Directory of Open Access Journals (Sweden)
Yakubu Abdulmojeed
2017-01-01
Full Text Available The Major Histocompatibility Complex (MHC contains highly variable multi-gene families, which play a key role in the adaptive immune response within vertebrates. Among the Capra MHC class II genes, the expressed DRB locus is highly polymorphic, particularly in exon 2, which encodes the antigen-binding site. Models of variable non-synonymous/synonymous rate ratios among sites may provide important insights into functional constraints at different amino acid sites and may be used to detect sites under positive selection. Many non-synonymous single nucleotide polymorphisms (nsSNPs at the DRB locus in goats are suspected to impact protein function. This study, therefore, aimed at comparing the efficiency of six computational approaches to predict the likelihood of a particular non-synonymous (amino acid change coding SNP to cause a functional impact on the protein. This involved the use of PANTHER, SNAP, SIFT, PolyPhen-2, PROVEAN and nsSNPAnalyzer bioinformatics analytical tools in detecting harmful and beneficial effects at H57G, Y89R, V104D and Y112I substitutions in the peptide binding region of the DRB gene of Nigerian goats. The results from PANTHER analysis revealed that H57G, Y89R and Y112I substitutions (Pdeleterious= 0.113, 0.204 and 0.472, respectively were beneficial; while that of V104D was deleterious (Pdeleterious= 0.756, an indication that it was non-neutral. As regards the SNAP approach, H57G and Y89R substitutions were returned neutral with expected accuracy of 53 and 69%, respectively while V104D and Y112I substitutions were harmful. H57G and Y89R substitutions were also found harmless in the SIFT analysis. However, only H57G (PROVEAN and V104D (nsSNPAnalyzer amino acid substitutions were found to be beneficial. Interestingly, the predicted 3D structures of both native and mutant DRB protein appeared similar as validated by Ramachandran plots. The consensus reached by PANTHER, SNAP, SIFT and PolyPhen-2 approaches on the neutrality
Are Synonymous Substitutions in Flowering Plant Mitochondria Neutral?
Wynn, Emily L; Christensen, Alan C
2015-10-01
Angiosperm mitochondrial genes appear to have very low mutation rates, while non-gene regions expand, diverge, and rearrange quickly. One possible explanation for this disparity is that synonymous substitutions in plant mitochondrial genes are not truly neutral and selection keeps their occurrence low. If this were true, the explanation for the disparity in mutation rates in genes and non-genes needs to consider selection as well as mechanisms of DNA repair. Rps14 is co-transcribed with cob and rpl5 in most plant mitochondrial genomes, but in some genomes, rps14 has been duplicated to the nucleus leaving a pseudogene in the mitochondria. This provides an opportunity to compare neutral substitution rates in pseudogenes with synonymous substitution rates in the orthologs. Genes and pseudogenes of rps14 have been aligned among different species and the mutation rates have been calculated. Neutral substitution rates in pseudogenes and synonymous substitution rates in genes are significantly different, providing evidence that synonymous substitutions in plant mitochondrial genes are not completely neutral. The non-neutrality is not sufficient to completely explain the exceptionally low mutation rates in land plant mitochondrial genomes, but selective forces appear to play a small role.
DEFF Research Database (Denmark)
van Schijndel, Jessica E; van Loo, Karen M J; van Zweeden, Martine
2009-01-01
selected non-synonymous single-nucleotide polymorphisms (SNPs) in three independent Caucasian schizophrenia case-control cohorts (USA, Denmark and Norway). A meta-analysis revealed ten non-synonymous SNPs that were nominally associated with schizophrenia, nine of which have not been previously linked...... attractive candidate for further study concerns SNP rs6336 (q=0.12) that causes the substitution of an evolutionarily highly conserved amino acid residue in the kinase domain of the neurodevelopmentally important receptor TRKA. Thus, TRKA signaling may represent a novel susceptibility pathway...
regSNPs-splicing: a tool for prioritizing synonymous single-nucleotide substitution.
Zhang, Xinjun; Li, Meng; Lin, Hai; Rao, Xi; Feng, Weixing; Yang, Yuedong; Mort, Matthew; Cooper, David N; Wang, Yue; Wang, Yadong; Wells, Clark; Zhou, Yaoqi; Liu, Yunlong
2017-09-01
While synonymous single-nucleotide variants (sSNVs) have largely been unstudied, since they do not alter protein sequence, mounting evidence suggests that they may affect RNA conformation, splicing, and the stability of nascent-mRNAs to promote various diseases. Accurately prioritizing deleterious sSNVs from a pool of neutral ones can significantly improve our ability of selecting functional genetic variants identified from various genome-sequencing projects, and, therefore, advance our understanding of disease etiology. In this study, we develop a computational algorithm to prioritize sSNVs based on their impact on mRNA splicing and protein function. In addition to genomic features that potentially affect splicing regulation, our proposed algorithm also includes dozens structural features that characterize the functions of alternatively spliced exons on protein function. Our systematical evaluation on thousands of sSNVs suggests that several structural features, including intrinsic disorder protein scores, solvent accessible surface areas, protein secondary structures, and known and predicted protein family domains, show significant differences between disease-causing and neutral sSNVs. Our result suggests that the protein structure features offer an added dimension of information while distinguishing disease-causing and neutral synonymous variants. The inclusion of structural features increases the predictive accuracy for functional sSNV prioritization.
Directory of Open Access Journals (Sweden)
Kourosh Bamdad
2016-12-01
Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion: Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.
Directory of Open Access Journals (Sweden)
Per Erixon
Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the
No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation
Directory of Open Access Journals (Sweden)
Hellberg Michael E
2006-03-01
Full Text Available Abstract Background The mitochondrial DNA (mtDNA of most animals evolves more rapidly than nuclear DNA, and often shows higher levels of intraspecific polymorphism and population subdivision. The mtDNA of anthozoans (corals, sea fans, and their kin, by contrast, appears to evolve slowly. Slow mtDNA evolution has been reported for several anthozoans, however this slow pace has been difficult to put in phylogenetic context without parallel surveys of nuclear variation or calibrated rates of synonymous substitution that could permit quantitative rate comparisons across taxa. Here, I survey variation in the coding region of a mitochondrial gene from a coral species (Balanophyllia elegans known to possess high levels of nuclear gene variation, and estimate synonymous rates of mtDNA substitution by comparison to another coral (Tubastrea coccinea. Results The mtDNA surveyed (630 bp of cytochrome oxidase subunit I was invariant among individuals sampled from 18 populations spanning 3000 km of the range of B. elegans, despite high levels of variation and population subdivision for allozymes over these same populations. The synonymous substitution rate between B. elegans and T. coccinea (0.05%/site/106 years is similar to that in most plants, but 50–100 times lower than rates typical for most animals. In addition, while substitutions to mtDNA in most animals exhibit a strong bias toward transitions, mtDNA from these corals does not. Conclusion Slow rates of mitochondrial nucleotide substitution result in low levels of intraspecific mtDNA variation in corals, even when nuclear loci vary. Slow mtDNA evolution appears to be the basal condition among eukaryotes. mtDNA substitution rates switch from slow to fast abruptly and unidirectionally. This switch may stem from the loss of just one or a few mitochondrion-specific DNA repair or replication genes.
Yates, Christopher M; Sternberg, Michael J E
2013-11-01
Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.
The soybean (Glycine max (L.) Merr.) chlorophyll deficient line MinnGold is a spontaneous mutant characterized by yellow foliage. Map-based cloning and transgenic complementation revealed that the mutant phenotype is caused by a non-synonymous nucleotide substitution in the third exon of a Mg-chelat...
Directory of Open Access Journals (Sweden)
Kumiko Yanagi
2012-01-01
Full Text Available Mutations in the X-linked genes neuroligin 3 (NLGN3 and neuroligin 4X (NLGN4X were first implicated in the pathogenesis of X-linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered.
Directory of Open Access Journals (Sweden)
Sudip Paul
2015-09-01
Full Text Available Computational approaches could help in identifying deleterious non-synonymous single nucleotide polymorphisms (nsSNPs in a disease related gene which is a difficult and laborious task through laboratory experiments. In the present study, we analyzed the impacts of nsSNPs on structure and function of Paraxonase 1 (PON1 using different bioinformatics tools. The human PON1 protein sequence and its corresponding gene's SNP information were collected from UniProt and dbSNP databases, respectively. We utilized SIFT, Polyphen, I-Mutant 2.0, MutPred, SNP and GO, PhD-SNP and PANTHER tools in order to examine the total 39 nsSNPs occurring in the PON1 coding region. We filtered the most pathological mutations by combining the scores of the aforementioned servers and found 8 SNPs (G344C, S302L, W281C, D279Y, H134R, F120S, L90P, C42R as deleterious and disease causing. The PDB structure of PON1 protein was obtained from RCSB Protein Data Bank (PDB ID: 1V04. The deleterious SNPs in native PON1 were introduced using Swiss-PDB Viewer package and changes in free energy were observed for six out of eight mutant structures. Two SNPs, S302L (substitution of serine to leucine at 302 position in amino acid sequence and L90P (substitution of leucine to proline at 90 position in amino acid sequence caused the highest energy increase amongst all. The findings implicate that these nsSNPs would be analyzed further in detail to enumerate their possible association with the protein deteriorating and disease causal potentialities.
Schwarz, Erika N; Ruhlman, Tracey A; Weng, Mao-Lun; Khiyami, Mohammad A; Sabir, Jamal S M; Hajarah, Nahid H; Alharbi, Njud S; Rabah, Samar O; Jansen, Robert K
2017-04-01
This study represents the most comprehensive plastome-wide comparison of nucleotide substitution rates across the three subfamilies of Fabaceae: Caesalpinioideae, Mimosoideae, and Papilionoideae. Caesalpinioid and mimosoid legumes have large, unrearranged plastomes compared with papilionoids, which exhibit varying levels of rearrangement including the loss of the inverted repeat (IR) in the IR-lacking clade (IRLC). Using 71 genes common to 39 legume taxa representing all the three subfamilies, we show that papilionoids consistently have higher nucleotide substitution rates than caesalpinioids and mimosoids, and rates in the IRLC papilionoids are generally higher than those in the IR-containing papilionoids. Unsurprisingly, this pattern was significantly correlated with growth habit as most papilionoids are herbaceous, whereas caesalpinioids and mimosoids are largely woody. Both nonsynonymous (dN) and synonymous (dS) substitution rates were also correlated with several biological features including plastome size and plastomic rearrangements such as the number of inversions and indels. In agreement with previous reports, we found that genes in the IR exhibit between three and fourfold reductions in the substitution rates relative to genes within the large single-copy or small single-copy regions. Furthermore, former IR genes in IR-lacking taxa exhibit accelerated rates compared with genes contained in the IR.
Predicting the effects of non-synonymous amino acid variants on ...
African Journals Online (AJOL)
amino acid change) coding SNPs to cause functional impact on protein at the PRLR locus of cattle and chicken using the MEGA MD bioinformatics tool. In cattle, sixteen out of the first twenty non synonymous amino substitutions obtained: V5A, T9V, ...
Directory of Open Access Journals (Sweden)
Nathan C Edwards
Full Text Available Synonymous variations, which are defined as codon substitutions that do not change the encoded amino acid, were previously thought to have no effect on the properties of the synthesized protein(s. However, mounting evidence shows that these "silent" variations can have a significant impact on protein expression and function and should no longer be considered "silent". Here, the effects of six synonymous and six non-synonymous variations, previously found in the gene of ADAMTS13, the von Willebrand Factor (VWF cleaving hemostatic protease, have been investigated using a variety of approaches. The ADAMTS13 mRNA and protein expression levels, as well as the conformation and activity of the variants have been compared to that of wild-type ADAMTS13. Interestingly, not only the non-synonymous variants but also the synonymous variants have been found to change the protein expression levels, conformation and function. Bioinformatic analysis of ADAMTS13 mRNA structure, amino acid conservation and codon usage allowed us to establish correlations between mRNA stability, RSCU, and intracellular protein expression. This study demonstrates that variants and more specifically, synonymous variants can have a substantial and definite effect on ADAMTS13 function and that bioinformatic analysis may allow development of predictive tools to identify variants that will have significant effects on the encoded protein.
Aris-Brosou, Stéphane; Bielawski, Joseph P
2006-08-15
A popular approach to examine the roles of mutation and selection in the evolution of genomes has been to consider the relationship between codon bias and synonymous rates of molecular evolution. A significant relationship between these two quantities is taken to indicate the action of weak selection on substitutions among synonymous codons. The neutral theory predicts that the rate of evolution is inversely related to the level of functional constraint. Therefore, selection against the use of non-preferred codons among those coding for the same amino acid should result in lower rates of synonymous substitution as compared with sites not subject to such selection pressures. However, reliably measuring the extent of such a relationship is problematic, as estimates of synonymous rates are sensitive to our assumptions about the process of molecular evolution. Previous studies showed the importance of accounting for unequal codon frequencies, in particular when synonymous codon usage is highly biased. Yet, unequal codon frequencies can be modeled in different ways, making different assumptions about the mutation process. Here we conduct a simulation study to evaluate two different ways of modeling uneven codon frequencies and show that both model parameterizations can have a dramatic impact on rate estimates and affect biological conclusions about genome evolution. We reanalyze three large data sets to demonstrate the relevance of our results to empirical data analysis.
Codon adaptation and synonymous substitution rate in diatom plastid genes.
Morton, Brian R; Sorhannus, Ulf; Fox, Martin
2002-07-01
Diatom plastid genes are examined with respect to codon adaptation and rates of silent substitution (Ks). It is shown that diatom genes follow the same pattern of codon usage as other plastid genes studied previously. Highly expressed diatom genes display codon adaptation, or a bias toward specific major codons, and these major codons are the same as those in red algae, green algae, and land plants. It is also found that there is a strong correlation between Ks and variation in codon adaptation across diatom genes, providing the first evidence for such a relationship in the algae. It is argued that this finding supports the notion that the correlation arises from selective constraints, not from variation in mutation rate among genes. Finally, the diatom genes are examined with respect to variation in Ks among different synonymous groups. Diatom genes with strong codon adaptation do not show the same variation in synonymous substitution rate among codon groups as the flowering plant psbA gene which, previous studies have shown, has strong codon adaptation but unusually high rates of silent change in certain synonymous groups. The lack of a similar finding in diatoms supports the suggestion that the feature is unique to the flowering plant psbA due to recent relaxations in selective pressure in that lineage.
Directory of Open Access Journals (Sweden)
Majewski Jacek
2006-08-01
Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.
Investigation of Polymorphisms in Coding Region of OsHKT1 in Relation to Salinity in Rice
Directory of Open Access Journals (Sweden)
Pham Quynh-Hoa
2016-11-01
Full Text Available Rice (Oryza sativa is sensitive to salinity, but the salt tolerance level differs among cultivars, which might result from natural variations in the genes that are responsible for salt tolerance. High-affinity potassium transporter (HKTs has been proven to be involved in salt tolerance in plants. Therefore, we screened for natural nucleotide polymorphism in the coding sequence of OsHKT1, which encodes the HKT protein in eight Vietnamese rice cultivars differing in salt tolerance level. In total, seven nucleotide substitutions in coding sequence of OsHKT1 were found, including two non-synonymous and five synonymous substitutions. Further analysis revealed that these two non-synonymous nucleotide substitutions (G50T and T1209A caused changes in amino acids (Gly17Val and Asp403Glu at signal peptide and the loop of the sixth transmembrane domain, respectively. To assess the potential effect of these substitutions on the protein function, the 3D structure of HKT protein variants was modelled by using PHYRE2 webserver. The results showed that no difference was observed when compared those predicted 3D structure of HKT protein variants with each other. In addition, the codon bias of synonymous substitutions cannot clearly show correlation with salt tolerance level. It might be interesting to further investigate the functional roles of detected non-synonymous substitutions as it might correlate to salt tolerance in rice.
The non-random clustering of non-synonymous substitutions and its relationship to evolutionary rate
Directory of Open Access Journals (Sweden)
Stone Eric A
2011-08-01
Full Text Available Abstract Background Protein sequences are subject to a mosaic of constraint. Changes to functional domains and buried residues, for example, are more apt to disrupt protein structure and function than are changes to residues participating in loops or exposed to solvent. Regions of constraint on the tertiary structure of a protein often result in loose segmentation of its primary structure into stretches of slowly- and rapidly-evolving amino acids. This clustering can be exploited, and existing methods have done so by relying on local sequence conservation as a signature of selection to help identify functionally important regions within proteins. We invert this paradigm by leveraging the regional nature of protein structure and function to both illuminate and make use of genome-wide patterns of local sequence conservation. Results Our hypothesis is that the regional nature of structural and functional constraints will assert a positive autocorrelation on the evolutionary rates of neighboring sites, which, in a pairwise comparison of orthologous proteins, will manifest itself as the clustering of non-synonymous changes across the amino acid sequence. We introduce a dispersion ratio statistic to test this and related hypotheses. Using genome-wide interspecific comparisons of orthologous protein pairs, we reveal a strong log-linear relationship between the degree of clustering and the intensity of constraint. We further demonstrate how this relationship varies with the evolutionary distance between the species being compared. We provide some evidence that proteins with a history of positive selection deviate from genome-wide trends. Conclusions We find a significant association between the evolutionary rate of a protein and the degree to which non-synonymous changes cluster along its primary sequence. We show that clustering is a non-redundant predictor of evolutionary rate, and we speculate that conflicting signals of clustering and constraint may
Canale, Aneth S; Venev, Sergey V; Whitfield, Troy W; Caffrey, Daniel R; Marasco, Wayne A; Schiffer, Celia A; Kowalik, Timothy F; Jensen, Jeffrey D; Finberg, Robert W; Zeldovich, Konstantin B; Wang, Jennifer P; Bolon, Daniel N A
2018-04-13
The fitness effects of synonymous mutations can provide insights into biological and evolutionary mechanisms. We analyzed the experimental fitness effects of all single-nucleotide mutations, including synonymous substitutions, at the beginning of the influenza A virus hemagglutinin (HA) gene. Many synonymous substitutions were deleterious both in bulk competition and for individually isolated clones. Investigating protein and RNA levels of a subset of individually expressed HA variants revealed that multiple biochemical properties contribute to the observed experimental fitness effects. Our results indicate that a structural element in the HA segment viral RNA may influence fitness. Examination of naturally evolved sequences in human hosts indicates a preference for the unfolded state of this structural element compared to that found in swine hosts. Our overall results reveal that synonymous mutations may have greater fitness consequences than indicated by simple models of sequence conservation, and we discuss the implications of this finding for commonly used evolutionary tests and analyses. Copyright © 2018. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
Tammy M K Cheng
Full Text Available Recent analyses of human genome sequences have given rise to impressive advances in identifying non-synonymous single nucleotide polymorphisms (nsSNPs. By contrast, the annotation of nsSNPs and their links to diseases are progressing at a much slower pace. Many of the current approaches to analysing disease-associated nsSNPs use primarily sequence and evolutionary information, while structural information is relatively less exploited. In order to explore the potential of such information, we developed a structure-based approach, Bongo (Bonds ON Graph, to predict structural effects of nsSNPs. Bongo considers protein structures as residue-residue interaction networks and applies graph theoretical measures to identify the residues that are critical for maintaining structural stability by assessing the consequences on the interaction network of single point mutations. Our results show that Bongo is able to identify mutations that cause both local and global structural effects, with a remarkably low false positive rate. Application of the Bongo method to the prediction of 506 disease-associated nsSNPs resulted in a performance (positive predictive value, PPV, 78.5% similar to that of PolyPhen (PPV, 77.2% and PANTHER (PPV, 72.2%. As the Bongo method is solely structure-based, our results indicate that the structural changes resulting from nsSNPs are closely associated to their pathological consequences.
International Nuclear Information System (INIS)
Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.
1998-01-01
To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)
Milne, Roger L.; Burwinkel, Barbara; Michailidou, Kyriaki; Arias-Perez, Jose-Ignacio; Zamora, M. Pilar; Menéndez-Rodríguez, Primitiva; Hardisson, David; Mendiola, Marta; González-Neira, Anna; Pita, Guillermo; Alonso, M. Rosario; Dennis, Joe; Wang, Qin; Bolla, Manjeet K.; Swerdlow, Anthony
2014-01-01
Candidate variant association studies have been largely unsuccessful in identifying common breast cancer susceptibility variants, although most studies have been underpowered to detect associations of a realistic magnitude. We assessed 41 common non-synonymous single-nucleotide polymorphisms (nsSNPs) for which evidence of association with breast cancer risk had been previously reported. Case-control data were combined from 38 studies of white European women (46 450 cases and 42 600 controls) ...
Milne, Roger L.; Burwinkel, Barbara; Michailidou, Kyriaki; Arias-Perez, Jose-Ignacio; Zamora, M. Pilar; Menéndez-Rodríguez, Primitiva; Hardisson, David; Mendiola, Marta; González-Neira, Anna; Pita, Guillermo; Alonso, M. Rosario; Dennis, Joe; Wang, Qin; Bolla, Manjeet K.; Swerdlow, Anthony
2014-01-01
Candidate variant association studies have been largely unsuccessful in identifying common breast cancer susceptibility\\ud variants, although most studies have been underpowered to detect associations of a realistic magnitude.\\ud We assessed 41 common non-synonymous single-nucleotide polymorphisms (nsSNPs) for which\\ud evidence of association with breast cancer risk had been previously reported. Case-control data were combined\\ud from 38 studies of white European women (46 450 cases and 42 60...
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Milne, Roger L; Burwinkel, Barbara; Michailidou, Kyriaki; Arias-Perez, Jose-Ignacio; Zamora, M Pilar; Menéndez-Rodríguez, Primitiva; Hardisson, David; Mendiola, Marta; González-Neira, Anna; Pita, Guillermo; Alonso, M Rosario; Dennis, Joe; Wang, Qin; Bolla, Manjeet K; Swerdlow, Anthony
2014-01-01
Candidate variant association studies have been largely unsuccessful in identifying common breast cancer susceptibility variants, although most studies have been underpowered to detect associations of a realistic magnitude We assessed 41 common non-synonymous single-nucleotide polymorphisms (nsSNPs) for which evidence of association with breast cancer risk had been previously reported. Case-control data were combined from 38 studies of white European women (46 450 cases and 42 600 controls) a...
Adaptive synonymous mutations in an experimentally evolved Pseudomonas fluorescens population
DEFF Research Database (Denmark)
Bailey, Susan; Hinz, Aaron; Kassen, Rees
2014-01-01
Conventional wisdom holds that synonymous mutations, nucleotide changes that do not alter the encoded amino acid, have no detectable effect on phenotype or fitness. However, a growing body of evidence from both comparative and experimental studies suggests otherwise. Synonymous mutations have been...... shown to impact gene expression, protein folding and fitness, however, direct evidence that they can be positively selected, and so contribute to adaptation, is lacking. Here we report the recovery of two beneficial synonymous single base pair changes that arose spontaneously and independently...... in an experimentally evolved population of Pseudomonas fluorescens. We show experimentally that these mutations increase fitness by an amount comparable to non-synonymous mutations and that the fitness increases stem from increased gene expression. These results provide unequivocal evidence that synonymous mutations...
Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA
Jukes, T. H.; Kimura, M.
1984-01-01
The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.
Annonaceae substitution rates: a codon model perspective
Directory of Open Access Journals (Sweden)
Lars Willem Chatrou
2014-01-01
Full Text Available The Annonaceae includes cultivated species of economic interest and represents an important source of information for better understanding the evolution of tropical rainforests. In phylogenetic analyses of DNA sequence data that are used to address evolutionary questions, it is imperative to use appropriate statistical models. Annonaceae are cases in point: Two sister clades, the subfamilies Annonoideae and Malmeoideae, contain the majority of Annonaceae species diversity. The Annonoideae generally show a greater degree of sequence divergence compared to the Malmeoideae, resulting in stark differences in branch lengths in phylogenetic trees. Uncertainty in how to interpret and analyse these differences has led to inconsistent results when estimating the ages of clades in Annonaceae using molecular dating techniques. We ask whether these differences may be attributed to inappropriate modelling assumptions in the phylogenetic analyses. Specifically, we test for (clade-specific differences in rates of non-synonymous and synonymous substitutions. A high ratio of nonsynonymous to synonymous substitutions may lead to similarity of DNA sequences due to convergence instead of common ancestry, and as a result confound phylogenetic analyses. We use a dataset of three chloroplast genes (rbcL, matK, ndhF for 129 species representative of the family. We find that differences in branch lengths between major clades are not attributable to different rates of non-synonymous and synonymous substitutions. The differences in evolutionary rate between the major clades of Annonaceae pose a challenge for current molecular dating techniques that should be seen as a warning for the interpretation of such results in other organisms.
Common non-synonymous SNPs associated with breast cancer susceptibility
DEFF Research Database (Denmark)
Milne, Roger L; Burwinkel, Barbara; Michailidou, Kyriaki
2014-01-01
Candidate variant association studies have been largely unsuccessful in identifying common breast cancer susceptibility variants, although most studies have been underpowered to detect associations of a realistic magnitude. We assessed 41 common non-synonymous single-nucleotide polymorphisms (ns......SNPs) for which evidence of association with breast cancer risk had been previously reported. Case-control data were combined from 38 studies of white European women (46 450 cases and 42 600 controls) and analyzed using unconditional logistic regression. Strong evidence of association was observed for three ns...... associations reached genome-wide statistical significance in a combined analysis of available data, including independent data from nine genome-wide association studies (GWASs): for ATXN7-K264R, OR = 1.07 (95% CI = 1.05-1.10, P = 1.0 × 10(-8)); for AKAP9-M463I, OR = 1.05 (95% CI = 1.04-1.07, P = 2.0 × 10...
DEFF Research Database (Denmark)
Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas
2013-01-01
The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...
Hepp, Diego; Gonçalves, Gislene Lopes; de Freitas, Thales Renato Ochotorena
2015-01-01
The melanocortin 1 receptor (MC1R) is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs) in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC) phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H); C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.
Directory of Open Access Journals (Sweden)
Diego Hepp
Full Text Available The melanocortin 1 receptor (MC1R is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H; C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.
Selection on start codons in prokaryotes and potential compensatory nucleotide substitutions.
Belinky, Frida; Rogozin, Igor B; Koonin, Eugene V
2017-09-29
Reconstruction of the evolution of start codons in 36 groups of closely related bacterial and archaeal genomes reveals purifying selection affecting AUG codons. The AUG starts are replaced by GUG and especially UUG significantly less frequently than expected under the neutral expectation derived from the frequencies of the respective nucleotide triplet substitutions in non-coding regions and in 4-fold degenerate sites. Thus, AUG is the optimal start codon that is actively maintained by purifying selection. However, purifying selection on start codons is significantly weaker than the selection on the same codons in coding sequences, although the switches between the codons result in conservative amino acid substitutions. The only exception is the AUG to UUG switch that is strongly selected against among start codons. Selection on start codons is most pronounced in evolutionarily conserved, highly expressed genes. Mutation of the start codon to a sub-optimal form (GUG or UUG) tends to be compensated by mutations in the Shine-Dalgarno sequence towards a stronger translation initiation signal. Together, all these findings indicate that in prokaryotes, translation start signals are subject to weak but significant selection for maximization of initiation rate and, consequently, protein production.
Metz, Edward C.; Robles-Sikisaka, Refugio; Vacquier, Victor D.
1998-01-01
Strong positive Darwinian selection acts on two sperm fertilization proteins, lysin and 18-kDa protein, from abalone (Haliotis). To understand the phylogenetic context for this dramatic molecular evolution, we obtained sequences of mitochondrial cytochrome c oxidase subunit I (mtCOI), and genomic sequences of lysin, 18-kDa, and a G protein subunit. Based on mtDNA differentiation, four north Pacific abalone species diverged within the past 2 million years (Myr), and remaining north Pacific species diverged over a period of 4–20 Myr. Between-species nonsynonymous differences in lysin and 18-kDa exons exceed nucleotide differences in introns by 3.5- to 24-fold. Remarkably, in some comparisons nonsynonymous substitutions in lysin and 18-kDa genes exceed synonymous substitutions in mtCOI. Lysin and 18-kDa intron/exon segments were sequenced from multiple red abalone individuals collected over a 1,200-km range. Only two nucleotide changes and two sites of slippage variation were detected in a total of >29,000 nucleotides surveyed. However, polymorphism in mtCOI and a G protein intron was found in this species. This finding suggests that positive selection swept one lysin allele and one 18-kDa allele to fixation. Similarities between mtCOI and lysin gene trees indicate that rapid adaptive evolution of lysin has occurred consistently through the history of the group. Comparisons with mtCOI molecular clock calibrations suggest that nonsynonymous substitutions accumulate 2–50 times faster in lysin and 18-kDa genes than in rapidly evolving mammalian genes. PMID:9724763
Directory of Open Access Journals (Sweden)
Nur Lisa Zaharan
2018-04-01
Full Text Available BackgroundSeveral non-synonymous single-nucleotide polymorphisms (nsSNPs have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA in relation to adiposity parameters among adolescents in Malaysia.MethodsWe examined whether (a PA and (b selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study (n = 1,151. Body mass indices, waist–hip ratio, and percentage body fat (% BF were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C. Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3 rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS. Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model.ResultsPAQ-C scores were associated with % BF (β = −0.44 [95% confidence interval −0.72, −0.16], p = 0.002. The CC genotype of ADRB3 rs4994 (β = −0.16 [−0.28, −0.05], corrected p = 0.01 and AA genotype of MC3R rs3827103 (β = −0.06 [−0.12, −0.00], p = 0.02 were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = −0.05 [−0.10, −0.01], p = 0.02 and combined GRS (β = −0.03 [−0.04, −0.01], p = 0.01 for % BF.ConclusionHigher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention
Zaharan, Nur Lisa; Muhamad, Nor Hanisah; Jalaludin, Muhammad Yazid; Su, Tin Tin; Mohamed, Zahurin; Mohamed, M N A; A Majid, Hazreen
2018-01-01
Several non-synonymous single-nucleotide polymorphisms (nsSNPs) have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA) in relation to adiposity parameters among adolescents in Malaysia. We examined whether (a) PA and (b) selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study ( n = 1,151). Body mass indices, waist-hip ratio, and percentage body fat (% BF) were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C). Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3) rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS). Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model. PAQ-C scores were associated with % BF (β = -0.44 [95% confidence interval -0.72, -0.16], p = 0.002). The CC genotype of ADRB3 rs4994 (β = -0.16 [-0.28, -0.05], corrected p = 0.01) and AA genotype of MC3R rs3827103 (β = -0.06 [-0.12, -0.00], p = 0.02) were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = -0.05 [-0.10, -0.01], p = 0.02) and combined GRS (β = -0.03 [-0.04, -0.01], p = 0.01) for % BF. Higher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention in this population.
A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff
Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J.; Lu, Xiangyi; Ruden, Douglas M.
2012-01-01
We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w1118; iso-2; iso-3 strain and the reference y1; cn1 bw1 sp1 strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5′UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5′ and 3′ UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory. PMID:22728672
Directory of Open Access Journals (Sweden)
Ioanna A Armata
Full Text Available BACKGROUND: Mutations in the GCH1 gene are associated with childhood onset, dopa-responsive dystonia (DRD. Correct diagnosis of DRD is crucial, given the potential for complete recovery once treated with L-dopa. The majority of DRD associated mutations lie within the coding region of the GCH1 gene, but three additional single nucleotide sequence substitutions have been reported within the 5' untranslated (5'UTR region of the mRNA. The biologic significance of these 5'UTR GCH1 sequence substitutions has not been analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Luciferase reporter assays, quantitative real time PCR and RNA decay assays, combined with bioinformatics, revealed a pathogenic 5'UTR GCH1 substitution. The +142C>T single nucleotide 5'UTR substitution that segregates with affected status in DRD patients, substantially attenuates translation without altering RNA expression levels or stability. The +142C>T substitution disrupts translation most likely by creating an upstream initiation start codon (uAUG and an upstream open reading frame (uORF. CONCLUSIONS/SIGNIFICANCE: This is the first GCH1 regulatory substitution reported to act at a post-transcriptional level, increasing the list of genetic diseases caused by abnormal translation and reaffirming the importance of investigating potential regulatory substitutions in genetic diseases.
Energy Technology Data Exchange (ETDEWEB)
Allione, Alessandra, E-mail: alessandra.allione@hugef-torino.org [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Guarrera, Simonetta; Russo, Alessia [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Ricceri, Fulvio [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Department of Medical Sciences, University of Turin, Via Santena 19, 10126 Turin (Italy); Purohit, Rituraj [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Bioinformatics Division, School of Bio Sciences and Technology, Vellore Institute of Technology University, Vellore 632014, Tamil Nadu (India); Pagnani, Andrea; Rosa, Fabio; Polidoro, Silvia; Voglino, Floriana [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Matullo, Giuseppe [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Department of Medical Sciences, University of Turin, Via Santena 19, 10126 Turin (Italy)
2013-11-15
Highlights: • We reported a large inter-individual variability of NER capacity. • ERCC4 rs1800124 and MBD4 rs10342 nsSNP variants were associated with DNA repair capacity. • DNA–protein interaction analyses showed alteration of binding for ERCC4 and MBD4 variants. • A new possible cross-talk between NER and BER pathways has been reported. - Abstract: Inter-individual differences in DNA repair capacity (DRC) may lead to genome instability and, consequently, modulate individual cancer risk. Among the different DNA repair pathways, nucleotide excision repair (NER) is one of the most versatile, as it can eliminate a wide range of helix-distorting DNA lesions caused by ultraviolet light irradiation and chemical mutagens. We performed a genotype–phenotype correlation study in 122 healthy subjects in order to assess if any associations exist between phenotypic profiles of NER and DNA repair gene single nucleotide polymorphisms (SNPs). Individuals were genotyped for 768 SNPs with a custom Illumina Golden Gate Assay, and peripheral blood mononuclear cells (PBMCs) of the same subjects were tested for a NER comet assay to measure DRC after challenging cells by benzo(a)pyrene diolepoxide (BPDE). We observed a large inter-individual variability of NER capacity, with women showing a statistically significant lower DRC (mean ± SD: 6.68 ± 4.76; p = 0.004) than men (mean ± SD: 8.89 ± 5.20). Moreover, DRC was significantly lower in individuals carrying a variant allele for the ERCC4 rs1800124 non-synonymous SNP (nsSNP) (p = 0.006) and significantly higher in subjects with the variant allele of MBD4 rs2005618 SNP (p = 0.008), in linkage disequilibrium (r{sup 2} = 0.908) with rs10342 nsSNP. Traditional in silico docking approaches on protein–DNA and protein–protein interaction showed that Gly875 variant in ERCC4 (rs1800124) decreases the DNA–protein interaction and that Ser273 and Thr273 variants in MBD4 (rs10342) indicate complete loss of protein
Convergent evolution of marine mammals is associated with distinct substitutions in common genes
Zhou, Xuming; Seim, Inge; Gladyshev, Vadim N.
2015-01-01
Phenotypic convergence is thought to be driven by parallel substitutions coupled with natural selection at the sequence level. Multiple independent evolutionary transitions of mammals to an aquatic environment offer an opportunity to test this thesis. Here, whole genome alignment of coding sequences identified widespread parallel amino acid substitutions in marine mammals; however, the majority of these changes were not unique to these animals. Conversely, we report that candidate aquatic adaptation genes, identified by signatures of likelihood convergence and/or elevated ratio of nonsynonymous to synonymous nucleotide substitution rate, are characterized by very few parallel substitutions and exhibit distinct sequence changes in each group. Moreover, no significant positive correlation was found between likelihood convergence and positive selection in all three marine lineages. These results suggest that convergence in protein coding genes associated with aquatic lifestyle is mainly characterized by independent substitutions and relaxed negative selection. PMID:26549748
Wang, Xiaodan; Ma, Dehong; Huang, Xinwei; Li, Lihua; Li, Duo; Zhao, Yujiao; Qiu, Lijuan; Pan, Yue; Chen, Junying; Xi, Juemin; Shan, Xiyun; Sun, Qiangming
2017-06-15
In the past few decades, dengue has spread rapidly and is an emerging disease in China. An unexpected dengue outbreak occurred in Xishuangbanna, Yunnan, China, resulting in 1331 patients in 2013. In order to obtain the complete genome information and perform mutation and evolutionary analysis of causative agent related to this largest outbreak of dengue fever. The viruses were isolated by cell culture and evaluated by genome sequence analysis. Phylogenetic trees were then constructed by Neighbor-Joining methods (MEGA6.0), followed by analysis of nucleotide mutation and amino acid substitution. The analysis of the diversity of secondary structure for E and NS1 protein were also performed. Then selection pressures acting on the coding sequences were estimated by PAML software. The complete genome sequences of two isolated strains (YNSW1, YNSW2) were 10,710 and 10,702 nucleotides in length, respectively. Phylogenetic analysis revealed both strain were classified as genotype II of DENV-3. The results indicated that both isolated strains of Xishuangbanna in 2013 and Laos 2013 stains (KF816161.1, KF816158.1, LC147061.1, LC147059.1, KF816162.1) were most similar to Bangladesh (AY496873.2) in 2002. After comparing with the DENV-3SS (H87) 62 amino acid substitutions were identified in translated regions, and 38 amino acid substitutions were identified in translated regions compared with DENV-3 genotype II stains Bangladesh (AY496873.2). 27(YNSW1) or 28(YNSW2) single nucleotide changes were observed in structural protein sequences with 7(YNSW1) or 8(YNSW2) non-synonymous mutations compared with AY496873.2. Of them, 4 non-synonymous mutations were identified in E protein sequences with (2 in the β-sheet, 2 in the coil). Meanwhile, 117(YNSW1) or 115 (YNSW2) single nucleotide changes were observed in non-structural protein sequences with 31(YNSW1) or 30 (YNSW2) non-synonymous mutations. Particularly, 14 single nucleotide changes were observed in NS1 sequences with 4/14 non-synonymous
Directory of Open Access Journals (Sweden)
Keightley Peter D
2008-09-01
Full Text Available Abstract Background Molecular evolutionary studies in mammals often estimate nucleotide substitution rates within and outside CpG dinucleotides separately. Frequently, in alignments of two sequences, the division of sites into CpG and non-CpG classes is based simply on the presence or absence of a CpG dinucleotide in either sequence, a procedure that we refer to as CpG/non-CpG assignment. Although it likely that this procedure is biased, it is generally assumed that the bias is negligible if species are very closely related. Results Using simulations of DNA sequence evolution we show that assignment of the ancestral CpG state based on the simple presence/absence of the CpG dinucleotide can seriously bias estimates of the substitution rate, because many true non-CpG changes are misassigned as CpG. Paradoxically, this bias is most severe between closely related species, because a minimum of two substitutions are required to misassign a true ancestral CpG site as non-CpG whereas only a single substitution is required to misassign a true ancestral non-CpG site as CpG in a two branch tree. We also show that CpG misassignment bias differentially affects fourfold degenerate and noncoding sites due to differences in base composition such that fourfold degenerate sites can appear to be evolving more slowly than noncoding sites. We demonstrate that the effects predicted by our simulations occur in a real evolutionary setting by comparing substitution rates estimated from human-chimp coding and intronic sequence using CpG/non-CpG assignment with estimates derived from a method that is largely free from bias. Conclusion Our study demonstrates that a common method of assigning sites into CpG and non CpG classes in pairwise alignments is seriously biased and recommends against the adoption of ad hoc methods of ancestral state assignment.
Zhao, Meixia; Du, Jianchang; Lin, Feng; Tong, Chaobo; Yu, Jingyin; Huang, Shunmou; Wang, Xiaowu; Liu, Shengyi; Ma, Jianxin
2013-10-01
Recent sequencing of the Brassica rapa and Brassica oleracea genomes revealed extremely contrasting genomic features such as the abundance and distribution of transposable elements between the two genomes. However, whether and how these structural differentiations may have influenced the evolutionary rates of the two genomes since their split from a common ancestor are unknown. Here, we investigated and compared the rates of nucleotide substitution between two long terminal repeats (LTRs) of individual orthologous LTR-retrotransposons, the rates of synonymous and non-synonymous substitution among triplicated genes retained in both genomes from a shared whole genome triplication event, and the rates of genetic recombination estimated/deduced by the comparison of physical and genetic distances along chromosomes and ratios of solo LTRs to intact elements. Overall, LTR sequences and genic sequences showed more rapid nucleotide substitution in B. rapa than in B. oleracea. Synonymous substitution of triplicated genes retained from a shared whole genome triplication was detected at higher rates in B. rapa than in B. oleracea. Interestingly, non-synonymous substitution was observed at lower rates in the former than in the latter, indicating shifted densities of purifying selection between the two genomes. In addition to evolutionary asymmetry, orthologous genes differentially regulated and/or disrupted by transposable elements between the two genomes were also characterized. Our analyses suggest that local genomic and epigenomic features, such as recombination rates and chromatin dynamics reshaped by independent proliferation of transposable elements and elimination between the two genomes, are perhaps partially the causes and partially the outcomes of the observed inter-specific asymmetric evolution. © 2013 Purdue University The Plant Journal © 2013 John Wiley & Sons Ltd.
Detecting selection needs comparative data
DEFF Research Database (Denmark)
Nielsen, Rasmus; Hubisz, Melissa J.
2005-01-01
Positive selection at the molecular level is usually indicated by an increase in the ratio of non-synonymous to synonymous substitutions (dN/dS) in comparative data. However, Plotkin et al. 1 describe a new method for detecting positive selection based on a single nucleotide sequence. We show here...... that this method is particularly sensitive to assumptions regarding the underlying mutational processes and does not provide a reliable way to identify positive selection....
Battilana, Juri; Emanuelli, Francesco; Gambino, Giorgio; Gribaudo, Ivana; Gasperi, Flavia; Boss, Paul K.; Grando, Maria Stella
2011-01-01
Grape berries of Muscat cultivars (Vitis vinifera L.) contain high levels of monoterpenols and exhibit a distinct aroma related to this composition of volatiles. A structural gene of the plastidial methyl-erythritol-phosphate (MEP) pathway, 1-deoxy-D-xylulose 5-phosphate synthase (VvDXS), was recently suggested as a candidate gene for this trait, having been co-localized with a major quantitative trait locus for linalool, nerol, and geraniol concentrations in berries. In addition, a structured association study discovered a putative causal single nucleotide polymorphism (SNP) responsible for the substitution of a lysine with an asparagine at position 284 of the VvDXS protein, and this SNP was significantly associated with Muscat-flavoured varieties. The significance of this nucleotide difference was investigated by comparing the monoterpene profiles with the expression of VvDXS alleles throughout berry development in Moscato Bianco, a cultivar heterozygous for the SNP mutation. Although correlation was detected between the VvDXS transcript profile and the accumulation of free monoterpenol odorants, the modulation of VvDXS expression during berry development appears to be independent of nucleotide variation in the coding sequence. In order to assess how the non-synonymous mutation may enhance Muscat flavour, an in vitro characterization of enzyme isoforms was performed followed by in vivo overexpression of each VvDXS allele in tobacco. The results showed that the amino acid non-neutral substitution influences the enzyme kinetics by increasing the catalytic efficiency and also dramatically affects monoterpene levels in transgenic lines. These findings confirm a functional effect of the VvDXS gene polymorphism and may pave the way for metabolic engineering of terpenoid contents in grapevine. PMID:21868399
Liu, Chengzhang; Wang, Xia; Xiang, Jianhai; Li, Fuhua
2012-09-01
Pacific white shrimp has become a major aquaculture and fishery species worldwide. Although a large scale EST resource has been publicly available since 2008, the data have not yet been widely used for SNP discovery or transcriptome-wide assessment of selective pressure. In this study, a set of 155 411 expressed sequence tags (ESTs) from the NCBI database were computationally analyzed and 17 225 single nucleotide polymorphisms (SNPs) were predicted, including 9 546 transitions, 5 124 transversions and 2 481 indels. Among the 7 298 SNP substitutions located in functionally annotated contigs, 58.4% (4 262) are non-synonymous SNPs capable of introducing amino acid mutations. Two hundred and fifty nonsynonymous SNPs in genes associated with economic traits have been identified as candidates for markers in selective breeding. Diversity estimates among the synonymous nucleotides were on average 3.49 times greater than those in non-synonymous, suggesting negative selection. Distribution of non-synonymous to synonymous substitutions (Ka/Ks) ratio ranges from 0 to 4.01, (average 0.42, median 0.26), suggesting that the majority of the affected genes are under purifying selection. Enrichment analysis identified multiple gene ontology categories under positive or negative selection. Categories involved in innate immune response and male gamete generation are rich in positively selected genes, which is similar to reports in Drosophila and primates. This work is the first transcriptome-wide assessment of selective pressure in a Penaeid shrimp species. The functionally annotated SNPs provide a valuable resource of potential molecular markers for selective breeding.
Energy Technology Data Exchange (ETDEWEB)
Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.
1987-02-01
To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.
Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J; Lu, Xiangyi; Ruden, Douglas M
2012-01-01
We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w(1118); iso-2; iso-3 strain and the reference y(1); cn(1) bw(1) sp(1) strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5'UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5' and 3' UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory.
Directory of Open Access Journals (Sweden)
Zijian Li
2014-02-01
Full Text Available Amino acid substitutions in influenza A virus are the main reasons for both antigenic shift and virulence change, which result from non-synonymous mutations in the viral genome. Nucleocapsid protein (NP, one of the major structural proteins of influenza virus, is responsible for regulation of viral RNA synthesis and replication. In this report we used LC-MS/MS to analyze tryptic digestion of nucleocapsid protein of influenza virus (A/Puerto Rico/8/1934 H1N1, which was isolated and purified by SDS poly-acrylamide gel electrophoresis. Thus, LC-MS/MS analyses, coupled with manual de novo sequencing, allowed the determination of three substituted amino acid residues R452K, T423A and N430T in two tryptic peptides. The obtained results provided experimental evidence that amino acid substitutions resulted from non-synonymous gene mutations could be directly characterized by mass spectrometry in proteins of RNA viruses such as influenza A virus.
Evolution of hypothalamus-pituitary growth axis among fish, amphibian, birds and mammals
Directory of Open Access Journals (Sweden)
Moaeen-Ud-Din M.
2015-01-01
Full Text Available Hypothalamus-pituitary growth axis (HP growth axis regulates animal growth and development in pre-natal and post natal life governed by many factors. However, until recently, the evolutionary history of this axis among lineages is not understood. Aim of the present study was to understand the major events in evolution and evolutionary history and trend of HP growth axis. The diversity among Homo sapience, Mus musculus, Rattus norvegicus, Gallus gallus, Danio rerio and Xenopus laevis was determined for genes involved in HP growth axis in current study. Sequences of HP growth axis genes were retrieved from NCBI (http://www.ncbi.nlm.nih.gov/. Nucleotide diversity using Kimura’s two-parameter method; codon-based test of positive selection using the Nei-Gojobori; equality of evolutionary rate with Tajima's relative rate test and phylogenetic history using the RelTime method were estimated in MEGA6. Estimates of the coefficients of evolutionary differentiation based on nucleotides and amino acids substitution patterns of HP growth axis genes showed contrasting evolutionary patterns among the lineages. The results demonstrated that although these genes might have crucial functional roles in each of the species, however, their sequence divergence did not necessarily reflect similar molecular evolution among the species. Codon-based test of positive selection revealed that Human vs Mouse, Chicken vs Rat, Human vs Rat and Mouse vs Rat had similar and higher non synonymous substitutions (P > 0.05. Higher rate of non-synonymous substitutions at similar orthologs level among species indicated a similar positive selection pressure in these species. Results for relative rate test assessed with the chi-squared test showed difference on unique mutations among lineages at synonymous and non synonymous sites except Chicken vs Mouse, Human vs Mouse, Chicken vs Rat, Human vs Rat and Mouse vs Rat. This indicated that the mutagenic process that generates
Sun, Yu; Tamarit, Daniel
2017-01-01
Abstract The major codon preference model suggests that codons read by tRNAs in high concentrations are preferentially utilized in highly expressed genes. However, the identity of the optimal codons differs between species although the forces driving such changes are poorly understood. We suggest that these questions can be tackled by placing codon usage studies in a phylogenetic framework and that bacterial genomes with extreme nucleotide composition biases provide informative model systems. Switches in the background substitution biases from GC to AT have occurred in Gardnerella vaginalis (GC = 32%), and from AT to GC in Lactobacillus delbrueckii (GC = 62%) and Lactobacillus fermentum (GC = 63%). We show that despite the large effects on codon usage patterns by these switches, all three species evolve under selection on synonymous sites. In G. vaginalis, the dramatic codon frequency changes coincide with shifts of optimal codons. In contrast, the optimal codons have not shifted in the two Lactobacillus genomes despite an increased fraction of GC-ending codons. We suggest that all three species are in different phases of an on-going shift of optimal codons, and attribute the difference to a stronger background substitution bias and/or longer time since the switch in G. vaginalis. We show that comparative and correlative methods for optimal codon identification yield conflicting results for genomes in flux and discuss possible reasons for the mispredictions. We conclude that switches in the direction of the background substitution biases can drive major shifts in codon preference patterns even under sustained selection on synonymous codon sites. PMID:27540085
Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes
Energy Technology Data Exchange (ETDEWEB)
Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.
2016-12-21
Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.
International Nuclear Information System (INIS)
Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.
1990-08-01
The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)
THE LEXICOGRAFIC PRINCIPLES OF WORD MEANINGS IN THE MULTILINGUAL SYNONYMIC DICTIONARIES
Directory of Open Access Journals (Sweden)
Siddikova, I.A.
2018-03-01
Full Text Available This article is dedicated to study of principles of description of the meaning of words in the multilingual synonymic dictionaries. The dictionary of synonyms must have full enough and absolutely explicit description of their semantic similarity and distinctions. The description can be full if it includes all existing features of the words, adequately denote every meaning and help the language learners and speakers in choosing possible meanings of synonyms owing to situation. The synonymic dictionary must include all synonyms, their meanings, lexico-semantic combination, distribution, grammatical constructions and stylistic features showing their usage in certain contexts and situations. In some cases according to their contextual meanings synonyms may be substituted depending on situation. The article is based on examples of English, Uzbek and Russian languages.
DEFF Research Database (Denmark)
Takikawa, Shingo; Engle, Ronald E; Faulk, Kristina N
2010-01-01
(-3) substitutions per site year(-1) during weeks 1-52 and 53-104, respectively. Thus, there was a significant decrease in evolution over time, as found for hepatitis C virus. The rate of non-synonymous substitution per non-synonymous site compared with that of synonymous substitution per synonymous site decreased...
Evaluating rare amino acid substitutions (RGC_CAMs in a yeast model clade.
Directory of Open Access Journals (Sweden)
Kenneth Polzin
Full Text Available When inferring phylogenetic relationships, not all sites in a sequence alignment are equally informative. One recently proposed approach that takes advantage of this inequality relies on sites that contain amino acids whose replacement requires multiple substitutions. Identifying these so-called RGC_CAM substitutions (after Rare Genomic Changes as Conserved Amino acids-Multiple substitutions requires that, first, at any given site in the amino acid sequence alignment, there must be a minimum of two different amino acids; second, each amino acid must be present in at least two taxa; and third, the amino acids must require a minimum of two nucleotide substitutions to replace each other. Although theory suggests that RGC_CAM substitutions are expected to be rare and less likely to be homoplastic, the informativeness of RGC_CAM substitutions has not been extensively evaluated in biological data sets. We investigated the quality of RGC_CAM substitutions by examining their degree of homoplasy and internode certainty in nearly 2.7 million aligned amino acid sites from 5,261 proteins from five species belonging to the yeast Saccharomyces sensu stricto clade whose phylogeny is well-established. We identified 2,647 sites containing RGC_CAM substitutions, a number that contrasts sharply with the 100,887 sites containing RGC_non-CAM substitutions (i.e., changes between amino acids that require only a single nucleotide substitution. We found that RGC_CAM substitutions had significantly lower homoplasy than RGC_non-CAM ones; specifically RGC_CAM substitutions showed a per-site average homoplasy index of 0.100, whereas RGC_non-CAM substitutions had a homoplasy index of 0.215. Internode certainty values were also higher for sites containing RGC_CAM substitutions than for RGC_non-CAM ones. These results suggest that RGC_CAM substitutions possess a strong phylogenetic signal and are useful markers for phylogenetic inference despite their rarity.
Ferri, L; Dionisi-Vici, C; Taurisano, R; Vaz, F M; Guerrini, R; Morrone, A
2016-11-01
Barth syndrome (BTHS) is an X-linked inborn error of metabolism which affects males. The main manifestations are cardiomyopathy, myopathy, hypotonia, growth delay, intermittent neutropenia and 3-methylglutaconic aciduria. Diagnosis is confirmed by mutational analysis of the TAZ gene and biochemical dosage of the monolysocardiolipin/tetralinoleoyl cardiolipin (MLCL:L4-CL) ratio. We report a 6-year-old boy who presented with severe hypoglycemia, lactic acidosis and severe dilated cardiomyopathy soon after birth. The MLCL:L4-CL ratio confirmed BTHS (3.90 on patient's fibroblast, normal: 0-0.3). Subsequent sequencing of the TAZ gene revealed only the new synonymous variant NM_000116.3 (TAZ):c.348C>T p.(Gly116Gly), which did not appear to affect the protein sequence. In silico prediction analysis suggested the new c.348C>T nucleotide change could alter the TAZ mRNA splicing processing. We analyzed TAZ mRNAs in the patient's fibroblasts and found an abnormal skipping of 24 bases (NM_000116.3:c.346_371), with the consequent ablation of 8 amino acid residues in the tafazzin protein (NP_000107.1:p.Lys117_Gly124del). Molecular analysis of at risk female family members identified the patient's sister and mother as heterozygous carriers. Apparently harmless synonymous variants in the TAZ gene can damage gene expression. Such findings widen our knowledge of molecular heterogeneity in BTHS. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Stefano Castellana
2017-06-01
Full Text Available 24,189 are all the possible non-synonymous amino acid changes potentially affecting the human mitochondrial DNA. Only a tiny subset was functionally evaluated with certainty so far, while the pathogenicity of the vast majority was only assessed in-silico by software predictors. Since these tools proved to be rather incongruent, we have designed and implemented APOGEE, a machine-learning algorithm that outperforms all existing prediction methods in estimating the harmfulness of mitochondrial non-synonymous genome variations. We provide a detailed description of the underlying algorithm, of the selected and manually curated training and test sets of variants, as well as of its classification ability.
NU-IN: Nucleotide evolution and input module for the EvolSimulator genome simulation platform
Directory of Open Access Journals (Sweden)
Barker Michael S
2010-08-01
Full Text Available Abstract Background There is increasing demand to test hypotheses that contrast the evolution of genes and gene families among genomes, using simulations that work across these levels of organization. The EvolSimulator program was developed recently to provide a highly flexible platform for forward simulations of amino acid evolution in multiple related lineages of haploid genomes, permitting copy number variation and lateral gene transfer. Synonymous nucleotide evolution is not currently supported, however, and would be highly advantageous for comparisons to full genome, transcriptome, and single nucleotide polymorphism (SNP datasets. In addition, EvolSimulator creates new genomes for each simulation, and does not allow the input of user-specified sequences and gene family information, limiting the incorporation of further biological realism and/or user manipulations of the data. Findings We present modified C++ source code for the EvolSimulator platform, which we provide as the extension module NU-IN. With NU-IN, synonymous and non-synonymous nucleotide evolution is fully implemented, and the user has the ability to use real or previously-simulated sequence data to initiate a simulation of one or more lineages. Gene family membership can be optionally specified, as well as gene retention probabilities that model biased gene retention. We provide PERL scripts to assist the user in deriving this information from previous simulations. We demonstrate the features of NU-IN by simulating genome duplication (polyploidy in the presence of ongoing copy number variation in an evolving lineage. This example is initiated with real genomic data, and produces output that we analyse directly with existing bioinformatic pipelines. Conclusions The NU-IN extension module is a publicly available open source software (GNU GPLv3 license extension to EvolSimulator. With the NU-IN module, users are now able to simulate both drift and selection at the nucleotide
Directory of Open Access Journals (Sweden)
Nan Zhao
2014-05-01
Full Text Available Single nucleotide polymorphisms (SNPs are among the most common types of genetic variation in complex genetic disorders. A growing number of studies link the functional role of SNPs with the networks and pathways mediated by the disease-associated genes. For example, many non-synonymous missense SNPs (nsSNPs have been found near or inside the protein-protein interaction (PPI interfaces. Determining whether such nsSNP will disrupt or preserve a PPI is a challenging task to address, both experimentally and computationally. Here, we present this task as three related classification problems, and develop a new computational method, called the SNP-IN tool (non-synonymous SNP INteraction effect predictor. Our method predicts the effects of nsSNPs on PPIs, given the interaction's structure. It leverages supervised and semi-supervised feature-based classifiers, including our new Random Forest self-learning protocol. The classifiers are trained based on a dataset of comprehensive mutagenesis studies for 151 PPI complexes, with experimentally determined binding affinities of the mutant and wild-type interactions. Three classification problems were considered: (1 a 2-class problem (strengthening/weakening PPI mutations, (2 another 2-class problem (mutations that disrupt/preserve a PPI, and (3 a 3-class classification (detrimental/neutral/beneficial mutation effects. In total, 11 different supervised and semi-supervised classifiers were trained and assessed resulting in a promising performance, with the weighted f-measure ranging from 0.87 for Problem 1 to 0.70 for the most challenging Problem 3. By integrating prediction results of the 2-class classifiers into the 3-class classifier, we further improved its performance for Problem 3. To demonstrate the utility of SNP-IN tool, it was applied to study the nsSNP-induced rewiring of two disease-centered networks. The accurate and balanced performance of SNP-IN tool makes it readily available to study the
Zhao, Nan; Han, Jing Ginger; Shyu, Chi-Ren; Korkin, Dmitry
2014-01-01
Single nucleotide polymorphisms (SNPs) are among the most common types of genetic variation in complex genetic disorders. A growing number of studies link the functional role of SNPs with the networks and pathways mediated by the disease-associated genes. For example, many non-synonymous missense SNPs (nsSNPs) have been found near or inside the protein-protein interaction (PPI) interfaces. Determining whether such nsSNP will disrupt or preserve a PPI is a challenging task to address, both experimentally and computationally. Here, we present this task as three related classification problems, and develop a new computational method, called the SNP-IN tool (non-synonymous SNP INteraction effect predictor). Our method predicts the effects of nsSNPs on PPIs, given the interaction's structure. It leverages supervised and semi-supervised feature-based classifiers, including our new Random Forest self-learning protocol. The classifiers are trained based on a dataset of comprehensive mutagenesis studies for 151 PPI complexes, with experimentally determined binding affinities of the mutant and wild-type interactions. Three classification problems were considered: (1) a 2-class problem (strengthening/weakening PPI mutations), (2) another 2-class problem (mutations that disrupt/preserve a PPI), and (3) a 3-class classification (detrimental/neutral/beneficial mutation effects). In total, 11 different supervised and semi-supervised classifiers were trained and assessed resulting in a promising performance, with the weighted f-measure ranging from 0.87 for Problem 1 to 0.70 for the most challenging Problem 3. By integrating prediction results of the 2-class classifiers into the 3-class classifier, we further improved its performance for Problem 3. To demonstrate the utility of SNP-IN tool, it was applied to study the nsSNP-induced rewiring of two disease-centered networks. The accurate and balanced performance of SNP-IN tool makes it readily available to study the rewiring of
Functional non-synonymous variants of ABCG2 and gout risk.
