = 0.89, f(T) = 0.11, f(C) = 0.81, and f(G) = 0.19. The SNP T945M had a genotypic frequency of only three animals for TT genotype. Additive effects were observed for T945M on REA and BF, while UCP1SNP1 affected HCW and BF. Based on the significant additive effects of the SNPs and the gene frequencies that we found, we can expect genetic gains with marker assisted selection.

  17. Pre-Steady State Kinetic Investigation of the Incorporation of Anti-Hepatitis B Nucleotide Analogs Catalyzed by Non-Canonical Human DNA Polymerases

    Science.gov (United States)

    Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai

    2011-01-01

    Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702

  18. Structural studies of a bacterial tRNA(HIS guanylyltransferase (Thg1-like protein, with nucleotide in the activation and nucleotidyl transfer sites.

    Directory of Open Access Journals (Sweden)

    Samantha J Hyde

    Full Text Available All nucleotide polymerases and transferases catalyze nucleotide addition in a 5' to 3' direction. In contrast, tRNA(His guanylyltransferase (Thg1 enzymes catalyze the unusual reverse addition (3' to 5' of nucleotides to polynucleotide substrates. In eukaryotes, Thg1 enzymes use the 3'-5' addition activity to add G-1 to the 5'-end of tRNA(His, a modification required for efficient aminoacylation of the tRNA by the histidyl-tRNA synthetase. Thg1-like proteins (TLPs are found in Archaea, Bacteria, and mitochondria and are biochemically distinct from their eukaryotic Thg1 counterparts TLPs catalyze 5'-end repair of truncated tRNAs and act on a broad range of tRNA substrates instead of exhibiting strict specificity for tRNA(His. Taken together, these data suggest that TLPs function in distinct biological pathways from the tRNA(His maturation pathway, perhaps in tRNA quality control. Here we present the first crystal structure of a TLP, from the gram-positive soil bacterium Bacillus thuringiensis (BtTLP. The enzyme is a tetramer like human THG1, with which it shares substantial structural similarity. Catalysis of the 3'-5' reaction with 5'-monophosphorylated tRNA necessitates first an activation step, generating a 5'-adenylylated intermediate prior to a second nucleotidyl transfer step, in which a nucleotide is transferred to the tRNA 5'-end. Consistent with earlier characterization of human THG1, we observed distinct binding sites for the nucleotides involved in these two steps of activation and nucleotidyl transfer. A BtTLP complex with GTP reveals new interactions with the GTP nucleotide in the activation site that were not evident from the previously solved structure. Moreover, the BtTLP-ATP structure allows direct observation of ATP in the activation site for the first time. The BtTLP structural data, combined with kinetic analysis of selected variants, provide new insight into the role of key residues in the activation step.

  19. Assessment of Genetic Diversity in Faba Bean Based on Single Nucleotide Polymorphism

    Directory of Open Access Journals (Sweden)

    Sukhjiwan Kaur

    2014-01-01

    Full Text Available Detection of genetic diversity is important for characterisation of crop plant collections in order to detect the presence of valuable trait variation for use in breeding programs. A collection of faba bean (Vicia faba L. genotypes was evaluated for intra- and inter-population diversity using a set of 768 genome-wide distributed single nucleotide polymorphism (SNP markers, of which 657 obtained successful amplification and detected polymorphisms. Gene diversity and polymorphism information content (PIC values varied between 0.022–0.500 and 0.023–1.00, with averages of 0.363 and 0.287, respectively. The genetic structure of the germplasm collection was analysed and a neighbour-joining (NJ dendrogram was constructed. The faba bean accessions grouped into two major groups, with several additional smaller sub-groups, predominantly on the basis of geographical origin. These results were further supported by principal co-ordinate analysis (PCoA, deriving two major groupings which were differentiated on the basis of site of origin and pedigree relationships. In general, high levels of heterozygosity were observed, presumably due to the partially allogamous nature of the species. The results will facilitate targeted crossing strategies in future faba bean breeding programs in order to achieve genetic gain.

  20. Single nucleotide polymorphisms in ZNF208 are associated with increased risk for HBV in Chinese people.

    Science.gov (United States)

    Li, Hengxin; Chen, Jun; Zhang, RuiZhi; Xu, Ran; Zhang, Zhe; Ren, Le; Yang, Qi; Tian, Yumei; Li, Daxu

    2017-12-22

    Single nucleotide polymorphisms (SNPs) in ZNF208 may be associated with susceptibility to Hepatitis B virus (HBV). In the current study, we analyzed the association between ZNF208 SNPs and risk of HBV in 242 HBV patients and 300 healthy subjects from the Xi'an area of Chinese Han Population. Of the five SNPs examined, rs2188971 (OR: 1.36, 95% CI: 1.04-1.76, P = 0.022), rs8103163 (OR: 1.40, 95% CI: 1.08-1.82, P = 0.010) and rs7248488 (OR: 1.38, 95% CI: 1.07-1.79, P = 0.014) were correlated with HBV susceptibility based on Chi-square tests. After the P -values were adjusted by Bonferroni correction, there only rs8103163 ( P = 0.050) was slightly with increased HBV risk. Additionally, haplotype A rs2188972 T rs2188971 A rs8103163 A rs7248488 (OR = 1.42; 95% C I, 1.10-1.85; P = 0.008) was found to increase susceptibility of suffering from HBV. These findings suggest that ZNF208 polymorphisms may contribute to the development of HBV.

  1. True Lies: The Double Life of the Nucleotide Excision Repair Factors in Transcription and DNA Repair

    Directory of Open Access Journals (Sweden)

    Nicolas Le May

    2010-01-01

    Full Text Available Nucleotide excision repair (NER is a major DNA repair pathway in eukaryotic cells. NER removes structurally diverse lesions such as pyrimidine dimers, arising upon UV irradiation or bulky chemical adducts, arising upon exposure to carcinogens and some chemotherapeutic drugs. NER defects lead to three genetic disorders that result in predisposition to cancers, accelerated aging, neurological and developmental defects. During NER, more than 30 polypeptides cooperate to recognize, incise, and excise a damaged oligonucleotide from the genomic DNA. Recent papers reveal an additional and unexpected role for the NER factors. In the absence of a genotoxic attack, the promoters of RNA polymerases I- and II-dependent genes recruit XPA, XPC, XPG, and XPF to initiate gene expression. A model that includes the growth arrest and DNA damage 45α protein (Gadd45α and the NER factors, in order to maintain the promoter of active genes under a hypomethylated state, has been proposed but remains controversial. This paper focuses on the double life of the NER factors in DNA repair and transcription and describes the possible roles of these factors in the RNA synthesis process.

  2. A single-nucleotide polymorphism of human neuropeptide s gene originated from Europe shows decreased bioactivity.

    Directory of Open Access Journals (Sweden)

    Cheng Deng

    Full Text Available Using accumulating SNP (Single-Nucleotide Polymorphism data, we performed a genome-wide search for polypeptide hormone ligands showing changes in the mature regions to elucidate genotype/phenotype diversity among various human populations. Neuropeptide S (NPS, a brain peptide hormone highly conserved in vertebrates, has diverse physiological effects on anxiety, fear, hyperactivity, food intake, and sleeping time through its cognate receptor-NPSR. Here, we report a SNP rs4751440 (L(6-NPS causing non-synonymous substitution on the 6(th position (V to L of the NPS mature peptide region. L(6-NPS has a higher allele frequency in Europeans than other populations and probably originated from European ancestors ~25,000 yrs ago based on haplotype analysis and Approximate Bayesian Computation. Functional analyses indicate that L(6-NPS exhibits a significant lower bioactivity than the wild type NPS, with ~20-fold higher EC50 values in the stimulation of NPSR. Additional evolutionary and mutagenesis studies further demonstrate the importance of the valine residue in the 6(th position for NPS functions. Given the known physiological roles of NPS receptor in inflammatory bowel diseases, asthma pathogenesis, macrophage immune responses, and brain functions, our study provides the basis to elucidate NPS evolution and signaling diversity among human populations.

  3. Molecular cloning and functional characterization of duck nucleotide-binding oligomerization domain 1 (NOD1).

    Science.gov (United States)

    Li, Huilin; Jin, Hui; Li, Yaqian; Liu, Dejian; Foda, Mohamed Frahat; Jiang, Yunbo; Luo, Rui

    2017-09-01

    Nucleotide-binding oligomerization domain 1 (NOD1) is an imperative cytoplasmic pattern recognition receptor (PRR) and considered as a key member of the NOD-like receptor (NLR) family which plays a critical role in innate immunity through sensing microbial components derived from bacterial peptidoglycan. In the current study, the full-length of duck NOD1 (duNOD1) cDNA from duck embryo fibroblasts (DEFs) was cloned. Multiple sequence alignment and phylogenetic analysis demonstrated that duNOD1 exhibited a strong evolutionary relationship with chicken and rock pigeon NOD1. Tissue-specific expression analysis showed that duNOD1 was widely distributed in various organs, with the highest expression observed in the liver. Furthermore, duNOD1 overexpression induced NF-κB activation in DEFs and the CARD domain is crucial for duNOD1-mediated NF-κB activation. In addition, silencing the duNOD1 decreased the activity of NF-κB in DEFs stimulated by iE-DAP. Overexpression of duNOD1 significantly increased the expression of TNF-α, IL-6, and RANTES in DEFs. These findings highlight the crucial role of duNOD1 as an intracellular sensor in duck innate immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Proteomic analysis of Rac1 signaling regulation by guanine nucleotide exchange factors.

    Science.gov (United States)

    Marei, Hadir; Carpy, Alejandro; Macek, Boris; Malliri, Angeliki

    2016-08-02

    The small GTPase Rac1 is implicated in various cellular processes that are essential for normal cell function. Deregulation of Rac1 signaling has also been linked to a number of diseases, including cancer. The diversity of Rac1 functioning in cells is mainly attributed to its ability to bind to a multitude of downstream effectors following activation by Guanine nucleotide Exchange Factors (GEFs). Despite the identification of a large number of Rac1 binding partners, factors influencing downstream specificity are poorly defined, thus hindering the detailed understanding of both Rac1's normal and pathological functions. In a recent study, we demonstrated a role for 2 Rac-specific GEFs, Tiam1 and P-Rex1, in mediating Rac1 anti- versus pro-migratory effects, respectively. Importantly, via conducting a quantitative proteomic screen, we identified distinct changes in the Rac1 interactome following activation by either GEF, indicating that these opposing effects are mediated through GEF modulation of the Rac1 interactome. Here, we present the full list of identified Rac1 interactors together with functional annotation of the differentially regulated Rac1 binding partners. In light of this data, we also provide additional insights into known and novel signaling cascades that might account for the GEF-mediated Rac1-driven cellular effects.

  5. regSNPs-splicing: a tool for prioritizing synonymous single-nucleotide substitution.

    Science.gov (United States)

    Zhang, Xinjun; Li, Meng; Lin, Hai; Rao, Xi; Feng, Weixing; Yang, Yuedong; Mort, Matthew; Cooper, David N; Wang, Yue; Wang, Yadong; Wells, Clark; Zhou, Yaoqi; Liu, Yunlong

    2017-09-01

    While synonymous single-nucleotide variants (sSNVs) have largely been unstudied, since they do not alter protein sequence, mounting evidence suggests that they may affect RNA conformation, splicing, and the stability of nascent-mRNAs to promote various diseases. Accurately prioritizing deleterious sSNVs from a pool of neutral ones can significantly improve our ability of selecting functional genetic variants identified from various genome-sequencing projects, and, therefore, advance our understanding of disease etiology. In this study, we develop a computational algorithm to prioritize sSNVs based on their impact on mRNA splicing and protein function. In addition to genomic features that potentially affect splicing regulation, our proposed algorithm also includes dozens structural features that characterize the functions of alternatively spliced exons on protein function. Our systematical evaluation on thousands of sSNVs suggests that several structural features, including intrinsic disorder protein scores, solvent accessible surface areas, protein secondary structures, and known and predicted protein family domains, show significant differences between disease-causing and neutral sSNVs. Our result suggests that the protein structure features offer an added dimension of information while distinguishing disease-causing and neutral synonymous variants. The inclusion of structural features increases the predictive accuracy for functional sSNV prioritization.

  6. The regulated secretory pathway and human disease: insights from gene variants and single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Stephen eSalton

    2013-08-01

    Full Text Available The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs, where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs, with neuropsychiatric, endocrine and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A of the human brain-derived neurotrophic factor (BDNF gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired.

  7. Effect of radioprotectant WR 2721 on cyclic nucleotides, prostaglandins, and lysosomes

    International Nuclear Information System (INIS)

    Trocha, P.J.; Catravas, G.N.

    1983-01-01

    Within 1 hr after ip injection of the radioprotectant WR 2721 into rats, splenic cGMP levels dropped and remained suppressed for 6 hr before returning to normal. However, if rats were exposed to ionizing radiation 30-40 min after WR 2721 treatment, they had higher cGMP levels at 3 hr postirradiation than the nonirradiUted, drug-treated controls, but the cGMP content was still found to be lower than that of the irradiated nondrug-treated controls. Radiation exposure of animals pretreated with WR 2721 also resulted in higher liver and spleen levels of cAMP and additional elevations in spleen prostaglandin content, compared with irradiated controls at 3-6 hr after radiation treatment. The secondary fluctuations of lysosomal enzyme activities, prostaglandin content, and cyclic nucleotide levels were also altered in irradiated rats pretreated with WR 2721 when compared with irradiated controls. Liver and spleen lysosomal β-glucuronidase activities, spleen cAMP and cGMP levels, and spleen prostaglandin concentrations were closer to physiological levels at 3 days postirradiation in rats given WR 2721 before the radiation treatment

  8. Divalent phosphate is a counterion for carboxyatractyloside-insensitive adenine nucleotide transport in rat liver mitochondria

    International Nuclear Information System (INIS)

    Nosek, M.T.; Aprille, J.R.

    1986-01-01

    Unidirectional, carboxyatractyloside(CAT)-insensitive adenine nucleotide (AdN) fluxes have been studied in isolated rat liver mitochondria (mito). Previous work has shown that ATP x Mg transport in one direction is coupled to ATP x Mg or P/sub i/ transport in the opposite direction. The purpose of this study was to determine whether divalent HPO 4 2- or monovalent H 2 PO 4 - is the transported phosphate species. The authors used the monofluorophosphate (PO 3 F 2- ) and difluorophosphate (PO 2 F 2 - ) analogues as potential counterions forAdN efflux. After a preincubation on ice with 14 C-ADP to label the matrix AdN, efflux was measured at 30 0 C, pH 7.4, in 225mM sucrose, 10mM KCl, 5mM MgCl 2 , 5mM glutamate, 5mM malate, 10mM Tris, 0.5mM P/sub i/, 1mM ATP, and 5μM CAT. With no other additions efflux was -0.62 +/- 0.20 nmole/minute/mg protein. The data supports the hypothesis that divalent but not monovalent phosphate can act as a counterion for ATPx Mg transport over this CAT-insensitive carrier

  9. Nucleotide-excision repair of DNA in cell-free extracts of the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Wang, Z.; Wu, X.; Friedberg, E.C.

    1993-01-01

    A wide spectrum of DNA lesions are repaired by the nucleotide-excision repair (NER) pathway in both eukaryotic and prokaryotic cells. We have developed a cell-free system in Saccharomyces cerevisiae that supports NER. NER was monitored by measuring repair synthesis in DNA treated with cisplatin or with UV radiation. Repair synthesis in vitro was defective in extracts of rad1, rad2, and rad10 mutant cells, all of which have mutations in genes whose products are known to be required for NER in vivo. Additionally, repair synthesis was complemented by mixing different mutant extracts, or by adding purified Rad1 or Rad10 protein to rad1 or rad10 mutant extracts, respectively. The latter observation demonstrates that the Rad1 and Rad10 proteins directly participate in the biochemical pathway of NER. NER supported by nuclear extracts requires ATP and Mg 2+ and is stimulated by polyethylene glycol and by small amounts of whole cell extract containing overexpressed Rad2 protein. The nuclear extracts also contain base-excision repair activity that is present at wild-type levels in rad mutant extracts. This cell-free system is expected to facilitate studies on the biochemical pathway of NER in S. cerevisiae

  10. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  11. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  12. Genome-wide single nucleotide polymorphisms (SNPs) for a model invasive ascidian Botryllus schlosseri.

    Science.gov (United States)

    Gao, Yangchun; Li, Shiguo; Zhan, Aibin

    2018-04-01

    Invasive species cause huge damages to ecology, environment and economy globally. The comprehensive understanding of invasion mechanisms, particularly genetic bases of micro-evolutionary processes responsible for invasion success, is essential for reducing potential damages caused by invasive species. The golden star tunicate, Botryllus schlosseri, has become a model species in invasion biology, mainly owing to its high invasiveness nature and small well-sequenced genome. However, the genome-wide genetic markers have not been well developed in this highly invasive species, thus limiting the comprehensive understanding of genetic mechanisms of invasion success. Using restriction site-associated DNA (RAD) tag sequencing, here we developed a high-quality resource of 14,119 out of 158,821 SNPs for B. schlosseri. These SNPs were relatively evenly distributed at each chromosome. SNP annotations showed that the majority of SNPs (63.20%) were located at intergenic regions, and 21.51% and 14.58% were located at introns and exons, respectively. In addition, the potential use of the developed SNPs for population genomics studies was primarily assessed, such as the estimate of observed heterozygosity (H O ), expected heterozygosity (H E ), nucleotide diversity (π), Wright's inbreeding coefficient (F IS ) and effective population size (Ne). Our developed SNP resource would provide future studies the genome-wide genetic markers for genetic and genomic investigations, such as genetic bases of micro-evolutionary processes responsible for invasion success.

  13. Both base excision repair and nucleotide excision repair in humans are influenced by nutritional factors.

    Science.gov (United States)

    Brevik, Asgeir; Karlsen, Anette; Azqueta, Amaya; Tirado, Anna Estaban; Blomhoff, Rune; Collins, Andrew

    2011-01-01

    Lack of reliable assays for DNA repair has largely prevented measurements of DNA repair from being included in human biomonitoring studies. Using newly developed modifications of the comet assay we tested whether a fruit- and antioxidant-rich plant-based intervention could affect base excision repair (BER) and nucleotide excision repair (NER) in a group of 102 male volunteers. BER and NER repair capacities were measured in lymphocytes before and after a dietary intervention lasting 8 weeks. The study had one control group, one group consuming three kiwifruits per day and one group consuming a variety of antioxidant-rich fruits and plant products in addition to their normal diet. DNA strand breaks were reduced following consumption of both kiwifruits (13%, p = 0.05) and antioxidant-rich plant products (20%, p = 0.02). Increased BER (55%, p = 0.01) and reduced NER (-39%, p plant products. Reduced NER was also observed in the kiwifruit group (-38%, p = 0.05), but BER was not affected in this group. Here we have demonstrated that DNA repair is affected by diet and that modified versions of the comet assay can be used to assess activity of different DNA repair pathways in human biomonitoring studies. Copyright © 2010 John Wiley & Sons, Ltd.

  14. 2',3'-cyclic nucleotide 3'-phosphodiesterases inhibit hepatitis B virus replication.

    Directory of Open Access Journals (Sweden)

    Hui Ma

    Full Text Available 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNP is a member of the interferon-stimulated genes, which includes isoforms CNP1 and CNP2. CNP1 is locally expressed in the myelin sheath but CNP2 is additionally expressed at low levels outside the nervous system. CNPs regulate multiple cellular functions and suppress protein production by association with polyadenylation of mRNA. Polyadenylation of Hepatitis B virus (HBV RNAs is crucial for HBV replication. Whether CNPs interact with polyadenylation signal of HBV RNAs and interfere HBV replication is unknown. In this study, we evaluated expressions of CNP isoforms in hepatoma cell lines and their effects on HBV replication. We found that CNP2 is moderately expressed and gently responded to interferon treatment in HepG2, but not in Huh7 cells. The CNP1 and CNP2 potently inhibited HBV production by blocking viral proteins synthesis and reducing viral RNAs, respectively. In chronic hepatitis B patients, CNP was expressed in most of HBV-infected hepatocytes of liver specimens. Knockdown of CNP expression moderately improved viral production in the HepG2.2.15 cells treated with IFN-α. In conclusion, CNP might be a mediator of interferon-induced response against HBV.

  15. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  16. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  17. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms.

    Science.gov (United States)

    Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

    2008-08-19

    Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  18. Prediction of maize phenotype based on whole-genome single nucleotide polymorphisms using deep belief networks

    Science.gov (United States)

    Rachmatia, H.; Kusuma, W. A.; Hasibuan, L. S.

    2017-05-01

    Selection in plant breeding could be more effective and more efficient if it is based on genomic data. Genomic selection (GS) is a new approach for plant-breeding selection that exploits genomic data through a mechanism called genomic prediction (GP). Most of GP models used linear methods that ignore effects of interaction among genes and effects of higher order nonlinearities. Deep belief network (DBN), one of the architectural in deep learning methods, is able to model data in high level of abstraction that involves nonlinearities effects of the data. This study implemented DBN for developing a GP model utilizing whole-genome Single Nucleotide Polymorphisms (SNPs) as data for training and testing. The case study was a set of traits in maize. The maize dataset was acquisitioned from CIMMYT’s (International Maize and Wheat Improvement Center) Global Maize program. Based on Pearson correlation, DBN is outperformed than other methods, kernel Hilbert space (RKHS) regression, Bayesian LASSO (BL), best linear unbiased predictor (BLUP), in case allegedly non-additive traits. DBN achieves correlation of 0.579 within -1 to 1 range.

  19. Crystal structure of the FeS cluster-containing nucleotide excision repair helicase XPD.

    Directory of Open Access Journals (Sweden)

    Stefanie C Wolski

    2008-06-01

    Full Text Available DNA damage recognition by the nucleotide excision repair pathway requires an initial step identifying helical distortions in the DNA and a proofreading step verifying the presence of a lesion. This proofreading step is accomplished in eukaryotes by the TFIIH complex. The critical damage recognition component of TFIIH is the XPD protein, a DNA helicase that unwinds DNA and identifies the damage. Here, we describe the crystal structure of an archaeal XPD protein with high sequence identity to the human XPD protein that reveals how the structural helicase framework is combined with additional elements for strand separation and DNA scanning. Two RecA-like helicase domains are complemented by a 4Fe4S cluster domain, which has been implicated in damage recognition, and an alpha-helical domain. The first helicase domain together with the helical and 4Fe4S-cluster-containing domains form a central hole with a diameter sufficient in size to allow passage of a single stranded DNA. Based on our results, we suggest a model of how DNA is bound to the XPD protein, and can rationalize several of the mutations in the human XPD gene that lead to one of three severe diseases, xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy.

  20. Remarkable nanoconfinement effects on chemical equilibrium manifested in nucleotide dimerization and H-D exchange reactions.

    Science.gov (United States)

    Polak, Micha; Rubinovich, Leonid

    2011-10-06

    Nanoconfinement entropic effects on chemical equilibrium involving a small number of molecules, which we term NCECE, are revealed by two widely diverse types of reactions. Employing statistical-mechanical principles, we show how the NCECE effect stabilizes nucleotide dimerization observed within self-assembled molecular cages. Furthermore, the effect provides the basis for dimerization even under an aqueous environment inside the nanocage. Likewise, the NCECE effect is pertinent to a longstanding issue in astrochemistry, namely the extra deuteration commonly observed for molecules reacting on interstellar dust grain surfaces. The origin of the NCECE effect is elucidated by means of the probability distributions of the reaction extent and related variations in the reactant-product mixing entropy. Theoretical modelling beyond our previous preliminary work highlights the role of the nanospace size in addition to that of the nanosystem size, namely the limited amount of molecules in the reaction mixture. Furthermore, the NCECE effect can depend also on the reaction mechanism, and on deviations from stoichiometry. The NCECE effect, leading to enhanced, greatly variable equilibrium "constants", constitutes a unique physical-chemical phenomenon, distinguished from the usual thermodynamical properties of macroscopically large systems. Being significant particularly for weakly exothermic reactions, the effects should stabilize products in other closed nanoscale structures, and thus can have notable implications for the growing nanotechnological utilization of chemical syntheses conducted within confined nanoreactors.

