WorldWideScience

Sample records for non-synonymous nucleotide substitution

  1. Application of computational algorithms to assess the functionality of non-synonymous substitutions in MHC DRB gene of Nigerian goats

    Directory of Open Access Journals (Sweden)

    Yakubu Abdulmojeed

    2017-01-01

    Full Text Available The Major Histocompatibility Complex (MHC contains highly variable multi-gene families, which play a key role in the adaptive immune response within vertebrates. Among the Capra MHC class II genes, the expressed DRB locus is highly polymorphic, particularly in exon 2, which encodes the antigen-binding site. Models of variable non-synonymous/synonymous rate ratios among sites may provide important insights into functional constraints at different amino acid sites and may be used to detect sites under positive selection. Many non-synonymous single nucleotide polymorphisms (nsSNPs at the DRB locus in goats are suspected to impact protein function. This study, therefore, aimed at comparing the efficiency of six computational approaches to predict the likelihood of a particular non-synonymous (amino acid change coding SNP to cause a functional impact on the protein. This involved the use of PANTHER, SNAP, SIFT, PolyPhen-2, PROVEAN and nsSNPAnalyzer bioinformatics analytical tools in detecting harmful and beneficial effects at H57G, Y89R, V104D and Y112I substitutions in the peptide binding region of the DRB gene of Nigerian goats. The results from PANTHER analysis revealed that H57G, Y89R and Y112I substitutions (Pdeleterious= 0.113, 0.204 and 0.472, respectively were beneficial; while that of V104D was deleterious (Pdeleterious= 0.756, an indication that it was non-neutral. As regards the SNAP approach, H57G and Y89R substitutions were returned neutral with expected accuracy of 53 and 69%, respectively while V104D and Y112I substitutions were harmful. H57G and Y89R substitutions were also found harmless in the SIFT analysis. However, only H57G (PROVEAN and V104D (nsSNPAnalyzer amino acid substitutions were found to be beneficial. Interestingly, the predicted 3D structures of both native and mutant DRB protein appeared similar as validated by Ramachandran plots. The consensus reached by PANTHER, SNAP, SIFT and PolyPhen-2 approaches on the neutrality

  2. Bioinformatic Analysis of Deleterious Non-Synonymous Single Nucleotide Polymorphisms (nsSNPs in the Coding Regions of Human Prion Protein Gene (PRNP

    Directory of Open Access Journals (Sweden)

    Kourosh Bamdad

    2016-12-01

    Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion:  Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.

  3. Prediction by graph theoretic measures of structural effects in proteins arising from non-synonymous single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Tammy M K Cheng

    Full Text Available Recent analyses of human genome sequences have given rise to impressive advances in identifying non-synonymous single nucleotide polymorphisms (nsSNPs. By contrast, the annotation of nsSNPs and their links to diseases are progressing at a much slower pace. Many of the current approaches to analysing disease-associated nsSNPs use primarily sequence and evolutionary information, while structural information is relatively less exploited. In order to explore the potential of such information, we developed a structure-based approach, Bongo (Bonds ON Graph, to predict structural effects of nsSNPs. Bongo considers protein structures as residue-residue interaction networks and applies graph theoretical measures to identify the residues that are critical for maintaining structural stability by assessing the consequences on the interaction network of single point mutations. Our results show that Bongo is able to identify mutations that cause both local and global structural effects, with a remarkably low false positive rate. Application of the Bongo method to the prediction of 506 disease-associated nsSNPs resulted in a performance (positive predictive value, PPV, 78.5% similar to that of PolyPhen (PPV, 77.2% and PANTHER (PPV, 72.2%. As the Bongo method is solely structure-based, our results indicate that the structural changes resulting from nsSNPs are closely associated to their pathological consequences.

  4. The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

    Science.gov (United States)

    Yates, Christopher M; Sternberg, Michael J E

    2013-11-01

    Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

  5. The non-random clustering of non-synonymous substitutions and its relationship to evolutionary rate

    Directory of Open Access Journals (Sweden)

    Stone Eric A

    2011-08-01

    Full Text Available Abstract Background Protein sequences are subject to a mosaic of constraint. Changes to functional domains and buried residues, for example, are more apt to disrupt protein structure and function than are changes to residues participating in loops or exposed to solvent. Regions of constraint on the tertiary structure of a protein often result in loose segmentation of its primary structure into stretches of slowly- and rapidly-evolving amino acids. This clustering can be exploited, and existing methods have done so by relying on local sequence conservation as a signature of selection to help identify functionally important regions within proteins. We invert this paradigm by leveraging the regional nature of protein structure and function to both illuminate and make use of genome-wide patterns of local sequence conservation. Results Our hypothesis is that the regional nature of structural and functional constraints will assert a positive autocorrelation on the evolutionary rates of neighboring sites, which, in a pairwise comparison of orthologous proteins, will manifest itself as the clustering of non-synonymous changes across the amino acid sequence. We introduce a dispersion ratio statistic to test this and related hypotheses. Using genome-wide interspecific comparisons of orthologous protein pairs, we reveal a strong log-linear relationship between the degree of clustering and the intensity of constraint. We further demonstrate how this relationship varies with the evolutionary distance between the species being compared. We provide some evidence that proteins with a history of positive selection deviate from genome-wide trends. Conclusions We find a significant association between the evolutionary rate of a protein and the degree to which non-synonymous changes cluster along its primary sequence. We show that clustering is a non-redundant predictor of evolutionary rate, and we speculate that conflicting signals of clustering and constraint may

  6. In silico Analysis of the Functional and Structural Impacts of Non-synonymous Single Nucleotide Polymorphisms in the Human Paraxonase 1 Gene

    Directory of Open Access Journals (Sweden)

    Sudip Paul

    2015-09-01

    Full Text Available Computational approaches could help in identifying deleterious non-synonymous single nucleotide polymorphisms (nsSNPs in a disease related gene which is a difficult and laborious task through laboratory experiments. In the present study, we analyzed the impacts of nsSNPs on structure and function of Paraxonase 1 (PON1 using different bioinformatics tools. The human PON1 protein sequence and its corresponding gene's SNP information were collected from UniProt and dbSNP databases, respectively. We utilized SIFT, Polyphen, I-Mutant 2.0, MutPred, SNP and GO, PhD-SNP and PANTHER tools in order to examine the total 39 nsSNPs occurring in the PON1 coding region. We filtered the most pathological mutations by combining the scores of the aforementioned servers and found 8 SNPs (G344C, S302L, W281C, D279Y, H134R, F120S, L90P, C42R as deleterious and disease causing. The PDB structure of PON1 protein was obtained from RCSB Protein Data Bank (PDB ID: 1V04. The deleterious SNPs in native PON1 were introduced using Swiss-PDB Viewer package and changes in free energy were observed for six out of eight mutant structures. Two SNPs, S302L (substitution of serine to leucine at 302 position in amino acid sequence and L90P (substitution of leucine to proline at 90 position in amino acid sequence caused the highest energy increase amongst all. The findings implicate that these nsSNPs would be analyzed further in detail to enumerate their possible association with the protein deteriorating and disease causal potentialities.

  7. Prediction of the damage-associated non-synonymous single nucleotide polymorphisms in the human MC1R gene.

    Science.gov (United States)

    Hepp, Diego; Gonçalves, Gislene Lopes; de Freitas, Thales Renato Ochotorena

    2015-01-01

    The melanocortin 1 receptor (MC1R) is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs) in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC) phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H); C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.

  8. Prediction of the damage-associated non-synonymous single nucleotide polymorphisms in the human MC1R gene.

    Directory of Open Access Journals (Sweden)

    Diego Hepp

    Full Text Available The melanocortin 1 receptor (MC1R is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H; C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.

  9. Non-Synonymous Single-Nucleotide Polymorphisms and Physical Activity Interactions on Adiposity Parameters in Malaysian Adolescents

    Directory of Open Access Journals (Sweden)

    Nur Lisa Zaharan

    2018-04-01

    Full Text Available BackgroundSeveral non-synonymous single-nucleotide polymorphisms (nsSNPs have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA in relation to adiposity parameters among adolescents in Malaysia.MethodsWe examined whether (a PA and (b selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study (n = 1,151. Body mass indices, waist–hip ratio, and percentage body fat (% BF were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C. Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3 rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS. Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model.ResultsPAQ-C scores were associated with % BF (β = −0.44 [95% confidence interval −0.72, −0.16], p = 0.002. The CC genotype of ADRB3 rs4994 (β = −0.16 [−0.28, −0.05], corrected p = 0.01 and AA genotype of MC3R rs3827103 (β = −0.06 [−0.12, −0.00], p = 0.02 were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = −0.05 [−0.10, −0.01], p = 0.02 and combined GRS (β = −0.03 [−0.04, −0.01], p = 0.01 for % BF.ConclusionHigher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention

  10. Non-Synonymous Single-Nucleotide Polymorphisms and Physical Activity Interactions on Adiposity Parameters in Malaysian Adolescents.

    Science.gov (United States)

    Zaharan, Nur Lisa; Muhamad, Nor Hanisah; Jalaludin, Muhammad Yazid; Su, Tin Tin; Mohamed, Zahurin; Mohamed, M N A; A Majid, Hazreen

    2018-01-01

    Several non-synonymous single-nucleotide polymorphisms (nsSNPs) have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA) in relation to adiposity parameters among adolescents in Malaysia. We examined whether (a) PA and (b) selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study ( n  = 1,151). Body mass indices, waist-hip ratio, and percentage body fat (% BF) were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C). Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3) rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS). Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model. PAQ-C scores were associated with % BF (β = -0.44 [95% confidence interval -0.72, -0.16], p  = 0.002). The CC genotype of ADRB3 rs4994 (β = -0.16 [-0.28, -0.05], corrected p  = 0.01) and AA genotype of MC3R rs3827103 (β = -0.06 [-0.12, -0.00], p  = 0.02) were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = -0.05 [-0.10, -0.01], p  = 0.02) and combined GRS (β = -0.03 [-0.04, -0.01], p  = 0.01) for % BF. Higher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention in this population.

  11. Three-cohort targeted gene screening reveals a non-synonymous TRKA polymorphism associated with schizophrenia

    DEFF Research Database (Denmark)

    van Schijndel, Jessica E; van Loo, Karen M J; van Zweeden, Martine

    2009-01-01

    selected non-synonymous single-nucleotide polymorphisms (SNPs) in three independent Caucasian schizophrenia case-control cohorts (USA, Denmark and Norway). A meta-analysis revealed ten non-synonymous SNPs that were nominally associated with schizophrenia, nine of which have not been previously linked...... attractive candidate for further study concerns SNP rs6336 (q=0.12) that causes the substitution of an evolutionarily highly conserved amino acid residue in the kinase domain of the neurodevelopmentally important receptor TRKA. Thus, TRKA signaling may represent a novel susceptibility pathway...

  12. Inter-individual variation in nucleotide excision repair pathway is modulated by non-synonymous polymorphisms in ERCC4 and MBD4 genes

    Energy Technology Data Exchange (ETDEWEB)

    Allione, Alessandra, E-mail: alessandra.allione@hugef-torino.org [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Guarrera, Simonetta; Russo, Alessia [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Ricceri, Fulvio [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Department of Medical Sciences, University of Turin, Via Santena 19, 10126 Turin (Italy); Purohit, Rituraj [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Bioinformatics Division, School of Bio Sciences and Technology, Vellore Institute of Technology University, Vellore 632014, Tamil Nadu (India); Pagnani, Andrea; Rosa, Fabio; Polidoro, Silvia; Voglino, Floriana [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Matullo, Giuseppe [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Department of Medical Sciences, University of Turin, Via Santena 19, 10126 Turin (Italy)

    2013-11-15

    Highlights: • We reported a large inter-individual variability of NER capacity. • ERCC4 rs1800124 and MBD4 rs10342 nsSNP variants were associated with DNA repair capacity. • DNA–protein interaction analyses showed alteration of binding for ERCC4 and MBD4 variants. • A new possible cross-talk between NER and BER pathways has been reported. - Abstract: Inter-individual differences in DNA repair capacity (DRC) may lead to genome instability and, consequently, modulate individual cancer risk. Among the different DNA repair pathways, nucleotide excision repair (NER) is one of the most versatile, as it can eliminate a wide range of helix-distorting DNA lesions caused by ultraviolet light irradiation and chemical mutagens. We performed a genotype–phenotype correlation study in 122 healthy subjects in order to assess if any associations exist between phenotypic profiles of NER and DNA repair gene single nucleotide polymorphisms (SNPs). Individuals were genotyped for 768 SNPs with a custom Illumina Golden Gate Assay, and peripheral blood mononuclear cells (PBMCs) of the same subjects were tested for a NER comet assay to measure DRC after challenging cells by benzo(a)pyrene diolepoxide (BPDE). We observed a large inter-individual variability of NER capacity, with women showing a statistically significant lower DRC (mean ± SD: 6.68 ± 4.76; p = 0.004) than men (mean ± SD: 8.89 ± 5.20). Moreover, DRC was significantly lower in individuals carrying a variant allele for the ERCC4 rs1800124 non-synonymous SNP (nsSNP) (p = 0.006) and significantly higher in subjects with the variant allele of MBD4 rs2005618 SNP (p = 0.008), in linkage disequilibrium (r{sup 2} = 0.908) with rs10342 nsSNP. Traditional in silico docking approaches on protein–DNA and protein–protein interaction showed that Gly875 variant in ERCC4 (rs1800124) decreases the DNA–protein interaction and that Ser273 and Thr273 variants in MBD4 (rs10342) indicate complete loss of protein

  13. Identical substitutions in magnesium chelatase paralogs result in chlorophyll deficient soybean mutants

    Science.gov (United States)

    The soybean (Glycine max (L.) Merr.) chlorophyll deficient line MinnGold is a spontaneous mutant characterized by yellow foliage. Map-based cloning and transgenic complementation revealed that the mutant phenotype is caused by a non-synonymous nucleotide substitution in the third exon of a Mg-chelat...

  14. Predicting the effects of non-synonymous amino acid variants on ...

    African Journals Online (AJOL)

    amino acid change) coding SNPs to cause functional impact on protein at the PRLR locus of cattle and chicken using the MEGA MD bioinformatics tool. In cattle, sixteen out of the first twenty non synonymous amino substitutions obtained: V5A, T9V, ...

  15. Common non-synonymous SNPs associated with breast cancer susceptibility

    DEFF Research Database (Denmark)

    Milne, Roger L; Burwinkel, Barbara; Michailidou, Kyriaki

    2014-01-01

    Candidate variant association studies have been largely unsuccessful in identifying common breast cancer susceptibility variants, although most studies have been underpowered to detect associations of a realistic magnitude. We assessed 41 common non-synonymous single-nucleotide polymorphisms (ns......SNPs) for which evidence of association with breast cancer risk had been previously reported. Case-control data were combined from 38 studies of white European women (46 450 cases and 42 600 controls) and analyzed using unconditional logistic regression. Strong evidence of association was observed for three ns...... associations reached genome-wide statistical significance in a combined analysis of available data, including independent data from nine genome-wide association studies (GWASs): for ATXN7-K264R, OR = 1.07 (95% CI = 1.05-1.10, P = 1.0 × 10(-8)); for AKAP9-M463I, OR = 1.05 (95% CI = 1.04-1.07, P = 2.0 × 10...

  16. Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA

    Science.gov (United States)

    Jukes, T. H.; Kimura, M.

    1984-01-01

    The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

  17. Common non-synonymous SNPs associated with breast cancer susceptibility: findings from the Breast Cancer Association Consortium

    OpenAIRE

    Milne, Roger L.; Burwinkel, Barbara; Michailidou, Kyriaki; Arias-Perez, Jose-Ignacio; Zamora, M. Pilar; Menéndez-Rodríguez, Primitiva; Hardisson, David; Mendiola, Marta; González-Neira, Anna; Pita, Guillermo; Alonso, M. Rosario; Dennis, Joe; Wang, Qin; Bolla, Manjeet K.; Swerdlow, Anthony

    2014-01-01

    Candidate variant association studies have been largely unsuccessful in identifying common breast cancer susceptibility\\ud variants, although most studies have been underpowered to detect associations of a realistic magnitude.\\ud We assessed 41 common non-synonymous single-nucleotide polymorphisms (nsSNPs) for which\\ud evidence of association with breast cancer risk had been previously reported. Case-control data were combined\\ud from 38 studies of white European women (46 450 cases and 42 60...

  18. Common non-synonymous SNPs associated with breast cancer susceptibility: findings from the Breast Cancer Association Consortium

    OpenAIRE

    Milne, Roger L.; Burwinkel, Barbara; Michailidou, Kyriaki; Arias-Perez, Jose-Ignacio; Zamora, M. Pilar; Menéndez-Rodríguez, Primitiva; Hardisson, David; Mendiola, Marta; González-Neira, Anna; Pita, Guillermo; Alonso, M. Rosario; Dennis, Joe; Wang, Qin; Bolla, Manjeet K.; Swerdlow, Anthony

    2014-01-01

    Candidate variant association studies have been largely unsuccessful in identifying common breast cancer susceptibility variants, although most studies have been underpowered to detect associations of a realistic magnitude. We assessed 41 common non-synonymous single-nucleotide polymorphisms (nsSNPs) for which evidence of association with breast cancer risk had been previously reported. Case-control data were combined from 38 studies of white European women (46 450 cases and 42 600 controls) ...

  19. Common non-synonymous SNPs associated with breast cancer susceptibility: findings from the Breast Cancer Association Consortium

    OpenAIRE

    Milne, Roger L; Burwinkel, Barbara; Michailidou, Kyriaki; Arias-Perez, Jose-Ignacio; Zamora, M Pilar; Menéndez-Rodríguez, Primitiva; Hardisson, David; Mendiola, Marta; González-Neira, Anna; Pita, Guillermo; Alonso, M Rosario; Dennis, Joe; Wang, Qin; Bolla, Manjeet K; Swerdlow, Anthony

    2014-01-01

    Candidate variant association studies have been largely unsuccessful in identifying common breast cancer susceptibility variants, although most studies have been underpowered to detect associations of a realistic magnitude We assessed 41 common non-synonymous single-nucleotide polymorphisms (nsSNPs) for which evidence of association with breast cancer risk had been previously reported. Case-control data were combined from 38 studies of white European women (46 450 cases and 42 600 controls) a...