Stiburkova, Blanka; Pavelcova, Katerina; Zavada, Jakub; Petru, Lenka; Simek, Pavel; Cepek, Pavel; Pavlikova, Marketa; Matsuo, Hirotaka; Merriman, Tony R; Pavelka, Karel
2017-11-01
Common dysfunctional variants of ATP binding cassette subfamily G member 2 (Junior blood group) (ABCG2), a high-capacity urate transporter gene, that result in decreased urate excretion are major causes of hyperuricemia and gout. In the present study, our objective was to determine the frequency and effect on gout of common and rare non-synonymous and other functional allelic variants in the ABCG2 gene. The main cohort recruited from the Czech Republic consisted of 145 gout patients; 115 normouricaemic controls were used for comparison. We amplified, directly sequenced and analysed 15 ABCG2 exons. The associations between genetic variants and clinical phenotype were analysed using the t-test, Fisher's exact test and a logistic and linear regression approach. Data from a New Zealand Polynesian sample set and the UK Biobank were included for the p.V12M analysis. In the ABCG2 gene, 18 intronic (one dysfunctional splicing) and 11 exonic variants were detected: 9 were non-synonymous (2 common, 7 rare including 1 novel), namely p.V12M, p.Q141K, p.R147W, p.T153M, p.F373C, p.T434M, p.S476P, p.D620N and p.K360del. The p.Q141K (rs2231142) variant had a significantly higher minor allele frequency (0.23) in the gout patients compared with the European-origin population (0.09) and was significantly more common among gout patients than among normouricaemic controls (odds ratio = 3.26, P gout (42 vs 48 years, P = 0.0143) and a greater likelihood of a familial history of gout (41% vs 27%, odds ratio = 1.96, P = 0.053). In a meta-analysis p.V12M exerted a protective effect from gout (P gout. Non-synonymous allelic variants of ABCG2 had a significant effect on earlier onset of gout and the presence of a familial gout history. ABCG2 should thus be considered a common and significant risk factor for gout. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Directory of Open Access Journals (Sweden)
Cheng Deng
Full Text Available Using accumulating SNP (Single-Nucleotide Polymorphism data, we performed a genome-wide search for polypeptide hormone ligands showing changes in the mature regions to elucidate genotype/phenotype diversity among various human populations. Neuropeptide S (NPS, a brain peptide hormone highly conserved in vertebrates, has diverse physiological effects on anxiety, fear, hyperactivity, food intake, and sleeping time through its cognate receptor-NPSR. Here, we report a SNP rs4751440 (L(6-NPS causing non-synonymous substitution on the 6(th position (V to L of the NPS mature peptide region. L(6-NPS has a higher allele frequency in Europeans than other populations and probably originated from European ancestors ~25,000 yrs ago based on haplotype analysis and Approximate Bayesian Computation. Functional analyses indicate that L(6-NPS exhibits a significant lower bioactivity than the wild type NPS, with ~20-fold higher EC50 values in the stimulation of NPSR. Additional evolutionary and mutagenesis studies further demonstrate the importance of the valine residue in the 6(th position for NPS functions. Given the known physiological roles of NPS receptor in inflammatory bowel diseases, asthma pathogenesis, macrophage immune responses, and brain functions, our study provides the basis to elucidate NPS evolution and signaling diversity among human populations.
Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S
2003-05-01
Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.
Directory of Open Access Journals (Sweden)
Akiko Takasuga
2015-08-01
Full Text Available Recessive skeletal dysplasia, characterized by joint- and/or hip bone-enlargement, was mapped within the critical region for a major quantitative trait locus (QTL influencing carcass weight; previously named CW-3 in Japanese Black cattle. The risk allele was on the same chromosome as the Q allele that increases carcass weight. Phenotypic characterization revealed that the risk allele causes disproportional tall stature and bone size that increases carcass weight in heterozygous individuals but causes disproportionately narrow chest width in homozygotes. A non-synonymous variant of FGD3 was identified as a positional candidate quantitative trait nucleotide (QTN and the corresponding mutant protein showed reduced activity as a guanine nucleotide exchange factor for Cdc42. FGD3 is expressed in the growth plate cartilage of femurs from bovine and mouse. Thus, loss of FDG3 activity may lead to subsequent loss of Cdc42 function. This would be consistent with the columnar disorganization of proliferating chondrocytes in chondrocyte-specific inactivated Cdc42 mutant mice. This is the first report showing association of FGD3 with skeletal dysplasia.
Watkins, N A; O'Connor, M N; Rankin, A; Jennings, N; Wilson, E; Harmer, I J; Davies, L; Smethurst, P A; Dudbridge, F; Farndale, R W; Ouwehand, W H
2006-06-01
Common genetic variants of cell surface receptors contribute to differences in functional responses and disease susceptibility. We have previously shown that single nucleotide polymorphisms (SNPs) in platelet glycoprotein VI (GP6) determine the extent of response to agonist. In addition, SNPs in the GP6 gene have been proposed as risk factors for coronary artery disease. To completely characterize genetic variation in the GP6 gene we generated a high-resolution SNP map by sequencing the promoter, exons and consensus splice sequences in 94 non-related Caucasoids. In addition, we sequenced DNA encoding the ligand-binding domains of GP6 from non-human primates to determine the level of evolutionary conservation. Eighteen SNPs were identified, six of which encoded amino acid substitutions in the mature form of the protein. The single non-synonymous SNP identified in the exons encoding the ligand-binding domains, encoding for a 103Leu > Val substitution, resulted in reduced ligand binding. Two common protein isoforms were confirmed in Caucasoid with frequencies of 0.82 and 0.15. Variation at the GP6 locus was characterized further by determining SNP frequency in over 2000 individuals from different ethnic backgrounds. The SNPs were polymorphic in all populations studied although significant differences in allele frequencies were observed. Twelve additional GP6 protein isoforms were identified from the genotyping results and, despite extensive variation in GP6, the sequence of the ligand-binding domains is conserved. Sequences from non-human primates confirmed this observation. These data provide valuable information for the optimal selection of genetic variants for use in future association studies.
Substitution rates in the X- and Y-linked genes of the plants, Silene latifolia and S. dioica.
Filatov, Dmitry A; Charlesworth, Deborah
2002-06-01
Theory predicts that selection should be less effective in the nonrecombining genes of Y-chromosomes, relative to the situation for genes on the other chromosomes, and this should lead to the accumulation of deleterious nonsynonymous substitutions. In addition, synonymous substitution rates may differ between X- and Y-linked genes because of the male-driven evolution effect and also because of actual differences in per-replication mutation rates between the sex chromosomes. Here, we report the first study of synonymous and nonsynonymous substitution rates on plant sex chromosomes. We sequenced two pairs of sex-linked genes, SlX1-SlY1 and SlX4-SlY4, from dioecious Silene latifolia and S. dioica, and their non-sex-linked homologues from nondioecious S. vulgaris and Lychnis flos-jovis, respectively. The rate of nonsynonymous substitutions in the SlY4 gene is significantly higher than that in the SlX4 gene. Silent substitution rates are also significantly higher in both Y-linked genes, compared with their X-linked homologues. The higher nonsynonymous substitution rate in the SlY4 gene is therefore likely to be caused by a mutation rate difference between the sex chromosomes. The difference in silent substitution rates between the SlX4 and SlY4 genes is too great to be explained solely by a higher per-generation mutation rate in males than females. It is thus probably caused by a difference in per-replication mutation rates between the sex chromosomes. This suggests that the local mutation rate can change in a relatively short evolutionary time.
Directory of Open Access Journals (Sweden)
Chen Jun
2012-11-01
Full Text Available Abstract Background A detailed knowledge about spatial and temporal gene expression is important for understanding both the function of genes and their evolution. For the vast majority of species, transcriptomes are still largely uncharacterized and even in those where substantial information is available it is often in the form of partially sequenced transcriptomes. With the development of next generation sequencing, a single experiment can now simultaneously identify the transcribed part of a species genome and estimate levels of gene expression. Results mRNA from actively growing needles of Norway spruce (Picea abies was sequenced using next generation sequencing technology. In total, close to 70 million fragments with a length of 76 bp were sequenced resulting in 5 Gbp of raw data. A de novo assembly of these reads, together with publicly available expressed sequence tag (EST data from Norway spruce, was used to create a reference transcriptome. Of the 38,419 PUTs (putative unique transcripts longer than 150 bp in this reference assembly, 83.5% show similarity to ESTs from other spruce species and of the remaining PUTs, 3,704 show similarity to protein sequences from other plant species, leaving 4,167 PUTs with limited similarity to currently available plant proteins. By predicting coding frames and comparing not only the Norway spruce PUTs, but also PUTs from the close relatives Picea glauca and Picea sitchensis to both Pinus taeda and Taxus mairei, we obtained estimates of synonymous and non-synonymous divergence among conifer species. In addition, we detected close to 15,000 SNPs of high quality and estimated gene expression differences between samples collected under dark and light conditions. Conclusions Our study yielded a large number of single nucleotide polymorphisms as well as estimates of gene expression on transcriptome scale. In agreement with a recent study we find that the synonymous substitution rate per year (0.6 × 10
Directory of Open Access Journals (Sweden)
Lingaas Frode
2008-01-01
Full Text Available Abstract Background Polymorphism in genes of regulating enzymes, transporters and receptors of the neurotransmitters of the central nervous system have been associated with altered behaviour, and single nucleotide polymorphisms (SNPs represent the most frequent type of genetic variation. The serotonin and dopamine signalling systems have a central influence on different behavioural phenotypes, both of invertebrates and vertebrates, and this study was undertaken in order to explore genetic variation that may be associated with variation in behaviour. Results Single nucleotide polymorphisms in canine genes related to behaviour were identified by individually sequencing eight dogs (Canis familiaris of different breeds. Eighteen genes from the dopamine and the serotonin systems were screened, revealing 34 SNPs distributed in 14 of the 18 selected genes. A total of 24,895 bp coding sequence was sequenced yielding an average frequency of one SNP per 732 bp (1/732. A total of 11 non-synonymous SNPs (nsSNPs, which may be involved in alteration of protein function, were detected. Of these 11 nsSNPs, six resulted in a substitution of amino acid residue with concomitant change in structural parameters. Conclusion We have identified a number of coding SNPs in behaviour-related genes, several of which change the amino acids of the proteins. Some of the canine SNPs exist in codons that are evolutionary conserved between five compared species, and predictions indicate that they may have a functional effect on the protein. The reported coding SNP frequency of the studied genes falls within the range of SNP frequencies reported earlier in the dog and other mammalian species. Novel SNPs are presented and the results show a significant genetic variation in expressed sequences in this group of genes. The results can contribute to an improved understanding of the genetics of behaviour.
Directory of Open Access Journals (Sweden)
Arnett Donna
2009-08-01
Full Text Available Abstract Background Variations in gene allele frequencies can contribute to differences in the prevalence of some common complex diseases among populations. Natural selection modulates the balance in allele frequencies across populations. Population differentiation (FST can evidence environmental selection pressures. Such genetic information is limited in Puerto Ricans, the second largest Hispanic ethnic group in the US, and a group with high prevalence of chronic disease. We determined allele frequencies and population differentiation for 101 single nucleotide polymorphisms (SNPs in 30 genes involved in major metabolic and disease-relevant pathways in Puerto Ricans (n = 969, ages 45–75 years and compared them to similarly aged non-Hispanic whites (NHW (n = 597. Results Minor allele frequency (MAF distributions for 45.5% of the SNPs assessed in Puerto Ricans were significantly different from those of NHW. Puerto Ricans carried risk alleles in higher frequency and protective alleles in lower frequency than NHW. Patterns of population differentiation showed that Puerto Ricans had SNPs with exceptional FST values in intronic, non-synonymous and promoter regions. NHW had exceptional FST values in intronic and promoter region SNPs only. Conclusion These observations may serve to explain and broaden studies on the impact of gene polymorphisms on chronic diseases affecting Puerto Ricans.
DEFF Research Database (Denmark)
Li, Yingrui; Vinckenbosch, Nicolas; Tian, Geng
2010-01-01
data, we derived the allele frequency spectrum of cSNPs with a minor allele frequency greater than 0.02. We identified a 1.8-fold excess of deleterious, non-syonomyous cSNPs over synonymous cSNPs in the low-frequency range (minor allele frequencies between 2% and 5%). This excess was more pronounced...
Directory of Open Access Journals (Sweden)
Ayman Abunimer
2014-03-01
Full Text Available Cardiovascular diseases are a large contributor to causes of early death in developed countries. Some of these conditions, such as sudden cardiac death and atrial fibrillation, stem from arrhythmias—a spectrum of conditions with abnormal electrical activity in the heart. Genome-wide association studies can identify single nucleotide variations (SNVs that may predispose individuals to developing acquired forms of arrhythmias. Through manual curation of published genome-wide association studies, we have collected a comprehensive list of 75 SNVs associated with cardiac arrhythmias. Ten of the SNVs result in amino acid changes and can be used in proteomic-based detection methods. In an effort to identify additional non-synonymous mutations that affect the proteome, we analyzed the post-translational modification S-nitrosylation, which is known to affect cardiac arrhythmias. We identified loss of seven known S-nitrosylation sites due to non-synonymous single nucleotide variations (nsSNVs. For predicted nitrosylation sites we found 1429 proteins where the sites are modified due to nsSNV. Analysis of the predicted S-nitrosylation dataset for over- or under-representation (compared to the complete human proteome of pathways and functional elements shows significant statistical over-representation of the blood coagulation pathway. Gene Ontology (GO analysis displays statistically over-represented terms related to muscle contraction, receptor activity, motor activity, cystoskeleton components, and microtubule activity. Through the genomic and proteomic context of SNVs and S-nitrosylation sites presented in this study, researchers can look for variation that can predispose individuals to cardiac arrhythmias. Such attempts to elucidate mechanisms of arrhythmia thereby add yet another useful parameter in predicting susceptibility for cardiac diseases.
Directory of Open Access Journals (Sweden)
Hemingway Janet
2007-01-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most common source of genetic variation in eukaryotic species and have become an important marker for genetic studies. The mosquito Anopheles funestus is one of the major malaria vectors in Africa and yet, prior to this study, no SNPs have been described for this species. Here we report a genome-wide set of SNP markers for use in genetic studies on this important human disease vector. Results DNA fragments from 50 genes were amplified and sequenced from 21 specimens of An. funestus. A third of specimens were field collected in Malawi, a third from a colony of Mozambican origin and a third form a colony of Angolan origin. A total of 494 SNPs including 303 within the coding regions of genes and 5 indels were identified. The physical positions of these SNPs in the genome are known. There were on average 7 SNPs per kilobase similar to that observed in An. gambiae and Drosophila melanogaster. Transitions outnumbered transversions, at a ratio of 2:1. The increased frequency of transition substitutions in coding regions is likely due to the structure of the genetic code and selective constraints. Synonymous sites within coding regions showed a higher polymorphism rate than non-coding introns or 3' and 5'flanking DNA with most of the substitutions in coding regions being observed at the 3rd codon position. A positive correlation in the level of polymorphism was observed between coding and non-coding regions within a gene. By genotyping a subset of 30 SNPs, we confirmed the validity of the SNPs identified during this study. Conclusion This set of SNP markers represents a useful tool for genetic studies in An. funestus, and will be useful in identifying candidate genes that affect diverse ranges of phenotypes that impact on vector control, such as resistance insecticide, mosquito behavior and vector competence.
Ojeda, Diego A; Forero, Diego A
2014-10-01
Non-synonymous single nucleotide polymorphisms (nsSNPs) in brain-expressed genes represent interesting candidates for genetic research in neuropsychiatric disorders. To study novel nsSNPs in brain-expressed genes in a sample of Colombian subjects. We applied an approach based on in silico mining of available genomic data to identify and select novel nsSNPs in brain-expressed genes. We developed novel genotyping assays, based in allele-specific PCR methods, for these nsSNPs and genotyped them in 171 Colombian subjects. Five common nsSNPs (rs6855837; p.Leu395Ile, rs2305160; p.Thr394Ala, rs10503929; p.Met289Thr, rs2270641; p.Thr4Pro and rs3822659; p.Ser735Ala) were studied, located in the CLOCK, NPAS2, NRG1, SLC18A1 and WWC1 genes. We reported allele and genotype frequencies in a sample of South American healthy subjects. There is previous experimental evidence, arising from genome-wide expression and association studies, for the involvement of these genes in several neuropsychiatric disorders and endophenotypes, such as schizophrenia, mood disorders or memory performance. Frequencies for these nsSNPSs in the Colombian samples varied in comparison to different HapMap populations. Future study of these nsSNPs in brain-expressed genes, a synaptogenomics approach, will be important for a better understanding of neuropsychiatric diseases and endophenotypes in different populations.
Sawai, Hiroaki; Nagashima, Junichi; Kuwahara, Msayasu; Kitagata, Rina; Tamura, Takehiro; Matsui, Ikuo
2007-09-01
The pyrimidine bases of RNA are uracil (U) and cytosine (C), while thymine (T) and C are used for DNA. The C(5) position of C and U is unsubstituted, whereas the C(5) of T is substituted with a Me group. Miller et al. hypothesized that various C(5)-substituted uracil derivatives were formed during chemical evolution, and that C(5)-substituted U derivatives may have played important roles in the transition from an 'RNA world' to a 'DNA-RNA-protein world'. Hyperthermophilic bacteria and archaea are considered to be primitive organisms that are evolutionarily close to the universal ancestor of all life on earth. Thus, we examined the substrate specificity of several C(5)-substituted or C(5)-unsubstituted dUTP and dCTP analogs for several DNA polymerases from hyperthermophilic bacteria, hyperthermophilic archaea, and viruses during PCR or primer extension reaction. The substrate specificity of the C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides varied greatly depending on the type of DNA polymerase. The significance of this difference in substrate specificity in terms of the origin and evolution of the DNA replication system is discussed briefly.
Sitt, Tatjana; Pelle, Roger; Chepkwony, Maurine; Morrison, W Ivan; Toye, Philip
2018-05-06
The extent of sequence diversity among the genes encoding 10 antigens (Tp1-10) known to be recognized by CD8+ T lymphocytes from cattle immune to Theileria parva was analysed. The sequences were derived from parasites in 23 buffalo-derived cell lines, three cattle-derived isolates and one cloned cell line obtained from a buffalo-derived stabilate. The results revealed substantial variation among the antigens through sequence diversity. The greatest nucleotide and amino acid diversity were observed in Tp1, Tp2 and Tp9. Tp5 and Tp7 showed the least amount of allelic diversity, and Tp5, Tp6 and Tp7 had the lowest levels of protein diversity. Tp6 was the most conserved protein; only a single non-synonymous substitution was found in all obtained sequences. The ratio of non-synonymous: synonymous substitutions varied from 0.84 (Tp1) to 0.04 (Tp6). Apart from Tp2 and Tp9, we observed no variation in the other defined CD8+ T cell epitopes (Tp4, 5, 7 and 8), indicating that epitope variation is not a universal feature of T. parva antigens. In addition to providing markers that can be used to examine the diversity in T. parva populations, the results highlight the potential for using conserved antigens to develop vaccines that provide broad protection against T. parva.
In silico analysis of consequences of non-synonymous SNPs of Slc11a2 gene in Indian bovines
Directory of Open Access Journals (Sweden)
Shreya M. Patel
2015-09-01
Full Text Available The aim of our study was to analyze the consequences of non-synonymous SNPs in Slc11a2 gene using bioinformatic tools. There is a current need of efficient bioinformatic tools for in-depth analysis of data generated by the next generation sequencing technologies. SNPs are known to play an imperative role in understanding the genetic basis of many genetic diseases. Slc11a2 is one of the major metal transporter families in mammals and plays a critical role in host defenses. In this study, we performed a comprehensive analysis of the impact of all non-synonymous SNPs in this gene using multiple tools like SIFT, PROVEAN, I-Mutant and PANTHER. Among the total 124 SNPs obtained from amplicon sequencing of Slc11a2 gene by Ion Torrent PGM involving 10 individuals of Gir cattle and Murrah buffalo each, we found 22 non-synonymous. Comparing the prediction of these 4 methods, 5 nsSNPs (G369R, Y374C, A377V, Q385H and N492S were identified as deleterious. In addition, while tested out for polar interactions with other amino acids in the protein, from above 5, Y374C, Q385H and N492S showed a change in interaction pattern and further confirmed by an increase in total energy after energy minimizations in case of mutant protein compared to the native.
International Nuclear Information System (INIS)
Yang, Jing; Li, Yuan-Yuan; Li, Yi-Xue; Ye, Zhi-Qiang
2012-01-01
Highlights: ► Proper dataset partition can improve the prediction of deleterious nsSNPs. ► Partition according to original residue type at nsSNP is a good criterion. ► Similar strategy is supposed promising in other machine learning problems. -- Abstract: Many non-synonymous SNPs (nsSNPs) are associated with diseases, and numerous machine learning methods have been applied to train classifiers for sorting disease-associated nsSNPs from neutral ones. The continuously accumulated nsSNP data allows us to further explore better prediction approaches. In this work, we partitioned the training data into 20 subsets according to either original or substituted amino acid type at the nsSNP site. Using support vector machine (SVM), training classification models on each subset resulted in an overall accuracy of 76.3% or 74.9% depending on the two different partition criteria, while training on the whole dataset obtained an accuracy of only 72.6%. Moreover, the dataset was also randomly divided into 20 subsets, but the corresponding accuracy was only 73.2%. Our results demonstrated that partitioning the whole training dataset into subsets properly, i.e., according to the residue type at the nsSNP site, will improve the performance of the trained classifiers significantly, which should be valuable in developing better tools for predicting the disease-association of nsSNPs.
Directory of Open Access Journals (Sweden)
Kenji Fukunaga
2015-12-01
Full Text Available We investigated genetic variation of a rice HEADING DATE 1(HD1 homolog in foxtail millet. First, we searched for a rice HD1 homolog in a foxtail millet genome sequence and designed primers to amplify the entire coding sequence of the gene. We compared full HD1 gene sequences of 11 accessions (including Yugu 1, a Chinese cultivar used for genome sequencing from various regions in Europe and Asia, found a nucleotide substitution at a putative splice site of intron 1, and designated the accessions with the nucleotide substitution as carrying a splicing variant. We verified by RT-PCR that this single nucleotide substitution causes aberrant splicing of intron 1. We investigated the geographical distribution of the splicing variant in 480 accessions of foxtail millet from various regions of Europe and Asia and part of Africa by dCAPS and found that the splicing variant is broadly distributed in Europe and Asia. Differences of heading times between accessions with wild type allele of the HD1 gene and those with the splicing variant allele were unclear. We also investigated variation in 13 accessions of ssp. viridis, the wild ancestor, and the results suggested that the wild type is predominant in the wild ancestor.
Proportionally more deleterious genetic variation in European than in African populations
DEFF Research Database (Denmark)
Lohmueller, Kirk E; Indap, Amit R; Schmidt, Steffen
2008-01-01
of functional SNPs considered, including synonymous, non-synonymous, predicted 'benign', predicted 'possibly damaging' and predicted 'probably damaging' SNPs. This result is wholly consistent with previous work showing higher overall levels of nucleotide variation in African populations than in Europeans. EA...... individuals, in contrast, have significantly more genotypes homozygous for the derived allele at synonymous and non-synonymous SNPs and for the damaging allele at 'probably damaging' SNPs than AAs do. For SNPs segregating only in one population or the other, the proportion of non-synonymous SNPs...
Giangaspero, Massimo; Harasawa, Ryô
2007-12-01
The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences.
In-silico analysis of non-synonymous-SNPs of STEAP2: To provoke the progression of prostate cancer
Directory of Open Access Journals (Sweden)
Naveed Muhammad
2016-01-01
Full Text Available As a novel biomarker from the STEAP family, STEAP2 encodes six transmembrane epithelial antigens to prostate cancer. The overexpression of STEAP2 is predicted as the second most common cancer in the world that is responsible for male cancer-related deaths. Nonsynonymous SNPs are important group of SNPs which lead to alternations in encoded polypeptides. Changes in the amino acid sequence of gene products can lead to abnormal tissue function. The present study firstly sorted out those SNPs which exist in the coding region of STEAP2 and evaluated their impact through computational tools. Secondly, the three-dimensional structure of STEAP2 was formed through I-TASSER and validated by different software. Genomic data has been retrieved from the 1000 Genome project and Ensembl and subsequently analysed using computational tools. Out of 177 non-synonymous single nucleotide polymorphisms (nsSNPs within the coding region, 42 mis-sense SNPs have been predicted as deleterious by all analyses. Our research shows a welldesigned computational methodology to inspect the prostate cancer associated nsSNPs. It can be concluded that these nsSNPs can play their role in the up-regulation of STEAP2 which further leads to progression of prostate cancer. It can benefit scientists in the handling of cancerassociated diseases related to STEAP2 through developing novel drug therapies.
DEFF Research Database (Denmark)
Wesselius, Anke; Bours, Martijn Jl; Jørgensen, Niklas R
2013-01-01
of these two receptors on osteoporosis risk. Patients with fracture (690 females and 231 males, aged ≥50 years) were genotyped for three non-synonymous P2X ( 4 ) R SNPs. Bone mineral density (BMD) was measured at the total hip, lumbar spine, and femoral neck. Subject carrying the variant allele of the Tyr315...... of non-synonymous polymorphisms in the P2RX ( 4 ) and the risk of osteoporosis, suggesting a role of the P2X ( 4 ) R in the regulation of bone mass....
Directory of Open Access Journals (Sweden)
Antoine ePersoons
2014-09-01
Full Text Available Melampsora larici-populina is a fungal pathogen responsible for foliar rust disease on poplar trees, which causes damage to forest plantations worldwide, particularly in Northern Europe. The reference genome of the isolate 98AG31 was previously sequenced using a whole genome shotgun strategy, revealing a large genome of 101 megabases containing 16,399 predicted genes, which included secreted protein genes representing poplar rust candidate effectors. In the present study, the genomes of 15 isolates collected over the past 20 years throughout the French territory, representing distinct virulence profiles, were characterized by massively parallel sequencing to assess genetic variation in the poplar rust fungus. Comparison to the reference genome revealed striking structural variations. Analysis of coverage and sequencing depth identified large missing regions between isolates related to the mating type loci. More than 611,824 single-nucleotide polymorphism (SNP positions were uncovered overall, indicating a remarkable level of polymorphism. Based on the accumulation of non-synonymous substitutions in coding sequences and the relative frequencies of synonymous and non-synonymous polymorphisms (i.e. PN/PS, we identify candidate genes that may be involved in fungal pathogenesis. Correlation between non-synonymous SNPs in genes encoding secreted proteins and pathotypes of the studied isolates revealed candidate genes potentially related to virulences 1, 6 and 8 of the poplar rust fungus.
Chauke, Chesa G; Magwebu, Zandisiwe E; Sharma, Jyoti R; Arieff, Zainunisha; Seier, Jürgen V
2016-08-01
Non-ketotic hyperglycinaemia (NKH) is an autosomal recessive inborn error of glycine metabolism characterized by accumulation of glycine in body fluids and various neurological symptoms. This study describes the first screening of NKH in cataract captive-bred vervet monkeys (Chlorocebus aethiops). Glycine dehydrogenase (GLDC), aminomethyltransferase (AMT) and glycine cleavage system H protein (GCSH) were prioritized. Mutation analysis of the complete coding sequence of GLDC and AMT revealed six novel single-base substitutions, of which three were non-synonymous missense and three were silent nucleotide changes. Although deleterious effects of the three amino acid substitutions were not evaluated, one substitution of GLDC gene (S44R) could be disease-causing because of its drastic amino acid change, affecting amino acids conserved in different primate species. This study confirms the diagnosis of NKH for the first time in vervet monkeys with cataracts. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China.
Directory of Open Access Journals (Sweden)
Zuyi Chen
Full Text Available Cancer of the cervix is associated with infection by certain types of human papillomavirus (HPV. The gene variants differ in immune responses and oncogenic potential. The E6 and E7 proteins encoded by high-risk HPV play a key role in cellular transformation. HPV-33 and HPV-58 types are highly prevalent among Chinese women. To study the gene intratypic variations, polymorphisms and positive selections of HPV-33 and HPV-58 E6/E7 in southwest China, HPV-33 (E6, E7: n = 216 and HPV-58 (E6, E7: n = 405 E6 and E7 genes were sequenced and compared to others submitted to GenBank. Phylogenetic trees were constructed by Maximum-likelihood and the Kimura 2-parameters methods by MEGA 6 (Molecular Evolutionary Genetics Analysis version 6.0. The diversity of secondary structure was analyzed by PSIPred software. The selection pressures acting on the E6/E7 genes were estimated by PAML 4.8 (Phylogenetic Analyses by Maximun Likelihood version4.8 software. The positive sites of HPV-33 and HPV-58 E6/E7 were contrasted by ClustalX 2.1. Among 216 HPV-33 E6 sequences, 8 single nucleotide mutations were observed with 6/8 non-synonymous and 2/8 synonymous mutations. The 216 HPV-33 E7 sequences showed 3 single nucleotide mutations that were non-synonymous. The 405 HPV-58 E6 sequences revealed 8 single nucleotide mutations with 4/8 non-synonymous and 4/8 synonymous mutations. Among 405 HPV-58 E7 sequences, 13 single nucleotide mutations were observed with 10/13 non-synonymous mutations and 3/13 synonymous mutations. The selective pressure analysis showed that all HPV-33 and 4/6 HPV-58 E6/E7 major non-synonymous mutations were sites of positive selection. All variations were observed in sites belonging to major histocompatibility complex and/or B-cell predicted epitopes. K93N and R145 (I/N were observed in both HPV-33 and HPV-58 E6.
Van, K; Onoda, S; Kim, M Y; Kim, K D; Lee, S-H
2008-03-01
The Waxy (Wx) gene product controls the formation of a straight chain polymer of amylose in the starch pathway. Dominance/recessiveness of the Wx allele is associated with amylose content, leading to non-waxy/waxy phenotypes. For a total of 113 foxtail millet accessions, agronomic traits and the molecular differences of the Wx gene were surveyed to evaluate genetic diversities. Molecular types were associated with phenotypes determined by four specific primer sets (non-waxy, Type I; low amylose, Type VI; waxy, Type IV or V). Additionally, the insertion of transposable element in waxy was confirmed by ex1/TSI2R, TSI2F/ex2, ex2int2/TSI7R and TSI7F/ex4r. Seventeen single nucleotide polymorphims (SNPs) were observed from non-coding regions, while three SNPs from coding regions were non-synonymous. Interestingly, the phenotype of No. 88 was still non-waxy, although seven nucleotides (AATTGGT) insertion at 2,993 bp led to 78 amino acids shorter. The rapid decline of r (2) in the sequenced region (exon 1-intron 1-exon 2) suggested a low level of linkage disequilibrium and limited haplotype structure. K (s) values and estimation of evolutionary events indicate early divergence of S. italica among cereal crops. This study suggested the Wx gene was one of the targets in the selection process during domestication.
Giangaspero, Massimo; Apicella, Claudio; Harasawa, Ryô
2013-09-01
The genus Pestivirus from the family Flaviviridae is represented by four established species; Bovine viral diarrhea virus 1 (BVDV-1); Bovine viral diarrhea virus 2 (BVDV-2); Border disease virus (BDV); and Classical swine fever virus (CSFV); as well a tentative species from a Giraffe. The palindromic nucleotide substitutions (PNS) in the 5' untranslated region (UTR) of Pestivirus RNA has been described as a new, simple and practical method for genotyping. New software is described, also named PNS, that was prepared specifically for this PNS genotyping procedure. Pestivirus identification using PNS was evaluated on five hundred and forty-three sequences at genus, species and genotype level using this software. The software is freely available at www.pns-software.com. Copyright © 2013 Elsevier B.V. All rights reserved.
Wu, Meixiang; Gotoh, Hiroki; Waters, Timothy; Walsh, Douglas B; Lavine, Laura Corley
2014-06-01
Knockdown resistance (kdr) has been identified as a main mechanism against pyrethroid insecticides in many arthropod pests including in the onion thrips, Thrips tabaci. To characterize and identify pyrethroid-resistance in onion thrips in Washington state, we conducted insecticide bioassays and sequenced a region of the voltage gated sodium channel gene from several different T. tabaci populations. Field collected Thrips tabaci were found to have large variations in resistance to the pyrethroid insecticide lambda-cyhalothrin. We identified two single nucleotide substitutions in our analysis of a partial sequence of the T. tabaci voltage-gated sodium channel gene. One mutation resulted in the non-synonymous substitution of methionine with leucine (M918L), which is well known to be responsible for super knockdown resistance in some pest species. Another non-synonymous substitution, a valine (GTT) to alanine (GCT) replacement at amino acid 1010 (V1010A) was identified in our study and was associated with lambda-cyhalothrin resistance. We have characterized a known kdr mutation and identified a novel mutation in the voltage-gated sodium channel gene of Thrips tabaci associated with resistance to lambda-cyhalothrin. This gene region and these mutations are expected to be useful in the development of a diagnostic test to detect kdr resistance in many onion thrips populations. © 2013 Society of Chemical Industry.
Examining Method Effect of Synonym and Antonym Test in Verbal Abilities Measure
Directory of Open Access Journals (Sweden)
Wahyu Widhiarso
2015-08-01
Full Text Available Many researchers have assumed that different methods could be substituted to measure the same attributes in assessment. Various models have been developed to accommodate the amount of variance attributable to the methods but these models application in empirical research is rare. The present study applied one of those models to examine whether method effects were presents in synonym and antonym tests. Study participants were 3,469 applicants to graduate school. The instrument used was the Graduate Academic Potential Test (PAPS, which includes synonym and antonym questions to measure verbal abilities. Our analysis showed that measurement models that using correlated trait–correlated methods minus one, CT-C(M–1, that separated trait and method effect into distinct latent constructs yielded slightly better values for multiple goodness-of-fit indices than one factor model. However, either for the synonym or antonym items, the proportion of variance accounted for by the method is smaller than trait variance. The correlation between factor scores of both methods is high (r = 0.994. These findings confirm that synonym and antonym tests represent the same attribute so that both tests cannot be treated as two unique methods for measuring verbal ability.
Examining Method Effect of Synonym and Antonym Test in Verbal Abilities Measure.
Widhiarso, Wahyu; Haryanta
2015-08-01
Many researchers have assumed that different methods could be substituted to measure the same attributes in assessment. Various models have been developed to accommodate the amount of variance attributable to the methods but these models application in empirical research is rare. The present study applied one of those models to examine whether method effects were presents in synonym and antonym tests. Study participants were 3,469 applicants to graduate school. The instrument used was the Graduate Academic Potential Test (PAPS), which includes synonym and antonym questions to measure verbal abilities. Our analysis showed that measurement models that using correlated trait-correlated methods minus one, CT-C(M-1), that separated trait and method effect into distinct latent constructs yielded slightly better values for multiple goodness-of-fit indices than one factor model. However, either for the synonym or antonym items, the proportion of variance accounted for by the method is smaller than trait variance. The correlation between factor scores of both methods is high (r = 0.994). These findings confirm that synonym and antonym tests represent the same attribute so that both tests cannot be treated as two unique methods for measuring verbal ability.
Non-nucleotide Agonists Triggering P2X7 Receptor Activation and Pore Formation
Directory of Open Access Journals (Sweden)
Francesco Di Virgilio
2018-02-01
Full Text Available The P2X7 receptor (P2X7R is a ligand-gated plasma membrane ion channel belonging to the P2X receptor subfamily activated by extracellular nucleotides. General consensus holds that the physiological (and maybe the only agonist is ATP. However, scattered evidence generated over the last several years suggests that ATP might not be the only agonist, especially at inflammatory sites. Solid data show that NAD+ covalently modifies the P2X7R of mouse T lymphocytes, thus lowering the ATP threshold for activation. Other structurally unrelated agents have been reported to activate the P2X7R via a poorly understood mechanism of action: (a the antibiotic polymyxin B, possibly a positive allosteric P2X7R modulator, (b the bactericidal peptide LL-37, (c the amyloidogenic β peptide, and (d serum amyloid A. Some agents, such as Alu-RNA, have been suggested to activate the P2X7R acting on the intracellular N- or C-terminal domains. Mode of P2X7R activation by these non-nucleotide ligands is as yet unknown; however, these observations raise the intriguing question of how these different non-nucleotide ligands may co-operate with ATP at inflammatory or tumor sites. New information obtained from the cloning and characterization of the P2X7R from exotic mammalian species (e.g., giant panda and data from recent patch-clamp studies are strongly accelerating our understanding of P2X7R mode of operation, and may provide hints to the mechanism of activation of P2X7R by non-nucleotide ligands.
DEFF Research Database (Denmark)
Ammitzbøll, Christian Gytz; Kjær, Troels Rønn; Steffensen, Rudi
2012-01-01
The innate immune system encompasses various recognition molecules able to sense both exogenous and endogenous danger signals arising from pathogens or damaged host cells. One such pattern-recognition molecule is M-ficolin, which is capable of activating the complement system through the lectin...... of non-synonymous SNPs on protein function....
Rodelo-Urrego, Manuel; García-Arenal, Fernando; Pagán, Israel
2015-01-01
Current declines in biodiversity put at risk ecosystem services that are fundamental for human welfare. Increasing evidence indicates that one such service is the ability to reduce virus emergence. It has been proposed that the reduction of virus emergence occurs at two levels: through a reduction of virus prevalence/transmission and, as a result of these epidemiological changes, through a limitation of virus genetic diversity. Although the former mechanism has been studied in a few host-virus interactions, very little is known about the association between ecosystem biodiversity and virus genetic diversity. To address this subject, we estimated genetic diversity, synonymous and non-synonymous nucleotide substitution rates, selection pressures, and frequency of recombinants and re-assortants in populations of Pepper golden mosaic virus (PepGMV) and Pepper huasteco yellow vein virus (PHYVV) that infect chiltepin plants in Mexico. We then analyzed how these parameters varied according to the level of habitat anthropization, which is the major cause of biodiversity loss. Our results indicated that genetic diversity of PepGMV (but not of PHYVV) populations increased with the loss of biodiversity at higher levels of habitat anthropization. This was mostly the consequence of higher rates of synonymous nucleotide substitutions, rather than of adaptive selection. The frequency of recombinants and re-assortants was higher in PepGMV populations infecting wild chiltepin than in those infecting cultivated ones, suggesting that genetic exchange is not the main mechanism for generating genetic diversity in PepGMV populations. These findings provide evidence that biodiversity may modulate the genetic diversity of plant viruses, but it may differentially affect even two closely related viruses. Our analyses may contribute to understanding the factors involved in virus emergence.
Wong, Wing Chung; Kim, Dewey; Carter, Hannah; Diekhans, Mark; Ryan, Michael C; Karchin, Rachel
2011-08-01
Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. MySQL database, source code and binaries freely available for academic/government use at http://wiki.chasmsoftware.org, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python 5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM.
Directory of Open Access Journals (Sweden)
Yun-Fu Liu
2013-08-01
Full Text Available The NLRP12 (NLR family, pyrin domain containing 12 serves as a suppressor factor in the inflammatory response and protects the host against inflammation-induced damage. In the present study, we aimed to study the polymorphisms of NLRP12 gene and its association with susceptibility to non-specific digestive disorder (NSDD in rabbits. We re-sequenced the entire coding region of the rabbit NLRP12 gene and detected a total of 19 SNPs containing 14 synonymous and five non-synonymous variations. Among them, the coding SNP (c.1682A>G, which would carry a potential functional implication, was subsequently subjected to genotyping for case-control association study (272 cases and 267 controls. The results revealed that allele A was significantly protective against NSDD with an odds ratio value of 0.884 (95% confidence interval, 0.788 to 0.993; p = 0.038. We also experimentally induced NSDD in growing rabbits by feeding a fibre-deficient diet and subsequently investigated NLRP12 mRNA expression. The mRNA expression of NLRP12 in healthy status was significantly higher than that in severe NSDD (p = 0.0016. The highest expression was observed in individuals carrying the protective genotype AA (p = 0.0108. These results suggested that NLRP12 was significantly associated with the NSDD in rabbits. However, the precise molecular mechanism of NLRP12 involving in the development of rabbit NSDD requires further research.
Substitution rate and natural selection in parvovirus B19
Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.
2016-01-01
The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080
A Novel Non-Toxic Xylene Substitute (SBO) for Histology
Kunhua, Wang; Chuming, Fan; Tao, Lai; Yanmei, Yang; Xin, Yang; Xiaoming, Zhang; Xuezhong, Guo; Xun, Lai
2011-01-01
Xylene has been generally used as a clearing and deparaffinizing agent in histology. Because of the potential toxic and flammable nature of xylene, its substitutes have been introduced into some laboratories. In this study, we introduced a novel, non-toxic xylene substitute (SBO), which was generated through a mixture of 86% of white oil No.2 and 14% of N-heptane. SBO had a high boiling point (188°C) and flash point (144°C) coupled with a scentless and decreased volatility. To compare the eff...
Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun
2016-10-01
The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.
LENUS (Irish Health Repository)
Chen, Jingchun
2011-09-01
We conducted data-mining analyses of genome wide association (GWA) studies of the CATIE and MGS-GAIN datasets, and found 13 markers in the two physically linked genes, PTPN21 and EML5, showing nominally significant association with schizophrenia. Linkage disequilibrium (LD) analysis indicated that all 7 markers from PTPN21 shared high LD (r(2)>0.8), including rs2274736 and rs2401751, the two non-synonymous markers with the most significant association signals (rs2401751, P=1.10 × 10(-3) and rs2274736, P=1.21 × 10(-3)). In a meta-analysis of all 13 replication datasets with a total of 13,940 subjects, we found that the two non-synonymous markers are significantly associated with schizophrenia (rs2274736, OR=0.92, 95% CI: 0.86-0.97, P=5.45 × 10(-3) and rs2401751, OR=0.92, 95% CI: 0.86-0.97, P=5.29 × 10(-3)). One SNP (rs7147796) in EML5 is also significantly associated with the disease (OR=1.08, 95% CI: 1.02-1.14, P=6.43 × 10(-3)). These 3 markers remain significant after Bonferroni correction. Furthermore, haplotype conditioned analyses indicated that the association signals observed between rs2274736\\/rs2401751 and rs7147796 are statistically independent. Given the results that 2 non-synonymous markers in PTPN21 are associated with schizophrenia, further investigation of this locus is warranted.
CodonTest: modeling amino acid substitution preferences in coding sequences.
Directory of Open Access Journals (Sweden)
Wayne Delport
2010-08-01
Full Text Available Codon models of evolution have facilitated the interpretation of selective forces operating on genomes. These models, however, assume a single rate of non-synonymous substitution irrespective of the nature of amino acids being exchanged. Recent developments have shown that models which allow for amino acid pairs to have independent rates of substitution offer improved fit over single rate models. However, these approaches have been limited by the necessity for large alignments in their estimation. An alternative approach is to assume that substitution rates between amino acid pairs can be subdivided into rate classes, dependent on the information content of the alignment. However, given the combinatorially large number of such models, an efficient model search strategy is needed. Here we develop a Genetic Algorithm (GA method for the estimation of such models. A GA is used to assign amino acid substitution pairs to a series of rate classes, where is estimated from the alignment. Other parameters of the phylogenetic Markov model, including substitution rates, character frequencies and branch lengths are estimated using standard maximum likelihood optimization procedures. We apply the GA to empirical alignments and show improved model fit over existing models of codon evolution. Our results suggest that current models are poor approximations of protein evolution and thus gene and organism specific multi-rate models that incorporate amino acid substitution biases are preferred. We further anticipate that the clustering of amino acid substitution rates into classes will be biologically informative, such that genes with similar functions exhibit similar clustering, and hence this clustering will be useful for the evolutionary fingerprinting of genes.
Screening of Missense SNPs in Coding Regions of COX-2 as a Key Enzyme Involved in Cancer
Directory of Open Access Journals (Sweden)
Sodabeh Jahanbakhsh-Godehkahriz
2013-09-01
Full Text Available Background & Objectives: Non-synonymous single nucleotide polymorphism (nsSNPs which results in disruption of protein function are used as markers in linkage and association of human proteins that might be involved in diseases and cancers . Methods: To study the functional effect of nsSNP in cyclooxygenase-2 (COX2 amino acids, the nucleotide sequences encoding COX-2 gene in cancers were extracted from the NCBI (gi|223941909 data bank (283 cases and analyzed by SIFT, I-Mutant 2.0, SNP and GO, PANTHER and FASTSNP servers. These servers involve programs that predict the effects of amino acid substitution on protein function, stability and missense . Results: COX-2 is an essential enzyme for the production of pro-inflammatory prostaglandins which are relevant to cancer development and progression. The substitutions in some positions such as R228H and S428A of COX-2 in most of cancers linked to reformed protein function through disruption in enzyme active site. Conclusion: Amino acid substitutions as a consequence of COX-2 nsSNPs have important role in human disease. Substitutions which are located in catalytic domain are important for the enzymatic function of COX-2 and associated with higher expression of COX-2.
Examination of the selective pressures on a live PRRS vaccine virus
DEFF Research Database (Denmark)
Storgaard, Torben; Oleksiewicz, M.; Bøtner, Anette
1999-01-01
of the selective pressure this attenuated virus had experienced during reversion. An analysis of nucleotide mutations showed a similar rate of mutations in the two genes (ORF5 and 7). However, non-synonymous mutations in ORF7 were eliminated by purifying selection. In contrast, non-synonymous mutations in ORF5...
Marjan, Mojtabavi Naeini; Hamzeh, Mesrian Tanha; Rahman, Emamzadeh; Sadeq, Vallian
2014-08-01
Aspirin (ASA) is a commonly used nonsteroidal anti-inflammatory drug (NSAID), which exerts its therapeutic effects through inhibition of cyclooxygenase (COX) isoform 2 (COX-2), while the inhibition of COX-1 by ASA leads to apparent side effects. In the present study, the relationship between COX-1 non-synonymous single nucleotide polymorphisms (nsSNPs) and aspirin related side effects was investigated. The functional impacts of 37 nsSNPs on aspirin inhibition potency of COX-1 with COX-1/aspirin molecular docking were computationally analyzed, and each SNP was scored based on DOCK Amber score. The data predicted that 22 nsSNPs could reduce COX-1 inhibition, while 15 nsSNPs showed increasing inhibition level in comparison to the regular COX-1 protein. In order to perform a comparing state, the Amber scores for two Arg119 mutants (R119A and R119Q) were also calculated. Moreover, among nsSNP variants, rs117122585 represented the closest Amber score to R119A mutant. A separate docking computation validated the score and represented a new binding position for ASA that acetyl group was located within the distance of 3.86Å from Ser529 OH group. This could predict an associated loss of activity of ASA through this nsSNP variant. Our data represent a computational sub-population pattern for aspirin COX-1 related side effects, and provide basis for further research on COX-1/ASA interaction. Copyright © 2014 Elsevier Ltd. All rights reserved.
Maximum parsimony, substitution model, and probability phylogenetic trees.
Weng, J F; Thomas, D A; Mareels, I
2011-01-01
The problem of inferring phylogenies (phylogenetic trees) is one of the main problems in computational biology. There are three main methods for inferring phylogenies-Maximum Parsimony (MP), Distance Matrix (DM) and Maximum Likelihood (ML), of which the MP method is the most well-studied and popular method. In the MP method the optimization criterion is the number of substitutions of the nucleotides computed by the differences in the investigated nucleotide sequences. However, the MP method is often criticized as it only counts the substitutions observable at the current time and all the unobservable substitutions that really occur in the evolutionary history are omitted. In order to take into account the unobservable substitutions, some substitution models have been established and they are now widely used in the DM and ML methods but these substitution models cannot be used within the classical MP method. Recently the authors proposed a probability representation model for phylogenetic trees and the reconstructed trees in this model are called probability phylogenetic trees. One of the advantages of the probability representation model is that it can include a substitution model to infer phylogenetic trees based on the MP principle. In this paper we explain how to use a substitution model in the reconstruction of probability phylogenetic trees and show the advantage of this approach with examples.
Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.
Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka
2014-01-01
Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.
LS-SNP/PDB: annotated non-synonymous SNPs mapped to Protein Data Bank structures.
Ryan, Michael; Diekhans, Mark; Lien, Stephanie; Liu, Yun; Karchin, Rachel
2009-06-01
LS-SNP/PDB is a new WWW resource for genome-wide annotation of human non-synonymous (amino acid changing) SNPs. It serves high-quality protein graphics rendered with UCSF Chimera molecular visualization software. The system is kept up-to-date by an automated, high-throughput build pipeline that systematically maps human nsSNPs onto Protein Data Bank structures and annotates several biologically relevant features. LS-SNP/PDB is available at (http://ls-snp.icm.jhu.edu/ls-snp-pdb) and via links from protein data bank (PDB) biology and chemistry tabs, UCSC Genome Browser Gene Details and SNP Details pages and PharmGKB Gene Variants Downloads/Cross-References pages.
DEFF Research Database (Denmark)
Bross, Peter; Li, Zhijie; Hansen, Jakob
2007-01-01
for variations in the HSPD1 and HSPE1 genes encoding the mitochondrial Hsp60/Hsp10 chaperone complex: two patients with multiple mitochondrial enzyme deficiency, 61 sudden infant death syndrome cases (MIM: #272120), and 60 patients presenting with ethylmalonic aciduria carrying non-synonymous susceptibility...... variations in the ACADS gene (MIM: *606885 and #201470). Besides previously reported variations we detected six novel variations: two in the bidirectional promoter region, and one synonymous and three non-synonymous variations in the HSPD1 coding region. One of the non-synonymous variations was polymorphic...... in patient and control samples, and the rare variations were each only found in single patients and absent in 100 control chromosomes. Functional investigation of the effects of the variations in the promoter region and the non-synonymous variations in the coding region indicated that none of them had...
Directory of Open Access Journals (Sweden)
Teemu Smura
Full Text Available Genus Enterovirus (Family Picornaviridae, consists of twelve species divided into genetically diverse types by their capsid protein VP1 coding sequences. Each enterovirus type can further be divided into intra-typic sub-clusters (genotypes. The aim of this study was to elucidate what leads to the emergence of novel enterovirus clades (types and genotypes. An evolutionary analysis was conducted for a sub-group of Enterovirus C species that contains types Coxsackievirus A21 (CVA-21, CVA-24, Enterovirus C95 (EV-C95, EV-C96 and EV-C99. VP1 gene datasets were collected and analysed to infer the phylogeny, rate of evolution, nucleotide and amino acid substitution patterns and signs of selection. In VP1 coding gene, high intra-typic sequence diversities and robust grouping into distinct genotypes within each type were detected. Within each type the majority of nucleotide substitutions were synonymous and the non-synonymous substitutions tended to cluster in distinct highly polymorphic sites. Signs of positive selection were detected in some of these highly polymorphic sites, while strong negative selection was indicated in most of the codons. Despite robust clustering to intra-typic genotypes, only few genotype-specific 'signature' amino acids were detected. In contrast, when different enterovirus types were compared, there was a clear tendency towards fixation of type-specific 'signature' amino acids. The results suggest that permanent fixation of type-specific amino acids is a hallmark associated with evolution of different enterovirus types, whereas neutral evolution and/or (frequency-dependent positive selection in few highly polymorphic amino acid sites are the dominant forms of evolution when strains within an enterovirus type are compared.
Modelling energy and non-energy substitution: A brief survey of elasticities
International Nuclear Information System (INIS)
Frondel, Manuel
2011-01-01
Estimating the degree of substitution between energy and non-energy inputs is the key for any evaluation of environmental and energy policies. Yet, given the variety of substitution elasticities, the central question arises as to which measure would be most appropriate. Apparently, Allen's elasticities of substitution have been the most-used measures in applied production analysis. In line with , this paper argues that cross-price elasticities are preferable for many practical purposes. This conclusion is based on a survey of classical substitution measures, such as those from Allen, Morishima, and McFadden. The survey highlights the fact that cross-price elasticities are their essential ingredients. - Highlights: → Given the large variety of substitution elasticities, the central question arises as to which measure would be most appropriate. Apparently, Allen's elasticities of substitution have been the most-used measures in applied production analysis. → In line with , this paper argues that cross-price elasticities are preferable for many practical purposes. → This conclusion is based on a survey of classical substitution measures, such as those from Allen, Morishima, and McFadden. → The survey also highlights the fact that cross-price elasticities are their essential ingredients.
DEFF Research Database (Denmark)
Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob
2010-01-01
To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...
A first-principles study of light non-metallic atom substituted blue phosphorene
Energy Technology Data Exchange (ETDEWEB)
Sun, Minglei [School of Mechanical Engineering, Southeast University, Nanjing 211189, Jiangsu (China); Tang, Wencheng, E-mail: 101000185@seu.edu.cn [School of Mechanical Engineering, Southeast University, Nanjing 211189, Jiangsu (China); Ren, Qingqiang [State Key Laboratory of Powder Metallurgy, Central South University, Changsha 410083, Hunan (China); Wang, Sa-ke [Department of Physics, Southeast University, Nanjing 210096, Jiangsu (China); Yu, Jin [School of Materials Science and Engineering, Southeast University, Nanjing 211189, Jiangsu (China); Jiangsu Key Laboratory of Advanced Metallic Materials, Southeast University, Nanjing 211189, Jiangsu (China); Du, Yanhui [School of Mechanical Engineering, Southeast University, Nanjing 211189, Jiangsu (China)
2015-11-30
Graphical abstract: - Highlights: • All the impurities are covalently bonded to blue phosphorene (with a single vacancy). • All the substituted systems are semiconductors. • B-substituted system exhibits direct bandgap semiconductor behavior. • The band gaps with spin polarization are found in C and O-substituted systems. • Our works can paves a new route at nanoscale for novel functionalities of optical and spintronics devices. - Abstract: First-principles calculations are implemented to study the geometric, electronic and magnetic properties of light non-metallic atom (B, C, N, O and F) substituted blue phosphorene. All the substituted systems are highly stable. The B-substituted system is a direct bandgap semiconductor with a bandgap size about 1.5 eV. The C, O-substituted systems are promising systems to explore two-dimensional diluted magnetic semiconductors. Magnetism is observed for C and O substitution, while for the other impurities no magnetic moment is detected. Our works paves a new route at nanoscale for novel functionalities of optical and spintronics devices.
Genetic variability in L1 and L2 genes of HPV-16 and HPV-58 in Southwest China.
Directory of Open Access Journals (Sweden)
Yaofei Yue
Full Text Available HPV account for most of the incidence of cervical cancer. Approximately 90% of anal cancers and a smaller subset (<50% of other cancers (oropharyngeal, penile, vaginal, vulvar are also attributed to HPV. The L1 protein comprising HPV vaccine formulations elicits high-titre neutralizing antibodies and confers type restricted protection. The L2 protein is a promising candidate for a broadly protective HPV vaccine. In our previous study, we found the most prevalent high-risk HPV infectious serotypes were HPV-16 and HPV-58 among women of Southwest China. To explore gene polymorphisms and intratypic variations of HPV-16 and HPV-58 L1/L2 genes originating in Southwest China, HPV-16 (L1: n = 31, L2: n = 28 and HPV-58 (L1: n = 21, L2: n = 21 L1/L2 genes were sequenced and compared to others described and submitted to GenBank. Phylogenetic trees were then constructed by Neighbor-Joining and the Kimura 2-parameters methods (MEGA software, followed by an analysis of the diversity of secondary structure. Then selection pressures acting on the L1/L2 genes were estimated by PAML software. Twenty-nine single nucleotide changes were observed in HPV-16 L1 sequences with 16/29 non-synonymous mutations and 13/29 synonymous mutations (six in alpha helix and two in beta turns. Seventeen single nucleotide changes were observed in HPV-16 L2 sequences with 8/17 non-synonymous mutations (one in beta turn and 9/17 synonymous mutations. Twenty-four single nucleotide changes were observed in HPV-58 L1 sequences with 10/24 non-synonymous mutations and 14/24 synonymous mutations (eight in alpha helix and four in beta turn. Seven single nucleotide changes were observed in HPV-58 L2 sequences with 4/7 non-synonymous mutations and 3/7 synonymous mutations. The result of selective pressure analysis showed that most of these mutations were of positive selection. This study may help understand the intrinsic geographical relatedness and biological differences of HPV-16/HPV-58 and
Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G
2017-07-19
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.
Directory of Open Access Journals (Sweden)
Cheng-Chong Chou
2004-11-01
Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.
Zhou, Jie; Kherani, Femida; Bardakjian, Tanya M.; Katowitz, James; Hughes, Nkecha; Schimmenti, Lisa A.; Schneider, Adele
2008-01-01
Purpose Mutations in the SOX2 and CHX10 genes have been reported in patients with anophthalmia and/or microphthalmia. In this study, we evaluated 34 anophthalmic/microphthalmic patient DNA samples (two sets of siblings included) for mutations and sequence variants in SOX2 and CHX10. Methods Conformational sensitive gel electrophoresis (CSGE) was used for the initial SOX2 and CHX10 screening of 34 affected individuals (two sets of siblings), five unaffected family members, and 80 healthy controls. Patient samples containing heteroduplexes were selected for sequence analysis. Base pair changes in SOX2 and CHX10 were confirmed by sequencing bidirectionally in patient samples. Results Two novel heterozygous mutations and two sequence variants (one known) in SOX2 were identified in this cohort. Mutation c.310 G>T (p. Glu104X), found in one patient, was in the region encoding the high mobility group (HMG) DNA-binding domain and resulted in a change from glutamic acid to a stop codon. The second mutation, noted in two affected siblings, was a single nucleotide deletion c.549delC (p. Pro184ArgfsX19) in the region encoding the activation domain, resulting in a frameshift and premature termination of the coding sequence. The shortened protein products may result in the loss of function. In addition, a novel nucleotide substitution c.*557G>A was identified in the 3′-untranslated region in one patient. The relationship between the nucleotide change and the protein function is indeterminate. A known single nucleotide polymorphism (c. *469 C>A, SNP rs11915160) was also detected in 2 of the 34 patients. Screening of CHX10 identified two synonymous sequence variants, c.471 C>T (p.Ser157Ser, rs35435463) and c.579 G>A (p. Gln193Gln, novel SNP), and one non-synonymous sequence variant, c.871 G>A (p. Asp291Asn, novel SNP). The non-synonymous polymorphism was also present in healthy controls, suggesting non-causality. Conclusions These results support the role of SOX2 in ocular
Analysis of the synonymous codon usage bias in recently emerged enterovirus D68 strains.
Karniychuk, Uladzimir U
2016-09-02
Understanding the codon usage pattern of a pathogen and relationship between pathogen and host's codon usage patterns has fundamental and applied interests. Enterovirus D68 (EV-D68) is an emerging pathogen with a potentially high public health significance. In the present study, the synonymous codon usage bias of 27 recently emerged, and historical EV-D68 strains was analyzed. In contrast to previously studied enteroviruses (enterovirus 71 and poliovirus), EV-D68 and human host have a high discrepancy between favored codons. Analysis of viral synonymous codon usage bias metrics, viral nucleotide/dinucleotide compositional parameters, and viral protein properties showed that mutational pressure is more involved in shaping the synonymous codon usage bias of EV-D68 than translation selection. Computation of codon adaptation indices allowed to estimate expression potential of the EV-D68 genome in several commonly used laboratory animals. This approach requires experimental validation and may provide an auxiliary tool for the rational selection of laboratory animals to model emerging viral diseases. Enterovirus D68 genome compositional and codon usage data can be useful for further pathogenesis, animal model, and vaccine design studies. Copyright © 2016 Elsevier B.V. All rights reserved.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Massimo Giangaspero
2008-06-01
Full Text Available Forty-three strains of classical swine fever (hog cholera virus (CSFV from outbreaks in pigs in Europe, Asia and America, two strains from commercial CSFV modified live vaccines and a strain isolated from a diseased lamb from Spain were subjected to analyses of nucleotide sequence variations in the 5’ terminal region of the genome. These isolates were divided into three clusters, namely: CSFV-1, CSFV-2, and CSFV-3, based on palindromic nucleotide substitutions in the 5’ untranslated region (UTR. The homology degree, according to nucleotide base pairing variation in the secondary palindromic structure of the three variable loci V1, V2 and V3, was 60% in the CSFV species, with a mean divergence value of 6.19 base pairs (bp. relatedness within genotypes ranged from 71.11% to 100%, with mean divergence values from 5.5 to 0.73 base pairs. Subgenotypes showed a divergence ranging from 1 to 9 base pairs within the genotype. Genotype CSFV-1 revealed 15 base pair combinations with 13 divergent base pairs, resulting in 4 subgenotypes with 6 variants in subgenotype CSFV-1.1, including the reference strain Brescia and 6 variants in subgenotype CSFV-1.2, including the Alfort reference strain. Subgenotypes CSFV-1.3 and CSFV-1.4 comprised one and two variants, respectively. Genotype CSFV-2 was represented by the Spanish ovine isolate 5440/99 and the genotype CSFV-3 included the Japanese strains Okinawa/86 and Kanagawa/74. CSFV genotypes revealed a strong relationship with Border disease virus strains, showing relatively low divergence values when compared to other pestivirus species. Evaluation of nucleotide base pair divergence among genotypes and expression of evolutionary changes in the CSFV species led to the construction of a phylogenetic tree based on secondary structure.