  1. Ebselen induces mitochondrial permeability transition because of its interaction with adenine nucleotide translocase.

    Science.gov (United States)

    Pavón, Natalia; Correa, Francisco; Buelna-Chontal, Mabel; Hernández-Esquivel, Luz; Chávez, Edmundo

    2015-10-15

    Mitochondrial permeability transition is a process established through massive Ca(2+) load in addition to an inducer reagent. Ebselen (Ebs), an antioxidant seleno compound, has been introduced as a reagent which inhibits mitochondrial dysfunction induced by permeability transition. Paradoxically enough, it has been shown that Ebs may also be able to induce the opening of the mitochondrial non-selective pores. This study was performed with the purpose of establishing the membrane system involved in Ebs-induced pore opening. Permeability transition was appraised by analyzing the following: i) matrix Ca(2+) release, and mitochondrial swelling, ii) efflux of cytochrome c, and iii) the inhibition of superoxide dismutase. All of these adverse reactions were inhibited by N-ethylmaleimide and cyclosporin A. At concentrations from 5 to 20 μM, we found that Ebs induces non-specific membrane permeability. Remarkably, Ebs blocks the binding of the fluorescent reagent eosin-5-maleimide to the thiol groups of the adenine nucleotide translocase. Based on the above, it is tempting to hypothesize that Ebs induces pore opening through its binding to the ADP/ATP carrier. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Lack of Association between STAT4 Single Nucleotide Polymorphisms and Iranian Juvenile Rheumatoid Arthritis Patients.

    Science.gov (United States)

    Aslani, Saeed; Mahmoudi, Mahdi; Salmaninejad, Arash; Poursani, Shiva; Ziaee, Vahid; Rezaei, Nima

    2017-06-01

    Juvenile rheumatoid arthritis (JRA) is a common chronic systemic autoimmune disease in children. Single nucleotide polymorphisms (SNPs) of signal transducer and activator of transcription 4 (STAT4) gene are suspected to have association with the risk of autoimmune diseases. Previous investigations have indicated that the STAT4 rs7574865 T allele was significantly associated with rheumatoid arthritis. In this study, we aimed to evaluate the association of STAT4 SNPs with JRA in Iranian population. T allele of STAT4 rs7574865 SNP was less frequent in patients than in controls, and the difference was not significant (p = 0.19, OR = 0.72, 95% CI: 0.44 -1.17). In addition, G allele of this SNP was frequent but not significant in JRA patients (p = 0.19, OR = 1.38, 95% CI: 0.85-2.25). Neither alleles nor genotypes of rs7601754 SNP of STAT4 gene demonstrated associations with JRA. We recognize that gene variants of STAT4 did not affect JRA susceptibility in Iranian population.

  3. Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

    NARCIS (Netherlands)

    Corradini, E.

    2015-01-01

    Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

  4. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  5. Study on the change of cyclic nucleotide in mice with yang vacuity disease

    International Nuclear Information System (INIS)

    Zhu Xinhua; Shen Ling; Wang Shuguang

    2002-01-01

    To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

  6. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  7. BWR zinc addition Sourcebook

    International Nuclear Information System (INIS)

    Garcia, Susan E.; Giannelli, Joseph F.; Jarvis, Alfred J.

    2014-01-01

    Boiling Water Reactors (BWRs) have been injecting zinc into the primary coolant via the reactor feedwater system for over 25 years for the purpose of controlling primary system radiation fields. The BWR zinc injection process has evolved since the initial application at the Hope Creek Nuclear Station in 1986. Key transitions were from the original natural zinc oxide (NZO) to depleted zinc oxide (DZO), and from active zinc injection of a powdered zinc oxide slurry (pumped systems) to passive injection systems (zinc pellet beds). Zinc addition has continued through various chemistry regimes changes, from normal water chemistry (NWC) to hydrogen water chemistry (HWC) and HWC with noble metals (NobleChem™) for mitigation of intergranular stress corrosion cracking (IGSCC) of reactor internals and primary system piping. While past reports published by the Electric Power Research Institute (EPRI) document specific industry experience related to these topics, the Zinc Sourcebook was prepared to consolidate all of the experience gained over the past 25 years. The Zinc Sourcebook will benefit experienced BWR Chemistry, Operations, Radiation Protection and Engineering personnel as well as new people entering the nuclear power industry. While all North American BWRs implement feedwater zinc injection, a number of other BWRs do not inject zinc. This Sourcebook will also be a valuable resource to plants considering the benefits of zinc addition process implementation, and to gain insights on industry experience related to zinc process control and best practices. This paper presents some of the highlights from the Sourcebook. (author)

  8. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  9. The effect of exhaustive exercise on the concentration of purine nucleotides and their metabolites in erythrocytes

    OpenAIRE

    E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak

    2008-01-01

    In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...

  10. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    International Nuclear Information System (INIS)

    Boulias, C.; Moscarello, M.A.

    1989-01-01

    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides

  11. Teardrop bladder: additional considerations

    International Nuclear Information System (INIS)

    Wechsler, R.J.; Brennan, R.E.

    1982-01-01

    Nine cases of teardrop bladder (TDB) seen at excretory urography are presented. In some of these patients, the iliopsoas muscles were at the upper limit of normal in size, and additional evaluation of the perivesical structures with computed tomography (CT) was necessary. CT demonstrated only hypertrophied muscles with or without perivesical fat. The psoas muscles and pelvic width were measured in 8 patients and compared with the measurements of a control group of males without TDB. Patients with TDB had large iliopsoas muscles and narrow pelves compared with the control group. The psoas muscle width/pelvic width ratio was significantly greater (p < 0.0005) in patients with TDB than in the control group, with values of 1.04 + 0.05 and 0.82 + 0.09, respectively. It is concluded that TDB is not an uncommon normal variant in black males. Both iliopsoas muscle hypertrophy and a narrow pelvis are factors that predispose a patient to TDB

  12. Sewage sludge additive

    Science.gov (United States)

    Kalvinskas, J. J.; Mueller, W. A.; Ingham, J. D. (Inventor)

    1980-01-01

    The additive is for a raw sewage treatment process of the type where settling tanks are used for the purpose of permitting the suspended matter in the raw sewage to be settled as well as to permit adsorption of the dissolved contaminants in the water of the sewage. The sludge, which settles down to the bottom of the settling tank is extracted, pyrolyzed and activated to form activated carbon and ash which is mixed with the sewage prior to its introduction into the settling tank. The sludge does not provide all of the activated carbon and ash required for adequate treatment of the raw sewage. It is necessary to add carbon to the process and instead of expensive commercial carbon, coal is used to provide the carbon supplement.

  13. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Science.gov (United States)

    Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

    2011-01-01

    Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  14. Allelic variation of the Waxy gene in foxtail millet [Setaria italica (L.) P. Beauv.] by single nucleotide polymorphisms.

    Science.gov (United States)

    Van, K; Onoda, S; Kim, M Y; Kim, K D; Lee, S-H

    2008-03-01

    The Waxy (Wx) gene product controls the formation of a straight chain polymer of amylose in the starch pathway. Dominance/recessiveness of the Wx allele is associated with amylose content, leading to non-waxy/waxy phenotypes. For a total of 113 foxtail millet accessions, agronomic traits and the molecular differences of the Wx gene were surveyed to evaluate genetic diversities. Molecular types were associated with phenotypes determined by four specific primer sets (non-waxy, Type I; low amylose, Type VI; waxy, Type IV or V). Additionally, the insertion of transposable element in waxy was confirmed by ex1/TSI2R, TSI2F/ex2, ex2int2/TSI7R and TSI7F/ex4r. Seventeen single nucleotide polymorphims (SNPs) were observed from non-coding regions, while three SNPs from coding regions were non-synonymous. Interestingly, the phenotype of No. 88 was still non-waxy, although seven nucleotides (AATTGGT) insertion at 2,993 bp led to 78 amino acids shorter. The rapid decline of r (2) in the sequenced region (exon 1-intron 1-exon 2) suggested a low level of linkage disequilibrium and limited haplotype structure. K (s) values and estimation of evolutionary events indicate early divergence of S. italica among cereal crops. This study suggested the Wx gene was one of the targets in the selection process during domestication.

  15. Nucleotides, micro- and macro-nutrients, limonoids, flavonoids, and hydroxycinnamates composition in the phloem sap of sweet orange

    Science.gov (United States)

    Hijaz, Faraj; Manthey, John A.; Van der Merwe, Deon; Killiny, Nabil

    2016-01-01

    ABSTRACT Currently, the global citrus production is declining due to the spread of Huanglongbing (HLB). HLB, otherwise known as citrus greening, is caused by Candidatus Liberibacter asiaticus (CLas) and is transmitted by the Asian citrus psyllids (ACP), Diaphorina citri Kuwayama. ACP transmits CLas bacterium while feeding on the citrus phloem sap. Multiplication of CLas in the phloem of citrus indicates that the sap contains all the essential nutrients needed for CLas. In this study, we investigated the micro- and macro-nutrients, nucleotides, and others secondary metabolites of phloem sap from pineapple sweet orange. The micro- and macro-nutrients were analyzed using inductively coupled plasma-mass spectroscopy (ICP-MS) and inductively coupled plasma-optical emission spectroscopy (ICP-OES). Nucleotides and other secondary metabolites analysis was accomplished by reversed phase HPLC coupled with UV, fluorescence detection, or negative mode electrospray ionization mass spectrometry (ESI-MS). Calcium (89 mM) was the highest element followed by potassium (38.8 mM) and phosphorous (24 mM). Magnesium and sulfur were also abundant and their concentrations were 15 and 9 mM, respectively. The rest of the elements were found in low amounts (flavonoids. In addition, several hydroxycinnamates were detected. The results of this study will increase our knowledge about the nature and the chemical composition of citrus phloem sap. PMID:27171979

  16. Dopa-responsive dystonia: functional analysis of single nucleotide substitutions within the 5' untranslated GCH1 region.

    Directory of Open Access Journals (Sweden)

    Ioanna A Armata

    Full Text Available BACKGROUND: Mutations in the GCH1 gene are associated with childhood onset, dopa-responsive dystonia (DRD. Correct diagnosis of DRD is crucial, given the potential for complete recovery once treated with L-dopa. The majority of DRD associated mutations lie within the coding region of the GCH1 gene, but three additional single nucleotide sequence substitutions have been reported within the 5' untranslated (5'UTR region of the mRNA. The biologic significance of these 5'UTR GCH1 sequence substitutions has not been analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Luciferase reporter assays, quantitative real time PCR and RNA decay assays, combined with bioinformatics, revealed a pathogenic 5'UTR GCH1 substitution. The +142C>T single nucleotide 5'UTR substitution that segregates with affected status in DRD patients, substantially attenuates translation without altering RNA expression levels or stability. The +142C>T substitution disrupts translation most likely by creating an upstream initiation start codon (uAUG and an upstream open reading frame (uORF. CONCLUSIONS/SIGNIFICANCE: This is the first GCH1 regulatory substitution reported to act at a post-transcriptional level, increasing the list of genetic diseases caused by abnormal translation and reaffirming the importance of investigating potential regulatory substitutions in genetic diseases.

  17. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Science.gov (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.

    2014-01-01

    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  18. Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A

    1987-10-01

    The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

  19. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

    Science.gov (United States)

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

    2010-11-19

    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  20. Identification of novel single nucleotide polymorphisms associated with acute respiratory distress syndrome by exome-seq.

    Directory of Open Access Journals (Sweden)

    Katherine Shortt

    Full Text Available Acute respiratory distress syndrome (ARDS is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719 in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T occurs within a histone mark (intron 6 of the Arylsulfatase D gene. rs9605146 (G>A causes a deleterious coding change (proline to leucine in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted.

  1. Role of a guanine nucleotide-binding protein in α1-adrenergic receptor-mediated Ca2+ mobilization in DDT1 MF-2 cells

    International Nuclear Information System (INIS)

    Cornett, L.E.; Norris, J.S.

    1987-01-01

    In this study the mechanisms involved in α 1 -adrenergic receptor-mediated Ca 2+ mobilization at the level of the plasma membrane were investigated. Stimulation of 45 Ca 2+ efflux from saponin-permeabilized DDT 1 MF-2 cells was observed with the addition of either the α 1 -adrenergic agonist phenylephrine and guanosine-5'-triphosphate or the nonhydrolyzable guanine nucleotide guanylyl-imidodiphosphate. In the presence of [ 32 P] NAD, pertussis toxin was found to catalyze ADP-ribosylation of a M/sub r/ = 40,500 (n = 8) peptide in membranes prepared from DDT 1 , MF-2 cells, possibly the α-subunit of N/sub i/. However, stimulation of unidirectional 45 Ca 2+ efflux by phenylephrine was not affected by previous treatment of cells with 100 ng/ml pertussis toxin. These data suggest that the putative guanine nucleotide-binding protein which couples the α 1 -adrenergic receptor to Ca 2+ mobilization in DDT 1 MF-2 cells is not a pertussis toxin substrate and may possibly be an additional member of guanine nucleotide binding protein family

  2. Additive lattice kirigami.

    Science.gov (United States)

    Castle, Toen; Sussman, Daniel M; Tanis, Michael; Kamien, Randall D

    2016-09-01

    Kirigami uses bending, folding, cutting, and pasting to create complex three-dimensional (3D) structures from a flat sheet. In the case of lattice kirigami, this cutting and rejoining introduces defects into an underlying 2D lattice in the form of points of nonzero Gaussian curvature. A set of simple rules was previously used to generate a wide variety of stepped structures; we now pare back these rules to their minimum. This allows us to describe a set of techniques that unify a wide variety of cut-and-paste actions under the rubric of lattice kirigami, including adding new material and rejoining material across arbitrary cuts in the sheet. We also explore the use of more complex lattices and the different structures that consequently arise. Regardless of the choice of lattice, creating complex structures may require multiple overlapping kirigami cuts, where subsequent cuts are not performed on a locally flat lattice. Our additive kirigami method describes such cuts, providing a simple methodology and a set of techniques to build a huge variety of complex 3D shapes.

  3. Additive Manufactured Superconducting Cavities

    Science.gov (United States)

    Holland, Eric; Rosen, Yaniv; Woolleet, Nathan; Materise, Nicholas; Voisin, Thomas; Wang, Morris; Mireles, Jorge; Carosi, Gianpaolo; Dubois, Jonathan

    Superconducting radio frequency cavities provide an ultra-low dissipative environment, which has enabled fundamental investigations in quantum mechanics, materials properties, and the search for new particles in and beyond the standard model. However, resonator designs are constrained by limitations in conventional machining techniques. For example, current through a seam is a limiting factor in performance for many waveguide cavities. Development of highly reproducible methods for metallic parts through additive manufacturing, referred to colloquially as 3D printing\\x9D, opens the possibility for novel cavity designs which cannot be implemented through conventional methods. We present preliminary investigations of superconducting cavities made through a selective laser melting process, which compacts a granular powder via a high-power laser according to a digitally defined geometry. Initial work suggests that assuming a loss model and numerically optimizing a geometry to minimize dissipation results in modest improvements in device performance. Furthermore, a subset of titanium alloys, particularly, a titanium, aluminum, vanadium alloy (Ti - 6Al - 4V) exhibits properties indicative of a high kinetic inductance material. This work is supported by LDRD 16-SI-004.

  4. Nucleotide composition bias and codon usage trends of gene ...

    Indian Academy of Sciences (India)

    2015-06-10

    Jun 10, 2015 ... In a wide variety of organisms, synonymous codons are selected with different ... In addition, a series of GC skew and AT skew data was calculated for codon positions 1, ..... bias from different perspectives. Interestingly .... This study was supported by programme for Changjiang Scholars and Innovative ...

  5. FRET-based binding assay between a fluorescent cAMP analogue and a cyclic nucleotide-binding domain tagged with a CFP.

    Science.gov (United States)

    Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya

    2017-09-01

    The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.

  6. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  7. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  9. Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

    Science.gov (United States)

    Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

    2017-12-01

    Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

  10. Supramolecular Properties of Triazole-containing Two Armed Peptidomimetics: From Organogelators to Nucleotide-binding Tweezers

    Science.gov (United States)

    Chui, Tin Ki

    obtain a clearer picture on the mode of association of these two series of branched peptidomimetics, the length of the tripeptidomimetic arms was truncated to a dipeptide, and the amino acid, valine, was used for further studies. Both the two new candidates, 88-K-V2 and 89-B-V2, were shown to dimerize in chloroform as shown from vapor pressure osmometry (VPO) studies. 1H NMR titration experiments indicated a better dimerization strength for the latter candidate due to the intermolecular pi-pi interactions offered by its benzene ring in addition to the intermolecular hydrogen bonding by the amides and triazole units. H/D exchange and 2D NMR experiments, and molecular modeling revealed that 88-K-V2 dimerized through the formation of antiparallel beta-strands whereas formation of parallel beta-strands took place in 89-B-V2. Compound 88-K-V2 was found to form 1:1 complexes with chloride (Ka 640 M-1) and monobasic diethyl phosphate (DEP) ion (Ka 810 M-1) in chloroform. Interestingly, 89-B-V 2 was shown to form the usual 1:1 complex with the former ion (Ka 970 M-1) while forming an unexpected 2:1 complex with the latter with positive cooperativity. It was observed that both the amides and triazole protons were involved in anion-binding. In the 88-K-V2-DEP complex, the host formed a helix-like structure that wrapped around the anion located at the center of the complex as determined by 2D NMR and molecular modeling studies. Finally, further structural modification of 88-K-V2 gave a water-soluble nucleotide-binding tweezer 93-K-R2·4TFA . This tweezer consisted of four arginines (R), two triazole units, two pyrene probes and a small hydrophilic ethanolamine tail. Fluorescence study showed that this tweezer was able to form 1:1 complexes with different nucleotides in water with similar binding strength regardless of the number of phosphate groups present in the nucleotides. Moleular modeling suggested that such a charge-independent binding behavior was due to the similar number

  11. A nine-nucleotide deletion and splice variation in the coding region of the interferon induced ISG12 gene

    DEFF Research Database (Denmark)

    Smidt, Kamille; Hansen, Lise Lotte; Søgaard, T Max M

    2003-01-01

    distributed between ISG12 and ISG12-S in breast carcinoma cells, in cancer cell lines and in cervical cytobrush material with neoplastic lesions. In addition, we have found a nine-nucleotide deletion situated in exon 4 of the ISG12 gene. This deletion leads to a three-amino-acid deletion (AMA) in the putative...... ISG12 gene products, ISG12Δ and ISG12-SΔ. We have determined the prevalence of the deletion ISG12Δ in normal and neoplastic cells. Homozygosity ISG12(0/0) and ISG12(Δ/Δ), and heterozygosity ISG12(0/Δ) were found, although the ISG12(Δ/Δ) genotype was rare. In heterozygous cells from cytobrush material...

  12. Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Mohamed N. Saad

    2016-01-01

    Full Text Available Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field.

  13. "Plug and play" logic gates based on fluorescence switching regulated by self-assembly of nucleotide and lanthanide ions.

    Science.gov (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2014-06-25

    Molecular logic gates in response to chemical, biological, or optical input signals at a molecular level have received much interest over the past decade. Herein, we construct "plug and play" logic systems based on the fluorescence switching of guest molecules confined in coordination polymer nanoparticles generated from nucleotide and lanthanide ions. In the system, the addition of new modules directly enables new logic functions. PASS 0, YES, PASS 1, NOT, IMP, OR, and AND gates are successfully constructed in sequence. Moreover, different logic gates (AND, INH, and IMP) can be constructed using different guest molecules and the same input combinations. The work will be beneficial to the future logic design and expand the applications of coordination polymers.

  14. Structural determination of functional units of the nucleotide binding domain (NBD94 of the reticulocyte binding protein Py235 of Plasmodium yoelii.

    Directory of Open Access Journals (Sweden)

    Ardina Grüber

    2010-02-01

    Full Text Available Invasion of the red blood cells (RBC by the merozoite of malaria parasites involves a large number of receptor ligand interactions. The reticulocyte binding protein homologue family (RH plays an important role in erythrocyte recognition as well as virulence. Recently, it has been shown that members of RH in addition to receptor binding may also have a role as ATP/ADP sensor. A 94 kDa region named Nucleotide-Binding Domain 94 (NBD94 of Plasmodium yoelii YM, representative of the putative nucleotide binding region of RH, has been demonstrated to bind ATP and ADP selectively. Binding of ATP or ADP induced nucleotide-dependent structural changes in the C-terminal hinge-region of NBD94, and directly impacted on the RBC binding ability of RH.In order to find the smallest structural unit, able to bind nucleotides, and its coupling module, the hinge region, three truncated domains of NBD94 have been generated, termed NBD94(444-547, NBD94(566-663 and NBD94(674-793, respectively. Using fluorescence correlation spectroscopy NBD94(444-547 has been identified to form the smallest nucleotide binding segment, sensitive for ATP and ADP, which became inhibited by 4-Chloro-7-nitrobenzofurazan. The shape of NBD94(444-547 in solution was calculated from small-angle X-ray scattering data, revealing an elongated molecule, comprised of two globular domains, connected by a spiral segment of about 73.1 A in length. The high quality of the constructs, forming the hinge-region, NBD94(566-663 and NBD94(674-793 enabled to determine the first crystallographic and solution structure, respectively. The crystal structure of NBD94(566-663 consists of two helices with 97.8 A and 48.6 A in length, linked by a loop. By comparison, the low resolution structure of NBD94(674-793 in solution represents a chair-like shape with three architectural segments.These structures give the first insight into how nucleotide binding impacts on the overall structure of RH and demonstrates the

  15. Reversal of Proximal Renal Tubular Dysfunction after Nucleotide Analogue Withdrawal in Chronic Hepatitis B

    Directory of Open Access Journals (Sweden)

    Abhasnee Sobhonslidsuk

    2017-01-01

    Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.

  16. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.

    2008-01-01

    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  17. Exposure of Human Lung Cells to Tobacco Smoke Condensate Inhibits the Nucleotide Excision Repair Pathway.

    Directory of Open Access Journals (Sweden)

    Nathaniel Holcomb

    Full Text Available Exposure to tobacco smoke is the number one risk factor for lung cancer. Although the DNA damaging properties of tobacco smoke have been well documented, relatively few studies have examined its effect on DNA repair pathways. This is especially true for the nucleotide excision repair (NER pathway which recognizes and removes many structurally diverse DNA lesions, including those introduced by chemical carcinogens present in tobacco smoke. The aim of the present study was to investigate the effect of tobacco smoke on NER in human lung cells. We studied the effect of cigarette smoke condensate (CSC, a surrogate for tobacco smoke, on the NER pathway in two different human lung cell lines; IMR-90 lung fibroblasts and BEAS-2B bronchial epithelial cells. To measure NER, we employed a slot-blot assay to quantify the introduction and removal of UV light-induced 6-4 photoproducts and cyclobutane pyrimidine dimers. We find a dose-dependent inhibition of 6-4 photoproduct repair in both cell lines treated with CSC. Additionally, the impact of CSC on the abundance of various NER proteins and their respective RNAs was investigated. The abundance of XPC protein, which is required for functional NER, is significantly reduced by treatment with CSC while the abundance of XPA protein, also required for NER, is unaffected. Both XPC and XPA RNA levels are modestly reduced by CSC treatment. Finally, treatment of cells with MG-132 abrogates the reduction in the abundance of XPC protein produced by treatment with CSC, suggesting that CSC enhances proteasome-dependent turnover of the protein that is mediated by ubiquitination. Together, these findings indicate that tobacco smoke can inhibit the same DNA repair pathway that is also essential for the removal of some of the carcinogenic DNA damage introduced by smoke itself, increasing the DNA damage burden of cells exposed to tobacco smoke.

  18. Identification of single nucleotide polymorphisms associated with hyperproduction of alpha-toxin in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Xudong Liang

    2011-04-01

    Full Text Available The virulence factor α-toxin (hla is needed by Staphylococcus aureus in order to cause infections in both animals and humans. Although the complicated regulation of hla expression has been well studied in human S. aureus isolates, the mechanisms of of hla regulation in bovine S. aureus isolates remain undefined. In this study, we found that many bovine S. aureus isolates, including the RF122 strain, generate dramatic amounts of α-toxin in vitro compared with human clinical S. aureus isolates, including MRSA WCUH29 and MRSA USA300. To elucidate potential regulatory mechanisms, we analyzed the hla promoter regions and identified predominant single nucleotide polymorphisms (SNPs at positions -376, -483, and -484 from the start codon in α-toxin hyper-producing isolates. Using site-directed mutagenesis and hla promoter-gfp-luxABCDE dual reporter approaches, we demonstrated that the SNPs contribute to the differential control of hla expression among bovine and human S. aureus isolates. Using a DNA affinity assay, gel-shift assays and a null mutant, we identified and revealed that an hla positive regulator, SarZ, contributes to the involvement of the SNPs in mediating hla expression. In addition, we found that the bovine S. aureus isolate RF122 exhibits higher transcription levels of hla positive regulators, including agrA, saeR, arlR and sarZ, but a lower expression level of hla repressor rot compared to the human S. aureus isolate WCUH29. Our results indicate α-toxin hyperproduction in bovine S. aureus is a multifactorial process, influenced at both the genomic and transcriptional levels. Moreover, the identification of predominant SNPs in the hla promoter region may provide a novel method for genotyping the S. aureus isolates.