  20. Numerical taxonomy of the genus Pestivirus based on palindromic nucleotide substitutions in the 5' untranslated region.

    Science.gov (United States)

    Giangaspero, Massimo; Harasawa, Ryô

    2007-12-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences.

  1. Selection on start codons in prokaryotes and potential compensatory nucleotide substitutions.

    Science.gov (United States)

    Belinky, Frida; Rogozin, Igor B; Koonin, Eugene V

    2017-09-29

    Reconstruction of the evolution of start codons in 36 groups of closely related bacterial and archaeal genomes reveals purifying selection affecting AUG codons. The AUG starts are replaced by GUG and especially UUG significantly less frequently than expected under the neutral expectation derived from the frequencies of the respective nucleotide triplet substitutions in non-coding regions and in 4-fold degenerate sites. Thus, AUG is the optimal start codon that is actively maintained by purifying selection. However, purifying selection on start codons is significantly weaker than the selection on the same codons in coding sequences, although the switches between the codons result in conservative amino acid substitutions. The only exception is the AUG to UUG switch that is strongly selected against among start codons. Selection on start codons is most pronounced in evolutionarily conserved, highly expressed genes. Mutation of the start codon to a sub-optimal form (GUG or UUG) tends to be compensated by mutations in the Shine-Dalgarno sequence towards a stronger translation initiation signal. Together, all these findings indicate that in prokaryotes, translation start signals are subject to weak but significant selection for maximization of initiation rate and, consequently, protein production.

  2. Dopa-responsive dystonia: functional analysis of single nucleotide substitutions within the 5' untranslated GCH1 region.

    Directory of Open Access Journals (Sweden)

    Ioanna A Armata

    Full Text Available BACKGROUND: Mutations in the GCH1 gene are associated with childhood onset, dopa-responsive dystonia (DRD. Correct diagnosis of DRD is crucial, given the potential for complete recovery once treated with L-dopa. The majority of DRD associated mutations lie within the coding region of the GCH1 gene, but three additional single nucleotide sequence substitutions have been reported within the 5' untranslated (5'UTR region of the mRNA. The biologic significance of these 5'UTR GCH1 sequence substitutions has not been analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Luciferase reporter assays, quantitative real time PCR and RNA decay assays, combined with bioinformatics, revealed a pathogenic 5'UTR GCH1 substitution. The +142C>T single nucleotide 5'UTR substitution that segregates with affected status in DRD patients, substantially attenuates translation without altering RNA expression levels or stability. The +142C>T substitution disrupts translation most likely by creating an upstream initiation start codon (uAUG and an upstream open reading frame (uORF. CONCLUSIONS/SIGNIFICANCE: This is the first GCH1 regulatory substitution reported to act at a post-transcriptional level, increasing the list of genetic diseases caused by abnormal translation and reaffirming the importance of investigating potential regulatory substitutions in genetic diseases.

  3. Species characterization in the genus Pestivirus according to palindromic nucleotide substitutions in the 5'-untranslated region.

    Science.gov (United States)

    Giangaspero, Massimo; Harasawa, Ryô

    2011-06-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the

  4. Role of novel and rare nucleotide substitutions of the β-globin gene

    Directory of Open Access Journals (Sweden)

    Margherita Vinciguerra

    2012-11-01

    Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序,旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段:1)血液及血红蛋白数据;2)珠蛋白基因分子分析以及家族遗传研究(如有可能)。 自2003年以来,我们已对这类病例进行DNA序列分析:传统的分子方法无法给出完整的诊断响应,尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。

  5. Plastome-Wide Nucleotide Substitution Rates Reveal Accelerated Rates in Papilionoideae and Correlations with Genome Features Across Legume Subfamilies.

    Science.gov (United States)

    Schwarz, Erika N; Ruhlman, Tracey A; Weng, Mao-Lun; Khiyami, Mohammad A; Sabir, Jamal S M; Hajarah, Nahid H; Alharbi, Njud S; Rabah, Samar O; Jansen, Robert K

    2017-04-01

    This study represents the most comprehensive plastome-wide comparison of nucleotide substitution rates across the three subfamilies of Fabaceae: Caesalpinioideae, Mimosoideae, and Papilionoideae. Caesalpinioid and mimosoid legumes have large, unrearranged plastomes compared with papilionoids, which exhibit varying levels of rearrangement including the loss of the inverted repeat (IR) in the IR-lacking clade (IRLC). Using 71 genes common to 39 legume taxa representing all the three subfamilies, we show that papilionoids consistently have higher nucleotide substitution rates than caesalpinioids and mimosoids, and rates in the IRLC papilionoids are generally higher than those in the IR-containing papilionoids. Unsurprisingly, this pattern was significantly correlated with growth habit as most papilionoids are herbaceous, whereas caesalpinioids and mimosoids are largely woody. Both nonsynonymous (dN) and synonymous (dS) substitution rates were also correlated with several biological features including plastome size and plastomic rearrangements such as the number of inversions and indels. In agreement with previous reports, we found that genes in the IR exhibit between three and fourfold reductions in the substitution rates relative to genes within the large single-copy or small single-copy regions. Furthermore, former IR genes in IR-lacking taxa exhibit accelerated rates compared with genes contained in the IR.

  6. Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

    International Nuclear Information System (INIS)

    Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.

    1990-08-01

    The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

  7. Synthesis of Substituted Benzyl Homo-C-Ribonucleosides and -Nucleotides as Carba-Analogues of Phosphoribosylanthranilate

    Czech Academy of Sciences Publication Activity Database

    Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal

    -, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012

  8. Characterization of coding synonymous and non-synonymous variants in ADAMTS13 using ex vivo and in silico approaches.

    Directory of Open Access Journals (Sweden)

    Nathan C Edwards

    Full Text Available Synonymous variations, which are defined as codon substitutions that do not change the encoded amino acid, were previously thought to have no effect on the properties of the synthesized protein(s. However, mounting evidence shows that these "silent" variations can have a significant impact on protein expression and function and should no longer be considered "silent". Here, the effects of six synonymous and six non-synonymous variations, previously found in the gene of ADAMTS13, the von Willebrand Factor (VWF cleaving hemostatic protease, have been investigated using a variety of approaches. The ADAMTS13 mRNA and protein expression levels, as well as the conformation and activity of the variants have been compared to that of wild-type ADAMTS13. Interestingly, not only the non-synonymous variants but also the synonymous variants have been found to change the protein expression levels, conformation and function. Bioinformatic analysis of ADAMTS13 mRNA structure, amino acid conservation and codon usage allowed us to establish correlations between mRNA stability, RSCU, and intracellular protein expression. This study demonstrates that variants and more specifically, synonymous variants can have a substantial and definite effect on ADAMTS13 function and that bioinformatic analysis may allow development of predictive tools to identify variants that will have significant effects on the encoded protein.

  9. Effect of the assignment of ancestral CpG state on the estimation of nucleotide substitution rates in mammals

    Directory of Open Access Journals (Sweden)

    Keightley Peter D

    2008-09-01

    Full Text Available Abstract Background Molecular evolutionary studies in mammals often estimate nucleotide substitution rates within and outside CpG dinucleotides separately. Frequently, in alignments of two sequences, the division of sites into CpG and non-CpG classes is based simply on the presence or absence of a CpG dinucleotide in either sequence, a procedure that we refer to as CpG/non-CpG assignment. Although it likely that this procedure is biased, it is generally assumed that the bias is negligible if species are very closely related. Results Using simulations of DNA sequence evolution we show that assignment of the ancestral CpG state based on the simple presence/absence of the CpG dinucleotide can seriously bias estimates of the substitution rate, because many true non-CpG changes are misassigned as CpG. Paradoxically, this bias is most severe between closely related species, because a minimum of two substitutions are required to misassign a true ancestral CpG site as non-CpG whereas only a single substitution is required to misassign a true ancestral non-CpG site as CpG in a two branch tree. We also show that CpG misassignment bias differentially affects fourfold degenerate and noncoding sites due to differences in base composition such that fourfold degenerate sites can appear to be evolving more slowly than noncoding sites. We demonstrate that the effects predicted by our simulations occur in a real evolutionary setting by comparing substitution rates estimated from human-chimp coding and intronic sequence using CpG/non-CpG assignment with estimates derived from a method that is largely free from bias. Conclusion Our study demonstrates that a common method of assigning sites into CpG and non CpG classes in pairwise alignments is seriously biased and recommends against the adoption of ad hoc methods of ancestral state assignment.

  10. Probing the mechanistic consequences of 5-fluorine substitution on cytidine nucleotide analogue incorporation by HIV-1 reverse transcriptase.

    Science.gov (United States)

    Ray, Adrian S; Schinazi, Raymond F; Murakami, Eisuke; Basavapathruni, Aravind; Shi, Junxing; Zorca, Suzana M; Chu, Chung K; Anderson, Karen S

    2003-05-01

    Beta-D and beta-L-enantiomers of 2',3'-dideoxycytidine analogues are potent chain-terminators and antimetabolites for viral and cellular replication. Seemingly small modifications markedly alter their antiviral and toxicity patterns. This review discusses previously published and recently obtained data on the effects of 5- and 2'-fluorine substitution on the pre-steady state incorporation of 2'-deoxycytidine-5'-monophosphate analogues by HIV-1 reverse transcriptase (RT) in light of their biological activity. The addition of fluorine at the 5-position of the pyrimidine ring altered the kinetic parameters for all nucleotides tested. Only the 5-fluorine substitution of the clinically relevant nucleosides (-)-beta-L-2',3'-dideoxy-3'-thia-5-fluorocytidine (L-FTC, Emtriva), and (+)-beta-D-2',3'-didehydro-2',3'-dideoxy-5-fluorocytidine (D-D4FC, Reverset), caused a higher overall efficiency of nucleotide incorporation during both DNA- and RNA-directed synthesis. Enhanced incorporation by RT may in part explain the potency of these nucleosides against HIV-1. In other cases, a lack of correlation between RT incorporation in enzymatic assays and antiviral activity in cell culture illustrates the importance of other cellular factors in defining antiviral potency. The substitution of fluorine at the 2' position of the deoxyribose ring negatively affects incorporation by RT indicating the steric gate of RT can detect electrostatic perturbations. Intriguing results pertaining to drug resistance have led to a better understanding of HIV-1 RT resistance mechanisms. These insights serve as a basis for understanding the mechanism of action for nucleoside analogues and, coupled with studies on other key enzymes, may lead to the more effective use of fluorine to enhance the potency and selectivity of antiviral agents.

  11. Partition dataset according to amino acid type improves the prediction of deleterious non-synonymous SNPs

    International Nuclear Information System (INIS)

    Yang, Jing; Li, Yuan-Yuan; Li, Yi-Xue; Ye, Zhi-Qiang

    2012-01-01

    Highlights: ► Proper dataset partition can improve the prediction of deleterious nsSNPs. ► Partition according to original residue type at nsSNP is a good criterion. ► Similar strategy is supposed promising in other machine learning problems. -- Abstract: Many non-synonymous SNPs (nsSNPs) are associated with diseases, and numerous machine learning methods have been applied to train classifiers for sorting disease-associated nsSNPs from neutral ones. The continuously accumulated nsSNP data allows us to further explore better prediction approaches. In this work, we partitioned the training data into 20 subsets according to either original or substituted amino acid type at the nsSNP site. Using support vector machine (SVM), training classification models on each subset resulted in an overall accuracy of 76.3% or 74.9% depending on the two different partition criteria, while training on the whole dataset obtained an accuracy of only 72.6%. Moreover, the dataset was also randomly divided into 20 subsets, but the corresponding accuracy was only 73.2%. Our results demonstrated that partitioning the whole training dataset into subsets properly, i.e., according to the residue type at the nsSNP site, will improve the performance of the trained classifiers significantly, which should be valuable in developing better tools for predicting the disease-association of nsSNPs.

  12. Numerical taxonomy of the genus Pestivirus: new software for genotyping based on the palindromic nucleotide substitutions method.

    Science.gov (United States)

    Giangaspero, Massimo; Apicella, Claudio; Harasawa, Ryô

    2013-09-01

    The genus Pestivirus from the family Flaviviridae is represented by four established species; Bovine viral diarrhea virus 1 (BVDV-1); Bovine viral diarrhea virus 2 (BVDV-2); Border disease virus (BDV); and Classical swine fever virus (CSFV); as well a tentative species from a Giraffe. The palindromic nucleotide substitutions (PNS) in the 5' untranslated region (UTR) of Pestivirus RNA has been described as a new, simple and practical method for genotyping. New software is described, also named PNS, that was prepared specifically for this PNS genotyping procedure. Pestivirus identification using PNS was evaluated on five hundred and forty-three sequences at genus, species and genotype level using this software. The software is freely available at www.pns-software.com. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  14. Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

    Science.gov (United States)

    Nishizawa, M; Nishizawa, K

    2000-10-01

    The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

  15. regSNPs-splicing: a tool for prioritizing synonymous single-nucleotide substitution.

    Science.gov (United States)

    Zhang, Xinjun; Li, Meng; Lin, Hai; Rao, Xi; Feng, Weixing; Yang, Yuedong; Mort, Matthew; Cooper, David N; Wang, Yue; Wang, Yadong; Wells, Clark; Zhou, Yaoqi; Liu, Yunlong

    2017-09-01

    While synonymous single-nucleotide variants (sSNVs) have largely been unstudied, since they do not alter protein sequence, mounting evidence suggests that they may affect RNA conformation, splicing, and the stability of nascent-mRNAs to promote various diseases. Accurately prioritizing deleterious sSNVs from a pool of neutral ones can significantly improve our ability of selecting functional genetic variants identified from various genome-sequencing projects, and, therefore, advance our understanding of disease etiology. In this study, we develop a computational algorithm to prioritize sSNVs based on their impact on mRNA splicing and protein function. In addition to genomic features that potentially affect splicing regulation, our proposed algorithm also includes dozens structural features that characterize the functions of alternatively spliced exons on protein function. Our systematical evaluation on thousands of sSNVs suggests that several structural features, including intrinsic disorder protein scores, solvent accessible surface areas, protein secondary structures, and known and predicted protein family domains, show significant differences between disease-causing and neutral sSNVs. Our result suggests that the protein structure features offer an added dimension of information while distinguishing disease-causing and neutral synonymous variants. The inclusion of structural features increases the predictive accuracy for functional sSNV prioritization.

  16. Contrasting Patterns of Nucleotide Substitution Rates Provide Insight into Dynamic Evolution of Plastid and Mitochondrial Genomes of Geranium.

    Science.gov (United States)

    Park, Seongjun; Ruhlman, Tracey A; Weng, Mao-Lun; Hajrah, Nahid H; Sabir, Jamal S M; Jansen, Robert K

    2017-06-01

    Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have included limited sampling of Geranium, the largest genus in the family with over 400 species. This study reports on rates and patterns of nucleotide substitutions in plastomes and mitogenomes of 17 species of Geranium and representatives of other Geraniaceae. As detected across other angiosperms, substitution rates in the plastome are 3.5 times higher than the mitogenome in most Geranium. However, in the branch leading to Geranium brycei/Geranium incanum mitochondrial genes experienced significantly higher dN and dS than plastid genes, a pattern that has only been detected in one other angiosperm. Furthermore, rate accelerations differ in the two organelle genomes with plastomes having increased dN and mitogenomes with increased dS. In the Geranium phaeum/Geranium reflexum clade, duplicate copies of clpP and rpoA genes that experienced asymmetric rate divergence were detected in the single copy region of the plastome. In the case of rpoA, the branch leading to G. phaeum/G. reflexum experienced positive selection or relaxation of purifying selection. Finally, the evolution of acetyl-CoA carboxylase is unusual in Geraniaceae because it is only the second angiosperm family where both prokaryotic and eukaryotic ACCases functionally coexist in the plastid. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. In-silico analysis of non-synonymous-SNPs of STEAP2: To provoke the progression of prostate cancer

    Directory of Open Access Journals (Sweden)

    Naveed Muhammad

    2016-01-01

    Full Text Available As a novel biomarker from the STEAP family, STEAP2 encodes six transmembrane epithelial antigens to prostate cancer. The overexpression of STEAP2 is predicted as the second most common cancer in the world that is responsible for male cancer-related deaths. Nonsynonymous SNPs are important group of SNPs which lead to alternations in encoded polypeptides. Changes in the amino acid sequence of gene products can lead to abnormal tissue function. The present study firstly sorted out those SNPs which exist in the coding region of STEAP2 and evaluated their impact through computational tools. Secondly, the three-dimensional structure of STEAP2 was formed through I-TASSER and validated by different software. Genomic data has been retrieved from the 1000 Genome project and Ensembl and subsequently analysed using computational tools. Out of 177 non-synonymous single nucleotide polymorphisms (nsSNPs within the coding region, 42 mis-sense SNPs have been predicted as deleterious by all analyses. Our research shows a welldesigned computational methodology to inspect the prostate cancer associated nsSNPs. It can be concluded that these nsSNPs can play their role in the up-regulation of STEAP2 which further leads to progression of prostate cancer. It can benefit scientists in the handling of cancerassociated diseases related to STEAP2 through developing novel drug therapies.