Peng, Qisheng; Wang, Zijian; Wu, Donglin; Li, Xiaoou; Liu, Xiaofeng; Sun, Wanchun; Liu, Ning
2016-08-01
Amino acid substitutions in the neuraminidase of the influenza virus are the main cause of the emergence of resistance to zanamivir or oseltamivir during seasonal influenza treatment; they are the result of non-synonymous mutations in the viral genome that can be successfully detected by polymer chain reaction (PCR)-based approaches. There is always an urgent need to detect variation in amino acid sequences directly at the protein level. Mass spectrometry coupled with de novo sequencing has been explored as an alternative and straightforward strategy for detecting amino acid substitutions, as well - this approach is the primary focus of the present study. Influenza virus (A/Puerto Rico/8/1934 H1N1) propagated in embryonated chicken eggs was purified by ultracentrifugation, followed by PNGase F treatment. The deglycosylated virion was lysed and separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The gel band corresponding to neuraminidase was picked up and subjected to liquid chromatography tandem mass spectrometry (LC-MS/MS) analysis. LC-MS/MS analyses, coupled with manual de novo sequencing, allowed the determination of three amino acid substitutions: R346K, S349 N, and S370I/L, in the neuraminidase from the influenza virus (A/Puerto Rico/8/1934 H1N1), which were located in three mutated peptides of the neuraminidase: YGNGVWIGK, TKNHSSR, and PNGWTETDI/LK, respectively. We found that the amino acid substitutions in the proteins of RNA viruses (including influenza A virus) resulting from non-synonymous gene mutations can indeed be directly analyzed via mass spectrometry, and that manual interpretation of the MS/MS data may be beneficial. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Role of novel and rare nucleotide substitutions of the β-globin gene
Directory of Open Access Journals (Sweden)
Margherita Vinciguerra
2012-11-01
Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序,旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段:1)血液及血红蛋白数据;2)珠蛋白基因分子分析以及家族遗传研究(如有可能)。 自2003年以来,我们已对这类病例进行DNA序列分析:传统的分子方法无法给出完整的诊断响应,尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。
Identification of physicochemical selective pressure on protein encoding nucleotide sequences
Directory of Open Access Journals (Sweden)
Sainudiin Raazesh
2006-03-01
Full Text Available Abstract Background Statistical methods for identifying positively selected sites in protein coding regions are one of the most commonly used tools in evolutionary bioinformatics. However, they have been limited by not taking the physiochemical properties of amino acids into account. Results We develop a new codon-based likelihood model for detecting site-specific selection pressures acting on specific physicochemical properties. Nonsynonymous substitutions are divided into substitutions that differ with respect to the physicochemical properties of interest, and those that do not. The substitution rates of these two types of changes, relative to the synonymous substitution rate, are then described by two parameters, γ and ω respectively. The new model allows us to perform likelihood ratio tests for positive selection acting on specific physicochemical properties of interest. The new method is first used to analyze simulated data and is shown to have good power and accuracy in detecting physicochemical selective pressure. We then re-analyze data from the class-I alleles of the human Major Histocompatibility Complex (MHC and from the abalone sperm lysine. Conclusion Our new method allows a more flexible framework to identify selection pressure on particular physicochemical properties.
Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin
2010-07-27
The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.
Abbate, Isabella; Lo Iacono, Oreste; Di Stefano, Rosa; Cappiello, Giuseppina; Girardi, Enrico; Longo, Roberta; Ferraro, Donatella; Antonucci, Giorgio; Di Marco, Vito; Solmone, Mariacarmela; Craxì, Antonio; Ippolito, Giuseppe; Capobianchi, Maria R
2004-05-01
HVR-1 quasispecies composition and evolution were investigated in patients chronically infected with genotype 1b HCV, treated with PEG-IFN alpha 2b or STD-IFN alpha 2b plus RBV. HVR-1 heterogeneity was assessed by calculating nucleotidic complexity, diversity, synonymous (S) and non-synonymous (NS) substitutions at baseline, after 4 weeks of therapy (T1) and at follow-up (T18). Evolution of viral quasispecies was analysed by constructing phylogenetic trees. No correlation of baseline viremia with heterogeneity was observed. Nucleotidic complexity was lower in patients showing early virological response, and tended to be inversely correlated to viral load decline at 4 weeks of treatment. In the majority of SR, profound changes of quasispecies composition occurred during 4 weeks of treatment, while in NR virtually no major changes of pre-therapy variants were observed. Relapse showed both patterns of quasispecies evolution. Virus quasispecies after follow-up was similar to that found at T1 in both Relapsers and NR patients. Baseline parameters of HVR-1 heterogeneity seem to be involved in the early response to treatment, and early response is associated with profound variations in the HVR-1 quasispecies. Viral quasispecies surviving early therapeutic pressure are most likely able to give rise to either virus rebound or persistence at T18.
Pitfalls of the most commonly used models of context dependent substitution
Directory of Open Access Journals (Sweden)
Huttley Gavin A
2008-12-01
Full Text Available Abstract Background Neighboring nucleotides exert a striking influence on mutation, with the hypermutability of CpG dinucleotides in many genomes being an exemplar. Among the approaches employed to measure the relative importance of sequence neighbors on molecular evolution have been continuous-time Markov process models for substitutions that treat sequences as a series of independent tuples. The most widely used examples are the codon substitution models. We evaluated the suitability of derivatives of the nucleotide frequency weighted (hereafter NF and tuple frequency weighted (hereafter TF models for measuring sequence context dependent substitution. Critical properties we address are their relationships to an independent nucleotide process and the robustness of parameter estimation to changes in sequence composition. We then consider the impact on inference concerning dinucleotide substitution processes from application of these two forms to intron sequence alignments from primates. Results We prove that the NF form always nests the independent nucleotide process and that this is not true for the TF form. As a consequence, using TF to study context effects can be misleading, which is shown by both theoretical calculations and simulations. We describe a simple example where a context parameter estimated under TF is confounded with composition terms unless all sequence states are equi-frequent. We illustrate this for the dinucleotide case by simulation under a nucleotide model, showing that the TF form identifies a CpG effect when none exists. Our analysis of primate introns revealed that the effect of nucleotide neighbors is over-estimated under TF compared with NF. Parameter estimates for a number of contexts are also strikingly discordant between the two model forms. Conclusion Our results establish that the NF form should be used for analysis of independent-tuple context dependent processes. Although neighboring effects in general are
A novel non-toxic xylene substitute (SBO) for histology.
Kunhua, Wang; Chuming, Fan; Tao, Lai; Yanmei, Yang; Xin, Yang; Xiaoming, Zhang; Xuezhong, Guo; Xun, Lai
2012-01-01
Xylene has been generally used as a clearing and deparaffinizing agent in histology. Because of the potential toxic and flammable nature of xylene, its substitutes have been introduced into some laboratories. In this study, we introduced a novel, non-toxic xylene substitute (SBO), which was generated through a mixture of 86% of white oil No.2 and 14% of N-heptane. SBO had a high boiling point (188°C) and flash point (144°C) coupled with a scentless and decreased volatility. To compare the effectiveness of SBO and xylene in histology, a wide range of tissue samples from rats and human beings were processed in parallel in SBO and xylene, subjected to various staining procedures. Similar to the xylene-processed paraffin blocks, the SBO-processed counterparts were easy to section without any evidence of cell shrinkage. Assessment of the SBO-treated sections stained with hematoxylin-eosin revealed a good maintenance of cell morphology and structure, and a clear definition of the cytoplasm and the nucleus. Moreover, comparable good results were achieved between the SBO- and xylene-processed tissues in other histochemical and immunohistochemical stainings. Six-month clinical applications at one department of pathology supported the potentials of SBO as a xylene substitute. In conclusion, we suggest that SBO is a safe and efficient substitute of xylene and may probably replace xylene without losing valuable diagnostic information.
Dass, J Febin Prabhu; Sudandiradoss, C
2012-07-15
5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.
Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon
2015-02-01
There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.
Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna
Directory of Open Access Journals (Sweden)
Souche Erika L
2011-06-01
Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.
Five new synonyms in Epimedium (Berberidaceae) from China.
Zhang, Yanjun; Dang, Haishan; Li, Shengyu; Li, Jianqiang; Wang, Ying
2015-01-01
Five new synonyms in Chinese Epimedium are designated in the present paper. Epimediumchlorandrum is treated as a synonym of Epimediumacuminatum; Epimediumrhizomatosum as a synonym of Epimediummembranaceum; Epimediumbrachyrrhizum as a synonym of Epimediumleptorrhizum; Epimediumdewuense as a synonym of Epimediumdolichostemon; and Epimediumsagittatumvar.oblongifoliolatum as a synonym of Epimediumborealiguizhouense.
Ahmed, Md Atique; Fauzi, Muh; Han, Eun-Taek
2018-03-14
Human infections due to the monkey malaria parasite Plasmodium knowlesi is on the rise in most Southeast Asian countries specifically Malaysia. The C-terminal 19 kDa domain of PvMSP1P is a potential vaccine candidate, however, no study has been conducted in the orthologous gene of P. knowlesi. This study investigates level of polymorphisms, haplotypes and natural selection of full-length pkmsp1p in clinical samples from Malaysia. A total of 36 full-length pkmsp1p sequences along with the reference H-strain and 40 C-terminal pkmsp1p sequences from clinical isolates of Malaysia were downloaded from published genomes. Genetic diversity, polymorphism, haplotype and natural selection were determined using DnaSP 5.10 and MEGA 5.0 software. Genealogical relationships were determined using haplotype network tree in NETWORK software v5.0. Population genetic differentiation index (F ST ) and population structure of parasite was determined using Arlequin v3.5 and STRUCTURE v2.3.4 software. Comparison of 36 full-length pkmsp1p sequences along with the H-strain identified 339 SNPs (175 non-synonymous and 164 synonymous substitutions). The nucleotide diversity across the full-length gene was low compared to its ortholog pvmsp1p. The nucleotide diversity was higher toward the N-terminal domains (pkmsp1p-83 and 30) compared to the C-terminal domains (pkmsp1p-38, 33 and 19). Phylogenetic analysis of full-length genes identified 2 distinct clusters of P. knowlesi from Malaysian Borneo. The 40 pkmsp1p-19 sequences showed low polymorphisms with 16 polymorphisms leading to 18 haplotypes. In total there were 10 synonymous and 6 non-synonymous substitutions and 12 cysteine residues were intact within the two EGF domains. Evidence of strong purifying selection was observed within the full-length sequences as well in all the domains. Shared haplotypes of 40 pkmsp1p-19 were identified within Malaysian Borneo haplotypes. This study is the first to report on the genetic diversity and natural
Giangaspero, Massimo; Harasawa, Ryô
2011-06-01
The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the
Five new synonyms in Epimedium ( Berberidaceae ) from China
Zhang, Yanjun; Dang, Haishan; Li, Shengyu; Li, Jianqiang; Wang, Ying
2015-01-01
Abstract Five new synonyms in Chinese Epimedium are designated in the present paper. Epimedium chlorandrum is treated as a synonym of Epimedium acuminatum ; Epimedium rhizomatosum as a synonym of Epimedium membranaceum ; Epimedium brachyrrhizum as a synonym of Epimedium leptorrhizum ; Epimedium dewuense as a synonym of Epimedium dolichostemon ; and Epimedium sagittatum var. oblongifoliolatum as a synonym of Epimedium borealiguizhouense .
Liu, Zhi-Qiang; Liu, Yan-Feng; Kuermanali, Nuer; Wang, Deng-Feng; Chen, Shi-Jun; Guo, Hui-Ling; Zhao, Li; Wang, Jun-Wei; Han, Tao; Wang, Yuan-Zhi; Wang, Jie; Shen, Chen-Feng; Zhang, Zhuang-Zhi; Chen, Chuang-Fu
2018-01-01
Phylogeny of hard ticks (Ixodidae) remains unresolved. Mitochondrial genomes (mitogenomes) are increasingly used to resolve phylogenetic controversies, but remain unavailable for the entire large Hyalomma genus. Hyalomma asiaticum is a parasitic tick distributed throughout the Asia. As a result of great morphological variability, two subspecies have been recognised historically; until a morphological data-based synonymization was proposed. However, this hypothesis was never tested using molecular data. Therefore, objectives of this study were to: 1. sequence the first Hyalomma mitogenome; 2. scrutinise the proposed synonymization using molecular data, i.e. complete mitogenomes of both subspecies: H. a. asiaticum and kozlovi; 3. conduct phylogenomic and comparative analyses of all available Ixodidae mitogenomes. Results corroborate the proposed synonymization: the two mitogenomes are almost identical (99.6%). Genomic features of both mitogenomes are standard for Metastriata; which includes the presence of two control regions and all three "Tick-Box" motifs. Gene order and strand distribution are perfectly conserved for the entire Metastriata group. Suspecting compositional biases, we conducted phylogenetic analyses (29 almost complete mitogenomes) using homogeneous and heterogeneous (CAT) models of substitution. The results were congruent, apart from the deep-level topology of prostriate ticks (Ixodes): the homogeneous model produced a monophyletic Ixodes, but the CAT model produced a paraphyletic Ixodes (and thereby Prostriata), divided into Australasian and non-Australasian clades. This topology implies that all metastriate ticks have evolved from the ancestor of the non-Australian branch of prostriate ticks. Metastriata was divided into three clades: 1. Amblyomminae and Rhipicephalinae (Rhipicephalus, Hyalomma, Dermacentor); 2. Haemaphysalinae and Bothriocrotoninae, plus Amblyomma sphenodonti; 3. Amblyomma elaphense, basal to all Metastriata. We conclude that
Wieczorek, Stefan; Holle, Julia U; Bremer, Jan P; Wibisono, David; Moosig, Frank; Fricke, Harald; Assmann, Gunter; Harper, Lorraine; Arning, Larissa; Gross, Wolfgang L; Epplen, Joerg T
2010-05-01
There is evidence that the leptin/ghrelin system is involved in T-cell regulation and plays a role in (auto)immune disorders such as SLE, RA and ANCA-associated vasculitides (AAVs). Here, we evaluate the genetic background of this system in WG. We screened variations in the genes encoding leptin, ghrelin and their receptors, the leptin receptor (LEPR) and the growth hormone secretagogue receptor (GHSR). Three single nucleotide polymorphisms (SNPs) in each gene region were analysed in 460 German WG cases and 878 ethnically matched healthy controls. A three-SNP haplotype of GHSR was significantly associated with WG [P = 0.0067; corrected P-value (P(c)) = 0.026; odds ratio (OR) = 1.30; 95% CI 1.08, 1.57], as was one non-synonymous SNP in LEPR (Lys656Asn, P = 0.0034; P(c) = 0.013; OR = 0.72; 95% CI 0.58, 0.90). These four SNPs were re-analysed in independent cohorts of 226 German WG cases and 519 controls. While the GHSR association was not confirmed, allele frequencies of the LEPR SNP were virtually identical to those from the initial cohorts. Analysis of this SNP in the combined WG and control panels revealed a significant association of the LEPR 656Lys allele with WG (P = 0.00032; P(c) = 0.0013; OR = 0.72; 95% CI 0.60, 0.86). Remarkably, the Lys656Asn SNP showed contrasting allele distribution in two cohorts of 108 and 88 German cases diagnosed with Churg-Strauss syndrome (CSS, combined P = 0.0067; OR = 1.41; 95% CI 1.10, 1.81), whereas identical allele frequencies were revealed when comparing British WG and microscopic polyangiitis cases. While GHSR has to be further evaluated, these data provide profound evidence for an association of the LEPR Lys656Asn SNP with AAV, resulting in opposing effects in WG and CSS.
Five new synonyms in Epimedium (Berberidaceae from China
Directory of Open Access Journals (Sweden)
Yanjun Zhang
2015-04-01
Full Text Available Five new synonyms in Chinese Epimedium are designated in the present paper. Epimedium chlorandrum is treated as a synonym of E. acuminatum; Epimedium rhizomatosum as a synonym of E. membranaceum; Epimedium brachyrrhizum as a synonym of E. leptorrhizum; Epimedium dewuense as a synonym of E. dolichostemon; and Epimedium sagittatum var. oblongifoliolatum as a synonym of E. borealiguizhouense.
A genomic overview of short genetic variations in a basal chordate, Ciona intestinalis
Directory of Open Access Journals (Sweden)
Satou Yutaka
2012-05-01
Full Text Available Abstract Background Although the Ciona intestinalis genome contains many allelic polymorphisms, there is only limited data analyzed systematically. Establishing a dense map of genetic variations in C. intestinalis is necessary not only for linkage analysis, but also for other experimental biology including molecular developmental and evolutionary studies, because animals from natural populations are typically used for experiments. Results Here, we identified over three million candidate short genomic variations within a 110 Mb euchromatin region among five C. intestinalis individuals. The average nucleotide diversity was approximately 1.1%. Genetic variations were found at a similar density in intergenic and gene regions. Non-synonymous and nonsense nucleotide substitutions were found in 12,493 and 1,214 genes accounting for 81.9% and 8.0% of the entire gene set, respectively, and over 60% of genes in the single animal encode non-identical proteins between maternal and paternal alleles. Conclusions Our results provide a framework for studying evolution of the animal genome, as well as a useful resource for a wide range of C. intestinalis researchers.
Milne, Roger L; Burwinkel, Barbara; Michailidou, Kyriaki; Arias-Perez, Jose-Ignacio; Zamora, M Pilar; Menéndez-Rodríguez, Primitiva; Hardisson, David; Mendiola, Marta; González-Neira, Anna; Pita, Guillermo; Alonso, M Rosario; Dennis, Joe; Wang, Qin; Bolla, Manjeet K; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Schoemaker, Minouk; Ko, Yon-Dschun; Brauch, Hiltrud; Hamann, Ute; Andrulis, Irene L; Knight, Julia A; Glendon, Gord; Tchatchou, Sandrine; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Tajima, Kazuo; Li, Jingmei; Brand, Judith S; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Lambrechts, Diether; Peuteman, Gilian; Christiaens, Marie-Rose; Smeets, Ann; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katazyna; Hartman, Mikael; Hui, Miao; Yen Lim, Wei; Wan Chan, Ching; Marme, Federick; Yang, Rongxi; Bugert, Peter; Lindblom, Annika; Margolin, Sara; García-Closas, Montserrat; Chanock, Stephen J; Lissowska, Jolanta; Figueroa, Jonine D; Bojesen, Stig E; Nordestgaard, Børge G; Flyger, Henrik; Hooning, Maartje J; Kriege, Mieke; van den Ouweland, Ans M W; Koppert, Linetta B; Fletcher, Olivia; Johnson, Nichola; dos-Santos-Silva, Isabel; Peto, Julian; Zheng, Wei; Deming-Halverson, Sandra; Shrubsole, Martha J; Long, Jirong; Chang-Claude, Jenny; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Cox, Angela; Cross, Simon S; Reed, Malcolm W R; Schmidt, Marjanka K; Broeks, Annegien; Cornelissen, Sten; Braaf, Linde; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K; Noh, Dong-Young; Simard, Jacques; Dumont, Martine; Goldberg, Mark S; Labrèche, France; Fasching, Peter A; Hein, Alexander; Ekici, Arif B; Beckmann, Matthias W; Radice, Paolo; Peterlongo, Paolo; Azzollini, Jacopo; Barile, Monica; Sawyer, Elinor; Tomlinson, Ian; Kerin, Michael; Miller, Nicola; Hopper, John L; Schmidt, Daniel F; Makalic, Enes; Southey, Melissa C; Hwang Teo, Soo; Har Yip, Cheng; Sivanandan, Kavitta; Tay, Wan-Ting; Shen, Chen-Yang; Hsiung, Chia-Ni; Yu, Jyh-Cherng; Hou, Ming-Feng; Guénel, Pascal; Truong, Therese; Sanchez, Marie; Mulot, Claire; Blot, William; Cai, Qiuyin; Nevanlinna, Heli; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Wu, Anna H; Tseng, Chiu-Chen; Van Den Berg, David; Stram, Daniel O; Bogdanova, Natalia; Dörk, Thilo; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Zhang, Ben; Couch, Fergus J; Toland, Amanda E; Yannoukakos, Drakoulis; Sangrajrang, Suleeporn; McKay, James; Wang, Xianshu; Olson, Janet E; Vachon, Celine; Purrington, Kristen; Severi, Gianluca; Baglietto, Laura; Haiman, Christopher A; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Devilee, Peter; Tollenaar, Robert A E M; Seynaeve, Caroline; Czene, Kamila; Eriksson, Mikael; Humphreys, Keith; Darabi, Hatef; Ahmed, Shahana; Shah, Mitul; Pharoah, Paul D P; Hall, Per; Giles, Graham G; Benítez, Javier; Dunning, Alison M; Chenevix-Trench, Georgia; Easton, Douglas F
2014-11-15
Candidate variant association studies have been largely unsuccessful in identifying common breast cancer susceptibility variants, although most studies have been underpowered to detect associations of a realistic magnitude. We assessed 41 common non-synonymous single-nucleotide polymorphisms (nsSNPs) for which evidence of association with breast cancer risk had been previously reported. Case-control data were combined from 38 studies of white European women (46 450 cases and 42 600 controls) and analyzed using unconditional logistic regression. Strong evidence of association was observed for three nsSNPs: ATXN7-K264R at 3p21 [rs1053338, per allele OR = 1.07, 95% confidence interval (CI) = 1.04-1.10, P = 2.9 × 10(-6)], AKAP9-M463I at 7q21 (rs6964587, OR = 1.05, 95% CI = 1.03-1.07, P = 1.7 × 10(-6)) and NEK10-L513S at 3p24 (rs10510592, OR = 1.10, 95% CI = 1.07-1.12, P = 5.1 × 10(-17)). The first two associations reached genome-wide statistical significance in a combined analysis of available data, including independent data from nine genome-wide association studies (GWASs): for ATXN7-K264R, OR = 1.07 (95% CI = 1.05-1.10, P = 1.0 × 10(-8)); for AKAP9-M463I, OR = 1.05 (95% CI = 1.04-1.07, P = 2.0 × 10(-10)). Further analysis of other common variants in these two regions suggested that intronic SNPs nearby are more strongly associated with disease risk. We have thus identified a novel susceptibility locus at 3p21, and confirmed previous suggestive evidence that rs6964587 at 7q21 is associated with risk. The third locus, rs10510592, is located in an established breast cancer susceptibility region; the association was substantially attenuated after adjustment for the known GWAS hit. Thus, each of the associated nsSNPs is likely to be a marker for another, non-coding, variant causally related to breast cancer risk. Further fine-mapping and functional studies are required to identify the underlying risk-modifying variants and the genes through which they act. © The
Synonymy and synonyms in Lexicography
DEFF Research Database (Denmark)
Bergenholtz, Henning; Gouws, Rufus
2012-01-01
In this paper we work with the assumption that items giving synonyms in dictionaries are primarily of assistance in the case of text production problems. We assume furthermore that synonymy does not prevail between lexemes but rather between textual items in concrete texts. Accordingly a rich...... selection of synonyms in text production dictionaries will offer the possibility to select the appropriate item – but only for mother-tongue speakers. We are not discussing items giving synonyms in learners' dictionaries and school dictionaries. From a selection of existing dictionaries it shows, as could...... be expected, that there is no uniform lexicographic practice but also numerous ways of dealing with synonyms that offers very little assistance to the intended target users of a specific dictionary. This could be due to the fact that too often the inclusion and presentation of synonyms are done without taking...
Shen, Ying
2010-01-01
This study addresses the interrelation among coherence, substitution, and reference by non-English major Chinese students. The author collected data through student questionnaires. Participants included 30 non-English major Chinese undergraduate students. The findings of this study suggested that the similarities and differences were confirmed…
Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.
Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K
2017-04-01
For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Li, M-H; Tiirikka, T; Kantanen, J
2014-02-01
In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10(-11) for all the colours; P=2.3 × 10(-11) for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding.
Directory of Open Access Journals (Sweden)
Navin Elango
2008-02-01
Full Text Available Transitions at CpG dinucleotides, referred to as "CpG substitutions", are a major mutational input into vertebrate genomes and a leading cause of human genetic disease. The prevalence of CpG substitutions is due to their mutational origin, which is dependent on DNA methylation. In comparison, other single nucleotide substitutions (for example those occurring at GpC dinucleotides mainly arise from errors during DNA replication. Here we analyzed high quality BAC-based data from human, chimpanzee, and baboon to investigate regional variation of CpG substitution rates. We show that CpG substitutions occur approximately 15 times more frequently than other single nucleotide substitutions in primate genomes, and that they exhibit substantial regional variation. Patterns of CpG rate variation are consistent with differences in methylation level and susceptibility to subsequent deamination. In particular, we propose a "distance-decaying" hypothesis, positing that due to the molecular mechanism of a CpG substitution, rates are correlated with the stability of double-stranded DNA surrounding each CpG dinucleotide, and the effect of local DNA stability may decrease with distance from the CpG dinucleotide.Consistent with our "distance-decaying" hypothesis, rates of CpG substitution are strongly (negatively correlated with regional G+C content. The influence of G+C content decays as the distance from the target CpG site increases. We estimate that the influence of local G+C content extends up to 1,500 approximately 2,000 bps centered on each CpG site. We also show that the distance-decaying relationship persisted when we controlled for the effect of long-range homogeneity of nucleotide composition. GpC sites, in contrast, do not exhibit such "distance-decaying" relationship. Our results highlight an example of the distinctive properties of methylation-dependent substitutions versus substitutions mostly arising from errors during DNA replication. Furthermore
In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.
Directory of Open Access Journals (Sweden)
Mohammed Alanazi
Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid
Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu
2013-01-01
A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
... in metabolic rate and generation time among plant lineages. In addition, through the estimation of the ratio of non-synonymous to synonymous substitution rates between orthologous mitochondrion-encoded genes of higher plants, we found an accelerated evolutionary rate that seems to be the result of relaxed selection.
Evolutionary genomics of the cold-adapted diatom Fragilariopsis cylindrus
Mock, Thomas
2017-01-17
The Southern Ocean houses a diverse and productive community of organisms. Unicellular eukaryotic diatoms are the main primary producers in this environment, where photosynthesis is limited by low concentrations of dissolved iron and large seasonal fluctuations in light, temperature and the extent of sea ice. How diatoms have adapted to this extreme environment is largely unknown. Here we present insights into the genome evolution of a cold-adapted diatom from the Southern Ocean, Fragilariopsis cylindrus, based on a comparison with temperate diatoms. We find that approximately 24.7 per cent of the diploid F. cylindrus genome consists of genetic loci with alleles that are highly divergent (15.1 megabases of the total genome size of 61.1 megabases). These divergent alleles were differentially expressed across environmental conditions, including darkness, low iron, freezing, elevated temperature and increased CO2. Alleles with the largest ratio of non-synonymous to synonymous nucleotide substitutions also show the most pronounced condition-dependent expression, suggesting a correlation between diversifying selection and allelic differentiation. Divergent alleles may be involved in adaptation to environmental fluctuations in the Southern Ocean.
Evolutionary genomics of the cold-adapted diatom Fragilariopsis cylindrus
Mock, Thomas; Otillar, Robert P.; Strauss, Jan; McMullan, Mark; Paajanen, Pirita; Schmutz, Jeremy; Salamov, Asaf; Sanges, Remo; Toseland, Andrew; Ward, Ben J.; Allen, Andrew E.; Dupont, Christopher L.; Frickenhaus, Stephan; Maumus, Florian; Veluchamy, Alaguraj; Wu, Taoyang; Barry, Kerrie W.; Falciatore, Angela; Ferrante, Maria I.; Fortunato, Antonio E.; Glö ckner, Gernot; Gruber, Ansgar; Hipkin, Rachel; Janech, Michael G.; Kroth, Peter G.; Leese, Florian; Lindquist, Erika A.; Lyon, Barbara R.; Martin, Joel; Mayer, Christoph; Parker, Micaela; Quesneville, Hadi; Raymond, James A.; Uhlig, Christiane; Valas, Ruben E.; Valentin, Klaus U.; Worden, Alexandra Z.; Armbrust, E. Virginia; Clark, Matthew D.; Bowler, Chris; Green, Beverley R.; Moulton, Vincent; Oosterhout, Cock van; Grigoriev, Igor V.
2017-01-01
The Southern Ocean houses a diverse and productive community of organisms. Unicellular eukaryotic diatoms are the main primary producers in this environment, where photosynthesis is limited by low concentrations of dissolved iron and large seasonal fluctuations in light, temperature and the extent of sea ice. How diatoms have adapted to this extreme environment is largely unknown. Here we present insights into the genome evolution of a cold-adapted diatom from the Southern Ocean, Fragilariopsis cylindrus, based on a comparison with temperate diatoms. We find that approximately 24.7 per cent of the diploid F. cylindrus genome consists of genetic loci with alleles that are highly divergent (15.1 megabases of the total genome size of 61.1 megabases). These divergent alleles were differentially expressed across environmental conditions, including darkness, low iron, freezing, elevated temperature and increased CO2. Alleles with the largest ratio of non-synonymous to synonymous nucleotide substitutions also show the most pronounced condition-dependent expression, suggesting a correlation between diversifying selection and allelic differentiation. Divergent alleles may be involved in adaptation to environmental fluctuations in the Southern Ocean.
Park, Seongjun; Ruhlman, Tracey A; Weng, Mao-Lun; Hajrah, Nahid H; Sabir, Jamal S M; Jansen, Robert K
2017-06-01
Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have included limited sampling of Geranium, the largest genus in the family with over 400 species. This study reports on rates and patterns of nucleotide substitutions in plastomes and mitogenomes of 17 species of Geranium and representatives of other Geraniaceae. As detected across other angiosperms, substitution rates in the plastome are 3.5 times higher than the mitogenome in most Geranium. However, in the branch leading to Geranium brycei/Geranium incanum mitochondrial genes experienced significantly higher dN and dS than plastid genes, a pattern that has only been detected in one other angiosperm. Furthermore, rate accelerations differ in the two organelle genomes with plastomes having increased dN and mitogenomes with increased dS. In the Geranium phaeum/Geranium reflexum clade, duplicate copies of clpP and rpoA genes that experienced asymmetric rate divergence were detected in the single copy region of the plastome. In the case of rpoA, the branch leading to G. phaeum/G. reflexum experienced positive selection or relaxation of purifying selection. Finally, the evolution of acetyl-CoA carboxylase is unusual in Geraniaceae because it is only the second angiosperm family where both prokaryotic and eukaryotic ACCases functionally coexist in the plastid. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
WEB-server for search of a periodicity in amino acid and nucleotide sequences
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
DEFF Research Database (Denmark)
Yang, Ziheng; Nielsen, Rasmus
2008-01-01
Current models of codon substitution are formulated at the levels of nucleotide substitution and do not explicitly consider the separate effects of mutation and selection. They are thus incapable of inferring whether mutation or selection is responsible for evolution at silent sites. Here we impl...... codon usage in mammals. Estimates of selection coefficients nevertheless suggest that selection on codon usage is weak and most mutations are nearly neutral. The sensitivity of the analysis on the assumed mutation model is discussed.......Current models of codon substitution are formulated at the levels of nucleotide substitution and do not explicitly consider the separate effects of mutation and selection. They are thus incapable of inferring whether mutation or selection is responsible for evolution at silent sites. Here we...... implement a few population genetics models of codon substitution that explicitly consider mutation bias and natural selection at the DNA level. Selection on codon usage is modeled by introducing codon-fitness parameters, which together with mutation-bias parameters, predict optimal codon frequencies...
Uemoto, Yoshinobu; Ohtake, Tsuyoshi; Sasago, Nanae; Takeda, Masayuki; Abe, Tsuyoshi; Sakuma, Hironori; Kojima, Takatoshi; Sasaki, Shinji
2017-11-13
Umami is a Japanese term for the fifth basic taste and is an important sensory property of beef palatability. Inosine 5'-monophosphate (IMP) contributes to umami taste in beef. Thus, the overall change in concentration of IMP and its degradation products can potentially affect the beef palatability. In this study, we investigated the genetic architecture of IMP and its degradation products in Japanese Black beef. First, we performed genome-wide association study (GWAS), candidate gene analysis, and functional analysis to detect the causal variants that affect IMP, inosine, and hypoxanthine. Second, we evaluated the allele frequencies in the different breeds, the contribution of genetic variance, and the effect on other economical traits using the detected variants. A total of 574 Japanese Black cattle were genotyped using the Illumina BovineSNP50 BeadChip and were then used for GWAS. The results of GWAS showed that the genome-wide significant single nucleotide polymorphisms (SNPs) on BTA9 were detected for IMP, inosine, and hypoxanthine. The ecto-5'-nucleotidase (NT5E) gene, which encodes the enzyme NT5E for the extracellular degradation of IMP to inosine, was located near the significant region on BTA9. The results of candidate gene analysis and functional analysis showed that two non-synonymous SNPs (c.1318C > T and c.1475 T > A) in NT5E affected the amount of IMP and its degradation products in beef by regulating the enzymatic activity of NT5E. The Q haplotype showed a positive effect on IMP and a negative effect on the enzymatic activity of NT5E in IMP degradation. The two SNPs were under perfect linkage disequilibrium in five different breeds, and different haplotype frequencies were seen among breeds. The two SNPs contribute to about half of the total genetic variance in IMP, and the results of genetic relationship between IMP and its degradation products showed that NT5E affected the overall concentration balance of IMP and its degradation products
Terminological synonyms in Czech and English sports terminologies
Directory of Open Access Journals (Sweden)
Michaela Cocca
2016-11-01
Full Text Available The following paper deals with the concept and typology of terminological synonyms in English and Czech, focusing on the official sport terms codified in English and/or Czech dictionaries. The analysis focuses on Anglicisms as terminological doublets, hyposynonyms, stylistic synonyms, and false friends. Results show that a high number of synonyms were generated by the process of transshaping or translating English terms into Czech. Our analysis suggests that there may be found three types of sports synonyms in English (real, quasi-, and pseudo- synonyms and four main types in Czech (terminological doublets, Anglicisms as hyposynonyms, false friends, and stylistic synonyms. The use of synonyms is even more evident in modern or newly created sports; mass media and the accessibility of data through the Internet playing an essential role as they mediate an immense input of information to the target population.
Bimolata, Waikhom; Kumar, Anirudh; Sundaram, Raman Meenakshi; Laha, Gouri Shankar; Qureshi, Insaf Ahmed; Reddy, Gajjala Ashok; Ghazi, Irfan Ahmad
2013-08-01
Xa27 is one of the important R-genes, effective against bacterial blight disease of rice caused by Xanthomonas oryzae pv. oryzae (Xoo). Using natural population of Oryza, we analyzed the sequence variation in the functionally important domains of Xa27 across the Oryza species. DNA sequences of Xa27 alleles from 27 rice accessions revealed higher nucleotide diversity among the reported R-genes of rice. Sequence polymorphism analysis revealed synonymous and non-synonymous mutations in addition to a number of InDels in non-coding regions of the gene. High sequence variation was observed in the promoter region including the 5'UTR with 'π' value 0.00916 and 'θ w ' = 0.01785. Comparative analysis of the identified Xa27 alleles with that of IRBB27 and IR24 indicated the operation of both positive selection (Ka/Ks > 1) and neutral selection (Ka/Ks ≈ 0). The genetic distances of alleles of the gene from Oryza nivara were nearer to IRBB27 as compared to IR24. We also found the presence of conserved and null UPT (upregulated by transcriptional activator) box in the isolated alleles. Considerable amino acid polymorphism was localized in the trans-membrane domain for which the functional significance is yet to be elucidated. However, the absence of functional UPT box in all the alleles except IRBB27 suggests the maintenance of single resistant allele throughout the natural population.
Directory of Open Access Journals (Sweden)
Henky Manoppo
2011-01-01
Full Text Available This research evaluated the nonspecific immune responsse, resistance, and growth of Litopenaeus vannamei fed nucleotide diet. Shrimp juveniles (mean weight 5.39±0.56 g were reared in two groups of glass aquaria, each with three replications. Shrimps in group one and group two were fed nucleotide diet and basal diet each for four weeks. Total haemocyte count (THC and PO activity were evaluated at the end of feeding while growth was measured at two weeks interval. At the end of feeding trial, the shrimps were intramuscularly injected with Vibrio harveyi 0.1x106 cfu.shrimp-1. THC of shrimp fed nucleotide diet significantly increased (P-1 diet showed positive effect on the enhancement of nonspecific immune responsse, resistance, and growth of L. vannamei. Key words: Litopenaeus vannamei, nucleotide, THC, PO activity, resistance ABSTRAK Penelitian bertujuan untuk mengevaluasi respons imun non-spesifik dan resistensi udang vaname (Litopenaeus vannamei yang diberi pakan nukleotida. Juvenil (5,39±0,56 g dipelihara dalam dua kelompok akuarium kaca masing-masing dengan 3 ulangan. Udang dalam dalam kelompok pertama diberi pakan nukleotida sedangkan udang dalam kelompok kedua diberi pakan standar selama 4 minggu. Total haemocyte count (THC dan aktivitas phenoloxidase (PO diukur pada akhir pemberian pakan sedangkan pertumbuhan udang diukur setiap dua minggu. Pada akhir periode pemberian pakan perlakuan, udang diuji tantang secara injeksi intramuskular dengan bakteri Vibrio harveyi 0,1x106 cfu.udang-1. THC udang yang diberi pakan nukleotida meningkat secara signifikan (P-1 pakan selama 4 minggu memberi pengaruh positif terhadap peningkatan respons imun non-spesifik, resistensi dan pertumbuhan udang vaname. Kata kunci: Litopenaeus vannamei, nukleotida, THC, aktivitas PO, resistensi
Recombination and its impact on the genome of the haplodiploid parasitoid wasp Nasonia.
Directory of Open Access Journals (Sweden)
Oliver Niehuis
2010-01-01
Full Text Available Homologous meiotic recombination occurs in most sexually reproducing organisms, yet its evolutionary advantages are elusive. Previous research explored recombination in the honeybee, a eusocial hymenopteran with an exceptionally high genome-wide recombination rate. A comparable study in a non-social member of the Hymenoptera that would disentangle the impact of sociality from Hymenoptera-specific features such as haplodiploidy on the evolution of the high genome-wide recombination rate in social Hymenoptera is missing. Utilizing single-nucleotide polymorphisms (SNPs between two Nasonia parasitoid wasp genomes, we developed a SNP genotyping microarray to infer a high-density linkage map for Nasonia. The map comprises 1,255 markers with an average distance of 0.3 cM. The mapped markers enabled us to arrange 265 scaffolds of the Nasonia genome assembly 1.0 on the linkage map, representing 63.6% of the assembled N. vitripennis genome. We estimated a genome-wide recombination rate of 1.4-1.5 cM/Mb for Nasonia, which is less than one tenth of the rate reported for the honeybee. The local recombination rate in Nasonia is positively correlated with the distance to the center of the linkage groups, GC content, and the proportion of simple repeats. In contrast to the honeybee genome, gene density in the parasitoid wasp genome is positively associated with the recombination rate; regions of low recombination are characterized by fewer genes with larger introns and by a greater distance between genes. Finally, we found that genes in regions of the genome with a low recombination frequency tend to have a higher ratio of non-synonymous to synonymous substitutions, likely due to the accumulation of slightly deleterious non-synonymous substitutions. These findings are consistent with the hypothesis that recombination reduces interference between linked sites and thereby facilitates adaptive evolution and the purging of deleterious mutations. Our results imply
Henrionnet, Christel; Dumas, Dominique; Hupont, Sébastien; Stoltz, Jean François; Mainard, Didier; Gillet, Pierre; Pinzano, Astrid
2017-01-01
In tissue engineering approaches, the quality of substitutes is a key element to determine its ability to treat cartilage defects. However, in clinical practice, the evaluation of tissue-engineered cartilage substitute quality is not possible due to the invasiveness of the standard procedure, which is to date histology. The aim of this work was to validate a new innovative system performed from two-photon excitation laser adapted to an optical macroscope to evaluate at macroscopic scale the collagen network in cartilage tissue-engineered substitutes in confrontation with gold standard histologic techniques or immunohistochemistry to visualize type II collagen. This system permitted to differentiate the quality of collagen network between ITS and TGF-β1 treatments. Multiscale large field imaging combined to multimodality approaches (SHG-TCSPC) at macroscopical scale represent an innovative and non-invasive technique to monitor the quality of collagen network in cartilage tissue-engineered substitutes before in vivo implantation.
Synonyms for some species of Mexican anoles (Squamata: Dactyloidae).
De Oca, Adrián Nieto Montes; Poe, Steven; Scarpetta, Simon; Gray, Levi; Lieb, Carl S
2013-01-01
We studied type material and freshly collected topotypical specimens to assess the taxonomic status of five names associated with species of Mexican Anolis. We find A. schmidti to be a junior synonym of A. nebulosus, A. breedlovei to be a junior synonym of A. cuprinus, A. polyrhachis to be a junior synonym of A. rubiginosus, A. simmonsi to be a junior synonym of A. nebuloides, and A. adleri to be a junior synonym of A. liogaster.
The Study of Synonymous Word "Mistake"
Suwardi, Albertus
2016-01-01
This article discusses the synonymous word "mistake*.The discussion will also cover the meaning of 'word' itself. Words can be considered as form whether spoken or written, or alternatively as composite expression, which combine and meaning. Synonymous are different phonological words which have the same or very similar meanings. The synonyms of mistake are error, fault, blunder, slip, slipup, gaffe and inaccuracy. The data is taken from a computer program. The procedure of data collection is...
Directory of Open Access Journals (Sweden)
Bombarely Aureliano
2012-08-01
Full Text Available Abstract Background Polyploidization is an important mechanism in plant evolution. By analyzing the leaf transcriptomes taken from the allotetraploid Nicotiana tabacum (tobacco and parental genome donors, N. sylvesteris (S-Genome and N. tomentosiformis (T-Genome, a phylogenomic approach was taken to map the fate of homeologous gene pairs in this plant. Results A comparison between the genes present in the leaf transcriptomes of N. tabacum and modern day representatives of its progenitor species demonstrated that only 33% of assembled transcripts could be distinguished based on their sequences. A large majority of the genes (83.6% of the non parent distinguishable and 87.2% of the phylogenetic topology analyzed clusters expressed above background level (more than 5 reads showed similar overall expression levels. Homeologous sequences could be identified for 968 gene clusters, and 90% (6% of all genes of the set maintained expression of only one of the tobacco homeologs. When both homeologs were expressed, only 15% (0.5% of the total showed evidence of differential expression, providing limited evidence of subfunctionalization. Comparing the rate of synonymous nucleotide substitution (Ks and non-synonymous nucleotide substitution (Kn provided limited evidence for positive selection during the evolution of tobacco since the polyploidization event took place. Conclusions Polyploidization is a powerful mechanism for plant speciation that can occur during one generation; however millions of generations may be necessary for duplicate genes to acquire a new function. Analysis of the tobacco leaf transcriptome reveals that polyploidization, even in a young tetraploid such as tobacco, can lead to complex changes in gene expression. Gene loss and gene silencing, or subfunctionalization may explain why both homeologs are not expressed by the associated genes. With Whole Genome Duplication (WGD events, polyploid genomes usually maintain a high percentage of
Genome-Wide Analysis of the Synonymous Codon Usage Patterns in Riemerella anatipestifer
Directory of Open Access Journals (Sweden)
Jibin Liu
2016-08-01
Full Text Available Riemerella anatipestifer (RA belongs to the Flavobacteriaceae family and can cause a septicemia disease in poultry. The synonymous codon usage patterns of bacteria reflect a series of evolutionary changes that enable bacteria to improve tolerance of the various environments. We detailed the codon usage patterns of RA isolates from the available 12 sequenced genomes by multiple codon and statistical analysis. Nucleotide compositions and relative synonymous codon usage (RSCU analysis revealed that A or U ending codons are predominant in RA. Neutrality analysis found no significant correlation between GC12 and GC3 (p > 0.05. Correspondence analysis and ENc-plot results showed that natural selection dominated over mutation in the codon usage bias. The tree of cluster analysis based on RSCU was concordant with dendrogram based on genomic BLAST by neighbor-joining method. By comparative analysis, about 50 highly expressed genes that were orthologs across all 12 strains were found in the top 5% of high CAI value. Based on these CAI values, we infer that RA contains a number of predicted highly expressed coding sequences, involved in transcriptional regulation and metabolism, reflecting their requirement for dealing with diverse environmental conditions. These results provide some useful information on the mechanisms that contribute to codon usage bias and evolution of RA.
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
Directory of Open Access Journals (Sweden)
Tongjun Gu
Full Text Available RNA editing is a process that modifies RNA nucleotides and changes the efficiency and fidelity of the central dogma. Enzymes that catalyze RNA editing are required for life, and defects in RNA editing are associated with many diseases. Recent advances in sequencing have enabled the genome-wide identification of RNA editing sites in mammalian transcriptomes. Here, we demonstrate that canonical RNA editing (A-to-I and C-to-U occurs in liver, white adipose, and bone tissues of the laboratory mouse, and we show that apparent non-canonical editing (all other possible base substitutions is an artifact of current high-throughput sequencing technology. Further, we report that high-confidence canonical RNA editing sites can cause non-synonymous amino acid changes and are significantly enriched in 3' UTRs, specifically at microRNA target sites, suggesting both regulatory and functional consequences for RNA editing.
Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†
Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai
2010-01-01
Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555
Annotating pathogenic non-coding variants in genic regions.
Gelfman, Sahar; Wang, Quanli; McSweeney, K Melodi; Ren, Zhong; La Carpia, Francesca; Halvorsen, Matt; Schoch, Kelly; Ratzon, Fanni; Heinzen, Erin L; Boland, Michael J; Petrovski, Slavé; Goldstein, David B
2017-08-09
Identifying the underlying causes of disease requires accurate interpretation of genetic variants. Current methods ineffectively capture pathogenic non-coding variants in genic regions, resulting in overlooking synonymous and intronic variants when searching for disease risk. Here we present the Transcript-inferred Pathogenicity (TraP) score, which uses sequence context alterations to reliably identify non-coding variation that causes disease. High TraP scores single out extremely rare variants with lower minor allele frequencies than missense variants. TraP accurately distinguishes known pathogenic and benign variants in synonymous (AUC = 0.88) and intronic (AUC = 0.83) public datasets, dismissing benign variants with exceptionally high specificity. TraP analysis of 843 exomes from epilepsy family trios identifies synonymous variants in known epilepsy genes, thus pinpointing risk factors of disease from non-coding sequence data. TraP outperforms leading methods in identifying non-coding variants that are pathogenic and is therefore a valuable tool for use in gene discovery and the interpretation of personal genomes.While non-coding synonymous and intronic variants are often not under strong selective constraint, they can be pathogenic through affecting splicing or transcription. Here, the authors develop a score that uses sequence context alterations to predict pathogenicity of synonymous and non-coding genetic variants, and provide a web server of pre-computed scores.
Synonymous genes explore different evolutionary landscapes.
Directory of Open Access Journals (Sweden)
Guillaume Cambray
2008-11-01
Full Text Available The evolutionary potential of a gene is constrained not only by the amino acid sequence of its product, but by its DNA sequence as well. The topology of the genetic code is such that half of the amino acids exhibit synonymous codons that can reach different subsets of amino acids from each other through single mutation. Thus, synonymous DNA sequences should access different regions of the protein sequence space through a limited number of mutations, and this may deeply influence the evolution of natural proteins. Here, we demonstrate that this feature can be of value for manipulating protein evolvability. We designed an algorithm that, starting from an input gene, constructs a synonymous sequence that systematically includes the codons with the most different evolutionary perspectives; i.e., codons that maximize accessibility to amino acids previously unreachable from the template by point mutation. A synonymous version of a bacterial antibiotic resistance gene was computed and synthesized. When concurrently submitted to identical directed evolution protocols, both the wild type and the recoded sequence led to the isolation of specific, advantageous phenotypic variants. Simulations based on a mutation isolated only from the synthetic gene libraries were conducted to assess the impact of sub-functional selective constraints, such as codon usage, on natural adaptation. Our data demonstrate that rational design of synonymous synthetic genes stands as an affordable improvement to any directed evolution protocol. We show that using two synonymous DNA sequences improves the overall yield of the procedure by increasing the diversity of mutants generated. These results provide conclusive evidence that synonymous coding sequences do experience different areas of the corresponding protein adaptive landscape, and that a sequence's codon usage effectively constrains the evolution of the encoded protein.
Non-isovalent alkali metal ''substitution'' in YBa2Cu3O7-y granular ceramics
International Nuclear Information System (INIS)
Cloots, R.; Liege Univ.; Rulmont, A.; Pekala, M.; Liege Univ.; Laval, J.Y.; Bougrine, H.; Liege Univ.; Ausloos, M.
1995-01-01
The aim of this paper is to study the influence of non-isovalent ''doping'' in YBa 2 Cu 3 O 7-y in particular on its synthesis conditions and on the resistive properties both with and without a magnetic field. We concentrate on the study of possible alkali ions (Na, K, Cs) ''substitution'' at the barium sites. A low temperature sintering process is used in order to induce a reactive liquid phase. The final chemical composition is discussed as a function of the amount of the liquid phase. No alkali ion is substituted. Carbonate layers are present. However, this (lack of) ''substitution'' leads to induced vacancies and improved electrical transport properties which are as good as in highly pure materials. For conciseness the case of Na ''substitution'' only is illustrated. The use of such data in order to probe the microstructure is emphasized. (orig.)
Trosiuk, Tetiana V; Shalak, Vyacheslav F; Szczepanowski, Roman H; Negrutskii, Boris S; El'skaya, Anna V
2016-02-01
Eukaryotic translation elongation factor 1Bα (eEF1Bα) is a functional homolog of the bacterial factor EF-Ts, and is a component of the macromolecular eEF1B complex. eEF1Bα functions as a catalyst of guanine nucleotide exchange on translation elongation factor 1A (eEF1A). The C-terminal domain of eEF1Bα is necessary and sufficient for its catalytic activity, whereas the N-terminal domain interacts with eukaryotic translation elongation factor 1Bγ (eEF1Bγ) to form a tight complex. However, eEF1Bγ has been shown to enhance the catalytic activity of eEF1Bα attributed to the C-terminal domain of eEF1Bα. This suggests that the N-terminal domain of eEF1Bα may in some way influence the guanine nucleotide exchange process. We have shown that full-length recombinant eEF1Bα and its truncated forms are non-globular proteins with elongated shapes. Truncation of the N-terminal domain of eEF1Bα, which is dispensable for catalytic activity, resulted in acceleration of the rate of guanine nucleotide exchange on eEF1A compared to full-length eEF1Bα. A similar effect on the catalytic activity of eEF1Bα was observed after its interaction with eEF1Bγ. We suggest that the non-catalytic N-terminal domain of eEF1Bα may interfere with eEF1A binding to the C-terminal catalytic domain, resulting in a decrease in the overall rate of the guanine nucleotide exchange reaction. Formation of a tight complex between the eEF1Bγ and eEF1Bα N-terminal domains abolishes this inhibitory effect. © 2015 FEBS.
Dubey, Bhawna; Meganathan, P R; Haque, Ikramul
2012-07-01
This paper reports the complete mitochondrial genome sequence of an endangered Indian snake, Python molurus molurus (Indian Rock Python). A typical snake mitochondrial (mt) genome of 17258 bp length comprising of 37 genes including the 13 protein coding genes, 22 tRNA genes, and 2 ribosomal RNA genes along with duplicate control regions is described herein. The P. molurus molurus mt. genome is relatively similar to other snake mt. genomes with respect to gene arrangement, composition, tRNA structures and skews of AT/GC bases. The nucleotide composition of the genome shows that there are more A-C % than T-G% on the positive strand as revealed by positive AT and CG skews. Comparison of individual protein coding genes, with other snake genomes suggests that ATP8 and NADH3 genes have high divergence rates. Codon usage analysis reveals a preference of NNC codons over NNG codons in the mt. genome of P. molurus. Also, the synonymous and non-synonymous substitution rates (ka/ks) suggest that most of the protein coding genes are under purifying selection pressure. The phylogenetic analyses involving the concatenated 13 protein coding genes of P. molurus molurus conformed to the previously established snake phylogeny.
Screening for susceptibility genes in hereditary non-polyposis colorectal cancer.
Yu, Li; Yin, Bo; Qu, Kaiying; Li, Jingjing; Jin, Qiao; Liu, Ling; Liu, Chunlan; Zhu, Yuxing; Wang, Qi; Peng, Xiaowei; Zhou, Jianda; Cao, Peiguo; Cao, Ke
2018-06-01
In the present study, hereditary non-polyposis colorectal cancer (HNPCC) susceptibility genes were screened for using whole exome sequencing in 3 HNPCC patients from 1 family and using single nucleotide polymorphism (SNP) genotyping assays in 96 other colorectal cancer and control samples. Peripheral blood was obtained from 3 HNPCC patients from 1 family; the proband and the proband's brother and cousin. High-throughput sequencing was performed using whole exome capture technology. Sequences were aligned against the HAPMAP, dbSNP130 and 1,000 Genome Project databases. Reported common variations and synonymous mutations were filtered out. Non-synonymous single nucleotide variants in the 3 HNPCC patients were integrated and the candidate genes were identified. Finally, SNP genotyping was performed for the genes in 96 peripheral blood samples. In total, 60.4 Gb of data was retrieved from the 3 HNPCC patients using whole exome capture technology. Subsequently, according to certain screening criteria, 15 candidate genes were identified. Among the 96 samples that had been SNP genotyped, 92 were successfully genotyped for 15 gene loci, while genotyping for HTRA1 failed in 4 sporadic colorectal cancer patient samples. In 12 control subjects and 81 sporadic colorectal cancer patients, genotypes at 13 loci were wild-type, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 . The CEP290 genotype was mutant in 1 sporadic colorectal cancer patient and was wild-type in all other subjects. A total of 5 of the 12 control subjects and 30 of the 81 sporadic colorectal cancer patients had a mutant HTRA1 genotype. In all 3 HNPCC patients, the same mutant genotypes were identified at all 15 gene loci. Overall, 13 potential susceptibility genes for HNPCC were identified, namely DDX20, ZFYVE26, PIK3R3, SLC26A8, ZEB2, TP53INP1, SLC11A1, LRBA, CEBPZ, ETAA1, SEMA3G, IFRD2 and FAT1 .
Directory of Open Access Journals (Sweden)
Michael E. Østergaard
2017-06-01
Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.
Genetic Diversity of a Natural Population of Apple stem pitting virus Isolated from Apple in Korea
Directory of Open Access Journals (Sweden)
Ju Yeon Yoon
2014-06-01
Full Text Available Apple stem pitting virus (ASPV, of the Foveavirus genus in the family Betaflexiviridae, is one of the most common viruses of apple and pear trees. To examine variability of the coat protein (CP gene from ASPV, eight isolates originating from 251 apple trees, which were collected from 22 apple orchards located in intensive apple growing areas of the North Gyeongsang and North Jeolla Provinces in Korea, were sequenced and compared. The nucleotide sequence identity of the CP gene of eight ASPV isolates ranged from 77.0 to 97.0%, while the amino acid sequence identity ranged from 87.7 to 98.5%. The N-terminal region of the viral CP gene was highly variable, whereas the C-terminal region was conserved. Genetic algorithm recombination detection (GARD and single breakpoint recombination (SBP analyses identified base substitutions between eight ASPV isolates at positions 54 and 57 and position 771, respectively. GABranch analysis was used to determine whether the eight isolates evolved due to positive selection. All values in the GABranch analysis showed a ratio of substitution rates at non-synonymous and synonymous sites (dNS/dS below 1, suggestive of strong negative selection forces during ASPV CP history. Although negative selection dominated CP evolution in the eight ASPV isolates, SLAC and FEL tests identified four possible positive selection sites at codons 10, 22, 102, and 158. This is the first study of the ASPV genome in Korea.
Investigating the impact of missense mutations in hCES1 by in silico structure-based approaches
DEFF Research Database (Denmark)
Nzabonimpa, Grace Shema; Rasmussen, Henrik Berg; Brunak, Søren
2016-01-01
Genetic variations in drug-metabolizing enzymes have been reported to influence pharmacokinetics, drug dosage and other aspects that affect therapeutic outcomes. Most particularly, non-synonymous single-nucleotide polymorphisms (nsSNPs) resulting in amino acid changes disrupt potential functional...
The importance of species name synonyms in literature searches
Guala, Gerald
2016-01-01
The synonyms of biological species names are shown to be an important component in comprehensive searches of electronic scientific literature databases but they are not well leveraged within the major literature databases examined. For accepted or valid species names in the Integrated Taxonomic Information System (ITIS) which have synonyms in the system, and which are found in citations within PLoS, PMC, PubMed or Scopus, both the percentage of species for which citations will not be found if synonyms are not used, and the percentage increase in number of citations found by including synonyms are very often substantial. However, there is no correlation between the number of synonyms per species and the magnitude of the effect. Further, the number of citations found does not generally increase proportionally to the number of synonyms available. Users looking for literature on specific species across all of the resources investigated here are often missing large numbers of citations if they are not manually augmenting their searches with synonyms. Of course, missing citations can have serious consequences by effectively hiding critical information. Literature searches should include synonym relationships and a new web service in ITIS, with examples of how to apply it to this issue, was developed as a result of this study, and is here announced, to aide in this.
The Importance of Species Name Synonyms in Literature Searches.
Guala, Gerald F
2016-01-01
The synonyms of biological species names are shown to be an important component in comprehensive searches of electronic scientific literature databases but they are not well leveraged within the major literature databases examined. For accepted or valid species names in the Integrated Taxonomic Information System (ITIS) which have synonyms in the system, and which are found in citations within PLoS, PMC, PubMed or Scopus, both the percentage of species for which citations will not be found if synonyms are not used, and the percentage increase in number of citations found by including synonyms are very often substantial. However, there is no correlation between the number of synonyms per species and the magnitude of the effect. Further, the number of citations found does not generally increase proportionally to the number of synonyms available. Users looking for literature on specific species across all of the resources investigated here are often missing large numbers of citations if they are not manually augmenting their searches with synonyms. Of course, missing citations can have serious consequences by effectively hiding critical information. Literature searches should include synonym relationships and a new web service in ITIS, with examples of how to apply it to this issue, was developed as a result of this study, and is here announced, to aide in this.
The Importance of Species Name Synonyms in Literature Searches.
Directory of Open Access Journals (Sweden)
Gerald F Guala
Full Text Available The synonyms of biological species names are shown to be an important component in comprehensive searches of electronic scientific literature databases but they are not well leveraged within the major literature databases examined. For accepted or valid species names in the Integrated Taxonomic Information System (ITIS which have synonyms in the system, and which are found in citations within PLoS, PMC, PubMed or Scopus, both the percentage of species for which citations will not be found if synonyms are not used, and the percentage increase in number of citations found by including synonyms are very often substantial. However, there is no correlation between the number of synonyms per species and the magnitude of the effect. Further, the number of citations found does not generally increase proportionally to the number of synonyms available. Users looking for literature on specific species across all of the resources investigated here are often missing large numbers of citations if they are not manually augmenting their searches with synonyms. Of course, missing citations can have serious consequences by effectively hiding critical information. Literature searches should include synonym relationships and a new web service in ITIS, with examples of how to apply it to this issue, was developed as a result of this study, and is here announced, to aide in this.