  19. Association of Nucleotide-binding Oligomerization Domain Receptors with Peptic Ulcer and Gastric Cancer.

    Science.gov (United States)

    Mohammadian Amiri, Rajeeh; Tehrani, Mohsen; Taghizadeh, Shirin; Shokri-Shirvani, Javad; Fakheri, Hafez; Ajami, Abolghasem

    2016-10-01

    Host innate immunity can affect the clinical outcomes of Helicobacter pylori infection, including gastritis, gastric ulcer, gastric adenocarcinoma, and MALT lymphoma. Nucleotide binding oligomerization domain (NOD)-1 and -2 are two molecules of innate immunity which are involved in the host defense against H. pylori. This study aimed to evaluate the effect of the expression level of NOD1 and NOD2 on the susceptibility to gastric cancer as well as peptic ulcer in individuals with H. pylori infection. The gene expression levels of these molecules were compared in three groups of non-ulcer dyspepsia (NUD) as a control group (n=52); peptic ulcer disease (PUD), (n=53); and gastric cancer (GC), (n=39). Relative expression levels of NOD1 in patients with GC were higher than those of NUD and PUD (p<0.001 and P<0.001, respectively). Similarly in case of NOD1, PUD group showed higher level of expression than NUD group (p<0.01). However, there was no significant difference between H. pylori -positive and -negative patients in NUD, PUD, or GC groups. Moreover, the expression levels of NOD2 showed no significant difference among NUD, PUD, or GC groups, while among H. pylori-positive patients, it was higher in GC group than NUD  and PUD groups (p<0.05 and p<0.01, respectively). In addition, positive correlation coefficients were attained between NOD1 and NOD2 expressions in patients with NUD (R2 Linear=0.349, p<0.001), PUD (R2 Linear=0.695, p<0.001), and GC (R2 Linear=0.385, p<0.001). Collectively, the results suggest that the chronic activation of NOD1 and NOD2 receptors might play a role in the development of gastric cancer.

  20. Transduction proteins of olfactory receptor cells: identification of guanine nucleotide binding proteins and protein kinase C

    International Nuclear Information System (INIS)

    Anholt, R.R.H.; Mumby, S.M.; Stoffers, D.A.; Girard, P.R.; Kuo, J.F.; Snyder, S.H.

    1987-01-01

    The authors have analyzed guanine nucleotide binding proteins (G-proteins) in the olfactory epithelium of Rana catesbeiana using subunit-specific antisera. The olfactory epithelium contained the α subunits of three G-proteins, migrating on polyacrylamide gels in SDS with apparent molecular weights of 45,000, 42,000, and 40,000, corresponding to G/sub s/, G/sub i/, and G/sub o/, respectively. A single β subunit with an apparent molecular weight of 36,000 was detected. An antiserum against the α subunit of retinal transducin failed to detect immunoreactive proteins in olfactory cilia detached from the epithelium. The olfactory cilia appeared to be enriched in immunoreactive G/sub sα/ relative to G/sub ichemical bond/ and G/sub ochemical bond/ when compared to membranes prepared from the olfactory epithelium after detachment of the cilia. Bound antibody was detected by autoradiography after incubation with [ 125 I]protein. Immunohistochemical studies using an antiserum against the β subunit of G-proteins revealed intense staining of the ciliary surface of the olfactory epithelium and of the axon bundles in the lamina propria. In contrast, an antiserum against a common sequence of the α subunits preferentially stained the cell membranes of the olfactory receptor cells and the acinar cells of Bowman's glands and the deep submucosal glands. In addition to G-proteins, they have identified protein kinase C in olfactory cilia via a protein kinase C specific antiserum and via phorbol ester binding. However, in contrast to the G-proteins, protein kinase C occurred also in cilia isolated from respiratory epithelium

  1. Association of FLG single nucleotide variations with clinical phenotypes of atopic dermatitis.

    Directory of Open Access Journals (Sweden)

    Myungshin Kim

    Full Text Available FLG encodes a large protein called profilaggrin, which plays a key role in maintaining an effective skin barrier against the environment. In this study, we identified FLG single nucleotide variations (FLG-SNVs and evaluated the association of FLG-SNVs with clinical phenotypes including atopic dermatitis (AD-associated minor clinical features, presence of specific allergic sensitization, and serum parameters.Eighty-one Korean patients with AD were enrolled. AD-associated minor clinical features as well as allergic rhinitis and asthma were diagnosed by specialists. FLG-SNVs were identified by Sanger sequencing of entire exons through long-range PCR. Allergic sensitization to a specific allergen was evaluated by multiple allergen simultaneous test. Serologic parameters such as serum eosinophil cationic protein (ECP and eosinophil derived neurotoxin (EDN were measured.A total of seventy-three SNVs and 4 LOF mutations were successfully genotyped. rs71626704 and rs76413899 were significantly associated with a history of asthma and cheilitis (P = 0.002 and P = 0.033, respectively, however, the associations were not found statistically significant after adjustment by multiple comparisons. In addition, we detected haplotype blocks which were correlated with non-specific hand or foot dermatitis and scalp scale. We identified FLG-SNVs which were associated with sensitization to environmental allergens; rs62623409 and rs71625199 (P = 0.038 and P = 0.008, respectively. Patients with FLG P478S TT and history of allergic rhinitis showed a higher EDN level, and among those patients, the ones with asthma showed a higher ECP level.This study revealed the association of FLG-SNVs with AD-associated minor clinical features. We firstly identified rs71625199 which was associated with higher environmental allergic sensitization. We also suggest that FLG P478S is a kind of disease modifier which affects serologic parameters such as EDN and ECP.

  2. SNPchiMp v.3: integrating and standardizing single nucleotide polymorphism data for livestock species.

    Science.gov (United States)

    Nicolazzi, Ezequiel L; Caprera, Andrea; Nazzicari, Nelson; Cozzi, Paolo; Strozzi, Francesco; Lawley, Cindy; Pirani, Ali; Soans, Chandrasen; Brew, Fiona; Jorjani, Hossein; Evans, Gary; Simpson, Barry; Tosser-Klopp, Gwenola; Brauning, Rudiger; Williams, John L; Stella, Alessandra

    2015-04-10

    In recent years, the use of genomic information in livestock species for genetic improvement, association studies and many other fields has become routine. In order to accommodate different market requirements in terms of genotyping cost, manufacturers of single nucleotide polymorphism (SNP) arrays, private companies and international consortia have developed a large number of arrays with different content and different SNP density. The number of currently available SNP arrays differs among species: ranging from one for goats to more than ten for cattle, and the number of arrays available is increasing rapidly. However, there is limited or no effort to standardize and integrate array- specific (e.g. SNP IDs, allele coding) and species-specific (i.e. past and current assemblies) SNP information. Here we present SNPchiMp v.3, a solution to these issues for the six major livestock species (cow, pig, horse, sheep, goat and chicken). Original data was collected directly from SNP array producers and specific international genome consortia, and stored in a MySQL database. The database was then linked to an open-access web tool and to public databases. SNPchiMp v.3 ensures fast access to the database (retrieving within/across SNP array data) and the possibility of annotating SNP array data in a user-friendly fashion. This platform allows easy integration and standardization, and it is aimed at both industry and research. It also enables users to easily link the information available from the array producer with data in public databases, without the need of additional bioinformatics tools or pipelines. In recognition of the open-access use of Ensembl resources, SNPchiMp v.3 was officially credited as an Ensembl E!mpowered tool. Availability at http://bioinformatics.tecnoparco.org/SNPchimp.

  3. Retrotransposon long interspersed nucleotide element-1 (LINE-1) is activated during salamander limb regeneration

    Science.gov (United States)

    Zhu, Wei; Kuo, Dwight; Nathanson, Jason; Satoh, Akira; Pao, Gerald M.; Yeo, Gene W.; Bryant, Susan V.; Voss, S. Randal; Gardiner, David M.; Hunter, Tony

    2012-01-01

    Salamanders possess an extraordinary capacity for tissue and organ regeneration when compared to mammals. In our effort to characterize the unique transcriptional fingerprint emerging during the early phase of salamander limb regeneration, we identified transcriptional activation of some germline-specific genes within the Mexican axolotl (Ambystoma mexicanum) that is indicative of cellular reprogramming of differentiated cells into a germline-like state. In this work, we focus on one of these genes, the long interspersed nucleotide element-1 (LINE-1) retrotransposon, which is usually active in germ cells and silent in most of the somatic tissues in other organisms. LINE-1 was found to be dramatically upregulated during regeneration. In addition, higher genomic LINE-1 content was also detected in the limb regenerate when compared to that before amputation indicating that LINE-1 retrotransposition is indeed active during regeneration. Active LINE-1 retrotransposition has been suggested to have a potentially deleterious impact on genomic integrity. Silencing of activated LINE-1 by small RNAs has been reported to be part of the machinery aiming to maintain genomic integrity. Indeed, we were able to identify putative LINE-1-related piRNAs in the limb blastema. Transposable element-related piRNAs have been identified frequently in the germline in other organisms. Thus, we present here a scenario in which a unique germline-like state is established during axolotl limb regeneration, and the re-activation of LINE-1 may serve as a marker for cellular dedifferentiation in the early-stage of limb regeneration. PMID:22913491

  4. Detecting high-order interactions of single nucleotide polymorphisms using genetic programming.

    Science.gov (United States)

    Nunkesser, Robin; Bernholt, Thorsten; Schwender, Holger; Ickstadt, Katja; Wegener, Ingo

    2007-12-15

    Not individual single nucleotide polymorphisms (SNPs), but high-order interactions of SNPs are assumed to be responsible for complex diseases such as cancer. Therefore, one of the major goals of genetic association studies concerned with such genotype data is the identification of these high-order interactions. This search is additionally impeded by the fact that these interactions often are only explanatory for a relatively small subgroup of patients. Most of the feature selection methods proposed in the literature, unfortunately, fail at this task, since they can either only identify individual variables or interactions of a low order, or try to find rules that are explanatory for a high percentage of the observations. In this article, we present a procedure based on genetic programming and multi-valued logic that enables the identification of high-order interactions of categorical variables such as SNPs. This method called GPAS cannot only be used for feature selection, but can also be employed for discrimination. In an application to the genotype data from the GENICA study, an association study concerned with sporadic breast cancer, GPAS is able to identify high-order interactions of SNPs leading to a considerably increased breast cancer risk for different subsets of patients that are not found by other feature selection methods. As an application to a subset of the HapMap data shows, GPAS is not restricted to association studies comprising several 10 SNPs, but can also be employed to analyze whole-genome data. Software can be downloaded from http://ls2-www.cs.uni-dortmund.de/~nunkesser/#Software

  5. Nonrandom Distribution of miRNAs Genes and Single Nucleotide Variants in Keratoconus Loci.

    Directory of Open Access Journals (Sweden)

    Dorota M Nowak

    Full Text Available Despite numerous studies, the causes of both development and progression of keratoconus remain elusive. Previous studies of this disorder focused mainly on one or two genetic factors only. However, in the analysis of such complex diseases all potential factors should be taken into consideration. The purpose of this study was a comprehensive analysis of known keratoconus loci to uncover genetic factors involved in this disease causation in the general population, which could be omitted in the original studies. In this investigation genomic data available in various databases and experimental own data were assessed. The lists of single nucleotide variants and miRNA genes localized in reported keratoconus loci were obtained from Ensembl and miRBase, respectively. The potential impact of nonsynonymous amino acid substitutions on protein structure and function was assessed with PolyPhen-2 and SIFT. For selected protein genes the ranking was made to choose those most promising for keratoconus development. Ranking results were based on topological features in the protein-protein interaction network. High specificity for the populations in which the causative sequence variants have been identified was found. In addition, the possibility of links between previously analyzed keratoconus loci was confirmed including miRNA-gene interactions. Identified number of genes associated with oxidative stress and inflammatory agents corroborated the hypothesis of their effect on the disease etiology. Distribution of the numerous sequences variants within both exons and mature miRNA which forces you to search for a broader look at the determinants of keratoconus. Our findings highlight the complexity of the keratoconus genetics.

  6. Expression Pattern and Localization Dynamics of Guanine Nucleotide Exchange Factor RIC8 during Mouse Oogenesis.

    Directory of Open Access Journals (Sweden)

    Merly Saare

    Full Text Available Targeting of G proteins to the cell cortex and their activation is one of the triggers of both asymmetric and symmetric cell division. Resistance to inhibitors of cholinesterase 8 (RIC8, a guanine nucleotide exchange factor, activates a certain subgroup of G protein α-subunits in a receptor independent manner. RIC8 controls the asymmetric cell division in Caenorhabditis elegans and Drosophila melanogaster, and symmetric cell division in cultured mammalian cells, where it regulates the mitotic spindle orientation. Although intensely studied in mitosis, the function of RIC8 in mammalian meiosis has remained unknown. Here we demonstrate that the expression and subcellular localization of RIC8 changes profoundly during mouse oogenesis. Immunofluorescence studies revealed that RIC8 expression is dependent on oocyte growth and cell cycle phase. During oocyte growth, RIC8 is abundantly present in cytoplasm of oocytes at primordial, primary and secondary preantral follicle stages. Later, upon oocyte maturation RIC8 also populates the germinal vesicle, its localization becomes cell cycle dependent, and it associates with chromatin and the meiotic spindle. After fertilization, RIC8 protein converges to the pronuclei and is also detectable at high levels in the nucleolus precursor bodies of both maternal and paternal pronucleus. During first cleavage of zygote RIC8 localizes in the mitotic spindle and cell cortex of forming blastomeres. In addition, we demonstrate that RIC8 co-localizes with its interaction partners Gαi1/2:GDP and LGN in meiotic/mitotic spindle, cell cortex and polar bodies of maturing oocytes and zygotes. Downregulation of Ric8 by siRNA leads to interferred translocation of Gαi1/2 to cortical region of maturing oocytes and reduction of its levels. RIC8 is also expressed at high level in female reproductive organs e.g. oviduct. Therefore we suggest a regulatory function for RIC8 in mammalian gametogenesis and fertility.

  7. Genetic analysis of glucosinolate variability in broccoli florets using genome-anchored single nucleotide polymorphisms.

    Science.gov (United States)

    Brown, Allan F; Yousef, Gad G; Reid, Robert W; Chebrolu, Kranthi K; Thomas, Aswathy; Krueger, Christopher; Jeffery, Elizabeth; Jackson, Eric; Juvik, John A

    2015-07-01

    The identification of genetic factors influencing the accumulation of individual glucosinolates in broccoli florets provides novel insight into the regulation of glucosinolate levels in Brassica vegetables and will accelerate the development of vegetables with glucosinolate profiles tailored to promote human health. Quantitative trait loci analysis of glucosinolate (GSL) variability was conducted with a B. oleracea (broccoli) mapping population, saturated with single nucleotide polymorphism markers from a high-density array designed for rapeseed (Brassica napus). In 4 years of analysis, 14 QTLs were associated with the accumulation of aliphatic, indolic, or aromatic GSLs in floret tissue. The accumulation of 3-carbon aliphatic GSLs (2-propenyl and 3-methylsulfinylpropyl) was primarily associated with a single QTL on C05, but common regulation of 4-carbon aliphatic GSLs was not observed. A single locus on C09, associated with up to 40 % of the phenotypic variability of 2-hydroxy-3-butenyl GSL over multiple years, was not associated with the variability of precursor compounds. Similarly, QTLs on C02, C04, and C09 were associated with 4-methylsulfinylbutyl GSL concentration over multiple years but were not significantly associated with downstream compounds. Genome-specific SNP markers were used to identify candidate genes that co-localized to marker intervals and previously sequenced Brassica oleracea BAC clones containing known GSL genes (GSL-ALK, GSL-PRO, and GSL-ELONG) were aligned to the genomic sequence, providing support that at least three of our 14 QTLs likely correspond to previously identified GSL loci. The results demonstrate that previously identified loci do not fully explain GSL variation in broccoli. The identification of additional genetic factors influencing the accumulation of GSL in broccoli florets provides novel insight into the regulation of GSL levels in Brassicaceae and will accelerate development of vegetables with modified or enhanced GSL

  8. The low single nucleotide polymorphism heritability of plasma and saliva cortisol levels.

    Science.gov (United States)

    Neumann, Alexander; Direk, Nese; Crawford, Andrew A; Mirza, Saira; Adams, Hieab; Bolton, Jennifer; Hayward, Caroline; Strachan, David P; Payne, Erin K; Smith, Jennifer A; Milaneschi, Yuri; Penninx, Brenda; Hottenga, Jouke J; de Geus, Eco; Oldehinkel, Albertine J; van der Most, Peter J; de Rijke, Yolanda; Walker, Brian R; Tiemeier, Henning

    2017-11-01

    Cortisol is an important stress hormone affected by a variety of biological and environmental factors, such as the circadian rhythm, exercise and psychological stress. Cortisol is mostly measured using blood or saliva samples. A number of genetic variants have been found to contribute to cortisol levels with these methods. While the effects of several specific single genetic variants is known, the joint genome-wide contribution to cortisol levels is unclear. Our aim was to estimate the amount of cortisol variance explained by common single nucleotide polymorphisms, i.e. the SNP heritability, using a variety of cortisol measures, cohorts and analysis approaches. We analyzed morning plasma (n=5705) and saliva levels (n=1717), as well as diurnal saliva levels (n=1541), in the Rotterdam Study using genomic restricted maximum likelihood estimation. Additionally, linkage disequilibrium score regression was fitted on the results of genome-wide association studies (GWAS) performed by the CORNET consortium on morning plasma cortisol (n=12,597) and saliva cortisol (n=7703). No significant SNP heritability was detected for any cortisol measure, sample or analysis approach. Point estimates ranged from 0% to 9%. Morning plasma cortisol in the CORNET cohorts, the sample with the most power, had a 6% [95%CI: 0-13%] SNP heritability. The results consistently suggest a low SNP heritability of these acute and short-term measures of cortisol. The low SNP heritability may reflect the substantial environmental and, in particular, situational component of these cortisol measures. Future GWAS will require very large sample sizes. Alternatively, more long-term cortisol measures such as hair cortisol samples are needed to discover further genetic pathways regulating cortisol concentrations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Gilbert Gwendolyn L

    2008-08-01

    Full Text Available Abstract Background Streptococcus agalactiae (Group B Streptococcus (GBS is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP based method for assigning GBS isolates to multilocus sequence typing (MLST-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  10. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff

    Science.gov (United States)

    Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J.; Lu, Xiangyi; Ruden, Douglas M.

    2012-01-01

    We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w1118; iso-2; iso-3 strain and the reference y1; cn1 bw1 sp1 strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5′UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5′ and 3′ UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory. PMID:22728672

  11. Correlating single nucleotide polymorphisms in the myostatin gene with performance traits in rabbit

    Directory of Open Access Journals (Sweden)

    E.M. Abdel-Kafy

    2016-09-01

    Full Text Available The Myostatin (MSTN, or Growth and Differentiation Factor 8 (GDF8, gene has been implicated in the double muscling phenomenon, in which a series of mutations render the gene inactive and unable to properly regulate muscle fibre deposition. Single nucleotide polymorphisms (SNPs in the MSTN gene have been correlated to production traits, making it a candidate target gene to enhance livestock and fowl productivity. This study aimed to assess any association of three SNPs in the rabbit MSTN gene (c.713T>A in exon 2, c.747+34C>T in intron 2, and c.*194A>G in 3’-untranslated region and their combinations, with carcass, production and reproductive traits. The investigated traits included individual body weight, daily body weight gain, carcass traits and reproductive traits. The 3 SNPs were screened using PCR-restriction fragment length polymorphism (RFLP-based analysis and the effects of the different SNP genotypes and their combinations were estimated in a rabbit population. Additionally, additive and dominance effects were estimated for significant traits. The results found no significant association between the c.713 T>A SNP and all the examined traits. Allele T at the c.747+34C>T SNP was only significantly associated (PG, allele G was significantly associated (PG SNP also had positive effects on most carcass traits. The estimated additive genetic effect for the c.*194A>G SNP was significant (PA and c.747+34C>T, GG at the c.*194A>G SNP correlated with highest values in body weight and daily weight gain. In conclusion, the ‘G’ allele at the c.*194A>G SNP had positive effects on growth and carcass traits and so could be used as a favourable allele in planning rabbit selection. Further population-wide studies are necessary to test the association of the c.*194A>G SNP with carcass traits. We also recommend evaluation of the potential effects of the c.*194A>G SNP on MSTN gene expression.

  12. UvrD Participation in Nucleotide Excision Repair Is Required for the Recovery of DNA Synthesis following UV-Induced Damage in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Kelley N. Newton

    2012-01-01

    Full Text Available UvrD is a DNA helicase that participates in nucleotide excision repair and several replication-associated processes, including methyl-directed mismatch repair and recombination. UvrD is capable of displacing oligonucleotides from synthetic forked DNA structures in vitro and is essential for viability in the absence of Rep, a helicase associated with processing replication forks. These observations have led others to propose that UvrD may promote fork regression and facilitate resetting of the replication fork following arrest. However, the molecular activity of UvrD at replication forks in vivo has not been directly examined. In this study, we characterized the role UvrD has in processing and restoring replication forks following arrest by UV-induced DNA damage. We show that UvrD is required for DNA synthesis to recover. However, in the absence of UvrD, the displacement and partial degradation of the nascent DNA at the arrested fork occur normally. In addition, damage-induced replication intermediates persist and accumulate in uvrD mutants in a manner that is similar to that observed in other nucleotide excision repair mutants. These data indicate that, following arrest by DNA damage, UvrD is not required to catalyze fork regression in vivo and suggest that the failure of uvrD mutants to restore DNA synthesis following UV-induced arrest relates to its role in nucleotide excision repair.

  13. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    Science.gov (United States)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  14. Optimization time synthesis of nucleotide labelled [γ-32P]-ATP

    International Nuclear Information System (INIS)

    Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali

    2013-01-01

    Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  15. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  16. The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Ian R Kelsall

    Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

  17. De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.; Hood, D.A.; Terjung, R.L.

    1986-01-01

    The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14 C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14 C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types

  18. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  19. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  20. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  1. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  2. Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

    Directory of Open Access Journals (Sweden)

    Elaine C Thomas

    Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

  3. Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells

    International Nuclear Information System (INIS)

    Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.

    1986-01-01

    The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/

  4. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  5. Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

    International Nuclear Information System (INIS)

    Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

    1986-01-01

    14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

  6. De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.

    1988-01-01

    Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

  7. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  8. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    Directory of Open Access Journals (Sweden)

    Andy Hesketh

    2017-07-01

    Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

  9. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    Science.gov (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  10. Significant contribution of the 3′→5′ exonuclease activity to the high fidelity of nucleotide incorporation catalyzed by human DNA polymerase ϵ

    Science.gov (United States)

    Zahurancik, Walter J.; Klein, Seth J.; Suo, Zucai

    2014-01-01

    Most eukaryotic DNA replication is performed by A- and B-family DNA polymerases which possess a faithful polymerase activity that preferentially incorporates correct over incorrect nucleotides. Additionally, many replicative polymerases have an efficient 3′→5′ exonuclease activity that excises misincorporated nucleotides. Together, these activities contribute to overall low polymerase error frequency (one error per 106–108 incorporations) and support faithful eukaryotic genome replication. Eukaryotic DNA polymerase ϵ (Polϵ) is one of three main replicative DNA polymerases for nuclear genomic replication and is responsible for leading strand synthesis. Here, we employed pre-steady-state kinetic methods and determined the overall fidelity of human Polϵ (hPolϵ) by measuring the individual contributions of its polymerase and 3′→5′ exonuclease activities. The polymerase activity of hPolϵ has a high base substitution fidelity (10−4–10−7) resulting from large decreases in both nucleotide incorporation rate constants and ground-state binding affinities for incorrect relative to correct nucleotides. The 3′→5′ exonuclease activity of hPolϵ further enhances polymerization fidelity by an unprecedented 3.5 × 102 to 1.2 × 104-fold. The resulting overall fidelity of hPolϵ (10−6–10−11) justifies hPolϵ to be a primary enzyme to replicate human nuclear genome (0.1–1.0 error per round). Consistently, somatic mutations in hPolϵ, which decrease its exonuclease activity, are connected with mutator phenotypes and cancer formation. PMID:25414327

  11. Adenylate Nucleotides and 2,3-Biphosphoglycerate Concentration in Erythrocytes of Growing Wielkopolska Stallions

    OpenAIRE

    M. Suska; E. Skotnicka; W. Dudzińska; W. Orowicz; M. Brzezinska

    2006-01-01

    The aim of this study was to examine the relationships between the concentrations of adenylate nucleotides (ATP, ADP, AMP), total nucleotide pool (TAN), adenylate energy charge (AEC) and 2,3-biphosphoglycerate (2,3-BPG) in the erythrocytes of young horses in the period of their rapid growth and development. The studies were conducted on 10 young Wielkopolska breed stallions for two years; Group A: 1-month-old, Group B: 3-month-old, Group C: 6-month-old, Group D: 1-year-old, and Group E: 2-yea...