  18. Study of five novel non-synonymous polymorphisms in human brain-expressed genes in a Colombian sample.

    Science.gov (United States)

    Ojeda, Diego A; Forero, Diego A

    2014-10-01

    Non-synonymous single nucleotide polymorphisms (nsSNPs) in brain-expressed genes represent interesting candidates for genetic research in neuropsychiatric disorders. To study novel nsSNPs in brain-expressed genes in a sample of Colombian subjects. We applied an approach based on in silico mining of available genomic data to identify and select novel nsSNPs in brain-expressed genes. We developed novel genotyping assays, based in allele-specific PCR methods, for these nsSNPs and genotyped them in 171 Colombian subjects. Five common nsSNPs (rs6855837; p.Leu395Ile, rs2305160; p.Thr394Ala, rs10503929; p.Met289Thr, rs2270641; p.Thr4Pro and rs3822659; p.Ser735Ala) were studied, located in the CLOCK, NPAS2, NRG1, SLC18A1 and WWC1 genes. We reported allele and genotype frequencies in a sample of South American healthy subjects. There is previous experimental evidence, arising from genome-wide expression and association studies, for the involvement of these genes in several neuropsychiatric disorders and endophenotypes, such as schizophrenia, mood disorders or memory performance. Frequencies for these nsSNPSs in the Colombian samples varied in comparison to different HapMap populations. Future study of these nsSNPs in brain-expressed genes, a synaptogenomics approach, will be important for a better understanding of neuropsychiatric diseases and endophenotypes in different populations.

  19. A computational prospect to aspirin side effects: aspirin and COX-1 interaction analysis based on non-synonymous SNPs.

    Science.gov (United States)

    Marjan, Mojtabavi Naeini; Hamzeh, Mesrian Tanha; Rahman, Emamzadeh; Sadeq, Vallian

    2014-08-01

    Aspirin (ASA) is a commonly used nonsteroidal anti-inflammatory drug (NSAID), which exerts its therapeutic effects through inhibition of cyclooxygenase (COX) isoform 2 (COX-2), while the inhibition of COX-1 by ASA leads to apparent side effects. In the present study, the relationship between COX-1 non-synonymous single nucleotide polymorphisms (nsSNPs) and aspirin related side effects was investigated. The functional impacts of 37 nsSNPs on aspirin inhibition potency of COX-1 with COX-1/aspirin molecular docking were computationally analyzed, and each SNP was scored based on DOCK Amber score. The data predicted that 22 nsSNPs could reduce COX-1 inhibition, while 15 nsSNPs showed increasing inhibition level in comparison to the regular COX-1 protein. In order to perform a comparing state, the Amber scores for two Arg119 mutants (R119A and R119Q) were also calculated. Moreover, among nsSNP variants, rs117122585 represented the closest Amber score to R119A mutant. A separate docking computation validated the score and represented a new binding position for ASA that acetyl group was located within the distance of 3.86Å from Ser529 OH group. This could predict an associated loss of activity of ASA through this nsSNP variant. Our data represent a computational sub-population pattern for aspirin COX-1 related side effects, and provide basis for further research on COX-1/ASA interaction. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Determining effects of non-synonymous SNPs on protein-protein interactions using supervised and semi-supervised learning.

    Directory of Open Access Journals (Sweden)

    Nan Zhao

    2014-05-01

    Full Text Available Single nucleotide polymorphisms (SNPs are among the most common types of genetic variation in complex genetic disorders. A growing number of studies link the functional role of SNPs with the networks and pathways mediated by the disease-associated genes. For example, many non-synonymous missense SNPs (nsSNPs have been found near or inside the protein-protein interaction (PPI interfaces. Determining whether such nsSNP will disrupt or preserve a PPI is a challenging task to address, both experimentally and computationally. Here, we present this task as three related classification problems, and develop a new computational method, called the SNP-IN tool (non-synonymous SNP INteraction effect predictor. Our method predicts the effects of nsSNPs on PPIs, given the interaction's structure. It leverages supervised and semi-supervised feature-based classifiers, including our new Random Forest self-learning protocol. The classifiers are trained based on a dataset of comprehensive mutagenesis studies for 151 PPI complexes, with experimentally determined binding affinities of the mutant and wild-type interactions. Three classification problems were considered: (1 a 2-class problem (strengthening/weakening PPI mutations, (2 another 2-class problem (mutations that disrupt/preserve a PPI, and (3 a 3-class classification (detrimental/neutral/beneficial mutation effects. In total, 11 different supervised and semi-supervised classifiers were trained and assessed resulting in a promising performance, with the weighted f-measure ranging from 0.87 for Problem 1 to 0.70 for the most challenging Problem 3. By integrating prediction results of the 2-class classifiers into the 3-class classifier, we further improved its performance for Problem 3. To demonstrate the utility of SNP-IN tool, it was applied to study the nsSNP-induced rewiring of two disease-centered networks. The accurate and balanced performance of SNP-IN tool makes it readily available to study the

  1. Determining Effects of Non-synonymous SNPs on Protein-Protein Interactions using Supervised and Semi-supervised Learning

    Science.gov (United States)

    Zhao, Nan; Han, Jing Ginger; Shyu, Chi-Ren; Korkin, Dmitry

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are among the most common types of genetic variation in complex genetic disorders. A growing number of studies link the functional role of SNPs with the networks and pathways mediated by the disease-associated genes. For example, many non-synonymous missense SNPs (nsSNPs) have been found near or inside the protein-protein interaction (PPI) interfaces. Determining whether such nsSNP will disrupt or preserve a PPI is a challenging task to address, both experimentally and computationally. Here, we present this task as three related classification problems, and develop a new computational method, called the SNP-IN tool (non-synonymous SNP INteraction effect predictor). Our method predicts the effects of nsSNPs on PPIs, given the interaction's structure. It leverages supervised and semi-supervised feature-based classifiers, including our new Random Forest self-learning protocol. The classifiers are trained based on a dataset of comprehensive mutagenesis studies for 151 PPI complexes, with experimentally determined binding affinities of the mutant and wild-type interactions. Three classification problems were considered: (1) a 2-class problem (strengthening/weakening PPI mutations), (2) another 2-class problem (mutations that disrupt/preserve a PPI), and (3) a 3-class classification (detrimental/neutral/beneficial mutation effects). In total, 11 different supervised and semi-supervised classifiers were trained and assessed resulting in a promising performance, with the weighted f-measure ranging from 0.87 for Problem 1 to 0.70 for the most challenging Problem 3. By integrating prediction results of the 2-class classifiers into the 3-class classifier, we further improved its performance for Problem 3. To demonstrate the utility of SNP-IN tool, it was applied to study the nsSNP-induced rewiring of two disease-centered networks. The accurate and balanced performance of SNP-IN tool makes it readily available to study the rewiring of

  2. Differences in substrate specificity of C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides by DNA polymerases from thermophilic bacteria, archaea, and phages.

    Science.gov (United States)

    Sawai, Hiroaki; Nagashima, Junichi; Kuwahara, Msayasu; Kitagata, Rina; Tamura, Takehiro; Matsui, Ikuo

    2007-09-01

    The pyrimidine bases of RNA are uracil (U) and cytosine (C), while thymine (T) and C are used for DNA. The C(5) position of C and U is unsubstituted, whereas the C(5) of T is substituted with a Me group. Miller et al. hypothesized that various C(5)-substituted uracil derivatives were formed during chemical evolution, and that C(5)-substituted U derivatives may have played important roles in the transition from an 'RNA world' to a 'DNA-RNA-protein world'. Hyperthermophilic bacteria and archaea are considered to be primitive organisms that are evolutionarily close to the universal ancestor of all life on earth. Thus, we examined the substrate specificity of several C(5)-substituted or C(5)-unsubstituted dUTP and dCTP analogs for several DNA polymerases from hyperthermophilic bacteria, hyperthermophilic archaea, and viruses during PCR or primer extension reaction. The substrate specificity of the C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides varied greatly depending on the type of DNA polymerase. The significance of this difference in substrate specificity in terms of the origin and evolution of the DNA replication system is discussed briefly.

  3. Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

    International Nuclear Information System (INIS)

    Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

    1998-01-01

    To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

  4. Synthesis of 8-amino and 8-substituted amino derivatives of acyclic purine nucleoside and nucleotide analogs. Alkylation of 8-substituted purine bases

    Czech Academy of Sciences Publication Activity Database

    Janeba, Zlatko; Holý, Antonín

    2001-01-01

    Roč. 20, 4-7 (2001), s. 1103-1106 ISSN 1525-7770 R&D Projects: GA ČR GV203/96/K001 Institutional research plan: CEZ:AV0Z4055905 Keywords : nucleotide analogs Subject RIV: CC - Organic Chemistry Impact factor: 0.508, year: 2001

  5. Substitution of Active Site Tyrosines with Tryptophan Alters the Free Energy for Nucleotide Flipping by Human Alkyladenine DNA Glycosylase†

    Science.gov (United States)

    Hendershot, Jenna M.; Wolfe, Abigail E.; O'Brien, Patrick J.

    2011-01-01

    Human alkyladenine DNA glycosylase (AAG) locates and excises a wide variety of structurally diverse alkylated and oxidized purine lesions from DNA to initiate the base excision repair pathway. Recognition of a base lesion requires flipping of the damaged nucleotide into a relatively open active site pocket between two conserved tyrosine residues, Y127 and Y159. We have mutated each of these amino acids to tryptophan and measured the kinetic effects on the nucleotide flipping and base excision steps. The Y127W and Y159W mutant proteins have robust glycosylase activity toward DNA containing 1,N6-ethenoadenine (εA), within 4-fold of that of the wildtype enzyme, raising the possibility that tryptophan fluorescence could be used to probe the DNA binding and nucleotide flipping steps. Stopped-flow fluorescence was used to compare the time-dependent changes in tryptophan fluorescence and εA fluorescence. For both mutants, the tryptophan fluorescence exhibited two-step binding with essentially identical rate constants as were observed for the εA fluorescence changes. These results provide evidence that AAG forms an initial recognition complex in which the active site pocket is perturbed and the stacking of the damaged base is disrupted. Upon complete nucleotide flipping, there is further quenching of the tryptophan fluorescence with coincident quenching of the εA fluorescence. Although these mutations do not have large effects on the rate constant for excision of εA, there are dramatic effects on the rate constants for nucleotide flipping that result in 40 to 100-fold decreases in the flipping equilibrium relative to wildtype. Most of this effect is due to an increased rate of unflipping, but surprisingly the Y159W mutation causes a 5-fold increase in the rate constant for flipping. The large effect on the equilibrium for nucleotide flipping explains the greater deleterious effects that these mutations have on the glycosylase activity toward base lesions that are in

  6. The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit.

    Science.gov (United States)

    Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun

    2016-10-01

    The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

  7. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas

    2013-01-01

    The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

  8. Genetic variation of classical swine fever virus based on palindromic nucleotide substitutions, a genetic marker in the 5' untranslated region of RNA

    Directory of Open Access Journals (Sweden)

    Massimo Giangaspero

    2008-06-01

    Full Text Available Forty-three strains of classical swine fever (hog cholera virus (CSFV from outbreaks in pigs in Europe, Asia and America, two strains from commercial CSFV modified live vaccines and a strain isolated from a diseased lamb from Spain were subjected to analyses of nucleotide sequence variations in the 5’ terminal region of the genome. These isolates were divided into three clusters, namely: CSFV-1, CSFV-2, and CSFV-3, based on palindromic nucleotide substitutions in the 5’ untranslated region (UTR. The homology degree, according to nucleotide base pairing variation in the secondary palindromic structure of the three variable loci V1, V2 and V3, was 60% in the CSFV species, with a mean divergence value of 6.19 base pairs (bp. relatedness within genotypes ranged from 71.11% to 100%, with mean divergence values from 5.5 to 0.73 base pairs. Subgenotypes showed a divergence ranging from 1 to 9 base pairs within the genotype. Genotype CSFV-1 revealed 15 base pair combinations with 13 divergent base pairs, resulting in 4 subgenotypes with 6 variants in subgenotype CSFV-1.1, including the reference strain Brescia and 6 variants in subgenotype CSFV-1.2, including the Alfort reference strain. Subgenotypes CSFV-1.3 and CSFV-1.4 comprised one and two variants, respectively. Genotype CSFV-2 was represented by the Spanish ovine isolate 5440/99 and the genotype CSFV-3 included the Japanese strains Okinawa/86 and Kanagawa/74. CSFV genotypes revealed a strong relationship with Border disease virus strains, showing relatively low divergence values when compared to other pestivirus species. Evaluation of nucleotide base pair divergence among genotypes and expression of evolutionary changes in the CSFV species led to the construction of a phylogenetic tree based on secondary structure.

  9. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff

    Science.gov (United States)

    Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J.; Lu, Xiangyi; Ruden, Douglas M.

    2012-01-01

    We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w1118; iso-2; iso-3 strain and the reference y1; cn1 bw1 sp1 strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5′UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5′ and 3′ UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory. PMID:22728672

  10. High-confidence assessment of functional impact of human mitochondrial non-synonymous genome variations by APOGEE.

    Directory of Open Access Journals (Sweden)

    Stefano Castellana

    2017-06-01

    Full Text Available 24,189 are all the possible non-synonymous amino acid changes potentially affecting the human mitochondrial DNA. Only a tiny subset was functionally evaluated with certainty so far, while the pathogenicity of the vast majority was only assessed in-silico by software predictors. Since these tools proved to be rather incongruent, we have designed and implemented APOGEE, a machine-learning algorithm that outperforms all existing prediction methods in estimating the harmfulness of mitochondrial non-synonymous genome variations. We provide a detailed description of the underlying algorithm, of the selected and manually curated training and test sets of variants, as well as of its classification ability.

  11. Non-synonymous FGD3 Variant as Positional Candidate for Disproportional Tall Stature Accounting for a Carcass Weight QTL (CW-3 and Skeletal Dysplasia in Japanese Black Cattle.

    Directory of Open Access Journals (Sweden)

    Akiko Takasuga

    2015-08-01

    Full Text Available Recessive skeletal dysplasia, characterized by joint- and/or hip bone-enlargement, was mapped within the critical region for a major quantitative trait locus (QTL influencing carcass weight; previously named CW-3 in Japanese Black cattle. The risk allele was on the same chromosome as the Q allele that increases carcass weight. Phenotypic characterization revealed that the risk allele causes disproportional tall stature and bone size that increases carcass weight in heterozygous individuals but causes disproportionately narrow chest width in homozygotes. A non-synonymous variant of FGD3 was identified as a positional candidate quantitative trait nucleotide (QTN and the corresponding mutant protein showed reduced activity as a guanine nucleotide exchange factor for Cdc42. FGD3 is expressed in the growth plate cartilage of femurs from bovine and mouse. Thus, loss of FDG3 activity may lead to subsequent loss of Cdc42 function. This would be consistent with the columnar disorganization of proliferating chondrocytes in chondrocyte-specific inactivated Cdc42 mutant mice. This is the first report showing association of FGD3 with skeletal dysplasia.

  12. Functional non-synonymous variants of ABCG2 and gout risk.

    Science.gov (United States)

    Stiburkova, Blanka; Pavelcova, Katerina; Zavada, Jakub; Petru, Lenka; Simek, Pavel; Cepek, Pavel; Pavlikova, Marketa; Matsuo, Hirotaka; Merriman, Tony R; Pavelka, Karel

    2017-11-01

    Common dysfunctional variants of ATP binding cassette subfamily G member 2 (Junior blood group) (ABCG2), a high-capacity urate transporter gene, that result in decreased urate excretion are major causes of hyperuricemia and gout. In the present study, our objective was to determine the frequency and effect on gout of common and rare non-synonymous and other functional allelic variants in the ABCG2 gene. The main cohort recruited from the Czech Republic consisted of 145 gout patients; 115 normouricaemic controls were used for comparison. We amplified, directly sequenced and analysed 15 ABCG2 exons. The associations between genetic variants and clinical phenotype were analysed using the t-test, Fisher's exact test and a logistic and linear regression approach. Data from a New Zealand Polynesian sample set and the UK Biobank were included for the p.V12M analysis. In the ABCG2 gene, 18 intronic (one dysfunctional splicing) and 11 exonic variants were detected: 9 were non-synonymous (2 common, 7 rare including 1 novel), namely p.V12M, p.Q141K, p.R147W, p.T153M, p.F373C, p.T434M, p.S476P, p.D620N and p.K360del. The p.Q141K (rs2231142) variant had a significantly higher minor allele frequency (0.23) in the gout patients compared with the European-origin population (0.09) and was significantly more common among gout patients than among normouricaemic controls (odds ratio = 3.26, P gout (42 vs 48 years, P = 0.0143) and a greater likelihood of a familial history of gout (41% vs 27%, odds ratio = 1.96, P = 0.053). In a meta-analysis p.V12M exerted a protective effect from gout (P gout. Non-synonymous allelic variants of ABCG2 had a significant effect on earlier onset of gout and the presence of a familial gout history. ABCG2 should thus be considered a common and significant risk factor for gout. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  13. LS-SNP/PDB: annotated non-synonymous SNPs mapped to Protein Data Bank structures.

    Science.gov (United States)

    Ryan, Michael; Diekhans, Mark; Lien, Stephanie; Liu, Yun; Karchin, Rachel

    2009-06-01

    LS-SNP/PDB is a new WWW resource for genome-wide annotation of human non-synonymous (amino acid changing) SNPs. It serves high-quality protein graphics rendered with UCSF Chimera molecular visualization software. The system is kept up-to-date by an automated, high-throughput build pipeline that systematically maps human nsSNPs onto Protein Data Bank structures and annotates several biologically relevant features. LS-SNP/PDB is available at (http://ls-snp.icm.jhu.edu/ls-snp-pdb) and via links from protein data bank (PDB) biology and chemistry tabs, UCSC Genome Browser Gene Details and SNP Details pages and PharmGKB Gene Variants Downloads/Cross-References pages.

  14. Contrasting association of a non-synonymous leptin receptor gene polymorphism with Wegener's granulomatosis and Churg-Strauss syndrome.