Statistical properties and fractals of nucleotide clusters in DNA sequences
International Nuclear Information System (INIS)
Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting
2004-01-01
Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences
Directory of Open Access Journals (Sweden)
Wan Hongjian
2012-09-01
Full Text Available Abstract Background Pepper (Capsicum annuum L. is one of the most important vegetable crops worldwide. However, its yield and fruit quality can be severely threatened by several pathogens. The plant nucleotide-binding site (NBS-leucine-rich repeat (LRR gene family is the largest class of known disease resistance genes (R genes effective against such pathogens. Therefore, the isolation and identification of such R gene homologues from pepper will provide a critical foundation for improving disease resistance breeding programs. Results A total of 78 R gene analogues (CaRGAs were identified in pepper by degenerate PCR amplification and database mining. Phylogenetic tree analysis of the deduced amino acid sequences for 51 of these CaRGAs with typically conserved motifs ( P-loop, kinase-2 and GLPL along with some known R genes from Arabidopsis and tomato grouped these CaRGAs into the non-Toll interleukin-1 receptor (TIR-NBS-LRR (CaRGAs I to IV and TIR-NBS-LRR (CaRGAs V to VII subfamilies. The presence of consensus motifs (i.e. P-loop, kinase-2 and hydrophobic domain is typical of the non-TIR- and TIR-NBS-LRR gene subfamilies. This finding further supports the view that both subfamilies are widely distributed in dicot species. Functional divergence analysis provided strong statistical evidence of altered selective constraints during protein evolution between the two subfamilies. Thirteen critical amino acid sites involved in this divergence were also identified using DIVERGE version 2 software. Analyses of non-synonymous and synonymous substitutions per site showed that purifying selection can play a critical role in the evolutionary processes of non-TIR- and TIR-NBS-LRR RGAs in pepper. In addition, four specificity-determining positions were predicted to be responsible for functional specificity. qRT-PCR analysis showed that both salicylic and abscisic acids induce the expression of CaRGA genes, suggesting that they may primarily be involved in
Erhardt, Georg; Shuiep, El Tahir Salih; Lisson, Maria; Weimann, Christina; Wang, Zhaoxin; El Zubeir, Ibtisam El Yas Mohamed; Pauciullo, Alfredo
2016-06-01
Milk samples of 193 camels (Camelus dromedarius) from different regions of Sudan were screened for casein variability by isoelectric focusing. Kappa-casein and beta-casein were monomorphic, whereas three protein patterns named αs1-casein A, C, and D were identified. The major allele A revealed frequencies of 0.79 (Lahaoi), 0.75 (Shanbali), 0.90 (Arabi Khali), and 0.88 (Arabi Gharbawi) in the different ecotypes. CSN1S1*C shows a single G > T nucleotide substitution in the exon 5, leading to a non-synonymous amino acid exchange (p.Glu30 > Asp30) in comparison to CSN1S1*A and D. At cDNA level, no further single nucleotide polymorphisms could be identified in CSN1S1* A, C, and D, whereas the variants CSN1S1*A and CSN1S1*C are characterized by missing of exon 18 compared to the already described CSN1S1*B, as consequence of DNA insertion of 11 bp at intron 17 which alter the pre-mRNA spliceosome machinery. A polymerase chain-restriction fragment length polymorphism method (PCR-RFLP) was established to type for G > T nucleotide substitution at genomic DNA level. The occurrence and differences of IgE-binding epitopes and bioactive peptides between αs1-casein A, C, and D after digestion were analyzed in silico. The amino acid substitutions and deletion affected the arising peptide pattern and thus modifications between IgE-binding epitopes and bioactive peptides of the variants were found. The allergenic potential of these different peptides will be investigated by microarray immunoassay using sera from milk-sensitized individuals, as it was already demonstrated for bovine αs1-casein variants.
DEFF Research Database (Denmark)
Eklund, Aron Charles; Friis, Pia; Wernersson, Rasmus
2010-01-01
BLASTN accuracy by modifying the substitution matrix and gap penalties. We generated gene expression microarray data for samples in which 1 or 10% of the target mass was an exogenous spike of known sequence. We found that the 10% spike induced 2-fold intensity changes in 3% of the probes, two......-third of which were decreases in intensity likely caused by bulk-hybridization. These changes were correlated with similarity between the spike and probe sequences. Interestingly, even very weak similarities tended to induce a change in probe intensity with the 10% spike. Using this data, we optimized the BLASTN...... substitution matrix to more accurately identify probes susceptible to non-specific hybridization with the spike. Relative to the default substitution matrix, the optimized matrix features a decreased score for A–T base pairs relative to G–C base pairs, resulting in a 5–15% increase in area under the ROC curve...
Phylogeny, rate variation, and genome size evolution of Pelargonium (Geraniaceae).
Weng, Mao-Lun; Ruhlman, Tracey A; Gibby, Mary; Jansen, Robert K
2012-09-01
The phylogeny of 58 Pelargonium species was estimated using five plastid markers (rbcL, matK, ndhF, rpoC1, trnL-F) and one mitochondrial gene (nad5). The results confirmed the monophyly of three major clades and four subclades within Pelargonium but also indicate the need to revise some sectional classifications. This phylogeny was used to examine karyotype evolution in the genus: plotting chromosome sizes, numbers and 2C-values indicates that genome size is significantly correlated with chromosome size but not number. Accelerated rates of nucleotide substitution have been previously detected in both plastid and mitochondrial genes in Pelargonium, but sparse taxon sampling did not enable identification of the phylogenetic distribution of these elevated rates. Using the multigene phylogeny as a constraint, we investigated lineage- and locus-specific heterogeneity of substitution rates in Pelargonium for an expanded number of taxa and demonstrated that both plastid and mitochondrial genes have had accelerated substitution rates but with markedly disparate patterns. In the plastid, the exons of rpoC1 have significantly accelerated substitution rates compared to its intron and the acceleration was mainly due to nonsynonymous substitutions. In contrast, the mitochondrial gene, nad5, experienced substantial acceleration of synonymous substitution rates in three internal branches of Pelargonium, but this acceleration ceased in all terminal branches. Several lineages also have dN/dS ratios significantly greater than one for rpoC1, indicating that positive selection is acting on this gene, whereas the accelerated synonymous substitutions in the mitochondrial gene are the result of elevated mutation rates. Published by Elsevier Inc.
Synonymous Codon Usage Analysis of Thirty Two Mycobacteriophage Genomes
Directory of Open Access Journals (Sweden)
Sameer Hassan
2009-01-01
Full Text Available Synonymous codon usage of protein coding genes of thirty two completely sequenced mycobacteriophage genomes was studied using multivariate statistical analysis. One of the major factors influencing codon usage is identified to be compositional bias. Codons ending with either C or G are preferred in highly expressed genes among which C ending codons are highly preferred over G ending codons. A strong negative correlation between effective number of codons (Nc and GC3s content was also observed, showing that the codon usage was effected by gene nucleotide composition. Translational selection is also identified to play a role in shaping the codon usage operative at the level of translational accuracy. High level of heterogeneity is seen among and between the genomes. Length of genes is also identified to influence the codon usage in 11 out of 32 phage genomes. Mycobacteriophage Cooper is identified to be the highly biased genome with better translation efficiency comparing well with the host specific tRNA genes.
Czech Academy of Sciences Publication Activity Database
Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal
-, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012
cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs
Energy Technology Data Exchange (ETDEWEB)
Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K
1983-01-01
Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.
Babbitt, Gregory A; Alawad, Mohammed A; Schulze, Katharina V; Hudson, André O
2014-01-01
While mRNA stability has been demonstrated to control rates of translation, generating both global and local synonymous codon biases in many unicellular organisms, this explanation cannot adequately explain why codon bias strongly tracks neighboring intergene GC content; suggesting that structural dynamics of DNA might also influence codon choice. Because minor groove width is highly governed by 3-base periodicity in GC, the existence of triplet-based codons might imply a functional role for the optimization of local DNA molecular dynamics via GC content at synonymous sites (≈GC3). We confirm a strong association between GC3-related intrinsic DNA flexibility and codon bias across 24 different prokaryotic multiple whole-genome alignments. We develop a novel test of natural selection targeting synonymous sites and demonstrate that GC3-related DNA backbone dynamics have been subject to moderate selective pressure, perhaps contributing to our observation that many genes possess extreme DNA backbone dynamics for their given protein space. This dual function of codons may impose universal functional constraints affecting the evolution of synonymous and non-synonymous sites. We propose that synonymous sites may have evolved as an 'accessory' during an early expansion of a primordial genetic code, allowing for multiplexed protein coding and structural dynamic information within the same molecular context. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Zhao, Jianjun; Zhang, Hailing; Bai, Xue; Martella, Vito; Hu, Bo; Sun, Yangang; Zhu, Chunsheng; Zhang, Lei; Liu, Hao; Xu, Shujuan; Shao, Xiqun; Wu, Wei; Yan, Xijun
2014-04-01
A total of 16 strains of canine distemper virus (CDV) were detected from vaccinated minks, foxes, and raccoon dogs in four provinces in North-Eastern China between the end of 2011 and 2013. Upon sequence analysis of the haemagglutinin gene and comparison with wild-type CDV from different species in the same geographical areas, two non-synonymous single nucleotide polymorphisms were identified in 10 CDV strains, which led to amino acid changes at positions 542 (isoleucine to asparagine) and 549 (tyrosine to histidine) of the haemagglutinin protein coding sequence. The change at residue 542 generated a potentially novel N-glycosylation site. Masking of antigenic epitopes by sugar moieties might represent a mechanism for evasion of virus neutralising antibodies and reduced protection by vaccination. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Wei-Cheng Yang
2008-03-01
Full Text Available The major histocompatibility complex (MHC is a large multigene coding for glycoproteins that play a key role in the initiation of immune responses in vertebrates. For a better understanding of the immunologic diversity in thriving marine mammal species, the sequence variation of the exon 2 region of MHC DQB locus was analyzed in 42 bottlenose dolphins (Tursiops truncatus collected from strandings and fishery bycatch in Taiwanese waters. The 172 bp sequences amplified showed no more than two alleles in each individual. The high proportion of non-synonymous nucleotide substitutions and the moderate amount of variation suggest positive selection pressure on this locus, arguing against a reduction in the marine environment selection pressure. The phylogenetic relationship among DQB exon 2 sequences of T. truncatus and other cetaceans did not coincide with taxonomic relationship, indicating a trans-species evolutionary pattern.
Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro
2016-01-01
Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S
2008-02-01
This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.
Czech Academy of Sciences Publication Activity Database
Janeba, Zlatko; Holý, Antonín
2001-01-01
Roč. 20, 4-7 (2001), s. 1103-1106 ISSN 1525-7770 R&D Projects: GA ČR GV203/96/K001 Institutional research plan: CEZ:AV0Z4055905 Keywords : nucleotide analogs Subject RIV: CC - Organic Chemistry Impact factor: 0.508, year: 2001
Explaining the imperfection of the molecular clock of hominid mitochondria.
Directory of Open Access Journals (Sweden)
Eva-Liis Loogväli
Full Text Available The molecular clock of mitochondrial DNA has been extensively used to date various genetic events. However, its substitution rate among humans appears to be higher than rates inferred from human-chimpanzee comparisons, limiting the potential of interspecies clock calibrations for intraspecific dating. It is not well understood how and why the substitution rate accelerates. We have analyzed a phylogenetic tree of 3057 publicly available human mitochondrial DNA coding region sequences for changes in the ratios of mutations belonging to different functional classes. The proportion of non-synonymous and RNA genes substitutions has reduced over hundreds of thousands of years. The highest mutation ratios corresponding to fast acceleration in the apparent substitution rate of the coding sequence have occurred after the end of the Last Ice Age. We recalibrate the molecular clock of human mtDNA as 7990 years per synonymous mutation over the mitochondrial genome. However, the distribution of substitutions at synonymous sites in human data significantly departs from a model assuming a single rate parameter and implies at least 3 different subclasses of sites. Neutral model with 3 synonymous substitution rates can explain most, if not all, of the apparent molecular clock difference between the intra- and interspecies levels. Our findings imply the sluggishness of purifying selection in removing the slightly deleterious mutations from the human as well as the Neandertal and chimpanzee populations. However, for humans, the weakness of purifying selection has been further exacerbated by the population expansions associated with the out-of Africa migration and the end of the Last Ice Age.
Complete Genome Sequence of Zucchini Yellow Mosaic Virus Strain Kurdistan, Iran.
Maghamnia, Hamid Reza; Hajizadeh, Mohammad; Azizi, Abdolbaset
2018-03-01
The complete genome sequence of Zucchini yellow mosaic virus strain Kurdistan (ZYMV-Kurdistan) infecting squash from Iran was determined from 13 overlapping fragments. Excluding the poly (A) tail, ZYMV-Kurdistan genome consisted of 9593 nucleotides (nt), with 138 and 211 nt at the 5' and 3' non-translated regions, respectively. It contained two open-reading frames (ORFs), the large ORF encoding a polyprotein of 3080 amino acids (aa) and the small overlapping ORF encoding a P3N-PIPO protein of 74 aa. This isolate had six unique aa differences compared to other ZYMV isolates and shared 79.6-98.8% identities with other ZYMV genome sequences at the nt level and 90.1-99% identities at the aa level. A phylogenetic tree of ZYMV complete genomic sequences showed that Iranian and Central European isolates are closely related and form a phylogenetically homogenous group. All values in the ratio of substitution rates at non-synonymous and synonymous sites ( d N / d S ) were below 1, suggestive of strong negative selection forces during ZYMV protein history. This is the first report of complete genome sequence information of the most prevalent virus in the west of Iran. This study helps our understanding of the genetic diversity of ZYMV isolates infecting cucurbit plants in Iran, virus evolution and epidemiology and can assist in designing better diagnostic tools.
Differentiation of drug and non-drug Cannabis using a single nucleotide polymorphism (SNP) assay.
Rotherham, D; Harbison, S A
2011-04-15
Cannabis sativa is both an illegal drug and a legitimate crop. The differentiation of illegal drug Cannabis from non-drug forms of Cannabis is relevant in the context of the growth of fibre and seed oil varieties of Cannabis for commercial purposes. This differentiation is currently determined based on the levels of tetrahydrocannabinol (THC) in adult plants. DNA based methods have the potential to assay Cannabis material unsuitable for analysis using conventional means including seeds, pollen and severely degraded material. The purpose of this research was to develop a single nucleotide polymorphism (SNP) assay for the differentiation of "drug" and "non-drug"Cannabis plants. An assay was developed based on four polymorphisms within a 399 bp fragment of the tetrahydrocannabinolic acid (THCA) synthase gene, utilising the snapshot multiplex kit. This SNP assay was tested on 94 Cannabis plants, which included 10 blind samples, and was able to differentiate between "drug" and "non-drug"Cannabis in all cases, while also differentiating between Cannabis and other species. Non-drug plants were found to be homozygous at the four sites assayed while drug Cannabis plants were either homozygous or heterozygous. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Arran Schlosberg
2014-05-01
Full Text Available Improvements in speed and cost of genome sequencing are resulting in increasing numbers of novel non-synonymous single nucleotide polymorphisms (nsSNPs in genes known to be associated with disease. The large number of nsSNPs makes laboratory-based classification infeasible and familial co-segregation with disease is not always possible. In-silico methods for classification or triage are thus utilised. A popular tool based on multiple-species sequence alignments (MSAs and work by Grantham, Align-GVGD, has been shown to underestimate deleterious effects, particularly as sequence numbers increase. We utilised the DEFLATE compression algorithm to account for expected variation across a number of species. With the adjusted Grantham measure we derived a means of quantitatively clustering known neutral and deleterious nsSNPs from the same gene; this was then used to assign novel variants to the most appropriate cluster as a means of binary classification. Scaling of clusters allows for inter-gene comparison of variants through a single pathogenicity score. The approach improves upon the classification accuracy of Align-GVGD while correcting for sensitivity to large MSAs. Open-source code and a web server are made available at https://github.com/aschlosberg/CompressGV.
Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila
2010-07-16
Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A
Wu, Jing; Gao, Xin-Tao; Hou, Shao-Hua; Guo, Xiao-Yu; Yang, Xue-Shong; Yuan, Wei-Feng; Xin, Ting; Zhu, Hong-Fei; Jia, Hong
2015-10-01
Fifty-five samples (15.62%) collected from dogs and cats were identified as canine parvovirus (CPV) infection in Beijing during 2010-2013. The nucleotide identities and aa similarities were 98.2-100% and 97.7-100%, respectively, when compared with the reference isolates. Also, several synonymous and non-synonymous mutations were also recorded for the first time. New CPV-2a was dominant, accounting for 90.90% of the samples. Two of the 16 samples collected from cats were identified as new CPV-2a (12.5%), showing nucleotide identities of 100% with those from dogs. Twelve samples (15.78%) collected from completely immunized dogs were found to be new CPV-2a, which means CPV-2 vaccines may not provide sufficient protection for the epidemic strains.
A large-scale study of the random variability of a coding sequence: a study on the CFTR gene.
Modiano, Guido; Bombieri, Cristina; Ciminelli, Bianca Maria; Belpinati, Francesca; Giorgi, Silvia; Georges, Marie des; Scotet, Virginie; Pompei, Fiorenza; Ciccacci, Cinzia; Guittard, Caroline; Audrézet, Marie Pierre; Begnini, Angela; Toepfer, Michael; Macek, Milan; Ferec, Claude; Claustres, Mireille; Pignatti, Pier Franco
2005-02-01
Coding single nucleotide substitutions (cSNSs) have been studied on hundreds of genes using small samples (n(g) approximately 100-150 genes). In the present investigation, a large random European population sample (average n(g) approximately 1500) was studied for a single gene, the CFTR (Cystic Fibrosis Transmembrane conductance Regulator). The nonsynonymous (NS) substitutions exhibited, in accordance with previous reports, a mean probability of being polymorphic (q > 0.005), much lower than that of the synonymous (S) substitutions, but they showed a similar rate of subpolymorphic (q < 0.005) variability. This indicates that, in autosomal genes that may have harmful recessive alleles (nonduplicated genes with important functions), genetic drift overwhelms selection in the subpolymorphic range of variability, making disadvantageous alleles behave as neutral. These results imply that the majority of the subpolymorphic nonsynonymous alleles of these genes are selectively negative or even pathogenic.
Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity
Directory of Open Access Journals (Sweden)
Tobias Fromme
2018-02-01
Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase
Liu, Dewu; Zhang, Yushan; Du, Yinjun; Yang, Guanfu; Zhang, Xiquan
2007-06-01
The growth-correlated genes that are part of the neuroendocrine growth axis play crucial roles in the regulation of growth and development of pig. The identification of genetic polymorphisms in these genes will enable the scientist to evaluate the biological relevance of such polymorphisms and to gain a better understanding of quantitative traits like growth. In the present study, seven pairs of primers were designed to obtain unknown sequences of growth-correlated genes, and other 25 pairs of primers were designed to identify single nucleotide polymorphisms (SNP) using the denaturing high-performance liquid chromatography (DHPLC) technology in four pig breeds (Duroc, Landrace, Lantang and Wuzhishan), significantly differing in growth and development characteristics. A total of 101 polymorphisms were discovered in 10,707 base pairs (bp) from six genes of the ghrelin (GHRL), leptin (LEP), insulin-like growth factor II (IGF-II), insulin-like growth factor binding protein 2 (IGFBP-2), insulin-like growth factor binding protein 3 (IGFBP-3), and somatostatin (SS). The observed average distances between the SNP in the 5'UTR, coding regions, introns and 3'UTR were 134, 521, 81 and 92 bp, respectively. Four SNPs were found in the coding regions of IGF-II, IGFBP-2 and LEP, respectively. Two synonymous mutations were obtained in IGF-II and LEP genes respectively, and two non-synonymous were found in IGFBP-2 and LEP genes, respectively. Seven other mutations were also observed. Thirty-two PCR-RFLP markers were found among 101 polymorphisms of the six genes. The SNP discovered in this study would provide suitable markers for association studies of candidate genes with growth related traits in pig.
Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu
2014-10-01
Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
The potential of avocado paste (Persea americana) as fat substitute in non-dairy ice cream
Ervina; Surjawan, I.; Abdillah, E.
2018-01-01
Consumer preferences towards plant-based food have shifted significantly due to sustainable and healthy reasons. Dairy products consist of high Saturated Fatty Acid (SFA) and overconsumption of SFA could lead to cardiovascular diseases. Avocado contains high levels of fat dominated by Monounsaturated Fatty Acid (MUFA) and phytosterol that have the potential as a plant-based fat source to substitute dairy-fat in ice cream. The objective of this study was to analyze the physicochemical, rheological and sensorial properties of ice cream substituted with different concentrations of avocado paste ranging from 0%, 25%, 50%, 75% and 100% respectively against dairy fat to produce non-dairy fat ice cream. The psychochemical properties and total fat were determined. Sensorial quality and hedonic attributes of ice cream were investigated using 60 semi-trained panelists. There were significant differences (p0.05). The addition of 50% avocado paste was the most preferred among the panelists. Avocado could provide a potential substitution for dairy-fat in ice cream.
Hoek, Annet C; Luning, Pieternel A; Stafleu, Annette; de Graaf, Cees
2004-06-01
The aim was to investigate socio-demographic characteristics, and attitudes to food and health of vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers in The Netherlands. The sample used for this study (participants > or =18 years) was taken from the Dutch National Food Consumption Survey, 1997/1998. Vegetarians (n = 63) and consumers of meat substitutes (n = 39) had similar socio-demographic profiles: higher education levels, higher social economic status, smaller households, and more urbanised residential areas, compared to meat consumers (n = 4313). Attitudes to food were assessed by the food-related lifestyle instrument. We found that vegetarians (n = 32) had more positive attitudes towards importance of product information, speciality shops, health, novelty, ecological products, social event, and social relationships than meat consumers (n = 1638). The health consciousness scale, which was used to assess attitudes to health, supported earlier findings that vegetarians are more occupied by health. Food-related lifestyle and health attitudes of meat substitute consumers (n = 17) were predominantly in-between those from vegetarians and meat consumers. The outcome of this study suggests that in strategies to promote meat substitutes for non-vegetarian consumers, the focus should not only be on health and ecological aspects of foods.
Liu, Hong-Mei; Zheng, Du-Ping; Zhang, Li-Bi; Oberste, M. Steven; Pallansch, Mark A.; Kew, Olen M.
2000-01-01
Type 1 wild-vaccine recombinant polioviruses were isolated from poliomyelitis patients in China from 1991 to 1993. We compared the sequences of 34 recombinant isolates over the 1,353-nucleotide (nt) genomic interval (nt 2480 to 3832) encoding the major capsid protein, VP1, and the protease, 2A. All recombinants had a 367-nt block of sequence (nt 3271 to 3637) derived from the Sabin 1 oral poliovirus vaccine strain spanning the 3′-terminal sequences of VP1 (115 nt) and the 5′ half of 2A (252 nt). The remaining VP1 sequences were closely (up to 99.5%) related to those of a major genotype of wild type 1 poliovirus endemic to China up to 1994. In contrast, the non-vaccine-derived sequences at the 3′ half of 2A were more distantly related (polioviruses from China. The vaccine-derived sequences of the earliest (April 1991) isolates completely matched those of Sabin 1. Later isolates diverged from the early isolates primarily by accumulation of synonymous base substitutions (at a rate of ∼3.7 × 10−2 substitutions per synonymous site per year) over the entire VP1-2A interval. Distinct evolutionary lineages were found in different Chinese provinces. From the combined epidemiologic and evolutionary analyses, we propose that the recombinant virus arose during mixed infection of a single individual in northern China in early 1991 and that its progeny spread by multiple independent chains of transmission into some of the most populous areas of China within a year of the initiating infection. PMID:11070012
Palindromic nucleotide analysis in human T cell receptor rearrangements.
Directory of Open Access Journals (Sweden)
Santosh K Srivastava
Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.
Blazier, J Chris; Ruhlman, Tracey A; Weng, Mao-Lun; Rehman, Sumaiyah K; Sabir, Jamal S M; Jansen, Robert K
2016-04-18
Genes for the plastid-encoded RNA polymerase (PEP) persist in the plastid genomes of all photosynthetic angiosperms. However, three unrelated lineages (Annonaceae, Passifloraceae and Geraniaceae) have been identified with unusually divergent open reading frames (ORFs) in the conserved region of rpoA, the gene encoding the PEP α subunit. We used sequence-based approaches to evaluate whether these genes retain function. Both gene sequences and complete plastid genome sequences were assembled and analyzed from each of the three angiosperm families. Multiple lines of evidence indicated that the rpoA sequences are likely functional despite retaining as low as 30% nucleotide sequence identity with rpoA genes from outgroups in the same angiosperm order. The ratio of non-synonymous to synonymous substitutions indicated that these genes are under purifying selection, and bioinformatic prediction of conserved domains indicated that functional domains are preserved. One of the lineages (Pelargonium, Geraniaceae) contains species with multiple rpoA-like ORFs that show evidence of ongoing inter-paralog gene conversion. The plastid genomes containing these divergent rpoA genes have experienced extensive structural rearrangement, including large expansions of the inverted repeat. We propose that illegitimate recombination, not positive selection, has driven the divergence of rpoA.
Nagpal, K.; Plantinga, T.S.; Wong, J.; Monks, B.G.; Gay, N.J.; Netea, M.G.; Fitzgerald, K.A.; Golenbock, D.
2009-01-01
The adapter protein MyD88 adapter-like (Mal), encoded by TIR-domain containing adapter protein (Tirap) (MIM 606252), is the most polymorphic of the five adapter proteins involved in Toll-like receptor signaling, harboring eight non-synonymous single nucleotide polymorphisms in its coding region. We
Hendershot, Jenna M.; Wolfe, Abigail E.; O'Brien, Patrick J.
2011-01-01
Human alkyladenine DNA glycosylase (AAG) locates and excises a wide variety of structurally diverse alkylated and oxidized purine lesions from DNA to initiate the base excision repair pathway. Recognition of a base lesion requires flipping of the damaged nucleotide into a relatively open active site pocket between two conserved tyrosine residues, Y127 and Y159. We have mutated each of these amino acids to tryptophan and measured the kinetic effects on the nucleotide flipping and base excision steps. The Y127W and Y159W mutant proteins have robust glycosylase activity toward DNA containing 1,N6-ethenoadenine (εA), within 4-fold of that of the wildtype enzyme, raising the possibility that tryptophan fluorescence could be used to probe the DNA binding and nucleotide flipping steps. Stopped-flow fluorescence was used to compare the time-dependent changes in tryptophan fluorescence and εA fluorescence. For both mutants, the tryptophan fluorescence exhibited two-step binding with essentially identical rate constants as were observed for the εA fluorescence changes. These results provide evidence that AAG forms an initial recognition complex in which the active site pocket is perturbed and the stacking of the damaged base is disrupted. Upon complete nucleotide flipping, there is further quenching of the tryptophan fluorescence with coincident quenching of the εA fluorescence. Although these mutations do not have large effects on the rate constant for excision of εA, there are dramatic effects on the rate constants for nucleotide flipping that result in 40 to 100-fold decreases in the flipping equilibrium relative to wildtype. Most of this effect is due to an increased rate of unflipping, but surprisingly the Y159W mutation causes a 5-fold increase in the rate constant for flipping. The large effect on the equilibrium for nucleotide flipping explains the greater deleterious effects that these mutations have on the glycosylase activity toward base lesions that are in
Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I
2014-06-01
Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.
Directory of Open Access Journals (Sweden)
Zhu-Qing Shao
Full Text Available BACKGROUND: In yeast coding sequences, once a particular codon has been used, subsequent occurrence of the same amino acid tends to use codons sharing the same tRNA. Such a phenomenon of co-tRNA codons pairing bias (CTCPB is also found in some other eukaryotes but it is not known whether it occurs in prokaryotes. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we focused on a total of 773 bacterial genomes to investigate their synonymous codon pairing preferences. After calculating the actual frequencies of synonymous codon pairs and comparing them with their expected values, we detected an obvious pairing bias towards identical codon pairs. This seems consistent with the previously reported CTCPB phenomenon, since identical codons are certainly read by the same tRNA. However, among co-tRNA but non-identical codon pairs, only 22 were often found overrepresented, suggesting that many co-tRNA codons actually do not preferentially pair together in prokaryotes. Therefore, the previously reported co-tRNA codons pairing rule needs to be more rigorously defined. The affinity differences between a tRNA anticodon and its readable codons should be taken into account. Moreover, both within-gene-shuffling tests and phylogenetic analyses support the idea that translational selection played an important role in shaping the observed synonymous codon pairing pattern in prokaryotes. CONCLUSIONS: Overall, a high level of synonymous codon pairing bias was detected in 73% investigated bacterial species, suggesting the synonymous codon ordering strategy has been prevalently adopted by prokaryotes to improve their translational efficiencies. The findings in this study also provide important clues to better understand the complex dynamics of translational process.
Directory of Open Access Journals (Sweden)
Liberles David A
2006-03-01
Full Text Available Abstract Background The exchange of nucleotides at synonymous sites in a gene encoding a protein is believed to have little impact on the fitness of a host organism. This should be especially true for synonymous transitions, where a pyrimidine nucleotide is replaced by another pyrimidine, or a purine is replaced by another purine. This suggests that transition redundant exchange (TREx processes at the third position of conserved two-fold codon systems might offer the best approximation for a neutral molecular clock, serving to examine, within coding regions, theories that require neutrality, determine whether transition rate constants differ within genes in a single lineage, and correlate dates of events recorded in genomes with dates in the geological and paleontological records. To date, TREx analysis of the yeast genome has recognized correlated duplications that established a new metabolic strategies in fungi, and supported analyses of functional change in aromatases in pigs. TREx dating has limitations, however. Multiple transitions at synonymous sites may cause equilibration and loss of information. Further, to be useful to correlate events in the genomic record, different genes within a genome must suffer transitions at similar rates. Results A formalism to analyze divergence at two fold redundant codon systems is presented. This formalism exploits two-state approach-to-equilibrium kinetics from chemistry. This formalism captures, in a single equation, the possibility of multiple substitutions at individual sites, avoiding any need to "correct" for these. The formalism also connects specific rate constants for transitions to specific approximations in an underlying evolutionary model, including assumptions that transition rate constants are invariant at different sites, in different genes, in different lineages, and at different times. Therefore, the formalism supports analyses that evaluate these approximations. Transitions at synonymous
Kerssens, Marleen M; Matousek, Pavel; Rogers, Keith; Stone, Nicholas
2010-12-01
A new diagnostic concept based on deep Raman spectroscopy is proposed permitting the non-invasive determination of the level of carbonate substitution in type II calcifications (HAP). The carbonate substitution has shown to be directly associated with the pathology of the surrounding breast tissue and different pathology groups can therefore be separated using specific features in the Raman spectra of the calcifications. This study explores the principle of distinguishing between type II calcifications, found in proliferating lesions, by using the strongest Raman peak from calcium hydroxyapatites (the phosphate peak at 960 cm(-1)) to act as a surrogate marker for carbonate substitution levels. It is believed that carbonate ion substitution leads to a perturbation of the hydroxyapatite lattice which in turn affects the phosphate vibrational modes. By studying calcifications, with known carbonate content, buried in porcine tissue it has been possible to evaluate the feasibility of using the proposed approach to probe the composition of the calcifications in vivo and hence provide pathology specific information non-invasively, in real time. Using the proposed concept we were able to determine the level of carbonate substitutions through soft tissue phantom samples (total thickness of 5.6 mm). As the level of carbonate substitution has been previously correlated with mid-FTIR to the lesion type, i.e. whether benign or invasive or in situ carcinoma, the new findings provide a major step forward towards establishing a new capability for diagnosing benign and malignant lesions in breast tissue in a safe and non-invasive manner in vivo.
New insights on the evolution of Leafy cotyledon1 (LEC1) type genes in vascular plants.
Cagliari, Alexandro; Turchetto-Zolet, Andreia Carina; Korbes, Ana Paula; Maraschin, Felipe Dos Santos; Margis, Rogerio; Margis-Pinheiro, Marcia
2014-01-01
NF-Y is a conserved oligomeric transcription factor found in all eukaryotes. In plants, this regulator evolved with a broad diversification of the genes coding for its three subunits (NF-YA, NF-YB and NF-YC). The NF-YB members can be divided into Leafy Cotyledon1 (LEC1) and non-LEC1 types. Here we presented a comparative genomic study using phylogenetic analyses to validate an evolutionary model for the origin of LEC-type genes in plants and their emergence from non-LEC1-type genes. We identified LEC1-type members in all vascular plant genomes, but not in amoebozoa, algae, fungi, metazoa and non-vascular plant representatives, which present exclusively non-LEC1-type genes as constituents of their NF-YB subunits. The non-synonymous to synonymous nucleotide substitution rates (Ka/Ks) between LEC1 and non-LEC1-type genes indicate the presence of positive selection acting on LEC1-type members to the fixation of LEC1-specific amino acid residues. The phylogenetic analyses demonstrated that plant LEC1-type genes are evolutionary divergent from the non-LEC1-type genes of plants, fungi, amoebozoa, algae and animals. Our results point to a scenario in which LEC1-type genes have originated in vascular plants after gene expansion in plants. We suggest that processes of neofunctionalization and/or subfunctionalization were responsible for the emergence of a versatile role for LEC1-type genes in vascular plants, especially in seed plants. LEC1-type genes besides being phylogenetic divergent also present different expression profile when compared with non-LEC1-type genes. Altogether, our data provide new insights about the LEC1 and non-LEC1 evolutionary relationship during the vascular plant evolution. Copyright © 2014 Elsevier Inc. All rights reserved.
Aissa, Nejla; Mayer, Noémie; Bert, Fréderic; Labia, Roger; Lozniewski, Alain; Nicolas-Chanoine, Marie-Hélène
2016-01-01
So far, two types of mechanism are known to be involved in carbapenem non-susceptibility of Escherichia coli clinical isolates: reduced outer membrane permeability associated with production of ESBLs and/or overproduction of class C β-lactamases; and production of carbapenemases. Non-susceptibility to only imipenem observed in two clinical isolates suggested a new mechanism, described in the present study. The ST was determined for the two isolates of E. coli (strains LSNy and VSBj), and their chromosomal region encoding the penicillin-binding domain of PBP2 was amplified, sequenced and then used for recombination experiments in E. coli K12 C600. Antibiotic MICs were determined using the Etest method. Strains LSNy and VSBj, which displayed ST23 and ST345, respectively, showed amino acid substitutions in their PBP2 penicillin-binding domain. Substitution Ala388Ser located in motif 2 (SXD) was common to the two strains. Two additional substitutions (Ala488Thr and Leu573Val) located outside the two other motifs were identified in strain LSNy, whereas another one (Thr331Pro) located in motif 1 was identified in strain VSBj. Recombination experiments to reproduce non-susceptibility to imipenem in E. coli K12 C600 were not successful when only the common substitution was transferred, whereas recombination with DNA fragments including either the three substitutions (strain LSNy) or the two substitutions (strain VSBj) were successful. Substitution of amino acids in the penicillin-binding domain of PBP2 is a new mechanism by which E. coli clinical isolates specifically resist imipenem. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Bouwman, Aniek C.; Hayes, Ben J.; Calus, Mario P.L.
2017-01-01
Background: Genomic evaluation is used to predict direct genomic values (DGV) for selection candidates in breeding programs, but also to estimate allele substitution effects (ASE) of single nucleotide polymorphisms (SNPs). Scaling of allele counts influences the estimated ASE, because scaling of
Kellner, Stefanie; Kollar, Laura Bettina; Ochel, Antonia; Ghate, Manjunath; Helm, Mark
2013-01-01
Selective alkylation of RNA nucleotides is an important field of RNA biochemistry, e.g. in applications of fluorescent labeling or in structural probing experiments, yet detailed structure-function studies of labeling agents are rare. Here, bromomethylcoumarins as reactive compounds for fluorescent labeling of RNA are developed as an attractive scaffold on which electronic properties can be modulated by varying the substituents. Six different 4-bromomethyl-coumarins of various substitution patterns were tested for nucleotide specificity of RNA alkylation using tRNA from Escherichia coli as substrate. Using semi-quantitative LC-MS/MS analysis, reactions at mildly acidic and slightly alkaline pH were compared. For all tested compounds, coumarin conjugates with 4-thiouridine, pseudouridine, guanosine, and uridine were identified, with the latter largely dominating. This data set shows that selectivity of ribonucleotide alkylation depends on the substitution pattern of the reactive dye, and even more strongly on the modulation of the reaction conditions. The latter should be therefore carefully optimized when striving to achieve selectivity. Interestingly, the highest selectivity for labeling of a modified nucleoside, namely of 4-thiouridine, was achieved with a compound whose selectivity was somewhat less dependent on reaction conditions than the other compounds. In summary, bromomethylcoumarin derivatives are a highly interesting class of compounds, since their selectivity for 4-thiouridine can be efficiently tuned by variation of substitution pattern and reaction conditions.
Li, M-H; Tiirikka, T; Kantanen, J
2013-01-01
In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three kno...
Stabilization of Angiotensin-(1-7) by key substitution with a cyclic non-natural amino acid.
Wester, Anita; Devocelle, Marc; Tallant, E Ann; Chappell, Mark C; Gallagher, Patricia E; Paradisi, Francesca
2017-10-01
Angiotensin-(1-7) [Ang-(1-7)], a heptapeptide hormone of the renin-angiotensin-aldosterone system, is a promising candidate as a treatment for cancer that reflects its anti-proliferative and anti-angiogenic properties. However, the peptide's therapeutic potential is limited by the short half-life and low bioavailability resulting from rapid enzymatic metabolism by peptidases including angiotensin-converting enzyme (ACE) and dipeptidyl peptidase 3 (DPP 3). We report the facile assembly of three novel Ang-(1-7) analogues by solid-phase peptide synthesis which incorporates the cyclic non-natural δ-amino acid ACCA. The analogues containing the ACCA substitution at the site of ACE cleavage exhibit complete resistance to human ACE, while substitution at the DDP 3 cleavage site provided stability against DPP 3 hydrolysis. Furthermore, the analogues retain the anti-proliferative properties of Ang-(1-7) against the 4T1 and HT-1080 cancer cell lines. These results suggest that ACCA-substituted Ang-(1-7) analogues which show resistance against proteolytic degradation by peptidases known to hydrolyze the native heptapeptide may be novel therapeutics in the treatment of cancer.
Wei, Zehong; Yi, Lina; Xu, Wei; Zhou, Huihui; Zhang, Yanjiao; Zhang, Wenbing; Mai, Kangsen
2015-11-01
A 9-week feeding trial was conducted to investigate the effects of dietary nucleotides (NT) on growth, immune response and disease resistance of sea cucumber Apostichopus japonicas (initial weight: 5.87 ± 0.03 g). Four graded levels of dietary NT were designed as 0, 150, 375 and 700 mg/kg, respectively. After the feeding trial, sea cucumbers were challenged with Vibrio splendidus for the determination of disease resistance. The results showed that the specific growth rates were significantly higher in sea cucumber fed the diet with 375 mg/kg NT than those fed the basal diet without NT supplementation (P sea cucumber fed diets with nucleotides (≥ 375 mg/kg) had significantly higher phagocytic activities in coelomic fluid (P 0.05). After being challenged with V. splendidus, the cumulative mortalities of sea cucumber fed diets with 150 and 375 mg/kg NT were significantly lower than that in the treatment without dietary nucleotide supplementation (P sea cucumber in vivo. In conclusion, it was showed that dietary NT does increase the growth performance, non-specific immunity and disease resistance of sea cucumber. The optimum dietary NT supplementation level for sea cucumber was found to be 375 mg/kg. The application of dietary NT may present a novel strategy for health management in sea cucumber's aquaculture. Copyright © 2015 Elsevier Ltd. All rights reserved.
Elixir, Alchemy and the Metamorphoses of Two Synonyms
Directory of Open Access Journals (Sweden)
Gotthard Strohmaier
2017-03-01
Full Text Available The history of the terms ‘elixir’ and ‘alchemy’ seems paradoxical; derived from Greek, the Arabic al-iksīr signified a dry powder capable of transforming base metals into gold or silver. Evolving through the European languages, elixir has come to mean a magic liquid that can be ingested to cure illness. The second term, al-kīmiyāʼ, which was in its Arabic beginnings almost synonymous with elixir, took a different turn and changed its meaning from a miraculous substance into an abstract noun connoting the art of alchemy. This article intends to show that these changes of meaning are linked to inevitable interrelations between the two synonyms and, consequently, the generally assumed etymology of the Arabic alkīmiyāʼ from the seemingly corresponding Greek expression χυμεία must be questioned. Of particular interest is the hitherto overlooked fact that al-kīmiyāʼ ends in a glottal stop, indicated by the hamza and being a consonant in its own right, which ultimately points to a non-Greek origin.
The possible role of human milk nucleotides as sleep inducers.
Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen
2009-02-01
Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.
Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V
2015-03-04
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.
Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka
2014-01-01
Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Basicity comparison for di-substituted 4-nitropyridine derivatives in polar non-aqueous media
International Nuclear Information System (INIS)
Gurzynski, Lukasz; Puszko, Aniela; Chmurzynski, Lech
2007-01-01
Acid dissociation, as well as cationic homoconjugation equilibria have been studied potentiometrically in systems involving four di-substituted 4-nitropyridines and conjugate cationic acids in the polar non-aqueous solvents - aprotic protophobic acetonitrile (AN) and propylene carbonate (PC), the amphiprotic methanol (MeOH), and in the aprotic protophilic dimethyl sulfoxide (DMSO). The influence of solvent effect on the obtained acidity constants has been discussed. The acidity constants (expressed as pK a values) were compared with those previously determined in another polar protophobic aprotic solvent - acetone (AC), and obtained for the unsubstituted pyridine (Py). A comparison of the acid dissociation constants determined in all media studied has proved that the strength of the cationic acids increases on going from acetonitrile through propylene carbonate, acetone, and methanol to dimethyl sulfoxide. Furthermore, the values of acidity constants in the non-aqueous media have shown that in all the solvents studied they change according to the substituent effects. It has been also found that substituted 4-nitropyridine derivatives studied exhibit no tendency towards cationic homoconjugation in acetonitrile, propylene carbonate, and methanol and dimethyl sulfoxide. Moreover, it has been demonstrated that the acid dissociation constants determined by potentiometric titration method in all the solutions investigated correlate well with the calculated energy parameters of the protonation reactions in the gaseous phase
Basicity comparison for di-substituted 4-nitropyridine derivatives in polar non-aqueous media
Energy Technology Data Exchange (ETDEWEB)
Gurzynski, Lukasz [Department of General and Inorganic Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland); Puszko, Aniela [Department of Organic Chemistry, School of Economics, Wroclaw (Poland); Chmurzynski, Lech [Department of General and Inorganic Chemistry, University of Gdansk, Sobieskiego 18, 80-952 Gdansk (Poland)], E-mail: lech@chemik.chem.univ.gda.pl
2007-12-15
Acid dissociation, as well as cationic homoconjugation equilibria have been studied potentiometrically in systems involving four di-substituted 4-nitropyridines and conjugate cationic acids in the polar non-aqueous solvents - aprotic protophobic acetonitrile (AN) and propylene carbonate (PC), the amphiprotic methanol (MeOH), and in the aprotic protophilic dimethyl sulfoxide (DMSO). The influence of solvent effect on the obtained acidity constants has been discussed. The acidity constants (expressed as pK{sub a} values) were compared with those previously determined in another polar protophobic aprotic solvent - acetone (AC), and obtained for the unsubstituted pyridine (Py). A comparison of the acid dissociation constants determined in all media studied has proved that the strength of the cationic acids increases on going from acetonitrile through propylene carbonate, acetone, and methanol to dimethyl sulfoxide. Furthermore, the values of acidity constants in the non-aqueous media have shown that in all the solvents studied they change according to the substituent effects. It has been also found that substituted 4-nitropyridine derivatives studied exhibit no tendency towards cationic homoconjugation in acetonitrile, propylene carbonate, and methanol and dimethyl sulfoxide. Moreover, it has been demonstrated that the acid dissociation constants determined by potentiometric titration method in all the solutions investigated correlate well with the calculated energy parameters of the protonation reactions in the gaseous phase.
Directory of Open Access Journals (Sweden)
Rouvay Roodt-Wilding
2013-09-01
Full Text Available Haliotis midae is one of the most valuable commercial abalone species in the world, but is highly vulnerable, due to exploitation, habitat destruction and predation. In order to preserve wild and cultured stocks, genetic management and improvement of the species has become crucial. Fundamental to this is the availability and employment of molecular markers, such as microsatellites and Single Nucleotide Polymorphisms (SNPs . Transcriptome sequences generated through sequencing-by-synthesis technology were utilized for the in vitro and in silico identification of 505 putative SNPs from a total of 316 selected contigs. A subset of 234 SNPs were further validated and characterized in wild and cultured abalone using two Illumina GoldenGate genotyping assays. Combined with VeraCode technology, this genotyping platform yielded a 65%−69% conversion rate (percentage polymorphic markers with a global genotyping success rate of 76%−85% and provided a viable means for validating SNP markers in a non-model species. The utility of 31 of the validated SNPs in population structure analysis was confirmed, while a large number of SNPs (174 were shown to be informative and are, thus, good candidates for linkage map construction. The non-synonymous SNPs (50 located in coding regions of genes that showed similarities with known proteins will also be useful for genetic applications, such as the marker-assisted selection of genes of relevance to abalone aquaculture.
Bester-Van Der Merwe, Aletta; Blaauw, Sonja; Du Plessis, Jana; Roodt-Wilding, Rouvay
2013-09-23
Haliotis midae is one of the most valuable commercial abalone species in the world, but is highly vulnerable, due to exploitation, habitat destruction and predation. In order to preserve wild and cultured stocks, genetic management and improvement of the species has become crucial. Fundamental to this is the availability and employment of molecular markers, such as microsatellites and single nucleotide (SNPs). Transcriptome sequences generated through sequencing-by-synthesis technology were utilized for the in vitro and in silico identification of 505 putative SNPs from a total of 316 selected contigs. A subset of 234 SNPs were further validated and characterized in wild and cultured abalone using two Illumina GoldenGate genotyping assays. Combined with VeraCode technology, this genotyping platform yielded a 65%-69% conversion rate (percentage polymorphic markers) with a global genotyping success rate of 76%-85% and provided a viable means for validating SNP markers in a non-model species. The utility of 31 of the validated SNPs in population structure analysis was confirmed, while a large number of SNPs (174) were shown to be informative and are, thus, good candidates for linkage map construction. The non-synonymous SNPs (50) located in coding regions of genes that showed similarities with known proteins will also be useful for genetic applications, such as the marker-assisted selection of genes of relevance to abalone aquaculture.
The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway
International Nuclear Information System (INIS)
Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori
1977-01-01
In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)
Källman, Thomas; De Mita, Stéphane; Larsson, Hanna; Gyllenstrand, Niclas; Heuertz, Myriam; Parducci, Laura; Suyama, Yoshihisa; Lagercrantz, Ulf; Lascoux, Martin
2014-01-01
The ability of plants to track seasonal changes is largely dependent on genes assigned to the photoperiod pathway, and variation in those genes is thereby important for adaptation to local day length conditions. Extensive physiological data in several temperate conifer species suggest that populations are adapted to local light conditions, but data on the genes underlying this adaptation are more limited. Here we present nucleotide diversity data from 19 genes putatively involved in photoperiodic response in Norway spruce (Picea abies). Based on similarity to model plants the genes were grouped into three categories according to their presumed position in the photoperiod pathway: photoreceptors, circadian clock genes, and downstream targets. An HKA (Hudson, Kreitman and Aquade) test showed a significant excess of diversity at photoreceptor genes, but no departure from neutrality at circadian genes and downstream targets. Departures from neutrality were also tested with Tajima's D and Fay and Wu's H statistics under three demographic scenarios: the standard neutral model, a population expansion model, and a more complex population split model. Only one gene, the circadian clock gene PaPRR3 with a highly positive Tajima's D value, deviates significantly from all tested demographic scenarios. As the PaPRR3 gene harbours multiple non-synonymous variants it appears as an excellent candidate gene for control of photoperiod response in Norway spruce.
Directory of Open Access Journals (Sweden)
Petrović Sandra
2015-01-01
Full Text Available Fanconi anemia (FA is a rare genetically heterogeneous disorder associated with bone marrow failure, birth defects and cancer susceptibility. Apart from the disease- causing mutations in FANC genes, the identification of specific DNA variations, such as single nucleotide polymorphisms (SNPs, in other candidate genes may lead to a better clinical description of this condition enabling individualized treatment with improvement of the prognosis. In this study, we have assessed 95 SNPs located in 52 key genes involved in base excision repair (BER, nucleotide excision repair (NER, mismatch repair (MMR, double strand break (DSB repair and cell cycle control using a DNA repair chip (Asper Biotech, Estonia which includes most of the common variants for the candidate genes. The SNP genotyping was performed in five FA-D2 patients and in one FA-A patient. The polymorphisms studied were synonymous (n=10, nonsynonymous (missense (n=52 and in non-coding regions of the genome (introns and 5 ‘and 3’ untranslated regions (UTR (n=33. Polymorphisms found at the homozygous state are selected for further analysis. Our results have shown a significant inter-individual variability among patients in the type and the frequency of SNPs and also elucidate the need for further studies of polymorphisms located in ATM, APEX APE 1, XRCC1, ERCC2, MSH3, PARP4, NBS1, BARD1, CDKN1B, TP53 and TP53BP1 which may be of great importance for better clinical description of FA. In addition, the present report recommends the use of SNPs as predictive and prognostic genetic markers to individualize therapy of FA patients. [Projekat Ministarstva nauke Republike Srbije, br. 173046
DEFF Research Database (Denmark)
Wesselius, Anke; Bours, Martijn J L; Henriksen, Zanne
2013-01-01
The P2Y(2) receptor is a G-protein-coupled receptor with adenosine 5'-triphosphate (and UTP) as natural ligands. It is thought to be involved in bone physiology in an anti-osteogenic manner. As several non-synonymous single nucleotide polymorphisms (SNPs) have been identified within the P2Y(2) re...
Directory of Open Access Journals (Sweden)
Tapani Hovi
Full Text Available Partial sequences of 110 type 2 poliovirus strains isolated from sewage in Slovakia in 2003-2005, and most probably originating from a single dose of oral poliovirus vaccine, were subjected to a detailed genetic analysis. Evolutionary patterns of these vaccine derived poliovirus strains (SVK-aVDPV2 were compared to those of type 1 and type 3 wild poliovirus (WPV lineages considered to have a single seed strain origin, respectively. The 102 unique SVK-aVDPV VP1 sequences were monophyletic differing from that of the most likely parental poliovirus type 2/Sabin (PV2 Sabin by 12.5-15.6%. Judging from this difference and from the rate of accumulation of synonymous transversions during the 22 month observation period, the relevant oral poliovirus vaccine dose had been administered to an unknown recipient more than 12 years earlier. The patterns of nucleotide substitution during the observation period differed from those found in the studied lineages of WPV1 or 3, including a lower transition/transversion (Ts/Tv bias and strikingly lower Ts/Tv rate ratios at the 2(nd codon position for both purines and pyrimidines. A relatively low preference of transitions at the 2(nd codon position was also found in the large set of VP1 sequences of Nigerian circulating (cVDPV2, as well as in the smaller sets from the Hispaniola cVDPV1 and Egypt cVDPV2 outbreaks, and among aVDPV1and aVDPV2 strains recently isolated from sewage in Finland. Codon-wise analysis of synonymous versus non-synonymous substitution rates in the VP1 sequences suggested that in five codons, those coding for amino acids at sites 24, 144, 147, 221 and 222, there may have been positive selection during the observation period. We conclude that pattern of poliovirus VP1 evolution in prolonged infection may differ from that found in WPV epidemics. Further studies on sufficiently large independent datasets are needed to confirm this suggestion and to reveal its potential significance.
Energy Technology Data Exchange (ETDEWEB)
Liu, Hongmei, E-mail: hmliu@gig.ac.cn [CAS Key Laboratory of Mineralogy and Metallogeny/Guangdong Provincial Key Laboratory of Mineral Physics and Materials, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, Guangzhou, 510640 (China); Wei, Gaoling [Guangdong Key Laboratory of Agricultural Environment Pollution Integrated Control, Guangdong Institute of Eco-Environmental and Soil Sciences, Guangzhou, 510650 (China); Xu, Zhen [School of Materials Science and Engineering, Central South University, Changsha, 410012 (China); Liu, Peng; Li, Ying [CAS Key Laboratory of Mineralogy and Metallogeny/Guangdong Provincial Key Laboratory of Mineral Physics and Materials, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, Guangzhou, 510640 (China); University of Chinese Academy of Sciences, Beijing, 100049 (China)
2016-12-15
Highlights: • XPS and Auger peak overlapping complicates Co-substituted magnetite quantification. • Disrurbance of Auger peaks was eliminated by non-linear least squares fitting. • Fitting greatly improved the accuracy of quantification for Co and Fe. • Catalytic activity of magnetite was enhanced with the increase of Co substitution. - Abstract: Quantitative analysis of Co and Fe using X-ray photoelectron spectroscopy (XPS) is of important for the evaluation of the catalytic ability of Co-substituted magnetite. However, the overlap of XPS peaks and Auger peaks for Co and Fe complicate quantification. In this study, non-linear least squares fitting (NLLSF) was used to calculate the relative Co and Fe contents of a series of synthesized Co-substituted magnetite samples with different Co doping levels. NLLSF separated the XPS peaks of Co 2p and Fe 2p from the Auger peaks of Fe and Co, respectively. Compared with a control group without fitting, the accuracy of quantification of Co and Fe was greatly improved after elimination by NLLSF of the disturbance of Auger peaks. A catalysis study confirmed that the catalytic activity of magnetite was enhanced with the increase of Co substitution. This study confirms the effectiveness and accuracy of the NLLSF method in XPS quantitative calculation of Fe and Co coexisting in a material.
Directory of Open Access Journals (Sweden)
Höltershinken Martin
2007-02-01
Full Text Available Abstract Background Isolated syndactyly in cattle, also known as mulefoot, is inherited as an autosomal recessive trait with variable penetrance in different cattle breeds. Recently, two independent mutations in the bovine LRP4 gene have been reported as the primary cause of syndactyly in the Holstein and Angus cattle breeds. Results We confirmed the previously described LRP4 exon 33 two nucleotide substitution in most of the affected Holstein calves and revealed additional evidence for allelic heterogeneity by the identification of four new LRP4 non-synonymous point mutations co-segregating in Holstein, German Simmental and Simmental-Charolais families. Conclusion We confirmed a significant role of LRP4 mutations in the pathogenesis of congenital syndactyly in cattle. The newly detected missense mutations in the LRP4 gene represent independent mutations affecting different conserved protein domains. However, the four newly described LRP4 mutations do still not explain all analyzed cases of syndactyly.
Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu
2013-01-01
A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.
CodonShuffle: a tool for generating and analyzing synonymously mutated sequences
Jorge, Daniel Macedo de Melo; Mills, Ryan E.; Lauring, Adam S.
2015-01-01
Because synonymous mutations do not change the amino acid sequence of a protein, they are generally considered to be selectively neutral. Empiric data suggest, however, that a significant fraction of viral mutational fitness effects may be attributable to synonymous mutation. Bias in synonymous codon usage in viruses may result from selection for translational efficiency, mutational bias, base pairing requirements in RNA structures, or even selection against specific dinucleotides by innate i...
Directory of Open Access Journals (Sweden)
L.G. Mamonova
2007-01-01
Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.
[Delegation yes, substitution no!].
Schroeder, A
2014-08-01
The aging of society leads on the one hand to increasing case numbers and on the other hand to a reduction in the number of physicians available for patient treatment. The delegation and substitution of medical duties as a tried and tested method is increasingly being recommended in order to compensate for the lack of physicians. The Berufsverband der Deutschen Urologen (BDU, Professional Association of German Urologists) supports the guiding principle of the Bundesärztekammer (Federal Medical Council) of "delegation yes, substitution no" and rejects a substitution of medical duties by non-medical academic health personnel. Against the background of the demographic changes, the increasing need for treatment and the current deficiency of junior physicians, a more extensive inclusion of well-qualified and experienced non-medical personnel by the delegation of medically responsible duties (medical scope of practice) can be an appropriate measure to maintain a good medical service in practices, hospitals and nursing homes.
DEFF Research Database (Denmark)
Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens
2011-01-01
Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...
Analysis of EFL Students' Ability in Reading Vocabulary of Synonyms and Antonyms
Directory of Open Access Journals (Sweden)
Vina Fathira
2017-02-01
Full Text Available Reading is an important thing for academic level. Every student must have many vocabularies to encourage her/his reading skill. The aim of this research is to analyze the students' understanding of reading vocabularies of synonyms and antonyms in the higher education level. Synonyms and antonyms are two important things should be mastered to get better reading comprehension. The method used in this research was quantitative with survey design. The population same as the sample of this research was from fifth semester students of STIBA Persada Bunda Pekanbaru. The procedures of the research were divided into 3 parts. First, students were asked to choose the best choice in the multiple choice for synonyms and anton, number and the wrong number, and grouped the wrong number into difficulties level. Last, the researcher analyzed the students' ability in reading vocabulary of synonyms and antonyms and concluded the result of students' ability in reading vocabulary of synonyms and antonyms in elementary, intermediate, and advanced level. The result of this research showed that the students' ability in reading vocabulary of synonyms and antonyms was categorized into "excellent" level with mean score 85. From the three difficulties level of question, the findings of this research were explained every level of question. In synonyms, the mean score of students' ability were 89, 85, and 84 for elementary, intermediate, and advanced level of question. Whereas, in antonyms, the mean score of students' ability were 97, 85, and 69 for elementary, intermediate, and advanced level of question.Keywords: students' ability, reading vocabulary, synonyms and antonyms
McClure, Matthew C; Bickhart, Derek; Null, Dan; Vanraden, Paul; Xu, Lingyang; Wiggans, George; Liu, George; Schroeder, Steve; Glasscock, Jarret; Armstrong, Jon; Cole, John B; Van Tassell, Curtis P; Sonstegard, Tad S
2014-01-01
The recent discovery of bovine haplotypes with negative effects on fertility in the Brown Swiss, Holstein, and Jersey breeds has allowed producers to identify carrier animals using commercial single nucleotide polymorphism (SNP) genotyping assays. This study was devised to identify the causative mutations underlying defective bovine embryo development contained within three of these haplotypes (Brown Swiss haplotype 1 and Holstein haplotypes 2 and 3) by combining exome capture with next generation sequencing. Of the 68,476,640 sequence variations (SV) identified, only 1,311 genome-wide SNP were concordant with the haplotype status of 21 sequenced carriers. Validation genotyping of 36 candidate SNP identified only 1 variant that was concordant to Holstein haplotype 3 (HH3), while no variants located within the refined intervals for HH2 or BH1 were concordant. The variant strictly associated with HH3 is a non-synonymous SNP (T/C) within exon 24 of the Structural Maintenance of Chromosomes 2 (SMC2) on Chromosome 8 at position 95,410,507 (UMD3.1). This polymorphism changes amino acid 1135 from phenylalanine to serine and causes a non-neutral, non-tolerated, and evolutionarily unlikely substitution within the NTPase domain of the encoded protein. Because only exome capture sequencing was used, we could not rule out the possibility that the true causative mutation for HH3 might lie in a non-exonic genomic location. Given the essential role of SMC2 in DNA repair, chromosome condensation and segregation during cell division, our findings strongly support the non-synonymous SNP (T/C) in SMC2 as the likely causative mutation. The absence of concordant variations for HH2 or BH1 suggests either the underlying causative mutations lie within a non-exomic region or in exome regions not covered by the capture array.
Directory of Open Access Journals (Sweden)
Matthew C McClure
Full Text Available The recent discovery of bovine haplotypes with negative effects on fertility in the Brown Swiss, Holstein, and Jersey breeds has allowed producers to identify carrier animals using commercial single nucleotide polymorphism (SNP genotyping assays. This study was devised to identify the causative mutations underlying defective bovine embryo development contained within three of these haplotypes (Brown Swiss haplotype 1 and Holstein haplotypes 2 and 3 by combining exome capture with next generation sequencing. Of the 68,476,640 sequence variations (SV identified, only 1,311 genome-wide SNP were concordant with the haplotype status of 21 sequenced carriers. Validation genotyping of 36 candidate SNP identified only 1 variant that was concordant to Holstein haplotype 3 (HH3, while no variants located within the refined intervals for HH2 or BH1 were concordant. The variant strictly associated with HH3 is a non-synonymous SNP (T/C within exon 24 of the Structural Maintenance of Chromosomes 2 (SMC2 on Chromosome 8 at position 95,410,507 (UMD3.1. This polymorphism changes amino acid 1135 from phenylalanine to serine and causes a non-neutral, non-tolerated, and evolutionarily unlikely substitution within the NTPase domain of the encoded protein. Because only exome capture sequencing was used, we could not rule out the possibility that the true causative mutation for HH3 might lie in a non-exonic genomic location. Given the essential role of SMC2 in DNA repair, chromosome condensation and segregation during cell division, our findings strongly support the non-synonymous SNP (T/C in SMC2 as the likely causative mutation. The absence of concordant variations for HH2 or BH1 suggests either the underlying causative mutations lie within a non-exomic region or in exome regions not covered by the capture array.