  12. NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

    Directory of Open Access Journals (Sweden)

    Lakshya Veer Singh

    2013-06-01

    Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

  13. Hydrolytic and alcoholytic dephosphorylation of nucleotides by acid phosphatase in the presence of ethanol.

    Science.gov (United States)

    Tomaszewski, M; Buchowicz, J

    1971-08-01

    The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.

  14. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    Science.gov (United States)

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  15. Single-Nucleotide-Polymorphism-Based Association Mapping of Dog Stereotypes

    Science.gov (United States)

    Jones, Paul; Chase, Kevin; Martin, Alan; Davern, Pluis; Ostrander, Elaine A.; Lark, Karl G.

    2008-01-01

    Phenotypic stereotypes are traits, often polygenic, that have been stringently selected to conform to specific criteria. In dogs, Canis familiaris, stereotypes result from breed standards set for conformation, performance (behaviors), etc. As a consequence, phenotypic values measured on a few individuals are representative of the breed stereotype. We used DNA samples isolated from 148 dog breeds to associate SNP markers with breed stereotypes. Using size as a trait to test the method, we identified six significant quantitative trait loci (QTL) on five chromosomes that include candidate genes appropriate to regulation of size (e.g., IGF1, IGF2BP2 SMAD2, etc.). Analysis of other morphological stereotypes, also under extreme selection, identified many additional significant loci. Less well-documented data for behavioral stereotypes tentatively identified loci for herding, pointing, boldness, and trainability. Four significant loci were identified for longevity, a breed characteristic not under direct selection, but inversely correlated with breed size. The strengths and limitations of the approach are discussed as well as its potential to identify loci regulating the within-breed incidence of specific polygenic diseases. PMID:18505865

  16. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

    Science.gov (United States)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu

    2017-01-01

    RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive

  17. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

    Directory of Open Access Journals (Sweden)

    Chandra Shekhar Pareek

    Full Text Available RNA-seq is a useful next-generation sequencing (NGS technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits.The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM SNP genotyping assay. The

  18. IL10 single nucleotide polymorphisms are related to upregulation of constitutive IL-10 production and susceptibility to Helicobacter pylori infection.

    Science.gov (United States)

    Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina

    2014-06-01

    Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.

  19. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.

    2008-08-01

    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  20. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    Science.gov (United States)

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  1. Gastroesophageal junction adenocarcinoma displays abnormalities in homologous recombination and nucleotide excision repair

    Directory of Open Access Journals (Sweden)

    Dewalt RI

    2014-02-01

    Full Text Available Robin I Dewalt,1 Kenneth A Kesler,2 Zane T Hammoud,3 LeeAnn Baldridge,4 Eyas M Hattab,4 Shadia I Jalal1,5 1Division of Hematology/Oncology, Department of Medicine, 2Cardiothoracic Division, Department of Surgery, Indiana University School of Medicine, Indianapolis, IN, USA; 3Henry Ford Hospital, Detroit, MI, USA; 4Department of Pathology and Laboratory Medicine, Indiana University School of Medicine, Indianapolis, IN, USA; 5Indiana University Melvin and Bren Simon Cancer Center, Indianapolis, IN, USA Objective: Esophageal adenocarcinoma (EAC continues to be a disease associated with high mortality. Among the factors leading to poor outcomes are innate resistance to currently available therapies, advanced stage at diagnosis, and complex biology. Platinum and ionizing radiation form the backbone of treatment for the majority of patients with EAC. Of the multiple processes involved in response to platinum chemotherapy or ionizing radiation, deoxyribonucleic acid (DNA repair has been a major player in cancer sensitivity to these agents. DNA repair defects have been described in various malignancies. The purpose of this study was to determine whether alterations in DNA repair are present in EAC compared with normal gastroesophageal tissues. Methods: We analyzed the expression of genes involved in homologous recombination (HR, nonhomologous end-joining, and nucleotide excision repair (NER pathways in 12 EAC tumor samples with their matched normal counterparts. These pathways were chosen because they are the main pathways involved in the repair of platinum- or ionizing-radiation-induced damage. In addition, abnormalities in these pathways have not been well characterized in EAC. Results: We identified increased expression of at least one HR gene in eight of the EAC tumor samples. Alterations in the expression of EME1, a structure-specific endonuclease involved in HR, were the most prevalent, with messenger (mRNA overexpression in six of the EAC samples

  2. Antimicrobial activity and mechanism of action of Nu-3, a protonated modified nucleotide

    Directory of Open Access Journals (Sweden)

    Wang Ming

    2011-01-01

    Full Text Available Abstract Background "Nubiotics" are synthetic oligonucleotides and nucleotides with nuclease-resistant backbones, and are fully protonated for enhanced ability to be taken up by bacterial cells. Nu-3 [butyl-phosphate-5'-thymidine-3'-phosphate-butyl], one of the family members of Nubiotics was efficacious in the treatment of burn-wound infections by Pseudomonas aeruginosa in mice. Subsequent studies revealed that Nu-3 had a favorable toxicological profile for use as a pharmaceutical agent. This study evaluated the antibacterial activity of Nu-3 in vitro and its efficacy as a topical antibiotic. In addition, we investigated the possible mechanisms of Nu-3 action at the levels of DNA synthesis and bacterial membrane changes. Methods Antimicrobial minimum inhibitory concentrations (MIC experiments with Nu-3 and controls were measured against a range of Gram-positive and Gram-negative bacteria, including some hospital isolates according to Clinical and Laboratory Standards Institute (CLSI guidelines. Analysis of the killing kinetics of Nu-3 was also performed against two strains (Staphylococcus aureus cvcc 2248 and Pseudomonas aeruginosa cvcc 5668. The mouse skin suture-wound infection model was used to evaluate the antibacterial activity of Nu-3. We used a 5-Bromo-2'-deoxy-uridine Labeling and Detection Kit III (Roche, Switzerland to analyze DNA replication in bacteria according to the manufacturer's instruction. The BacLight™ Bacterial Membrane Potential Kit (Invitrogen was used to measure the bacterial membrane potential in S. aureus. Results Nu-3 had a wide antibacterial spectrum to Gram-positive, Gram-negative and some resistant bacteria. The MIC values of Nu-3 against all tested MRSA and MSSA were roughly in a same range while MICs of Oxacillin and Vancomycin varied between the bacteria tested. In the mouse model of skin wound infection study, the treatment with 5% Nu-3 glycerine solution also showed comparable therapeutic effects to

  3. Association of Interleukin-1 Gene Single Nucleotide Polymorphisms with Keratoconus in Chinese Han Population.

    Science.gov (United States)

    Wang, Yani; Wei, Wei; Zhang, Changning; Zhang, XueHui; Liu, Ming; Zhu, Xiuping; Xu, Kun

    2016-05-01

    To investigate whether interleukin-1 alpha (IL1A) and interleukin-1 beta (IL1B) polymorphisms are associated with keratoconus (KC) in unrelated Chinese Han patients. The IL1A (rs2071376) and IL1B (rs1143627, rs16944) polymorphisms were genotyped in 115 unrelated Chinese Han KC patients and 101 healthy Chinese Han volunteers with the Sequenom MassARRAY RS1000. Sequenom Typer 4.0 software, PLINK 1.07, Haploview 4.0 software platform were used to analyze the allelic variants of IL1A and IL1B genes, and their association with KC risk factors were assessed. Among the variants, the three SNPs (rs2071376 in IL1A, rs1143627 and rs16944 in the promoter region of IL1B) were different between the two groups. The A allele of rs2071376 (A > C, p = 0.017, OR = 1.968, 95% C.I. 1.313-3.425), the C allele of rs1143627 (C > T, p rs16944 (A > G, p = 0.002, OR = 2.401, 95% C.I. 1.396-4.161) were associated with a increased risk of KC in Chinese Han patients. This study showed that rs2071376, rs1143627 and rs16944 had significant differences in associations between KC patients and the control group when different genotypes were analyzed in three models (dominant, recessive, and additive). In the haplotype analysis, the two single nucleotide polymorphisms (SNPs), rs1143627 and rs16944 showed strong linkage disequilibrium. In addition, Haplotype "ACA" was found to be associated with a higher risk of developing KC (OR = 12.91, p < 0.001). Keratocyte apoptosis is an initiating event in the pathogenesis of KC which could be induced by the altered levels of IL1 gene. These findings confirmed that polymorphisms in IL1 genes were associated with risk of KC in the Chinese Han population, which help us to gain insight into the pathogenesis of KC.

  4. Cohort analysis of a single nucleotide polymorphism on DNA chips.

    Science.gov (United States)

    Schwonbeck, Susanne; Krause-Griep, Andrea; Gajovic-Eichelmann, Nenad; Ehrentreich-Förster, Eva; Meinl, Walter; Glatt, Hansrüdi; Bier, Frank F

    2004-11-15

    A method has been developed to determine SNPs on DNA chips by applying a flow-through bioscanner. As a practical application we demonstrated the fast and simple SNP analysis of 24 genotypes in an array of 96 spots with a single hybridisation and dissociation experiment. The main advantage of this methodical concept is the parallel and fast analysis without any need of enzymatic digestion. Additionally, the DNA chip format used is appropriate for parallel analysis up to 400 spots. The polymorphism in the gene of the human phenol sulfotransferase SULT1A1 was studied as a model SNP. Biotinylated PCR products containing the SNP (The SNP summary web site: ) (mutant) and those containing no mutation (wild-type) were brought onto the chips coated with NeutrAvidin using non-contact spotting. This was followed by an analysis which was carried out in a flow-through biochip scanner while constantly rinsing with buffer. After removing the non-biotinylated strand a fluorescent probe was hybridised, which is complementary to the wild-type sequence. If this probe binds to a mutant sequence, then one single base is not fully matching. Thereby, the mismatched hybrid (mutant) is less stable than the full-matched hybrid (wild-type). The final step after hybridisation on the chip involves rinsing with a buffer to start dissociation of the fluorescent probe from the immobilised DNA strand. The online measurement of the fluorescence intensity by the biochip scanner provides the possibility to follow the kinetics of the hybridisation and dissociation processes. According to the different stability of the full-match and the mismatch, either visual discrimination or kinetic analysis is possible to distinguish SNP-containing sequence from the wild-type sequence.

  5. Single-Nucleotide Variations in Cardiac Arrhythmias: Prospects for Genomics and Proteomics Based Biomarker Discovery and Diagnostics

    Directory of Open Access Journals (Sweden)

    Ayman Abunimer

    2014-03-01

    Full Text Available Cardiovascular diseases are a large contributor to causes of early death in developed countries. Some of these conditions, such as sudden cardiac death and atrial fibrillation, stem from arrhythmias—a spectrum of conditions with abnormal electrical activity in the heart. Genome-wide association studies can identify single nucleotide variations (SNVs that may predispose individuals to developing acquired forms of arrhythmias. Through manual curation of published genome-wide association studies, we have collected a comprehensive list of 75 SNVs associated with cardiac arrhythmias. Ten of the SNVs result in amino acid changes and can be used in proteomic-based detection methods. In an effort to identify additional non-synonymous mutations that affect the proteome, we analyzed the post-translational modification S-nitrosylation, which is known to affect cardiac arrhythmias. We identified loss of seven known S-nitrosylation sites due to non-synonymous single nucleotide variations (nsSNVs. For predicted nitrosylation sites we found 1429 proteins where the sites are modified due to nsSNV. Analysis of the predicted S-nitrosylation dataset for over- or under-representation (compared to the complete human proteome of pathways and functional elements shows significant statistical over-representation of the blood coagulation pathway. Gene Ontology (GO analysis displays statistically over-represented terms related to muscle contraction, receptor activity, motor activity, cystoskeleton components, and microtubule activity. Through the genomic and proteomic context of SNVs and S-nitrosylation sites presented in this study, researchers can look for variation that can predispose individuals to cardiac arrhythmias. Such attempts to elucidate mechanisms of arrhythmia thereby add yet another useful parameter in predicting susceptibility for cardiac diseases.

  6. Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase.

    Science.gov (United States)

    Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S

    2003-05-01

    Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

  7. Assessment of single nucleotide polymorphisms in screening 52 DNA repair and cell cycle control genes in Fanconi anemia patients

    Directory of Open Access Journals (Sweden)

    Petrović Sandra

    2015-01-01

    Full Text Available Fanconi anemia (FA is a rare genetically heterogeneous disorder associated with bone marrow failure, birth defects and cancer susceptibility. Apart from the disease- causing mutations in FANC genes, the identification of specific DNA variations, such as single nucleotide polymorphisms (SNPs, in other candidate genes may lead to a better clinical description of this condition enabling individualized treatment with improvement of the prognosis. In this study, we have assessed 95 SNPs located in 52 key genes involved in base excision repair (BER, nucleotide excision repair (NER, mismatch repair (MMR, double strand break (DSB repair and cell cycle control using a DNA repair chip (Asper Biotech, Estonia which includes most of the common variants for the candidate genes. The SNP genotyping was performed in five FA-D2 patients and in one FA-A patient. The polymorphisms studied were synonymous (n=10, nonsynonymous (missense (n=52 and in non-coding regions of the genome (introns and 5 ‘and 3’ untranslated regions (UTR (n=33. Polymorphisms found at the homozygous state are selected for further analysis. Our results have shown a significant inter-individual variability among patients in the type and the frequency of SNPs and also elucidate the need for further studies of polymorphisms located in ATM, APEX APE 1, XRCC1, ERCC2, MSH3, PARP4, NBS1, BARD1, CDKN1B, TP53 and TP53BP1 which may be of great importance for better clinical description of FA. In addition, the present report recommends the use of SNPs as predictive and prognostic genetic markers to individualize therapy of FA patients. [Projekat Ministarstva nauke Republike Srbije, br. 173046

  8. Association of STAT4 gene single nucleotide polymorphisms with Iranian juvenile-onset systemic lupus erythematosus patients.

    Science.gov (United States)

    Salmaninejad, Arash; Mahmoudi, Mahdi; Aslani, Saeed; Poursani, Shiva; Ziaee, Vahid; Rezaei, Nima

    2017-01-01

    Salmaninejad A, Mahmoudi M, Aslani S, Poursani S, Ziaee V, Rezaei N. Association of STAT4 gene single nucleotide polymorphisms with Iranian juvenile-onset systemic lupus erythematosus patients. Turk J Pediatr 2017; 59: 144-149. Juvenile-onset systemic lupus erythematosus (JSLE) is a complex autoimmune disease, characterized by multi-organ involvement. Single nucleotide polymorphisms (SNPs) of signal transducer and activator of transcription 4 (STAT4) gene have been reported to have relationship with the risk of several autoimmune diseases. Studies have provided evidence that STAT4 may participate in the pathogenesis of JSLE. Therefore, we aimed to evaluate the association of STAT4 SNPs with JSLE in Iranian population. In this case-control study, two SNPs of STAT4 gene, including rs7574865 and rs7601754 were genotyped in 50 Iranian JSLE patients and 281 matched healthy individuals using real-time PCR allelic discrimination approach. Our experiments demonstrated that G and T alleles of rs7574865 SNP had similar distribution between patients and controls (P = 0.16). Additionally, differences in frequency of GG, GT, and TT genotypes (P = 0.14, 0.29, and 0.54, respectively) were not significant. Likewise, A and G alleles, as well as genotypes of rs7601754 SNP did not show significant differences between JSLE patients and healthy individuals. Lack of association of rs7574865 and rs7601754 SNPs in STAT4 gene with susceptibility to JSLE in Iranian population, despite their association with the risk of adult SLE in the same population, implicates on difference of genetic background of JSLE and SLE.

  9. Nucleotide composition of the Zika virus RNA genome and its codon usage

    NARCIS (Netherlands)

    van Hemert, Formijn; Berkhout, Ben

    2016-01-01

    RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

  10. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  11. Building the library of RNA 3D nucleotide conformations using the clustering approach

    Directory of Open Access Journals (Sweden)

    Zok Tomasz

    2015-09-01

    Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.

  12. Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

    International Nuclear Information System (INIS)

    Welin, Martin; Nordlund, Paer

    2010-01-01

    Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

  13. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  14. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  15. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam; Gehring, Christoph A; Berkowitz, Gerald A.

    2012-01-01

    , including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a

  16. 2′-O-methyl nucleotide modified DNA substrates influence the ...

    Indian Academy of Sciences (India)

    2014-07-18

    Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

  17. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik

    2003-01-01

    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  18. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  19. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    Science.gov (United States)

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  20. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  1. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  2. Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.

    Science.gov (United States)

    Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka

    2014-01-01

    Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.

  3. SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

    DEFF Research Database (Denmark)

    Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin

    2015-01-01

    XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

  4. Grinding up Wheat: a Massive Loss of Nucleotide Diversity Since Domestication

    DEFF Research Database (Denmark)

    Haudry, Anabelle; Cenci, Alberto; Ravel, Catherine

    2007-01-01

    Several demographic and selective events occurred during the domestication of wheat from the allotetraploid wild emmer (Triticum turgidum ssp. dicoccoides). Cultivated wheat has since been affected by other historical events. We analyzed nucleotide diversity at 21 loci in a sample of 101 individu...

  5. A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization.

    Science.gov (United States)

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon

    2014-11-24

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  7. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas

    2013-01-01

    The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

  8. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  9. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    Science.gov (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  10. Slow spontaneous [Ca2+]i oscillations reflect nucleotide release from renal epithelia

    DEFF Research Database (Denmark)

    Geyti, Christine Stride; Odgaard, Elvin V. P.; Overgaard, Morten Thaarup

    2008-01-01

    Renal epithelia can be provoked mechanically to release nucleotides, which subsequently increases the intracellular Ca(2+) concentration [Ca(2+)](i) through activation of purinergic (P2) receptors. Cultured cells often show spontaneous [Ca(2+)](i) oscillations, a feature suggested to involve nucl...

  11. Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica

    2013-12-01

    Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

  12. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  13. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek

    2015-01-01

    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  14. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  15. Synthesis of Benzene and Pyridine 2-C-Methyl-C-ribonucleosides and -nucleotides

    Czech Academy of Sciences Publication Activity Database

    Tokarenko, Anna; Poštová Slavětínská, Lenka; Klepetářová, Blanka; Hocek, Michal

    2015-01-01

    Roč. 2015, č. 36 (2015), s. 7962-7983 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * glycosides * antiviral agents * cross - coupling Subject RIV: CC - Organic Chemistry Impact factor: 3.068, year: 2015

  16. Synthesis of Substituted Benzyl Homo-C-Ribonucleosides and -Nucleotides as Carba-Analogues of Phosphoribosylanthranilate

    Czech Academy of Sciences Publication Activity Database

    Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal

    -, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012

  17. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

    2017-01-01

    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  18. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Oligodeoxynucleotides containing 2'-amino-LNA nucleotides as constrained morpholino phosphoramidate and phosphorodiamidate monomers

    DEFF Research Database (Denmark)

    Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer

    2017-01-01

    Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...

  20. Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

    Science.gov (United States)

    Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

    1999-03-01

    The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

  1. Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal

    2012-01-01

    Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

  2. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    2017-03-02

    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  3. On the biased nucleotide composition of the human coronavirus RNA genome

    NARCIS (Netherlands)

    Berkhout, Ben; van Hemert, Formijn

    2015-01-01

    We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

  4. Enhanced activity of the purine nucleotide cycle of the exercising muscle in patients with hyperthyroidism.

    Science.gov (United States)

    Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C

    2001-05-01

    Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.

  5. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    International Nuclear Information System (INIS)

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.

    1987-01-01

    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125 I-[Tyr 1 ]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg 2+ . When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125 I-[Tyr 1 ]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor

  6. Dynamic interaction of TTDA with TFIIH is stabilized by nucleotide excision repair in living cells.

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); C. Miquel (Catherine); A.F. Theil (Arjan); P.O. Mari (Pierre-Olivier); D. Hoogstraten (Deborah); J.M.Y. Ng (Jessica); C. Dinant (Christoffel); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)

    2006-01-01

    textabstractTranscription/repair factor IIH (TFIIH) is essential for RNA polymerase II transcription and nucleotide excision repair (NER). This multi-subunit complex consists of ten polypeptides, including the recently identified small 8-kDa trichothiodystrophy group A (TTDA)/ hTFB5 protein.

  7. Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...

    African Journals Online (AJOL)

    The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...

  8. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

    Science.gov (United States)

    Kupriushkin, M S; Pyshnyĭ, D V

    2012-01-01

    Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

  9. effects of sulphur addition on addition on and mechanical properties

    African Journals Online (AJOL)

    User

    234-8034714355. 8034714355. 1. EFFECTS OF SULPHUR ADDITION ON. ADDITION ON. 2. AND MECHANICAL PROPERTIES O. 3. 4. C. W. Onyia. 5. 1DEPT. OF METALLURGICAL AND MATERIALS. 6. 2, 4DEPT. OF METALLURGICAL ...

  10. The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

    Science.gov (United States)

    Woolfitt, A R; Kellett, G L; Hoggett, J G

    1988-01-29

    The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

  11. Synthesis and biological properties of 5-azido-2'-deoxyuridine 5'-triphosphate, a photoactive nucleotide suitable for making light-sensitive DNA

    International Nuclear Information System (INIS)

    Evans, R.K.; Haley, B.E.

    1987-01-01

    A photoactive nucleotide analogue of dUTP, 5-azido-2'-deoxyuridine 5'-triphosphate (5-N 3 dUTP), was synthesized from dUMP in five steps. The key reaction in the synthesis of 5-N 3 dUTP is the nitration of dUMP in 98% yield in 5 min at 25 0 C using an excess of nitrosonium tetrafluoroborate in anhydrous dimethylformamide. Reduction of the resulting 5-nitro compound with zinc and 20 mM HCl gave 5-aminodeoxyuridine monophosphate (5-NH 2 dUMP). Diazotization of 5-NH 2 dUMP with HNO 2 followed by the addition NaN 3 to the acidic diazonium salt solution gave a photoactive nucleotide derivative in 80-90% yield. The monophosphate product was identified as 5-N 3 dUMP by proton NMR, UV, IR, and chromatographic analysis as well as by the mode of synthesis and its photosensitivity. After formation of 5-N 3 dUTP through a chemical coupling of pyrophosphate to 5-N 3 dUMP, the triphosphate form of the nucleotide was found to support DNA synthesis by Escherichia coli DNA polymerase I at a rate indistinguishable from that supported by dTTP. When UMP was used as the starting compound, 5-N 3 UTP was formed in an analogous fashion with similar yields and produced a photoactive nucleotide which is a substrate for E. coli RNA polymerase. To prepare [γ- 32 P]-5-N 3 dUTP for use as an active-site-directed photoaffinity labeling reagent, a simple method of preparing γ- 32 P-labeled pyrimidine nucleotides was developed. [γ- 32 P]-5-N 3 dUTP is an effective photoaffinity labeling reagent for DNA polymerase I and was found to bind to the active site with a 2-fold higher affinity than dTTP. The photoactivity of 5-N 3 dUMP is stable to extremes of pH, and [γ- 32 P]-5-N 3 dUTP was an effective photolabeling reagent even in the presence of 10 mM dithiothreitol

  12. DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob

    2010-01-01

    To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...

  13. Simulation of the coupling between nucleotide binding and transmembrane domains in the ABC transporter BtuCD

    DEFF Research Database (Denmark)

    Sonne, Jacob; Kandt, C.; Peters, Günther H.j.

    2007-01-01

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...

  14. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    Science.gov (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  15. A Transcriptome Map of Actinobacillus pleuropneumoniae at Single-Nucleotide Resolution Using Deep RNA-Seq.

    Directory of Open Access Journals (Sweden)

    Zhipeng Su

    Full Text Available Actinobacillus pleuropneumoniae is the pathogen of porcine contagious pleuropneumoniae, a highly contagious respiratory disease of swine. Although the genome of A. pleuropneumoniae was sequenced several years ago, limited information is available on the genome-wide transcriptional analysis to accurately annotate the gene structures and regulatory elements. High-throughput RNA sequencing (RNA-seq has been applied to study the transcriptional landscape of bacteria, which can efficiently and accurately identify gene expression regions and unknown transcriptional units, especially small non-coding RNAs (sRNAs, UTRs and regulatory regions. The aim of this study is to comprehensively analyze the transcriptome of A. pleuropneumoniae by RNA-seq in order to improve the existing genome annotation and promote our understanding of A. pleuropneumoniae gene structures and RNA-based regulation. In this study, we utilized RNA-seq to construct a single nucleotide resolution transcriptome map of A. pleuropneumoniae. More than 3.8 million high-quality reads (average length ~90 bp from a cDNA library were generated and aligned to the reference genome. We identified 32 open reading frames encoding novel proteins that were mis-annotated in the previous genome annotations. The start sites for 35 genes based on the current genome annotation were corrected. Furthermore, 51 sRNAs in the A. pleuropneumoniae genome were discovered, of which 40 sRNAs were never reported in previous studies. The transcriptome map also enabled visualization of 5'- and 3'-UTR regions, in which contained 11 sRNAs. In addition, 351 operons covering 1230 genes throughout the whole genome were identified. The RNA-Seq based transcriptome map validated annotated genes and corrected annotations of open reading frames in the genome, and led to the identification of many functional elements (e.g. regions encoding novel proteins, non-coding sRNAs and operon structures. The transcriptional units

  16. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  17. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  18. ADDITIVES USED TO OBTAIN FOOD

    Directory of Open Access Journals (Sweden)

    Dorina Ardelean

    2012-01-01

    Full Text Available Use of food additives in food is determined by the growth of contemporary food needs of the world population. Additives used in food, both natural and artificial ones, contribute to: improving the organoleptic characteristics and to preserve the food longer, but we must not forget that all these additives should not be found naturally in food products. Some of these additives are not harmful and human pests in small quantities, but others may have harmful effects on health.