    Science.gov (United States)

    Wieczorek, Stefan; Holle, Julia U; Bremer, Jan P; Wibisono, David; Moosig, Frank; Fricke, Harald; Assmann, Gunter; Harper, Lorraine; Arning, Larissa; Gross, Wolfgang L; Epplen, Joerg T

    2010-05-01

    There is evidence that the leptin/ghrelin system is involved in T-cell regulation and plays a role in (auto)immune disorders such as SLE, RA and ANCA-associated vasculitides (AAVs). Here, we evaluate the genetic background of this system in WG. We screened variations in the genes encoding leptin, ghrelin and their receptors, the leptin receptor (LEPR) and the growth hormone secretagogue receptor (GHSR). Three single nucleotide polymorphisms (SNPs) in each gene region were analysed in 460 German WG cases and 878 ethnically matched healthy controls. A three-SNP haplotype of GHSR was significantly associated with WG [P = 0.0067; corrected P-value (P(c)) = 0.026; odds ratio (OR) = 1.30; 95% CI 1.08, 1.57], as was one non-synonymous SNP in LEPR (Lys656Asn, P = 0.0034; P(c) = 0.013; OR = 0.72; 95% CI 0.58, 0.90). These four SNPs were re-analysed in independent cohorts of 226 German WG cases and 519 controls. While the GHSR association was not confirmed, allele frequencies of the LEPR SNP were virtually identical to those from the initial cohorts. Analysis of this SNP in the combined WG and control panels revealed a significant association of the LEPR 656Lys allele with WG (P = 0.00032; P(c) = 0.0013; OR = 0.72; 95% CI 0.60, 0.86). Remarkably, the Lys656Asn SNP showed contrasting allele distribution in two cohorts of 108 and 88 German cases diagnosed with Churg-Strauss syndrome (CSS, combined P = 0.0067; OR = 1.41; 95% CI 1.10, 1.81), whereas identical allele frequencies were revealed when comparing British WG and microscopic polyangiitis cases. While GHSR has to be further evaluated, these data provide profound evidence for an association of the LEPR Lys656Asn SNP with AAV, resulting in opposing effects in WG and CSS.

  15. Common non-synonymous SNPs associated with breast cancer susceptibility: findings from the Breast Cancer Association Consortium.

    Science.gov (United States)

    Milne, Roger L; Burwinkel, Barbara; Michailidou, Kyriaki; Arias-Perez, Jose-Ignacio; Zamora, M Pilar; Menéndez-Rodríguez, Primitiva; Hardisson, David; Mendiola, Marta; González-Neira, Anna; Pita, Guillermo; Alonso, M Rosario; Dennis, Joe; Wang, Qin; Bolla, Manjeet K; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Schoemaker, Minouk; Ko, Yon-Dschun; Brauch, Hiltrud; Hamann, Ute; Andrulis, Irene L; Knight, Julia A; Glendon, Gord; Tchatchou, Sandrine; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Tajima, Kazuo; Li, Jingmei; Brand, Judith S; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Lambrechts, Diether; Peuteman, Gilian; Christiaens, Marie-Rose; Smeets, Ann; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katazyna; Hartman, Mikael; Hui, Miao; Yen Lim, Wei; Wan Chan, Ching; Marme, Federick; Yang, Rongxi; Bugert, Peter; Lindblom, Annika; Margolin, Sara; García-Closas, Montserrat; Chanock, Stephen J; Lissowska, Jolanta; Figueroa, Jonine D; Bojesen, Stig E; Nordestgaard, Børge G; Flyger, Henrik; Hooning, Maartje J; Kriege, Mieke; van den Ouweland, Ans M W; Koppert, Linetta B; Fletcher, Olivia; Johnson, Nichola; dos-Santos-Silva, Isabel; Peto, Julian; Zheng, Wei; Deming-Halverson, Sandra; Shrubsole, Martha J; Long, Jirong; Chang-Claude, Jenny; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Cox, Angela; Cross, Simon S; Reed, Malcolm W R; Schmidt, Marjanka K; Broeks, Annegien; Cornelissen, Sten; Braaf, Linde; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K; Noh, Dong-Young; Simard, Jacques; Dumont, Martine; Goldberg, Mark S; Labrèche, France; Fasching, Peter A; Hein, Alexander; Ekici, Arif B; Beckmann, Matthias W; Radice, Paolo; Peterlongo, Paolo; Azzollini, Jacopo; Barile, Monica; Sawyer, Elinor; Tomlinson, Ian; Kerin, Michael; Miller, Nicola; Hopper, John L; Schmidt, Daniel F; Makalic, Enes; Southey, Melissa C; Hwang Teo, Soo; Har Yip, Cheng; Sivanandan, Kavitta; Tay, Wan-Ting; Shen, Chen-Yang; Hsiung, Chia-Ni; Yu, Jyh-Cherng; Hou, Ming-Feng; Guénel, Pascal; Truong, Therese; Sanchez, Marie; Mulot, Claire; Blot, William; Cai, Qiuyin; Nevanlinna, Heli; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Wu, Anna H; Tseng, Chiu-Chen; Van Den Berg, David; Stram, Daniel O; Bogdanova, Natalia; Dörk, Thilo; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Zhang, Ben; Couch, Fergus J; Toland, Amanda E; Yannoukakos, Drakoulis; Sangrajrang, Suleeporn; McKay, James; Wang, Xianshu; Olson, Janet E; Vachon, Celine; Purrington, Kristen; Severi, Gianluca; Baglietto, Laura; Haiman, Christopher A; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Devilee, Peter; Tollenaar, Robert A E M; Seynaeve, Caroline; Czene, Kamila; Eriksson, Mikael; Humphreys, Keith; Darabi, Hatef; Ahmed, Shahana; Shah, Mitul; Pharoah, Paul D P; Hall, Per; Giles, Graham G; Benítez, Javier; Dunning, Alison M; Chenevix-Trench, Georgia; Easton, Douglas F

    2014-11-15

    Candidate variant association studies have been largely unsuccessful in identifying common breast cancer susceptibility variants, although most studies have been underpowered to detect associations of a realistic magnitude. We assessed 41 common non-synonymous single-nucleotide polymorphisms (nsSNPs) for which evidence of association with breast cancer risk had been previously reported. Case-control data were combined from 38 studies of white European women (46 450 cases and 42 600 controls) and analyzed using unconditional logistic regression. Strong evidence of association was observed for three nsSNPs: ATXN7-K264R at 3p21 [rs1053338, per allele OR = 1.07, 95% confidence interval (CI) = 1.04-1.10, P = 2.9 × 10(-6)], AKAP9-M463I at 7q21 (rs6964587, OR = 1.05, 95% CI = 1.03-1.07, P = 1.7 × 10(-6)) and NEK10-L513S at 3p24 (rs10510592, OR = 1.10, 95% CI = 1.07-1.12, P = 5.1 × 10(-17)). The first two associations reached genome-wide statistical significance in a combined analysis of available data, including independent data from nine genome-wide association studies (GWASs): for ATXN7-K264R, OR = 1.07 (95% CI = 1.05-1.10, P = 1.0 × 10(-8)); for AKAP9-M463I, OR = 1.05 (95% CI = 1.04-1.07, P = 2.0 × 10(-10)). Further analysis of other common variants in these two regions suggested that intronic SNPs nearby are more strongly associated with disease risk. We have thus identified a novel susceptibility locus at 3p21, and confirmed previous suggestive evidence that rs6964587 at 7q21 is associated with risk. The third locus, rs10510592, is located in an established breast cancer susceptibility region; the association was substantially attenuated after adjustment for the known GWAS hit. Thus, each of the associated nsSNPs is likely to be a marker for another, non-coding, variant causally related to breast cancer risk. Further fine-mapping and functional studies are required to identify the underlying risk-modifying variants and the genes through which they act. © The

  16. Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair.

    Science.gov (United States)

    Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I

    2014-06-01

    Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.

  17. Effect of two non-synonymous ecto-5'-nucleotidase variants on the genetic architecture of inosine 5'-monophosphate (IMP) and its degradation products in Japanese Black beef.

    Science.gov (United States)

    Uemoto, Yoshinobu; Ohtake, Tsuyoshi; Sasago, Nanae; Takeda, Masayuki; Abe, Tsuyoshi; Sakuma, Hironori; Kojima, Takatoshi; Sasaki, Shinji

    2017-11-13

    Umami is a Japanese term for the fifth basic taste and is an important sensory property of beef palatability. Inosine 5'-monophosphate (IMP) contributes to umami taste in beef. Thus, the overall change in concentration of IMP and its degradation products can potentially affect the beef palatability. In this study, we investigated the genetic architecture of IMP and its degradation products in Japanese Black beef. First, we performed genome-wide association study (GWAS), candidate gene analysis, and functional analysis to detect the causal variants that affect IMP, inosine, and hypoxanthine. Second, we evaluated the allele frequencies in the different breeds, the contribution of genetic variance, and the effect on other economical traits using the detected variants. A total of 574 Japanese Black cattle were genotyped using the Illumina BovineSNP50 BeadChip and were then used for GWAS. The results of GWAS showed that the genome-wide significant single nucleotide polymorphisms (SNPs) on BTA9 were detected for IMP, inosine, and hypoxanthine. The ecto-5'-nucleotidase (NT5E) gene, which encodes the enzyme NT5E for the extracellular degradation of IMP to inosine, was located near the significant region on BTA9. The results of candidate gene analysis and functional analysis showed that two non-synonymous SNPs (c.1318C > T and c.1475 T > A) in NT5E affected the amount of IMP and its degradation products in beef by regulating the enzymatic activity of NT5E. The Q haplotype showed a positive effect on IMP and a negative effect on the enzymatic activity of NT5E in IMP degradation. The two SNPs were under perfect linkage disequilibrium in five different breeds, and different haplotype frequencies were seen among breeds. The two SNPs contribute to about half of the total genetic variance in IMP, and the results of genetic relationship between IMP and its degradation products showed that NT5E affected the overall concentration balance of IMP and its degradation products

  18. In silico analysis of consequences of non-synonymous SNPs of Slc11a2 gene in Indian bovines

    Directory of Open Access Journals (Sweden)

    Shreya M. Patel

    2015-09-01

    Full Text Available The aim of our study was to analyze the consequences of non-synonymous SNPs in Slc11a2 gene using bioinformatic tools. There is a current need of efficient bioinformatic tools for in-depth analysis of data generated by the next generation sequencing technologies. SNPs are known to play an imperative role in understanding the genetic basis of many genetic diseases. Slc11a2 is one of the major metal transporter families in mammals and plays a critical role in host defenses. In this study, we performed a comprehensive analysis of the impact of all non-synonymous SNPs in this gene using multiple tools like SIFT, PROVEAN, I-Mutant and PANTHER. Among the total 124 SNPs obtained from amplicon sequencing of Slc11a2 gene by Ion Torrent PGM involving 10 individuals of Gir cattle and Murrah buffalo each, we found 22 non-synonymous. Comparing the prediction of these 4 methods, 5 nsSNPs (G369R, Y374C, A377V, Q385H and N492S were identified as deleterious. In addition, while tested out for polar interactions with other amino acids in the protein, from above 5, Y374C, Q385H and N492S showed a change in interaction pattern and further confirmed by an increase in total energy after energy minimizations in case of mutant protein compared to the native.

  19. A single-nucleotide polymorphism of human neuropeptide s gene originated from Europe shows decreased bioactivity.

    Directory of Open Access Journals (Sweden)

    Cheng Deng

    Full Text Available Using accumulating SNP (Single-Nucleotide Polymorphism data, we performed a genome-wide search for polypeptide hormone ligands showing changes in the mature regions to elucidate genotype/phenotype diversity among various human populations. Neuropeptide S (NPS, a brain peptide hormone highly conserved in vertebrates, has diverse physiological effects on anxiety, fear, hyperactivity, food intake, and sleeping time through its cognate receptor-NPSR. Here, we report a SNP rs4751440 (L(6-NPS causing non-synonymous substitution on the 6(th position (V to L of the NPS mature peptide region. L(6-NPS has a higher allele frequency in Europeans than other populations and probably originated from European ancestors ~25,000 yrs ago based on haplotype analysis and Approximate Bayesian Computation. Functional analyses indicate that L(6-NPS exhibits a significant lower bioactivity than the wild type NPS, with ~20-fold higher EC50 values in the stimulation of NPSR. Additional evolutionary and mutagenesis studies further demonstrate the importance of the valine residue in the 6(th position for NPS functions. Given the known physiological roles of NPS receptor in inflammatory bowel diseases, asthma pathogenesis, macrophage immune responses, and brain functions, our study provides the basis to elucidate NPS evolution and signaling diversity among human populations.

  20. A nucleotide substitution at the 5′ splice site of intron 1 of rice HEADING DATE 1 (HD1 gene homolog in foxtail millet, broadly found in landraces from Europe and Asia

    Directory of Open Access Journals (Sweden)

    Kenji Fukunaga

    2015-12-01

    Full Text Available We investigated genetic variation of a rice HEADING DATE 1(HD1 homolog in foxtail millet. First, we searched for a rice HD1 homolog in a foxtail millet genome sequence and designed primers to amplify the entire coding sequence of the gene. We compared full HD1 gene sequences of 11 accessions (including Yugu 1, a Chinese cultivar used for genome sequencing from various regions in Europe and Asia, found a nucleotide substitution at a putative splice site of intron 1, and designated the accessions with the nucleotide substitution as carrying a splicing variant. We verified by RT-PCR that this single nucleotide substitution causes aberrant splicing of intron 1. We investigated the geographical distribution of the splicing variant in 480 accessions of foxtail millet from various regions of Europe and Asia and part of Africa by dCAPS and found that the splicing variant is broadly distributed in Europe and Asia. Differences of heading times between accessions with wild type allele of the HD1 gene and those with the splicing variant allele were unclear. We also investigated variation in 13 accessions of ssp. viridis, the wild ancestor, and the results suggested that the wild type is predominant in the wild ancestor.

  1. Single nucleotide polymorphisms (SNPs in coding regions of canine dopamine- and serotonin-related genes

    Directory of Open Access Journals (Sweden)

    Lingaas Frode

    2008-01-01

    Full Text Available Abstract Background Polymorphism in genes of regulating enzymes, transporters and receptors of the neurotransmitters of the central nervous system have been associated with altered behaviour, and single nucleotide polymorphisms (SNPs represent the most frequent type of genetic variation. The serotonin and dopamine signalling systems have a central influence on different behavioural phenotypes, both of invertebrates and vertebrates, and this study was undertaken in order to explore genetic variation that may be associated with variation in behaviour. Results Single nucleotide polymorphisms in canine genes related to behaviour were identified by individually sequencing eight dogs (Canis familiaris of different breeds. Eighteen genes from the dopamine and the serotonin systems were screened, revealing 34 SNPs distributed in 14 of the 18 selected genes. A total of 24,895 bp coding sequence was sequenced yielding an average frequency of one SNP per 732 bp (1/732. A total of 11 non-synonymous SNPs (nsSNPs, which may be involved in alteration of protein function, were detected. Of these 11 nsSNPs, six resulted in a substitution of amino acid residue with concomitant change in structural parameters. Conclusion We have identified a number of coding SNPs in behaviour-related genes, several of which change the amino acids of the proteins. Some of the canine SNPs exist in codons that are evolutionary conserved between five compared species, and predictions indicate that they may have a functional effect on the protein. The reported coding SNP frequency of the studied genes falls within the range of SNP frequencies reported earlier in the dog and other mammalian species. Novel SNPs are presented and the results show a significant genetic variation in expressed sequences in this group of genes. The results can contribute to an improved understanding of the genetics of behaviour.

  2. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G) of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    OpenAIRE

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...

  3. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.

    Science.gov (United States)

    Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J; Lu, Xiangyi; Ruden, Douglas M

    2012-01-01

    We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w(1118); iso-2; iso-3 strain and the reference y(1); cn(1) bw(1) sp(1) strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5'UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5' and 3' UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory.

  4. Non-synonymous polymorphisms in the P2RX ( 4 ) are related to bone mineral density and osteoporosis risk in a cohort of Dutch fracture patients

    DEFF Research Database (Denmark)

    Wesselius, Anke; Bours, Martijn Jl; Jørgensen, Niklas R

    2013-01-01

    of these two receptors on osteoporosis risk. Patients with fracture (690 females and 231 males, aged ≥50 years) were genotyped for three non-synonymous P2X ( 4 ) R SNPs. Bone mineral density (BMD) was measured at the total hip, lumbar spine, and femoral neck. Subject carrying the variant allele of the Tyr315...... of non-synonymous polymorphisms in the P2RX ( 4 ) and the risk of osteoporosis, suggesting a role of the P2X ( 4 ) R in the regulation of bone mass....

  5. Functional effect of grapevine 1-deoxy-D-xylulose 5-phosphate synthase substitution K284N on Muscat flavour formation

    Science.gov (United States)

    Battilana, Juri; Emanuelli, Francesco; Gambino, Giorgio; Gribaudo, Ivana; Gasperi, Flavia; Boss, Paul K.; Grando, Maria Stella

    2011-01-01

    Grape berries of Muscat cultivars (Vitis vinifera L.) contain high levels of monoterpenols and exhibit a distinct aroma related to this composition of volatiles. A structural gene of the plastidial methyl-erythritol-phosphate (MEP) pathway, 1-deoxy-D-xylulose 5-phosphate synthase (VvDXS), was recently suggested as a candidate gene for this trait, having been co-localized with a major quantitative trait locus for linalool, nerol, and geraniol concentrations in berries. In addition, a structured association study discovered a putative causal single nucleotide polymorphism (SNP) responsible for the substitution of a lysine with an asparagine at position 284 of the VvDXS protein, and this SNP was significantly associated with Muscat-flavoured varieties. The significance of this nucleotide difference was investigated by comparing the monoterpene profiles with the expression of VvDXS alleles throughout berry development in Moscato Bianco, a cultivar heterozygous for the SNP mutation. Although correlation was detected between the VvDXS transcript profile and the accumulation of free monoterpenol odorants, the modulation of VvDXS expression during berry development appears to be independent of nucleotide variation in the coding sequence. In order to assess how the non-synonymous mutation may enhance Muscat flavour, an in vitro characterization of enzyme isoforms was performed followed by in vivo overexpression of each VvDXS allele in tobacco. The results showed that the amino acid non-neutral substitution influences the enzyme kinetics by increasing the catalytic efficiency and also dramatically affects monoterpene levels in transgenic lines. These findings confirm a functional effect of the VvDXS gene polymorphism and may pave the way for metabolic engineering of terpenoid contents in grapevine. PMID:21868399

  6. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries)

    OpenAIRE

    Li, M-H; Tiirikka, T; Kantanen, J

    2013-01-01

    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three kno...