Transcriptome Characterization and Functional Marker Development in Sorghum Sudanense.
Directory of Open Access Journals (Sweden)
Jieqin Li
Full Text Available Sudangrass, Sorghum sudanense, is an important forage in warm regions. But little is known about its genome. In this study, the transcriptomes of sudangrass S722 and sorghum Tx623B were sequenced by Illumina sequencing. More than 4Gb bases were sequenced for each library. For Tx623B and S722, 88.79% and 83.88% reads, respectively were matched to the Sorghum bicolor genome. A total of 2,397 differentially expressed genes (DEGs were detected by RNA-Seq between the two libraries, including 849 up-regulated genes and 1,548 down-regulated genes. These DEGs could be divided into three groups by annotation analysis. A total of 44,495 single nucleotide polymorphisms (SNPs were discovered by aligning S722 reads to the sorghum reference genome. Of these SNPs, 61.37% were transition, and this value did not differ much between different chromosomes. In addition, 16,928 insertion and deletion (indel loci were identified between the two genomes. A total of 5,344 indel markers were designed, 15 of which were selected to construct the genetic map derived from the cross of Tx623A and Sa. It was indicated that the indel markers were useful and versatile between sorghum and sudangrass. Comparison of synonymous base substitutions (Ks and non-synonymous base substitutions (Ka between the two libraries showed that 95% orthologous pairs exhibited Ka/Ks<1.0, indicating that these genes were influenced by purifying selection. The results from this study provide important information for molecular genetic research and a rich resource for marker development in sudangrass and other Sorghum species.
Characteristics of forming of synonymic rows within lexical phraseological field
Directory of Open Access Journals (Sweden)
Мария Валерьевна Волнакова
2011-03-01
Full Text Available The article deals with the characteristics of forming of phraseological synonymic rows with a lexical identifier as a dominant of a row. Revealed synonymic rows mirror the deepness of systematic language relationships between lexis and phraseology.
Kemmochi, Yukio; Tsutsumi, Kaori; Arikawa, Akihiro; Nakazawa, Hiroyuki
2002-11-22
2,3,7,8-Substituted polychlorinated dibenzo-p-dioxins/polychlorinated dibenzofurans (PCDD/Fs) and non-ortho-substituted polychlorinated biphenyls (PCBs) account for almost all of the total toxic equivalents (TEQ) in environmental samples. Activated carbon columns are used to fractionate the samples for GC-MS analysis or bioassay. Micropore-free surface-activated carbon is highly selective for PCDD/Fs and non-ortho-PCBs and can improve the conventional activated carbon column clean-up. Along with sulfuric acid-coated diatomaceous earth columns, micropore-free surface-activated carbon provides a rapid, robust, and high-throughput sample preparation method for PCDD/Fs and non-ortho-PCBs analysis.
Weidensee, Sabine; Goettig, Peter; Bertone, Marko; Haas, Dorothea; Magdolen, Viktor; Kiechle, Marion; Meindl, Alfons; van Kuilenburg, André B. P.; Gross, Eva
2011-01-01
Evaluation of a non-synonymous mutation associated with dihydropyrimidine dehydrogenase (DPD) deficiency. DPD enzyme analysis, mutation analysis and molecular dynamics simulations based on the 3D-model of DPD. The substitution Lys63Glu is likely to affect the FAD binding pocket within the DPD
Surbanovski, Nada; Tobutt, Kenneth R; Konstantinović, Miroslav; Maksimović, Vesna; Sargent, Daniel J; Stevanović, Vladimir; Bosković, Radovan I
2007-05-01
Many species of Prunus display an S-RNase-based gametophytic self-incompatibility (SI), controlled by a single highly polymorphic multigene complex termed the S-locus. This comprises tightly linked stylar- and pollen-expressed genes that determine the specificity of the SI response. We investigated SI of Prunus tenella, a wild species found in small, isolated populations on the Balkan peninsula, initially by pollination experiments and identifying stylar-expressed RNase alleles. Nine P. tenella S-RNase alleles (S(1)-S(9)) were cloned; their sequence analysis showed a very high ratio of non-synonymous to synonymous nucleotide substitutions (K(a)/K(s)) and revealed that S-RNase alleles of P. tenella, unlike those of Prunus dulcis, show positive selection in all regions except the conserved regions and that between C2 and RHV. Remarkably, S(8)-RNase, was found to be identical to S(1)-RNase from Prunus avium, a species that does not interbreed with P. tenella and, except for just one amino acid, to S(11) of P. dulcis. However, the corresponding introns and S-RNase-SFB intergenic regions showed considerable differences. Moreover, protein sequences of the pollen-expressed SFB alleles were not identical, harbouring 12 amino-acid replacements between those of P. tenella SFB(8) and P. avium SFB(1). Implications of this finding for hypotheses about the evolution of new S-specificities are discussed.
Hoek, A.C.; Luning, P.A.; Stafleu, A.; Graaf, C. de
2004-01-01
The aim was to investigate socio-demographic characteristics, and attitudes to food and health of vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers in the Netherlands. The sample used for this study (participants ≥18 years) was taken from the Dutch National Food
Hoek, A.C.; Luning, P.A.; Stafleu, A.; Graaf, de C.
2004-01-01
The aim was to investigate socio-demographic characteristics, and attitudes to food and health of vegetarians, non-vegetarian consumers of meat substitutes, and meat consumers in The Netherlands. The sample used for this study (participants > or =18 years) was taken from the Dutch National Food
Vongvanrungruang, A; Mongkolsiriwatana, C; Boonkaew, T; Sawatdichaikul, O; Srikulnath, K; Peyachoknagul, S
2016-09-19
The fragrance gene, betaine aldehyde dehydrogenase 2 (Badh2), has been well studied in many plant species. The objectives of this study were to clone Badh2 and compare the sequences between aromatic and non-aromatic coconuts. The complete coding region was cloned from cDNA of both aromatic and non-aromatic coconuts. The nucleotide sequences were highly homologous to Badh2 genes of other plants. Badh2 consisted of a 1512-bp open reading frame encoding 503 amino acids. A single nucleotide difference between aromatic and non-aromatic coconuts resulted in the conversion of alanine (non-aromatic) to proline (aromatic) at position 442, which was the substrate binding site of BADH2. The ring side chain of proline could destabilize the structure leading to a non-functional enzyme. Badh2 genomic DNA was cloned from exon 1 to 4, and from exon 5 to 15 from the two coconut types, except for intron 4 that was very long. The intron sequences of the two coconut groups were highly homologous. No differences in Badh2 expression were found among the tissues of aromatic coconut or between aromatic and non-aromatic coconuts. The amino acid sequences of BADH2 from coconut and other plants were compared and the genetic relationship was analyzed using MEGA 7.0. The phylogenetic tree reconstructed by the Bayesian information criterion consisted of two distinct groups of monocots and dicots. Among the monocots, coconut (Cocos nucifera) and oil palm (Elaeis guineensis) were the most closely related species. A marker for coconut differentiation was developed from one-base substitution site and could be successfully used.
Directory of Open Access Journals (Sweden)
Keijiro Mizukami
2013-01-01
Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.
Nucleotide sequence of tomato ringspot virus RNA-2.
Rott, M E; Tremaine, J H; Rochon, D M
1991-07-01
The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.
Directory of Open Access Journals (Sweden)
Olha Hurba
Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.
Directory of Open Access Journals (Sweden)
Xiao-Yan Zhang
2018-04-01
Full Text Available ORF3a, a newly identified non-AUG-initiated ORF encoded by members of genera Polerovirus and Luteovirus, is required for long-distance movement in plants. However, the mechanism of action of P3a in viral systemic movement is still not clear. In this study, sequencing of a brassica yellows virus (BrYV mutant defective in systemic infection revealed two-nucleotide variation at positions 3406 and 3467 in the genome. Subsequent nucleotide substitution analysis proved that only the non-synonymous substitution (C→U at position 3406, resulting in P3aP18L, abolished the systemic infection of BrYV. Preliminary investigation showed that wild type BrYV was able to load into the petiole of the agroinfiltrated Nicotiana benthamiana leaves, whereas the mutant displayed very low efficiency. Further experiments revealed that the P3a and its mutant P3aP18L localized to the Golgi apparatus and near plasmodesmata, as well as the endoplasmic reticulum. Both P3a and P3aP18L were able to self-interact in vivo, however, the mutant P3aP18L seemed to form more stable dimer than wild type. More interestingly, we confirmed firstly that the ectopic expression of P3a of other poleroviruses and luteoviruses, as well as co-infection with Pea enation mosaic virus 2 (PEMV 2, restored the ability of systemic movement of BrYV P3a defective mutant, indicating that the P3a is functionally conserved in poleroviruses and luteoviruses and is redundant when BrYV co-infects with PEMV 2. These observations provide a novel insight into the conserved function of P3a and its underlying mechanism in the systemic infection.
Zhang, Xiao-Yan; Zhao, Tian-Yu; Li, Yuan-Yuan; Xiang, Hai-Ying; Dong, Shu-Wei; Zhang, Zong-Ying; Wang, Ying; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2018-01-01
ORF3a, a newly identified non-AUG-initiated ORF encoded by members of genera Polerovirus and Luteovirus , is required for long-distance movement in plants. However, the mechanism of action of P3a in viral systemic movement is still not clear. In this study, sequencing of a brassica yellows virus (BrYV) mutant defective in systemic infection revealed two-nucleotide variation at positions 3406 and 3467 in the genome. Subsequent nucleotide substitution analysis proved that only the non-synonymous substitution (C→U) at position 3406, resulting in P3a P18L , abolished the systemic infection of BrYV. Preliminary investigation showed that wild type BrYV was able to load into the petiole of the agroinfiltrated Nicotiana benthamiana leaves, whereas the mutant displayed very low efficiency. Further experiments revealed that the P3a and its mutant P3a P18L localized to the Golgi apparatus and near plasmodesmata, as well as the endoplasmic reticulum. Both P3a and P3a P18L were able to self-interact in vivo , however, the mutant P3a P18L seemed to form more stable dimer than wild type. More interestingly, we confirmed firstly that the ectopic expression of P3a of other poleroviruses and luteoviruses, as well as co-infection with Pea enation mosaic virus 2 (PEMV 2), restored the ability of systemic movement of BrYV P3a defective mutant, indicating that the P3a is functionally conserved in poleroviruses and luteoviruses and is redundant when BrYV co-infects with PEMV 2. These observations provide a novel insight into the conserved function of P3a and its underlying mechanism in the systemic infection.
Exome sequencing in 53 sporadic cases of schizophrenia identifies 18 putative candidate genes.
Directory of Open Access Journals (Sweden)
Michel Guipponi
Full Text Available Schizophrenia (SCZ is a severe, debilitating mental illness which has a significant genetic component. The identification of genetic factors related to SCZ has been challenging and these factors remain largely unknown. To evaluate the contribution of de novo variants (DNVs to SCZ, we sequenced the exomes of 53 individuals with sporadic SCZ and of their non-affected parents. We identified 49 DNVs, 18 of which were predicted to alter gene function, including 13 damaging missense mutations, 2 conserved splice site mutations, 2 nonsense mutations, and 1 frameshift deletion. The average number of exonic DNV per proband was 0.88, which corresponds to an exonic point mutation rate of 1.7×10(-8 per nucleotide per generation. The non-synonymous-to-synonymous mutation ratio of 2.06 did not differ from neutral expectations. Overall, this study provides a list of 18 putative candidate genes for sporadic SCZ, and when combined with the results of similar reports, identifies a second proband carrying a non-synonymous DNV in the RGS12 gene.
Diversification and the rate of molecular evolution: no evidence of a link in mammals
Directory of Open Access Journals (Sweden)
Bromham Lindell
2011-10-01
Full Text Available Abstract Background Recent research has indicated a positive association between rates of molecular evolution and diversification in a number of taxa. However debate continues concerning the universality and cause of this relationship. Here, we present the first systematic investigation of this relationship within the mammals. We use phylogenetically independent sister-pair comparisons to test for a relationship between substitution rates and clade size at a number of taxonomic levels. Total, non-synonymous and synonymous substitution rates were estimated from mitochondrial and nuclear DNA sequences. Results We found no evidence for an association between clade size and substitution rates in mammals, for either the nuclear or the mitochondrial sequences. We found significant associations between body size and substitution rates, as previously reported. Conclusions Our results present a contrast to previous research, which has reported significant positive associations between substitution rates and diversification for birds, angiosperms and reptiles. There are three possible reasons for the differences between the observed results in mammals versus other clades. First, there may be no link between substitution rates and diversification in mammals. Second, this link may exist, but may be much weaker in mammals than in other clades. Third, the link between substitution rates and diversification may exist in mammals, but may be confounded by other variables.
Diversification and the rate of molecular evolution: no evidence of a link in mammals.
Goldie, Xavier; Lanfear, Robert; Bromham, Lindell
2011-10-04
Recent research has indicated a positive association between rates of molecular evolution and diversification in a number of taxa. However debate continues concerning the universality and cause of this relationship. Here, we present the first systematic investigation of this relationship within the mammals. We use phylogenetically independent sister-pair comparisons to test for a relationship between substitution rates and clade size at a number of taxonomic levels. Total, non-synonymous and synonymous substitution rates were estimated from mitochondrial and nuclear DNA sequences. We found no evidence for an association between clade size and substitution rates in mammals, for either the nuclear or the mitochondrial sequences. We found significant associations between body size and substitution rates, as previously reported. Our results present a contrast to previous research, which has reported significant positive associations between substitution rates and diversification for birds, angiosperms and reptiles. There are three possible reasons for the differences between the observed results in mammals versus other clades. First, there may be no link between substitution rates and diversification in mammals. Second, this link may exist, but may be much weaker in mammals than in other clades. Third, the link between substitution rates and diversification may exist in mammals, but may be confounded by other variables.
Directory of Open Access Journals (Sweden)
Mohamed S. Hassanane
2018-06-01
Full Text Available Egyptian chickens, representing 2 breeds and 7 strains, were genotyped using the PCR-RFLP and sequencing techniques for detection of a non-synonymous dimorphism (G/A in exon 14 of chicken Myxovirus resistance (Mx gene. This dimorphic position is responsible for altering Mx protein’s antiviral activity. Polymerase Chain reactions were performed using Egyptian chickens DNA and specific primer set to amplify Mx DNA fragments of 299 or 301 bp, containing the dimorphic position. Amplicons were cut with restriction enzyme Hpy81. Genotype and allele frequencies for the resistant allele A and sensitive allele G were calculated in all the tested chickens. Results of PCR-RFLP were confirmed by sequencing. The three genotypes AA, AG, GG at the target nucleotide position in Mx gene were represented in all the studied Egyptian chicken breeds and strains except Baladi strain which showed only one genotype AA. The average allele frequency of the resistant A allele in the tested birds (0.67 was higher than the sensitive G allele average frequency in the same birds (0.33. Appling PCR-RFLP technique in the breeding program can be used to select chickens carrying the A allele with high frequencies. This will help in improving poultry breeding in Egypt by producing infectious disease-resistant chickens. Keywords: Egyptian chickens, Antiviral activity, Mx gene, Genotyping, PCR-RFLP
DNA Nucleotides Detection via capacitance properties of Graphene
Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash
2016-05-01
In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.
Mallick, K
2014-01-01
Bone substitute biomaterials are fundamental to the biomedical sector, and have recently benefitted from extensive research and technological advances aimed at minimizing failure rates and reducing the need for further surgery. This book reviews these developments, with a particular focus on the desirable properties for bone substitute materials and their potential to encourage bone repair and regeneration. Part I covers the principles of bone substitute biomaterials for medical applications. One chapter reviews the quantification of bone mechanics at the whole-bone, micro-scale, and non-scale levels, while others discuss biomineralization, osteoductivization, materials to fill bone defects, and bioresorbable materials. Part II focuses on biomaterials as scaffolds and implants, including multi-functional scaffolds, bioceramics, and titanium-based foams. Finally, Part III reviews further materials with the potential to encourage bone repair and regeneration, including cartilage grafts, chitosan, inorganic poly...
Pablo Andres Neumeyer; Martín Gonzalez Rozada
2003-01-01
This objective of this paper is to estimate the elasticity of substitution in the demand for non-tradable goods relative to tradable goods in Argentina. This parameter plays a crucial role in the analysis of the macroeconomic equilibrium of a small open economy (Mendoza, Galindo and Izquierdo (2003)). Using two data sets we found estimates for this elasticity of, approximately, 0.40 and 0.48.
Robart, Aaron R; O'Connor, Catherine M; Collins, Kathleen
2010-03-01
Telomerase adds simple-sequence repeats to chromosome 3' ends to compensate for the loss of repeats with each round of genome replication. To accomplish this de novo DNA synthesis, telomerase uses a template within its integral RNA component. In addition to providing the template, the telomerase RNA subunit (TER) also harbors nontemplate motifs that contribute to the specialized telomerase catalytic cycle of reiterative repeat synthesis. Most nontemplate TER motifs function through linkage with the template, but in ciliate and vertebrate telomerases, a stem-loop motif binds telomerase reverse transcriptase (TERT) and reconstitutes full activity of the minimal recombinant TERT+TER RNP, even when physically separated from the template. Here, we resolve the functional requirements for this motif of ciliate TER in physiological RNP context using the Tetrahymena thermophila p65-TER-TERT core RNP reconstituted in vitro and the holoenzyme reconstituted in vivo. Contrary to expectation based on assays of the minimal recombinant RNP, we find that none of a panel of individual loop IV nucleotide substitutions impacts the profile of telomerase product synthesis when reconstituted as physiological core RNP or holoenzyme RNP. However, loop IV nucleotide substitutions do variably reduce assembly of TERT with the p65-TER complex in vitro and reduce the accumulation and stability of telomerase RNP in endogenous holoenzyme context. Our results point to a unifying model of a conformational activation role for this TER motif in the telomerase RNP enzyme.
Antonyms and Synonyms: Cognitive Aspects of Negation in Positive Sentences
Arimitsu, Nami
2017-01-01
This paper investigates the cognitive orientation of the negative meaning in antonyms and synonyms. While the negative meaning in antonyms is a reflection of the cognitive mapping of our mental contiguity, the negative images in synonymous words are more closely associated with aspects of subjective semantics and factors related to politeness
Directory of Open Access Journals (Sweden)
Maria Grazia Doro
Full Text Available We sequenced to near completion the entire mtDNA of 28 Sardinian goats, selected to represent the widest possible diversity of the most widespread mitochondrial evolutionary lineage, haplogroup (Hg A. These specimens were reporters of the diversity in the island but also elsewhere, as inferred from their affiliation to each of 11 clades defined by D-loop variation. Two reference sequences completed the dataset. Overall, 206 variations were found in the full set of 30 sequences, of which 23 were protein-coding non-synonymous single nucleotide substitutions. Many polymorphic sites within Hg A were informative for the reconstruction of its internal phylogeny. Bayesian and network clustering revealed a general similarity over the entire molecule of sequences previously assigned to the same D-loop clade, indicating evolutionarily meaningful lineages. Two major sister groupings emerged within Hg A, which parallel distinct geographical distributions of D-loop clades in extant stocks. The pattern of variation in protein-coding genes revealed an overwhelming role of purifying selection, with the quota of surviving variants approaching neutrality. However, a simple model of relaxation of selection for the bulk of variants here reported should be rejected. Non-synonymous diversity of Hg's A, B and C denoted that a proportion of variants not greater than that allowed in the wild was given the opportunity to spread into domesticated stocks. Our results also confirmed that a remarkable proportion of pre-existing Hg A diversity became incorporated into domestic stocks. Our results confirm clade A11 as a well differentiated and ancient lineage peculiar of Sardinia.
Exome sequencing in a breast canner family without BRCA mutation
Energy Technology Data Exchange (ETDEWEB)
Noh, Jae Myoung; Choi, Doo Ho; Park, Won; Huh, Seung Jae [Dept. of Radiation Oncology, amsung Medical Center, Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of); Kim, Ji Hun; Cho, Dae Yeon [LabGenomics Clinical Research Institute, LabGenomics, Seongnam (Korea, Republic of)
2015-06-15
We performed exome sequencing in a breast cancer family without BRCA mutations. A family that three sisters have a history of breast cancer was selected for analysis. There were no family members with breast cancer in the previous generation. Genetic testing for BRCA mutation was negative, even by the multiplex ligation-dependent probe amplification method. Two sisters with breast cancer were selected as affected members, while the mother of the sisters was a non-affected member. Whole exome sequencing was performed on the HiSeq 2000 platform with paired-end reads of 101 bp in the three members. We identified 19,436, 19,468, and 19,345 single-nucleotide polymorphisms (SNPs) in the coding regions. Among them, 8,759, 8,789, and 8,772 were non-synonymous SNPs, respectively. After filtering out 12,843 synonymous variations and 12,105 known variations with indels found in the dbSNP135 or 1000 Genomes Project database, we selected 73 variations in the samples from the affected sisters that did not occur in the sample from the unaffected mother. Using the Sorting Intolerant From Tolerant (SIFT), PolyPhen-2, and MutationTaster algorithms to predict amino acid substitutions, the XCR1, DLL1, TH, ACCS, SPPL3, CCNF, and SRL genes were risky among all three algorithms, while definite candidate genes could not be conclusively determined. Using exome sequencing, we found 7 variants for a breast cancer family without BRCA mutations. Genetic evidence of disease association should be confirmed by future studies.
Campbell, Michael C; Smith, Lunden T; Harvey, Jayla
2018-03-29
Despite its critical role in the defense against microbial infection and tumor development, little is known about the range of nucleotide and haplotype variation at IFN-γ, or the evolutionary forces that have shaped patterns of diversity at this locus. To address this gap in knowledge, we examined sequence data from the IFN-γ gene in 1461 individuals from 15 worldwide populations. Our analyses uncovered novel patterns of variation in distinct African populations, including an excess of high frequency-derived alleles, unusually long haplotype structure surrounding the IFN-γ gene, and a "star-like" genealogy of African-specific haplotypes carrying variants previously associated with infectious disease. We also inferred a deep time to coalescence of variation at IFN-γ (~ 0.8 million years ago) and ancient ages for common polymorphisms predating the evolution of modern humans. Taken together, these results are congruent with a model of positive selection on standing variation in African populations. Furthermore, we inferred that common variants in intron 3 of IFN-γ are the likely targets of selection. In addition, we observed a paucity of non-synonymous substitutions relative to synonymous changes in the exons of IFN-γ in African and non-African populations, suggestive of strong purifying selection. Therefore, we contend that positive and purifying selection have influenced levels of diversity in different regions of IFN-γ, implying that these distinct genic regions are, or have been, functionally important. Overall, this study provides additional insights into the evolutionary events that have contributed to the frequency and distribution of alleles having a role in human health and disease.
International Nuclear Information System (INIS)
Rolles, Daniel; Braune, Markus; Cvejanovic, Slobodan; Gessner, Oliver; Hentges, Rainer; Korica, Sanja; Langer, Burkhard; Lischke, Toralf; Pruemper, Georg; Reinkoester, Axel; Viefhaus, Jens; Zimmermann, Bjoern; McKoy, Vince; Becker, Uwe
2006-01-01
In homonuclear diatomic molecules such as N 2 , the inversion symmetry of the system causes non-local, coherent behavior of the otherwise localized core holes. The non-locality of the electron emission and the remaining core hole changes in a continuous way into partially localized behaviour if a gradual breakdown of the inversion symmetry is induced by isotope substitution. This is reflected by a loss of interference and a parity mixing of the outgoing photoelectron waves. Our results represent the first experimentally observed isotope effect on the electronic structure of a diatomic molecule
Securing maximum diversity of Non Pollen Palynomorphs in palynological samples
DEFF Research Database (Denmark)
Enevold, Renée; Odgaard, Bent Vad
2015-01-01
Palynology is no longer synonymous with analysis of pollen with the addition of a few fern spores. A wide range of Non Pollen Palynomorphs are now described and are potential palaeoenvironmental proxies in the palynological surveys. The contribution of NPP’s has proven important to the interpreta......Palynology is no longer synonymous with analysis of pollen with the addition of a few fern spores. A wide range of Non Pollen Palynomorphs are now described and are potential palaeoenvironmental proxies in the palynological surveys. The contribution of NPP’s has proven important...
Crutch, Sebastian J; Williams, Paul; Ridgway, Gerard R; Borgenicht, Laura
2012-09-01
This study describes an investigation of different types of semantic relationship among abstract words: antonyms (e.g. good-bad), synonyms (e.g. good-great), non-antonymous, non-synonymous associates (NANSAs; e.g. good-fun) and unrelated words (e.g. good-late). The comprehension and semantic properties of these words were examined using two distinct methodologies. Experiment 1 tested the comprehension of pairs of abstract words in three patients with global aphasia using a spoken word to written word matching paradigm. Contrary to expectations, all three patients showed superior antonym comprehension compared with synonyms or NANSAs, discriminating antonyms with a similar level of accuracy as unrelated words. Experiment 2 aimed to explore the content or semantic attributes of the abstract words used in Experiment 1 through the generation of control ratings across nine cognitive dimensions (sensation, action, thought, emotion, social interaction, space, time, quantity and polarity). Discrepancy analyses revealed that antonyms were as or more similar to one another than synonyms on all but one measure: polarity. The results of Experiment 2 provide a possible explanation for the novel pattern of neuropsychological data observed in Experiment 1, namely that polarity information is more important than other semantic attributes when discriminating the meaning of abstract words. It is argued that polarity is a critical semantic attribute of abstract words, and that simple 'dissimilarity' metrics mask fundamental consistencies in the semantic representation of antonyms. It is also suggested that mapping abstract semantic space requires the identification and quantification of the contribution made to abstract concepts by not only sensorimotor and emotional information but also a host of other cognitive dimensions. Copyright © 2012 Elsevier Ltd. All rights reserved.
Norman, Jane E; Lee, Kurtis R; Walker, Mary E; Murden, Sherina L; Harris, Jessica; Mundell, Stuart; J Murphy, Gavin; Mumford, Andrew D
2015-10-01
Multiple electrode aggregometry (MEA) improves prediction of thrombosis and bleeding in cardiac patients. However, the causes of inter-individual variation in MEA results are incompletely understood. We explore whether low MEA results are associated with platelet G-protein coupled receptor (GPCR) gene variants. The effects of P2Y12 receptor (P2Y12), thromboxane A2 receptor (TPα) and protease-activated receptor 1 (PAR1) dysfunction on the MEA ADP-test, ASPI-test and TRAP-test were determined using receptor antagonists. Cardiac surgery patients with pre-operative MEA results suggesting GPCR dysfunction were selected for P2Y12 (P2RY12), TPα (TBXA2R) and PAR1 (F2R) sequencing. In control blood samples, P2Y12, TPα or PAR1 antagonists markedly reduced ADP-test, ASPI-test and TRAP-test results respectively. In the 636 patients from a cohort of 2388 cardiac surgery patients who were not receiving aspirin or a P2Y12 blocker, the median ADP-test result was 75.1 U (range 4.8-153.2), ASPI-test 83.7 U (1.4-157.3) and TRAP-test 117.7 U (2.4-194.1), indicating a broad range of results unexplained by anti-platelet drugs. In 238 consenting patients with unexplained low MEA results, three P2RY12 variants occurred in 70/107 (65%) with suspected P2Y12 dysfunction and four TBXA2R variants occurred in 19/22 (86%) with suspected TPα dysfunction although the later group was too small to draw meaningful conclusions about variant frequency. All the variants were synonymous and unlikely to cause GPCR dysfunction. There were no F2R variants in the 109 cases with suspected PAR1 dysfunction. MEA results suggesting isolated platelet GPCR dysfunction were common in cardiac surgery patients, but were not associated with non-synonymous variants in P2RY12 or F2R. Copyright © 2015 Elsevier Ltd. All rights reserved.
2010-07-01
... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject to...
Directory of Open Access Journals (Sweden)
Xiao Jinhua
2009-02-01
Full Text Available Abstract Background The interactions of fig wasps and their host figs provide a model for investigating co-evolution. Fig wasps have specialized morphological characters and lifestyles thought to be adaptations to living in the fig's syconium. Although these aspects of natural history are well documented, the genetic mechanism(s underlying these changes remain(s unknown. Fig wasp olfaction is the key to host-specificity. The Or83b gene class, an unusual member of olfactory receptor family, plays a critical role in enabling the function of conventional olfactory receptors. Four Or83b orthologous genes from one pollinator (PFW (Ceratosolen solmsi and three non-pollinator fig wasps (NPFWs (Apocrypta bakeri, Philotrypesis pilosa and Philotrypesis sp. associated with one species of fig (Ficus hispida can be used to better understand the molecular mechanism underlying the fig wasp's adaptation to its host. We made a comparison of spatial tissue-specific expression patterns and substitution rates of one orthologous gene in these fig wasps and sought evidence for selection pressures. Results A newly identified Or83b orthologous gene was named Or2. Expressions of Or2 were restricted to the heads of all wingless male fig wasps, which usually live in the dark cavity of a fig throughout their life cycle. However, expressions were widely detected in the antennae, legs and abdomens of all female fig wasps that fly from one fig to another for oviposition, and secondarily pollination. Weak expression was also observed in the thorax of PFWs. Compared with NPFWs, the Or2 gene in C. solmsi had an elevated rate of substitutions and lower codon usage. Analyses using Tajima's D, Fu and Li's D* and F* tests indicated a non-neutral pattern of nucleotide variation in all fig wasps. Unlike in NPFWs, this non-neutral pattern was also observed for synonymous sites of Or2 within PFWs. Conclusion The sex- and species-specific expression patterns of Or2 genes detected beyond
Fu, Xue Jun; Nozu, Kandai; Eguchi, Aya; Nozu, Yoshimi; Morisada, Naoya; Shono, Akemi; Taniguchi-Ikeda, Mariko; Shima, Yuko; Nakanishi, Koichi; Vorechovsky, Igor; Iijima, Kazumoto
2016-10-01
X-linked Alport syndrome (XLAS) is a progressive hereditary nephropathy caused by mutations in the type IV collagen alpha chain 5 gene (COL4A5). Although many COL4A5 mutations have previously been identified, pathogenic synonymous mutations have not yet been described. A family with XLAS underwent mutational analyses of COL4A5 by PCR and direct sequencing, as well as transcript analysis of potential splice site mutations. In silico analysis was also conducted to predict the disruption of splicing factor binding sites. Immunohistochemistry (IHC) of kidney biopsies was used to detect α2 and α5 chain expression. We identified a hemizygous point mutation, c.876A>T, in exon 15 of COL4A5 in the proband and his brother, which is predicted to result in a synonymous amino acid change, p.(Gly292Gly). Transcript analysis showed that this mutation potentially altered splicing because it disrupted the splicing factor binding site. The kidney biopsy of the proband showed lamellation of the glomerular basement membrane (GBM), while IHC revealed negative α5(IV) staining in the GBM and Bowman's capsule, which is typical of XLAS. This is the first report of a synonymous COL4A5 substitution being responsible for XLAS. Our findings suggest that transcript analysis should be conducted for the future correct assessment of silent mutations.
Directory of Open Access Journals (Sweden)
Shmuel Sattath
2011-02-01
Full Text Available In Drosophila, multiple lines of evidence converge in suggesting that beneficial substitutions to the genome may be common. All suffer from confounding factors, however, such that the interpretation of the evidence-in particular, conclusions about the rate and strength of beneficial substitutions-remains tentative. Here, we use genome-wide polymorphism data in D. simulans and sequenced genomes of its close relatives to construct a readily interpretable characterization of the effects of positive selection: the shape of average neutral diversity around amino acid substitutions. As expected under recurrent selective sweeps, we find a trough in diversity levels around amino acid but not around synonymous substitutions, a distinctive pattern that is not expected under alternative models. This characterization is richer than previous approaches, which relied on limited summaries of the data (e.g., the slope of a scatter plot, and relates to underlying selection parameters in a straightforward way, allowing us to make more reliable inferences about the prevalence and strength of adaptation. Specifically, we develop a coalescent-based model for the shape of the entire curve and use it to infer adaptive parameters by maximum likelihood. Our inference suggests that ∼13% of amino acid substitutions cause selective sweeps. Interestingly, it reveals two classes of beneficial fixations: a minority (approximately 3% that appears to have had large selective effects and accounts for most of the reduction in diversity, and the remaining 10%, which seem to have had very weak selective effects. These estimates therefore help to reconcile the apparent conflict among previously published estimates of the strength of selection. More generally, our findings provide unequivocal evidence for strongly beneficial substitutions in Drosophila and illustrate how the rapidly accumulating genome-wide data can be leveraged to address enduring questions about the genetic basis
Sattath, Shmuel; Elyashiv, Eyal; Kolodny, Oren; Rinott, Yosef; Sella, Guy
2011-02-10
In Drosophila, multiple lines of evidence converge in suggesting that beneficial substitutions to the genome may be common. All suffer from confounding factors, however, such that the interpretation of the evidence-in particular, conclusions about the rate and strength of beneficial substitutions-remains tentative. Here, we use genome-wide polymorphism data in D. simulans and sequenced genomes of its close relatives to construct a readily interpretable characterization of the effects of positive selection: the shape of average neutral diversity around amino acid substitutions. As expected under recurrent selective sweeps, we find a trough in diversity levels around amino acid but not around synonymous substitutions, a distinctive pattern that is not expected under alternative models. This characterization is richer than previous approaches, which relied on limited summaries of the data (e.g., the slope of a scatter plot), and relates to underlying selection parameters in a straightforward way, allowing us to make more reliable inferences about the prevalence and strength of adaptation. Specifically, we develop a coalescent-based model for the shape of the entire curve and use it to infer adaptive parameters by maximum likelihood. Our inference suggests that ∼13% of amino acid substitutions cause selective sweeps. Interestingly, it reveals two classes of beneficial fixations: a minority (approximately 3%) that appears to have had large selective effects and accounts for most of the reduction in diversity, and the remaining 10%, which seem to have had very weak selective effects. These estimates therefore help to reconcile the apparent conflict among previously published estimates of the strength of selection. More generally, our findings provide unequivocal evidence for strongly beneficial substitutions in Drosophila and illustrate how the rapidly accumulating genome-wide data can be leveraged to address enduring questions about the genetic basis of adaptation.
The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.
Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L
1989-04-01
The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.
2013-01-01
Background Genetic variation at the melanocortin-1 receptor (MC1R) gene is correlated with melanin color variation in many birds. Feral pigeons (Columba livia) show two major melanin-based colorations: a red coloration due to pheomelanic pigment and a black coloration due to eumelanic pigment. Furthermore, within each color type, feral pigeons display continuous variation in the amount of melanin pigment present in the feathers, with individuals varying from pure white to a full dark melanic color. Coloration is highly heritable and it has been suggested that it is under natural or sexual selection, or both. Our objective was to investigate whether MC1R allelic variants are associated with plumage color in feral pigeons. Findings We sequenced 888 bp of the coding sequence of MC1R among pigeons varying both in the type, eumelanin or pheomelanin, and the amount of melanin in their feathers. We detected 10 non-synonymous substitutions and 2 synonymous substitution but none of them were associated with a plumage type. It remains possible that non-synonymous substitutions that influence coloration are present in the short MC1R fragment that we did not sequence but this seems unlikely because we analyzed the entire functionally important region of the gene. Conclusions Our results show that color differences among feral pigeons are probably not attributable to amino acid variation at the MC1R locus. Therefore, variation in regulatory regions of MC1R or variation in other genes may be responsible for the color polymorphism of feral pigeons. PMID:23915680
Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S
2017-06-26
Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.
Statistical Physics of Complex Substitutive Systems
Jin, Qing
Diffusion processes are central to human interactions. Despite extensive studies that span multiple disciplines, our knowledge is limited to spreading processes in non-substitutive systems. Yet, a considerable number of ideas, products, and behaviors spread by substitution; to adopt a new one, agents must give up an existing one. This captures the spread of scientific constructs--forcing scientists to choose, for example, a deterministic or probabilistic worldview, as well as the adoption of durable items, such as mobile phones, cars, or homes. In this dissertation, I develop a statistical physics framework to describe, quantify, and understand substitutive systems. By empirically exploring three collected high-resolution datasets pertaining to such systems, I build a mechanistic model describing substitutions, which not only analytically predicts the universal macroscopic phenomenon discovered in the collected datasets, but also accurately captures the trajectories of individual items in a complex substitutive system, demonstrating a high degree of regularity and universality in substitutive systems. I also discuss the origins and insights of the parameters in the substitution model and possible generalization form of the mathematical framework. The systematical study of substitutive systems presented in this dissertation could potentially guide the understanding and prediction of all spreading phenomena driven by substitutions, from electric cars to scientific paradigms, and from renewable energy to new healthy habits.
Kato, S; Mukai, Y
2004-03-01
In the Rosaceae family, which includes Prunus, gametophytic self-incompatibility (GSI) is controlled by a single multiallelic locus (S-locus), and the S-locus product expressed in the pistils is a glycoprotein with ribonuclease activity (S-RNase). Two populations of flowering cherry (Prunus lannesiana var. speciosa), located on Hachijo Island in Japan's Izu Islands, were sampled, and S-allele diversity was surveyed based on the sequence polymorphism of S-RNase. A total of seven S-alleles were cloned and sequenced. The S-RNases of flowering cherry showed high homology to those of Prunus cultivars (P. avium and P. dulcis). In the phylogenetic tree, the S-RNases of flowering cherry and other Prunus cultivars formed a distinct group, but they did not form species-specific subgroups. The nucleotide substitution pattern in S-RNases of flowering cherry showed no excess of nonsynonymous substitutions relative to synonymous substitutions. However, the S-RNases of flowering cherry had a higher Ka/Ks ratio than those of other Prunus cultivars, and a subtle heterogeneity in the nucleotide substitution rates was observed among the Prunus species. The S-genotype of each individual was determined by Southern blotting of restriction enzyme-digested genomic DNA, using cDNA for S-RNase as a probe. A total of 22 S-alleles were identified. All individuals examined were heterozygous, as expected under GSI. The allele frequencies were, contrary to the expectation under GSI, significantly unequal. The two populations studied showed a high degree of overlap, with 18 shared alleles. However, the allele frequencies differed considerably between the two populations.
Improved production of membrane proteins in Escherichia coli by selective codon substitutions
DEFF Research Database (Denmark)
Nørholm, Morten H.H.; Toddo, Stephen; Virkki, Minttu T.I.
2013-01-01
Membrane proteins are extremely challenging to produce in sufficient quantities for biochemical and structural analysis and there is a growing demand for solutions to this problem. In this study we attempted to improve expression of two difficult-to-express coding sequences (araH and narK) for me......Membrane proteins are extremely challenging to produce in sufficient quantities for biochemical and structural analysis and there is a growing demand for solutions to this problem. In this study we attempted to improve expression of two difficult-to-express coding sequences (araH and nar......K) for membrane transporters. For both coding sequences, synonymous codon substitutions in the region adjacent to the AUG start led to significant improvements in expression, whereas multi-parameter sequence optimization of codons throughout the coding sequence failed. We conclude that coding sequences can be re...
Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men
Directory of Open Access Journals (Sweden)
Ahamad Salamian
2008-01-01
Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.
Directory of Open Access Journals (Sweden)
Diana D Moreno-Santillán
Full Text Available The genes of the Major Histocompatibility Complex (MHC play an important role in the vertebrate immune response and are among the most polymorphic genes known in vertebrates. In some marine mammals, MHC genes have been shown to be characterized by low levels of polymorphism compared to terrestrial taxa; this reduction in variation is often explained as a result of lower pathogen pressures in marine habitats. To determine if this same reduction in variation applies to the migratory population of blue whales (Balaenoptera musculus that occurs in the Gulf of California, we genotyped a 172 bp fragment of exon 2 of the MHC Class II DQB locus for 80 members of this population. Twenty-two putatively functional DQB allotypes were identified, all of which were homologous with DQB sequences from other cetacean species. Up to 5 putative alleles per individual were identified, suggesting that gene duplication has occurred at this locus. Rates of non-synonymous to synonymous substitutions (ω and maximum likelihood analyses of models of nucleotide variation provided potential evidence of ongoing positive selection at this exon. Phylogenetic analyses of DQB alleles from B. musculus and 16 other species of cetaceans revealed trans-specific conservation of MHC variants, suggesting that selection has acted on this locus over prolonged periods of time. Collectively our findings reveal that immunogenic variation in blue whales is comparable to that in terrestrial mammals, thereby providing no evidence that marine taxa are subject to reduced pathogen-induced selective pressures.
Antinociceptive effect of purine nucleotides.
Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R
1996-10-01
The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.
Johnston, Christine; Magaret, Amalia; Roychoudhury, Pavitra; Greninger, Alexander L; Cheng, Anqi; Diem, Kurt; Fitzgibbon, Matthew P; Huang, Meei-Li; Selke, Stacy; Lingappa, Jairam R; Celum, Connie; Jerome, Keith R; Wald, Anna; Koelle, David M
2017-10-01
Understanding the variability in circulating herpes simplex virus type 2 (HSV-2) genomic sequences is critical to the development of HSV-2 vaccines. Genital lesion swabs containing ≥ 10 7 log 10 copies HSV DNA collected from Africa, the USA, and South America underwent next-generation sequencing, followed by K-mer based filtering and de novo genomic assembly. Sites of heterogeneity within coding regions in unique long and unique short (U L _U S ) regions were identified. Phylogenetic trees were created using maximum likelihood reconstruction. Among 46 samples from 38 persons, 1468 intragenic base-pair substitutions were identified. The maximum nucleotide distance between strains for concatenated U L_ U S segments was 0.4%. Phylogeny did not reveal geographic clustering. The most variable proteins had non-synonymous mutations in < 3% of amino acids. Unenriched HSV-2 DNA can undergo next-generation sequencing to identify intragenic variability. The use of clinical swabs for sequencing expands the information that can be gathered directly from these specimens. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jacqueline Stockley
Full Text Available The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12 could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =, both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =. Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.
Stockley, Jacqueline; Nisar, Shaista P; Leo, Vincenzo C; Sabi, Essa; Cunningham, Margaret R; Eikenboom, Jeroen C; Lethagen, Stefan; Schneppenheim, Reinhard; Goodeve, Anne C; Watson, Steve P; Mundell, Stuart J; Daly, Martina E
2015-01-01
The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12) could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =), both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N) was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =). Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.
Cole, Charles; Krampis, Konstantinos; Karagiannis, Konstantinos; Almeida, Jonas S; Faison, William J; Motwani, Mona; Wan, Quan; Golikov, Anton; Pan, Yang; Simonyan, Vahan; Mazumder, Raja
2014-01-27
Next-generation sequencing (NGS) technologies have resulted in petabytes of scattered data, decentralized in archives, databases and sometimes in isolated hard-disks which are inaccessible for browsing and analysis. It is expected that curated secondary databases will help organize some of this Big Data thereby allowing users better navigate, search and compute on it. To address the above challenge, we have implemented a NGS biocuration workflow and are analyzing short read sequences and associated metadata from cancer patients to better understand the human variome. Curation of variation and other related information from control (normal tissue) and case (tumor) samples will provide comprehensive background information that can be used in genomic medicine research and application studies. Our approach includes a CloudBioLinux Virtual Machine which is used upstream of an integrated High-performance Integrated Virtual Environment (HIVE) that encapsulates Curated Short Read archive (CSR) and a proteome-wide variation effect analysis tool (SNVDis). As a proof-of-concept, we have curated and analyzed control and case breast cancer datasets from the NCI cancer genomics program - The Cancer Genome Atlas (TCGA). Our efforts include reviewing and recording in CSR available clinical information on patients, mapping of the reads to the reference followed by identification of non-synonymous Single Nucleotide Variations (nsSNVs) and integrating the data with tools that allow analysis of effect nsSNVs on the human proteome. Furthermore, we have also developed a novel phylogenetic analysis algorithm that uses SNV positions and can be used to classify the patient population. The workflow described here lays the foundation for analysis of short read sequence data to identify rare and novel SNVs that are not present in dbSNP and therefore provides a more comprehensive understanding of the human variome. Variation results for single genes as well as the entire study are available
Patterns of mutation and selection at synonymous sites in Drosophila
DEFF Research Database (Denmark)
Singh, Nadia D; Bauer DuMont, Vanessa L; Hubisz, Melissa J
2007-01-01
, when applied to 18 coding sequences in 3 species of Drosophila, confirmed an earlier report that the Notch gene in Drosophila melanogaster was evolving under selection in favor of those codons defined as unpreferred in this species. This finding opened the possibility that synonymous sites may...... be subject to a variety of selective pressures beyond weak selection for increased frequencies of the codons currently defined as "preferred" in D. melanogaster. To further explore patterns of synonymous site evolution in Drosophila in a lineage-specific manner, we expanded the application of the maximum...... likelihood framework to 8,452 protein coding sequences with well-defined orthology in D. melanogaster, Drosophila sechellia, and Drosophila yakuba. Our analyses reveal intragenomic and interspecific variation in mutational patterns as well as in patterns and intensity of selection on synonymous sites. In D...
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth
2016-05-11
Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
Labour migration and substitution (updated) : Second, revised version
Cremers, Jan
2017-01-01
This (revised) paper compares the outcomes of several national and international studies on substitution as a consequence of migrants entering the labour market. Substitution appears if finding a job by one person results in the job loss (or non-obtaining of a job) of another person. The recruitment
Genomic Comparisons Reveal Microevolutionary Differences in Mycobacterium abscessus Subspecies
Directory of Open Access Journals (Sweden)
Joon L. Tan
2017-10-01
Full Text Available Mycobacterium abscessus, a rapid-growing non-tuberculous mycobacterium, has been the cause of sporadic and outbreak infections world-wide. The subspecies in M. abscessus complex (M. abscessus, M. massiliense, and M. bolletii are associated with different biologic and pathogenic characteristics and are known to be among the most frequently isolated opportunistic pathogens from clinical material. To date, the evolutionary forces that could have contributed to these biological and clinical differences are still unclear. We compared genome data from 243 M. abscessus strains downloaded from the NCBI ftp Refseq database to understand how the microevolutionary processes of homologous recombination and positive selection influenced the diversification of the M. abscessus complex at the subspecies level. The three subspecies are clearly separated in the Minimum Spanning Tree. Their MUMi-based genomic distances support the separation of M. massiliense and M. bolletii into two subspecies. Maximum Likelihood analysis through dN/dS (the ratio of number of non-synonymous substitutions per non-synonymous site, to the number of synonymous substitutions per synonymous site identified distinct genes in each subspecies that could have been affected by positive selection during evolution. The results of genome-wide alignment based on concatenated locally-collinear blocks suggest that (a recombination has affected the M. abscessus complex more than mutation and positive selection; (b recombination occurred more frequently in M. massiliense than in the other two subspecies; and (c the recombined segments in the three subspecies have come from different intra-species and inter-species origins. The results lead to the identification of possible gene sets that could have been responsible for the subspecies-specific features and suggest independent evolution among the three subspecies, with recombination playing a more significant role than positive selection in the
Genomic Comparisons Reveal Microevolutionary Differences in Mycobacterium abscessus Subspecies
Tan, Joon L.; Ng, Kee P.; Ong, Chia S.; Ngeow, Yun F.
2017-01-01
Mycobacterium abscessus, a rapid-growing non-tuberculous mycobacterium, has been the cause of sporadic and outbreak infections world-wide. The subspecies in M. abscessus complex (M. abscessus, M. massiliense, and M. bolletii) are associated with different biologic and pathogenic characteristics and are known to be among the most frequently isolated opportunistic pathogens from clinical material. To date, the evolutionary forces that could have contributed to these biological and clinical differences are still unclear. We compared genome data from 243 M. abscessus strains downloaded from the NCBI ftp Refseq database to understand how the microevolutionary processes of homologous recombination and positive selection influenced the diversification of the M. abscessus complex at the subspecies level. The three subspecies are clearly separated in the Minimum Spanning Tree. Their MUMi-based genomic distances support the separation of M. massiliense and M. bolletii into two subspecies. Maximum Likelihood analysis through dN/dS (the ratio of number of non-synonymous substitutions per non-synonymous site, to the number of synonymous substitutions per synonymous site) identified distinct genes in each subspecies that could have been affected by positive selection during evolution. The results of genome-wide alignment based on concatenated locally-collinear blocks suggest that (a) recombination has affected the M. abscessus complex more than mutation and positive selection; (b) recombination occurred more frequently in M. massiliense than in the other two subspecies; and (c) the recombined segments in the three subspecies have come from different intra-species and inter-species origins. The results lead to the identification of possible gene sets that could have been responsible for the subspecies-specific features and suggest independent evolution among the three subspecies, with recombination playing a more significant role than positive selection in the diversification
Control of Chemical Risks by Substitution of Harmful Substances
DEFF Research Database (Denmark)
Jacobsen, Thomas
1997-01-01
Substitution of volatile, organic solvents with non-volatile, low-toxic esters of fatty acids for cleaning purposes in offset printing has successfully been implemented in several European countries. Similar substitutions in other industrial cleaning processes seem possible, especially regarding...
The manufacture of synthetic non-sintered and degradable bone grafting substitutes.
Gerike, W; Bienengräber, V; Henkel, K-O; Bayerlein, T; Proff, P; Gedrange, T; Gerber, Th
2006-02-01
A new synthetic bone grafting substitute (NanoBone, ARTOSS GmbH, Germany) is presented. This is produced by a new technique, the sol-gel-method. This bone grafting substitute consists of nanocrystalline hydroxyapatite (HA) and nanostructured silica (SiO2). By achieving a highly porous structure good osteoconductivity can be seen. In addition, the material will be completely biodegraded and new own bone is formed. It has been demonstrated that NanoBone is biodegraded by osteoclasts in a manner comparable to the natural bone remodelling process.
International Nuclear Information System (INIS)
Dey, Antu K.; David, Kathryn B.; Ray, Neelanjana; Ketas, Thomas J.; Klasse, Per J.; Doms, Robert W.; Moore, John P.
2008-01-01
The native, functional HIV-1 envelope glycoprotein (Env) complex is a trimer of two non-covalently associated subunits: the gp120 surface glycoprotein and the gp41 transmembrane glycoprotein. However, various non-functional forms of Env are present on virus particles and HIV-1-infected cells, some of which probably arise as the native complex decays. The aberrant forms include gp120-gp41 monomers and oligomers, as well as gp41 subunits from which gp120 has dissociated. The presence of non-functional Env creates binding sites for antibodies that do not recognize native Env complexes and that are, therefore, non-neutralizing. Non-native Env forms (monomers, dimers, tetramers and aggregates) can also arise when soluble gp140 proteins, lacking the cytoplasmic and transmembrane domains of gp41, are expressed for vaccine studies. We recently identified five amino acids in the gp41 N-terminal region (I535, Q543, S553, K567 and R588) that promote gp140 trimerization. We have now studied their influence on the function and antigenic properties of JR-FL Env expressed on the surfaces of pseudoviruses and Env-transfected cells. The 5 substitutions in gp41 reduce the expression of non-trimeric gp160s, without affecting trimer levels. Pseudovirions bearing the mutant Env are fully infectious with similar kinetics of Env-mediated fusion. Various non-neutralizing antibodies bind less strongly to the Env mutant, but neutralizing antibody binding is unaffected. Hence the gp41 substitutions do not adversely affect Env structure, supporting their use for making new Env-based vaccines. The mutant Env might also help in studies intended to correlate antibody binding to virus neutralization. Of note is that the 5 residues are much more frequent, individually or collectively, in viruses from subtypes other than B
Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.
Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela
2013-07-01
Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.
Li, Jinqian; Feng, Shengjun; Liu, Xi; Guo, Mingzhe; Chen, Mingxiao; Chen, Yiyi; Rong, Liang; Xia, Jinyu; Zhou, Yuanping; Zhong, Jin; Li, Yi-Ping
2018-05-01
Genotype 1b strain Con1 represents an important reference in the study of hepatitis C virus (HCV). Here, we aimed to develop an advanced infectious Con1 recombinant. We found that previously identified mutations A1226G/F1464L/A1672S/Q1773H permitted culture adaption of Con1 Core-NS5A (C-5A) recombinant containing 5'UTR and NS5B-3'UTR from JFH1 (genotype 2a), thus acquired additional mutations L725H/F886L/D2415G. C-5A containing all seven mutations (C-5A_7m) replicated efficiently in Huh7.5 and Huh7.5.1 cells and had an increased infectivity in SEC14L2-expressing Huh7.5.1 cells. Incorporation of Con1 NS5B was deleterious to C-5A_7m, however Con1 5'UTR was permissive but attenuated the virus. Nucleotides G1, A4, and G35 primarily accounted for the viral attenuation without affecting RNA translation. C-5A_7m was inhibited dose-dependently by simeprevir and daclatasvir, and substitutions at A4, A29, A34, and G35 conferred resistance to miR-122 antagonism. The novel Con1 5'UTR-NS5A recombinant, adaptive mutations, and critical nucleotides described here will facilitate future studies of HCV culture systems and virus-host interaction. Copyright © 2018 Elsevier Inc. All rights reserved.
Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Liu, Zhen-Xing; Hao, Le; Ma, Jiang-Yao; Li, Yu-Gu
2016-02-24
Streptococcus agalactiae is an important human and animal pathogen. To better understand the genetic features and evolution of S. agalactiae, multiple factors influencing synonymous codon usage patterns in S. agalactiae were analyzed in this study. A- and U-ending rich codons were used in S. agalactiae function genes through the overall codon usage analysis, indicating that Adenine (A)/Thymine (T) compositional constraints might contribute an important role to the synonymous codon usage pattern. The GC3% against the effective number of codon (ENC) value suggested that translational selection was the important factor for codon bias in the microorganism. Principal component analysis (PCA) showed that (i) mutational pressure was the most important factor in shaping codon usage of all open reading frames (ORFs) in the S. agalactiae genome; (ii) strand specific mutational bias was not capable of influencing the codon usage bias in the leading and lagging strands; and (iii) gene length was not the important factor in synonymous codon usage pattern in this organism. Additionally, the high correlation between tRNA adaptation index (tAI) value and codon adaptation index (CAI), frequency of optimal codons (Fop) value, reinforced the role of natural selection for efficient translation in S. agalactiae. Comparison of synonymous codon usage pattern between S. agalactiae and susceptible hosts (human and tilapia) showed that synonymous codon usage of S. agalactiae was independent of the synonymous codon usage of susceptible hosts. The study of codon usage in S. agalactiae may provide evidence about the molecular evolution of the bacterium and a greater understanding of evolutionary relationships between S. agalactiae and its hosts.
International Nuclear Information System (INIS)
Liu, Hung J.; Lee, Long H.; Hsu, Hsiao W.; Kuo, Liam C.; Liao, Ming H.
2003-01-01
Nucleotide sequences of the S-class genome segments of 17 field-isolates and vaccine strains of avian reovirus (ARV) isolated over a 23-year period from different hosts, pathotypes, and geographic locations were examined and analyzed to define phylogenetic profiles and evolutionary mechanism. The S1 genome segment showed noticeably higher divergence than the other S-class genes. The σC-encoding gene has evolved into six distinct lineages. In contrast, the other S-class genes showed less divergence than that of the σC-encoding gene and have evolved into two to three major distinct lineages, respectively. Comparative sequence analysis provided evidence indicating extensive sequence divergence between ARV and other orthoreoviruses. The evolutionary trees of each gene were distinct, suggesting that these genes evolve in an independent manner. Furthermore, variable topologies were the result of frequent genetic reassortment among multiple cocirculating lineages. Results showed genetic diversity correlated more closely with date of isolation and geographic sites than with host species and pathotypes. This is the first evidence demonstrating genetic variability among circulating ARVs through a combination of evolutionary mechanisms involving multiple cocirculating lineages and genetic reassortment. The evolutionary rates and patterns of base substitutions were examined. The evolutionary rate for the σC-encoding gene and σC protein was higher than for the other S-class genes and other family of viruses. With the exception of the σC-encoding gene, which nonsynonymous substitutions predominate over synonymous, the evolutionary process of the other S-class genes can be explained by the neutral theory of molecular evolution. Results revealed that synonymous substitutions predominate over nonsynonymous in the S-class genes, even though genetic diversity and substitution rates vary among the viruses
Directory of Open Access Journals (Sweden)
Sailen Barik
2017-12-01
Full Text Available A significant number of proteins in all living species contains amino acid repeats (AARs of various lengths and compositions, many of which play important roles in protein structure and function. Here, I have surveyed select homopolymeric single [(An] and double [(ABn] AARs in the human proteome. A close examination of their codon pattern and analysis of RNA structure propensity led to the following set of empirical rules: (1 One class of amino acid repeats (Class I uses a mixture of synonymous codons, some of which approximate the codon bias ratio in the overall human proteome; (2 The second class (Class II disregards the codon bias ratio, and appears to have originated by simple repetition of the same codon (or just a few codons; and finally, (3 In all AARs (including Class I, Class II, and the in-betweens, the codons are chosen in a manner that precludes the formation of RNA secondary structure. It appears that the AAR genes have evolved by orchestrating a balance between codon usage and mRNA secondary structure. The insights gained here should provide a better understanding of AAR evolution and may assist in designing synthetic genes.
Barik, Sailen
2017-12-01
A significant number of proteins in all living species contains amino acid repeats (AARs) of various lengths and compositions, many of which play important roles in protein structure and function. Here, I have surveyed select homopolymeric single [(A)n] and double [(AB)n] AARs in the human proteome. A close examination of their codon pattern and analysis of RNA structure propensity led to the following set of empirical rules: (1) One class of amino acid repeats (Class I) uses a mixture of synonymous codons, some of which approximate the codon bias ratio in the overall human proteome; (2) The second class (Class II) disregards the codon bias ratio, and appears to have originated by simple repetition of the same codon (or just a few codons); and finally, (3) In all AARs (including Class I, Class II, and the in-betweens), the codons are chosen in a manner that precludes the formation of RNA secondary structure. It appears that the AAR genes have evolved by orchestrating a balance between codon usage and mRNA secondary structure. The insights gained here should provide a better understanding of AAR evolution and may assist in designing synthetic genes.
Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.
2012-01-01
Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756
Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J
2012-02-03
Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.