  19. RINL, guanine nucleotide exchange factor Rab5-subfamily, is involved in the EphA8-degradation pathway with odin.

    Directory of Open Access Journals (Sweden)

    Hiroaki Kajiho

    Full Text Available The Rab family of small guanosine triphosphatases (GTPases plays a vital role in membrane trafficking. Its active GTP-bound state is driven by guanine nucleotide-exchange factors (GEFs. Ras and Rab interactor (or Ras interaction/interference-like (RINL, which contains a conserved VPS9 domain critical for GEF action, was recently identified as a new Rab5 subfamily GEF in vitro. However, its detailed function and interacting molecules have not yet been fully elucidated. Here we found that RINL has GEF activity for the Rab5 subfamily proteins by measuring their GTP-bound forms in cultured cells. We also found that RINL interacts with odin, a member of the ankyrin-repeat and sterile-alpha motif (SAM domain-containing (Anks protein family. In addition, the Eph tyrosine kinase receptor EphA8 formed a ternary complex with both RINL and odin. Interestingly, RINL expression in cultured cells reduced EphA8 levels in a manner dependent on both its GEF activity and interaction with odin. In addition, knockdown of RINL increased EphA8 level in HeLa cells. Our findings suggest that RINL, as a GEF for Rab5 subfamily, is implicated in the EphA8-degradation pathway via its interaction with odin.

  20. Studies on the production of endogenous pyrogen by rabbit monocytes: the role of calcium and cyclic nucleotides.

    Science.gov (United States)

    Sigal, S L; Duff, G W; Atkins, E

    1985-01-01

    Rabbit monocytes stimulated with endotoxin produced endogenous pyrogen, even under conditions of high or low extracellular calcium concentrations. Maximal production occurred when the concentration was in the near-physiological range. Prolonged incubation of cells with a calcium chelator prevented subsequent activation with endotoxin, an effect which was rapidly reversible by re-addition of calcium but not other cations. Addition of small amounts of lanthanum, which acts as a calcium channel blocker, prevented the restoration of pyrogen production, indicating that entry of the added calcium into the monocyte was required. Incorporation of a calcium ionophore into the cell membrane did not stimulate pyrogen production, and no measurable influx or efflux of calcium occurred during stimulation with endotoxin. These observations suggest that a slowly exchangeable calcium pool is necessary for the production of endogenous pyrogen, but that a rise in intracellular calcium is not by itself a necessary or sufficient stimulus. This stands in contrast to other biological systems in which Ca2+ directly couples stimulus and hormone secretion. Incubation of cells with agents shown to increase cyclic 3',5' AMP or cyclic 3',5' GMP levels in monocytes similarly did not stimulate pyrogen production or modulate its production by endotoxin stimulation. Thus, cyclic nucleotides also did not play a detectable role as intracellular messengers in this system. Future work is required to define more clearly the mechanism for the production of endogenous pyrogen, given its marked effects on the immune system through lymphocyte activation and temperature regulation.

  1. Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene

    Directory of Open Access Journals (Sweden)

    Yang Ming

    2012-07-01

    Full Text Available Abstract Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have

  2. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  3. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  4. Effects of preservation methods on amino acids and 5'-nucleotides of Agaricus bisporus mushrooms.

    Science.gov (United States)

    Liu, Ying; Huang, Fan; Yang, Hong; Ibrahim, S A; Wang, Yan-Feng; Huang, Wen

    2014-04-15

    In this study, the proximate composition, free amino acids content and 5'-nucleotides in frozen, canned and salted Agaricus bisporus (A. bisporus) were investigated. We found that the three kinds of A. bisporus products were good sources of protein, with amount varying in the ranges of 16.54-24.35g/100g (dry weight). Freezing, canning and salting process, followed by 6months of storage led to a significant reduction in free amino acids, especially tyrosine, alanine, glutamine and cysteine. There were medium levels of MSG-like amino acids in frozen A. bisporus and canned A. bisporus, and low levels of MSG-like amino acids in salted A. bisporus. The mount of flavor 5'-nucleotides in frozen A. bisporus was higher than that of canned and salted A. bisporus. The present study thus suggests that freezing is beneficial for the preservation of A. bisporus. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Effect of ionizing radiation on calcium and cyclic nucleotides metabolism in rats of different age

    International Nuclear Information System (INIS)

    Efimova, N.I.; Libenson, S.V.

    1982-01-01

    Some features of mechanism of calcium homeostasis and cyclic nucleotide exchange breakage in case of acute radiation injury of rats of various age were studied. It is established that calcium level in blood in nonpuberal animals, calcium and cAMP excretion with urine are minimal and reach maximum at puberal age. cGMP excretion with urine and concentrational levels of cAMP and cGMP in blood do not change with age. It is shown that calcium excretion with urine decreases adaptively in conditions of acute radiation injury in rats of all age groups. Maximal shifts in cAMP/cGMP ratio were noted in nonpuberal animals, whereas maximal adaptive-compensatory abilities in the regulation system of calcium homeostasis and cyclic nucleotides are typical to adolescent puberal animals

  6. Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina

    Science.gov (United States)

    Arora, Avnish Kumar; Kamaluddin

    2009-03-01

    Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.

  7. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  8. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  9. Lack of nucleotide variability in a beetle pest with extreme inbreeding

    OpenAIRE

    Andreev, D.; Breilid, H.; Kirkendall, L.; Brun, Luc-Olivier; French-Constant, R.H.

    1998-01-01

    The coffee berry borer beetle #Hypothenemus hampei$ (Ferrari) (#Curculionidae$ : #Scolytinae$) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an usual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occuring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation i...

  10. Non-nucleotide Agonists Triggering P2X7 Receptor Activation and Pore Formation

    Directory of Open Access Journals (Sweden)

    Francesco Di Virgilio

    2018-02-01

    Full Text Available The P2X7 receptor (P2X7R is a ligand-gated plasma membrane ion channel belonging to the P2X receptor subfamily activated by extracellular nucleotides. General consensus holds that the physiological (and maybe the only agonist is ATP. However, scattered evidence generated over the last several years suggests that ATP might not be the only agonist, especially at inflammatory sites. Solid data show that NAD+ covalently modifies the P2X7R of mouse T lymphocytes, thus lowering the ATP threshold for activation. Other structurally unrelated agents have been reported to activate the P2X7R via a poorly understood mechanism of action: (a the antibiotic polymyxin B, possibly a positive allosteric P2X7R modulator, (b the bactericidal peptide LL-37, (c the amyloidogenic β peptide, and (d serum amyloid A. Some agents, such as Alu-RNA, have been suggested to activate the P2X7R acting on the intracellular N- or C-terminal domains. Mode of P2X7R activation by these non-nucleotide ligands is as yet unknown; however, these observations raise the intriguing question of how these different non-nucleotide ligands may co-operate with ATP at inflammatory or tumor sites. New information obtained from the cloning and characterization of the P2X7R from exotic mammalian species (e.g., giant panda and data from recent patch-clamp studies are strongly accelerating our understanding of P2X7R mode of operation, and may provide hints to the mechanism of activation of P2X7R by non-nucleotide ligands.

  11. Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

    Energy Technology Data Exchange (ETDEWEB)

    Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.

    2016-12-21

    Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.

  12. Calcium-dependent, cyclic nucleotide-independent steroidogenesis in the bovine placenta.

    OpenAIRE

    Shemesh, M; Hansel, W; Strauss, J F

    1984-01-01

    Dispersed bovine placental cells (fetal cotyledon and maternal caruncle) were shown to synthesize progesterone. To determine if their steroidogenic activity could be modulated by a cyclic nucleotide-mediated process, we added luteinizing hormone, 8-bromoadenosine 3',5'-monophosphate, 8-bromoguanosine 3',5'-monophosphate, adenosine, or cholera toxin to dispersed cells from placentomes of 100-283 days gestational age and examined progesterone synthesis during 3-to 16-hr incubation periods. Net ...

  13. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  14. Prolinol-based nucleoside phosphonic acids: new isosteric conformationally flexible nucleotide analogues

    Czech Academy of Sciences Publication Activity Database

    Vaněk, Václav; Buděšínský, Miloš; Rinnová, Markéta; Rosenberg, Ivan

    2009-01-01

    Roč. 65, č. 4 (2009), s. 862-876 ISSN 0040-4020 R&D Projects: GA ČR GA203/05/0827; GA MŠk(CZ) LC06077; GA MŠk LC512; GA MŠk(CZ) LC06061 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotide analogues * phosphonates * prolinol derivatives * N- alkylation Subject RIV: CC - Organic Chemistry Impact factor: 3.219, year: 2009

  15. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    International Nuclear Information System (INIS)

    Edenbrandt, C.M.; Murphy, S.

    1990-01-01

    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation

  16. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  17. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA

    OpenAIRE

    Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

  18. Mesenchymal stem cells from different murine tissues have differential capacity to metabolize extracellular nucleotides.

    Science.gov (United States)

    Iser, Isabele C; Bracco, Paula A; Gonçalves, Carlos E I; Zanin, Rafael F; Nardi, Nance B; Lenz, Guido; Battastini, Ana Maria O; Wink, Márcia R

    2014-10-01

    Mesenchymal stem cells (MSCs) have shown a great potential for cell-based therapy and many different therapeutic purposes. Despite the recent advances in the knowledge of MSCs biology, their biochemical and molecular properties are still poorly defined. Ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) and ecto-5'-nucleotidase (eNT/CD73) are widely expressed enzymes that hydrolyze extracellular nucleotides, generating an important cellular signaling cascade. Currently, studies have evidenced the relationship between the purinergic system and the development, maintenance, and differentiation of stem cells. The objective of this study is to identify the NTPDases and eNT/CD73 and compare the levels of nucleotide hydrolysis on MSCs isolated from different murine tissues (bone marrow, lung, vena cava, kidney, pancreas, spleen, skin, and adipose tissue). MSCs from all tissues investigated expressed the ectoenzymes at different levels. In MSCs from pancreas and adipose tissue, the hydrolysis of triphosphonucleosides was significantly higher when compared to the other cells. The diphosphonucleosides were hydrolyzed at a higher rate by MSC from pancreas when compared to MSC from other tissues. The differential nucleotide hydrolysis activity and enzyme expression in these cells suggests that MSCs play different roles in regulating the purinergic system in these tissues. Overall MSCs are an attractive adult-derived cell population for therapies, however, the fact that ecto-nucleotide metabolism can affect the microenvironment, modulating important events, such as immune response, makes the assessment of this metabolism an important part of the characterization of MSCs to be applied therapeutically. © 2014 Wiley Periodicals, Inc.

  19. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  20. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    Science.gov (United States)

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  1. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Single nucleotide polymorphism in Egyptian cattle insulin-like growth factor binding protein-3 gene

    Directory of Open Access Journals (Sweden)

    Othman E. Othman

    2014-12-01

    It is concluded that the IGFBP-3/HaeIII polymorphism may be utilized as a good marker for genetic differentiation between cattle animals for different body functions such as growth, metabolism, reproduction, immunity and energy balance. The nucleotide sequences of Egyptian cattle IGFBP-3 A and C alleles were submitted to GenBank with the accession numbers KF899893 and KF899894, respectively.

  3. Nucleotide homeostasis and purinergic nociceptive signaling in rat meninges in migraine-like conditions.

    Science.gov (United States)

    Yegutkin, Gennady G; Guerrero-Toro, Cindy; Kilinc, Erkan; Koroleva, Kseniya; Ishchenko, Yevheniia; Abushik, Polina; Giniatullina, Raisa; Fayuk, Dmitriy; Giniatullin, Rashid

    2016-09-01

    Extracellular ATP is suspected to contribute to migraine pain but regulatory mechanisms controlling pro-nociceptive purinergic mechanisms in the meninges remain unknown. We studied the peculiarities of metabolic and signaling pathways of ATP and its downstream metabolites in rat meninges and in cultured trigeminal cells exposed to the migraine mediator calcitonin gene-related peptide (CGRP). Under resting conditions, meningeal ATP and ADP remained at low nanomolar levels, whereas extracellular AMP and adenosine concentrations were one-two orders higher. CGRP increased ATP and ADP levels in meninges and trigeminal cultures and reduced adenosine concentration in trigeminal cells. Degradation rates for exogenous nucleotides remained similar in control and CGRP-treated meninges, indicating that CGRP triggers nucleotide release without affecting nucleotide-inactivating pathways. Lead nitrate-based enzyme histochemistry of whole mount meninges revealed the presence of high ATPase, ADPase, and AMPase activities, primarily localized in the medial meningeal artery. ATP and ADP induced large intracellular Ca(2+) transients both in neurons and in glial cells whereas AMP and adenosine were ineffective. In trigeminal glia, ATP partially operated via P2X7 receptors. ATP, but not other nucleotides, activated nociceptive spikes in meningeal trigeminal nerve fibers providing a rationale for high degradation rate of pro-nociceptive ATP. Pro-nociceptive effect of ATP in meningeal nerves was reproduced by α,β-meATP operating via P2X3 receptors. Collectively, extracellular ATP, which level is controlled by CGRP, can persistently activate trigeminal nerves in meninges which considered as the origin site of migraine headache. These data are consistent with the purinergic hypothesis of migraine pain and suggest new targets against trigeminal pain.

  4. Fluorinated Nucleotide Modifications Modulate Allele Selectivity of SNP-Targeting Antisense Oligonucleotides

    Directory of Open Access Journals (Sweden)

    Michael E. Østergaard

    2017-06-01

    Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.

  5. Porous silicon surfaces for metabonomics: Detection and identification of nucleotides without matrix interference

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, D.; Azcarate, Sabino [Dpto. de Micro y Nanotecnologias, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain); Fernandez, Jose A.; Astigarraga, Egoitz [Dpto. de Quimica Fisica, Universidad del Pais Vasco, Campus de Lejona, Lejona (Spain); Marcaide, Arrate [Dpto. de Procesos de Fabricacion, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain)

    2007-07-01

    In present work, porous silicon surfaces (PSS) have been developed for time of flight mass spectrometric experiments (TOF-MS) in the monitoring of nucleotides, commonly found as metabolites in the cell. The mass range of the studied molecules ({proportional_to} 400 amu) is common to several important messengers and other metabolites. Different porosified surfaces have been developed by means of electrochemical etching and different degree of porosity and pore size achieved as function of silicon dopant concentration, silicon resistivity, current density and the presence or absence of illumination along the process. As main conclusion, it can be said that an interesting commercial nucleotide (Cyclic adenosine monophosphate, c-AMP) has been detected on low concentrations ({proportional_to}hundreds of femtomols) for some of the fabricated porous surfaces. Taking into account that these concentrations are similar to the ones found in real samples, this result opens the possibility to the fabrication of DIOS (Desorption Ionization On Silicon) chips for the detection of nucleotides in biological fluids. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  6. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  7. Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.

    Directory of Open Access Journals (Sweden)

    Enying Zhang

    Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.

  8. The low-dose combination preparation Vertigoheel activates cyclic nucleotide pathways and stimulates vasorelaxation.

    Science.gov (United States)

    Heinle, H; Tober, C; Zhang, D; Jäggi, R; Kuebler, W M

    2010-01-01

    Vertigo of various and often unknown aetiologies has been associated with and attributed to impaired microvascular perfusion in the inner ear or the vertebrobasilar system. Vertigoheel is a low-dose combination preparation of proven value in the symptomatic treatment of vertigo. In the present study we tested the hypothesis that Vertigoheel's anti-vertiginous properties may in part be due to a vasodilatory effect exerted via stimulation of the adenylate and/or guanylate cyclase pathways. Thus, the influence of Vertigoheel or its single constituents on synthesis and degradation of cyclic nucleotides was measured. Furthermore, vessel myography was used to observe the effect of Vertigoheel on the vasoreactivity of rat carotid arteries. Vertigoheel and one of its constituents, Anamirta cocculus, stimulated adenylate cyclase activity, while another constituent, Conium maculatum, inhibited phosphodiesterase 5, suggesting that the individual constituents of Vertigoheel contribute differentially to a synergistic stimulation of cyclic nucleotide signalling pathways. In rat carotid artery rings, Vertigoheel counteracted phenylephrine-induced tonic vasoconstriction. The present data demonstrate a vasorelaxant effect of Vertigoheel that goes along with a synergistic stimulation of cyclic nucleotide pathways and may provide a mechanistic basis for the documented anti-vertiginous effects of this combination preparation.

  9. Ethanol-induced activation of adenine nucleotide turnover. Evidence for a role of acetate

    International Nuclear Information System (INIS)

    Puig, J.G.; Fox, I.H.

    1984-01-01

    Consumption of alcohol causes hyperuricemia by decreasing urate excretion and increasing its production. Our previous studies indicate that ethanol administration increases uric acid production by increasing ATP degradation to uric acid precursors. To test the hypothesis that ethanol-induced increased urate production results from acetate metabolism and enhanced adenosine triphosphate turnover, we gave intravenous sodium acetate, sodium chloride and ethanol (0.1 mmol/kg per min for 1 h) to five normal subjects. Acetate plasma levels increased from 0.04 +/- 0.01 mM (mean +/- SE) to peak values of 0.35 +/- 0.07 mM and to 0.08 +/- 0.01 mM during acetate and ethanol infusions, respectively. Urinary oxypurines increased to 223 +/- 13% and 316 +/- 44% of the base-line values during acetate and ethanol infusions, respectively. Urinary radioactivity from the adenine nucleotide pool labeled with [8-14C] adenine increased to 171 +/- 27% and to 128 +/- 8% of the base-line values after acetate and ethanol infusions. These data indicate that both ethanol and acetate increase purine nucleotide degradation by enhancing the turnover of the adenine nucleotide pool. They support the hypothesis that acetate metabolism contributes to the increased production of urate associated with ethanol intake

  10. OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

    Science.gov (United States)

    Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

    2016-02-01

    Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

  11. Endogenous adenosine produced during hypoxia attenuates neutrophil accumulation: coordination by extracellular nucleotide metabolism.

    Science.gov (United States)

    Eltzschig, Holger K; Thompson, Linda F; Karhausen, Jorn; Cotta, Richard J; Ibla, Juan C; Robson, Simon C; Colgan, Sean P

    2004-12-15

    Hypoxia is a well-documented inflammatory stimulus and results in tissue polymorphonuclear leukocyte (PMN) accumulation. Likewise, increased tissue adenosine levels are commonly associated with hypoxia, and given the anti-inflammatory properties of adenosine, we hypothesized that adenosine production via adenine nucleotide metabolism at the vascular surface triggers an endogenous anti-inflammatory response during hypoxia. Initial in vitro studies indicated that endogenously generated adenosine, through activation of PMN adenosine A(2A) and A(2B) receptors, functions as an antiadhesive signal for PMN binding to microvascular endothelia. Intravascular nucleotides released by inflammatory cells undergo phosphohydrolysis via hypoxia-induced CD39 ectoapyrase (CD39 converts adenosine triphosphate/adenosine diphosphate [ATP/ADP] to adenosine monophosphate [AMP]) and CD73 ecto-5'-nucleotidase (CD73 converts AMP to adenosine). Extensions of our in vitro findings using cd39- and cd73-null animals revealed that extracellular adenosine produced through adenine nucleotide metabolism during hypoxia is a potent anti-inflammatory signal for PMNs in vivo. These findings identify CD39 and CD73 as critical control points for endogenous adenosine generation and implicate this pathway as an innate mechanism to attenuate excessive tissue PMN accumulation.

  12. A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.

    Science.gov (United States)

    Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I

    2016-01-01

    We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.

  13. Multilocus analysis of nucleotide variation and speciation in three closely related Populus (Salicaceae) species.

    Science.gov (United States)

    Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo

    2015-10-01

    Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.

  14. Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

    International Nuclear Information System (INIS)

    Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.

    2003-01-01

    Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

  15. Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.

    Directory of Open Access Journals (Sweden)

    Waikhom Bimolata

    Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.

  16. Synthesis and degradation of cyclic nucleotides in brain after a high dose of ionizing radiation

    International Nuclear Information System (INIS)

    Hunt, W.A.; Dalton, T.K.

    1981-01-01

    Previous data from our laboratory have indicated that a high dose of ionizing radiation can deplete the cyclic nucleotides guanosine 3',5'-cyclic monophosphate (cGMP) and adenosine 3',5'-cyclic monophosphate (cAMP) on several areas of the rat brain. cGMP is more sensitive to radiation than cAMP and does not recover for at least 24 h after irradiation. The response of cAMP is transient and recovery occurs within 4 h. The purpose of the present paper is to determine whether alternations in the activity of the synthetic and degradative enzymes that regulate cyclic nucleotide levels could account for the observed effects. Guanylate and adenylate cyclase and cGMP and cAMP phosphodiesterase activities were determined 10 min after irradiation with 10,000 rad of high-energy electrons. No alteration was detected under these experimental conditions. The data suggest that the reduction in cyclic nucleotides is not a direct effect on their metabolic enzymes and is probably secondary to some as yet-undefined action of radiation on the brain

  17. The first 3':5'-cyclic nucleotide-amino acid complex: L-His-cIMP.

    Science.gov (United States)

    Slepokura, Katarzyna

    2012-08-01

    In the crystal structure of the L-His-cIMP complex, i.e. L-histidinium inosine 3':5'-cyclic phosphate [systematic name: 5-(2-amino-2-carboxyethyl)-1H-imidazol-3-ium 7-hydroxy-2-oxo-6-(6-oxo-6,9-dihydro-1H-purin-9-yl)-4a,6,7,7a-tetrahydro-4H-1,3,5,2λ(5)-furo[3,2-d][1,3,2λ(5)]dioxaphosphinin-2-olate], C(6)H(10)N(3)O(2)(+)·C(10)H(10)N(4)O(7)P(-), the Hoogsteen edge of the hypoxanthine (Hyp) base of cIMP and the Hyp face are engaged in specific amino acid-nucleotide (His···cIMP) recognition, i.e. by abutting edge-to-edge and by π-π stacking, respectively. The Watson-Crick edge of Hyp and the cIMP phosphate group play a role in nonspecific His···cIMP contacts. The interactions between the cIMP anions (anti/C3'-endo/trans-gauche/chair conformers) are realized mainly between riboses and phosphate groups. The results for this L-His-cIMP complex, compared with those for the previously reported solvated L-His-IMP crystal structure, indicate a different nature of amino acid-nucleotide recognition and interactions upon the 3':5'-cyclization of the nucleotide phosphate group.

  18. Pulmonary preservation studies: effects on endothelial function and pulmonary adenine nucleotides.

    Science.gov (United States)

    Paik, Hyo Chae; Hoffmann, Steven C; Egan, Thomas M

    2003-02-27

    Lung transplantation is an effective therapy plagued by a high incidence of early graft dysfunction, in part because of reperfusion injury. The optimal preservation solution for lung transplantation is unknown. We performed experiments using an isolated perfused rat lung model to test the effect of lung preservation with three solutions commonly used in clinical practice. Lungs were retrieved from Sprague-Dawley rats and flushed with one of three solutions: modified Euro-Collins (MEC), University of Wisconsin (UW), or low potassium dextran and glucose (LPDG), then stored cold for varying periods before reperfusion with Earle's balanced salt solution using the isolated perfused rat lung model. Outcome measures were capillary filtration coefficient (Kfc), wet-to-dry weight ratio, and lung tissue levels of adenine nucleotides and cyclic AMP. All lungs functioned well after 4 hr of storage. By 6 hr, UW-flushed lungs had a lower Kfc than LPDG-flushed lungs. After 8 hr of storage, only UW-flushed lungs had a measurable Kfc. Adenine nucleotide levels were higher in UW-flushed lungs after prolonged storage. Cyclic AMP levels correlated with Kfc in all groups. Early changes in endothelial permeability seemed to be better attenuated in lungs flushed with UW compared with LPDG or MEC; this was associated with higher amounts of adenine nucleotides. MEC-flushed lungs failed earlier than LPDG-flushed or UW-flushed lungs. The content of the solution may be more important for lung preservation than whether the ionic composition is intracellular or extracellular.