  7. Non-Synonymous Polymorphisms in the FCN1 Gene Determine Ligand-Binding Ability and Serum Levels of M-Ficolin

    DEFF Research Database (Denmark)

    Ammitzbøll, Christian Gytz; Kjær, Troels Rønn; Steffensen, Rudi

    2012-01-01

    The innate immune system encompasses various recognition molecules able to sense both exogenous and endogenous danger signals arising from pathogens or damaged host cells. One such pattern-recognition molecule is M-ficolin, which is capable of activating the complement system through the lectin...... of non-synonymous SNPs on protein function....

  8. Non-synonymous variations in cancer and their effects on the human proteome: workflow for NGS data biocuration and proteome-wide analysis of TCGA data.

    Science.gov (United States)

    Cole, Charles; Krampis, Konstantinos; Karagiannis, Konstantinos; Almeida, Jonas S; Faison, William J; Motwani, Mona; Wan, Quan; Golikov, Anton; Pan, Yang; Simonyan, Vahan; Mazumder, Raja

    2014-01-27

    Next-generation sequencing (NGS) technologies have resulted in petabytes of scattered data, decentralized in archives, databases and sometimes in isolated hard-disks which are inaccessible for browsing and analysis. It is expected that curated secondary databases will help organize some of this Big Data thereby allowing users better navigate, search and compute on it. To address the above challenge, we have implemented a NGS biocuration workflow and are analyzing short read sequences and associated metadata from cancer patients to better understand the human variome. Curation of variation and other related information from control (normal tissue) and case (tumor) samples will provide comprehensive background information that can be used in genomic medicine research and application studies. Our approach includes a CloudBioLinux Virtual Machine which is used upstream of an integrated High-performance Integrated Virtual Environment (HIVE) that encapsulates Curated Short Read archive (CSR) and a proteome-wide variation effect analysis tool (SNVDis). As a proof-of-concept, we have curated and analyzed control and case breast cancer datasets from the NCI cancer genomics program - The Cancer Genome Atlas (TCGA). Our efforts include reviewing and recording in CSR available clinical information on patients, mapping of the reads to the reference followed by identification of non-synonymous Single Nucleotide Variations (nsSNVs) and integrating the data with tools that allow analysis of effect nsSNVs on the human proteome. Furthermore, we have also developed a novel phylogenetic analysis algorithm that uses SNV positions and can be used to classify the patient population. The workflow described here lays the foundation for analysis of short read sequence data to identify rare and novel SNVs that are not present in dbSNP and therefore provides a more comprehensive understanding of the human variome. Variation results for single genes as well as the entire study are available

  9. High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  10. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    2013-01-01

    Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  11. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  12. Identification of nucleotides in the 5'UTR and amino acids substitutions that are essential for the infectivity of 5'UTR-NS5A recombinant of hepatitis C virus genotype 1b (strain Con1).

    Science.gov (United States)

    Li, Jinqian; Feng, Shengjun; Liu, Xi; Guo, Mingzhe; Chen, Mingxiao; Chen, Yiyi; Rong, Liang; Xia, Jinyu; Zhou, Yuanping; Zhong, Jin; Li, Yi-Ping

    2018-05-01

    Genotype 1b strain Con1 represents an important reference in the study of hepatitis C virus (HCV). Here, we aimed to develop an advanced infectious Con1 recombinant. We found that previously identified mutations A1226G/F1464L/A1672S/Q1773H permitted culture adaption of Con1 Core-NS5A (C-5A) recombinant containing 5'UTR and NS5B-3'UTR from JFH1 (genotype 2a), thus acquired additional mutations L725H/F886L/D2415G. C-5A containing all seven mutations (C-5A_7m) replicated efficiently in Huh7.5 and Huh7.5.1 cells and had an increased infectivity in SEC14L2-expressing Huh7.5.1 cells. Incorporation of Con1 NS5B was deleterious to C-5A_7m, however Con1 5'UTR was permissive but attenuated the virus. Nucleotides G1, A4, and G35 primarily accounted for the viral attenuation without affecting RNA translation. C-5A_7m was inhibited dose-dependently by simeprevir and daclatasvir, and substitutions at A4, A29, A34, and G35 conferred resistance to miR-122 antagonism. The novel Con1 5'UTR-NS5A recombinant, adaptive mutations, and critical nucleotides described here will facilitate future studies of HCV culture systems and virus-host interaction. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. A genome-wide scan study identifies a single nucleotide substitution in ASIP associated with white versus non-white coat-colour variation in sheep (Ovis aries).

    Science.gov (United States)

    Li, M-H; Tiirikka, T; Kantanen, J

    2014-02-01

    In sheep, coat colour (and pattern) is one of the important traits of great biological, economic and social importance. However, the genetics of sheep coat colour has not yet been fully clarified. We conducted a genome-wide association study of sheep coat colours by genotyping 47 303 single-nucleotide polymorphisms (SNPs) in the Finnsheep population in Finland. We identified 35 SNPs associated with all the coat colours studied, which cover genomic regions encompassing three known pigmentation genes (TYRP1, ASIP and MITF) in sheep. Eighteen of these associations were confirmed in further tests between white versus non-white individuals, but none of the 35 associations were significant in the analysis of only non-white colours. Across the tests, the s66432.1 in ASIP showed significant association (P=4.2 × 10(-11) for all the colours; P=2.3 × 10(-11) for white versus non-white colours) with the variation in coat colours and strong linkage disequilibrium with other significant variants surrounding the ASIP gene. The signals detected around the ASIP gene were explained by differences in white versus non-white alleles. Further, a genome scan for selection for white coat pigmentation identified a strong and striking selection signal spanning ASIP. Our study identified the main candidate gene for the coat colour variation between white and non-white as ASIP, an autosomal gene that has been directly implicated in the pathway regulating melanogenesis. Together with ASIP, the two other newly identified genes (TYRP1 and MITF) in the Finnsheep, bordering associated SNPs, represent a new resource for enriching sheep coat-colour genetics and breeding.

  14. Single nucleotide substitution mutations and polymorphisms in ...

    African Journals Online (AJOL)

    Administrator

    2011-09-14

    Sep 14, 2011 ... 1The Karachi Institute of Biotechnology and Genetic Engineering (KIBGE), University of Karachi, Karachi, Pakistan. 2Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, Pakistan. 3Department of Dermatology, Jinnah Postgraduate Medical Center, Karachi, Pakistan. Accepted 7 July, 2011.

  15. Two non-synonymous markers in PTPN21, identified by genome-wide association study data-mining and replication, are associated with schizophrenia.

    LENUS (Irish Health Repository)

    Chen, Jingchun

    2011-09-01

    We conducted data-mining analyses of genome wide association (GWA) studies of the CATIE and MGS-GAIN datasets, and found 13 markers in the two physically linked genes, PTPN21 and EML5, showing nominally significant association with schizophrenia. Linkage disequilibrium (LD) analysis indicated that all 7 markers from PTPN21 shared high LD (r(2)>0.8), including rs2274736 and rs2401751, the two non-synonymous markers with the most significant association signals (rs2401751, P=1.10 × 10(-3) and rs2274736, P=1.21 × 10(-3)). In a meta-analysis of all 13 replication datasets with a total of 13,940 subjects, we found that the two non-synonymous markers are significantly associated with schizophrenia (rs2274736, OR=0.92, 95% CI: 0.86-0.97, P=5.45 × 10(-3) and rs2401751, OR=0.92, 95% CI: 0.86-0.97, P=5.29 × 10(-3)). One SNP (rs7147796) in EML5 is also significantly associated with the disease (OR=1.08, 95% CI: 1.02-1.14, P=6.43 × 10(-3)). These 3 markers remain significant after Bonferroni correction. Furthermore, haplotype conditioned analyses indicated that the association signals observed between rs2274736\\/rs2401751 and rs7147796 are statistically independent. Given the results that 2 non-synonymous markers in PTPN21 are associated with schizophrenia, further investigation of this locus is warranted.

  16. Annonaceae substitution rates: a codon model perspective

    Directory of Open Access Journals (Sweden)

    Lars Willem Chatrou

    2014-01-01

    Full Text Available The Annonaceae includes cultivated species of economic interest and represents an important source of information for better understanding the evolution of tropical rainforests. In phylogenetic analyses of DNA sequence data that are used to address evolutionary questions, it is imperative to use appropriate statistical models. Annonaceae are cases in point: Two sister clades, the subfamilies Annonoideae and Malmeoideae, contain the majority of Annonaceae species diversity. The Annonoideae generally show a greater degree of sequence divergence compared to the Malmeoideae, resulting in stark differences in branch lengths in phylogenetic trees. Uncertainty in how to interpret and analyse these differences has led to inconsistent results when estimating the ages of clades in Annonaceae using molecular dating techniques. We ask whether these differences may be attributed to inappropriate modelling assumptions in the phylogenetic analyses. Specifically, we test for (clade-specific differences in rates of non-synonymous and synonymous substitutions. A high ratio of nonsynonymous to synonymous substitutions may lead to similarity of DNA sequences due to convergence instead of common ancestry, and as a result confound phylogenetic analyses. We use a dataset of three chloroplast genes (rbcL, matK, ndhF for 129 species representative of the family. We find that differences in branch lengths between major clades are not attributable to different rates of non-synonymous and synonymous substitutions. The differences in evolutionary rate between the major clades of Annonaceae pose a challenge for current molecular dating techniques that should be seen as a warning for the interpretation of such results in other organisms.

  17. Sequencing of the needle transcriptome from Norway spruce (Picea abies Karst L. reveals lower substitution rates, but similar selective constraints in gymnosperms and angiosperms

    Directory of Open Access Journals (Sweden)

    Chen Jun

    2012-11-01

    Full Text Available Abstract Background A detailed knowledge about spatial and temporal gene expression is important for understanding both the function of genes and their evolution. For the vast majority of species, transcriptomes are still largely uncharacterized and even in those where substantial information is available it is often in the form of partially sequenced transcriptomes. With the development of next generation sequencing, a single experiment can now simultaneously identify the transcribed part of a species genome and estimate levels of gene expression. Results mRNA from actively growing needles of Norway spruce (Picea abies was sequenced using next generation sequencing technology. In total, close to 70 million fragments with a length of 76 bp were sequenced resulting in 5 Gbp of raw data. A de novo assembly of these reads, together with publicly available expressed sequence tag (EST data from Norway spruce, was used to create a reference transcriptome. Of the 38,419 PUTs (putative unique transcripts longer than 150 bp in this reference assembly, 83.5% show similarity to ESTs from other spruce species and of the remaining PUTs, 3,704 show similarity to protein sequences from other plant species, leaving 4,167 PUTs with limited similarity to currently available plant proteins. By predicting coding frames and comparing not only the Norway spruce PUTs, but also PUTs from the close relatives Picea glauca and Picea sitchensis to both Pinus taeda and Taxus mairei, we obtained estimates of synonymous and non-synonymous divergence among conifer species. In addition, we detected close to 15,000 SNPs of high quality and estimated gene expression differences between samples collected under dark and light conditions. Conclusions Our study yielded a large number of single nucleotide polymorphisms as well as estimates of gene expression on transcriptome scale. In agreement with a recent study we find that the synonymous substitution rate per year (0.6 × 10

  18. Definition of novel GP6 polymorphisms and major difference in haplotype frequencies between populations by a combination of in-depth exon resequencing and genotyping with tag single nucleotide polymorphisms.

    Science.gov (United States)

    Watkins, N A; O'Connor, M N; Rankin, A; Jennings, N; Wilson, E; Harmer, I J; Davies, L; Smethurst, P A; Dudbridge, F; Farndale, R W; Ouwehand, W H

    2006-06-01

    Common genetic variants of cell surface receptors contribute to differences in functional responses and disease susceptibility. We have previously shown that single nucleotide polymorphisms (SNPs) in platelet glycoprotein VI (GP6) determine the extent of response to agonist. In addition, SNPs in the GP6 gene have been proposed as risk factors for coronary artery disease. To completely characterize genetic variation in the GP6 gene we generated a high-resolution SNP map by sequencing the promoter, exons and consensus splice sequences in 94 non-related Caucasoids. In addition, we sequenced DNA encoding the ligand-binding domains of GP6 from non-human primates to determine the level of evolutionary conservation. Eighteen SNPs were identified, six of which encoded amino acid substitutions in the mature form of the protein. The single non-synonymous SNP identified in the exons encoding the ligand-binding domains, encoding for a 103Leu > Val substitution, resulted in reduced ligand binding. Two common protein isoforms were confirmed in Caucasoid with frequencies of 0.82 and 0.15. Variation at the GP6 locus was characterized further by determining SNP frequency in over 2000 individuals from different ethnic backgrounds. The SNPs were polymorphic in all populations studied although significant differences in allele frequencies were observed. Twelve additional GP6 protein isoforms were identified from the genotyping results and, despite extensive variation in GP6, the sequence of the ligand-binding domains is conserved. Sequences from non-human primates confirmed this observation. These data provide valuable information for the optimal selection of genetic variants for use in future association studies.

  19. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  20. CHASM and SNVBox: toolkit for detecting biologically important single nucleotide mutations in cancer.

    Science.gov (United States)

    Wong, Wing Chung; Kim, Dewey; Carter, Hannah; Diekhans, Mark; Ryan, Michael C; Karchin, Rachel

    2011-08-01

    Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. MySQL database, source code and binaries freely available for academic/government use at http://wiki.chasmsoftware.org, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python 5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM.

  1. Mass Spectrometry Analysis Coupled with de novo Sequencing Reveals Amino Acid Substitutions in Nucleocapsid Protein from Influenza A Virus

    Directory of Open Access Journals (Sweden)

    Zijian Li

    2014-02-01

    Full Text Available Amino acid substitutions in influenza A virus are the main reasons for both antigenic shift and virulence change, which result from non-synonymous mutations in the viral genome. Nucleocapsid protein (NP, one of the major structural proteins of influenza virus, is responsible for regulation of viral RNA synthesis and replication. In this report we used LC-MS/MS to analyze tryptic digestion of nucleocapsid protein of influenza virus (A/Puerto Rico/8/1934 H1N1, which was isolated and purified by SDS poly-acrylamide gel electrophoresis. Thus, LC-MS/MS analyses, coupled with manual de novo sequencing, allowed the determination of three substituted amino acid residues R452K, T423A and N430T in two tryptic peptides. The obtained results provided experimental evidence that amino acid substitutions resulted from non-synonymous gene mutations could be directly characterized by mass spectrometry in proteins of RNA viruses such as influenza A virus.

  2. Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

    Directory of Open Access Journals (Sweden)

    Per Erixon

    Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

  3. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Directory of Open Access Journals (Sweden)

    Olha Hurba

    Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  4. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Science.gov (United States)

    Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka

    2014-01-01

    Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  5. Single-Nucleotide Variations in Cardiac Arrhythmias: Prospects for Genomics and Proteomics Based Biomarker Discovery and Diagnostics

    Directory of Open Access Journals (Sweden)

    Ayman Abunimer

    2014-03-01

    Full Text Available Cardiovascular diseases are a large contributor to causes of early death in developed countries. Some of these conditions, such as sudden cardiac death and atrial fibrillation, stem from arrhythmias—a spectrum of conditions with abnormal electrical activity in the heart. Genome-wide association studies can identify single nucleotide variations (SNVs that may predispose individuals to developing acquired forms of arrhythmias. Through manual curation of published genome-wide association studies, we have collected a comprehensive list of 75 SNVs associated with cardiac arrhythmias. Ten of the SNVs result in amino acid changes and can be used in proteomic-based detection methods. In an effort to identify additional non-synonymous mutations that affect the proteome, we analyzed the post-translational modification S-nitrosylation, which is known to affect cardiac arrhythmias. We identified loss of seven known S-nitrosylation sites due to non-synonymous single nucleotide variations (nsSNVs. For predicted nitrosylation sites we found 1429 proteins where the sites are modified due to nsSNV. Analysis of the predicted S-nitrosylation dataset for over- or under-representation (compared to the complete human proteome of pathways and functional elements shows significant statistical over-representation of the blood coagulation pathway. Gene Ontology (GO analysis displays statistically over-represented terms related to muscle contraction, receptor activity, motor activity, cystoskeleton components, and microtubule activity. Through the genomic and proteomic context of SNVs and S-nitrosylation sites presented in this study, researchers can look for variation that can predispose individuals to cardiac arrhythmias. Such attempts to elucidate mechanisms of arrhythmia thereby add yet another useful parameter in predicting susceptibility for cardiac diseases.