Directory of Open Access Journals (Sweden)
Rigau Joan
2004-07-01
Full Text Available Abstract Background Polymorphisms were investigated within the ZmPox3 maize peroxidase gene, possibly involved in lignin biosynthesis because of its colocalization with a cluster of QTL related to lignin content and cell wall digestibility. The purpose of this study was to identify, on the basis of 37 maize lines chosen for their varying degrees of cell wall digestibility and representative of temperate regions germplasm, ZmPox3 haplotypes or individual polymorphisms possibly associated with digestibility. Results Numerous haplotypes with high diversity were identified. Frequency of nucleotide changes was high with on average one SNP every 57 bp. Nucleotide diversity was not equally distributed among site categories: the estimated π was on average eight times higher for silent sites than for non-synonymous sites. Numerous sites were in linkage disequilibrium that decayed with increasing physical distance. A zmPox3 mutant allele, carrying an insertion of a transposable element in the second exon, was found in lines derived from the early flint inbred line, F7. This element possesses many structural features of miniature inverted-repeat transposable elements (MITE. The mutant allele encodes a truncated protein lacking important functional sites. An ANOVA performed with a subset of 31 maize lines indicated that the transposable element was significantly associated with cell wall digestibility. This association was confirmed using an additional set of 25 flint lines related to F7. Moreover, RT-PCR experiments revealed a decreased amount of corresponding mRNA in plants with the MITE insertion. Conclusion These results showed that ZmPox3 could possibly be involved in monolignol polymerisation, and that a deficiency in ZmPox3 peroxidase activity seemingly has a negative effect on cell wall digestibility. Also, genetic diversity analyses of ZmPox3 indicated that this peroxidase could be a relevant target for grass digestibility improvement using
1001 Proteomes: a functional proteomics portal for the analysis of Arabidopsis thaliana accessions.
Joshi, Hiren J; Christiansen, Katy M; Fitz, Joffrey; Cao, Jun; Lipzen, Anna; Martin, Joel; Smith-Moritz, A Michelle; Pennacchio, Len A; Schackwitz, Wendy S; Weigel, Detlef; Heazlewood, Joshua L
2012-05-15
The sequencing of over a thousand natural strains of the model plant Arabidopsis thaliana is producing unparalleled information at the genetic level for plant researchers. To enable the rapid exploitation of these data for functional proteomics studies, we have created a resource for the visualization of protein information and proteomic datasets for sequenced natural strains of A. thaliana. The 1001 Proteomes portal can be used to visualize amino acid substitutions or non-synonymous single-nucleotide polymorphisms in individual proteins of A. thaliana based on the reference genome Col-0. We have used the available processed sequence information to analyze the conservation of known residues subject to protein phosphorylation among these natural strains. The substitution of amino acids in A. thaliana natural strains is heavily constrained and is likely a result of the conservation of functional attributes within proteins. At a practical level, we demonstrate that this information can be used to clarify ambiguously defined phosphorylation sites from phosphoproteomic studies. Protein sets of available natural variants are available for download to enable proteomic studies on these accessions. Together this information can be used to uncover the possible roles of specific amino acids in determining the structure and function of proteins in the model plant A. thaliana. An online portal to enable the community to exploit these data can be accessed at http://1001proteomes.masc-proteomics.org/
Landmark Image Retrieval Using Visual Synonyms
Gavves, E.; Snoek, C.G.M.
2010-01-01
In this paper, we consider the incoherence problem of the visual words in bag-of-words vocabularies. Different from existing work, which performs assignment of words based solely on closeness in descriptor space, we focus on identifying pairs of independent, distant words - the visual synonyms -
THE MIGHT OF RUSSIAN LANGUAGE ACCORDING TO SYNONYMIC DICTIONARY BY COMPUTER EVALUATION SYSTEM ASIS®
Directory of Open Access Journals (Sweden)
Vitaly N. Trishin
2013-01-01
Full Text Available The article describes electronic dictionary of synonyms in Russian language by ASIS® system (more than 500 000 words and collocations, 190 000 synonymic connections.The program can be used not just as a dictionary of synonyms and close meaning words, but also as spelling dictionary and definition dictionary of Russian language in order to check the orthography and define the meaning of unknown words. The dictionary is also designed to be an instrument of philological surveys and studies of the language trough the extensive query system on different characteristic of words (definition, composition, synonymy, etc.. Program’s lexical base includes words from dictionaries and guides in all subject areas - from astronomy to Japanese painting. Over compilation of dictionary developer used published dictionaries: spelling, synonymic, definition dictionaries, dictionary of collocations, dictionary of foreign words and etc. of 19-21 cc. Newspapers, magazines and web-resources were active used as well for appending the dictionary. This dictionary practically shows, that by the amount of words Russian language belongs with the most developed languages in the world, and by the scale and density of synonymic space, in the author’s opinion, it has no equal.
Visual synonyms for landmark image retrieval
Gavves, E.; Snoek, C.G.M.; Smeulders, A.W.M.
2012-01-01
In this paper, we address the incoherence problem of the visual words in bag-of-words vocabularies. Different from existing work, which assigns words based on closeness in descriptor space, we focus on identifying pairs of independent, distant words - the visual synonyms - that are likely to host
Non-invasive prenatal detection of trisomy 21 using tandem single nucleotide polymorphisms.
Directory of Open Access Journals (Sweden)
Sujana Ghanta
Full Text Available BACKGROUND: Screening tests for Trisomy 21 (T21, also known as Down syndrome, are routinely performed for the majority of pregnant women. However, current tests rely on either evaluating non-specific markers, which lead to false negative and false positive results, or on invasive tests, which while highly accurate, are expensive and carry a risk of fetal loss. We outline a novel, rapid, highly sensitive, and targeted approach to non-invasively detect fetal T21 using maternal plasma DNA. METHODS AND FINDINGS: Highly heterozygous tandem Single Nucleotide Polymorphism (SNP sequences on chromosome 21 were analyzed using High-Fidelity PCR and Cycling Temperature Capillary Electrophoresis (CTCE. This approach was used to blindly analyze plasma DNA obtained from peripheral blood from 40 high risk pregnant women, in adherence to a Medical College of Wisconsin Institutional Review Board approved protocol. Tandem SNP sequences were informative when the mother was heterozygous and a third paternal haplotype was present, permitting a quantitative comparison between the maternally inherited haplotype and the paternally inherited haplotype to infer fetal chromosomal dosage by calculating a Haplotype Ratio (HR. 27 subjects were assessable; 13 subjects were not informative due to either low DNA yield or were not informative at the tandem SNP sequences examined. All results were confirmed by a procedure (amniocentesis/CVS or at postnatal follow-up. Twenty subjects were identified as carrying a disomy 21 fetus (with two copies of chromosome 21 and seven subjects were identified as carrying a T21 fetus. The sensitivity and the specificity of the assay was 100% when HR values lying between 3/5 and 5/3 were used as a threshold for normal subjects. CONCLUSIONS: In summary, a targeted approach, based on calculation of Haplotype Ratios from tandem SNP sequences combined with a sensitive and quantitative DNA measurement technology can be used to accurately detect fetal
Karro, J E; Peifer, M; Hardison, R C; Kollmann, M; von Grünberg, H H
2008-02-01
The distribution of guanine and cytosine nucleotides throughout a genome, or the GC content, is associated with numerous features in mammals; understanding the pattern and evolutionary history of GC content is crucial to our efforts to annotate the genome. The local GC content is decaying toward an equilibrium point, but the causes and rates of this decay, as well as the value of the equilibrium point, remain topics of debate. By comparing the results of 2 methods for estimating local substitution rates, we identify 620 Mb of the human genome in which the rates of the various types of nucleotide substitutions are the same on both strands. These strand-symmetric regions show an exponential decay of local GC content at a pace determined by local substitution rates. DNA segments subjected to higher rates experience disproportionately accelerated decay and are AT rich, whereas segments subjected to lower rates decay more slowly and are GC rich. Although we are unable to draw any conclusions about causal factors, the results support the hypothesis proposed by Khelifi A, Meunier J, Duret L, and Mouchiroud D (2006. GC content evolution of the human and mouse genomes: insights from the study of processed pseudogenes in regions of different recombination rates. J Mol Evol. 62:745-752.) that the isochore structure has been reshaped over time. If rate variation were a determining factor, then the current isochore structure of mammalian genomes could result from the local differences in substitution rates. We predict that under current conditions strand-symmetric portions of the human genome will stabilize at an average GC content of 30% (considerably less than the current 42%), thus confirming that the human genome has not yet reached equilibrium.
Directory of Open Access Journals (Sweden)
Mei Yu
Full Text Available We conducted a microarray study to discover gene expression patterns associated with a lack of melanogenesis in non-pigmented hair follicles (HF by microarray. Pigmented and non-pigmented HFs were collected and micro-dissected into the hair bulb (HB and the upper hair sheaths (HS including the bulge region. In comparison to pigmented HS and HBs, nucleotide excision repair (NER family genes ERCC1, ERCC2, ERCC3, ERCC4, ERCC5, ERCC6, XPA, NTPBP, HCNP, DDB2 and POLH exhibited statistically significantly lower expression in non- pigmented HS and HBs. Quantitative PCR verified microarray data and identified ERCC3 as highly differentially expressed. Immunohistochemistry confirmed ERCC3 expression in HF melanocytes. A reduction in ERCC3 by siRNA interference in human melanocytes in vitro reduced their tyrosinase production ability. Our results suggest that loss of NER gene function is associated with a loss of melanin production capacity. This may be due to reduced gene transcription and/or reduced DNA repair in melanocytes which may eventually lead to cell death. These results provide novel information with regard to melanogenesis and its regulation.
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Four new synonyms and a new combination in Parnassia (Celastraceae).
Shu, Yumin; Zhang, Zhixiang
2017-01-01
Parnassia yunnanensis had been previously described based on mixed specimens containing materials partially belonging to Parnassia cacuminum , which makes the application of Parnassia yunnanensis ambiguous. Therefore, we lectotypified Parnassia yunnanensis and meanwhile synonymized Parnassia lanceolata var. oblongipetala under it. Parnassia yunnanensis var. longistipitata was found more similar to Parnassia cacuminum rather than Parnassia yunnanensis , thus a new combination, Parnassia cacuminum var. longistipitata comb. nov. was proposed. Furthermore, other three names ( Parnassia vevusta , Parnassia degeensis and Parnassia kangdingensis ) were reduced to synonyms of Parnassia cacuminum too.
Moslehi, Nazanin; Ehsani, Behnaz; Mirmiran, Parvin; Hojjat, Parvane; Azizi, Fereidoun
2015-10-26
We aimed to investigate associations between dietary macronutrient proportions and prospective visceral adiposity index changes (ΔVAI). The study included 1254 adults (18-74 years), from the Tehran Lipid and Glucose Study (TLGS), who were followed for three years. Dietary intakes were assessed twice using food frequency questionnaires. Associations of dietary macronutrient with ΔVAI and risk of visceral adiposity dysfunction (VAD) after three years were investigated. The percentage of energy intake from protein in the total population, and from fat in women, were associated with higher increases in VAI. A 5% higher energy intake from protein substituted for carbohydrate, monounsaturated fatty acids (MUFAs), and polyunsaturated fatty acids (PUFAs) was associated with higher ΔVAI. Higher energy intake from animal protein substituted for PUFAs was positively associated with ΔVAI. Substituting protein and PUFAs with MUFAs were related to higher ΔVAI. The associations were similar in men and women, but reached significance mostly among women. Risk of VAD was increased when 1% of energy from protein was replaced with MUFAs. Substituting protein for carbohydrate and fat, and fat for carbohydrate, resulted in increased risk of VAD in women. Higher dietary proportions of protein and animal-derived MUFA may be positively associated with ΔVAI and risk of VAD.
Energy Technology Data Exchange (ETDEWEB)
Shekhar, Sudhanshu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Center for Complex Engineered Multifunctional Materials, University of Pittsburgh, Pittsburgh, PA 15261 (United States); McGowan Institute of Regenerative Medicine, University of Pittsburgh, PA 15261 (United States); Roy, Abhijit; Hong, Daeho [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Kumta, Prashant N., E-mail: pkumta@pitt.edu [Department of Bioengineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Department of Chemical Engineering, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Department of Mechanical Engineering and Materials Science, University of Pittsburgh, Pittsburgh, PA 15260 (United States); Center for Complex Engineered Multifunctional Materials, University of Pittsburgh, Pittsburgh, PA 15261 (United States); McGowan Institute of Regenerative Medicine, University of Pittsburgh, PA 15261 (United States)
2016-12-01
Nanostructured ceramic particles, particularly, nanoparticles of calcium phosphate (CaP) remain an attractive option among the various types of non-viral gene delivery vectors studied because of their safety, biocompatibility, biodegradability, and ease of handling as well as their adsorptive capacity for DNA. We have accordingly developed an enhanced version of nanostructured calcium phosphates (NanoCaPs), by substituting known amounts of silicate for phosphate in the hydroxyapatite (HA) lattice (NanoSiCaPs). Results indicate that in addition to the excellent transfection levels exhibited by un-substituted NanoCaPs alone in vitro, an additional 20–50% increase in transfection is observed for NanoCaPs containing 8.3–50 mol% silicate aptly called NanoSiCaPs, owing to its rapid dissolution properties enabling nanoparticles escaping the lysosomal degradation. However, high silicate substitution (> 50 mol%) resulted in a drastic decline in transfection as the synthesized NanoCaPs deviated far from the characteristic hydroxyapatite phase formed as evidenced by the materials characterization results. - Highlights: • Successful demonstration of nanostructured NanoSiCaPs formation • Demonstration of superior transfection of NanoSiCaPs contrasted to NanoCaPs • Silicate substitution leads to smaller aggregates of nanoparticle complexes. • Enhanced dissolution of NanoSiCaPs demonstrated • Faster NanoSiCaPs dissolution leads to escape of pDNA from lysosomal degradation.
Karolina, R.; Muhammad, F.
2018-02-01
Based on PP. No.85 of 1999 on the management of hazardous and toxic (B3), fly ash and bottom ash wastes are categorized into B3 waste because there are heavy metal oxide contents that can pollute the environment. One form of environmental rescue that can be applied is to utilize waste fly ash and bottom ash in the manufacture of concrete. In this research, fly ash and bottom ash waste are used as substitution of cement and fine aggregate to make lightweight concrete. The purpose of this research is to know the mechanical properties of non-autoclaved aerated lightweight concrete (NAAC) with FA and BA substitution to cement and fine aggregate which is expected to improve the quality of concrete. The NAAC lightweight concrete in this study is divided into 4 categories: normal NAAC lightweight concrete, NAAC lightweight NAAC substituted concrete with FA, NAAC lightweight concrete substituted with BA, and NAAC combined light weight from FA and BA with variations of 10%, 20% And 30%. The test specimen used in cylindrical shape, which was tested at the age of 28 days, amounted to 90 pieces and consisted of 10 variations. Each variation amounted to 9 samples. Based on the test results with FA and BA substitutions of 10%, 20%, and 30%, the highest compressive strength was achieved in samples with FA 30% of 12.687 MPa, maximum tensile strength achieved in samples with FA 30% of 1,540 MPa, The highest absorption was achieved in normal NAAC of 5.66%. Based on the weight of the contents of all samples, samples can be categorized in lightweight concrete, since the weight of the contents is less than 1900 kg / m3.
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A
2016-01-01
Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms
Four new synonyms and a new combination in Parnassia (Celastraceae
Directory of Open Access Journals (Sweden)
Yumin Shu
2017-03-01
Full Text Available Parnassia yunnanensis had been previously described based on mixed specimens containing materials partially belonging to P. cacuminum, which makes the application of P. yunnanensis ambiguous. Therefore, we lectotypified P. yunnanensis and meanwhile synonymized P. lanceolata var. oblongipetala under it. P. yunnanensis var. longistipitata was found more similar to P. cacuminum rather than P. yunnanensis, thus a new combination, P. cacuminum var. longistipitata comb. nov. was proposed. Furthermore, other three names (P. vevusta, P. degeensis and P. kangdingensis were reduced to synonyms of P. cacuminum too.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Control of ribosome traffic by position-dependent choice of synonymous codons
DEFF Research Database (Denmark)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...
Hexavalent Chromium Substitution Projects
2011-05-12
Hexavalent Chromium Substitution Projects Date (12 May 2011) Gene McKinley ASC/WNV (937) 255-3596 Gene.McKinley@wpafb.af.mil Aeronautical Systems...valid OMB control number. 1. REPORT DATE 12 MAY 2011 2. REPORT TYPE 3. DATES COVERED 00-00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Hexavalent ...A-10) – AETC (T-6, T-38 and T1A) • Both Cr Primers & Non-Cr primers as well as Cr Surface Treatment – F-22 8 Non- Chrome Tie-coat & touch-up
Ris-Stalpers, C.; Trifiro, M. A.; Kuiper, G. G.; Jenster, G.; Romalo, G.; Sai, T.; van Rooij, H. C.; Kaufman, M.; Rosenfield, R. L.; Liao, S.
1991-01-01
We have identified two different single nucleotide alterations in codon 686 (GAC; aspartic acid) in exon 4 of the human androgen receptor gene in three unrelated families with the complete form of androgen insensitivity. One mutation (G----C) results in an aspartic acid----histidine substitution
Yang, Seung-Jo; Kim, Byung-Yong; Chun, Jongsik
2017-11-01
Lactobacillus bobalius, Lactobacillus kimchii and Lactobacillus paralimentarius belong to the genus Lactobacillus and show close phylogenetic relationships. In a previous study, L. bobalius and L. kimchii were proposed to be reclassified as later heterotypic synonyms of L. paralimentarius using high 16S rRNA gene sequence similarities (≥99.5 %) and DNA-DNA hybridization values (≥82 %). We determined high quality whole genome assemblies of the type strains of L. bobalius and L. kimchii, which were then compared with that of L. paralimentarius. Average nucleotide identity values among three genomes ranged from 91.4 to 92.3 % which are clearly below 95~96 %, the generally recognized cutoff value for bacterial species boundaries. On the basis of comparative genomic evidence, L. bobalius, L. kimchii, and L. paralimentarius should stand as separate species in the genus Lactobacillus. We therefore suggest rejecting the previous proposal to combine these three species into a single species.
Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.
Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro
2015-11-01
The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cyclic nucleotides and radioresistnace
International Nuclear Information System (INIS)
Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.
1982-01-01
The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru
Non-degenerate 1,2-silyl shift in silyl substituted alkyltrimethylcyclopentadienes
Czech Academy of Sciences Publication Activity Database
Pinkas, Jiří; Kubišta, Jiří; Gyepes, R.; Čejka, Jiří; Meunier, P.; Mach, Karel
2005-01-01
Roč. 690, č. 3 (2005), s. 731-741 ISSN 0022-328X Grant - others:French Government(FR) 20006842 Institutional research plan: CEZ:AV0Z40400503 Keywords : substituted cyclopentadienes * silatropic shift * dynamic NMR spectroscopy Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.025, year: 2005
Kupriushkin, M S; Pyshnyĭ, D V
2012-01-01
Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.
International Nuclear Information System (INIS)
Smithwick, L. Ashley; Smith, Andrew; Quensen, John F.; Stack, Allison; London, Lucille; Morris, Pamela J.
2003-01-01
Polychlorinated biphenyls (PCBs) are persistent environmental contaminants, and their ubiquitous nature has prompted studies of their potential health hazards. As a result of their lipophilic nature, PCBs accumulate in breast milk and subsequently affect the health of offspring of exposed individuals. Biological effects of PCBs in animals have mostly been attributed to coplanar congeners, although effects of ortho congeners also have been demonstrated. To investigate the relationship of immunotoxicity and chlorine substitution pattern, the effects of PCB congeners and mixtures of ortho and non-ortho-substituted constituents of Aroclor 1242 on splenocytes from C57B1/6 mice were examined. The immunotoxic endpoints investigated included splenocyte viability, lipopolysaccharide (LPS)-induced splenocyte proliferation, and LPS-induced antibody secretion. Congeners with multiple ortho chlorines preferentially inhibited splenocyte proliferation as compared with non- or mono-ortho-substituted congeners. However, mixtures of non- and mono-ortho-substituted congeners and multi-ortho-substituted congeners inhibited LPS-induced splenocyte proliferation and antibody secretion at similar concentrations. Exposure of splenocytes to these mixtures did not activate the aryl hydrocarbon receptor (AhR) signal transduction pathway. These results suggest individual multi-ortho-substituted congeners preferentially inhibit LPS-induced splenocyte proliferation, while congeners not exhibiting an effect individually may have additive effects in a mixture to produce an immunotoxic response through an AhR-independent pathway
Boerema, G.H.; Loerakker, W.M.; Hamers, Maria E.C.
1996-01-01
Various old records of Phoma lingam (teleomorph Leptosphaeria maculans) on non-cruciferous plants proved to be based on misidentifications. In the past the fungus has also often been confused with other fungi occurring on crucifers. Forty-five species formerly classified under the generic synonyms
Öhrmalm, Christina; Jobs, Magnus; Eriksson, Ronnie; Golbob, Sultan; Elfaitouri, Amal; Benachenhou, Farid; Strømme, Maria; Blomberg, Jonas
2010-01-01
One of the main problems in nucleic acid-based techniques for detection of infectious agents, such as influenza viruses, is that of nucleic acid sequence variation. DNA probes, 70-nt long, some including the nucleotide analog deoxyribose-Inosine (dInosine), were analyzed for hybridization tolerance to different amounts and distributions of mismatching bases, e.g. synonymous mutations, in target DNA. Microsphere-linked 70-mer probes were hybridized in 3M TMAC buffer to biotinylated single-stranded (ss) DNA for subsequent analysis in a Luminex® system. When mismatches interrupted contiguous matching stretches of 6 nt or longer, it had a strong impact on hybridization. Contiguous matching stretches are more important than the same number of matching nucleotides separated by mismatches into several regions. dInosine, but not 5-nitroindole, substitutions at mismatching positions stabilized hybridization remarkably well, comparable to N (4-fold) wobbles in the same positions. In contrast to shorter probes, 70-nt probes with judiciously placed dInosine substitutions and/or wobble positions were remarkably mismatch tolerant, with preserved specificity. An algorithm, NucZip, was constructed to model the nucleation and zipping phases of hybridization, integrating both local and distant binding contributions. It predicted hybridization more exactly than previous algorithms, and has the potential to guide the design of variation-tolerant yet specific probes. PMID:20864443
Hoek, Annet C; Luning, Pieternel A; Weijzen, Pascalle; Engels, Wim; Kok, Frans J; de Graaf, Cees
2011-06-01
What does it take to increase the consumption of meat substitutes and attract new consumers? We identified main barriers and drivers by a consumer survey (n=553) in the U.K. and the Netherlands. Person-related factors (food neophobia and food choice motives) and product-related attitudes and beliefs towards meat and meat substitutes were compared between non-users (n=324), light/medium-users (n=133) and heavy-users of meat substitutes (n=96). Consumer acceptance was largely determined by the attitudes and beliefs towards meat substitutes and food neophobia. Key barriers for non-users and light/medium-users were the unfamiliarity with meat substitutes and the lower sensory attractiveness compared to meat. In addition, non-users had a higher tendency to avoid new foods. Hence, the less consumers were using meat substitutes, the more they wanted these products to be similar to meat. Although non-users and light/medium-users did recognize the ethical and weight-control aspects of meat substitutes, this was obviously less relevant to them. Actually, only heavy-users had high motivations to choose ethical foods, which explains their choice for meat substitutes. In order to make meat substitutes more attractive to meat consumers, we would not recommend to focus on communication of ethical arguments, but to significantly improve the sensory quality and resemblance to meat. Copyright © 2011 Elsevier Ltd. All rights reserved.
Control of ribosome traffic by position-dependent choice of synonymous codons
International Nuclear Information System (INIS)
Mitarai, Namiko; Pedersen, Steen
2013-01-01
Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)
THE EXISTENCE OF SYNONYMS IN A LANGUAGE - 2 FORMS BUT ONE, OR RATHER 2 MEANINGS
DEJONGE, B
1993-01-01
This paper focuses on the problem of synonymy. In practice, the existence of synonyms is generally accepted, but in theory, synonymy is undesirable. In this article an attempt is made to show that functional differences in meaning can distinguish two apparently synonymous verbs in Modern Italian.
Directory of Open Access Journals (Sweden)
Marco Mottinelli
2017-09-01
Full Text Available Background: 1,2,3,4-Tetrahydroisoquinolines (THIQs are common motifs in alkaloids and in medicinal chemistry. Synthetic access to THIQs via the Pomeranz–Fritsch–Bobbit (PFB methodology using mineral acids for deactivated, electron-poor aromatic systems, is scarcely represented in the literature. Here, the factors controlling the regiochemical outcome of cyclization are evaluated.Results: A double reductive alkylation was telescoped into a one-pot reaction delivering good to excellent yields of desired aminoacetals for cyclization. Cyclization of activated systems proceeded smoothly under standard PFB conditions, but for non-activated systems the use of HClO4 alone was effective. When cyclization was possible in both para- and ortho-positions to the substituent, 7-substituted derivatives were formed with significant amounts of 5-substituted byproduct. The formation of the 4-hydroxy-THIQs vs the 4-methoxy-THIQ products could be controlled through modification of the reaction concentration. In addition, while a highly-activated system exclusively cyclized to the indole, this seems generally highly disfavored. When competition between 6- and 7-ring formation was investigated in non-activated systems, 5,7,8,13-tetrahydro-6,13-methanodibenzo[c,f]azonine was exclusively obtained. Furthermore, selective ring closure in the para-position could be achieved under standard PFB conditions, while a double ring closure could be obtained utilizing HClO4.Conclusion: Reactivity differences in aminoacetal precursors can be employed to control cyclization using the PFB methodology. It is now possible to select confidently the right conditions for the synthesis of N-aryl-4-hydroxy-1,2,3,4-tetrahydroisoquinolines.
Mottinelli, Marco; Leese, Mathew P
2017-01-01
Background: 1,2,3,4-Tetrahydroisoquinolines (THIQs) are common motifs in alkaloids and in medicinal chemistry. Synthetic access to THIQs via the Pomeranz–Fritsch–Bobbit (PFB) methodology using mineral acids for deactivated, electron-poor aromatic systems, is scarcely represented in the literature. Here, the factors controlling the regiochemical outcome of cyclization are evaluated. Results: A double reductive alkylation was telescoped into a one-pot reaction delivering good to excellent yields of desired aminoacetals for cyclization. Cyclization of activated systems proceeded smoothly under standard PFB conditions, but for non-activated systems the use of HClO4 alone was effective. When cyclization was possible in both para- and ortho-positions to the substituent, 7-substituted derivatives were formed with significant amounts of 5-substituted byproduct. The formation of the 4-hydroxy-THIQs vs the 4-methoxy-THIQ products could be controlled through modification of the reaction concentration. In addition, while a highly-activated system exclusively cyclized to the indole, this seems generally highly disfavored. When competition between 6- and 7-ring formation was investigated in non-activated systems, 5,7,8,13-tetrahydro-6,13-methanodibenzo[c,f]azonine was exclusively obtained. Furthermore, selective ring closure in the para-position could be achieved under standard PFB conditions, while a double ring closure could be obtained utilizing HClO4. Conclusion: Reactivity differences in aminoacetal precursors can be employed to control cyclization using the PFB methodology. It is now possible to select confidently the right conditions for the synthesis of N-aryl-4-hydroxy-1,2,3,4-tetrahydroisoquinolines. PMID:29062406
Mottinelli, Marco; Leese, Mathew P; Potter, Barry V L
2017-01-01
Background: 1,2,3,4-Tetrahydroisoquinolines (THIQs) are common motifs in alkaloids and in medicinal chemistry. Synthetic access to THIQs via the Pomeranz-Fritsch-Bobbit (PFB) methodology using mineral acids for deactivated, electron-poor aromatic systems, is scarcely represented in the literature. Here, the factors controlling the regiochemical outcome of cyclization are evaluated. Results: A double reductive alkylation was telescoped into a one-pot reaction delivering good to excellent yields of desired aminoacetals for cyclization. Cyclization of activated systems proceeded smoothly under standard PFB conditions, but for non-activated systems the use of HClO 4 alone was effective. When cyclization was possible in both para - and ortho -positions to the substituent, 7-substituted derivatives were formed with significant amounts of 5-substituted byproduct. The formation of the 4-hydroxy-THIQs vs the 4-methoxy-THIQ products could be controlled through modification of the reaction concentration. In addition, while a highly-activated system exclusively cyclized to the indole, this seems generally highly disfavored. When competition between 6- and 7-ring formation was investigated in non-activated systems, 5,7,8,13-tetrahydro-6,13-methanodibenzo[ c , f ]azonine was exclusively obtained. Furthermore, selective ring closure in the para- position could be achieved under standard PFB conditions, while a double ring closure could be obtained utilizing HClO 4 . Conclusion: Reactivity differences in aminoacetal precursors can be employed to control cyclization using the PFB methodology. It is now possible to select confidently the right conditions for the synthesis of N- aryl-4-hydroxy-1,2,3,4-tetrahydroisoquinolines.
Analysis of EFL Students' Ability in Reading Vocabulary of Synonyms and Antonyms
Vina Fathira
2017-01-01
Reading is an important thing for academic level. Every student must have many vocabularies to encourage her/his reading skill. The aim of this research is to analyze the students' understanding of reading vocabularies of synonyms and antonyms in the higher education level. Synonyms and antonyms are two important things should be mastered to get better reading comprehension. The method used in this research was quantitative with survey design. The population same as the sample of this researc...
Lyons, Brendan M; McHenry, Monique A; Barrington, David S
2017-07-01
Cytosolic phosphoglucose isomerase (pgiC) is an enzyme essential to glycolysis found universally in eukaryotes, but broad understanding of variation in the gene coding for pgiC is lacking for ferns. We used a substantially expanded representation of the gene for Andean species of the fern genus Polystichum to characterize pgiC in ferns relative to angiosperms, insects, and an amoebozoan; assess the impact of selection versus neutral evolutionary processes on pgiC; and explore evolutionary relationships of selected Andean species. The dataset of complete sequences comprised nine accessions representing seven species and one hybrid from the Andes and Serra do Mar. The aligned sequences of the full data set comprised 3376 base pairs (70% of the entire gene) including 17 exons and 15 introns from two central areas of the gene. The exons are highly conserved relative to angiosperms and retain substantial homology to insect pgiC, but intron length and structure are unique to the ferns. Average intron size is similar to angiosperms; intron number and location in insects are unlike those of the plants we considered. The introns included an array of indels and, in intron 7, an extensive microsatellite array with potential utility in analyzing population-level histories. Bayesian and maximum-parsimony analysis of 129 variable nucleotides in the Andean polystichums revealed that 59 (1.7% of the 3376 total) were phylogenetically informative; most of these united sister accessions. The phylogenetic trees for the Andean polystichums were incongruent with previously published cpDNA trees for the same taxa, likely the result of rapid evolutionary change in the introns and contrasting stability in the exons. The exons code a total of seven amino-acid substitutions. Comparison of non-synonymous to synonymous substitutions did not suggest that the pgiC gene is under selection in the Andes. Variation in pgiC including two additional accessions represented by incomplete sequences
Phosphorylation states of cell cycle and DNA repair proteins can be altered by the nsSNPs
International Nuclear Information System (INIS)
Savas, Sevtap; Ozcelik, Hilmi
2005-01-01
Phosphorylation is a reversible post-translational modification that affects the intrinsic properties of proteins, such as structure and function. Non-synonymous single nucleotide polymorphisms (nsSNPs) result in the substitution of the encoded amino acids and thus are likely to alter the phosphorylation motifs in the proteins. In this study, we used the web-based NetPhos tool to predict candidate nsSNPs that either introduce or remove putative phosphorylation sites in proteins that act in DNA repair and cell cycle pathways. Our results demonstrated that a total of 15 nsSNPs (16.9%) were likely to alter the putative phosphorylation patterns of 14 proteins. Three of these SNPs (CDKN1A-S31R, OGG1-S326C, and XRCC3-T241M) have already found to be associated with altered cancer risk. We believe that this set of nsSNPs constitutes an excellent resource for further molecular and genetic analyses. The novel systematic approach used in this study will accelerate the understanding of how naturally occurring human SNPs may alter protein function through the modification of phosphorylation mechanisms and contribute to disease susceptibility
Athar, Mohd; Lone, Mohsin Y.; Jha, Prakash C.
2018-02-01
Designing of new calixarene receptors for the selective binding of anions is an age-old concept; even though expected outcomes from this field are at premature stage. Herein, we have performed quantum chemical calculations to provide structural basis of anion binding with urea and thiourea substituted calixarenes (1, 2, and 3). In particular, spherical halides (F-, Cl-, Br-) and linear anions (CN-, N3-, SCN-) were modelled for calculating binding energies with receptor 1, 2 and 3 followed by their marked IR vibrations; taking the available experimental information into account. We found that the thiourea substitutions have better capability to stabilize the anions. Results have suggested that the structural behaviour of macrocyclic motifs were responsible for displaying the anion binding potentials. Moreover, second order "charge transfer" interactions of n-σ∗NH and n-σ∗OH type along the H-bond axis played critical role in developing hydrogen bonds. The present work also examines the role of non-covalent interactions (NCI) and their effects on thermodynamic and chemical-reactivity descriptors.
Genetic variation in eleven phase I drug metabolism genes in an ethnically diverse population.
Solus, Joseph F; Arietta, Brenda J; Harris, James R; Sexton, David P; Steward, John Q; McMunn, Chara; Ihrie, Patrick; Mehall, Janelle M; Edwards, Todd L; Dawson, Elliott P
2004-10-01
The extent of genetic variation found in drug metabolism genes and its contribution to interindividual variation in response to medication remains incompletely understood. To better determine the identity and frequency of variation in 11 phase I drug metabolism genes, the exons and flanking intronic regions of the cytochrome P450 (CYP) isoenzyme genes CYP1A1, CYP1A2, CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6, CYP2E1, CYP3A4 and CYP3A5 were amplified from genomic DNA and sequenced. A total of 60 kb of bi-directional sequence was generated from each of 93 human DNAs, which included Caucasian, African-American and Asian samples. There were 388 different polymorphisms identified. These included 269 non-coding, 45 synonymous and 74 non-synonymous polymorphisms. Of these, 54% were novel and included 176 non-coding, 14 synonymous and 21 non-synonymous polymorphisms. Of the novel variants observed, 85 were represented by single occurrences of the minor allele in the sample set. Much of the variation observed was from low-frequency alleles. Comparatively, these genes are variation-rich. Calculations measuring genetic diversity revealed that while the values for the individual genes are widely variable, the overall nucleotide diversity of 7.7 x 10(-4) and polymorphism parameter of 11.5 x 10(-4) are higher than those previously reported for other gene sets. Several independent measurements indicate that these genes are under selective pressure, particularly for polymorphisms corresponding to non-synonymous amino acid changes. There is relatively little difference in measurements of diversity among the ethnic groups, but there are large differences among the genes and gene subfamilies themselves. Of the three CYP subfamilies involved in phase I drug metabolism (1, 2, and 3), subfamily 2 displays the highest levels of genetic diversity.
International Nuclear Information System (INIS)
Chen Yun; Wu Xiaofeng; Liu Zhong
2009-01-01
This paper studies global synchronization of non-autonomous chaotic electro-mechanical gyrostat systems via variable substitution control. A master-slave non-autonomous synchronization scheme with variable substitution control is mathematically presented. Based on the scheme, some sufficient algebraic criteria for global chaos synchronization of master and slave electro-mechanical gyrostat systems via various single-variable coupling are derived. The effectiveness of the obtained criteria is numerically illustrated by the examples.
The Nym Family: Synonyms, Antonyms, Homonyms, Acronyms.
Cummings, Melodie
Intended to help students improve their vocabulary and spelling skills, this booklet offers activities on synonyms, antonyms, homonyms (including homophones and homographs), and acronyms. It is suggested that the teacher present these types of words as members of the "Nym Family." Ideas for posters and books to be used as instructional…
Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.
2003-01-01
A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171
Pal, Shilpee; Sarkar, Indrani; Roy, Ayan; Mohapatra, Pradeep K Das; Mondal, Keshab C; Sen, Arnab
2018-02-01
The present study has been aimed to the comparative analysis of high GC composition containing Corynebacterium genomes and their evolutionary study by exploring codon and amino acid usage patterns. Phylogenetic study by MLSA approach, indel analysis and BLAST matrix differentiated Corynebacterium species in pathogenic and non-pathogenic clusters. Correspondence analysis on synonymous codon usage reveals that, gene length, optimal codon frequencies and tRNA abundance affect the gene expression of Corynebacterium. Most of the optimal codons as well as translationally optimal codons are C ending i.e. RNY (R-purine, N-any nucleotide base, and Y-pyrimidine) and reveal translational selection pressure on codon bias of Corynebacterium. Amino acid usage is affected by hydrophobicity, aromaticity, protein energy cost, etc. Highly expressed genes followed the cost minimization hypothesis and are less diverged at their synonymous positions of codons. Functional analysis of core genes shows significant difference in pathogenic and non-pathogenic Corynebacterium. The study reveals close relationship between non-pathogenic and opportunistic pathogenic Corynebaterium as well as between molecular evolution and survival niches of the organism.
Directory of Open Access Journals (Sweden)
Ponnusamy Kalaiarasan
Full Text Available Role of, 29-non-synonymous, 15-intronic, 3-close to UTR, single nucleotide polymorphisms (SNPs and 2 mutations of Human Pyruvate Kinase (PK M2 were investigated by in-silico and in-vitro functional studies. Prediction of deleterious substitutions based on sequence homology and structure based servers, SIFT, PANTHER, SNPs&GO, PhD-SNP, SNAP and PolyPhen, depicted that 19% emerged common between all the mentioned programs. SNPeffect and HOPE showed three substitutions (C31F, Q310P and S437Y in-silico as deleterious and functionally important. In-vitro activity assays showed C31F and S437Y variants of PKM2 with reduced activity, while Q310P variant was catalytically inactive. The allosteric activation due to binding of fructose 1-6 bisphosphate (FBP was compromised in case of S437Y nsSNP variant protein. This was corroborated through molecular dynamics (MD simulation study, which was also carried out in other two variant proteins. The 5 intronic SNPs of PKM2, associated with sporadic breast cancer in a case-control study, when subjected to different computational analyses, indicated that 3 SNPs (rs2856929, rs8192381 and rs8192431 could generate an alternative transcript by influencing splicing factor binding to PKM2. We propose that these, potentially functional and important variations, both within exons and introns, could have a bearing on cancer metabolism, since PKM2 has been implicated in cancer in the recent past.
Features of Recent Codon Evolution: A Comparative Polymorphism-Fixation Study
Directory of Open Access Journals (Sweden)
Zhongming Zhao
2010-01-01
Full Text Available Features of amino-acid and codon changes can provide us important insights on protein evolution. So far, investigators have often examined mutation patterns at either interspecies fixed substitution or intraspecies nucleotide polymorphism level, but not both. Here, we performed a unique analysis of a combined set of intra-species polymorphisms and inter-species substitutions in human codons. Strong difference in mutational pattern was found at codon positions 1, 2, and 3 between the polymorphism and fixation data. Fixation had strong bias towards increasing the rarest codons but decreasing the most frequently used codons, suggesting that codon equilibrium has not been reached yet. We detected strong CpG effect on CG-containing codons and subsequent suppression by fixation. Finally, we detected the signature of purifying selection against A∣U dinucleotides at synonymous dicodon boundaries. Overall, fixation process could effectively and quickly correct the volatile changes introduced by polymorphisms so that codon changes could be gradual and directional and that codon composition could be kept relatively stable during evolution.
Zhang, Xinsheng; Wallace, Olivia L; Domi, Arban; Wright, Kevin J; Driscoll, Jonathan; Anzala, Omu; Sanders, Eduard J; Kamali, Anatoli; Karita, Etienne; Allen, Susan; Fast, Pat; Gilmour, Jill; Price, Matt A; Parks, Christopher L
2015-08-01
Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Nedenia Bonvino Stafuzza
Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.
From Poule de Luxe to Geisha: Source Languages behind the Present-Day English Synonyms of Prostitute
Directory of Open Access Journals (Sweden)
Bożena Duda
2014-11-01
Full Text Available This paper aims at drawing a picture, as complete as possible, of an anthropocentric reality hidden in the synonyms of prostitute which have been incorporated into the English lexico-semantic system from other languages since the beginning of the 19th century. The body of Present-day English synonyms of prostitute to be analysed includes horizontal, geisha, shawl and poule de luxe. Apart from providing the source languages from which English borrowed the afore-mentioned synonyms of prostitute, an attempt will be made at discovering the plausible cultural and sociological justification for the lexical borrowings to have taken place. In order to make the onomasiological picture of the sense ‘prostitute’ as complete as it can be within the limits of this paper, a mention will be made of the lexical heritage within the range of the synonyms of prostitute which were incorporated into the English language in the course of Middle English, Early Modern English and Late Modern English.
Guryn, Roman; Staszewski, Marek; Stasiak, Anna; McNaught Flores, Daniel; Fogel, Wiesława Agnieszka; Leurs, Rob; Walczyński, Krzysztof
2018-02-03
H₃ receptors present on histaminergic and non-histaminergic neurons, act as autoreceptors or heteroreceptors controlling neurotransmitter release and synthesis. Previous, studies have found that the compound N -methyl- N -3-phenylalkyl-2-[2-(4-n-propylpiperazin-1-yl)-1,3-thiazol-5-yl]ethan-1-amine ( ADS-531, 2c ) exhibits high in vitro potency toward H₃ guinea pig jejunal receptors, with pA₂ = 8.27. To optimize the structure of the lead compound ADS-531 , a series of 5-substituted-2-thiazol-4- n -propylpiperazines 3 were synthesized and subjected to in vitro pharmacological characterization; the alkyl chain between position 2 of the thiazole ring and the terminal secondary N -methylamino function was elongated from three to four methylene groups and the N -methylamino functionality was substituted by benzyl-, 2-phenylethyl-, and 3-phenyl-propyl- moieties. SAR studies on novel non-imidazole, 5-substituted-2-thiazol-4- n -propyl-piperazines 3 showed that the most active compound 3a (pA₂ = 8.38), additionally possessed a weak competitive H₁-antagonistic activity. Therefore, compound ADS-531 , which did not exhibit any H₁-antagonistic activity, was chosen for further evaluation for its affinity to the recombinant rat and human histamine H₃ receptors (rH₃R and hH₃R, respectively). ADS-531 exhibited nanomolar affinity for both rH₃R and hH₃R receptors. It was also shown that, ADS-531 given subchronically to rats (s.c. 3 mg/kg, 5 days) penetrated the brain, where it affected dopamine, noradrenaline and serotonin concentration; however, it did not affect histamine concentration nor feeding behavior.
Cannabis as a substitute for alcohol and other drugs
Directory of Open Access Journals (Sweden)
Reiman Amanda
2009-12-01
Full Text Available Abstract Background Substitution can be operationalized as the conscious choice to use one drug (legal or illicit instead of, or in conjunction with, another due to issues such as: perceived safety; level of addiction potential; effectiveness in relieving symptoms; access and level of acceptance. This practice of substitution has been observed among individuals using cannabis for medical purposes. This study examined drug and alcohol use, and the occurrence of substitution among medical cannabis patients. Methods Anonymous survey data were collected at the Berkeley Patient's Group (BPG, a medical cannabis dispensary in Berkeley, CA. (N = 350 The sample was 68% male, 54% single, 66% White, mean age was 39; 74% have health insurance (including MediCal, 41% work full time, 81% have completed at least some college, 55% make less than $40,000 a year. Seventy one percent report having a chronic medical condition, 52% use cannabis for a pain related condition, 75% use cannabis for a mental health issue. Results Fifty three percent of the sample currently drinks alcohol, 2.6 was the average number of drinking days per week, 2.9 was the average number of drinks on a drinking occasion. One quarter currently uses tobacco, 9.5 is the average number of cigarettes smoked daily. Eleven percent have used a non-prescribed, non OTC drug in the past 30 days with cocaine, MDMA and Vicodin reported most frequently. Twenty five percent reported growing up in an abusive or addictive household. Sixteen percent reported previous alcohol and/or drug treatment, and 2% are currently in a 12-step or other recovery program. Forty percent have used cannabis as a substitute for alcohol, 26% as a substitute for illicit drugs and 66% as a substitute for prescription drugs. The most common reasons given for substituting were: less adverse side effects (65%, better symptom management (57%, and less withdrawal potential (34% with cannabis. Conclusion The substitution of one
Nucleotide sequence preservation of human mitochondrial DNA
International Nuclear Information System (INIS)
Monnat, R.J. Jr.; Loeb, L.A.
1985-01-01
Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms
The Selective Advantage of Synonymous Codon Usage Bias in Salmonella.
Directory of Open Access Journals (Sweden)
Gerrit Brandis
2016-03-01
Full Text Available The genetic code in mRNA is redundant, with 61 sense codons translated into 20 different amino acids. Individual amino acids are encoded by up to six different codons but within codon families some are used more frequently than others. This phenomenon is referred to as synonymous codon usage bias. The genomes of free-living unicellular organisms such as bacteria have an extreme codon usage bias and the degree of bias differs between genes within the same genome. The strong positive correlation between codon usage bias and gene expression levels in many microorganisms is attributed to selection for translational efficiency. However, this putative selective advantage has never been measured in bacteria and theoretical estimates vary widely. By systematically exchanging optimal codons for synonymous codons in the tuf genes we quantified the selective advantage of biased codon usage in highly expressed genes to be in the range 0.2-4.2 x 10-4 per codon per generation. These data quantify for the first time the potential for selection on synonymous codon choice to drive genome-wide sequence evolution in bacteria, and in particular to optimize the sequences of highly expressed genes. This quantification may have predictive applications in the design of synthetic genes and for heterologous gene expression in biotechnology.
Simulating efficiently the evolution of DNA sequences.
Schöniger, M; von Haeseler, A
1995-02-01
Two menu-driven FORTRAN programs are described that simulate the evolution of DNA sequences in accordance with a user-specified model. This general stochastic model allows for an arbitrary stationary nucleotide composition and any transition-transversion bias during the process of base substitution. In addition, the user may define any hypothetical model tree according to which a family of sequences evolves. The programs suggest the computationally most inexpensive approach to generate nucleotide substitutions. Either reproducible or non-repeatable simulations, depending on the method of initializing the pseudo-random number generator, can be performed. The corresponding options are offered by the interface menu.
Renewable Substitutability Index: Maximizing Renewable Resource Use in Buildings
Directory of Open Access Journals (Sweden)
Ravi S. Srinivasan
2015-05-01
Full Text Available In order to achieve a material and energy balance in buildings that is sustainable in the long run, there is an urgent need to assess the renewable and non-renewable resources used in the manufacturing process and to progressively replace non-renewable resources with renewables. Such progressive disinvestment in the non-renewable resources that may be substituted with renewable resources is referred to as “Renewable Substitutability” and if implemented, this process will lead to a paradigm shift in the way building materials are manufactured. This paper discusses the development of a Renewable Substitutability Index (RSI that is designed to maximize the use of renewable resources in a building and quantifies the substitution process using solar emergy (i.e., the solar equivalent joules required for any item. The RSI of a building or a building component, i.e., floor or wall systems, etc., is the ratio of the renewable resources used during construction, including replacement and maintenance, to the building’s maximum renewable emergy potential. RSI values range between 0 and 1.0. A higher RSI achieves a low-energy building strategy promoting a higher order of sustainability by optimizing the use of renewables over a building’s lifetime from formation-extraction-manufacturing to maintenance, operation, demolition, and recycle.
Substitution as a Device of Grammatical Cohesion in English Contexts
Directory of Open Access Journals (Sweden)
Mohammad Reza Hasannejad
2012-05-01
Full Text Available The present study set out to investigate the effect of teaching substitution as a kind of grammatical cohesion on the true identification of confusing substitution elements with cohesive or non-cohesive roles in different contexts and also the production of modal, reporting and conditional contexts through clausal substitution acquaintance. To this end, the following procedures were taken. First 120 male and female EFL students were selected from Iranshahr Azad University. Having administered the language proficiency test, researchers selected 80 students as intermediate subjects according to their TOEFL band scores. First, pretests of cohesion identification (substitution and production of modal, reporting and conditional environments were administered to both control and experimental groups. Then, the experimental group was exposed to the teaching of the above-said above-mentioned cohesive device. Finally, post-tests of substitution elements’ identification and modal, reporting and conditional contexts’ production through clausal substitution familiarity were administered. The results showed that cohesive device treatment helped students on the true identification of substitution elements. Another finding proved that EFL students might have no difficulty in learning certain rules or classification of rules and application of their clausal substitution knowledge in creating modal, reporting and conditional contexts. Our findings can have implications for the field of language learning and teaching.
Classifying Coding DNA with Nucleotide Statistics
Directory of Open Access Journals (Sweden)
Nicolas Carels
2009-10-01
Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.
Genetic diversity of three surface protein genes in Plasmodium malariae from three Asian countries.
Srisutham, Suttipat; Saralamba, Naowarat; Sriprawat, Kanlaya; Mayxay, Mayfong; Smithuis, Frank; Nosten, Francois; Pukrittayakamee, Sasithon; Day, Nicholas P J; Dondorp, Arjen M; Imwong, Mallika
2018-01-11
Genetic diversity of the three important antigenic proteins, namely thrombospondin-related anonymous protein (TRAP), apical membrane antigen 1 (AMA1), and 6-cysteine protein (P48/45), all of which are found in various developmental stages of Plasmodium parasites is crucial for targeted vaccine development. While studies related to the genetic diversity of these proteins are available for Plasmodium falciparum and Plasmodium vivax, barely enough information exists regarding Plasmodium malariae. The present study aims to demonstrate the genetic variations existing among these three genes in P. malariae by analysing their diversity at nucleotide and protein levels. Three surface protein genes were isolated from 45 samples collected in Thailand (N = 33), Myanmar (N = 8), and Lao PDR (N = 4), using conventional polymerase chain reaction (PCR) assay. Then, the PCR products were sequenced and analysed using BioEdit, MEGA6, and DnaSP programs. The average pairwise nucleotide diversities (π) of P. malariae trap, ama1, and p48/45 were 0.00169, 0.00413, and 0.00029, respectively. The haplotype diversities (Hd) of P. malariae trap, ama1, and p48/45 were 0.919, 0.946, and 0.130, respectively. Most of the nucleotide substitutions were non-synonymous, which indicated that the genetic variations of these genes were maintained by positive diversifying selection, thus, suggesting their role as a potential target of protective immune response. Amino acid substitutions of P. malariae TRAP, AMA1, and P48/45 could be categorized to 17, 20, and 2 unique amino-acid variants, respectively. For further vaccine development, carboxyl terminal of P48/45 would be a good candidate according to conserved amino acid at low genetic diversity (π = 0.2-0.3). High mutational diversity was observed in P. malariae trap and ama1 as compared to p48/45 in P. malariae samples isolated from Thailand, Myanmar, and Lao PDR. Taken together, these results suggest that P48/45 might be a good vaccine
Steck, Andrea K; Xu, Ping; Geyer, Susan; Redondo, Maria J; Antinozzi, Peter; Wentworth, John M; Sosenko, Jay; Onengut-Gumuscu, Suna; Chen, Wei-Min; Rich, Stephen S; Pugliese, Alberto
2017-08-01
Genome-wide association studies identified >50 type 1 diabetes (T1D) associated non-human leukocyte antigens (non-HLA) loci. The purpose of this study was to assess the contribution of non-HLA single nucleotide polymorphisms (SNPs) to risk of disease progression. The TrialNet Pathway to Prevention Study follows relatives of T1D patients for development of autoantibodies (Abs) and T1D. Using the Immunochip, we analyzed 53 diabetes-associated, non-HLA SNPs in 1016 Ab-positive, at-risk non-Hispanic white relatives. Effect of SNPs on the development of multiple Abs and T1D. Cox proportional analyses included all substantial non-HLA SNPs, HLA genotypes, relationship to proband, sex, age at initial screening, initial Ab type, and number. Factors involved in progression from single to multiple Abs included age at screening, relationship to proband, HLA genotypes, and rs3087243 (cytotoxic T lymphocyte antigen-4). Significant factors for diabetes progression included age at screening, Ab number, HLA genotypes, rs6476839 [GLIS family zinc finger 3 (GLIS3)], and rs3184504 [SH2B adaptor protein 3 (SH2B3)]. When glucose area under the curve (AUC) was included, factors involved in disease progression included glucose AUC, age at screening, Ab number, relationship to proband, HLA genotypes, rs6476839 (GLIS3), and rs7221109 (CCR7). In stratified analyses by age, glucose AUC, age at screening, sibling, HLA genotypes, rs6476839 (GLIS3), and rs4900384 (C14orf64) were significantly associated with progression to diabetes in participants <12 years old, whereas glucose AUC, sibling, rs3184504 (SH2B3), and rs4900384 (C14orf64) were significant in those ≥12. In conclusion, we identified five non-HLA SNPs associated with increased risk of progression from Ab positivity to disease that may improve risk stratification for prevention trials. Copyright © 2017 by the Endocrine Society
Directory of Open Access Journals (Sweden)
Guosheng Su
Full Text Available Non-additive genetic variation is usually ignored when genome-wide markers are used to study the genetic architecture and genomic prediction of complex traits in human, wild life, model organisms or farm animals. However, non-additive genetic effects may have an important contribution to total genetic variation of complex traits. This study presented a genomic BLUP model including additive and non-additive genetic effects, in which additive and non-additive genetic relation matrices were constructed from information of genome-wide dense single nucleotide polymorphism (SNP markers. In addition, this study for the first time proposed a method to construct dominance relationship matrix using SNP markers and demonstrated it in detail. The proposed model was implemented to investigate the amounts of additive genetic, dominance and epistatic variations, and assessed the accuracy and unbiasedness of genomic predictions for daily gain in pigs. In the analysis of daily gain, four linear models were used: 1 a simple additive genetic model (MA, 2 a model including both additive and additive by additive epistatic genetic effects (MAE, 3 a model including both additive and dominance genetic effects (MAD, and 4 a full model including all three genetic components (MAED. Estimates of narrow-sense heritability were 0.397, 0.373, 0.379 and 0.357 for models MA, MAE, MAD and MAED, respectively. Estimated dominance variance and additive by additive epistatic variance accounted for 5.6% and 9.5% of the total phenotypic variance, respectively. Based on model MAED, the estimate of broad-sense heritability was 0.506. Reliabilities of genomic predicted breeding values for the animals without performance records were 28.5%, 28.8%, 29.2% and 29.5% for models MA, MAE, MAD and MAED, respectively. In addition, models including non-additive genetic effects improved unbiasedness of genomic predictions.
Directory of Open Access Journals (Sweden)
Nengyi Zhang
2010-04-01
Full Text Available Central carbon metabolism (CCM is a fundamental component of life. The participating genes and enzymes are thought to be structurally and functionally conserved across and within species. Association mapping utilizes a rich history of mutation and recombination to achieve high resolution mapping. Therefore, applying association mapping in maize (Zea mays ssp. mays, the most diverse model crop species, to study the genetics of CCM is a particularly attractive system.We used a maize diversity panel to test the CCM functional conservation. We found heritable variation in enzyme activity for every enzyme tested. One of these enzymes was the NAD-dependent isocitrate dehydrogenase (IDH, E.C. 1.1.1.41, in which we identified a novel amino-acid substitution in a phylogenetically conserved site. Using candidate gene association mapping, we identified that this non-synonymous polymorphism was associated with IDH activity variation. The proposed mechanism for the IDH activity variation includes additional components regulating protein level. With the comparison of sequences from maize and teosinte (Zea mays ssp. Parviglumis, the maize wild ancestor, we found that some CCM genes had also been targeted for selection during maize domestication.Our results demonstrate the efficacy of association mapping for dissecting natural variation in primary metabolic pathways. The considerable genetic diversity observed in maize CCM genes underlies heritable phenotypic variation in enzyme activities and can be useful to identify putative functional sites.
Bretteville-Jensen, Anne Line; Lillehagen, Mats; Gjersing, Linn; Andreas, Jasmina Burdzovic
2015-02-01
Diversion of opioid substitution drugs (OSD) is of public concern. This study examined the prevalence, frequency, and predictors of illicit OSD use in a group of injecting drug users (IDUs) and assessed if such use was associated with non-fatal overdoses. Semi-annual cross-sectional interviews conducted in Oslo, Norway (2006-2013), from 1355 street-recruited IDUs. Hurdle, logistic, and multinomial regression models were employed. Overall, 27% reported illicit OSD use in the past four weeks; 16.8% methadone, 12.5% buprenorphine, and 2.9% both drugs. Almost 1/10 reported at least one non-fatal overdose in the past four weeks, and roughly 1/3 reported such experience in the past year. Use of additional drugs tended to be equally, or more prevalent among illicit OSD users than other IDUs. In terms of illicit OSD use being a risk factor for non-lethal overdoses, our results showed significant associations only for infrequent buprenorphine use (using once or less than once per week). Other factors associated with non-fatal overdoses included age, education, homelessness, as well as the benzodiazepines, stimulants, and heroin use. Users of diverted OSD may represent a high-risk population, as they used more additional drugs and used them more frequently than other IDUs. However, illicit OSD use may be less harmful than previously assumed. After accounting for an extensive set of covariates, only infrequent illicit buprenorphine use, but not methadone use, was associated with non-fatal overdoses. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Duarte, Margarida; Carvalho, Carina; Bernardo, Susana; Barros, Sílvia Vanessa; Benevides, Sandra; Flor, Lídia; Monteiro, Madalena; Marques, Isabel; Henriques, Margarida; Barros, Sílvia C; Fagulha, Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel
2015-10-01
Rabbit haemorrhagic disease virus 2 (RHDV2) is widespread in several countries of Western Europe, but it has not been introduced to other continents. However, between late 2014 and early 2015, the presence of RHDV2 was confirmed outside of the European continent, in the Azores, initially in the islands of Graciosa, Flores, S. Jorge and Terceira. In this study we report the subsequent detection of RHDV2 in wild rabbits from the islands of Faial, St. Maria and S. Miguel, and display the necropsy and microscopic examination data obtained, which showed lesions similar to those induced by classical strains of RHDV, with severe affection of lungs and liver. We also disclose the result of a genetic investigation carried out with RHDV2 positive samples from wild rabbits found dead in the seven islands. Partial vp60 sequences were amplified from 27 tissue samples. Nucleotide analysis showed that the Azorean strains are closely related to each other, sharing a high genetic identity (>99.15%). None of the obtained sequences were identical to any RHDV2 sequence publically known, hampering a clue for the source of the outbreaks. However, Bayesian and maximum likelihood phylogenetic analyses disclosed that Azorean strains are more closely related to a few strains from Southern Portugal than with any others presently known. In the analysed region comprising the terminal 942 nucleotides of the vp60 gene, four new single nucleotide polymorphisms (SNP) were identified. Based on the present data, these four SNPs, which are unique in the strains from Azores, may constitute putative molecular geographic markers for Azorean RHDV2 strains, if they persist in the future. One of these variations is a non-synonymous substitution that involves the replacement of one amino acid in a hypervariable region of the capsid protein. Copyright © 2015 Elsevier B.V. All rights reserved.
Identification of new food alternatives: how do consumers categorize meat and meat substitutes?
Hoek, A.C.; Boekel, van M.A.J.S.; Voordouw, J.; Luning, P.A.
2011-01-01
New meat substitutes need to be recognized as alternatives to meat. We therefore investigated which category representations consumers have of meat and meat substitutes. Thirty-four non-vegetarian participants performed a free sorting task with 17 meat products and 19 commercially available meat
Carter, Tamar E.; Boulter, Alexis; Existe, Alexandre; Romain, Jean R.; St. Victor, Jean Yves; Mulligan, Connie J.; Okech, Bernard A.
2015-01-01
Antimalarial drugs are a key tool in malaria elimination programs. With the emergence of artemisinin resistance in southeast Asia, an effort to identify molecular markers for surveillance of resistant malaria parasites is underway. Non-synonymous mutations in the kelch propeller domain (K13-propeller) in Plasmodium falciparum have been associated with artemisinin resistance in samples from southeast Asia, but additional studies are needed to characterize this locus in other P. falciparum populations with different levels of artemisinin use. Here, we sequenced the K13-propeller locus in 82 samples from Haiti, where limited government oversight of non-governmental organizations may have resulted in low-level use of artemisinin-based combination therapies. We detected a single-nucleotide polymorphism (SNP) at nucleotide 1,359 in a single isolate. Our results contribute to our understanding of the global genomic diversity of the K13-propeller locus in P. falciparum populations. PMID:25646258
A New Synonym of Odontochilus saprophyticus (Goodyerinae: Orchidoideae: Orchidaceae
Directory of Open Access Journals (Sweden)
Huai-Zhen Tian
2014-06-01
Full Text Available Zeuxine hainanensis H. Xu, H. J. Yang & Y. D. Li is treated as a heterotypic synonym of Odontochilus saprophyticus (Aver. Ormerod in the present communication. Detailed description and relevant photographs are provided to facilitate identification of the species.
Energy and the non-energy inputs substitution: evidence for Italy, Portugal and Spain
International Nuclear Information System (INIS)
Medina, J.; Vega-Cervera, J.A.