  19. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  20. Guanylic nucleotide starvation affects Saccharomyces cerevisiae mother-daughter separation and may be a signal for entry into quiescence

    Directory of Open Access Journals (Sweden)

    Sagot Isabelle

    2005-05-01

    Full Text Available Abstract Background Guanylic nucleotides are both macromolecules constituents and crucial regulators for a variety of cellular processes. Therefore, their intracellular concentration must be strictly controlled. Consistently both yeast and mammalian cells tightly correlate the transcription of genes encoding enzymes critical for guanylic nucleotides biosynthesis with the proliferation state of the cell population. Results To gain insight into the molecular relationships connecting intracellular guanylic nucleotide levels and cellular proliferation, we have studied the consequences of guanylic nucleotide limitation on Saccharomyces cerevisiae cell cycle progression. We first utilized mycophenolic acid, an immunosuppressive drug that specifically inhibits inosine monophosphate dehydrogenase, the enzyme catalyzing the first committed step in de novo GMP biosynthesis. To approach this system physiologically, we next developed yeast mutants for which the intracellular guanylic nucleotide pools can be modulated through changes of growth conditions. In both the pharmacological and genetic approaches, we found that guanylic nucleotide limitation generated a mother-daughter separation defect, characterized by cells with two unseparated daughters. We then showed that this separation defect resulted from cell wall perturbations but not from impaired cytokinesis. Importantly, cells with similar separation defects were found in a wild type untreated yeast population entering quiescence upon nutrient limitation. Conclusion Our results demonstrate that guanylic nucleotide limitation slows budding yeast cell cycle progression, with a severe pause in telophase. At the cellular level, guanylic nucleotide limitation causes the emergence of cells with two unseparated daughters. By fluorescence and electron microscopy, we demonstrate that this phenotype arises from defects in cell wall partition between mother and daughter cells. Because cells with two unseparated

  1. Color Addition and Subtraction Apps

    Science.gov (United States)

    Ruiz, Frances; Ruiz, Michael J.

    2015-01-01

    Color addition and subtraction apps in HTML5 have been developed for students as an online hands-on experience so that they can more easily master principles introduced through traditional classroom demonstrations. The evolution of the additive RGB color model is traced through the early IBM color adapters so that students can proceed step by step…

  2. How Safe Are Color Additives?

    Science.gov (United States)

    ... Linkedin Pin it Email Print Subscribe: FDA Consumer Health Information Color additives give the red tint to your fruit punch ... in Foods, Drugs, Cosmetics, and Medical Devices Color Additives: FDA's Regulatory Process and Historical Perspectives ... Health Cosmetics Dietary Supplements Drugs Food Medical Devices Nutrition ...

  3. Density measures and additive property

    OpenAIRE

    Kunisada, Ryoichi

    2015-01-01

    We deal with finitely additive measures defined on all subsets of natural numbers which extend the asymptotic density (density measures). We consider a class of density measures which are constructed from free ultrafilters on natural numbers and study a certain additivity property of such density measures.

  4. Effects of luminal flow and nucleotides on [Ca(2+)](i) in rabbit cortical collecting duct.

    Science.gov (United States)

    Woda, Craig B; Leite, Maurilo; Rohatgi, Rajeev; Satlin, Lisa M

    2002-09-01

    Nucleotide binding to purinergic P2 receptors contributes to the regulation of a variety of physiological functions in renal epithelial cells. Whereas P2 receptors have been functionally identified at the basolateral membrane of the cortical collecting duct (CCD), a final regulatory site of urinary Na(+), K(+), and acid-base excretion, controversy exists as to whether apical purinoceptors exist in this segment. Nor has the distribution of receptor subtypes present on the unique cell populations that constitute Ca(2+) the CCD been established. To examine this, we measured nucleotide-induced changes in intracellular Ca(2+) concentration ([Ca(2+)](i)) in fura 2-loaded rabbit CCDs microperfused in vitro. Resting [Ca(2+)](i) did not differ between principal and intercalated cells, averaging approximately 120 nM. An acute increase in tubular fluid flow rate, associated with a 20% increase in tubular diameter, led to increases in [Ca(2+)](i) in both cell types. Luminal perfusion of 100 microM UTP or ATP-gamma-S, in the absence of change in flow rate, caused a rapid and transient approximately fourfold increase in [Ca(2+)](i) in both cell types (P < 0.05). Luminal suramin, a nonspecific P2 receptor antagonist, blocked the nucleotide- but not flow-induced [Ca(2+)](i) transients. Luminal perfusion with a P2X (alpha,beta-methylene-ATP), P2X(7) (benzoyl-benzoyl-ATP), P2Y(1) (2-methylthio-ATP), or P2Y(4)/P2Y(6) (UDP) receptor agonist had no effect on [Ca(2+)](i). The nucleotide-induced [Ca(2+)](i) transients were inhibited by the inositol-1,4,5-triphosphate receptor blocker 2-aminoethoxydiphenyl borate, thapsigargin, which depletes internal Ca(2+) stores, luminal perfusion with a Ca(2+)-free perfusate, or the L-type Ca(2+) channel blocker nifedipine. These results suggest that luminal nucleotides activate apical P2Y(2) receptors in the CCD via pathways that require both internal Ca(2+) mobilization and extracellular Ca(2+) entry. The flow-induced rise in [Ca(2+)](i) is

  5. Regulation of formyl peptide receptor binding to rabbit neutrophil plasma membranes. Use of monovalent cations, guanine nucleotides, and bacterial toxins to discriminate among different states of the receptor

    International Nuclear Information System (INIS)

    Feltner, D.E.; Marasco, W.A.

    1989-01-01

    The regulation by monovalent cations, guanine nucleotides, and bacterial toxins of [3H]FMLP binding to rabbit neutrophil plasma membranes was studied by using dissociation techniques to identify regulatory effects on separate receptor states. Under conditions of low receptor occupancy (1 nM [3H]FMLP) and in both Na+ and K+ buffers, dissociation is heterogenous, displaying two distinct, statistically significant off rates. [3H]FMLP binding was enhanced by substituting other monovalent cations for Na+. In particular, enhanced binding in the presence of K+ relative to Na+ was caused by additional binding to both rapidly and slowly dissociating receptors. Three receptor dissociation rates, two of which appear to correspond to the two affinity states detected in equilibrium binding studies, were defined by specific GTP and pertussis toxin (PT) treatments. Neither GTP, nor PT or cholera toxins (CT) had an effect on the rate of dissociation of [3H]FMLP from the rapidly dissociating form of the receptor. Both 100 microM GTP and PT treatments increased the percentage of rapidly dissociating receptors, correspondingly decreasing the percentage of slowly dissociating receptors. The observed changes in the rapidly and slowly dissociating receptors after GTP, PT, and CT treatments were caused by an absolute decrease in the amount of binding to the slowly dissociating receptors. However, complete inhibition of slowly dissociating receptor binding by GTP, PT, or both was never observed. Both GTP and PT treatments, but not CT treatment, increased by two-fold the rate of dissociation of 1 nM [3H]FMLP from the slowly dissociating form of the receptor, resulting in a third dissociation rate. Thus, slowly dissociating receptors comprise two different receptor states, a G protein-associated guanine nucleotide and PT-sensitive state and a guanine nucleotide-insensitive state

  6. The R package otu2ot for implementing the entropy decomposition of nucleotide variation in sequence data

    Directory of Open Access Journals (Sweden)

    Alban eRamette

    2014-11-01

    Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.

  7. Glu504Lys Single Nucleotide Polymorphism of Aldehyde Dehydrogenase 2 Gene and the Risk of Human Diseases

    Directory of Open Access Journals (Sweden)

    Yan Zhao

    2015-01-01

    Full Text Available Aldehyde dehydrogenase (ALDH 2 is a mitochondrial enzyme that is known for its important role in oxidation and detoxification of ethanol metabolite acetaldehyde. ALDH2 also metabolizes other reactive aldehydes such as 4-hydroxy-2-nonenal and acrolein. The Glu504Lys single nucleotide polymorphism (SNP of ALDH2 gene, which is found in approximately 40% of the East Asian populations, causes defect in the enzyme activity of ALDH2, leading to alterations in acetaldehyde metabolism and alcohol-induced “flushing” syndrome. Evidence suggests that ALDH2 Glu504Lys SNP is a potential candidate genetic risk factor for a variety of chronic diseases such as cardiovascular disease, cancer, and late-onset Alzheimer’s disease. In addition, the association between ALDH2 Glu504Lys SNP and the development of these chronic diseases appears to be affected by the interaction between the SNP and lifestyle factors such as alcohol consumption as well as by the presence of other genetic variations.

  8. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  9. De novo Genome Assembly and Single Nucleotide Variations for Soybean Mosaic Virus Using Soybean Seed Transcriptome Data

    Directory of Open Access Journals (Sweden)

    Yeonhwa Jo

    2017-10-01

    Full Text Available Soybean is the most important legume crop in the world. Several diseases in soybean lead to serious yield losses in major soybean-producing countries. Moreover, soybean can be infected by diverse viruses. Recently, we carried out a large-scale screening to identify viruses infecting soybean using available soybean transcriptome data. Of the screened transcriptomes, a soybean transcriptome for soybean seed development analysis contains several virus-associated sequences. In this study, we identified five viruses, including soybean mosaic virus (SMV, infecting soybean by de novo transcriptome assembly followed by blast search. We assembled a nearly complete consensus genome sequence of SMV China using transcriptome data. Based on phylogenetic analysis, the consensus genome sequence of SMV China was closely related to SMV isolates from South Korea. We examined single nucleotide variations (SNVs for SMVs in the soybean seed transcriptome revealing 780 SNVs, which were evenly distributed on the SMV genome. Four SNVs, C-U, U-C, A-G, and G-A, were frequently identified. This result demonstrated the quasispecies variation of the SMV genome. Taken together, this study carried out bioinformatics analyses to identify viruses using soybean transcriptome data. In addition, we demonstrated the application of soybean transcriptome data for virus genome assembly and SNV analysis.

  10. Persistent discharges in dentate gyrus perisoma-inhibiting interneurons require hyperpolarization-activated cyclic nucleotide-gated channel activation.

    Science.gov (United States)

    Elgueta, Claudio; Köhler, Johannes; Bartos, Marlene

    2015-03-11

    Parvalbumin (PV)-expressing perisoma-inhibiting interneurons (PIIs) of the dentate gyrus integrate rapidly correlated synaptic inputs and generate short-duration action potentials that propagate along the axon to their output synapses, supporting fast inhibitory signaling onto their target cells. Here we show that PV-PIIs in rat and mouse dentate gyrus (DG) integrate their intrinsic activity over time and can turn into a persistent firing mode characterized by the ability to generate long-lasting trains of action potentials at ∼50 Hz in the absence of additional inputs. Persistent firing emerges in the axons remote from the axon initial segment and markedly depends on hyperpolarization-activated cyclic nucleotide-gated channel (HCNC) activation. Persistent firing properties are modulated by intracellular Ca(2+) levels and somatic membrane potential. Detailed computational single-cell PIIs models reveal that HCNC-mediated conductances can contribute to persistent firing during conditions of a shift in their voltage activation curve to more depolarized potentials. Paired recordings from PIIs and their target granule cells show that persistent firing supports strong inhibitory output signaling. Thus, persistent firing may emerge during conditions of intense activation of the network, thereby providing silencing to the circuitry and the maintenance of sparse activity in the dentate gyrus. Copyright © 2015 the authors 0270-6474/15/354131-09$15.00/0.

  11. Nucleotide-Binding Oligomerization Domain-1 and -2 Play No Role in Controlling Brucella abortus Infection in Mice

    Directory of Open Access Journals (Sweden)

    Fernanda S. Oliveira

    2012-01-01

    Full Text Available Nucleotide-binding oligomerization domain proteins (NODs are modular cytoplasmic proteins implicated in the recognition of peptidoglycan-derived molecules. Further, several in vivo studies have demonstrated a role for Nod1 and Nod2 in host defense against bacterial pathogens. Here, we demonstrated that macrophages from NOD1-, NOD2-, and Rip2-deficient mice produced lower levels of TNF-α following infection with live Brucella abortus compared to wild-type mice. Similar reduction on cytokine synthesis was not observed for IL-12 and IL-6. However, NOD1, NOD2, and Rip2 knockout mice were no more susceptible to infection with virulent B. abortus than wild-type mice. Additionally, spleen cells from NOD1-, NOD2-, and Rip2-deficient mice showed unaltered production of IFN-γ compared to C57BL/6 mice. Taken together, this study demonstrates that NOD1, NOD2 and Rip2 are dispensable for the control of B. abortus during in vivo infection.

  12. A Genome Wide Association Study on Age at First Calving Using High Density Single Nucleotide Polymorphism Chips in Hanwoo (

    Directory of Open Access Journals (Sweden)

    K.-E. Hyeong

    2014-10-01

    Full Text Available Age at first calving is an important trait for achieving earlier reproductive performance. To detect quantitative trait loci (QTL for reproductive traits, a genome wide association study was conducted on the 96 Hanwoo cows that were born between 2008 and 2010 from 13 sires in a local farm (Juk-Am Hanwoo farm, Suncheon, Korea and genotyped with the Illumina 50K bovine single nucleotide polymorphism (SNP chips. Phenotypes were regressed on additive and dominance effects for each SNP using a simple linear regression model after the effects of birth-year-month and polygenes were considered. A forward regression procedure was applied to determine the best set of SNPs for age at first calving. A total of 15 QTL were detected at the comparison-wise 0.001 level. Two QTL with strong statistical evidence were found at 128.9 Mb and 111.1 Mb on bovine chromosomes (BTA 2 and 7, respectively, each of which accounted for 22% of the phenotypic variance. Also, five significant SNPs were detected on BTAs 10, 16, 20, 26, and 29. Multiple QTL were found on BTAs 1, 2, 7, and 14. The significant QTLs may be applied via marker assisted selection to increase rate of genetic gain for the trait, after validation tests in other Hanwoo cow populations.

  13. Inhibition of translation by 7-methyl guanosine (m7G) nucleotide cap analogs with derivatized 5'-monophosphates

    International Nuclear Information System (INIS)

    Tahara, S.M.; Darzynkiewicz, E.; Ekiel, I.

    1986-01-01

    Recognition of the 5'-m 7 GpppN (cap) structure of eukaryote mRNA is an important step of translation initiation as shown by the potent inhibitory effect of m 7 G nucleotides on this process. A comparison of cap analogs as competitive inhibitors of initiation has allowed the authors to map probable protein-ligand contact points between the cap and cognate cap binding proteins (CBPs). Recently, several new derivatives of m 7 GMP (1) with modified phosphates were synthesized: m 7 G 5'-phosphite (2), m 7 G 5'-phosphoramidate (3), m 7 G 5'-methylphosphonate (4), and m 7 G 5'-phosphate-O-methyl ester (5). In addition, 7,8-dimethyl GMP (6) and 7-methyl 8-amino GMP (7) were synthesized. 6 and7 are primarily syn and anti respectively, relative to the glycosidic bond as shown by solution NMR studies. Inhibition by analogs on total translation in reticulocyte lysate and binding of mRNA to rabbit reticulocyte ribosomes was found to be: 1 = 3 > 5 > 4 > 2. The inhibitory activity of 3 was unexpected since it is isosteric with 4, however it suggested that electron configuration and/or the ability to form a hydrogen bond between protein and the phosphate moiety might be important for ligand binding. 7 was more inhibitory than 6. The latter two are isosteric therefore differences in electron delocalization and/or syn-anti conformation are likely to be the reason(s) for the observed difference

  14. BLOC-3 mutated in Hermansky-Pudlak syndrome is a Rab32/38 guanine nucleotide exchange factor.

    Science.gov (United States)

    Gerondopoulos, Andreas; Langemeyer, Lars; Liang, Jin-Rui; Linford, Andrea; Barr, Francis A

    2012-11-20

    Hermansky-Pudlak syndrome (HPS) is a human disease characterized by partial loss of pigmentation and impaired blood clotting. These symptoms are caused by defects in the biogenesis of melanosomes and platelet dense granules, often referred to as lysosome-related organelles. Genes mutated in HPS encode subunits of the biogenesis of lysosome-related organelles complexes (BLOCs). BLOC-1 and BLOC-2, together with the AP-3 clathrin adaptor complex, act at early endosomes to sort components required for melanin formation and melanosome biogenesis away from the degradative lysosomal pathway toward early stage melanosomes. However the molecular functions of the Hps1-Hps4 complex BLOC-3 remain mysterious. Like other trafficking pathways, melanosome biogenesis and transport of enzymes involved in pigmentation involves specific Rab GTPases, in this instance Rab32 and Rab38. We now demonstrate that BLOC-3 is a Rab32 and Rab38 guanine nucleotide exchange factor (GEF). Silencing of the BLOC-3 subunits Hps1 and Hps4 results in the mislocalization of Rab32 and Rab38 and reduction in pigmentation. In addition, we show that BLOC-3 can promote specific membrane recruitment of Rab32/38. BLOC-3 therefore defines a novel Rab GEF family with a specific function in the biogenesis of lysosome-related organelles. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Cofactor balance by nicotinamide nucleotide transhydrogenase (NNT) coordinates reductive carboxylation and glucose catabolism in the tricarboxylic acid (TCA) cycle.

    Science.gov (United States)

    Gameiro, Paulo A; Laviolette, Laura A; Kelleher, Joanne K; Iliopoulos, Othon; Stephanopoulos, Gregory

    2013-05-03

    Cancer and proliferating cells exhibit an increased demand for glutamine-derived carbons to support anabolic processes. In addition, reductive carboxylation of α-ketoglutarate by isocitrate dehydrogenase 1 (IDH1) and 2 (IDH2) was recently shown to be a major source of citrate synthesis from glutamine. The role of NAD(P)H/NAD(P)(+) cofactors in coordinating glucose and glutamine utilization in the tricarboxylic acid (TCA) cycle is not well understood, with the source(s) of NADPH for the reductive carboxylation reaction remaining unexplored. Nicotinamide nucleotide transhydrogenase (NNT) is a mitochondrial enzyme that transfers reducing equivalents from NADH to NADPH. Here, we show that knockdown of NNT inhibits the contribution of glutamine to the TCA cycle and activates glucose catabolism in SkMel5 melanoma cells. The increase in glucose oxidation partially occurred through pyruvate carboxylase and rendered NNT knockdown cells more sensitive to glucose deprivation. Importantly, knocking down NNT inhibits reductive carboxylation in SkMel5 and 786-O renal carcinoma cells. Overexpression of NNT is sufficient to stimulate glutamine oxidation and reductive carboxylation, whereas it inhibits glucose catabolism in the TCA cycle. These observations are supported by an impairment of the NAD(P)H/NAD(P)(+) ratios. Our findings underscore the role of NNT in regulating central carbon metabolism via redox balance, calling for other mechanisms that coordinate substrate preference to maintain a functional TCA cycle.

  16. A Steric-inhibition model for regulation of nucleotide exchange via the Dock180 family of GEFs.

    Science.gov (United States)

    Lu, Mingjian; Kinchen, Jason M; Rossman, Kent L; Grimsley, Cynthia; Hall, Matthew; Sondek, John; Hengartner, Michael O; Yajnik, Vijay; Ravichandran, Kodi S

    2005-02-22

    CDM (CED-5, Dock180, Myoblast city) family members have been recently identified as novel, evolutionarily conserved guanine nucleotide exchange factors (GEFs) for Rho-family GTPases . They regulate multiple processes, including embryonic development, cell migration, apoptotic-cell engulfment, tumor invasion, and HIV-1 infection, in diverse model systems . However, the mechanism(s) of regulation of CDM proteins has not been well understood. Here, our studies on the prototype member Dock180 reveal a steric-inhibition model for regulating the Dock180 family of GEFs. At basal state, the N-terminal SH3 domain of Dock180 binds to the distant catalytic Docker domain and negatively regulates the function of Dock180. Further studies revealed that the SH3:Docker interaction sterically blocks Rac access to the Docker domain. Interestingly, ELMO binding to the SH3 domain of Dock180 disrupted the SH3:Docker interaction, facilitated Rac access to the Docker domain, and contributed to the GEF activity of the Dock180/ELMO complex. Additional genetic rescue studies in C. elegans suggested that the regulation of the Docker-domain-mediated GEF activity by the SH3 domain and its adjoining region is evolutionarily conserved. This steric-inhibition model may be a general mechanism for regulating multiple SH3-domain-containing Dock180 family members and may have implications for a variety of biological processes.

  17. Catalytic properties of RNA polymerases IV and V: accuracy, nucleotide incorporation and rNTP/dNTP discrimination.

    Science.gov (United States)

    Marasco, Michelle; Li, Weiyi; Lynch, Michael; Pikaard, Craig S

    2017-11-02

    All eukaryotes have three essential nuclear multisubunit RNA polymerases, abbreviated as Pol I, Pol II and Pol III. Plants are remarkable in having two additional multisubunit RNA polymerases, Pol IV and Pol V, which synthesize noncoding RNAs that coordinate RNA-directed DNA methylation for silencing of transposons and a subset of genes. Based on their subunit compositions, Pols IV and V clearly evolved as specialized forms of Pol II, but their catalytic properties remain undefined. Here, we show that Pols IV and V differ from one another, and Pol II, in nucleotide incorporation rate, transcriptional accuracy and the ability to discriminate between ribonucleotides and deoxyribonucleotides. Pol IV transcription is considerably more error-prone than Pols II or V, which may be tolerable in its synthesis of short RNAs that serve as precursors for siRNAs targeting non-identical members of transposon families. By contrast, Pol V exhibits high fidelity transcription, similar to Pol II, suggesting a need for Pol V transcripts to faithfully reflect the DNA sequence of target loci to which siRNA-Argonaute silencing complexes are recruited. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Mobile phone specific electromagnetic fields induce transient DNA damage and nucleotide excision repair in serum-deprived human glioblastoma cells.

    Science.gov (United States)

    Al-Serori, Halh; Ferk, Franziska; Kundi, Michael; Bileck, Andrea; Gerner, Christopher; Mišík, Miroslav; Nersesyan, Armen; Waldherr, Monika; Murbach, Manuel; Lah, Tamara T; Herold-Mende, Christel; Collins, Andrew R; Knasmüller, Siegfried

    2018-01-01

    Some epidemiological studies indicate that the use of mobile phones causes cancer in humans (in particular glioblastomas). It is known that DNA damage plays a key role in malignant transformation; therefore, we investigated the impact of the UMTS signal which is widely used in mobile telecommunications, on DNA stability in ten different human cell lines (six brain derived cell lines, lymphocytes, fibroblasts, liver and buccal tissue derived cells) under conditions relevant for users (SAR 0.25 to 1.00 W/kg). We found no evidence for induction of damage in single cell gel electrophoresis assays when the cells were cultivated with serum. However, clear positive effects were seen in a p53 proficient glioblastoma line (U87) when the cells were grown under serum free conditions, while no effects were found in p53 deficient glioblastoma cells (U251). Further experiments showed that the damage disappears rapidly in U87 and that exposure induced nucleotide excision repair (NER) and does not cause double strand breaks (DSBs). The observation of NER induction is supported by results of a proteome analysis indicating that several proteins involved in NER are up-regulated after exposure to UMTS; additionally, we found limited evidence for the activation of the γ-interferon pathway. The present findings show that the signal causes transient genetic instability in glioma derived cells and activates cellular defense systems.

  19. A High-Throughput Assay for Rho Guanine Nucleotide Exchange Factors Based on the Transcreener GDP Assay.

    Science.gov (United States)

    Reichman, Melvin; Schabdach, Amanda; Kumar, Meera; Zielinski, Tom; Donover, Preston S; Laury-Kleintop, Lisa D; Lowery, Robert G

    2015-12-01

    Ras homologous (Rho) family GTPases act as molecular switches controlling cell growth, movement, and gene expression by cycling between inactive guanosine diphosphate (GDP)- and active guanosine triphosphate (GTP)-bound conformations. Guanine nucleotide exchange factors (GEFs) positively regulate Rho GTPases by accelerating GDP dissociation to allow formation of the active, GTP-bound complex. Rho proteins are directly involved in cancer pathways, especially cell migration and invasion, and inhibiting GEFs holds potential as a therapeutic strategy to diminish Rho-dependent oncogenesis. Methods for measuring GEF activity suitable for high-throughput screening (HTS) are limited. We developed a simple, generic biochemical assay method for measuring GEF activity based on the fact that GDP dissociation is generally the rate-limiting step in the Rho GTPase catalytic cycle, and thus addition of a GEF causes an increase in steady-state GTPase activity. We used the Transcreener GDP Assay, which relies on selective immunodetection of GDP, to measure the GEF-dependent stimulation of steady-state GTP hydrolysis by small GTPases using Dbs (Dbl's big sister) as a GEF for Cdc42, RhoA, and RhoB. The assay is well suited for HTS, with a homogenous format and far red fluorescence polarization (FP) readout, and it should be broadly applicable to diverse Rho GEF/GTPase pairs. © 2015 Society for Laboratory Automation and Screening.