  6. ENU-mutagenesis mice with a non-synonymous mutation in Grin1 exhibit abnormal anxiety-like behaviors, impaired fear memory, and decreased acoustic startle response

    Science.gov (United States)

    2013-01-01

    Background The Grin1 (glutamate receptor, ionotropic, NMDA1) gene expresses a subunit of N-methyl-D-aspartate (NMDA) receptors that is considered to play an important role in excitatory neurotransmission, synaptic plasticity, and brain development. Grin1 is a candidate susceptibility gene for neuropsychiatric disorders, including schizophrenia, bipolar disorder, and attention deficit/hyperactivity disorder (ADHD). In our previous study, we examined an N-ethyl-N-nitrosourea (ENU)-generated mutant mouse strain (Grin1Rgsc174/Grin1+) that has a non-synonymous mutation in Grin1. These mutant mice showed hyperactivity, increased novelty-seeking to objects, and abnormal social interactions. Therefore, Grin1Rgsc174/Grin1+ mice may serve as a potential animal model of neuropsychiatric disorders. However, other behavioral characteristics related to these disorders, such as working memory function and sensorimotor gating, have not been fully explored in these mutant mice. In this study, to further investigate the behavioral phenotypes of Grin1Rgsc174/Grin1+ mice, we subjected them to a comprehensive battery of behavioral tests. Results There was no significant difference in nociception between Grin1Rgsc174/Grin1+ and wild-type mice. The mutants did not display any abnormalities in the Porsolt forced swim and tail suspension tests. We confirmed the previous observations that the locomotor activity of these mutant mice increased in the open field and home cage activity tests. They displayed abnormal anxiety-like behaviors in the light/dark transition and the elevated plus maze tests. Both contextual and cued fear memory were severely deficient in the fear conditioning test. The mutant mice exhibited slightly impaired working memory in the eight-arm radial maze test. The startle amplitude was markedly decreased in Grin1Rgsc174/Grin1+ mice, whereas no significant differences between genotypes were detected in the prepulse inhibition (PPI) test. The mutant mice showed no obvious

  7. Low multiple electrode aggregometry platelet responses are not associated with non-synonymous variants in G-protein coupled receptor genes.

    Science.gov (United States)

    Norman, Jane E; Lee, Kurtis R; Walker, Mary E; Murden, Sherina L; Harris, Jessica; Mundell, Stuart; J Murphy, Gavin; Mumford, Andrew D

    2015-10-01

    Multiple electrode aggregometry (MEA) improves prediction of thrombosis and bleeding in cardiac patients. However, the causes of inter-individual variation in MEA results are incompletely understood. We explore whether low MEA results are associated with platelet G-protein coupled receptor (GPCR) gene variants. The effects of P2Y12 receptor (P2Y12), thromboxane A2 receptor (TPα) and protease-activated receptor 1 (PAR1) dysfunction on the MEA ADP-test, ASPI-test and TRAP-test were determined using receptor antagonists. Cardiac surgery patients with pre-operative MEA results suggesting GPCR dysfunction were selected for P2Y12 (P2RY12), TPα (TBXA2R) and PAR1 (F2R) sequencing. In control blood samples, P2Y12, TPα or PAR1 antagonists markedly reduced ADP-test, ASPI-test and TRAP-test results respectively. In the 636 patients from a cohort of 2388 cardiac surgery patients who were not receiving aspirin or a P2Y12 blocker, the median ADP-test result was 75.1 U (range 4.8-153.2), ASPI-test 83.7 U (1.4-157.3) and TRAP-test 117.7 U (2.4-194.1), indicating a broad range of results unexplained by anti-platelet drugs. In 238 consenting patients with unexplained low MEA results, three P2RY12 variants occurred in 70/107 (65%) with suspected P2Y12 dysfunction and four TBXA2R variants occurred in 19/22 (86%) with suspected TPα dysfunction although the later group was too small to draw meaningful conclusions about variant frequency. All the variants were synonymous and unlikely to cause GPCR dysfunction. There were no F2R variants in the 109 cases with suspected PAR1 dysfunction. MEA results suggesting isolated platelet GPCR dysfunction were common in cardiac surgery patients, but were not associated with non-synonymous variants in P2RY12 or F2R. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  9. Substitutional analysis

    CERN Document Server

    Rutherford, Daniel Edwin

    2013-01-01

    Classic monograph, suitable for advanced undergraduates and graduate students. Topics include calculus of permutations and tableaux, semi-normal representation, orthogonal and natural representations, group characters, and substitutional equations. 1968 edition.

  10. A non-synonymous single-nucleotide polymorphism in the gene encoding Toll-like Receptor 3 (TLR3) is associated with sero-negative Rheumatoid Arthritis (RA) in a Danish population

    DEFF Research Database (Denmark)

    Laska, Magdalena Janina; Hansen, Bettina; Troldborg, Anne

    2014-01-01

    BACKGROUND: It has been suggested that polymorphisms in Toll-like Receptors (TLRs) are associated with Rheumatoid Arthritis (RA), but the implicated alleles have differed between studies. The aim of this investigation was to explore whether polymorphisms of TLR genes are associated with RA...... according to IgM rheumatoid factor (RF) and anti-cyclic citrinullated peptide (CCP) status suggested a significant association of sero-negative RA with the rs3775291 A allele and disease activity in this subset. CONCLUSION: These observations on a RA population of Danish ancestry suggest that variations...... in the TLR3 locus may be implicated in the pathogenesis of sero-negative RA. Since this TLR3 SNP has previously been associated with systemic lupus erythematous (SLE), the present findings support the notion that TLR3 genetic variants may represent a common risk factor in different chronic inflammatory...

  11. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  12. Operator substitution

    NARCIS (Netherlands)

    Hautus, M.L.J.

    1994-01-01

    Substitution of an operator into an operator-valued map is defined and studied. A Bezout-type remainder theorem is used to derive a number of results. The tensor map is used to formulate solvability conditions for linear matrix equations. Some applications to system theory are given, in particular

  13. Solvent substitution

    International Nuclear Information System (INIS)

    1990-01-01

    The DOE Environmental Restoration and Waste Management Office of Technology Development and the Air Force Engineering and Services Center convened the First Annual International Workshop on Solvent Substitution on December 4--7, 1990. The primary objectives of this joint effort were to share information and ideas among attendees in order to enhance the development and implementation of required new technologies for the elimination of pollutants associated with industrial use of hazardous and toxic solvents; and to aid in accelerating collaborative efforts and technology transfer between government and industry for solvent substitution. There were workshop sessions focusing on Alternative Technologies, Alternative Solvents, Recovery/Recycling, Low VOC Materials and Treatment for Environmentally Safe Disposal. The 35 invited papers presented covered a wide range of solvent substitution activities including: hardware and weapons production and maintenance, paint stripping, coating applications, printed circuit boards, metal cleaning, metal finishing, manufacturing, compliance monitoring and process control monitoring. This publication includes the majority of these presentations. In addition, in order to further facilitate information exchange and technology transfer, the US Air Force and DOE solicited additional papers under a general ''Call for Papers.'' These papers, which underwent review and final selection by a peer review committee, are also included in this combined Proceedings/Compendium. For those involved in handling, using or managing hazardous and toxic solvents, this document should prove to be a valuable resource, providing the most up-to-date information on current technologies and practices in solvent substitution. Individual papers are abstracted separated

  14. Tonemic Substitution

    African Journals Online (AJOL)

    Ezenwafor

    grammatical constructions. The choice of substitutable tonemes as observed from the analyzed data is highly. Ezenwafordependent on the intuitive judgement of the native speaker. This work shows with adequate data, that regular tonemic changes are not always meaningful in Ekwulobia lect. Such tonemic alternations are ...

  15. Solvent substitution

    Energy Technology Data Exchange (ETDEWEB)

    1990-01-01

    The DOE Environmental Restoration and Waste Management Office of Technology Development and the Air Force Engineering and Services Center convened the First Annual International Workshop on Solvent Substitution on December 4--7, 1990. The primary objectives of this joint effort were to share information and ideas among attendees in order to enhance the development and implementation of required new technologies for the elimination of pollutants associated with industrial use of hazardous and toxic solvents; and to aid in accelerating collaborative efforts and technology transfer between government and industry for solvent substitution. There were workshop sessions focusing on Alternative Technologies, Alternative Solvents, Recovery/Recycling, Low VOC Materials and Treatment for Environmentally Safe Disposal. The 35 invited papers presented covered a wide range of solvent substitution activities including: hardware and weapons production and maintenance, paint stripping, coating applications, printed circuit boards, metal cleaning, metal finishing, manufacturing, compliance monitoring and process control monitoring. This publication includes the majority of these presentations. In addition, in order to further facilitate information exchange and technology transfer, the US Air Force and DOE solicited additional papers under a general Call for Papers.'' These papers, which underwent review and final selection by a peer review committee, are also included in this combined Proceedings/Compendium. For those involved in handling, using or managing hazardous and toxic solvents, this document should prove to be a valuable resource, providing the most up-to-date information on current technologies and practices in solvent substitution. Individual papers are abstracted separated.

  16. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  17. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

    2016-01-01

    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  18. Patterns of nucleotide diversity at photoperiod related genes in Norway spruce [Picea abies (L.) Karst].

    Science.gov (United States)

    Källman, Thomas; De Mita, Stéphane; Larsson, Hanna; Gyllenstrand, Niclas; Heuertz, Myriam; Parducci, Laura; Suyama, Yoshihisa; Lagercrantz, Ulf; Lascoux, Martin

    2014-01-01

    The ability of plants to track seasonal changes is largely dependent on genes assigned to the photoperiod pathway, and variation in those genes is thereby important for adaptation to local day length conditions. Extensive physiological data in several temperate conifer species suggest that populations are adapted to local light conditions, but data on the genes underlying this adaptation are more limited. Here we present nucleotide diversity data from 19 genes putatively involved in photoperiodic response in Norway spruce (Picea abies). Based on similarity to model plants the genes were grouped into three categories according to their presumed position in the photoperiod pathway: photoreceptors, circadian clock genes, and downstream targets. An HKA (Hudson, Kreitman and Aquade) test showed a significant excess of diversity at photoreceptor genes, but no departure from neutrality at circadian genes and downstream targets. Departures from neutrality were also tested with Tajima's D and Fay and Wu's H statistics under three demographic scenarios: the standard neutral model, a population expansion model, and a more complex population split model. Only one gene, the circadian clock gene PaPRR3 with a highly positive Tajima's D value, deviates significantly from all tested demographic scenarios. As the PaPRR3 gene harbours multiple non-synonymous variants it appears as an excellent candidate gene for control of photoperiod response in Norway spruce.

  19. Allelic variation of the Waxy gene in foxtail millet [Setaria italica (L.) P. Beauv.] by single nucleotide polymorphisms.

    Science.gov (United States)

    Van, K; Onoda, S; Kim, M Y; Kim, K D; Lee, S-H

    2008-03-01

    The Waxy (Wx) gene product controls the formation of a straight chain polymer of amylose in the starch pathway. Dominance/recessiveness of the Wx allele is associated with amylose content, leading to non-waxy/waxy phenotypes. For a total of 113 foxtail millet accessions, agronomic traits and the molecular differences of the Wx gene were surveyed to evaluate genetic diversities. Molecular types were associated with phenotypes determined by four specific primer sets (non-waxy, Type I; low amylose, Type VI; waxy, Type IV or V). Additionally, the insertion of transposable element in waxy was confirmed by ex1/TSI2R, TSI2F/ex2, ex2int2/TSI7R and TSI7F/ex4r. Seventeen single nucleotide polymorphims (SNPs) were observed from non-coding regions, while three SNPs from coding regions were non-synonymous. Interestingly, the phenotype of No. 88 was still non-waxy, although seven nucleotides (AATTGGT) insertion at 2,993 bp led to 78 amino acids shorter. The rapid decline of r (2) in the sequenced region (exon 1-intron 1-exon 2) suggested a low level of linkage disequilibrium and limited haplotype structure. K (s) values and estimation of evolutionary events indicate early divergence of S. italica among cereal crops. This study suggested the Wx gene was one of the targets in the selection process during domestication.

  20. In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.

    Directory of Open Access Journals (Sweden)

    Mohammed Alanazi

    Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid

  1. Identification of single amino acid substitutions (SAAS) in neuraminidase from influenza a virus (H1N1) via mass spectrometry analysis coupled with de novo peptide sequencing.

    Science.gov (United States)

    Peng, Qisheng; Wang, Zijian; Wu, Donglin; Li, Xiaoou; Liu, Xiaofeng; Sun, Wanchun; Liu, Ning

    2016-08-01

    Amino acid substitutions in the neuraminidase of the influenza virus are the main cause of the emergence of resistance to zanamivir or oseltamivir during seasonal influenza treatment; they are the result of non-synonymous mutations in the viral genome that can be successfully detected by polymer chain reaction (PCR)-based approaches. There is always an urgent need to detect variation in amino acid sequences directly at the protein level. Mass spectrometry coupled with de novo sequencing has been explored as an alternative and straightforward strategy for detecting amino acid substitutions, as well - this approach is the primary focus of the present study. Influenza virus (A/Puerto Rico/8/1934 H1N1) propagated in embryonated chicken eggs was purified by ultracentrifugation, followed by PNGase F treatment. The deglycosylated virion was lysed and separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The gel band corresponding to neuraminidase was picked up and subjected to liquid chromatography tandem mass spectrometry (LC-MS/MS) analysis. LC-MS/MS analyses, coupled with manual de novo sequencing, allowed the determination of three amino acid substitutions: R346K, S349 N, and S370I/L, in the neuraminidase from the influenza virus (A/Puerto Rico/8/1934 H1N1), which were located in three mutated peptides of the neuraminidase: YGNGVWIGK, TKNHSSR, and PNGWTETDI/LK, respectively. We found that the amino acid substitutions in the proteins of RNA viruses (including influenza A virus) resulting from non-synonymous gene mutations can indeed be directly analyzed via mass spectrometry, and that manual interpretation of the MS/MS data may be beneficial. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  2. CodonTest: modeling amino acid substitution preferences in coding sequences.

    Directory of Open Access Journals (Sweden)

    Wayne Delport

    2010-08-01

    Full Text Available Codon models of evolution have facilitated the interpretation of selective forces operating on genomes. These models, however, assume a single rate of non-synonymous substitution irrespective of the nature of amino acids being exchanged. Recent developments have shown that models which allow for amino acid pairs to have independent rates of substitution offer improved fit over single rate models. However, these approaches have been limited by the necessity for large alignments in their estimation. An alternative approach is to assume that substitution rates between amino acid pairs can be subdivided into rate classes, dependent on the information content of the alignment. However, given the combinatorially large number of such models, an efficient model search strategy is needed. Here we develop a Genetic Algorithm (GA method for the estimation of such models. A GA is used to assign amino acid substitution pairs to a series of rate classes, where is estimated from the alignment. Other parameters of the phylogenetic Markov model, including substitution rates, character frequencies and branch lengths are estimated using standard maximum likelihood optimization procedures. We apply the GA to empirical alignments and show improved model fit over existing models of codon evolution. Our results suggest that current models are poor approximations of protein evolution and thus gene and organism specific multi-rate models that incorporate amino acid substitution biases are preferred. We further anticipate that the clustering of amino acid substitution rates into classes will be biologically informative, such that genes with similar functions exhibit similar clustering, and hence this clustering will be useful for the evolutionary fingerprinting of genes.

  3. Genomic characterization of the porcine CRTC3 and the effects of a non-synonymous mutation p.V515F on lean meat production and belly fat.

    Science.gov (United States)

    Lee, S H; Hur, M H; Lee, E A; Hong, K C; Kim, J M

    2018-03-01

    cAMP-responsive element-binding protein (CREB)-regulated transcriptional coactivator 3 (CRTC3) is well known to be related to obesity in humans and mice. However, the effects of CRTC3 have not been studied in pigs. Here, we characterized the structure of the porcine CRTC3 gene and identified single nucleotide polymorphisms (SNPs) in its coding region. Moreover, mRNA expression profiles of CRTC3 in muscle and fat tissues were examined. Of the 40 identified SNPs, the p.V515F mutation, located on exon 16, was genotyped in 368 Yorkshire pigs. The p.V515F mutation was significantly associated with lean meat production ability, including reduced back fat thickness (P=0.0317) and loin eye area (P=0.0174). Moreover, the SNP was significantly associated with differences in intermuscular fat (P=0.0092), total muscle area in the belly (P=0.0108), and total fat percentage in the belly (P=0.0298). Taken together, our results suggest that the p.V515F mutation affects to lean meat production ability and amount of belly fat. Copyright © 2017. Published by Elsevier Ltd.

  4. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  5. Detection of two non-synonymous SNPs in SLC45A2 on BTA20 as candidate causal mutations for oculocutaneous albinism in Braunvieh cattle.

    Science.gov (United States)

    Rothammer, Sophie; Kunz, Elisabeth; Seichter, Doris; Krebs, Stefan; Wassertheurer, Martina; Fries, Ruedi; Brem, Gottfried; Medugorac, Ivica

    2017-10-05

    Cases of albinism have been reported in several species including cattle. So far, research has identified many genes that are involved in this eye-catching phenotype. Thus, when two paternal Braunvieh half-sibs with oculocutaneous albinism were detected on a private farm, we were interested in knowing whether their phenotype was caused by an already known gene/mutation. Analysis of genotyping data (50K) of the two albino individuals, their mothers and five other relatives identified a 47.61-Mb candidate haplotype on Bos taurus chromosome BTA20. Subsequent comparisons of the sequence of this haplotype with sequence data from four Braunvieh sires and the Aurochs genome identified two possible candidate causal mutations at positions 39,829,806 bp (G/A; R45Q) and 39,864,148 bp (C/T; T444I) that were absent in 1682 animals from various bovine breeds included in the 1000 bull genomes project. Both polymorphisms represent coding variants in the SLC45A2 gene, for which the human equivalent harbors numerous variants associated with oculocutaneous albinism type 4. We demonstrate an association of R45Q and T444I with the albino phenotype by targeted genotyping. Although the candidate gene SLC45A2 is known to be involved in albinism in different species, to date in cattle only mutations in the TYR and MITF genes were reported to be associated with albinism or albinism-like phenotypes. Thus, our study extends the list of genes that are associated with bovine albinism. However, further research and more samples from related animals are needed to elucidate if only one of these two single nucleotide polymorphisms or the combination of both is the actual causal variant.

  6. Simple, heart-smart substitutions

    Science.gov (United States)

    Coronary artery disease - heart smart substitutions; Atherosclerosis - heart smart substitutions; Cholesterol - heart smart substitutions; Coronary heart disease - heart smart substitutions; Healthy diet - heart ...