2001-01-01
The factor demand is modeled for Italy, Portugal and Spain. We estimated a translog cost function with capital, labor and energy over the 1980-1996 period. Our objective regarding energy as input was two-fold: on the one hand, to verify its incorporation as a productive factor, and, on the other, to observe its degree of substitutability with the other classical factors, given the high level of energy dependency of these countries. Using a separability test and confidence intervals for the Allen and price elasticities, our estimates confirmed both the nonseparability of the energy input and the existence of consistent substitution between energy and labor only for Italy. (author)
Preparation and Reaction Chemistry of Novel Silicon-Substituted 1,3-Dienes
Directory of Open Access Journals (Sweden)
Partha P. Choudhury
2015-09-01
Full Text Available 2-Silicon-substituted 1,3-dienes containing non transferrable groups known to promote transmetallation were prepared by Grignard chemistry and enyne metathesis. These dienes participated in one pot metathesis/Diels-Alder reactions in regio- and diastereoselective fashions. Electron-rich alkenes showed the fastest rates in metathesis reactions, and ethylene, a commonly used metathesis promoter slowed enyne metathesis. 2-Pyridyldimethylsilyl and 2-thienyldimethylsilyl substituted Diels-Alder cycloadducts participated in cross-coupling chemistry and the 2-thienyldimethylsilyl substituted cycloadducts underwent cross-coupling under very mild reaction conditions.
Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.
Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris
2004-07-14
With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.
Synonyms, Antonyms, and Retroactive Inhibition with Meaningful Material
Weisshed, Ethel
1973-01-01
The determination of the extent to which generalizations derived from studies of rote verbal learning, particularly paired-associate learning applied to highly meaningful materials, was the focus of this study. It was found that discriminating tags to synonyms and antonyms permitting the application of appropriate transfer rules may be attached.…
Supplementary Material for: The arabidopsis cyclic nucleotide interactome
Donaldson, Lara; Meier, Stuart; Gehring, Christoph A
2016-01-01
Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
Simple, heart-smart substitutions
Coronary artery disease - heart smart substitutions; Atherosclerosis - heart smart substitutions; Cholesterol - heart smart substitutions; Coronary heart disease - heart smart substitutions; Healthy diet - heart ...
Demarest, Stefaan; Molenberghs, Geert; Van der Heyden, Johan; Gisle, Lydia; Van Oyen, Herman; de Waleffe, Sandrine; Van Hal, Guido
2017-11-01
Substitution of non-participating households is used in the Belgian Health Interview Survey (BHIS) as a method to obtain the predefined net sample size. Yet, possible effects of applying substitution on response rates and health estimates remain uncertain. In this article, the process of substitution with its impact on response rates and health estimates is assessed. The response rates (RR)-both at household and individual level-according to the sampling criteria were calculated for each stage of the substitution process, together with the individual accrual rate (AR). Unweighted and weighted health estimates were calculated before and after applying substitution. Of the 10,468 members of 4878 initial households, 5904 members (RRind: 56.4%) of 2707 households (RRhh: 55.5%) participated. For the three successive (matched) substitutes, the RR dropped to 45%. The composition of the net sample resembles the one of the initial samples. Applying substitution did not produce any important distorting effects on the estimates. Applying substitution leads to an increase in non-participation, but does not impact the estimations.
Azarian, Taj; Ali, Afsar; Johnson, Judith A; Mohr, David; Prosperi, Mattia; Veras, Nazle M; Jubair, Mohammed; Strickland, Samantha L; Rashid, Mohammad H; Alam, Meer T; Weppelmann, Thomas A; Katz, Lee S; Tarr, Cheryl L; Colwell, Rita R; Morris, J Glenn; Salemi, Marco
2014-12-23
Phylodynamic analysis of genome-wide single-nucleotide polymorphism (SNP) data is a powerful tool to investigate underlying evolutionary processes of bacterial epidemics. The method was applied to investigate a collection of 65 clinical and environmental isolates of Vibrio cholerae from Haiti collected between 2010 and 2012. Characterization of isolates recovered from environmental samples identified a total of four toxigenic V. cholerae O1 isolates, four non-O1/O139 isolates, and a novel nontoxigenic V. cholerae O1 isolate with the classical tcpA gene. Phylogenies of strains were inferred from genome-wide SNPs using coalescent-based demographic models within a Bayesian framework. A close phylogenetic relationship between clinical and environmental toxigenic V. cholerae O1 strains was observed. As cholera spread throughout Haiti between October 2010 and August 2012, the population size initially increased and then fluctuated over time. Selection analysis along internal branches of the phylogeny showed a steady accumulation of synonymous substitutions and a progressive increase of nonsynonymous substitutions over time, suggesting diversification likely was driven by positive selection. Short-term accumulation of nonsynonymous substitutions driven by selection may have significant implications for virulence, transmission dynamics, and even vaccine efficacy. Cholera, a dehydrating diarrheal disease caused by toxigenic strains of the bacterium Vibrio cholerae, emerged in 2010 in Haiti, a country where there were no available records on cholera over the past 100 years. While devastating in terms of morbidity and mortality, the outbreak provided a unique opportunity to study the evolutionary dynamics of V. cholerae and its environmental presence. The present study expands on previous work and provides an in-depth phylodynamic analysis inferred from genome-wide single nucleotide polymorphisms of clinical and environmental strains from dispersed geographic settings in
Mäkinen, Outi Elina; Wanhalinna, Viivi; Zannini, Emanuele; Arendt, Elke Karin
2016-01-01
A growing number of consumers opt for plant-based milk substitutes for medical reasons or as a lifestyle choice. Medical reasons include lactose intolerance, with a worldwide prevalence of 75%, and cow's milk allergy. Also, in countries where mammal milk is scarce and expensive, plant milk substitutes serve as a more affordable option. However, many of these products have sensory characteristics objectionable to the mainstream western palate. Technologically, plant milk substitutes are suspensions of dissolved and disintegrated plant material in water, resembling cow's milk in appearance. They are manufactured by extracting the plant material in water, separating the liquid, and formulating the final product. Homogenization and thermal treatments are necessary to improve the suspension and microbial stabilities of commercial products that can be consumed as such or be further processed into fermented dairy-type products. The nutritional properties depend on the plant source, processing, and fortification. As some products have extremely low protein and calcium contents, consumer awareness is important when plant milk substitutes are used to replace cow's milk in the diet, e.g. in the case of dairy intolerances. If formulated into palatable and nutritionally adequate products, plant-based substitutes can offer a sustainable alternative to dairy products.
Directory of Open Access Journals (Sweden)
Geldner Niko
2005-02-01
Full Text Available Abstract Background Small G proteins, which are essential regulators of multiple cellular functions, are activated by guanine nucleotide exchange factors (GEFs that stimulate the exchange of the tightly bound GDP nucleotide by GTP. The catalytic domain responsible for nucleotide exchange is in general associated with non-catalytic domains that define the spatio-temporal conditions of activation. In the case of small G proteins of the Arf subfamily, which are major regulators of membrane trafficking, GEFs form a heterogeneous family whose only common characteristic is the well-characterized Sec7 catalytic domain. In contrast, the function of non-catalytic domains and how they regulate/cooperate with the catalytic domain is essentially unknown. Results Based on Sec7-containing sequences from fully-annotated eukaryotic genomes, including our annotation of these sequences from Paramecium, we have investigated the domain architecture of large ArfGEFs of the BIG and GBF subfamilies, which are involved in Golgi traffic. Multiple sequence alignments combined with the analysis of predicted secondary structures, non-structured regions and splicing patterns, identifies five novel non-catalytic structural domains which are common to both subfamilies, revealing that they share a conserved modular organization. We also report a novel ArfGEF subfamily with a domain organization so far unique to alveolates, which we name TBS (TBC-Sec7. Conclusion Our analysis unifies the BIG and GBF subfamilies into a higher order subfamily, which, together with their being the only subfamilies common to all eukaryotes, suggests that they descend from a common ancestor from which species-specific ArfGEFs have subsequently evolved. Our identification of a conserved modular architecture provides a background for future functional investigation of non-catalytic domains.
Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai
2011-01-01
Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702
Directory of Open Access Journals (Sweden)
William Amos
Full Text Available The "heterozygote instability" (HI hypothesis suggests that gene conversion events focused on heterozygous sites during meiosis locally increase the mutation rate, but this hypothesis remains largely untested. As humans left Africa they lost variability, which, if HI operates, should have reduced the mutation rate in non-Africans. Relative substitution rates were quantified in diverse humans using aligned whole genome sequences from the 1,000 genomes project. Substitution rate is consistently greater in Africans than in non-Africans, but only in diploid regions of the genome, consistent with a role for heterozygosity. Analysing the same data partitioned into a series of non-overlapping 2 Mb windows reveals a strong, non-linear correlation between the amount of heterozygosity lost "out of Africa" and the difference in substitution rate between Africans and non-Africans. Putative recent mutations, derived variants that occur only once among the 80 human chromosomes sampled, occur preferentially at the centre of 2 Kb windows that have elevated heterozygosity compared both with the same region in a closely related population and with an immediately adjacent region in the same population. More than half of all substitutions appear attributable to variation in heterozygosity. This observation provides strong support for HI with implications for many branches of evolutionary biology.
Hoek, A.C.; Elzerman, J.E.; Hageman, R.; Kok, F.J.; Luning, P.A.; Graaf, de C.
2013-01-01
The overall aim of this study was to explore long-term consumer acceptance of new environmentally sustainable alternatives to meat. We investigated whether meat substitutes, which are relatively new food products, would be better appreciated after repeated consumption. Eighty-nine non-vegetarian
Biomaterials in search of a meniscus substitute.
Rongen, Jan J; van Tienen, Tony G; van Bochove, Bas; Grijpma, Dirk W; Buma, Pieter
2014-04-01
The menisci fulfill key biomechanical functions in the tibiofemoral (knee) joint. Unfortunately meniscal injuries are quite common and most often treated by (partial) meniscectomy. However, some patients experience enduring symptoms, and, more importantly, it leads to an increased risk for symptomatic osteoarthritis. Over the past decades, researchers have put effort in developing a meniscal substitute able to prevent osteoarthritis and treat enduring clinical symptoms. Grossly, two categories of substitutes are observed: First, a resorbable scaffold mimicking biomechanical function which slowly degrades while tissue regeneration and organization is promoted. Second, a non resorbable, permanent implant which mimics the biomechanical function of the native meniscus. Numerous biomaterials with different (material) properties have been used in order to provide such a substitute. Nevertheless, a clinically applicable cartilage protecting material is not yet emerged. In the current review we provide an overview, and discuss, these different materials and extract recommendations regarding material properties for future developmental research. Copyright © 2014 Elsevier Ltd. All rights reserved.
Substitute fluid examinations for liquid manure
Directory of Open Access Journals (Sweden)
Schrader Kevin
2017-01-01
Full Text Available For the farming industry it is essential to use liquid manure as natural fertilizer. Through new agricultural regulation 2015 in Germany the industry must develop new liquid manure spreader systems because the ammonia and methane emission are limited. In a research project the University of Applied Sciences Zwickau and some other industry partners will develop such a new innovative liquid manure spreader. The new liquid manure spreader should use pulsating air to distribute the liquid manure exactly. The pulsating air, which flows through the pipelines, should be analysed at a test station. For examinations at this test station it is important to find another substitute fluid because liquid manure smells strong, is not transparent and is also not homogeneous enough for scientific investigations. Furthermore it is important to ensure that the substitute fluid is, like liquid manure, a non-Newtonian fluid. The substitute fluid must be a shear-thinning substance - this means the viscosity decrease at higher shear rate. Many different samples like soap-water-farragoes, jelly-water-farragoes, agar-water-farragoes, soap-ethanol-farragoes and more are, for the project, examined in regard of their physical properties to find the best substitute fluid. The samples are examined at the rotational viscometer for viscosity at various shear rates and then compared with the viscosity values of liquid manure.
Substitute fluid examinations for liquid manure
Schrader, Kevin; Riedel, Marco; Eichert, Helmut
For the farming industry it is essential to use liquid manure as natural fertilizer. Through new agricultural regulation 2015 in Germany the industry must develop new liquid manure spreader systems because the ammonia and methane emission are limited. In a research project the University of Applied Sciences Zwickau and some other industry partners will develop such a new innovative liquid manure spreader. The new liquid manure spreader should use pulsating air to distribute the liquid manure exactly. The pulsating air, which flows through the pipelines, should be analysed at a test station. For examinations at this test station it is important to find another substitute fluid because liquid manure smells strong, is not transparent and is also not homogeneous enough for scientific investigations. Furthermore it is important to ensure that the substitute fluid is, like liquid manure, a non-Newtonian fluid. The substitute fluid must be a shear-thinning substance - this means the viscosity decrease at higher shear rate. Many different samples like soap-water-farragoes, jelly-water-farragoes, agar-water-farragoes, soap-ethanol-farragoes and more are, for the project, examined in regard of their physical properties to find the best substitute fluid. The samples are examined at the rotational viscometer for viscosity at various shear rates and then compared with the viscosity values of liquid manure.
Agus Budi Setyawan; Yudi Irawan Chandra, SKom, MMSI
2005-01-01
This writing describes the application of the proverb, synonym, antonym, and dictionaries Indonesian. Basically, this application to find out about the meaning of the proverb, synonym, antonym and meaning of the word in Indonesian. For that the author wanted to show them in computerized form using Microsoft Visual Basic 6.0. by presenting it in the form of computerized data that the authors hope that we get a more accurate or the possibility of error becomes smaller. Also expected this appli...
Directory of Open Access Journals (Sweden)
Rostislav V Shevchenko
2014-10-01
Full Text Available In the last decade, a new class of natural biomaterials derived from de-fatted soybean flour processed by either thermoset or extraction procedures has been developed. These biomaterials uniquely combine adaptability to various clinical applications to proven tissue regeneration properties. In the present work, the biomaterials were formulated either as hydrogel or as paste formulation and their potential as wound dressing material or as dermal substitute was assessed by two in vivo models in pig skin: The healing full-thickness punch biopsy model and the non-healing full-thickness polytetrafluoroethylene (PTFE chamber model. The results clearly show that collagen deposition is induced by the presence of these biomaterials. A unique pattern of early inflammatory response, eliciting neutrophils and controlling macrophage infiltration, is followed by tissue cell colonization of the wound bed with a significant deposition of collagen fibers. The study also highlighted the importance in the use of optimal formulations and appropriate handling upon implantation. In large size, non-healing wounds, wound dermis was best obtained with the paste formulation as hydrogels appeared to be too loose to ensure lasting scaffolding properties. On the contrary, packing of the granules during the application of paste reduced biomaterial degradation rate and prevent the penetration of newly vascularized tissue, thus impeding grafting of split-thickness autologous skin grafts on the dermal substitute base.
Eosin-sensitized photooxidation of substituted phenylalanines and tyrosines
Energy Technology Data Exchange (ETDEWEB)
Rizzuto, F.; Spikes, J.D.
1977-01-01
The cosin-sensitized photooxidation of tyrosine and a number of compounds related to tyrosine (substituted phenylalanines) was studied by steady-state kinetic and flash photolysis techniques. In particular, the role of the phenolic group and the amino and carboxyl groups of the alanyl side chain in the photooxidation mechanism was investigated in detail. Several relationships between substrate structure and susceptibility to photooxidation as well as effects of substrate structure on photooxidation mechanisms were found. For example, phenylalanine is not photooxidizable, but substitution of electron-donating (activating) groups such as -OH (as in tyrosine) or -NH/sub 2/ (as in p-aminophenylalanine) results in rapidly photooxidized derivatives. However, substituting deactivating groups such as -Cl (as in p-chlorophenylalanine) or weakly activating groups such as -OCH/sub 3/ (as in 4-methoxyphenylalanine) result in non-photooxidizable derivatives. Substitution of additional activating groups to the ring of hydroxy-substituted phenylalanines results in increased rates of photooxidation, whereas additional deactivating groups result in decreased photooxidation rates. The rate-determining step in the photooxidation mechanism is shown to be dependent on the presence and position of an electron-donating substituent on the benzenoid ring. Only minor involvement of the side chain amino and carboxyl groups was found. Both singlet oxygen and hydrogen abstraction mechanisms are involved in the eosin-sensitized photooxidation of hydroxy-substituted phenylalanines (e.g., tyrosine). The hydrogen abstraction mechanism probably predominates at both pH 8 and 11.
The Use of Non-linguistic Data in a Terminology and Knowledge Bank
DEFF Research Database (Denmark)
Madsen, Bodil Nistrup
‘symbol’, non-verbal form’ and ‘non-linguistic form’ – are they synonymous designations of one data category or do they designate diff erent data categories? In the presentation we will discuss defi nitions from e.g. ISOcat, ISO 704:2009 and the DanTermBank taxonomy of terminological data categories......, and we will present some thoughts about the relevance of non-linguistic information in a national term bank....
Nucleotide composition bias and codon usage trends of gene ...
Indian Academy of Sciences (India)
2015-06-10
Jun 10, 2015 ... In a wide variety of organisms, synonymous codons are selected with different ... In addition, a series of GC skew and AT skew data was calculated for codon positions 1, ..... bias from different perspectives. Interestingly .... This study was supported by programme for Changjiang Scholars and Innovative ...
SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.
Singer, Maxine; Winocour, Ernest
2011-04-10
The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.
Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong
2017-03-01
Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.
Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.
2015-11-01
Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.
Kassem, Mona A; Juarez, Miguel; Gómez, Pedro; Mengual, Carmen M; Sempere, Raquel N; Plaza, María; Elena, Santiago F; Moreno, Aranzazu; Fereres, Alberto; Aranda, Miguel A
2013-11-01
The genetic variability of a Cucurbit aphid-borne yellows virus (CABYV) (genus Polerovirus, family Luteoviridae) population was evaluated by determining the nucleotide sequences of two genomic regions of CABYV isolates collected in open-field melon and squash crops during three consecutive years in Murcia (southeastern Spain). A phylogenetic analysis showed the existence of two major clades. The sequences did not cluster according to host, year, or locality of collection, and nucleotide similarities among isolates were 97 to 100 and 94 to 97% within and between clades, respectively. The ratio of nonsynonymous to synonymous nucleotide substitutions reflected that all open reading frames have been under purifying selection. Estimates of the population's genetic diversity were of the same magnitude as those previously reported for other plant virus populations sampled at larger spatial and temporal scales, suggesting either the presence of CABYV in the surveyed area long before it was first described, multiple introductions, or a particularly rapid diversification. We also determined the full-length sequences of three isolates, identifying the occurrence and location of recombination events along the CABYV genome. Furthermore, our field surveys indicated that Aphis gossypii was the major vector species of CABYV and the most abundant aphid species colonizing melon fields in the Murcia (Spain) region. Our surveys also suggested the importance of the weed species Ecballium elaterium as an alternative host and potential virus reservoir.
Goda, N; Mano, T; Kosintsev, P; Vorobiev, A; Masuda, R
2010-11-01
The allelic diversity of the DRB locus in major histocompatibility complex (MHC) genes was analyzed in the brown bear (Ursus arctos) from the Hokkaido Island of Japan, Siberia, and Kodiak of Alaska. Nineteen alleles of the DRB exon 2 were identified from a total of 38 individuals of U. arctos and were highly polymorphic. Comparisons of non-synonymous and synonymous substitutions in the antigen-binding sites of deduced amino acid sequences indicated evidence for balancing selection on the bear DRB locus. The phylogenetic analysis of the DRB alleles among three genera (Ursus, Tremarctos, and Ailuropoda) in the family Ursidae revealed that DRB allelic lineages were not separated according to species. This strongly shows trans-species persistence of DRB alleles within the Ursidae. © 2010 John Wiley & Sons A/S.
The distribution of synonymous codon choice in the translation initiation region of dengue virus.
Directory of Open Access Journals (Sweden)
Jian-hua Zhou
Full Text Available Dengue is the most common arthropod-borne viral (Arboviral illness in humans. The genetic features concerning the codon usage of dengue virus (DENV were analyzed by the relative synonymous codon usage, the effective number of codons and the codon adaptation index. The evolutionary distance between DENV and the natural hosts (Homo sapiens, Pan troglodytes, Aedes albopictus and Aedes aegypti was estimated by a novel formula. Finally, the synonymous codon usage preference for the translation initiation region of this virus was also analyzed. The result indicates that the general trend of the 59 synonymous codon usage of the four genotypes of DENV are similar to each other, and this pattern has no link with the geographic distribution of the virus. The effect of codon usage pattern of Aedes albopictus and Aedes aegypti on the formation of codon usage of DENV is stronger than that of the two primates. Turning to the codon usage preference of the translation initiation region of this virus, some codons pairing to low tRNA copy numbers in the two primates have a stronger tendency to exist in the translation initiation region than those in the open reading frame of DENV. Although DENV, like other RNA viruses, has a high mutation to adapt its hosts, the regulatory features about the synonymous codon usage have been 'branded' on the translation initiation region of this virus in order to hijack the translational mechanisms of the hosts.
Kai, M; Nakata, N; Matsuoka, M; Sekizuka, T; Kuroda, M; Makino, M
2013-10-01
Genome analysis of Mycobacterium leprae strain Kyoto-2 in this study revealed characteristic nucleotide substitutions in gene ML0411, compared to the reference genome M. leprae strain TN. The ML0411 gene of Kyoto-2 had six SNPs compared to that of TN. All SNPs in ML0411 were non-synonymous mutations that result in amino acid replacements. In addition, a seventh SNP was found 41 bp upstream of the start codon in the regulatory region. The seven SNP sites in the ML0411 region were investigated by sequencing in 36 M. leprae isolates from the Leprosy Research Center in Japan. The SNP pattern in 14 of the 36 isolates showed similarity to that of Kyoto-2. Determination of the standard SNP types within the 36 stocked isolates revealed that almost all of the Japanese strains belonged to SNP type III, with nucleotide substitutions at position 14676, 164275, and 2935685 of the M. leprae TN genome. The geographical distribution pattern of east Asian M. leprae isolates by discrimination of ML0411 SNPs was investigated and interestingly turned out to be similar to that of tandem repeat numbers of GACATC in the rpoT gene (3 copies or 4 copies), which has been established as a tool for M. leprae genotyping. All seven Korean M. leprae isolates examined in this study, as well as those derived from Honshu Island of Japan, showed 4 copies of the 6-base tandem repeat plus the ML0411 SNPs observed in M. leprae Kyoto-2. They are termed Northeast Asian (NA) strain of M. leprae. On the other hand, many of isolates derived from the Okinawa Islands of Japan and from the Philippines showed 3 copies of the 6-base tandem repeat in addition to the M. leprae TN ML0411 type of SNPs. These results demonstrate the existence of M. leprae strains in Northeast Asian region having characteristic SNP patterns. Copyright © 2013 Elsevier B.V. All rights reserved.
Fan, Ben; Blom, Jochen; Klenk, Hans-Peter; Borriss, Rainer
2017-01-01
The plant growth promoting model bacterium FZB42T was proposed as the type strain of Bacillus amyloliquefaciens subsp. plantarum (Borriss et al., 2011), but has been recently recognized as being synonymous to Bacillus velezensis due to phylogenomic analysis (Dunlap C. et al., 2016). However, until now, majority of publications consider plant-associated close relatives of FZB42 still as “B. amyloliquefaciens.” Here, we reinvestigated the taxonomic status of FZB42 and related strains in its context to the free-living soil bacterium DSM7T, the type strain of B. amyloliquefaciens. We identified 66 bacterial genomes from the NCBI data bank with high similarity to DSM7T. Dendrograms based on complete rpoB nucleotide sequences and on core genome sequences, respectively, clustered into a clade consisting of three tightly linked branches: (1) B. amyloliquefaciens, (2) Bacillus siamensis, and (3) a conspecific group containing the type strains of B. velezensis, Bacillus methylotrophicus, and B. amyloliquefaciens subsp. plantarum. The three monophyletic clades shared a common mutation rate of 0.01 substitutions per nucleotide position, but were distantly related to Bacillus subtilis (0.1 substitutions per nucleotide position). The tight relatedness of the three clusters was corroborated by TETRA, dDDH, ANI, and AAI analysis of the core genomes, but dDDH and ANI values were found slightly below species level thresholds when B. amyloliquefaciens DSM7T genome sequence was used as query sequence. Due to these results, we propose that the B. amyloliquefaciens clade should be considered as a taxonomic unit above of species level, designated here as “operational group B. amyloliquefaciens” consisting of the soil borne B. amyloliquefaciens, and plant associated B. siamensis and B. velezensis, whose members are closely related and allow identifying changes on the genomic level due to developing the plant-associated life-style. PMID:28163698
Fan, Ben; Blom, Jochen; Klenk, Hans-Peter; Borriss, Rainer
2017-01-01
The plant growth promoting model bacterium FZB42 T was proposed as the type strain of Bacillus amyloliquefaciens subsp. plantarum (Borriss et al., 2011), but has been recently recognized as being synonymous to Bacillus velezensis due to phylogenomic analysis (Dunlap C. et al., 2016). However, until now, majority of publications consider plant-associated close relatives of FZB42 still as " B. amyloliquefaciens ." Here, we reinvestigated the taxonomic status of FZB42 and related strains in its context to the free-living soil bacterium DSM7 T , the type strain of B. amyloliquefaciens . We identified 66 bacterial genomes from the NCBI data bank with high similarity to DSM7 T . Dendrograms based on complete rpoB nucleotide sequences and on core genome sequences, respectively, clustered into a clade consisting of three tightly linked branches: (1) B. amyloliquefaciens , (2) Bacillus siamensis , and (3) a conspecific group containing the type strains of B. velezensis, Bacillus methylotrophicus , and B. amyloliquefaciens subsp. plantarum . The three monophyletic clades shared a common mutation rate of 0.01 substitutions per nucleotide position, but were distantly related to Bacillus subtilis (0.1 substitutions per nucleotide position). The tight relatedness of the three clusters was corroborated by TETRA, dDDH, ANI, and AAI analysis of the core genomes, but dDDH and ANI values were found slightly below species level thresholds when B. amyloliquefaciens DSM7 T genome sequence was used as query sequence. Due to these results, we propose that the B. amyloliquefaciens clade should be considered as a taxonomic unit above of species level, designated here as "operational group B. amyloliquefaciens " consisting of the soil borne B. amyloliquefaciens , and plant associated B. siamensis and B. velezensis , whose members are closely related and allow identifying changes on the genomic level due to developing the plant-associated life-style.
Directory of Open Access Journals (Sweden)
Tapani Hovi
Full Text Available Vaccine derived poliovirus (VDPV type 2 strains strongly divergent from the corresponding vaccine strain, Sabin 2, were repeatedly isolated from sewage in Slovakia over a period of 22 months in 2003-2005. Cell cultures of stool specimens from known immune deficient patients and from an identified putative source population of 500 people failed to identify the potential excretor(s of the virus. The occurrence of VDPV in sewage stopped without any intervention. No paralytic cases were reported in Slovakia during the episode. According to a GenBank search and similarity plotting-analysis, the closest known relative of the first isolate PV2/03/SVK/E783 through all main sections of the genome was the type 2 poliovirus Sabin strain, with nucleotide identities in 5'UTR, P1, P2, P3, and 3'UTR parts of the genome of 88.6, 85.9, 87.3, 88.5, and 94.0 percent, respectively. Phenotypic properties of selected Slovakian aVDPV strains resembled those of VDPV strains isolated from immune deficient individuals with prolonged PV infection (iVDPV, including antigenic changes and moderate neurovirulence in the transgenic mouse model. One hundred and two unique VP1 coding sequences were determined from VDPV strains isolated from 34 sewage specimens. Nucleotide differences from Sabin 2 in the VP1 coding region ranged from 12.5 to 15.6 percent, and reached a maximum of 9.6 percent between the VDPV strains under study. Most of the nucleotide substitutions were synonymous but as many as 93 amino acid positions out of 301 in VP1 showed substitutions. We conclude that (1 individuals with prolonged poliovirus infection are not as rare as suggested by the studies on immune deficient patients known to the health care systems and (2 genetic divergence of VDPV strains may remain extensive during years long replication in humans.
Cannabis as a substitute for prescription drugs – a cross-sectional study
Corroon, James M; Mischley, Laurie K; Sexton, Michelle
2017-01-01
Background The use of medical cannabis is increasing, most commonly for pain, anxiety and depression. Emerging data suggest that use and abuse of prescription drugs may be decreasing in states where medical cannabis is legal. The aim of this study was to survey cannabis users to determine whether they had intentionally substituted cannabis for prescription drugs. Methods A total of 2,774 individuals were a self-selected convenience sample who reported having used cannabis at least once in the previous 90 days. Subjects were surveyed via an online anonymous questionnaire on cannabis substitution effects. Participants were recruited through social media and cannabis dispensaries in Washington State. Results A total of 1,248 (46%) respondents reported using cannabis as a substitute for prescription drugs. The most common classes of drugs substituted were narcotics/opioids (35.8%), anxiolytics/benzodiazepines (13.6%) and antidepressants (12.7%). A total of 2,473 substitutions were reported or approximately two drug substitutions per affirmative respondent. The odds of reporting substituting were 4.59 (95% confidence interval [CI], 3.87–5.43) greater among medical cannabis users compared with non-medical users and 1.66 (95% CI, 1.27–2.16) greater among those reporting use for managing the comorbidities of pain, anxiety and depression. A slightly higher percentage of those who reported substituting resided in states where medical cannabis was legal at the time of the survey (47% vs. 45%, p=0.58), but this difference was not statistically significant. Discussion These patient-reported outcomes support prior research that individuals are using cannabis as a substitute for prescription drugs, particularly, narcotics/opioids, and independent of whether they identify themselves as medical or non-medical users. This is especially true if they suffer from pain, anxiety and depression. Additionally, this study suggests that state laws allowing access to, and use of, medical
Dunlap, Christopher A; Kim, Soo-Jin; Kwon, Soon-Wo; Rooney, Alejandro P
2016-03-01
Bacillus velezensis was previously reported to be a later heterotypic synonym of Bacillus amyloliquefaciens , based primarily on DNA-DNA relatedness values. We have sequenced a draft genome of B. velezensis NRRL B-41580 T . Comparative genomics and DNA-DNA relatedness calculations show that it is not a synonym of B. amyloliquefaciens. It was instead synonymous with Bacillus methylotrophicus. ' Bacillus oryzicola ' is a recently described species that was isolated as an endophyte of rice ( Oryza sativa ). The strain was demonstrated to have plant-pathogen antagonist activity in greenhouse assays, and the 16S rRNA gene was reported to have 99.7 % sequence similarity with Bacillus siamensis and B. methylotrophicus , which are both known for their plant pathogen antagonism. To better understand the phylogenetics of these closely related strains, we sequenced the genome of ' B . oryzicola ' KACC 18228. Comparative genomic analysis showed only minor differences between this strain and the genomes of B. velezensis NRRL B-41580 T , B. methylotrophicus KACC 13015 T and Bacillus amyloliquefaciens subsp. plantarum FZB42 T . The pairwise in silico DNA-DNA hybridization values calculated in comparisons between the strains were all greater than 84 %, which is well above the standard species threshold of 70 %. The results of morphological, physiological, chemotaxonomic and phylogenetic analyses indicate that the strains share phenotype and genotype coherence. Therefore, we propose that B. methylotrophicus KACC 13015 T , B. amyloliquefaciens subsp. plantarum FZB42 T , and ' B. oryzicola' KACC 18228 should be reclassified as later heterotypic synonyms of B. velezensis NRRL B-41580 T , since the valid publication date of B. velezensis precedes the other three strains.
Directory of Open Access Journals (Sweden)
Claudia Trigo Pedroso Moraes
2015-02-01
Full Text Available Human respiratory syncytial virus (HRSV is an important respiratory pathogens among children between zero-five years old. Host immunity and viral genetic variability are important factors that can make vaccine production difficult. In this work, differences between biological clones of HRSV were detected in clinical samples in the absence and presence of serum collected from children in the convalescent phase of the illness and from their biological mothers. Viral clones were selected by plaque assay in the absence and presence of serum and nucleotide sequences of the G2 and F2 genes of HRSV biological clones were compared. One non-synonymous mutation was found in the F gene (Ile5Asn in one clone of an HRSV-B sample and one non-synonymous mutation was found in the G gene (Ser291Pro in four clones of the same HRSV-B sample. Only one of these clones was obtained after treatment with the child's serum. In addition, some synonymous mutations were determined in two clones of the HRSV-A samples. In conclusion, it is possible that minor sequences could be selected by host antibodies contributing to the HRSV evolutionary process, hampering the development of an effective vaccine, since we verify the same codon alteration in absence and presence of human sera in individual clones of BR-85 sample.
Moraes, Claudia Trigo Pedroso; Oliveira, Danielle Bruna Leal; Campos, Angelica Cristine Almeida; Bosso, Patricia Alves; Lima, Hildener Nogueira; Stewien, Klaus Eberhard; Gilio, Alfredo Elias; Vieira, Sandra Elisabete; Botosso, Viviane Fongaro; Durigon, Edison Luiz
2015-02-01
Human respiratory syncytial virus (HRSV) is an important respiratory pathogens among children between zero-five years old. Host immunity and viral genetic variability are important factors that can make vaccine production difficult. In this work, differences between biological clones of HRSV were detected in clinical samples in the absence and presence of serum collected from children in the convalescent phase of the illness and from their biological mothers. Viral clones were selected by plaque assay in the absence and presence of serum and nucleotide sequences of the G2 and F2 genes of HRSV biological clones were compared. One non-synonymous mutation was found in the F gene (Ile5Asn) in one clone of an HRSV-B sample and one non-synonymous mutation was found in the G gene (Ser291Pro) in four clones of the same HRSV-B sample. Only one of these clones was obtained after treatment with the child's serum. In addition, some synonymous mutations were determined in two clones of the HRSV-A samples. In conclusion, it is possible that minor sequences could be selected by host antibodies contributing to the HRSV evolutionary process, hampering the development of an effective vaccine, since we verify the same codon alteration in absence and presence of human sera in individual clones of BR-85 sample.
Dye, Natalie A; Pincus, Zachary; Fisher, Isabelle C; Shapiro, Lucy; Theriot, Julie A
2011-07-01
The maintenance of cell shape in Caulobacter crescentus requires the essential gene mreB, which encodes a member of the actin superfamily and the target of the antibiotic, A22. We isolated 35 unique A22-resistant Caulobacter strains with single amino acid substitutions near the nucleotide binding site of MreB. Mutations that alter cell curvature and mislocalize the intermediate filament crescentin cluster on the back surface of MreB's structure. Another subset have variable cell widths, with wide cell bodies and actively growing thin extensions of the cell poles that concentrate fluorescent MreB. We found that the extent to which MreB localization is perturbed is linearly correlated with the development of pointed cell poles and variable cell widths. Further, we find that a mutation to glycine of two conserved aspartic acid residues that are important for nucleotide hydrolysis in other members of the actin superfamily abolishes robust midcell recruitment of MreB but supports a normal rate of growth. These mutant strains provide novel insight into how MreB's protein structure, subcellular localization, and activity contribute to its function in bacterial cell shape. © 2011 Blackwell Publishing Ltd.
Base-By-Base: Single nucleotide-level analysis of whole viral genome alignments
Directory of Open Access Journals (Sweden)
Tcherepanov Vasily
2004-07-01
Full Text Available Abstract Background With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes is not feasible without new bioinformatics tools. Results A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1 rapidly identify and correct alignment errors in large, multiple genome alignments; and 2 generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs to retrieve detailed annotation information about the aligned genomes or use information from text files. Conclusion Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.
Missense Mutation in Fam83H Gene in Iranian Patients with Amelogenesis Imperfecta.
Pourhashemi, S Jalal; Ghandehari Motlagh, Mehdi; Meighani, Ghasem; Ebrahimi Takaloo, Azadeh; Mansouri, Mahsa; Mohandes, Fatemeh; Mirzaii, Maryam; Khoshzaban, Ahad; Moshtaghi, Faranak; Abedkhojasteh, Hoda; Heidari, Mansour
2014-12-01
Amelogenesis Imperfecta (AI) is a disorder of tooth development where there is an abnormal formation of enamel or the external layer of teeth. The aim of this study was to screen mutations in the four most important candidate genes, ENAM, KLK4, MMP20 and FAM83H responsible for amelogenesis imperfect. Geneomic DNA was isolated from five Iranian families with 22 members affected with enamel malformations. The PCR amplifications were typically carried out for amplification the coding regions for AI patients and unaffected family members. The PCR products were subjected to direct sequencing. The pedigree analysis was performed using Cyrillic software. One family had four affected members with autosomal dominant hypocalcified amelogenesis imperfecta (ADHPCAI); pedigree analysis revealed four consanguineous families with 18 patients with autosomal recessive hypoplastic amelogenesis imperfecta (ARHPAI). One non-synonymous single-nucleotide substitution, c.1150T>A, p. Ser 342Thr was identified in the FAM83H, which resulted in ADHCAI. Furthermore, different polymorphisms or unclassified variants were detected in MMP20, ENAM and KLK4. Our results are consistent with other studies and provide further evidence for pathogenic mutations of FAM83H gene. These findings suggest different loci and genes could be implicated in the pathogenesis of AI.
Directory of Open Access Journals (Sweden)
Jonathan W Arthur
2010-12-01
Full Text Available Enzymes encoded by the AKR1C1 and AKR1C2 genes are responsible for the metabolism of progesterone and 5α-dihydrotestosterone (DHT, respectively. The effect of amino acid substitutions, resulting from single nucleotide polymorphisms (SNPs in the AKR1C2 gene, on the enzyme kinetics of the AKR1C2 gene product were determined experimentally by Takashi et al. In this paper, we used homology modeling to predict and analyze the structure of AKR1C1 and AKR1C2 genetic variants. The experimental reduction in enzyme activity in the AKR1C2 variants F46Y and L172Q, as determined by Takahashi et al., is predicted to be due to increased instability in cofactor binding, caused by disruptions to the hydrogen bonds between NADP and AKR1C2, resulting from the insertion of polar residues into largely non-polar environments near the site of cofactor binding. Other AKR1C2 variants were shown to involve either conservative substitutions or changes taking place on the surface of the molecule and distant from the active site, confirming the experimental finding of Takahashi et al. that these variants do not result in any statistically significant reduction in enzyme activity. The AKR1C1 R258C variant is predicted to have no effect on enzyme activity for similar reasons. Thus, we provide further insight into the molecular mechanism of the enzyme kinetics of these proteins. Our data also highlight previously reported difficulties with online databases.
Directory of Open Access Journals (Sweden)
Miguel A Martín-Acebes
Full Text Available West Nile virus (WNV is a worldwide distributed mosquito-borne flavivirus that naturally cycles between birds and mosquitoes, although it can infect multiple vertebrate hosts including horses and humans. This virus is responsible for recurrent epidemics of febrile illness and encephalitis, and has recently become a global concern. WNV requires to transit through intracellular acidic compartments at two different steps to complete its infectious cycle. These include fusion between the viral envelope and the membrane of endosomes during viral entry, and virus maturation in the trans-Golgi network. In this study, we followed a genetic approach to study the connections between viral components and acidic pH. A WNV mutant with increased resistance to the acidotropic compound NH4Cl, which blocks organelle acidification and inhibits WNV infection, was selected. Nucleotide sequencing revealed that this mutant displayed a single amino acid substitution (Lys 3 to Glu on the highly basic internal capsid or core (C protein. The functional role of this replacement was confirmed by its introduction into a WNV infectious clone. This single amino acid substitution also increased resistance to other acidification inhibitor (concanamycin A and induced a reduction of the neurovirulence in mice. Interestingly, a naturally occurring accompanying mutation found on prM protein abolished the resistant phenotype, supporting the idea of a genetic crosstalk between the internal C protein and the external glycoproteins of the virion. The findings here reported unveil a non-previously assessed connection between the C viral protein and the acidic pH necessary for entry and proper exit of flaviviruses.
Martín-Acebes, Miguel A; Blázquez, Ana-Belén; de Oya, Nereida Jiménez; Escribano-Romero, Estela; Shi, Pei-Yong; Saiz, Juan-Carlos
2013-01-01
West Nile virus (WNV) is a worldwide distributed mosquito-borne flavivirus that naturally cycles between birds and mosquitoes, although it can infect multiple vertebrate hosts including horses and humans. This virus is responsible for recurrent epidemics of febrile illness and encephalitis, and has recently become a global concern. WNV requires to transit through intracellular acidic compartments at two different steps to complete its infectious cycle. These include fusion between the viral envelope and the membrane of endosomes during viral entry, and virus maturation in the trans-Golgi network. In this study, we followed a genetic approach to study the connections between viral components and acidic pH. A WNV mutant with increased resistance to the acidotropic compound NH4Cl, which blocks organelle acidification and inhibits WNV infection, was selected. Nucleotide sequencing revealed that this mutant displayed a single amino acid substitution (Lys 3 to Glu) on the highly basic internal capsid or core (C) protein. The functional role of this replacement was confirmed by its introduction into a WNV infectious clone. This single amino acid substitution also increased resistance to other acidification inhibitor (concanamycin A) and induced a reduction of the neurovirulence in mice. Interestingly, a naturally occurring accompanying mutation found on prM protein abolished the resistant phenotype, supporting the idea of a genetic crosstalk between the internal C protein and the external glycoproteins of the virion. The findings here reported unveil a non-previously assessed connection between the C viral protein and the acidic pH necessary for entry and proper exit of flaviviruses.
Renewable Substitutability Index: Maximizing Renewable Resource Use in Buildings
Srinivasan, Ravi; Campbell, Daniel; Wang, Wei
2015-01-01
In order to achieve a material and energy balance in buildings that is sustainable in the long run, there is an urgent need to assess the renewable and non-renewable resources used in the manufacturing process and to progressively replace non-renewable resources with renewables. Such progressive disinvestment in the non-renewable resources that may be substituted with renewable resources is referred to as “Renewable Substitutability” and if implemented, this process will lead to a paradigm sh...
Osborne, Colin S.; Leitner, Ingrid; Favre, Bertrand; Ryder, Neil S.
2005-01-01
There has only been one clinically confirmed case of terbinafine resistance in dermatophytes, where six sequential Trichophyton rubrum isolates from the same patient were found to be resistant to terbinafine and cross-resistant to other squalene epoxidase (SE) inhibitors. Microsomal SE activity from these resistant isolates was insensitive to terbinafine, suggesting a target-based mechanism of resistance (B. Favre, M. Ghannoum, and N. S. Ryder, Med. Mycol. 42:525-529, 2004). In this study, we have characterized at the molecular level the cause of the resistant phenotype of these clinical isolates. Cloning and sequencing of the SE gene and cDNA from T. rubrum revealed the presence of an intron in the gene and an open reading frame encoding a protein of 489 residues, with an equivalent similarity (57%) to both yeast and mammalian SEs. The nucleotide sequences of SE from two terbinafine-susceptible strains were identical whereas those of terbinafine-resistant strains, serially isolated from the same patient, each contained the same single missense introducing the amino acid substitution L393F. Introduction of the corresponding substitution in the Candida albicans SE gene (L398F) and expression of this gene in Saccharomyces cerevisiae conferred a resistant phenotype to the transformants when compared to those expressing the wild-type sequence. Terbinafine resistance in these T. rubrum clinical isolates appears to be due to a single amino acid substitution in SE. PMID:15980358
2012-04-24
... updating the non-regulatory provisions of the Georgia SIP to reflect the substitution. In summary, the... Regulations (CFR) part 52 are available for inspection at the following location: Environmental Protection... EPA's concurrence, the HOT lane substitution took effect as a matter of federal law. A copy of EPA's...
DEFF Research Database (Denmark)
Olsson, Erika; Wallach-Kildemoes, Helle; Ahmed, Ban
2017-01-01
OBJECTIVES: The objective was to study the relationship between the length and content of patient-pharmacist communication in community pharmacies, and generic substitution. METHODS: The study was conducted in six community pharmacies in Sweden. Non-participant observations with audio recordings...... for differences in time spent on different categories. KEY FINDINGS: In encounters where generic substitution occurred more time (19.2 s) was spent on non-medical (for instance administrative or economical) issues (P = 0.01, 95% confidence interval 4.8-33.6). However, the total time of the encounter...... to those with only elementary school education. CONCLUSIONS: Occurrence of generic substitution was correlated with more time spent on communicating on non-medical, but not on medical, issues. No extra time was spent on medical information for the groups normally overrepresented among those with low health...
Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase
International Nuclear Information System (INIS)
Aalto, T.K.; Raivio, K.O.
1990-01-01
Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage
Main: Nucleotide Analysis [KOME
Lifescience Database Archive (English)
Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...
Factor substitution, and economies of scale and utilisation in Kuwait's crude oil industry
International Nuclear Information System (INIS)
Al-Mutairi, Naief; Burney, Nadeem A.
2002-01-01
The cost structure of the crude oil industry in Kuwait has been examined, with specific focus on factor substitution, and economies of scale and utilisation. This has been done by estimating translog cost functions, both long-run and short-run, using time-series data covering the period from 1976 to 1996. The results indicate that the implied production structure is non-homothetic, and the pattern of scale effect is labour saving, but capital and material using. The evidence also supports the presence of an induced exogenous technical change, which is non-neutral (labour and capital using, and material saving). The elasticity of substitution between capital and labour is positive, implying that the two inputs are substitute. The results also indicate the existence of diseconomies of scale in the production of crude oil, but no economies or diseconomies of utilisation
Selected polyethylene glycols as DOP substitutes. Addendum 1
International Nuclear Information System (INIS)
Gerber, B.V.
1981-01-01
The recommendation is made that Polyethylene glycol (PEG) 400 be considered as a substitute for DOP in aerosol generators producing a polydisperse distribution for testing the integrity of filters and for testing respirator fit. Further, the recommendation is made that pentaethylene glycol (PTAEG) and possibly hexaethylene glycol be considered as a substitute for DOP in aerosol generators thermally producing monodisperse aerosol for quality acceptance tests according tu US federal specifications and standards. The toxicology data base available on the polyethylene glycol family of chemical compounds is discussed and the conclusion is drawn that the probability of approval and acceptance as a non-hazardous substance in the filter and filter media test role is high. Data and analysis supporting PTAEG performance equivalent to DOP in the filter and filter media test role are given or referenced. Cost and availability of the substitute materials is discussed. Conclusions based on the present data and information are given and recommendations for further work are made
Allele specific LAMP- gold nanoparticle for characterization of single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Fábio Ferreira Carlos
2017-12-01
Full Text Available Due to their relevance as disease biomarkers and for diagnostics, screening of single nucleotide polymorphism (SNPs requires simple and straightforward strategies capable to provide results in medium throughput settings. Suitable approaches relying on isothermal amplification techniques have been evolving to substitute the cumbersome and highly specialized PCR amplification detection schemes. Nonetheless, identification of an individualâs genotype still requires sophisticated equipment and laborious methods.Here, we present a low-cost and reliable approach based on the allele specific loop-mediated isothermal amplification (AS-LAMP coupled to ssDNA functionalized gold nanoparticle (Au-nanoprobe colorimetric sequence discrimination. The Au-nanoprobe integration allows for the colorimetric detection of AS-LAMP amplification product that can be easily interpreted in less than 15Â min. We targeted a clinical relevant SNP responsible for lactose intolerance (-13910C/T dbSNP rs#: 4988235 to demonstrate its proof of concept and full potential of this novel approach. Keywords: SNP, Isothermal amplification, Gold nanoparticles, Gold nanoprobes, Lactose intolerance
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Copper complex of (substituted... Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine salt... substances identified generically as copper complex of (substituted sulfonaphthyl azo substituted phenyl...
Zhang, Rui; Liu, Jialin; Huang, Yong; Wang, Miye; Shi, Qingke; Chen, Jun; Zeng, Zhi
2017-05-02
It has been shown that the entities in everyday clinical text are often expressed in a way that varies from how they are expressed in the nomenclature. Owing to lots of synonyms, abbreviations, medical jargons or even misspellings in the daily used physician notes in clinical information system (CIS), the terminology without enough synonyms may not be adequately suitable for the task of Chinese clinical term recognition. This paper demonstrates a validated system to retrieve the Chinese term of clinical finding (CTCF) from CIS and map them to the corresponding concepts of international clinical nomenclature, such as SNOMED CT. The system focuses on the SNOMED CT with Chinese synonyms enrichment (SCCSE). The literal similarity and the diagnosis-related similarity metrics were used for concept mapping. Two CTCF recognition methods, the rule- and terminology-based approach (RTBA) and the conditional random field machine learner (CRF), were adopted to identify the concepts in physician notes. The system was validated against the history of present illness annotated by clinical experts. The RTBA and CRF could be combined to predict new CTCFs besides SCCSE persistently. Around 59,000 CTCF candidates were accepted as valid and 39,000 of them occurred at least once in the history of present illness. 3,729 of them were accordant with the description in referenced Chinese clinical nomenclature, which could cross map to other international nomenclature such as SNOMED CT. With the hybrid similarity metrics, another 7,454 valid CTCFs (synonyms) were succeeded in concept mapping. For CTCF recognition in physician notes, a series of experiments were performed to find out the best CRF feature set, which gained an F-score of 0.887. The RTBA achieved a better F-score of 0.919 by the CTCF dictionary created in this research. This research demonstrated that it is feasible to help the SNOMED CT with Chinese synonyms enrichment based on physician notes in CIS. With continuous
Jiang, Yufeng; Lv, Huafei; Yu, Xinxin; Pan, Sujuan; Zhang, Tiantian; Huang, Yide; Wang, Yuhua; Xie, Shusen; Yang, Hongqin; Peng, Yiru
2017-06-01
Metal phthalocyanines (MPcs) are a very important class of widespread application compounds. They are not only used as dyes but also used as catalysts, data storage, electron charge carriers in photocopiers, photoconductors in chemical sensors, and photo-antenna devices in photosysthesis, photovoltaic cells. A particular application of Pcs is that it was used as a photosensitizers (PS) for treatment of certain cancer by photodynamic therapy of cancer and non-cancer diseases. However, the molecular aggregation of phthalocyanines, which is an intrinsic property of these large π-π conjugated systems, provides an efficient non-radioactive energy relaxation pathway, thereby shortening the excited state lifetimes, and reducing the photosensitizing and target efficiency. To overcome these problems, the introduction of axial ligands to phthalocyanine can prevent the formation of aggregation to some extend. In this paper, hematoxylin axially substituted tetra-α-(pentoxy) titanium (IV) phthalocyanine (TiPc(OC5H11)4-Hematoxylin) were characterized by elemental analysis, IR, 1H NMR, UV-Vis, fluorescence spectra. No obviously Q band change was observed after the hematoxylin was substituted at the peripheral position of substituted phthalocyanine ring. Because of the rigidity structure of the hematoxylin, the fluorescence intensity of hematoxylin peripheral substituted phthalocyanine decreased compared with free substituted phthalocyanines. The fluorescence lifetimes of axially substituted phthalocyanine was fitted to be 3.613 ns. This compound may be considered as a promising photosensitizer for PDT.
Taha, Hesham; Dove, Stefan; Geduhn, Jens; König, Burkhard; Shen, Yuequan; Tang, Wei-Jen; Seifert, Roland
2012-01-01
Bacillus anthracis causes anthrax disease and exerts its deleterious effects by the release of three exotoxins, i.e. lethal factor, protective antigen and edema factor (EF), a highly active calmodulin-dependent adenylyl cyclase (AC). Conventional antibiotic treatment is ineffective against either toxaemia or antibiotic-resistant strains. Thus, more effective drugs for anthrax treatment are needed. Our previous studies showed that EF is differentially inhibited by various purine and pyrimidine nucleotides modified with N-methylanthraniloyl (MANT)- or anthraniloyl (ANT) groups at the 2'(3')-O-ribosyl position, with the unique preference for the base cytosine (Taha et al., Mol Pharmacol 75:693 (2009)). MANT-CTP was the most potent EF inhibitor (K (i), 100 nM) among 16 compounds studied. Here, we examined the interaction of EF with a series of 18 2',3'-O-mono- and bis-(M)ANT-substituted nucleotides, recently shown to be very potent inhibitors of the AC toxin from Bordetella pertussis, CyaA (Geduhn et al., J Pharmacol Exp Ther 336:104 (2011)). We analysed purified EF and EF mutants in radiometric AC assays and in fluorescence spectroscopy studies and conducted molecular modelling studies. Bis-MANT nucleotides inhibited EF competitively. Propyl-ANT-ATP was the most potent EF inhibitor (K (i), 80 nM). In contrast to the observations made for CyaA, introduction of a second (M)ANT-group decreased rather than increased inhibitor potency at EF. Activation of EF by calmodulin resulted in effective fluorescence resonance energy transfer (FRET) from tryptophan and tyrosine residues located in the vicinity of the catalytic site to bis-MANT-ATP, but FRET to bis-MANT-CTP was only small. Mutations N583Q, K353A and K353R differentially altered the inhibitory potencies of bis-MANT-ATP and bis-MANT-CTP. The nucleotide binding site of EF accommodates bulky bis-(M)ANT-substituted purine and pyrimidine nucleotides, but the fit is suboptimal compared to CyaA. These data provide a basis
Substitution of Organic Solvents in Selected Industrial Cleaning Processes
DEFF Research Database (Denmark)
Jacobsen, Thomas; Rasmussen, Pia Brunn
1997-01-01
Volatile organic solvents (VOC)are becoming increasingly unwanted in industrial processes. Substitution of VOC with non-volatile, low-toxic compounds is a possibility to reduce VOC-use. It has been successfully demonstrated, that organic solvents used in cleaning processes in sheet offset printing...
A study in the lexicographical treatment of Arabic synonyms | Heliel ...
African Journals Online (AJOL)
Recently three dictionaries of Arabic synonyms were published with the aim of helping Arabic learners, writers and translators. Though Classical Arabic lexicography distinguishes itself in the field of synonymy, Modern Standard Arabic lacks reliable dictionaries in the field and hence the importance of analysing these three ...
Adsorption of nucleotides onto ferromagnesian phyllosilicates: Significance for the origin of life
Pedreira-Segade, Ulysse; Feuillie, Cécile; Pelletier, Manuel; Michot, Laurent J.; Daniel, Isabelle
2016-03-01
The concentration of prebiotic organic building blocks may have promoted the formation of biopolymers in the environment of the early Earth. We therefore studied the adsorption of RNA monomers AMP, GMP, CMP, and UMP, and DNA monomers dGMP, dCMP, and TMP, on minerals that were abundant in the early Earth environment as the result of aqueous or hydrothermal alteration of the primitive oceanic crust. We focused our study on swelling clays, i.e. nontronite and montmorillonite, and non-swelling phyllosilicates, i.e. pyrophyllite, chlorite, lizardite and chrysotile suspended in an aqueous saline solution analog to seawater. In this reference study, adsorption experiments were carried out under standard conditions of pressure and temperature and controlled pH. Under such conditions, this work is also relevant to the preservation of nucleic acids in Fe-Mg-rich terrestrial and Martian soils. We compared the adsorption of the different monomers on individual minerals, as well as the adsorption of single monomers on the whole suite of minerals. We found that DNA monomers adsorb much more strongly than RNA monomers, and that any monomer containing the G nucleobase adsorbed more strongly than one containing the C nucleobase. At high surface loadings (greater than about 1 mM monomer in aqueous solution) we also found a dramatic increase in the slope of adsorption isotherm on the swelling clays, leading to large increases in the amounts adsorbed. Data were processed in order to understand the adsorption mechanism of nucleotides onto mineral surfaces. We infer that all nucleotides behave as homologous molecules in regard to their adsorption onto the studied mineral surfaces. At low to moderate surface loadings, their adsorption is best explained by a single mechanism common to the suite of minerals of the present study. At pH 7, adsorption certainly proceeds by ligand exchange between the phosphate group and the hydroxyls of the broken edges of phyllosilicates leading to the
Olsson, Erika; Wallach-Kildemoes, Helle; Ahmed, Ban; Ingman, Pontus; Kaae, Susanne; Kälvemark Sporrong, Sofia
2017-08-01
The objective was to study the relationship between the length and content of patient-pharmacist communication in community pharmacies, and generic substitution. The study was conducted in six community pharmacies in Sweden. Non-participant observations with audio recordings and short structured interviews were conducted. Out of 32 pharmacists 29 agreed to participate (90.6%), as did 282 out of 407 patients (69.3%). Logistic regression analysis was applied to calculate odds ratio for occurrence of generic substitution. Linear regression (β-coefficients) was applied to test for differences in time spent on different categories. In encounters where generic substitution occurred more time (19.2 s) was spent on non-medical (for instance administrative or economical) issues (P = 0.01, 95% confidence interval 4.8-33.6). However, the total time of the encounter was not significantly longer. The amount of time spent on non-medical issues increased with age of patient (age 60+: β, 33 s, P communicating on non-medical, but not on medical, issues. No extra time was spent on medical information for the groups normally overrepresented among those with low health literacy. This study suggests that pharmacists need to further embrace their role in promoting rational use of medicines, not least when generic substitution occurs. © 2016 Royal Pharmaceutical Society.
Luo, Shanshan; Hipler, Uta-Christina; Münzberg, Christin; Skerka, Christine; Zipfel, Peter F
2015-01-01
Candida albicans, the important human fungal pathogen uses multiple evasion strategies to control, modulate and inhibit host complement and innate immune attack. Clinical C. albicans strains vary in pathogenicity and in serum resistance, in this work we analyzed sequence polymorphisms and variations in the expression levels of two central fungal complement evasion proteins, Gpm1 (phosphoglycerate mutase 1) and Pra1 (pH-regulated antigen 1) in thirteen clinical C. albicans isolates. Four nucleotide (nt) exchanges, all representing synonymous exchanges, were identified within the 747-nt long GPM1 gene. For the 900-nt long PRA1 gene, sixteen nucleotide exchanges were identified, which represented synonymous, as well as non-synonymous exchanges. All thirteen clinical isolates had a homozygous exchange (A to G) at position 73 of the PRA1 gene. Surface levels of Gpm1 varied by 8.2, and Pra1 levels by 3.3 fold in thirteen tested isolates and these differences influenced fungal immune fitness. The high Gpm1/Pra1 expressing candida strains bound the three human immune regulators more efficiently, than the low expression strains. The difference was 44% for Factor H binding, 51% for C4BP binding and 23% for plasminogen binding. This higher Gpm1/Pra1 expressing strains result in enhanced survival upon challenge with complement active, Factor H depleted human serum (difference 40%). In addition adhesion to and infection of human endothelial cells was increased (difference 60%), and C3b surface deposition was less effective (difference 27%). Thus, variable expression levels of central immune evasion protein influences immune fitness of the human fungal pathogen C. albicans and thus contribute to fungal virulence.
Cannabis as a substitute for prescription drugs – a cross-sectional study
Directory of Open Access Journals (Sweden)
Corroon Jr JM
2017-05-01
Full Text Available James M Corroon Jr,1 Laurie K Mischley,2 Michelle Sexton3 1Center for Medical Cannabis Education, Del Mar, CA, 2Bastyr University Research Institute, Kenmore, WA, 3Department of Medical Research, Center for the Study of Cannabis and Social Policy, Seattle, WA, USA Background: The use of medical cannabis is increasing, most commonly for pain, anxiety and depression. Emerging data suggest that use and abuse of prescription drugs may be decreasing in states where medical cannabis is legal. The aim of this study was to survey cannabis users to determine whether they had intentionally substituted cannabis for prescription drugs.Methods: A total of 2,774 individuals were a self-selected convenience sample who reported having used cannabis at least once in the previous 90 days. Subjects were surveyed via an online anonymous questionnaire on cannabis substitution effects. Participants were recruited through social media and cannabis dispensaries in Washington State.Results: A total of 1,248 (46% respondents reported using cannabis as a substitute for prescription drugs. The most common classes of drugs substituted were narcotics/opioids (35.8%, anxiolytics/benzodiazepines (13.6% and antidepressants (12.7%. A total of 2,473 substitutions were reported or approximately two drug substitutions per affirmative respondent. The odds of reporting substituting were 4.59 (95% confidence interval [CI], 3.87–5.43 greater among medical cannabis users compared with non-medical users and 1.66 (95% CI, 1.27–2.16 greater among those reporting use for managing the comorbidities of pain, anxiety and depression. A slightly higher percentage of those who reported substituting resided in states where medical cannabis was legal at the time of the survey (47% vs. 45%, p=0.58, but this difference was not statistically significant.Discussion: These patient-reported outcomes support prior research that individuals are using cannabis as a substitute for prescription drugs
Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi
2010-11-19
Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.