  20. Nucleotide-binding oligomerization domain 2 (NOD2) activation induces apoptosis of human oral squamous cell carcinoma cells.

    Science.gov (United States)

    Yoon, Hyo-Eun; Ahn, Mee-Young; Kwon, Seong-Min; Kim, Dong-Jae; Lee, Jun; Yoon, Jung-Hoon

    2016-04-01

    Microbial Pattern-recognition receptors (PRRs), such as nucleotide-binding oligomerization domains (NODs), are essential for mammalian innate immune response. This study was designed to determine the effect of NOD1 and NOD2 agonist on innate immune responses and antitumor activity in oral squamous cell carcinoma (OSCC) cells. NODs expression was examined by RT-PCR, and IL-8 production by NODs agonist was examined by ELISA. Western blot analysis was performed to determine the MAPK activation in response to their agonist. Cell proliferation was determined by MTT assay. Flow cytometry and Western blot analysis were performed to determine the MDP-induced cell death. The levels of NODs were apparently expressed in OSCC cells. NODs agonist, Tri-DAP and MDP, led to the production of IL-8 and MAPK activation. NOD2 agonist, MDP, inhibited the proliferation of YD-10B cells in a dose-dependent manner. Also, the ratio of Annexin V-positive cells and cleaved PARP was increased by MDP treatment in YD-10B cells, suggesting that MDP-induced cell death in YD-10B cells may be owing to apoptosis. Our results indicate that NODs are functionally expressed in OSCC cells and can trigger innate immune responses. In addition, NOD2 agonist inhibited cell proliferation and induced apoptosis. These findings provide the potential value of MDP as novel candidates for antitumor agents of OSCC. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Previously Unidentified Single Nucleotide Polymorphisms in HIV/AIDS Cases Associate with Clinical Parameters and Disease Progression

    Directory of Open Access Journals (Sweden)

    Vladimir V. Anokhin

    2016-01-01

    Full Text Available The genetic background of an individual plays an important role in the progression of HIV infection to AIDS. Identifying previously unknown or uncharacterized single nucleotide polymorphisms (SNPs that associate with disease progression may reveal important therapeutic targets and provide a greater understanding of disease pathogenesis. In the present study, we employed ultra-high multiplex PCR on an Ion Torrent next-generation sequencing platform to sequence 23 innate immune genes from 94 individuals with HIV/AIDS. This data was used to identify potential associations of SNPs with clinical parameters and disease progression. SNPs that associated with an increased viral load were identified in the genes for the interleukin 15 receptor (IL15RA, toll-like receptor 7 (TLR7, tripartite motif-containing protein 5 (TRIM5, and two killer-cell immunoglobulin-like receptors (KIR2DL1 and KIR2DL3. Additionally, SNPs that associated with progression from HIV infection to AIDS were identified in two 2′-5′-oligoadenylate synthetase genes (OAS2 and OAS3. In contrast, other SNPs identified in OAS2 and OAS3 genes, as well as in the TRIM5 and KIR2DS4 genes, were associated with a slower progression of disease. Taken together, our data demonstrates the utility of ultra-high multiplex PCR in identifying polymorphisms of potential clinical significance and further,identifies SNPs that may play a role in HIV pathogenesis.

  2. A combination of SILAC and nucleotide acyl phosphate labelling reveals unexpected targets of the Rsk inhibitor BI-D1870.

    Science.gov (United States)

    Edgar, Alexander J; Trost, Matthias; Watts, Colin; Zaru, Rossana

    2014-02-01

    Protein kinase inhibitors frequently have interesting effects that cannot be fully ascribed to the intended target kinase(s) but identifying additional targets that might explain the effects is not straightforward. By comparing two different inhibitors of the Rsk (p90 ribosomal S6 kinase) kinases, we found that the increasingly used compound BI-D1870 had biological effects in murine DCs (dendritic cells) that could not be solely ascribed to Rsk or other documented targets. We assessed the ability of BI-D1870 and a second Rsk inhibitor, BIX 02565 to protect enzyme active sites from reaction with biotinylated nucleotide acyl phosphates. Using SILAC (stable isotope labelling by amino acids in cell culture)-labelled DC lysates as a source of enzyme targets, we identify several kinases that interact with BI-D1870 but not with BIX 02565. We confirmed that these kinases, including Slk, Lok and Mst1, are inhibited by BI-D1870 but to a much lesser extent by BIX 02565 and that phosphorylation of some of their substrates is blocked by BI-D1870 in living cells. Our results suggest that the BI-D1870 inhibitor should be used with caution. The SILAC-based methodology we used should be useful for further comparative unbiased profiling of the target spectrum of kinase inhibitors with interesting biological effects under conditions that closely mimic those found in cells. © 2014 The author(s).

  3. A single nucleotide polymorphism in the dimethylarginine dimethylaminohydrolase gene is associated with lower risk of pulmonary hypertension in bronchopulmonary dysplasia

    Science.gov (United States)

    Trittmann, JK; Gastier-Foster, JM; Zmuda, EJ; Frick, J; Rogers, LK; Vieland, VJ; Chicoine, LG; Nelin, LD

    2016-01-01

    Aim Pulmonary hypertension (PH) develops in 25–40% of bronchopulmonary dysplasia (BPD) patients, substantially increasing mortality. We have previously found that asymmetric dimethylarginine (ADMA), an endogenous inhibitor of nitric oxide (NO) production, is elevated in patients with BPD-associated PH. ADMA is metabolized by NG,NG- dimethylarginine dimethylaminohydrolase (DDAH). Presently, we test the hypothesis that there are single nucleotide polymorphisms (SNPs) in DDAH1 and/or DDAH2 associated with the development of PH in BPD patients. Methods BPD patients were enrolled (n=98) at Nationwide Children’s Hospital. Clinical characteristics and 36 SNPs in DDAH1 and DDAH2 were compared between BPD-associated PH patients (cases) and BPD-alone patients (controls). Results In BPD patients, 25 (26%) had echocardiographic evidence of PH (cases). In this cohort, DDAH1 wildtype rs480414 was 92% sensitive and 53% specific for PH in BPD, and the DDAH1 SNP rs480414 decreased the risk of PH in an additive model of inheritance (OR=0.39; 95% CI [0.18–0.88], p=0.01). Conclusion The rs480414 SNP in DDAH1 may be protective against the development of PH in patients with BPD. Furthermore, the DDAH1 rs480414 may be a useful biomarker in developing predictive models for PH in patients with BPD. PMID:26663142

  4. Prevalence of Food Additive Intolerance

    DEFF Research Database (Denmark)

    Madsen, Charlotte Bernhard

    1994-01-01

    The prevalence estimates vary with a factor 100. As the results vary so do the study populations. 6 If the different study populations are accounted for, a common conclusion can be drawn: Food additive intolerance is found in adults with atopic symptoms from the respiratory tract and skin. The prevalence......1 The existing prevalence estimates of food additive intolerance(1-4) are being reviewed. 2 In the EEC report the estimated frequency of food additive intolerance is 0.03% to 0.15% based on data from patient groups. 3 The British population study results in a prevalence estimate of 0.......026%. The challenged population is 81 children and adults with a history of reproducible clinical symptoms after ingestion of food additives. 4 In the Danish population study a prevalence of 1-2% is found in children age 5-16. In this study a total of 606 children mainly with atopic disease have been challenged. 5...

  5. Topology Optimization for Additive Manufacturing

    DEFF Research Database (Denmark)

    Clausen, Anders

    This PhD thesis deals with the combination of topology optimization and additive man-ufacturing (AM, also known as 3D-printing). In addition to my own works, the thesis contains a broader review and assessment of the literature within the field. The thesis first presents a classification...... of the various AM technologies, a review of relevant manufacturing materials, the properties of these materials in the additively manufactured part, as well as manufacturing constraints with a potential for design optimization. Subsequently, specific topology optimization formulations relevant for the most im...... for scalable manufacturing. In relation to interface problems it is shown how a flexible void area may be included into a standard minimum compliance problem by employing an additional design variable field and a sensitivity filter. Furthermore, it is shown how the design of coated structures may be modeled...

  6. (ICSID) ADDITIONAL FACILITY IN INTERNA

    African Journals Online (AJOL)

    Fr. Ikenga

    ... which is adopted by Article 5 of the Additional Facility Rules to guide the ... B, Barrister at Law, e-mail: kcezeibe@yahoo.com; Phone 08033950631 and .... revision and annulment which are internally available under the Washington ...

  7. Food additives: an ethical evaluation.

    Science.gov (United States)

    Mepham, Ben

    2011-01-01

    Food additives are an integral part of the modern food system, but opinion polls showing most Europeans have worries about them imply an urgent need for ethical analysis of their use. The existing literature on food ethics, safety assessment and animal testing. Food additives provide certain advantages in terms of many people's lifestyles. There are disagreements about the appropriate application of the precautionary principle and of the value and ethical validity of animal tests in assessing human safety. Most consumers have a poor understanding of the relative benefits and risks of additives, but concerns over food safety and animal testing remain high. Examining the impacts of food additives on consumer sovereignty, consumer health and on animals used in safety testing should allow a more informed debate about their appropriate uses.

  8. Wide and High Additive Manufacturing

    Energy Technology Data Exchange (ETDEWEB)

    Post, Brian K. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Roschli, Alex C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2017-03-01

    The goal of this project is to develop and demonstrate the enabling technologies for Wide and High Additive Manufacturing (WHAM). WHAM will open up new areas of U.S. manufacturing for very large tooling in support of the transportation and energy industries, significantly reducing cost and lead time. As with Big Area Additive Manufacturing (BAAM), the initial focus is on the deposition of composite materials.

  9. Food additives and preschool children.

    Science.gov (United States)

    Martyn, Danika M; McNulty, Breige A; Nugent, Anne P; Gibney, Michael J

    2013-02-01

    Food additives have been used throughout history to perform specific functions in foods. A comprehensive framework of legislation is in place within Europe to control the use of additives in the food supply and ensure they pose no risk to human health. Further to this, exposure assessments are regularly carried out to monitor population intakes and verify that intakes are not above acceptable levels (acceptable daily intakes). Young children may have a higher dietary exposure to chemicals than adults due to a combination of rapid growth rates and distinct food intake patterns. For this reason, exposure assessments are particularly important in this age group. The paper will review the use of additives and exposure assessment methods and examine factors that affect dietary exposure by young children. One of the most widely investigated unfavourable health effects associated with food additive intake in preschool-aged children are suggested adverse behavioural effects. Research that has examined this relationship has reported a variety of responses, with many noting an increase in hyperactivity as reported by parents but not when assessed using objective examiners. This review has examined the experimental approaches used in such studies and suggests that efforts are needed to standardise objective methods of measuring behaviour in preschool children. Further to this, a more holistic approach to examining food additive intakes by preschool children is advisable, where overall exposure is considered rather than focusing solely on behavioural effects and possibly examining intakes of food additives other than food colours.

  10. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  11. effects of sulphur addition on addition on and mechanical properties

    African Journals Online (AJOL)

    User

    on the microstructure and mechanical properties of sand cast been investigated ... owed that the addition of sulphur to Al-12wt%Si alloy. 12wt%Si alloy .... 28 materials. 29. Element. Aluminum. Silicon. Al. Si. Ca. Fe. Cu. Zn. Mn. Mg. Cr. B. 99.71.

  12. The PurR regulon in Lactococcus lactis – transcriptional regulation of the purine nucleotide metabolism and translational machinery

    DEFF Research Database (Denmark)

    Jendresen, Christian Bille; Martinussen, Jan; Kilstrup, Mogens

    2012-01-01

    Purine nucleotides are either synthesized de novo from 5-phosphoribosyl-1-pyrophosphate (PRPP) or salvaged from the environment. In Lactococcus lactis, transcription of the de novo synthesis operons, purCSQLF and purDEK, has genetically been shown to be activated by the PurR protein when bound to......-related functions. Of special interest is the presence of PurBox motifs in rrn promoters, suggesting a novel connection between nucleotide availability and the translational machinery....

  13. Evaluation of certain food additives.

    Science.gov (United States)

    2017-01-01

    This report represents the conclusions of a Joint FAO/WHO Expert Committee convened to evaluate the safety of various food additives, including flavouring agents, with a view to concluding as to safety concerns and to preparing specifications for identity and purity. The first part of the report contains a general discussion of the principles governing the toxicological evaluation of and assessment of dietary exposure to food additives, including flavouring agents. A summary follows of the Committee’s evaluations of technical, toxicological and dietary exposure data for 10 food additives (Allura Red AC; carob bean gum; lutein esters from Tagetes erecta; octenyl succinic acid (OSA)– modified gum arabic; pectin; Quinoline Yellow; rosemary extract; steviol glycosides; tartrazine; and xanthan gum) and five groups of flavouring agents (alicyclic, alicyclic-fused and aromatic-fused ring lactones; aliphatic and aromatic amines and amides; aliphatic secondary alcohols, ketones and related esters; cinnamyl alcohol and related substances; and tetrahydrofuran and furanone derivatives). Specifications for the following food additives were revised: aspartame; cassia gum; citric and fatty acid esters of glycerol (CITREM); modified starches; octanoic acid; starch sodium octenyl succinate; and total colouring matters. Annexed to the report are tables summarizing the Committee’s recommendations for dietary exposures to and toxicological evaluations of all of the food additives, including flavouring agents, considered at this meeting.

  14. Additive manufacturing of tunable lenses

    Science.gov (United States)

    Schlichting, Katja; Novak, Tobias; Heinrich, Andreas

    2017-02-01

    Individual additive manufacturing of optical systems based on 3D Printing offers varied possibilities in design and usage. In addition to the additive manufacturing procedure, the usage of tunable lenses allows further advantages for intelligent optical systems. Our goal is to bring the advantages of additive manufacturing together with the huge potential of tunable lenses. We produced tunable lenses as a bundle without any further processing steps, like polishing. The lenses were designed and directly printed with a 3D Printer as a package. The design contains the membrane as an optical part as well as the mechanical parts of the lens, like the attachments for the sleeves which contain the oil. The dynamic optical lenses were filled with an oil. The focal length of the lenses changes due to a change of the radius of curvature. This change is caused by changing the pressure in the inside of the lens. In addition to that, we designed lenses with special structures to obtain different areas with an individual optical power. We want to discuss the huge potential of this technology for several applications. Further, an appropriate controlling system is needed. Wéll show the possibilities to control and regulate the optical power of the lenses. The lenses could be used for illumination tasks, and in the future, for individual measurement tasks. The main advantage is the individuality and the possibility to create an individual design which completely fulfills the requirements for any specific application.

  15. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    Science.gov (United States)

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Cap-proximal nucleotides via differential eIF4E binding and alternative promoter usage mediate translational response to energy stress.

    Science.gov (United States)

    Tamarkin-Ben-Harush, Ana; Vasseur, Jean-Jacques; Debart, Françoise; Ulitsky, Igor; Dikstein, Rivka

    2017-02-08

    Transcription start-site (TSS) selection and alternative promoter (AP) usage contribute to gene expression complexity but little is known about their impact on translation. Here we performed TSS mapping of the translatome following energy stress. Assessing the contribution of cap-proximal TSS nucleotides, we found dramatic effect on translation only upon stress. As eIF4E levels were reduced, we determined its binding to capped-RNAs with different initiating nucleotides and found the lowest affinity to 5'cytidine in correlation with the translational stress-response. In addition, the number of differentially translated APs was elevated following stress. These include novel glucose starvation-induced downstream transcripts for the translation regulators eIF4A and Pabp, which are also translationally-induced despite general translational inhibition. The resultant eIF4A protein is N-terminally truncated and acts as eIF4A inhibitor. The induced Pabp isoform has shorter 5'UTR removing an auto-inhibitory element. Our findings uncovered several levels of coordination of transcription and translation responses to energy stress.

  17. The allele frequency of two single nucleotide polymorphisms in the von Hippel-Lindau (VHL) tumor suppressor gene in the Taiwanese population.

    Science.gov (United States)

    Wang, Wen-Chung; Chen, Hui-Ju; Shu, Wei-Pang; Tsai, Yi-Chang; Lai, Yen-Chein

    2011-10-01

    The von Hippel-Lindau (VHL) tumor suppressor gene located on chromosome 3p25-26 is implicated in VHL disease. Two informative single nucleotide polymorphisms are at positions 19 and 1149 on the nucleotide sequence from Gene Bank NM_000551. In this study we examined the allele frequencies at these two loci in the Taiwanese population and compared the results to those from European ethnic populations. The allele frequency was examined in 616 healthy individuals including 301 university students and 315 neonates. Both A/G polymorphisms were investigated using restriction fragment length polymorphism analysis created by restriction enzymes, BsaJ I and Acc I. Among these subjects, the allele frequencies at 19 SNP and 1149 SNP for variant G were 0.130 and 0.133, respectively. And these results were significant differences from those of the Caucasian populations. In addition, 90% of the tested subjects had identical genotypes at these two loci suggesting the existence of nonrandom association of alleles. We found that the G allele frequency at these two loci in the Taiwanese population is much lower than that in people from Western countries. This phenomenon may be attributed to ethnic effects. Copyright © 2011. Published by Elsevier B.V.

  18. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  19. A computational study of a recreated G protein-GEF reaction intermediate competent for nucleotide exchange: fate of the Mg ion.

    Directory of Open Access Journals (Sweden)

    Mériam Ben Hamida-Rebaï

    Full Text Available Small G-proteins of the superfamily Ras function as molecular switches, interacting with different cellular partners according to their activation state. G-protein activation involves the dissociation of bound GDP and its replacement by GTP, in an exchange reaction that is accelerated and regulated in the cell by guanine-nucleotide exchange factors (GEFs. Large conformational changes accompany the exchange reaction, and our understanding of the mechanism is correspondingly incomplete. However, much knowledge has been derived from structural studies of blocked or inactive mutant GEFs, which presumably closely represent intermediates in the exchange reaction and yet which are by design incompetent for carrying out the nucleotide exchange reaction. In this study we have used comparative modelling to recreate an exchange-competent form of a late, pre-GDP-ejection intermediate species in Arf1, a well-characterized small G-protein. We extensively characterized three distinct models of this intermediate using molecular dynamics simulations, allowing us to address ambiguities related to the mutant structural studies. We observed in particular the unfavorable nature of Mg2+ associated forms of the complex and the establishment of closer Arf1-GEF contacts in its absence. The results of this study shed light on GEF-mediated activation of this small G protein and on predicting the fate of the Mg ion at a critical point in the exchange reaction. The structural models themselves furnish additional targets for interfacial inhibitor design, a promising direction for exploring potentially druggable targets with high biological specificity.

  20. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  1. Calcium addition in straw gasification

    DEFF Research Database (Denmark)

    Risnes, H.; Fjellerup, Jan Søren; Henriksen, Ulrik Birk

    2003-01-01

    The present work focuses on the influence of calcium addition in gasification. The inorganic¿organic element interaction as well as the detailed inorganic¿inorganic elements interaction has been studied. The effect of calcium addition as calcium sugar/molasses solutions to straw significantly...... affected the ash chemistry and the ash sintering tendency but much less the char reactivity. Thermo balance test are made and high-temperature X-ray diffraction measurements are performed, the experimental results indicate that with calcium addition major inorganic¿inorganic reactions take place very late...... in the char conversion process. Comprehensive global equilibrium calculations predicted important characteristics of the inorganic ash residue. Equilibrium calculations predict the formation of liquid salt if sufficient amounts of Ca are added and according to experiments as well as calculations calcium binds...

  2. Additive interaction in survival analysis

    DEFF Research Database (Denmark)

    Rod, Naja Hulvej; Lange, Theis; Andersen, Ingelise

    2012-01-01

    It is a widely held belief in public health and clinical decision-making that interventions or preventive strategies should be aimed at patients or population subgroups where most cases could potentially be prevented. To identify such subgroups, deviation from additivity of absolute effects...... an empirical example of interaction between education and smoking on risk of lung cancer. We argue that deviations from additivity of effects are important for public health interventions and clinical decision-making, and such estimations should be encouraged in prospective studies on health. A detailed...... is the relevant measure of interest. Multiplicative survival models, such as the Cox proportional hazards model, are often used to estimate the association between exposure and risk of disease in prospective studies. In Cox models, deviations from additivity have usually been assessed by surrogate measures...

  3. Additional disulfide bonds in insulin

    DEFF Research Database (Denmark)

    Vinther, Tine N; Pettersson, Ingrid; Huus, Kasper

    2015-01-01

    The structure of insulin, a glucose homeostasis-controlling hormone, is highly conserved in all vertebrates and stabilized by three disulfide bonds. Recently, we designed a novel insulin analogue containing a fourth disulfide bond located between positions A10-B4. The N-terminus of insulin's B......-chain is flexible and can adapt multiple conformations. We examined how well disulfide bond predictions algorithms could identify disulfide bonds in this region of insulin. In order to identify stable insulin analogues with additional disulfide bonds, which could be expressed, the Cβ cut-off distance had...... in comparison to analogues with additional disulfide bonds that were more difficult to predict. In contrast, addition of the fourth disulfide bond rendered all analogues resistant to fibrillation under stress conditions and all stable analogues bound to the insulin receptor with picomolar affinities. Thus...

  4. Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

    KAUST Repository

    Qu, Hongzhu; Wu, Hao; Zhang, Tongwu; Zhang, Zhang; Hu, Songnian; Yu, Jun

    2010-01-01

    Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

  5. The Nucleotide Synthesis Enzyme CAD Inhibits NOD2 Antibacterial Function in Human Intestinal Epithelial Cells

    Science.gov (United States)

    Richmond, Amy L.; Kabi, Amrita; Homer, Craig R.; García, Noemí Marina; Nickerson, Kourtney P.; NesvizhskiI, Alexey I.; Sreekumar, Arun; Chinnaiyan, Arul M.; Nuñez, Gabriel; McDonald, Christine

    2013-01-01

    BACKGROUND & AIMS Polymorphisms that reduce the function of nucleotide-binding oligomerization domain (NOD)2, a bacterial sensor, have been associated with Crohn’s disease (CD). No proteins that regulate NOD2 activity have been identified as selective pharmacologic targets. We sought to discover regulators of NOD2 that might be pharmacologic targets for CD therapies. METHODS Carbamoyl phosphate synthetase/ aspartate transcarbamylase/dihydroorotase (CAD) is an enzyme required for de novo pyrimidine nucleotide synthesis; it was identified as a NOD2-interacting protein by immunoprecipitation-coupled mass spectrometry. CAD expression was assessed in colon tissues from individuals with and without inflammatory bowel disease by immunohistochemistry. The interaction between CAD and NOD2 was assessed in human HCT116 intestinal epithelial cells by immunoprecipitation, immunoblot, reporter gene, and gentamicin protection assays. We also analyzed human cell lines that express variants of NOD2 and the effects of RNA interference, overexpression and CAD inhibitors. RESULTS CAD was identified as a NOD2-interacting protein expressed at increased levels in the intestinal epithelium of patients with CD compared with controls. Overexpression of CAD inhibited NOD2-dependent activation of nuclear factor κB and p38 mitogen-activated protein kinase, as well as intracellular killing of Salmonella. Reduction of CAD expression or administration of CAD inhibitors increased NOD2-dependent signaling and antibacterial functions of NOD2 variants that are and are not associated with CD. CONCLUSIONS The nucleotide synthesis enzyme CAD is a negative regulator of NOD2. The antibacterial function of NOD2 variants that have been associated with CD increased in response to pharmacologic inhibition of CAD. CAD is a potential therapeutic target for CD. PMID:22387394

  6. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  7. Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

    KAUST Repository

    Qu, Hongzhu

    2010-12-01

    Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

  8. The pyrimidine nucleotide carrier PNC1 and mitochondrial trafficking of thymidine phosphates in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Franzolin, Elisa; Miazzi, Cristina; Frangini, Miriam; Palumbo, Elisa; Rampazzo, Chiara [Department of Biology, University of Padova, Via Ugo Bassi 58B, I-35131 Padova (Italy); Bianchi, Vera, E-mail: vbianchi@bio.unipd.it [Department of Biology, University of Padova, Via Ugo Bassi 58B, I-35131 Padova (Italy)

    2012-10-15

    In cycling cells cytosolic de novo synthesis of deoxynucleotides is the main source of precursors for mitochondrial (mt) DNA synthesis. The transfer of deoxynucleotides across the inner mt membrane requires protein carriers. PNC1, a SLC25 family member, exchanges pyrimidine nucleoside triphosphates in liposomes and its downregulation decreases mtUTP concentration in cultured cells. By an isotope-flow protocol we confirmed transport of uridine nucleotides by PNC1 in intact cultured cells and investigated PNC1 involvement in the mt trafficking of thymidine phosphates. Key features of our approach were the manipulation of PNC1 expression by RNA interference or inducible overexpression, the employment of cells proficient or deficient for cytosolic thymidine kinase (TK1) to distinguish the direction of flow of thymidine nucleotides across the mt membrane during short pulses with [{sup 3}H]-thymidine, the determination of mtdTTP specific radioactivity to quantitate the rate of mtdTTP export to the cytoplasm. Downregulation of PNC1 in TK1{sup -} cells increased labeled dTTP in mitochondria due to a reduced rate of export. Overexpression of PNC1 in TK1{sup +} cells increased mtdTTP pool size and radioactivity, suggesting an involvement in the import of thymidine phosphates. Thus PNC1 is a component of the network regulating the mtdTTP pool in human cells. -- Highlights: Black-Right-Pointing-Pointer Thymidine phosphates exchange between mitochondria and cytosol in mammalian cells. Black-Right-Pointing-Pointer siRNA-downregulation of PNC1 delays mitochondrial dTTP export in TK1{sup -} cells. Black-Right-Pointing-Pointer PNC1 overexpression accumulates dTTP in mitochondria of TK1{sup +} cells. Black-Right-Pointing-Pointer PNC1 exchanges thymidine nucleotides across the mitochondrial inner membrane. Black-Right-Pointing-Pointer PNC1 participates in the regulation of the mtdTTP pool supporting mtDNA synthesis.