  7. NU-IN: Nucleotide evolution and input module for the EvolSimulator genome simulation platform

    Directory of Open Access Journals (Sweden)

    Barker Michael S

    2010-08-01

    Full Text Available Abstract Background There is increasing demand to test hypotheses that contrast the evolution of genes and gene families among genomes, using simulations that work across these levels of organization. The EvolSimulator program was developed recently to provide a highly flexible platform for forward simulations of amino acid evolution in multiple related lineages of haploid genomes, permitting copy number variation and lateral gene transfer. Synonymous nucleotide evolution is not currently supported, however, and would be highly advantageous for comparisons to full genome, transcriptome, and single nucleotide polymorphism (SNP datasets. In addition, EvolSimulator creates new genomes for each simulation, and does not allow the input of user-specified sequences and gene family information, limiting the incorporation of further biological realism and/or user manipulations of the data. Findings We present modified C++ source code for the EvolSimulator platform, which we provide as the extension module NU-IN. With NU-IN, synonymous and non-synonymous nucleotide evolution is fully implemented, and the user has the ability to use real or previously-simulated sequence data to initiate a simulation of one or more lineages. Gene family membership can be optionally specified, as well as gene retention probabilities that model biased gene retention. We provide PERL scripts to assist the user in deriving this information from previous simulations. We demonstrate the features of NU-IN by simulating genome duplication (polyploidy in the presence of ongoing copy number variation in an evolving lineage. This example is initiated with real genomic data, and produces output that we analyse directly with existing bioinformatic pipelines. Conclusions The NU-IN extension module is a publicly available open source software (GNU GPLv3 license extension to EvolSimulator. With the NU-IN module, users are now able to simulate both drift and selection at the nucleotide

  8. Emergence of canine distemper virus strains with two amino acid substitutions in the haemagglutinin protein, detected from vaccinated carnivores in North-Eastern China in 2012-2013.

    Science.gov (United States)

    Zhao, Jianjun; Zhang, Hailing; Bai, Xue; Martella, Vito; Hu, Bo; Sun, Yangang; Zhu, Chunsheng; Zhang, Lei; Liu, Hao; Xu, Shujuan; Shao, Xiqun; Wu, Wei; Yan, Xijun

    2014-04-01

    A total of 16 strains of canine distemper virus (CDV) were detected from vaccinated minks, foxes, and raccoon dogs in four provinces in North-Eastern China between the end of 2011 and 2013. Upon sequence analysis of the haemagglutinin gene and comparison with wild-type CDV from different species in the same geographical areas, two non-synonymous single nucleotide polymorphisms were identified in 10 CDV strains, which led to amino acid changes at positions 542 (isoleucine to asparagine) and 549 (tyrosine to histidine) of the haemagglutinin protein coding sequence. The change at residue 542 generated a potentially novel N-glycosylation site. Masking of antigenic epitopes by sugar moieties might represent a mechanism for evasion of virus neutralising antibodies and reduced protection by vaccination. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Antinociceptive effect of purine nucleotides.

    Science.gov (United States)

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  10. Analysis of the CCR5 gene coding region diversity in five South American populations reveals two new non-synonymous alleles in Amerindians and high CCR5*D32 frequency in Euro-Brazilians

    Directory of Open Access Journals (Sweden)

    Angelica B.W. Boldt

    2009-01-01

    Full Text Available The CC chemokine receptor 5 (CCR5 molecule is an important co-receptor for HIV. The effect of the CCR5*D32 allele in susceptibility to HIV infection and AIDS disease is well known. Other alleles than CCR5*D32 have not been analysed before, neither in Amerindians nor in the majority of the populations all over the world. We investigated the distribution of the CCR5 coding region alleles in South Brazil and noticed a high CCR5*D32 frequency in the Euro-Brazilian population of the Paraná State (9.3%, which is the highest thus far reported for Latin America. The D32 frequency is even higher among the Euro-Brazilian Mennonites (14.2%. This allele is uncommon in Afro-Brazilians (2.0%, rare in the Guarani Amerindians (0.4% and absent in the Kaingang Amerindians and the Oriental-Brazilians. R223Q is common in the Oriental-Brazilians (7.7% and R60S in the Afro-Brazilians (5.0%. A29S and L55Q present an impaired response to b-chemokines and occurred in Afro- and Euro-Brazilians with cumulative frequencies of 4.4% and 2.7%, respectively. Two new non-synonymous alleles were found in Amerindians: C323F (g.3729G > T in Guarani (1.4% and Y68C (g.2964A > G in Kaingang (10.3%. The functional characteristics of these alleles should be defined and considered in epidemiological investigations about HIV-1 infection and AIDS incidence in Amerindian populations.

  11. DEFLATE Compression Algorithm Corrects for Overestimation of Phylogenetic Diversity by Grantham Approach to Single-Nucleotide Polymorphism Classification

    Directory of Open Access Journals (Sweden)

    Arran Schlosberg

    2014-05-01

    Full Text Available Improvements in speed and cost of genome sequencing are resulting in increasing numbers of novel non-synonymous single nucleotide polymorphisms (nsSNPs in genes known to be associated with disease. The large number of nsSNPs makes laboratory-based classification infeasible and familial co-segregation with disease is not always possible. In-silico methods for classification or triage are thus utilised. A popular tool based on multiple-species sequence alignments (MSAs and work by Grantham, Align-GVGD, has been shown to underestimate deleterious effects, particularly as sequence numbers increase. We utilised the DEFLATE compression algorithm to account for expected variation across a number of species. With the adjusted Grantham measure we derived a means of quantitatively clustering known neutral and deleterious nsSNPs from the same gene; this was then used to assign novel variants to the most appropriate cluster as a means of binary classification. Scaling of clusters allows for inter-gene comparison of variants through a single pathogenicity score. The approach improves upon the classification accuracy of Align-GVGD while correcting for sensitivity to large MSAs. Open-source code and a web server are made available at https://github.com/aschlosberg/CompressGV.

  12. Identification of Mx gene nucleotide dimorphism (G/A as genetic marker for antiviral activity in Egyptian chickens

    Directory of Open Access Journals (Sweden)

    Mohamed S. Hassanane

    2018-06-01

    Full Text Available Egyptian chickens, representing 2 breeds and 7 strains, were genotyped using the PCR-RFLP and sequencing techniques for detection of a non-synonymous dimorphism (G/A in exon 14 of chicken Myxovirus resistance (Mx gene. This dimorphic position is responsible for altering Mx protein’s antiviral activity. Polymerase Chain reactions were performed using Egyptian chickens DNA and specific primer set to amplify Mx DNA fragments of 299 or 301 bp, containing the dimorphic position. Amplicons were cut with restriction enzyme Hpy81. Genotype and allele frequencies for the resistant allele A and sensitive allele G were calculated in all the tested chickens. Results of PCR-RFLP were confirmed by sequencing. The three genotypes AA, AG, GG at the target nucleotide position in Mx gene were represented in all the studied Egyptian chicken breeds and strains except Baladi strain which showed only one genotype AA. The average allele frequency of the resistant A allele in the tested birds (0.67 was higher than the sensitive G allele average frequency in the same birds (0.33. Appling PCR-RFLP technique in the breeding program can be used to select chickens carrying the A allele with high frequencies. This will help in improving poultry breeding in Egypt by producing infectious disease-resistant chickens. Keywords: Egyptian chickens, Antiviral activity, Mx gene, Genotyping, PCR-RFLP

  13. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    Science.gov (United States)

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  14. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L

    2011-06-01

    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  15. Maximum parsimony, substitution model, and probability phylogenetic trees.

    Science.gov (United States)

    Weng, J F; Thomas, D A; Mareels, I

    2011-01-01

    The problem of inferring phylogenies (phylogenetic trees) is one of the main problems in computational biology. There are three main methods for inferring phylogenies-Maximum Parsimony (MP), Distance Matrix (DM) and Maximum Likelihood (ML), of which the MP method is the most well-studied and popular method. In the MP method the optimization criterion is the number of substitutions of the nucleotides computed by the differences in the investigated nucleotide sequences. However, the MP method is often criticized as it only counts the substitutions observable at the current time and all the unobservable substitutions that really occur in the evolutionary history are omitted. In order to take into account the unobservable substitutions, some substitution models have been established and they are now widely used in the DM and ML methods but these substitution models cannot be used within the classical MP method. Recently the authors proposed a probability representation model for phylogenetic trees and the reconstructed trees in this model are called probability phylogenetic trees. One of the advantages of the probability representation model is that it can include a substitution model to infer phylogenetic trees based on the MP principle. In this paper we explain how to use a substitution model in the reconstruction of probability phylogenetic trees and show the advantage of this approach with examples.

  16. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  17. Investigation of Polymorphisms in Coding Region of OsHKT1 in Relation to Salinity in Rice

    Directory of Open Access Journals (Sweden)

    Pham Quynh-Hoa

    2016-11-01

    Full Text Available Rice (Oryza sativa is sensitive to salinity, but the salt tolerance level differs among cultivars, which might result from natural variations in the genes that are responsible for salt tolerance. High-affinity potassium transporter (HKTs has been proven to be involved in salt tolerance in plants. Therefore, we screened for natural nucleotide polymorphism in the coding sequence of OsHKT1, which encodes the HKT protein in eight Vietnamese rice cultivars differing in salt tolerance level. In total, seven nucleotide substitutions in coding sequence of OsHKT1 were found, including two non-synonymous and five synonymous substitutions. Further analysis revealed that these two non-synonymous nucleotide substitutions (G50T and T1209A caused changes in amino acids (Gly17Val and Asp403Glu at signal peptide and the loop of the sixth transmembrane domain, respectively. To assess the potential effect of these substitutions on the protein function, the 3D structure of HKT protein variants was modelled by using PHYRE2 webserver. The results showed that no difference was observed when compared those predicted 3D structure of HKT protein variants with each other. In addition, the codon bias of synonymous substitutions cannot clearly show correlation with salt tolerance level. It might be interesting to further investigate the functional roles of detected non-synonymous substitutions as it might correlate to salt tolerance in rice.

  18. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  19. Medicineringsfejl ved generisk substitution

    DEFF Research Database (Denmark)

    Rölfing, Jan

    2012-01-01

    Generic substitution is a major cause of medical mistakes in the general population. Danish legislation obligates pharmacies to substitute prescribed medicine with the cheapest equivalent formulation, despite variations in product name, packaging, shape and colour. Consequently, medical mistakes...... occur. Scientific evidence on the consequences of generic substitution is sparse. Call upon fellow health workers to report medical mistakes to the national entities and scientific peers, in order to increase awareness and scientific evidence about the problem....

  20. Disparities in allele frequencies and population differentiation for 101 disease-associated single nucleotide polymorphisms between Puerto Ricans and non-Hispanic whites

    Directory of Open Access Journals (Sweden)

    Arnett Donna

    2009-08-01

    Full Text Available Abstract Background Variations in gene allele frequencies can contribute to differences in the prevalence of some common complex diseases among populations. Natural selection modulates the balance in allele frequencies across populations. Population differentiation (FST can evidence environmental selection pressures. Such genetic information is limited in Puerto Ricans, the second largest Hispanic ethnic group in the US, and a group with high prevalence of chronic disease. We determined allele frequencies and population differentiation for 101 single nucleotide polymorphisms (SNPs in 30 genes involved in major metabolic and disease-relevant pathways in Puerto Ricans (n = 969, ages 45–75 years and compared them to similarly aged non-Hispanic whites (NHW (n = 597. Results Minor allele frequency (MAF distributions for 45.5% of the SNPs assessed in Puerto Ricans were significantly different from those of NHW. Puerto Ricans carried risk alleles in higher frequency and protective alleles in lower frequency than NHW. Patterns of population differentiation showed that Puerto Ricans had SNPs with exceptional FST values in intronic, non-synonymous and promoter regions. NHW had exceptional FST values in intronic and promoter region SNPs only. Conclusion These observations may serve to explain and broaden studies on the impact of gene polymorphisms on chronic diseases affecting Puerto Ricans.

  1. Analysis of nucleotide diversity among alleles of the major bacterial blight resistance gene Xa27 in cultivars of rice (Oryza sativa) and its wild relatives.

    Science.gov (United States)

    Bimolata, Waikhom; Kumar, Anirudh; Sundaram, Raman Meenakshi; Laha, Gouri Shankar; Qureshi, Insaf Ahmed; Reddy, Gajjala Ashok; Ghazi, Irfan Ahmad

    2013-08-01

    Xa27 is one of the important R-genes, effective against bacterial blight disease of rice caused by Xanthomonas oryzae pv. oryzae (Xoo). Using natural population of Oryza, we analyzed the sequence variation in the functionally important domains of Xa27 across the Oryza species. DNA sequences of Xa27 alleles from 27 rice accessions revealed higher nucleotide diversity among the reported R-genes of rice. Sequence polymorphism analysis revealed synonymous and non-synonymous mutations in addition to a number of InDels in non-coding regions of the gene. High sequence variation was observed in the promoter region including the 5'UTR with 'π' value 0.00916 and 'θ w ' = 0.01785. Comparative analysis of the identified Xa27 alleles with that of IRBB27 and IR24 indicated the operation of both positive selection (Ka/Ks > 1) and neutral selection (Ka/Ks ≈ 0). The genetic distances of alleles of the gene from Oryza nivara were nearer to IRBB27 as compared to IR24. We also found the presence of conserved and null UPT (upregulated by transcriptional activator) box in the isolated alleles. Considerable amino acid polymorphism was localized in the trans-membrane domain for which the functional significance is yet to be elucidated. However, the absence of functional UPT box in all the alleles except IRBB27 suggests the maintenance of single resistant allele throughout the natural population.

  2. Transcriptome-Wide Single Nucleotide Polymorphisms (SNPs for Abalone (Haliotis midae: Validation and Application Using GoldenGate Medium-Throughput Genotyping Assays

    Directory of Open Access Journals (Sweden)

    Rouvay Roodt-Wilding

    2013-09-01

    Full Text Available Haliotis midae is one of the most valuable commercial abalone species in the world, but is highly vulnerable, due to exploitation, habitat destruction and predation. In order to preserve wild and cultured stocks, genetic management and improvement of the species has become crucial. Fundamental to this is the availability and employment of molecular markers, such as microsatellites and Single Nucleotide Polymorphisms (SNPs . Transcriptome sequences generated through sequencing-by-synthesis technology were utilized for the in vitro and in silico identification of 505 putative SNPs from a total of 316 selected contigs. A subset of 234 SNPs were further validated and characterized in wild and cultured abalone using two Illumina GoldenGate genotyping assays. Combined with VeraCode technology, this genotyping platform yielded a 65%−69% conversion rate (percentage polymorphic markers with a global genotyping success rate of 76%−85% and provided a viable means for validating SNP markers in a non-model species. The utility of 31 of the validated SNPs in population structure analysis was confirmed, while a large number of SNPs (174 were shown to be informative and are, thus, good candidates for linkage map construction. The non-synonymous SNPs (50 located in coding regions of genes that showed similarities with known proteins will also be useful for genetic applications, such as the marker-assisted selection of genes of relevance to abalone aquaculture.

  3. Transcriptome-wide single nucleotide polymorphisms (SNPs) for abalone (Haliotis midae): validation and application using GoldenGate medium-throughput genotyping assays.

    Science.gov (United States)

    Bester-Van Der Merwe, Aletta; Blaauw, Sonja; Du Plessis, Jana; Roodt-Wilding, Rouvay

    2013-09-23

    Haliotis midae is one of the most valuable commercial abalone species in the world, but is highly vulnerable, due to exploitation, habitat destruction and predation. In order to preserve wild and cultured stocks, genetic management and improvement of the species has become crucial. Fundamental to this is the availability and employment of molecular markers, such as microsatellites and single nucleotide (SNPs). Transcriptome sequences generated through sequencing-by-synthesis technology were utilized for the in vitro and in silico identification of 505 putative SNPs from a total of 316 selected contigs. A subset of 234 SNPs were further validated and characterized in wild and cultured abalone using two Illumina GoldenGate genotyping assays. Combined with VeraCode technology, this genotyping platform yielded a 65%-69% conversion rate (percentage polymorphic markers) with a global genotyping success rate of 76%-85% and provided a viable means for validating SNP markers in a non-model species. The utility of 31 of the validated SNPs in population structure analysis was confirmed, while a large number of SNPs (174) were shown to be informative and are, thus, good candidates for linkage map construction. The non-synonymous SNPs (50) located in coding regions of genes that showed similarities with known proteins will also be useful for genetic applications, such as the marker-assisted selection of genes of relevance to abalone aquaculture.

  4. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Substitution rate and natural selection in parvovirus B19

    Science.gov (United States)

    Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.

    2016-01-01

    The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080

  6. Evaluating rare amino acid substitutions (RGC_CAMs in a yeast model clade.

    Directory of Open Access Journals (Sweden)

    Kenneth Polzin

    Full Text Available When inferring phylogenetic relationships, not all sites in a sequence alignment are equally informative. One recently proposed approach that takes advantage of this inequality relies on sites that contain amino acids whose replacement requires multiple substitutions. Identifying these so-called RGC_CAM substitutions (after Rare Genomic Changes as Conserved Amino acids-Multiple substitutions requires that, first, at any given site in the amino acid sequence alignment, there must be a minimum of two different amino acids; second, each amino acid must be present in at least two taxa; and third, the amino acids must require a minimum of two nucleotide substitutions to replace each other. Although theory suggests that RGC_CAM substitutions are expected to be rare and less likely to be homoplastic, the informativeness of RGC_CAM substitutions has not been extensively evaluated in biological data sets. We investigated the quality of RGC_CAM substitutions by examining their degree of homoplasy and internode certainty in nearly 2.7 million aligned amino acid sites from 5,261 proteins from five species belonging to the yeast Saccharomyces sensu stricto clade whose phylogeny is well-established. We identified 2,647 sites containing RGC_CAM substitutions, a number that contrasts sharply with the 100,887 sites containing RGC_non-CAM substitutions (i.e., changes between amino acids that require only a single nucleotide substitution. We found that RGC_CAM substitutions had significantly lower homoplasy than RGC_non-CAM ones; specifically RGC_CAM substitutions showed a per-site average homoplasy index of 0.100, whereas RGC_non-CAM substitutions had a homoplasy index of 0.215. Internode certainty values were also higher for sites containing RGC_CAM substitutions than for RGC_non-CAM ones. These results suggest that RGC_CAM substitutions possess a strong phylogenetic signal and are useful markers for phylogenetic inference despite their rarity.