Meta-analysis of greenhouse gas displacement factors of wood product substitution
International Nuclear Information System (INIS)
Sathre, Roger; O'Connor, Jennifer
2010-01-01
A displacement factor can express the efficiency of using biomass to reduce net greenhouse gas (GHG) emission, by quantifying the amount of emission reduction achieved per unit of wood use. Here we integrate data from 21 different international studies in a meta-analysis of the displacement factors of wood products substituted in place of non-wood materials. We calculate the displacement factors in consistent units of tons of carbon (tC) of emission reduction per tC in wood product. The displacement factors range from a low of -2.3 to a high of 15, with most lying in the range of 1.0 to 3.0. The average displacement factor value is 2.1, meaning that for each tC in wood products substituted in place of non-wood products, there occurs an average GHG emission reduction of approximately 2.1 tC. Expressed in other units, this value corresponds to roughly 3.9 t CO 2 eq emission reduction per ton of dry wood used. The few cases of negative displacement factors are the result of worst-case scenarios that are unrealistic in current practice. This meta-analysis quantifies the range of GHG benefits of wood substitution, and provides a clear climate rationale for increasing wood substitution in place of other products, provided that forests are sustainably managed and that wood residues are used responsibly.
Meta-analysis of greenhouse gas displacement factors of wood product substitution
Energy Technology Data Exchange (ETDEWEB)
Sathre, Roger [Ecotechnology, Mid Sweden University, 83125 Ostersund (Sweden); O' Connor, Jennifer [FPInnovations-Forintek, Vancouver, BC, Canada V6T 1W5 (Canada)
2010-04-15
A displacement factor can express the efficiency of using biomass to reduce net greenhouse gas (GHG) emission, by quantifying the amount of emission reduction achieved per unit of wood use. Here we integrate data from 21 different international studies in a meta-analysis of the displacement factors of wood products substituted in place of non-wood materials. We calculate the displacement factors in consistent units of tons of carbon (tC) of emission reduction per tC in wood product. The displacement factors range from a low of -2.3 to a high of 15, with most lying in the range of 1.0 to 3.0. The average displacement factor value is 2.1, meaning that for each tC in wood products substituted in place of non-wood products, there occurs an average GHG emission reduction of approximately 2.1 tC. Expressed in other units, this value corresponds to roughly 3.9 t CO{sub 2} eq emission reduction per ton of dry wood used. The few cases of negative displacement factors are the result of worst-case scenarios that are unrealistic in current practice. This meta-analysis quantifies the range of GHG benefits of wood substitution, and provides a clear climate rationale for increasing wood substitution in place of other products, provided that forests are sustainably managed and that wood residues are used responsibly.
Rooting human parechovirus evolution in time
Directory of Open Access Journals (Sweden)
Benschop Kimberley
2009-07-01
Full Text Available Abstract Background The Picornaviridae family contains a number of important pathogenic viruses, among which the recently reclassified human parechoviruses (HPeVs. These viruses are widespread and can be grouped in several types. Understanding the evolutionary history of HPeV could answer questions such as how long the circulating lineages last shared a common ancestor and how the evolution of this viral species is shaped by its population dynamics. Using both strict and relaxed clock Bayesian phylogenetics we investigated 1 the substitutions rates of the structural P1 and capsid VP1 regions and 2 evolutionary timescale of currently circulating HPeV lineages. Results Our estimates reveal that human parechoviruses exhibit high substitution rates for both structural P1 and capsid VP1 regions, respectively 2.21 × 10-3 (0.48 – 4.21 × 10-3 and 2.79 × 10-3 (2.05 – 3.66 × 10-3 substitutions per site per year. These are within the range estimated for other picornaviruses. By employing a constant population size coalescent prior, the date of the most recent common ancestor was estimated to be at around 1600 (1427–1733. In addition, by looking at the frequency of synonymous and non-synonymous substitutions within the VP1 gene we show that purifying selection constitutes the dominating evolutionary force leading to strong amino acid conservation. Conclusion In conclusion, our estimates provide a timescale for the evolution of HPeVs and suggest that genetic diversity of current circulating HPeV types has arisen about 400 years ago.
Bacterial nucleotide-based second messengers.
Pesavento, Christina; Hengge, Regine
2009-04-01
In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.
Pecavar, Verena; Blaschitz, Marion; Hufnagl, Peter; Zeinzinger, Josef; Fiedler, Anita; Allerberger, Franz; Maass, Matthias; Indra, Alexander
2012-06-01
Clostridium difficile, a Gram-positive, spore-forming, anaerobic bacterium, is the main causative agent of hospital-acquired diarrhoea worldwide. In addition to metronidazole and vancomycin, rifaximin, a rifamycin derivative, is a promising antibiotic for the treatment of recurring C. difficile infections (CDI). However, exposure of C. difficile to this antibiotic has led to the development of rifaximin-resistance due to point mutations in the β-subunit of the RNA polymerase (rpoB) gene. In the present study, 348 C. difficile strains with known PCR-ribotypes were investigated for respective single nucleotide polymorphisms (SNPs) within the proposed rpoB hot-spot region by using high-resolution melting (HRM) analysis. This method allows the detection of SNPs by comparing the altered melting behaviour of dsDNA with that of wild-type DNA. Discrimination between wild-type and mutant strains was enhanced by creating heteroduplexes by mixing sample DNA with wild-type DNA, leading to characteristic melting curve shapes from samples containing SNPs in the respective rpoB section. In the present study, we were able to identify 16 different rpoB sequence-types (ST) by sequencing analysis of a 325 bp fragment. The 16 PCR STs displayed a total of 24 different SNPs. Fifteen of these 24 SNPs were located within the proposed 151 bp SNP hot-spot region, resulting in 11 different HRM curve profiles (CP). Eleven SNPs (seven of which were within the proposed hot-spot region) led to amino acid substitutions associated with reduced susceptibility to rifaximin and 13 SNPs (eight of which were within the hot-spot region) were synonymous. This investigation clearly demonstrates that HRM analysis of the proposed SNP hot-spot region in the rpoB gene of C. difficile is a fast and cost-effective method for the identification of C. difficile samples with reduced susceptibility to rifaximin and even allows simultaneous SNP subtyping of the respective C. difficile isolates.
DEFF Research Database (Denmark)
Fabbri, Elena; Caniglia, R.; Mucci, Nadia
2012-01-01
Single nucleotide polymorphisms (SNPs) which represent the most widespread source of sequence variation in genomes, are becoming a routine application in several fields such as forensics, ecology and conservation genetics. Their use, requiring short amplifications, may allow a more efficient geno....... We evaluated the cost, laboratory effort and reliability of these different markers and discuss the possible future use of VeraCode, SNPlex and Fluidigm EP1 system in wild population monitoring....
Mallick, Md. Mofasser; Vitta, Satish
2018-06-01
Co-oxides with a layered structure are of interest for high-temperature thermoelectric applications as they can be tuned to enhance their electrical conductivity while retaining their low thermal conductivity. The figure-of-merit of Na y CoO2 has been enhanced using the combined effects of Na-non-stoichiometry and non-isoelectronic Co-substitution. A series of compounds Na0.7Co1- x Ni x O2 with x ≤ 0.1 have been synthesized using conventional techniques. Structural analysis using x-ray diffraction and Rietveld refinement shows the formation of a γ-NaCoO2-type phase in all the compounds. The presence of a small amount of NiO for x > 0.05 indicates that the solubility limit of Ni in Na0.7CoO2 is 5 at.%. All the compounds have been found to be p-type with the thermopower reaching a maximum of 220 μV K-1 at 1023 K for x = 0.1. The thermopower has been found to vary linearly with temperature for all the compounds; a degenerate metallic behavior. The electrical resistivity varies between 3 and 10 mΩ cm at all temperatures and has a metallic temperature dependence in agreement with the thermopower results. The power factor for the x = 0.1 compound reaches a maximum value of 0.55 mW m-1 K-2 at ˜ 900 K compared to 0.45 mW m-1 K-2 for the compound with no substitution. The thermal conductivity at 1023 K decreases from 1.2 to 0.9 W m-1 K-1 for x = 0.1. These factors lead to an increase of the figure-of-merit, zT, to 0.58 at 1023 K for x = 0.1, an increase of 57% compared to the unsubstituted compound. The magnetic studies show that Na0.7CoO2 is paramagnetic with an antiferromagnetic transition at ˜ 36 K. Substitution of Ni2+ for Co3+ has been found to induce a ferromagnetic-like transition at ˜ 240 K which is suppressed at high fields.
Indian Academy of Sciences (India)
IAS Admin
experiences and viewpoints on matters related to teaching and learning science. Tutorial on Phylogenetic ... flow and genetic drift. Mutations of nucleotide bases can be of two types: synonymous .... closely related species. Commonly used ...
Finkelstein, Eric A; Zhen, Chen; Bilger, Marcel; Nonnemaker, James; Farooqui, Assad M; Todd, Jessica E
2013-01-01
Using the 2006 Homescan panel, we estimate the changes in energy, fat and sodium purchases resulting from a tax that increases the price of sugar-sweetened beverages (SSBs) by 20% and the effect of such a tax on body weight. In addition to substitutions that may arise with other beverages, we account for substitutions between SSBs and 12 major food categories. Our main findings are that the tax would result in a decrease in store-bought energy of 24.3kcal per day per person, which would translate into an average weight loss of 1.6 pounds during the first year and a cumulated weight loss of 2.9 pounds in the long run. We do not find evidence of substitution to sugary foods and show that complementary foods could contribute to decreasing energy purchases. Despite their significantly lower price elasticity, the tax has a similar effect on calories for the largest purchasers of SSBs. Copyright © 2012 Elsevier B.V. All rights reserved.
Is political conservatism synonymous with authoritarianism?
Crowson, H Michael; Thoma, Stephen J; Hestevold, Nita
2005-10-01
The authors performed 2 studies that tested the distinction between conservative political ideology and right-wing authoritarianism (RWA). Across these studies, moderate relationships emerged between RWA and our measures of cognitive rigidity, whereas the relationship between rigidity and mainstream conservative ideology was not as strong. The authors used partial-correlation and path analyses to assess the possibility that RWA mediates the relationship between (a) cognitive rigidity and (b) mainstream conservative attitudes and self-identified conservatism. The results indicated that conservatism is not synonymous with RWA. Additionally, RWA appeared to partially mediate the relationship between cognitive rigidity and mainstream conservatism.
DEFF Research Database (Denmark)
Cedhagen, Tomas; Tendal, Ole S.
1989-01-01
Laboratory observations and experiments demonstrate that the naked rhizopods Amoeba gigantea SANDAHL, 1857 and Megamoebomyxa argillo~ia NYHOLM, 1950, and the foraminifers Astrorhiza arenifera STSCHEDRlNA, 1946, A. sabulifera STSCHEDRINA, 1946 and A. arctlca STSCHEDRINA, 1958 are synonyms of Astro......Laboratory observations and experiments demonstrate that the naked rhizopods Amoeba gigantea SANDAHL, 1857 and Megamoebomyxa argillo~ia NYHOLM, 1950, and the foraminifers Astrorhiza arenifera STSCHEDRlNA, 1946, A. sabulifera STSCHEDRINA, 1946 and A. arctlca STSCHEDRINA, 1958 are synonyms...
Zahurancik, Walter J.; Klein, Seth J.; Suo, Zucai
2014-01-01
Most eukaryotic DNA replication is performed by A- and B-family DNA polymerases which possess a faithful polymerase activity that preferentially incorporates correct over incorrect nucleotides. Additionally, many replicative polymerases have an efficient 3′→5′ exonuclease activity that excises misincorporated nucleotides. Together, these activities contribute to overall low polymerase error frequency (one error per 106–108 incorporations) and support faithful eukaryotic genome replication. Eukaryotic DNA polymerase ϵ (Polϵ) is one of three main replicative DNA polymerases for nuclear genomic replication and is responsible for leading strand synthesis. Here, we employed pre-steady-state kinetic methods and determined the overall fidelity of human Polϵ (hPolϵ) by measuring the individual contributions of its polymerase and 3′→5′ exonuclease activities. The polymerase activity of hPolϵ has a high base substitution fidelity (10−4–10−7) resulting from large decreases in both nucleotide incorporation rate constants and ground-state binding affinities for incorrect relative to correct nucleotides. The 3′→5′ exonuclease activity of hPolϵ further enhances polymerization fidelity by an unprecedented 3.5 × 102 to 1.2 × 104-fold. The resulting overall fidelity of hPolϵ (10−6–10−11) justifies hPolϵ to be a primary enzyme to replicate human nuclear genome (0.1–1.0 error per round). Consistently, somatic mutations in hPolϵ, which decrease its exonuclease activity, are connected with mutator phenotypes and cancer formation. PMID:25414327
Enzymatic Incorporation of Modified Purine Nucleotides in DNA.
Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet
2017-12-14
A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Li Yan; Nam, C T; Ooi, C P
2009-01-01
Calcium hydroxyapatite (HA) is the main inorganic component of natural bones and can bond to bone directly in vivo. Thus HA is widely used as coating material on bone implants due to its good osteoconductivity and osteoinductivity. Metal ions doped HA have been used as catalyst or absorbents since the ion exchange method has introduced new properties in HA which are inherent to the metal ions. For example, Mn 2+ ions have the potential to increase cell adhesion while Fe 3+ ions have magnetic properties. Here, Fe(III) substituted hydroxyapatite (Fe-HA) and Mn(II) substituted hydroxyapatite (Mn-HA) were produced by wet chemical method coupled with ion exchange mechanism. Compared with pure HA, the colour of both Fe-HA and Mn-HA nanoparticles changed from white to brown and pink respectively. The intensity of the colours increased with increasing substitution concentrations. XRD patterns showed that all samples were single phased HA while the FTIR spectra revealed all samples possessed the characteristic phosphate and hydroxyl adsorption bands of HA. However, undesired adsorption bands of carbonate substitution (B-type carbonated HA) and H 2 O were also detected, which was reasonable since the wet chemical method was used in the synthesis of these nanoparticles. FESEM images showed all samples were elongated spheroids with small size distribution and of around 70 nm, regardless of metal ion substitution concentrations. EDX spectra showed the presence of Fe and Mn and ICP-AES results revealed all metal ion substituted HA were non-stoichiometric (Ca/P atomic ratio deviates from 1.67). Fe-HA nanoparticles were paramagnetic and the magnetic susceptibility increased with the increase of Fe content. Based on the extraction assay for cytotoxicity test, both Fe-HA and Mn-HA displayed non-cytotoxicity to osteoblast.
Ahn, Jinhi; Beharry, Seelochan; Molday, Laurie L; Molday, Robert S
2003-10-10
ABCR, also known as ABCA4, is a member of the superfamily of ATP binding cassette transporters that is believed to transport retinal or retinylidene-phosphatidylethanolamine across photoreceptor disk membranes. Mutations in the ABCR gene are responsible for Stargardt macular dystrophy and related retinal dystrophies that cause severe loss in vision. ABCR consists of two tandemly arranged halves each containing a membrane spanning segment followed by a large extracellular/lumen domain, a multi-spanning membrane domain, and a nucleotide binding domain (NBD). To define the role of each NBD, we examined the nucleotide binding and ATPase activities of the N and C halves of ABCR individually and co-expressed in COS-1 cells and derived from trypsin-cleaved ABCR in disk membranes. When disk membranes or membranes from co-transfected cells were photoaffinity labeled with 8-azido-ATP and 8-azido-ADP, only the NBD2 in the C-half bound and trapped the nucleotide. Co-expressed half-molecules displayed basal and retinal-stimulated ATPase activity similar to full-length ABCR. The individually expressed N-half displayed weak 8-azido-ATP labeling and low basal ATPase activity that was not stimulated by retinal, whereas the C-half did not bind ATP and exhibited little if any ATPase activity. Purified ABCR contained one tightly bound ADP, presumably in NBD1. Our results indicate that only NBD2 of ABCR binds and hydrolyzes ATP in the presence or absence of retinal. NBD1, containing a bound ADP, associates with NBD2 to play a crucial, non-catalytic role in ABCR function.
Kim, Jeong-Hee
2006-04-01
This paper was conducted to examine the effects of transformational leadership behaviors, within the substitutes for leadership model (Kerr & Jermier, 1978). Data was collected from 181 staff nurses in 3 general hospitals, with self-reporting questionnaires (MLQ developed by Bass, rd-SLS developed by Podsakoff, et al., and MSQ developed by Weiss, et al.). Descriptive statistics, factor analysis, Cronbach's alpha and moderated regression analysis were used. 1) The transformational leader behaviors and substitutes for leadership each had correlations with job satisfaction. 2) The total amount of variance accounted for by the substitutes for leadership was substantially greater than by the transformational leadership behaviors. 3) Few of the substitutes variables moderated the relationships between the transformational leader behaviors and job satisfaction in a manner consistent with that specified by Howell, Dorfman, and Kerr (1986). The finding of this study suggest that leaders need to have a better understanding of those contextual variables that influence job satisfaction. Thus future research should focus attention on the moderating effects of substitutes, as well as the things that leaders can do to influence them. In addition, it may be good to examine the effects of substitutes on other criterion variables.
Borkowski, Leszek; Sroka-Bartnicka, Anna; Drączkowski, Piotr; Ptak, Agnieszka; Zięba, Emil; Ślósarczyk, Anna; Ginalska, Grażyna
2016-05-01
Apatite forming ability of hydroxyapatite (HAP) and carbonate hydroxyapatite (CHAP) containing composites was compared. Two composite materials, intended for filling bone defects, were made of polysaccharide polymer and one of two types of hydroxyapatite. The bioactivity of the composites was evaluated in vitro by soaking in a simulated body fluid (SBF), and the formation of the apatite layer was determined by scanning electron microscopy with energy-dispersive spectrometer and Raman spectroscopy. The results showed that both the composites induced the formation of apatite layer on their surface after soaking in SBF. In addition, the sample weight changes and the ion concentration of the SBF were scrutinized. The results showed the weight increase for both materials after SBF treatment, higher weight gain and higher uptake of calcium ions by HAP containing scaffolds. SBF solution analysis indicated loss of calcium and phosphorus ions during experiment. All these results indicate apatite forming ability of both biomaterials and suggest comparable bioactive properties of composite containing pure hydroxyapatite and carbonate-substituted one. Copyright © 2016 Elsevier B.V. All rights reserved.
Ultrasound Promoted Synthesis of Bis(substituted pyrazol-4-ylcarbonyl-Substituted Thioureas
Directory of Open Access Journals (Sweden)
Li Xiao
2009-03-01
Full Text Available A series of novel bis(substituted pyrazol-4-ylcarbonyl-substituted thioureas have been synthesized by the reactions of substituted pyrazol-4-ylcarbonyl isothiocyanates with different diamines under ultrasound irradiation and classical heating method at 20-25 °C. In general, substantial improvement in rates and modest yields increases were observed when reactions were carried out under sonication, compared with the classical heating method. The structures of these compounds have been elucidated by elemental and spectral (IR, 1H-NMR analysis.
Tambong, J T; Xu, R; Sadiku, A; Chen, Q; Badiss, A; Yu, Q
2014-04-01
Serratia marcescens strains isolated from entomopathogenic nematodes (Rhabditis sp.) were examined for their pathogenicity and establishment in wax moth (Galleria mellonella) larvae. All the Serratia strains were potently pathogenic to G. mellonella larvae, leading to death within 48 h. The strains were shown to possess a metalloprotease gene encoding for a novel serralysin-like protein. Rapid establishment of the bacteria in infected larvae was confirmed by specific polymerase chain reaction (PCR) detection of a DNA fragment encoding for this protein. Detection of the viable Serratia strains in infected larvae was validated using the SYBR Green reverse transcriptase real-time PCR assay targeting the metalloprotease gene. Nucleotide sequences of the metalloprotease gene obtained in our study showed 72 single nucleotide polymorphisms (SNP) and 3 insertions compared with the metalloprotease gene of S. marcescens E-15. The metalloprotease gene had 60 synonymous and 8 nonsynonymous substitutions relative to the closest GenBank entry, S. marcescens E-15. A comparison of the amino acid composition of the new serralysin-like protein with that of the serralysin protein of S. marcescens E-15 revealed differences at 11 positions and a new aspartic acid residue. Analysis of the effect of protein variation suggests that a new aspartic acid residue resulting from nonsynonymous nucleotide mutations in the protein structure could have the most significant effect on its biological function. The new metalloprotease gene and (or) its product could have applications in plant agricultural biotechnology.
Paixão-Côrtes, Vanessa Rodrigues; Viscardi, Lucas Henrique; Salzano, Francisco Mauro; Hünemeier, Tábita; Bortolini, Maria Cátira
2012-12-01
After a brief review of the most recent findings in the study of human evolution, an extensive comparison of the complete genomes of our nearest relative, the chimpanzee (Pan troglodytes), of extant Homo sapiens, archaic Homo neanderthalensis and the Denisova specimen were made. The focus was on non-synonymous mutations, which consequently had an impact on protein levels and these changes were classified according to degree of effect. A total of 10,447 non-synonymous substitutions were found in which the derived allele is fixed or nearly fixed in humans as compared to chimpanzee. Their most frequent location was on chromosome 21. Their presence was then searched in the two archaic genomes. Mutations in 381 genes would imply radical amino acid changes, with a fraction of these related to olfaction and other important physiological processes. Eight new alleles were identified in the Neanderthal and/or Denisova genetic pools. Four others, possibly affecting cognition, occured both in the sapiens and two other archaic genomes. The selective sweep that gave rise to Homo sapiens could, therefore, have initiated before the modern/archaic human divergence.
Energy Technology Data Exchange (ETDEWEB)
Alm, Eric; Shapiro, B. Jesse
2009-04-15
Different microbial species are thought to occupy distinct ecological niches, subjecting each species to unique selective constraints, which may leave a recognizable signal in their genomes. Thus, it may be possible to extract insight into the genetic basis of ecological differences among lineages by identifying unusual patterns of substitutions in orthologous gene or protein sequences. We use the ratio of substitutions in slow versus fast-evolving sites (nucleotides in DNA, or amino acids in protein sequence) to quantify deviations from the typical pattern of selective constraint observed across bacterial lineages. We propose that elevated S:F in one branch (an excess of slow-site substitutions) can indicate a functionally-relevant change, due to either positive selection or relaxed evolutionary constraint. In a genome-wide comparative study of gamma-proteobacterial proteins, we find that cell-surface proteins involved with motility and secretion functions often have high S:F ratios, while information-processing genes do not. Change in evolutionary constraints in some species is evidenced by increased S:F ratios within functionally-related sets of genes (e.g., energy production in Pseudomonas fluorescens), while other species apparently evolve mostly by drift (e.g., uniformly elevated S:F across most genes in Buchnera spp.). Overall, S:F reveals several species-specific, protein-level changes with potential functional/ecological importance. As microbial genome projects yield more species-rich gene-trees, the S:F ratio will become an increasingly powerful tool for uncovering functional genetic differences among species.
[A population genetic study of 22 autosomal loci of single nucleotide polymorphisms].
Tang, Jian-pin; Jiang, Feng-hui; Shi, Mei-sen; Xu, Chuan-chao; Chen, Rui; Lai, Xiao-pin
2012-12-01
To evaluate polymorphisms and forensic efficiency of 22 non-binary single nucleotide polymorphism (SNP) loci. One hundred ethnic Han Chinese individuals were recruited from Dongguan, Guangdong. The 22 loci were genotyped with matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS). Nine loci were found with a single allele, 4 loci were found to be biallelic, whilst 9 loci were found to have 3 alleles. For 13 polymorphic loci, the combined discrimination power and power of exclusion were 0.999 98 and 0.9330, respectively. For the 9 non-biallelic loci, the combined discrimination power and power of exclusion were 0.9998 and 0.8956, respectively. For motherless cases, the combined power of exclusion was 0.6405 for 13 polymorphic SNPs and 0.6405 for 9 non-binary SNPs. Non-binary loci have a greater discrimination power and exclusion power per SNP.
Identification of cyclic nucleotide gated channels using regular expressions
Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.
2013-01-01
Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin
Szeinbaum, Nadia; Kellum, Cailin E; Glass, Jennifer B; Janda, J Michael; DiChristina, Thomas J
2018-04-01
Previously, experimental DNA-DNA hybridization (DDH) between Shewanellahaliotis JCM 14758 T and Shewanellaalgae JCM 21037 T had suggested that the two strains could be considered different species, despite minimal phenotypic differences. The recent isolation of Shewanella sp. MN-01, with 99 % 16S rRNA gene identity to S. algae and S. haliotis, revealed a potential taxonomic problem between these two species. In this study, we reassessed the nomenclature of S. haliotis and S. algae using available whole-genome sequences. The whole-genome sequence of S. haliotis JCM 14758 T and ten S. algae strains showed ≥97.7 % average nucleotide identity and >78.9 % digital DDH, clearly above the recommended species thresholds. According to the rules of priority and in view of the results obtained, S. haliotis is to be considered a later heterotypic synonym of S. algae. Because the whole-genome sequence of Shewanella sp. strain MN-01 shares >99 % ANI with S. algae JCM 14758 T , it can be confidently identified as S. algae.
Nucleotide Metabolism and its Control in Lactic Acid Bacteria
DEFF Research Database (Denmark)
Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal
2005-01-01
Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....
A PYY Q62P variant linked to human obesity
Energy Technology Data Exchange (ETDEWEB)
Ahituv, Nadav; Kavaslar, Nihan; Schackwitz, Wendy; Ustaszewska,Anna; Collier, John Michael; Hebert, Sybil; Doelle, Heather; Dent,Robert; Pennacchio, Len A.; McPherson, Ruth
2005-06-27
Members of the pancreatic polypeptide family and the irreceptors have been implicated in the control of food intake in rodents and humans. To investigate whether nucleotide changes in these candidate genes result in abnormal weight in humans, we sequenced the coding exons and splice sites of seven family members (NPY, PYY, PPY, NPY1R, NPY2R, NPY4R, and NPY5R) in a large cohort of extremely obese (n=379) and lean (n=378) individuals. In total we found eleven rare non-synonymous variants, four of which exhibited familial segregation, NPY1R L53P and PPY P63L with leanness and NPY2R D42G and PYY Q62P with obesity. Functional analysis of the obese variants revealed NPY2R D42G to have reduced cell surface expression, while previous cell culture based studies indicated variant PYY Q62P to have altered receptor binding selectivity and we show that it fails to reduce food intake through mouse peptide injection experiments. These results support that rare non-synonymous variants within these genes can alter susceptibility to human body mass index extremes.
Wong, D R; den Dulk, M O; Derijks, L J J; Gemmeke, E H K M; Hooymans, P M
2007-01-01
in the liver. 6-MP is then further catabolised by xanthine-oxidase (XO) and TPMT or anabolised by hypoxanthine phosphoribosyl transferase (HPRT). Remarkably, treatment with 6-MP in combination with the XO-inhibitor allopurinol resulted in a myelotoxic 6TGN level in the first week after start of treatment. There are two hypotheses on the mechanism by which this finding could be explained. First, an ‘ultra-high’ XO activity results in a direct and complete conversion of 6-MP into 6-thiouric acid. Secondly, AZA is not converted into 6-MP. Consequently, there is no formation of active thiopurine nucleotides out of 6-MP. Also, a combination of these two mechanisms could lead to a decreased formation of active thiopurine metabolites. Conclusion: Our finding indicates non-conventional insights in the biotransformation of AZA contributing to an interindividual variation in thiopurine metabolism.
Substitution determination of Fmoc‐substituted resins at different wavelengths
Kley, Markus; Bächle, Dirk; Loidl, Günther; Meier, Thomas; Samson, Daniel
2017-01-01
In solid‐phase peptide synthesis, the nominal batch size is calculated using the starting resin substitution and the mass of the starting resin. The starting resin substitution constitutes the basis for the calculation of a whole set of important process parameters, such as the number of amino acid derivative equivalents. For Fmoc‐substituted resins, substitution determination is often performed by suspending the Fmoc‐protected starting resin in 20% (v/v) piperidine in DMF to generate the dibenzofulvene–piperidine adduct that is quantified by ultraviolet–visible spectroscopy. The spectrometric measurement is performed at the maximum absorption wavelength of the dibenzofulvene–piperidine adduct, that is, at 301.0 nm. The recorded absorption value, the resin weight and the volume are entered into an equation derived from Lambert–Beer's law, together with the substance‐specific molar absorption coefficient at 301.0 nm, in order to calculate the nominal substitution. To our knowledge, molar absorption coefficients between 7100 l mol−1 cm−1 and 8100 l mol−1 cm−1 have been reported for the dibenzofulvene–piperidine adduct at 301.0 nm. Depending on the applied value, the nominal batch size may differ up to 14%. In this publication, a determination of the molar absorption coefficients at 301.0 and 289.8 nm is reported. Furthermore, proof is given that by measuring the absorption at 289.8 nm the impact of wavelength accuracy is reduced. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd. PMID:28635051
Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...
African Journals Online (AJOL)
PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...
Ponomareva, Eugenia P; Ternovoi, Vladimir A; Mikryukova, Tamara P; Protopopova, Elena V; Gladysheva, Anastasia V; Shvalov, Alexander N; Konovalova, Svetlana N; Chausov, Eugene V; Loktev, Valery B
2017-10-01
The C11-13 strain from the Siberian subtype of tick-borne encephalitis virus (TBEV) was isolated from human brain using pig embryo kidney (PEK), 293, and Neuro-2a cells. Analysis of the complete viral genome of the C11-13 variants during six passages in these cells revealed that the cell-adapted C11-13 variants had multiple amino acid substitutions as compared to TBEV from human brain. Seven out of eight amino acids substitutions in the high-replicating C11-13(PEK) variant mapped to non-structural proteins; 13 out of 14 substitutions in the well-replicating C11-13(293) variant, and all four substitutions in the low-replicating C11-13(Neuro-2a) variant were also localized in non-structural proteins, predominantly in the NS2a (2), NS3 (6) and NS5 (3) proteins. The substitutions NS2a 1067 (Asn → Asp), NS2a 1168 (Leu → Val) in the N-terminus of NS2a and NS3 1745 (His → Gln) in the helicase domain of NS3 were found in all selected variants. We postulate that multiple substitutions in the NS2a, NS3 and NS5 genes play a key role in adaptation of TBEV to different cells.
Scopesi, Fabio; Canini, Silvana; Arioni, Cesare; Mazzella, Massimo; Gazzolo, Diego; Lantieri, Pasquale B; Bonacci, Wanda; Serra, Giovanni
2006-06-01
Recently we demonstrated an increased 2,3-diphosphoglycerate (2,3-DPG) erythrocyte concentration in rat pups subjected to nucleotide-enriched artificial feeding. The present study was carried out to test the hypothesis that a possible increase in 2,3-DPG concentration can also be obtained in human neonates who are fed nucleotide-enriched formula. Preterm neonates born or referred to the neonatal intensive care unit of the G. Gaslini Hospital, Genoa University, with a gestational age >30 weeks and <37 weeks were enrolled in our randomized trial. Recruitment took place within 48-72 hours from birth. Only newborns of mothers deciding not to breast-feed were eligible to be randomized for the supplemented group (FN) or non-supplemented group (RF). Breast-fed newborns were considered the control group (C). The study window (for supplementation and blood samples) was restricted to the first two weeks following birth (from the 2nd (t1) to the 16th (t2) day of life). At the end of our study, only 21 neonates were eligible for statistical analysis. The stimulating action of dietary nucleotides on 2,3-DPG concentration failed to be demonstrated; increases in 2,3-DPG concentration that were observed in newborns fed with nucleotide supplemented formula (FN) were comparable to those observed in newborns fed with regular formula (RF) and breast-fed newborns. The EC recommendation for the amount of nucleotides allowed in formula milk does not seem to be high enough to have positive effects on 2,3-DPG synthesis. Whether this possible 'pharmacological' effect can be achieved by a higher intake of ingested nucleotides and/or a change in the proportions of single nucleotides contained in milk formulas remain interesting end points to be elucidated.
Nuzzo, F; Bulato, C; Nielsen, B I; Lee, K; Wielders, S J; Simioni, P; Key, N S; Castoldi, E
2015-03-01
Coagulation factor V (FV) deficiency is a rare autosomal recessive bleeding disorder. We investigated a patient with severe FV deficiency (FV:C mutation in exon 4 (c.578G>C, p.Cys193Ser), predicting the abolition of a conserved disulphide bridge, and an apparently synonymous variant in exon 8 (c.1281C>G). The observation that half of the patient's F5 mRNA lacked the last 18 nucleotides of exon 8 prompted us to re-evaluate the c.1281C>G variant for its possible effects on splicing. Bioinformatics sequence analysis predicted that this transversion would activate a cryptic donor splice site and abolish an exonic splicing enhancer. Characterization in a F5 minigene model confirmed that the c.1281C>G variant was responsible for the patient's splicing defect, which could be partially corrected by a mutation-specific morpholino antisense oligonucleotide. The aberrantly spliced F5 mRNA, whose stability was similar to that of the normal mRNA, encoded a putative FV mutant lacking amino acids 427-432. Expression in COS-1 cells indicated that the mutant protein is poorly secreted and not functional. In conclusion, the c.1281C>G mutation, which was predicted to be translationally silent and hence neutral, causes FV deficiency by impairing pre-mRNA splicing. This finding underscores the importance of cDNA analysis for the correct assessment of exonic mutations. © 2014 John Wiley & Sons Ltd.
Substituting fields within the action: Consistency issues and some applications
International Nuclear Information System (INIS)
Pons, Josep M.
2010-01-01
In field theory, as well as in mechanics, the substitution of some fields in terms of other fields at the level of the action raises an issue of consistency with respect to the equations of motion. We discuss this issue and give an expression which neatly displays the difference between doing the substitution at the level of the Lagrangian or at the level of the equations of motion. Both operations do not commute in general. A very relevant exception is the case of auxiliary variables, which are discussed in detail together with some of their relevant applications. We discuss the conditions for the preservation of symmetries--Noether as well as non-Noether--under the reduction of degrees of freedom provided by the mechanism of substitution. We also examine how the gauge fixing procedures fit in our framework and give simple examples on the issue of consistency in this case.
Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.
E, Chao; Duan, Baogen; Yu, Jin
2017-04-20
Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.
Single Nucleotide Polymorphism
DEFF Research Database (Denmark)
Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg
2014-01-01
Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....
Ashley, Neil; Adams, Susan; Slama, Abdelhamid; Zeviani, Massimo; Suomalainen, Anu; Andreu, Antonio L; Naviaux, Robert K; Poulton, Joanna
2007-06-15
Defects in mtDNA maintenance range from fatal multisystem childhood diseases, such as Alpers syndrome, to milder diseases in adults, including mtDNA depletion syndromes (MDS) and familial progressive external ophthalmoplegia (AdPEO). Most are associated with defects in genes involved in mitochondrial deoxynucleotide metabolism or utilization, such as mutations in thymidine kinase 2 (TK2) as well as the mtDNA replicative helicase, Twinkle and gamma polymerase (POLG). We have developed an in vitro system to measure incorporation of radiolabelled dNTPs into mitochondria of saponin permeabilized cells. We used this to compare the rates of mtDNA synthesis in cells from 12 patients with diseases of mtDNA maintenance. We observed reduced incorporation of exogenous alpha (32)P-dTTP in fibroblasts from a patient with Alpers syndrome associated with the A467T substitution in POLG, a patient with dGK mutations, and a patient with mtDNA depletion of unknown origin compared to controls. However, incorporation of alpha (32)P-dTTP relative to either cell doubling time or alpha (32)P-dCTP incorporation was increased in patients with thymidine kinase deficiency or PEO as the result of TWINKLE mutations compared with controls. The specific activity of newly synthesized mtDNA depends on the size of the endogenous pool diluting the exogenous labelled nucleotide. Our result is consistent with a deficiency in the intramitochondrial pool of dTTP relative to dCTP in cells from patients with TK2 deficiency and TWINKLE mutations. Such DNA precursor asymmetry could cause pausing of the replication complex and hence exacerbate the propensity for age-related mtDNA mutations. Because deviations from the normal concentrations of dNTPs are known to be mutagenic, we suggest that intramitochondrial nucleotide imbalance could underlie the multiple mtDNA mutations observed in these patients.
Directory of Open Access Journals (Sweden)
Eryn E. Slankster
2012-06-01
Full Text Available We have developed DNA-based genetic markers for rapid-cycling Brassica rapa (RCBr, also known as Fast Plants. Although markers for Brassica rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP based markers and 14 variable number tandem repeat (VNTR-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a nongenic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology.
International Nuclear Information System (INIS)
Goldberg, Tony L.; Lowe, James F.; Milburn, Suzanne M.; Firkins, Lawrence D.
2003-01-01
Porcine reproductive and respiratory syndrome virus (PRRSV) displays notorious genetic, antigenic, and clinical variability. Little is known, however, about the nature and extent of viral variation present within naturally infected animals. By amplifying and cloning the open reading frame 5 gene from tonsils of naturally infected swine, and by sequencing individual clones, we characterized viral diversity in nine animals from two farms. All animals harbored multiple PRRSV variants at both the nucleic and the amino acid levels. Structural variation and rates of synonymous and nonsynonymous nucleotide substitution were no different within known epitopes than elsewhere. Analysis of molecular variance indicated that differences between farms, among animals within farms, and within individual animals accounted for 92.94, 3.84, and 3.22% of the total viral genetic variability observed, respectively. PRRSV exists during natural infection as a quasispecies distribution of related genotypes. Positive natural selection for immune evasiveness does not appear to maintain this diversity
R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.
Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L
2013-07-01
The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.
Condensing the information in DNA with double-headed nucleotides
DEFF Research Database (Denmark)
Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte
2017-01-01
A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...
Breastfeeding and Opiate Substitution Therapy: Starting to Understand Infant Feeding Choices
Directory of Open Access Journals (Sweden)
Lisa E. Graves
2016-01-01
Full Text Available Introduction Despite research demonstrating the safety and benefit of breastfeeding in opioid substitution therapy, few women in treatment breastfeed. Understanding the factors contributing to the choices women on opioid substitution therapy make about infant feeding is important. Objectives The aim of this study was to better understand and support infant feeding choices and breastfeeding experiences in women on opioid substitution therapy. Methods A systematic review was conducted on five databases: (1 Ovid MEDLINE(R without revisions, (2 Ovid MEDLINE(R In-Process & Other Non-Indexed Citations, (3 EMBASE, (4 CINAHL, and (5 FRANCIS. From 1081 articles, 46 articles were reviewed. Results The literature supports breastfeeding as an appropriate and safe option for women on opioid substitution treatment. Breastfeeding and rooming-in reduce neonatal abstinence. Women face barriers to breastfeeding due to societal stigma and the lack of patient and health-care provider education. Conclusions Efforts are needed to increase the knowledge that women and health-care professionals have about the safety and benefits of breastfeeding.
Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe
2015-05-30
Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.
Substitution determination of Fmoc-substituted resins at different wavelengths.
Eissler, Stefan; Kley, Markus; Bächle, Dirk; Loidl, Günther; Meier, Thomas; Samson, Daniel
2017-10-01
In solid-phase peptide synthesis, the nominal batch size is calculated using the starting resin substitution and the mass of the starting resin. The starting resin substitution constitutes the basis for the calculation of a whole set of important process parameters, such as the number of amino acid derivative equivalents. For Fmoc-substituted resins, substitution determination is often performed by suspending the Fmoc-protected starting resin in 20% (v/v) piperidine in DMF to generate the dibenzofulvene-piperidine adduct that is quantified by ultraviolet-visible spectroscopy. The spectrometric measurement is performed at the maximum absorption wavelength of the dibenzofulvene-piperidine adduct, that is, at 301.0 nm. The recorded absorption value, the resin weight and the volume are entered into an equation derived from Lambert-Beer's law, together with the substance-specific molar absorption coefficient at 301.0 nm, in order to calculate the nominal substitution. To our knowledge, molar absorption coefficients between 7100 l mol -1 cm -1 and 8100 l mol -1 cm -1 have been reported for the dibenzofulvene-piperidine adduct at 301.0 nm. Depending on the applied value, the nominal batch size may differ up to 14%. In this publication, a determination of the molar absorption coefficients at 301.0 and 289.8 nm is reported. Furthermore, proof is given that by measuring the absorption at 289.8 nm the impact of wavelength accuracy is reduced. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Melvin, J.G.
1980-09-01
The extent to which electricity could substitute for imported oil in Canada is assessed and it is concluded that the bulk of projected oil imports could be displaced. This substitution of electricity for oil could be largely completed within two decades, with existing technology, using Canadian resources. The substitution of electricity for imported oil would result in relatively low energy costs and would stimulate economic growth. Energy self-sufficiency through the substitution of electricity for oil is uniquely a Canadian option; it is not open to other industrial countries. The option exists because of Canada's resources of oil sands for essential liquid fuels, hydraulic and nuclear electrical potential, and natural gas as an interim source of energy. While other countries face an energy crisis due to declining supplies of oil, Canada faces opportunities. The policies of Federal and Provincial governments, as perceived by individual decision makers, will have a major influence on Canada's ability to realize opportunities. (auth)
Lee, Bridgin G; Anastasia, Agustin; Hempstead, Barbara L; Lee, Francis S; Blendy, Julie A
2015-12-01
Nicotine withdrawal is characterized by both affective and cognitive symptoms. Identifying genetic polymorphisms that could affect the symptoms associated with nicotine withdrawal are important in predicting withdrawal sensitivity and identifying personalized cessation therapies. In the current study we used a mouse model of a non-synonymous single nucleotide polymorphism in the translated region of the brain-derived neurotrophic factor (BDNF) gene that substitutes a valine (Val) for a methionine (Met) amino acid (Val66Met) to examine the relationship between the Val66Met single nucleotide polymorphism and nicotine dependence. This study measured proBDNF and the BDNF prodomain levels following nicotine and nicotine withdrawal and examined a mouse model of a common polymorphism in this protein (BDNF(Met/Met)) in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test. Using the BDNF knock-in mouse containing the BDNF Val66Met polymorphism we found: (1) blunted anxiety-like behavior in BDNF(Met/Met) mice following withdrawal in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test; (2) the anxiolytic effects of chronic nicotine are absent in BDNF(Met/Met) mice; and (3) an increase in BDNF prodomain in BDNF(Met/Met) mice following nicotine withdrawal. Our study is the first to examine the effect of the BDNF Val66Met polymorphism on the affective symptoms of withdrawal from nicotine in mice. In these mice, a single-nucleotide polymorphism in the translated region of the BDNF gene can result in a blunted withdrawal, as measured by decreased anxiety-like behavior. The significant increase in the BDNF prodomain in BDNF(Met/Met) mice following nicotine cessation suggests a possible role of this ligand in the circuitry remodeling after withdrawal. © The Author 2015. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For
Directory of Open Access Journals (Sweden)
Stuart F. McDaniel
2013-04-01
Full Text Available Premise of the study: We developed and tested primers for 218 nuclear loci for studying population genetics, phylogeography, and genome evolution in bryophytes. Methods and Results: We aligned expressed sequence tags (ESTs from Ceratodon purpureus to the Physcomitrella patens genome sequence, and designed primers that are homologous to conserved exons but span introns in the P. patens genome. We tested these primers on four isolates from New York, USA; Otavalo, Ecuador; and two laboratory isolates from Austria (WT4 and GG1. The median genome-wide nucleotide diversity was 0.008 substitutions/site, but the range was large (0–0.14, illustrating the among-locus heterogeneity in the species. Conclusions: These loci provide a valuable resource for finely resolved, genome-wide population genetic and species-level phylogenetic analyses of C. purpureus and its relatives.
DEFF Research Database (Denmark)
Hviid, T V; Møller, C; Sørensen, S
1998-01-01
imprinting of the HLA-G locus could have implications for the interaction in the feto-maternal relationship. Restriction Fragment Length Polymorphism (RFLP), allele-specific amplification and Single Strand Conformation Polymorphism (SSCP) analysis followed by DNA sequencing were performed on Reverse...... Transcription (RT) Polymerase Chain Reaction (PCR) products of HLA-G mRNA to examine the expression of maternal and paternal alleles. Our results demonstrate that HLA-G is co-dominantly expressed in first trimester trophoblast cells. A "new" non-synonymous base substitution in exon 4 was detected. We also...
Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping
Hendershot, Jenna M.; O'Brien, Patrick J.
2014-01-01
Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304
Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana
2016-05-01
Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final
Directory of Open Access Journals (Sweden)
Wanhong Xu
Full Text Available Senecavirus A (SVA, previously known as Seneca Valley virus, was first isolated in the United States in 2002. SVA was associated with porcine idiopathic vesicular disease in Canada and the USA in 2007 and 2012, respectively. Recent increase in SVA outbreaks resulting in neonatal mortality of piglets and/or vesicular lesions in sows in Brazil, the USA and Canada point to the necessity to study the pathogenicity and molecular epidemiology of the virus. Here, we report the analysis of the complete coding sequences of SVA from 2 clinical cases and 9 assembly yard environmental samples collected in 2015 in Canada, along with 22 previously released complete genomes in the GenBank. With this combined data set, the evolution of the SVA over a 12-month period in 2015/2016 was evaluated. These SVA isolates were characterized by a rapid accumulation of genetic variations driven mainly by a high nucleotide substitution rate and purifying selection. The SVA sequences clustered in clearly defined geographical areas with reported cases of SVA infection. No transmission links were identified between assembly yards, suggesting that point source introductions may have occurred. In addition, 25 fixed non-synonymous mutations were identified across all analyzed strains when compared to the prototype SVA strain (SVV-001. This study highlights the importance of monitoring SVA mutations for their role in increased virulence and impact on SVA diagnostics.
MBEToolbox: a Matlab toolbox for sequence data analysis in molecular biology and evolution
Directory of Open Access Journals (Sweden)
Xia Xuhua
2005-03-01
Full Text Available Abstract Background MATLAB is a high-performance language for technical computing, integrating computation, visualization, and programming in an easy-to-use environment. It has been widely used in many areas, such as mathematics and computation, algorithm development, data acquisition, modeling, simulation, and scientific and engineering graphics. However, few functions are freely available in MATLAB to perform the sequence data analyses specifically required for molecular biology and evolution. Results We have developed a MATLAB toolbox, called MBEToolbox, aimed at filling this gap by offering efficient implementations of the most needed functions in molecular biology and evolution. It can be used to manipulate aligned sequences, calculate evolutionary distances, estimate synonymous and nonsynonymous substitution rates, and infer phylogenetic trees. Moreover, it provides an extensible, functional framework for users with more specialized requirements to explore and analyze aligned nucleotide or protein sequences from an evolutionary perspective. The full functions in the toolbox are accessible through the command-line for seasoned MATLAB users. A graphical user interface, that may be especially useful for non-specialist end users, is also provided. Conclusion MBEToolbox is a useful tool that can aid in the exploration, interpretation and visualization of data in molecular biology and evolution. The software is publicly available at http://web.hku.hk/~jamescai/mbetoolbox/ and http://bioinformatics.org/project/?group_id=454.
Shin, Su-Kyoung; Hwang, Chung Yeon; Cho, Yong-Joon; Yi, Hana
2015-12-01
Serpens flexibilis was proposed in 1977 and approved in 1980 without the 16S rRNA gene sequence information. The sequence of S. flexibilis became available in 2010, after the publication of Pseudomonas tuomuerensis in 2009. Our preliminary phylogenetic analyses indicated that these two strains share high sequence similarity and therefore showed strong potential to be united into a single species. To clarify the taxonomic status of the two species, a polyphasic taxonomy study was conducted including whole genome sequencing. The value of average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) between the genome sequences of S. flexibilis ATCC 29606(T) and P. tuomuerensis JCM 14085(T) were 98.1% and 89.0%, respectively. The phenotypic and chemotaxonomic properties including enzymatic activities, substrate utilization profiles, and fatty acids, supported that the two taxa have no pronounced difference and should thus constitute a single species. Therefore, we propose to transfer Serpens flexibilis Hespell 1977 to the genus Pseudomonas as Pseudomonas flexibilis comb. nov. (type strain=ATCC 29606(T)), with Pseudomonas tuomuerensis Xin et al. 2009 as a later heterotypic synonym of Pseudomonas flexibilis. Copyright © 2015 Elsevier GmbH. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla
2016-01-01
Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016
Approaches in Substitution of Organic Solvents
DEFF Research Database (Denmark)
Jacobsen, Thomas
2000-01-01
In substitution of harmful chemicals or products with less harmful or harmless ones, there are different approaches according to the different situations, the technical requirements to the substitutes, and the goals for the substitution. Three different cases are presented. The substitution process...
Directory of Open Access Journals (Sweden)
Tuch Brian B
2008-06-01
Full Text Available Abstract Background The patterns of mutation vary both within and across genomes. It has been shown for a few mammals that mutation rates vary within the genome, while for unknown reasons, the sensu stricto yeasts have uniform rates instead. The generality of these observations has been unknown. Here we examine silent site substitutions in a more expansive set (20 mammals, 27 fungi, 4 insects to determine why some genomes demonstrate this mosaic distribution and why others are uniform. Results We applied several intragene and intergene correlation tests to measure regional substitution patterns. Assuming that silent sites are a reasonable approximation to neutrally mutating sequence, our results show that all multicellular eukaryotes exhibit mutational heterogeneity. In striking contrast, all fungi are mutationally uniform – with the exception of three Candida species: C. albicans, C. dubliniensis, and C. tropicalis. We speculate that aspects of replication timing may be responsible for distinguishing these species. Our analysis also reveals classes of genes whose silent sites behave anomalously with respect to the mutational background in many species, indicating prevalent selective pressures. Genes associated with nucleotide binding or gene regulation have consistently low silent substitution rates in every mammalian species, as well as multiple fungi. On the other hand, receptor genes repeatedly exhibit high silent substitution rates, suggesting they have been influenced by diversifying selection. Conclusion Our findings provide a framework for understanding the regional mutational properties of eukaryotes, revealing a sharp difference between fungi and multicellular species. They also elucidate common selective pressures acting on eukaryotic silent sites, with frequent evidence for both purifying and diversifying selection.
Directory of Open Access Journals (Sweden)
Desirée Villahermosa
2017-05-01
Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.
In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...
African Journals Online (AJOL)
Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.
Novel insertion mutation in a non-Jewish Caucasian type 1 Gaucher disease patient
Energy Technology Data Exchange (ETDEWEB)
Choy, F.Y.M.; Humphries, M.L. [Univ. of Victoria, British Columbia (Canada); Ferreira, P. [Univ. of Alberta, Edmonton (Canada)
1997-01-20
Gaucher disease is the most prevalent lysosomal storage disorder. It is autosomal recessive, resulting in lysosomal glucocerebrosidase deficiency. Three clinical forms of Gaucher disease have been described: type 1 (nonneuronopathic), type 2 (acute neuronopathic), and type 3 (subacute neuronopathic). We performed PCR-thermal cycle sequence analysis of glucocerebrosidase genomic DNA and identified a novel mutation in a non-Jewish type 1 Gaucher disease patient. It is a C insertion in exon 3 at cDNA nucleotide position 122 and genomic nucleotide position 1626. This mutation causes a frameshift and, subsequently, four of the five codons immediately downstream of the insertion were changed while the sixth was converted to a stop codon, resulting in premature termination of protein translation. The 122CC insertion abolishes a Cac81 restriction endonuclease cleavage site, allowing a convenient and reliable method for detection using RFLP analysis of PCR-amplified glucocerebrosidase genomic DNA. The mutation in the other Gaucher allele was found to be an A{r_arrow}G substitution at glucocerebrosidase cDNA nucleotide position 1226 that so far has only been reported among type 1 Gaucher disease patients. Since mutation 122CC causes a frameshift and early termination of protein translation, it most likely results in a meaningless transcript and subsequently no residual glucocerebrosidase enzyme activity. We speculate that mutation 122CC may result in a worse prognosis than mutations associated with partial activity. When present in the homozygous form, it could be a lethal allele similar to what has been postulated for the other known insertion mutation, 84GG. Our patient, who is a compound heterozygote 122CC/1226G, has moderately severe type 1 Gaucher disease. Her clinical response to Ceredase{reg_sign} therapy that began 31 months ago has been favorable, though incomplete. 30 refs., 3 figs., 2 tabs.
Directory of Open Access Journals (Sweden)
Claire Chewapreecha
2014-08-01
Full Text Available Traditional genetic association studies are very difficult in bacteria, as the generally limited recombination leads to large linked haplotype blocks, confounding the identification of causative variants. Beta-lactam antibiotic resistance in Streptococcus pneumoniae arises readily as the bacteria can quickly incorporate DNA fragments encompassing variants that make the transformed strains resistant. However, the causative mutations themselves are embedded within larger recombined blocks, and previous studies have only analysed a limited number of isolates, leading to the description of "mosaic genes" as being responsible for resistance. By comparing a large number of genomes of beta-lactam susceptible and non-susceptible strains, the high frequency of recombination should break up these haplotype blocks and allow the use of genetic association approaches to identify individual causative variants. Here, we performed a genome-wide association study to identify single nucleotide polymorphisms (SNPs and indels that could confer beta-lactam non-susceptibility using 3,085 Thai and 616 USA pneumococcal isolates as independent datasets for the variant discovery. The large sample sizes allowed us to narrow the source of beta-lactam non-susceptibility from long recombinant fragments down to much smaller loci comprised of discrete or linked SNPs. While some loci appear to be universal resistance determinants, contributing equally to non-susceptibility for at least two classes of beta-lactam antibiotics, some play a larger role in resistance to particular antibiotics. All of the identified loci have a highly non-uniform distribution in the populations. They are enriched not only in vaccine-targeted, but also non-vaccine-targeted lineages, which may raise clinical concerns. Identification of single nucleotide polymorphisms underlying resistance will be essential for future use of genome sequencing to predict antibiotic sensitivity in clinical microbiology.
Acid-Base Equilibria of Some N-Substituted Thiophene-2-Carboxamidoximes in Non-Aqueous Media
DÜRÜST, Nedime
2002-01-01
The protonation constants of the amino nitrogens of some N-substituted thiophene-2-carboxamidoximes have been determined in acetic acid by means of potentiometric titration with perchloric acid. pKa values of the title compounds were interpreted on the basis of structural effects due to the substituents and the main skeleton.
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Medicineringsfejl ved generisk substitution
DEFF Research Database (Denmark)
Rölfing, Jan
2012-01-01
Generic substitution is a major cause of medical mistakes in the general population. Danish legislation obligates pharmacies to substitute prescribed medicine with the cheapest equivalent formulation, despite variations in product name, packaging, shape and colour. Consequently, medical mistakes...... occur. Scientific evidence on the consequences of generic substitution is sparse. Call upon fellow health workers to report medical mistakes to the national entities and scientific peers, in order to increase awareness and scientific evidence about the problem....
Directory of Open Access Journals (Sweden)
Valerio Costa
2016-06-01
Full Text Available Type 2 diabetes (T2D is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9 or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG. However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP, currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing.
Synonyms and homonyms of Malvasia cultivars (Vitis vinifera L.) existing in Spain
Energy Technology Data Exchange (ETDEWEB)
Rodriguez Torres, I.; Ibanez, J.; Andres, M. T. de; Rubio, C.; Borrego, J.; Cabello, F.; Zerolo, J.; Munoz Organero, G.
2009-07-01
Malvasia is a common name for different grape cultivars that have long been grown in Spain. In many cases, these cultivars are noted as being aromatic, sweet, and similar to Muscat in flavour. However, not all grapes that share this name exhibit these characteristics. This study compares the Malvasia cultivars in the Spanish Denominations of Origin with those grape cultivars grown in the grapevine collection of El Encin (Alcala de Henares, Spain) using morphological, iso enzymatic, and micro satellite analysis as well as a large bibliographic search of the studied cultivars. Despite their Malvasia denomination, some cultivars have been identified as synonyms of Macabeo, Alarije, Dona Blanca, Chasselas, or Planta Nova, all included on the official Spanish list of commercial grape cultivars. Malvasia de Sitges and Malvasia de Lanzarote have the characteristic flavour of Malvasia grapes and no synonyms were found among the cultivars grown in Spain, whereas Malvasia Rosada resulted from a colour mutation in Malvasia de Sitges. (Author) 26 refs.
High-resolution characterization of a hepatocellular carcinoma genome.
Totoki, Yasushi; Tatsuno, Kenji; Yamamoto, Shogo; Arai, Yasuhito; Hosoda, Fumie; Ishikawa, Shumpei; Tsutsumi, Shuichi; Sonoda, Kohtaro; Totsuka, Hirohiko; Shirakihara, Takuya; Sakamoto, Hiromi; Wang, Linghua; Ojima, Hidenori; Shimada, Kazuaki; Kosuge, Tomoo; Okusaka, Takuji; Kato, Kazuto; Kusuda, Jun; Yoshida, Teruhiko; Aburatani, Hiroyuki; Shibata, Tatsuhiro
2011-05-01
Hepatocellular carcinoma, one of the most common virus-associated cancers, is the third most frequent cause of cancer-related death worldwide. By massively parallel sequencing of a primary hepatitis C virus-positive hepatocellular carcinoma (36× coverage) and matched lymphocytes (>28× coverage) from the same individual, we identified more than 11,000 somatic substitutions of the tumor genome that showed predominance of T>C/A>G transition and a decrease of the T>C substitution on the transcribed strand, suggesting preferential DNA repair. Gene annotation enrichment analysis of 63 validated non-synonymous substitutions revealed enrichment of phosphoproteins. We further validated 22 chromosomal rearrangements, generating four fusion transcripts that had altered transcriptional regulation (BCORL1-ELF4) or promoter activity. Whole-exome sequencing at a higher sequence depth (>76× coverage) revealed a TSC1 nonsense substitution in a subpopulation of the tumor cells. This first high-resolution characterization of a virus-associated cancer genome identified previously uncharacterized mutation patterns, intra-chromosomal rearrangements and fusion genes, as well as genetic heterogeneity within the tumor.
BLOOD SUBSTITUTES: EVOLUTION FROM NON-CARRYING TO OXYGEN AND GAS CARRYING FLUIDS
Cabrales, Pedro; Intaglietta, Marcos
2013-01-01
The development of oxygen (O2) carrying blood substitutes has evolved from the goal of replicating blood O2 transports properties to that of preserving microvascular and organ function, reducing the inherent or potential toxicity of the material used to carry O2, and treating pathologies initiated by anemia and hypoxia. Furthermore, the emphasis has shifted from blood replacement fluid to “O2 therapeutics” that restore tissue oxygenation to specific tissues regions. This review covers the different alternatives, potential and limitations of hemoglobin based O2 carriers (HBOCs) and perfluorocarbon based O2 carriers (PFCOCs), with emphasis on the physiological conditions disturbed in the situation that they will be used. It describes how concepts learned from plasma expanders without O2 carrying capacity can be applied to maintain O2 delivery and summarizes the microvascular responses due to HBOCs and PFCOCs. This review also presents alternative applications of HBOCs and PFCOCs namely: 1) How HBOC O2 affinity can be engineered to target O2 delivery to hypoxic tissues; and 2) How the high gas solubility of PFCOCs provides new opportunities for carrying, dissolving and delivering gases with biological activity. It is concluded that current blood substitutes development has amplified their applications horizon by devising therapeutic functions for oxygen carriers requiring limited O2 delivery capacity restoration. Conversely, full, blood-like O2 carrying capacity re-establishment awaits control of O2 carrier toxicity. PMID:23820271
Efficient Oligo nucleotide mediated CRISPR-Cas9 Gene Editing in Aspergilli
DEFF Research Database (Denmark)
Nødvig, Christina Spuur; Hoof, Jakob Blæsbjerg; Kogle, Martin Engelhard
2018-01-01
CRISPR-Cas9 technologies are revolutionizing fungal gene editing. Here we show that survival of specific Cas9/sgRNA mediated DNA double strand breaks (DSBs) depends on the non-homologous end-joining, NHEJ, DNA repair pathway and we use this observation to develop a tool to assess protospacer....... niger, and in A. oryzae indicating that this type of repair may be wide spread in filamentous fungi. Importantly, we demonstrate that by using single-stranded oligo nucleotides for CRISPR-Cas9 mediated gene editing it is possible to introduce specific point mutations as well gene deletions...
Detection of DNA nucleotides on pretreated boron doped diamond electrodes
Energy Technology Data Exchange (ETDEWEB)
Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica
2011-07-01
The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)