  9. The pyrimidine nucleotide carrier PNC1 and mitochondrial trafficking of thymidine phosphates in cultured human cells

    International Nuclear Information System (INIS)

    Franzolin, Elisa; Miazzi, Cristina; Frangini, Miriam; Palumbo, Elisa; Rampazzo, Chiara; Bianchi, Vera

    2012-01-01

    In cycling cells cytosolic de novo synthesis of deoxynucleotides is the main source of precursors for mitochondrial (mt) DNA synthesis. The transfer of deoxynucleotides across the inner mt membrane requires protein carriers. PNC1, a SLC25 family member, exchanges pyrimidine nucleoside triphosphates in liposomes and its downregulation decreases mtUTP concentration in cultured cells. By an isotope-flow protocol we confirmed transport of uridine nucleotides by PNC1 in intact cultured cells and investigated PNC1 involvement in the mt trafficking of thymidine phosphates. Key features of our approach were the manipulation of PNC1 expression by RNA interference or inducible overexpression, the employment of cells proficient or deficient for cytosolic thymidine kinase (TK1) to distinguish the direction of flow of thymidine nucleotides across the mt membrane during short pulses with [ 3 H]-thymidine, the determination of mtdTTP specific radioactivity to quantitate the rate of mtdTTP export to the cytoplasm. Downregulation of PNC1 in TK1 − cells increased labeled dTTP in mitochondria due to a reduced rate of export. Overexpression of PNC1 in TK1 + cells increased mtdTTP pool size and radioactivity, suggesting an involvement in the import of thymidine phosphates. Thus PNC1 is a component of the network regulating the mtdTTP pool in human cells. -- Highlights: ► Thymidine phosphates exchange between mitochondria and cytosol in mammalian cells. ► siRNA-downregulation of PNC1 delays mitochondrial dTTP export in TK1 − cells. ► PNC1 overexpression accumulates dTTP in mitochondria of TK1 + cells. ► PNC1 exchanges thymidine nucleotides across the mitochondrial inner membrane. ► PNC1 participates in the regulation of the mtdTTP pool supporting mtDNA synthesis.

  10. In silico screening for inhibitors of p-glycoprotein that target the nucleotide binding domains.

    Science.gov (United States)

    Brewer, Frances K; Follit, Courtney A; Vogel, Pia D; Wise, John G

    2014-12-01

    Multidrug resistances and the failure of chemotherapies are often caused by the expression or overexpression of ATP-binding cassette transporter proteins such as the multidrug resistance protein, P-glycoprotein (P-gp). P-gp is expressed in the plasma membrane of many cell types and protects cells from accumulation of toxins. P-gp uses ATP hydrolysis to catalyze the transport of a broad range of mostly hydrophobic compounds across the plasma membrane and out of the cell. During cancer chemotherapy, the administration of therapeutics often selects for cells which overexpress P-gp, thereby creating populations of cancer cells resistant to a variety of chemically unrelated chemotherapeutics. The present study describes extremely high-throughput, massively parallel in silico ligand docking studies aimed at identifying reversible inhibitors of ATP hydrolysis that target the nucleotide-binding domains of P-gp. We used a structural model of human P-gp that we obtained from molecular dynamics experiments as the protein target for ligand docking. We employed a novel approach of subtractive docking experiments that identified ligands that bound predominantly to the nucleotide-binding domains but not the drug-binding domains of P-gp. Four compounds were found that inhibit ATP hydrolysis by P-gp. Using electron spin resonance spectroscopy, we showed that at least three of these compounds affected nucleotide binding to the transporter. These studies represent a successful proof of principle demonstrating the potential of targeted approaches for identifying specific inhibitors of P-gp. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

  11. Nucleotide-induced conformational dynamics in ABC transporters from structure-based coarse grained modelling.

    Science.gov (United States)

    Flechsig, Holger

    2016-02-01

    ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter

  12. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  13. Aminodisulfides as additives to lubricants

    Energy Technology Data Exchange (ETDEWEB)

    Balin, A.I.; Tarasevich, V.B.; Veretenova, T.N.

    1980-01-01

    A study was carried out and tehcnology developed for producing sulfur-nitrogen containing additives of the type of aminodisulfide by interaction of beta, beta-dichlordialkyl (aryl) disulfides with diethanolamine in a medium of sulfur-diethanolamine. The 2,2'-bis-(diethanol)-dialkyl(aryl) disulfides obtained do not hydrolyze in aqueous soltuions of alkalis, exhibit rather high antiscoring properties and are recommended for tests as active additives of high pressure to SOZH and technological lubricants of the oil and emulsion types.

  14. Predictive single nucleotide polymorphism markers for acute oral mucositis in patients with nasopharyngeal carcinoma treated with radiotherapy

    Science.gov (United States)

    Le, Ziyu; Niu, Xiaoshuang; Chen, Ying; Ou, Xiaomin; Zhao, Guoqi; Liu, Qi; Tu, Wenzhi; Hu, Chaosu; Kong, Lin; Liu, Yong

    2017-01-01

    The aim of this study was to investigate the association between the susceptibility of severe oral mucositis (OM) in Chinese nasopharyngeal carcinoma (NPC) patients treated with radiotherapy and single nucleotide polymorphisms (SNPs) across the whole genome. SNPs were screened in a total of 24 patients with NPC and an additional 6 were subjected to mRNA expression analysis. Patients were subdivided into CTC 0-2 (CTC toxicity grade 0, 1, and 2) and CTC 3+ (CTC toxicity grade 3 and above) groups according to their CTC (common toxicity criteria) scores. The GTEx dataset was used to performed eQTL analyses and in-vitro functional assays were performed for eQTL-associated genes. Our data identified 7 functional SNPs associated with the development of OM. We observed that rs11081899-A, located in the 5′-UTR of the ZNF24 gene, was significantly correlated with a higher risk of severe mucositis (OR = 14.631, 95% CI = 2.61-105.46, p = 1.2 × 10−4), and positively associated with ZNF24 mRNA expression (p = 4.1 × 10−6) from GTEx dataset. In addition, high ZNF24 mRNA expression was associated with severe OM in patients with NPC (p = 0.02). Further functional assays revealed that ZNF24 knockdown reduced p65 expression and suppressed TNF-α-induced NF-κB activation and pro-inflammatory cytokines release. These findings suggested that rs11081899-A may be a genetic susceptibility factor for radiation-induced OM in patients with NPC, although its value in clinical application needs to be further verified in a large cohort. Also, we suggested that downregulation of ZNF24 may attenuate the development of mucositis by suppressing NF-κB activation. PMID:28968968

  15. An Improved Consensus Linkage Map of Barley Based on Flow-Sorted Chromosomes and Single Nucleotide Polymorphism Markers

    Directory of Open Access Journals (Sweden)

    María Muñoz-Amatriaín

    2011-11-01

    Full Text Available Recent advances in high-throughput genotyping have made it easier to combine information from different mapping populations into consensus genetic maps, which provide increased marker density and genome coverage compared to individual maps. Previously, a single nucleotide polymorphism (SNP-based genotyping platform was developed and used to genotype 373 individuals in four barley ( L. mapping populations. This led to a 2943 SNP consensus genetic map with 975 unique positions. In this work, we add data from six additional populations and more individuals from one of the original populations to develop an improved consensus map from 1133 individuals. A stringent and systematic analysis of each of the 10 populations was performed to achieve uniformity. This involved reexamination of the four populations included in the previous map. As a consequence, we present a robust consensus genetic map that contains 2994 SNP loci mapped to 1163 unique positions. The map spans 1137.3 cM with an average density of one marker bin per 0.99 cM. A novel application of the genotyping platform for gene detection allowed the assignment of 2930 genes to flow-sorted chromosomes or arms, confirmed the position of 2545 SNP-mapped loci, added chromosome or arm allocations to an additional 370 SNP loci, and delineated pericentromeric regions for chromosomes 2H to 7H. Marker order has been improved and map resolution has been increased by almost 20%. These increased precision outcomes enable more optimized SNP selection for marker-assisted breeding and support association genetic analysis and map-based cloning. It will also improve the anchoring of DNA sequence scaffolds and the barley physical map to the genetic map.

  16. Association of single nucleotide polymorphisms in the MVP gene with platinum resistance and survival in patients with epithelial ovarian cancer.

    Science.gov (United States)

    Zhao, Ya-Nan; He, Dong-Ning; Wang, Ya-DI; Li, Jun-Jie; Ha, Min-Wen

    2016-04-01

    The human major vault protein (MVP) has been linked to the development of multidrug resistance in cancer cells, and overexpression of MVP has been observed in ovarian cancer tissues. The aim of the present study was to investigate the association between single nucleotide polymorphisms (SNPs) in the MVP gene and the tumor response to platinum-based chemotherapy and survival of patients affected by epithelial ovarian cancer (EOC), in addition to confirm whether tetra-primer amplification-refractory mutation system (ARMS)-polymerase chain reaction (PCR) is an accurate genotyping method. For this purpose, two polymorphisms in the MVP gene, namely reference SNP (rs)1057451 and rs4788186, were selected from the data obtained by the International haplotype map (HapMap) Project regarding Chinese Han population, and were evaluated by tetra-primer ARMS-PCR. Upon validation by DNA sequencing, the association of these polymorphisms with platinum resistance, progression-free survival (PFS) and overall survival (OS) in patients with EOC was assessed. The results of tetra-primer ARMS-PCR were in agreement with those derived from DNA sequencing. No significant differences were observed between platinum-sensitive and platinum-resistant cohorts in terms of allele and genotype distribution of these two polymorphisms in the MVP gene, which were not associated with PFS or OS. However, a trend toward prolonged PFS was observed in patients carrying the heterozygous AG allele at the rs4788186 locus. These results suggest that rs1057451 and rs4788186 variants in the MVP gene are not associated with favorable therapeutic response to platinum or longer survival in Chinese Han patients affected by EOC. In addition, the data of the present study confirm that tetra-primer ARMS-PCR is a trustworthy and economical genotyping method.

  17. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  18. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  19. Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses

    Directory of Open Access Journals (Sweden)

    Ogata Hiroyuki

    2007-12-01

    Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their

  20. Efficient Oligo nucleotide mediated CRISPR-Cas9 Gene Editing in Aspergilli

    DEFF Research Database (Denmark)

    Nødvig, Christina Spuur; Hoof, Jakob Blæsbjerg; Kogle, Martin Engelhard

    2018-01-01

    CRISPR-Cas9 technologies are revolutionizing fungal gene editing. Here we show that survival of specific Cas9/sgRNA mediated DNA double strand breaks (DSBs) depends on the non-homologous end-joining, NHEJ, DNA repair pathway and we use this observation to develop a tool to assess protospacer....... niger, and in A. oryzae indicating that this type of repair may be wide spread in filamentous fungi. Importantly, we demonstrate that by using single-stranded oligo nucleotides for CRISPR-Cas9 mediated gene editing it is possible to introduce specific point mutations as well gene deletions...

  1. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  2. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  3. Quantification of nucleotides by ICPMS: coupling of ICPMS with capillary electrophoresis or capillary HPLC

    International Nuclear Information System (INIS)

    Inagaki, K.; Fujii, S.; Takatsu, A.; Yarita, T.; Zhu, Y.; Chiba, K.

    2009-01-01

    Full text: Quantification of nucleotides in small volumes of biological samples has eagerly been demanded. A method using ICPMS coupled with capillary electrophoresis or capillary liquid chromatography is reported. A new interface system, which consists of a double tube nebulizer inserted with a fused silica capillary tube and a cylinder mini-chamber with a sheath gas inlet, was designed. Moreover, the surface conditions of the sampling and skimmer cones, and the introduction of H 2 gas into the plasma were found to significantly improve the signal/background ratio for phosphorus determination at m/z 31. (author)

  4. Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA

    Science.gov (United States)

    Jukes, T. H.; Kimura, M.

    1984-01-01

    The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

  5. LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E

    DEFF Research Database (Denmark)

    Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael

    2002-01-01

    Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....

  6. Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes

    Directory of Open Access Journals (Sweden)

    McGuire Patrick E

    2010-12-01

    Full Text Available Abstract Background A genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into their respective genomes. The same requirements complicate the development and deployment of single nucleotide polymorphism (SNP markers in polyploid species. We report here a strategy that satisfies these requirements and deploy it in the sequencing of genes in cultivated hexaploid wheat (Triticum aestivum, genomes AABBDD and wild tetraploid wheat (Triticum turgidum ssp. dicoccoides, genomes AABB from the putative site of wheat domestication in Turkey. Data are used to assess the distribution of diversity among and within wheat genomes and to develop a panel of SNP markers for polyploid wheat. Results Nucleotide diversity was estimated in 2114 wheat genes and was similar between the A and B genomes and reduced in the D genome. Within a genome, diversity was diminished on some chromosomes. Low diversity was always accompanied by an excess of rare alleles. A total of 5,471 SNPs was discovered in 1791 wheat genes. Totals of 1,271, 1,218, and 2,203 SNPs were discovered in 488, 463, and 641 genes of wheat putative diploid ancestors, T. urartu, Aegilops speltoides, and Ae. tauschii, respectively. A public database containing genome-specific primers, SNPs, and other information was constructed. A total of 987 genes with nucleotide diversity estimated in one or more of the wheat genomes was placed on an Ae. tauschii genetic map, and the map was superimposed on wheat deletion-bin maps. The agreement between the maps was assessed. Conclusions In a young polyploid, exemplified by T. aestivum, ancestral species are the primary source of genetic diversity. Low effective recombination due to self-pollination and a genetic mechanism precluding homoeologous chromosome pairing during polyploid meiosis can lead to the loss of diversity from large

  7. Genomic Model with Correlation Between Additive and Dominance Effects.

    Science.gov (United States)

    Xiang, Tao; Christensen, Ole Fredslund; Vitezica, Zulma Gladis; Legarra, Andres

    2018-05-09

    Dominance genetic effects are rarely included in pedigree-based genetic evaluation. With the availability of single nucleotide polymorphism markers and the development of genomic evaluation, estimates of dominance genetic effects have become feasible using genomic best linear unbiased prediction (GBLUP). Usually, studies involving additive and dominance genetic effects ignore possible relationships between them. It has been often suggested that the magnitude of functional additive and dominance effects at the quantitative trait loci are related, but there is no existing GBLUP-like approach accounting for such correlation. Wellmann and Bennewitz showed two ways of considering directional relationships between additive and dominance effects, which they estimated in a Bayesian framework. However, these relationships cannot be fitted at the level of individuals instead of loci in a mixed model and are not compatible with standard animal or plant breeding software. This comes from a fundamental ambiguity in assigning the reference allele at a given locus. We show that, if there has been selection, assigning the most frequent as the reference allele orients the correlation between functional additive and dominance effects. As a consequence, the most frequent reference allele is expected to have a positive value. We also demonstrate that selection creates negative covariance between genotypic additive and dominance genetic values. For parameter estimation, it is possible to use a combined additive and dominance relationship matrix computed from marker genotypes, and to use standard restricted maximum likelihood (REML) algorithms based on an equivalent model. Through a simulation study, we show that such correlations can easily be estimated by mixed model software and accuracy of prediction for genetic values is slightly improved if such correlations are used in GBLUP. However, a model assuming uncorrelated effects and fitting orthogonal breeding values and dominant

  8. Additive to clay drilling muds

    Energy Technology Data Exchange (ETDEWEB)

    Voytenko, V.S.; Nekrasova, V.B.; Nikitinskiy, E.L.; Ponomarev, V.N.

    1984-01-01

    The purpose of the invention is to improve the lubricating and strengthening properties of clay drilling muds. This goal is achieved because the lubricating and strengthening additive used is waste from the pulp and paper industry at the stage of reprocessing crude sulfate soap into phytosterol.

  9. The selective addition of water

    NARCIS (Netherlands)

    Resch, V.; Hanefeld, U.

    2014-01-01

    Water is omnipresent and essential. Yet at the same time it is a rather unreactive molecule. The direct addition of water to C[double bond, length as m-dash]C double bonds is therefore a challenge not answered convincingly. In this perspective we critically evaluate the selectivity and the

  10. Additive manufacturing in maxillofacial reconstruction

    Directory of Open Access Journals (Sweden)

    Dincă Luciana Laura

    2017-01-01

    Full Text Available In this paper the benefits of using additive manufacturing technologies in maxillofacial reconstruction are highlighted. Based on a real clinical case, the paper describes the manufacture of an implant prototype replacing the right zygomatic bone and a part of maxilla using additive manufacturing technologies. The face is the most expressive part of the human body that makes us unique. It was shown that the maxillofacial prostheses help to improve the psychological state of patients affected by, because low self esteem feeling appears commonly to this patients with the facial defects. The aim of this paper is to show how using additive manufacturing technologies methods within this research, the producing a surgical model will help surgeon to improve the pre-operative planning. For this we used additive manufacturing technologies such as Stereolitography to achieve the biomodel and FDM-fused deposition modelling to obtain a prototype model because these technologies make it possible to obtain prosthesis according to the physical and mechanical requirements of the region of implantation.

  11. Radiation curable Michael addition compounds

    International Nuclear Information System (INIS)

    Gruber, G.W.; Friedlander, C.B.; McDonald, W.H.; Dowbenko, R.

    1979-01-01

    Radiation polymerizable acrylyloxy-containing reaction products are provided from Michael addition reaction of an amide containing at least two acrylate groups with a primary or secondary amine. The resulting amine adducts of the amide, which contain at least one acrylate group per molecule, possesses high cure rates in air and are useful in compositions for forming coatings. (author)

  12. Additively manufactured porous tantalum implants

    NARCIS (Netherlands)

    Wauthle, Ruben; Van Der Stok, Johan; Yavari, Saber Amin; Van Humbeeck, Jan; Kruth, Jean Pierre; Zadpoor, Amir Abbas; Weinans, Harrie; Mulier, Michiel; Schrooten, Jan

    2015-01-01

    The medical device industry's interest in open porous, metallic biomaterials has increased in response to additive manufacturing techniques enabling the production of complex shapes that cannot be produced with conventional techniques. Tantalum is an important metal for medical devices because of

  13. Evaluation of certain food additives.

    Science.gov (United States)

    2012-01-01

    This report represents the conclusions of a Joint FAO/WHO Expert Committee convened to evaluate the safety of various food additives, including flavouring agents, with a view to concluding as to safety concerns and to preparing specifications for identity and purity. The first part of the report contains a general discussion of the principles governing the toxicological evaluation of and assessment of dietary exposure to food additives, including flavouring agents. A summary follows of the Committee's evaluations of technical, toxicological and dietary exposure data for five food additives (magnesium dihydrogen diphosphate; mineral oil (medium and low viscosity) classes II and III; 3-phytase from Aspergillus niger expressed in Aspergillus niger; serine protease (chymotrypsin) from Nocardiopsis prasina expressed in Bacillus licheniformis; and serine protease (trypsin) from Fusarium oxysporum expressed in Fusarium venenatum) and 16 groups of flavouring agents (aliphatic and aromatic amines and amides; aliphatic and aromatic ethers; aliphatic hydrocarbons, alcohols, aldehydes, ketones, carboxylic acids and related esters, sulfides, disulfides and ethers containing furan substitution; aliphatic linear alpha,beta-unsaturated aldehydes, acids and related alcohols, acetals and esters; amino acids and related substances; epoxides; furfuryl alcohol and related substances; linear and branched-chain aliphatic, unsaturated, unconjugated alcohols, aldehydes, acids and related esters; miscellaneous nitrogen-containing substances; phenol and phenol derivatives; pyrazine derivatives; pyridine, pyrrole and quinoline derivatives; saturated aliphatic acyclic branched-chain primary alcohols, aldehydes and acids; simple aliphatic and aromatic sulfides and thiols; sulfur-containing heterocyclic compounds; and sulfur-substituted furan derivatives). Specifications for the following food additives were revised: ethyl cellulose, mineral oil (medium viscosity), modified starches and titanium

  14. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.

    Science.gov (United States)

    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana

    2016-05-01

    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  15. Lack of nucleotide variability in a beetle pest with extreme inbreeding.

    Science.gov (United States)

    Andreev, D; Breilid, H; Kirkendall, L; Brun, L O; ffrench-Constant, R H

    1998-05-01

    The coffee berry borer beetle Hypothenemus hampei (Ferrari) (Curculionidae: Scolytinae) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an unusual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occurring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation in nuclear and mitochondrial genomes of this beetle worldwide. Here we show that two nuclear loci (Resistance to dieldrin and ITS2) are completely invariant, whereas some variability is maintained at a mitochondrial locus (COI), probably corresponding to a higher mutation rate in the mitochondrial genome. Phylogenetic analysis of the mitochondrial data shows only two clades of beetle haplotypes outside of Kenya, the proposed origin of the species. These data confirm that inbreeding greatly reduces nucleotide variation and suggest the recent global spread of only two inbreeding lines of this bark beetle.

  16. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    Science.gov (United States)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

    2017-02-01

    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  17. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  18. FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.

    Science.gov (United States)

    Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A

    2016-06-13

    Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.

  19. NMR studies of the fate of adenine nucleotides in glucose-starved erythrocytes

    International Nuclear Information System (INIS)

    Bubb, W.A.; Mulquiney, P.J.; Kuchel, P.W.; Rohwer, J.; De Atauri, P.

    2002-01-01

    Full text: As a consequence of many refinements during the past 30 years, we now have a detailed understanding of the glycolytic pathway in human erythrocytes. By comparison, and notwithstanding their central importance to four key steps in erythrocyte glycolysis, our knowledge of the catabolism of adenine nucleotides remains relatively limited. In particular, the mechanism for the degradation of AMP, whose concentration rises under conditions of oxidative stress or glucose deprivation, remains poorly understood, AMP degradation may proceed via two possible pathways which converge in the production of inosine. Analysis of the key intermediates for the respective pathways, adenosine and AMP, as well as determination of end products is not straightforward. High-resolution NMR spectroscopy affords a potentially simple analytical solution to this problem but is complicated by spectral overlap and the sensitivity of key resonances to variations in pH and the concentrations of cations such as Mg 2+ . We describe a multinuclear NMR approach towards characterising the intermediates and end-products of adenine nucleotide metabolism in glucose-starved human erythrocytes. Assignments based on homo- and heteronuclear correlation experiments for both 13 C and 31 P are presented

  20. An intermediate state of T7 RNA polymerase provides another pathway of nucleotide selection

    International Nuclear Information System (INIS)

    Wang Zhan-Feng; Liu Yu-Ru; Wang Peng-Ye; Xie Ping

    2017-01-01

    Phage T7 RNA polymerase is a single-subunit transcription enzyme, transcribing template DNA to RNA. Nucleoside triphosphate (NTP) selection and translocation are two critical steps of the transcription elongation. Here, using all-atom molecular dynamics simulations, we found that between pre- and post-translocation states of T7 RNA polymerase an intermediate state exists, where the O helix C-terminal residue tyrosine 639, which plays important roles in translocation, locates between its pre- and post-translocation positions and the side chain of the next template DNA nucleotide has moved into the active site. NTP selection in this intermediate state was studied, revealing that the selection in the intermediate state can be achieved relying on the effect of Watson–Crick interaction between NTP and template DNA nucleotide, effect of stability of the components near the active site such as the nascent DNA–RNA hybrid and role of tyrosine 639. This indicates that another NTP-selection pathway can also exist besides the main pathway where NTP selection begins at the post-translocation state upon the entry of NTP. (paper)