  7. 40 CFR 721.981 - Substituted naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex.

    Science.gov (United States)

    2010-07-01

    ... naphthalenyl-substituted azonaphthol chromium complex. 721.981 Section 721.981 Protection of Environment...-substituted naphthalenyl-substituted azonaphthol chromium complex. (a) Chemical substance and significant new... naphtholoazo-substituted naphthalenyl-substituted azonaphthol chromium complex (PMN P-93-1631) is subject to...

  8. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    DEFF Research Database (Denmark)

    Bross, Peter; Li, Zhijie; Hansen, Jakob

    2007-01-01

    for variations in the HSPD1 and HSPE1 genes encoding the mitochondrial Hsp60/Hsp10 chaperone complex: two patients with multiple mitochondrial enzyme deficiency, 61 sudden infant death syndrome cases (MIM: #272120), and 60 patients presenting with ethylmalonic aciduria carrying non-synonymous susceptibility...... variations in the ACADS gene (MIM: *606885 and #201470). Besides previously reported variations we detected six novel variations: two in the bidirectional promoter region, and one synonymous and three non-synonymous variations in the HSPD1 coding region. One of the non-synonymous variations was polymorphic...... in patient and control samples, and the rare variations were each only found in single patients and absent in 100 control chromosomes. Functional investigation of the effects of the variations in the promoter region and the non-synonymous variations in the coding region indicated that none of them had...

  9. Nonsynonymous substitution in abalone sperm fertilization genes exceeds substitution in introns and mitochondrial DNA

    Science.gov (United States)

    Metz, Edward C.; Robles-Sikisaka, Refugio; Vacquier, Victor D.

    1998-01-01

    Strong positive Darwinian selection acts on two sperm fertilization proteins, lysin and 18-kDa protein, from abalone (Haliotis). To understand the phylogenetic context for this dramatic molecular evolution, we obtained sequences of mitochondrial cytochrome c oxidase subunit I (mtCOI), and genomic sequences of lysin, 18-kDa, and a G protein subunit. Based on mtDNA differentiation, four north Pacific abalone species diverged within the past 2 million years (Myr), and remaining north Pacific species diverged over a period of 4–20 Myr. Between-species nonsynonymous differences in lysin and 18-kDa exons exceed nucleotide differences in introns by 3.5- to 24-fold. Remarkably, in some comparisons nonsynonymous substitutions in lysin and 18-kDa genes exceed synonymous substitutions in mtCOI. Lysin and 18-kDa intron/exon segments were sequenced from multiple red abalone individuals collected over a 1,200-km range. Only two nucleotide changes and two sites of slippage variation were detected in a total of >29,000 nucleotides surveyed. However, polymorphism in mtCOI and a G protein intron was found in this species. This finding suggests that positive selection swept one lysin allele and one 18-kDa allele to fixation. Similarities between mtCOI and lysin gene trees indicate that rapid adaptive evolution of lysin has occurred consistently through the history of the group. Comparisons with mtCOI molecular clock calibrations suggest that nonsynonymous substitutions accumulate 2–50 times faster in lysin and 18-kDa genes than in rapidly evolving mammalian genes. PMID:9724763

  10. Electricity/oil substitution

    International Nuclear Information System (INIS)

    Melvin, J.G.

    1980-09-01

    The extent to which electricity could substitute for imported oil in Canada is assessed and it is concluded that the bulk of projected oil imports could be displaced. This substitution of electricity for oil could be largely completed within two decades, with existing technology, using Canadian resources. The substitution of electricity for imported oil would result in relatively low energy costs and would stimulate economic growth. Energy self-sufficiency through the substitution of electricity for oil is uniquely a Canadian option; it is not open to other industrial countries. The option exists because of Canada's resources of oil sands for essential liquid fuels, hydraulic and nuclear electrical potential, and natural gas as an interim source of energy. While other countries face an energy crisis due to declining supplies of oil, Canada faces opportunities. The policies of Federal and Provincial governments, as perceived by individual decision makers, will have a major influence on Canada's ability to realize opportunities. (auth)

  11. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  12. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  13. Nucleotide diversity of the ZmPox3 maize peroxidase gene: Relationships between a MITE insertion in exon 2 and variation in forage maize digestibility

    Directory of Open Access Journals (Sweden)

    Rigau Joan

    2004-07-01

    Full Text Available Abstract Background Polymorphisms were investigated within the ZmPox3 maize peroxidase gene, possibly involved in lignin biosynthesis because of its colocalization with a cluster of QTL related to lignin content and cell wall digestibility. The purpose of this study was to identify, on the basis of 37 maize lines chosen for their varying degrees of cell wall digestibility and representative of temperate regions germplasm, ZmPox3 haplotypes or individual polymorphisms possibly associated with digestibility. Results Numerous haplotypes with high diversity were identified. Frequency of nucleotide changes was high with on average one SNP every 57 bp. Nucleotide diversity was not equally distributed among site categories: the estimated π was on average eight times higher for silent sites than for non-synonymous sites. Numerous sites were in linkage disequilibrium that decayed with increasing physical distance. A zmPox3 mutant allele, carrying an insertion of a transposable element in the second exon, was found in lines derived from the early flint inbred line, F7. This element possesses many structural features of miniature inverted-repeat transposable elements (MITE. The mutant allele encodes a truncated protein lacking important functional sites. An ANOVA performed with a subset of 31 maize lines indicated that the transposable element was significantly associated with cell wall digestibility. This association was confirmed using an additional set of 25 flint lines related to F7. Moreover, RT-PCR experiments revealed a decreased amount of corresponding mRNA in plants with the MITE insertion. Conclusion These results showed that ZmPox3 could possibly be involved in monolignol polymerisation, and that a deficiency in ZmPox3 peroxidase activity seemingly has a negative effect on cell wall digestibility. Also, genetic diversity analyses of ZmPox3 indicated that this peroxidase could be a relevant target for grass digestibility improvement using

  14. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  15. Detecting selection needs comparative data

    DEFF Research Database (Denmark)

    Nielsen, Rasmus; Hubisz, Melissa J.

    2005-01-01

    Positive selection at the molecular level is usually indicated by an increase in the ratio of non-synonymous to synonymous substitutions (dN/dS) in comparative data. However, Plotkin et al. 1 describe a new method for detecting positive selection based on a single nucleotide sequence. We show here...... that this method is particularly sensitive to assumptions regarding the underlying mutational processes and does not provide a reliable way to identify positive selection....

  16. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    Science.gov (United States)

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  17. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  18. Bone substitute biomaterials

    CERN Document Server

    Mallick, K

    2014-01-01

    Bone substitute biomaterials are fundamental to the biomedical sector, and have recently benefitted from extensive research and technological advances aimed at minimizing failure rates and reducing the need for further surgery. This book reviews these developments, with a particular focus on the desirable properties for bone substitute materials and their potential to encourage bone repair and regeneration. Part I covers the principles of bone substitute biomaterials for medical applications. One chapter reviews the quantification of bone mechanics at the whole-bone, micro-scale, and non-scale levels, while others discuss biomineralization, osteoductivization, materials to fill bone defects, and bioresorbable materials. Part II focuses on biomaterials as scaffolds and implants, including multi-functional scaffolds, bioceramics, and titanium-based foams. Finally, Part III reviews further materials with the potential to encourage bone repair and regeneration, including cartilage grafts, chitosan, inorganic poly...

  19. [Delegation yes, substitution no!].

    Science.gov (United States)

    Schroeder, A

    2014-08-01

    The aging of society leads on the one hand to increasing case numbers and on the other hand to a reduction in the number of physicians available for patient treatment. The delegation and substitution of medical duties as a tried and tested method is increasingly being recommended in order to compensate for the lack of physicians. The Berufsverband der Deutschen Urologen (BDU, Professional Association of German Urologists) supports the guiding principle of the Bundesärztekammer (Federal Medical Council) of "delegation yes, substitution no" and rejects a substitution of medical duties by non-medical academic health personnel. Against the background of the demographic changes, the increasing need for treatment and the current deficiency of junior physicians, a more extensive inclusion of well-qualified and experienced non-medical personnel by the delegation of medically responsible duties (medical scope of practice) can be an appropriate measure to maintain a good medical service in practices, hospitals and nursing homes.

  20. Aryl substitution of pentacenes

    Directory of Open Access Journals (Sweden)

    Andreas R. Waterloo

    2014-07-01

    Full Text Available A series of 11 new pentacene derivatives has been synthesized, with unsymmetrical substitution based on a trialkylsilylethynyl group at the 6-position and various aryl groups appended to the 13-position. The electronic and physical properties of the new pentacene chromophores have been analyzed by UV–vis spectroscopy (solution and thin films, thermoanalytical methods (DSC and TGA, cyclic voltammetry, as well as X-ray crystallography (for 8 derivatives. X-ray crystallography has been specifically used to study the influence of unsymmetrical substitution on the solid-state packing of the pentacene derivatives. The obtained results add to our ability to better predict substitution patterns that might be helpful for designing new semiconductors for use in solid-state devices.

  1. Aryl substitution of pentacenes

    Science.gov (United States)

    Waterloo, Andreas R; Sale, Anna-Chiara; Lehnherr, Dan; Hampel, Frank

    2014-01-01

    Summary A series of 11 new pentacene derivatives has been synthesized, with unsymmetrical substitution based on a trialkylsilylethynyl group at the 6-position and various aryl groups appended to the 13-position. The electronic and physical properties of the new pentacene chromophores have been analyzed by UV–vis spectroscopy (solution and thin films), thermoanalytical methods (DSC and TGA), cyclic voltammetry, as well as X-ray crystallography (for 8 derivatives). X-ray crystallography has been specifically used to study the influence of unsymmetrical substitution on the solid-state packing of the pentacene derivatives. The obtained results add to our ability to better predict substitution patterns that might be helpful for designing new semiconductors for use in solid-state devices. PMID:25161729

  2. Genetic analysis of central carbon metabolism unveils an amino acid substitution that alters maize NAD-dependent isocitrate dehydrogenase activity.

    Directory of Open Access Journals (Sweden)

    Nengyi Zhang

    2010-04-01

    Full Text Available Central carbon metabolism (CCM is a fundamental component of life. The participating genes and enzymes are thought to be structurally and functionally conserved across and within species. Association mapping utilizes a rich history of mutation and recombination to achieve high resolution mapping. Therefore, applying association mapping in maize (Zea mays ssp. mays, the most diverse model crop species, to study the genetics of CCM is a particularly attractive system.We used a maize diversity panel to test the CCM functional conservation. We found heritable variation in enzyme activity for every enzyme tested. One of these enzymes was the NAD-dependent isocitrate dehydrogenase (IDH, E.C. 1.1.1.41, in which we identified a novel amino-acid substitution in a phylogenetically conserved site. Using candidate gene association mapping, we identified that this non-synonymous polymorphism was associated with IDH activity variation. The proposed mechanism for the IDH activity variation includes additional components regulating protein level. With the comparison of sequences from maize and teosinte (Zea mays ssp. Parviglumis, the maize wild ancestor, we found that some CCM genes had also been targeted for selection during maize domestication.Our results demonstrate the efficacy of association mapping for dissecting natural variation in primary metabolic pathways. The considerable genetic diversity observed in maize CCM genes underlies heritable phenotypic variation in enzyme activities and can be useful to identify putative functional sites.

  3. Muon substituted free radicals

    International Nuclear Information System (INIS)

    Burkhard, P.; Fischer, H.; Roduner, E.; Strub, W.; Gygax, F.N.; Brinkman, G.A.; Louwrier, P.W.F.; McKenna, D.; Ramos, M.; Webster, B.C.

    1984-01-01

    Spin polarized energetic positive muons are injected as magnetic probes into unsaturated organic liquids. They are implemented via fast chemical processes ( -10 s) in various molecules. Of particular interest among these are muonium substituted free radicals. The technique allows determination of accurate rate coefficients for fast chemical reactions of radicals. Furthermore, radiochemical processes occuring in picoseconds after injection of the muon are studied. Of fundamental interest are also the structural and dynamical implications of substituting a proton by a muon, or in other terms, a hydrogen atom by a muonium atom. Selected examples for each of these three types of experiments are given. (Auth.)

  4. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  5. Hazardous solvent substitution

    International Nuclear Information System (INIS)

    Twitchell, K.E.

    1995-01-01

    This article is an overview of efforts at INEL to reduce the generation of hazardous wastes through the elimination of hazardous solvents. To aid in their efforts, a number of databases have been developed and will become a part of an Integrated Solvent Substitution Data System. This latter data system will be accessible through Internet

  6. Carbolanthanation of substituted alkynes

    International Nuclear Information System (INIS)

    Kalinin, V.N.; Kazimirchuk, E.I.; Vitt, S.V.; Khandozhko, V.N.; Beletskaya, I.P.

    1993-01-01

    Using the reaction between CH 3 YbI and substituted alkynes as an example, agents can enter into carbolanthanation reaction via transfer of a methyl group to carbon atom of acetylene bond with the production of a new olefin carbanion. 5 refs.; 1 fig.; 3 tabs

  7. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  8. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  9. [Currently available skin substitutes].

    Science.gov (United States)

    Oravcová, Darina; Koller, Ján

    2014-01-01

    The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. Autologous split or full-thickness skin graft are the best definitive burn wound coverage, but it is constrained by the limited available sources, especially in major burns. Donor site morbidities in term of additional wounds and scarring are also of concern of the autograft application. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. This paper reviews currently available skin substitutes, produced in not for-profit skin banks as well as commercially available. They are divided according to type of material included, as biological, biosynthetic and synthetic and named respectively.

  10. Estimated allele substitution effects underlying genomic evaluation models depend on the scaling of allele counts

    NARCIS (Netherlands)

    Bouwman, Aniek C.; Hayes, Ben J.; Calus, Mario P.L.

    2017-01-01

    Background: Genomic evaluation is used to predict direct genomic values (DGV) for selection candidates in breeding programs, but also to estimate allele substitution effects (ASE) of single nucleotide polymorphisms (SNPs). Scaling of allele counts influences the estimated ASE, because scaling of

  11. Haemophilia A: Database of nucleotide substitutions, deletions, insertions and rearrangements of the factor VIII gene

    Energy Technology Data Exchange (ETDEWEB)

    Tuddenham, E.G.D. (Clinical Research Centre, Harrow (United Kingdom)); Cooper, D.N. (Thrombosis Research Inst., London (United Kingdom)); Gitschier, J. (Univ. of California, San Francisco (United States)); Higuchi, M.; Kazazian, H.H.; Antonarakis, S.E. (Johns Hopkins Univ., Baltimore (United States)); Hoyer, L.W. (American Red Cross, Rockville (United States)); Yoshioka, A. (Nara Medical Coll., Kashihara City (Japan)); Peake, I.R. (Royal Hallamshire Hospital, Sheffield (United Kingdom)); Schwaab, R. (Inst. fuer Klinische Biochemie der Univ. Bonn (West Germany)); Lavergne, J.M. (Hopital de Bicetre (France)); Giannelli, F. (Guy' s Hospital, London (United Kingdom))

    1991-09-25

    Mutations at the factor VIII gene locus causing Haemophilia A have now been identified in many patients from a many ethnic groups. Earlier studies used biased methods which detected repetitive mutations at a few CG dinucleotides. More recently rapid gene scanning methods have uncovered an extreme diversity of mutations. Over 80 different point mutations, 6 insertions, 7 small deletions, and 60 large deletions have been characterized. Repetitive mutation has been proved for at least 16 CpG sites. All nonsense mutations cause severe disease. Most missense mutations appear to cause instability of the protein, but some are associated with production of dysfunctional factor VIII molecules, thereby localizing functionally critical regions of the cofactor. Variable phenotype has been observed in association with three of the latter class of genotype. This catalogue of gene lesions in Haemophilia A will be updated annually.

  12. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

    Science.gov (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

    2012-01-01

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  13. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

    Science.gov (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

    2012-02-03

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  14. Identification and characterization of single nucleotide polymorphisms in 6 growth-correlated genes in porcine by denaturing high performance liquid chromatography.

    Science.gov (United States)

    Liu, Dewu; Zhang, Yushan; Du, Yinjun; Yang, Guanfu; Zhang, Xiquan

    2007-06-01

    The growth-correlated genes that are part of the neuroendocrine growth axis play crucial roles in the regulation of growth and development of pig. The identification of genetic polymorphisms in these genes will enable the scientist to evaluate the biological relevance of such polymorphisms and to gain a better understanding of quantitative traits like growth. In the present study, seven pairs of primers were designed to obtain unknown sequences of growth-correlated genes, and other 25 pairs of primers were designed to identify single nucleotide polymorphisms (SNP) using the denaturing high-performance liquid chromatography (DHPLC) technology in four pig breeds (Duroc, Landrace, Lantang and Wuzhishan), significantly differing in growth and development characteristics. A total of 101 polymorphisms were discovered in 10,707 base pairs (bp) from six genes of the ghrelin (GHRL), leptin (LEP), insulin-like growth factor II (IGF-II), insulin-like growth factor binding protein 2 (IGFBP-2), insulin-like growth factor binding protein 3 (IGFBP-3), and somatostatin (SS). The observed average distances between the SNP in the 5'UTR, coding regions, introns and 3'UTR were 134, 521, 81 and 92 bp, respectively. Four SNPs were found in the coding regions of IGF-II, IGFBP-2 and LEP, respectively. Two synonymous mutations were obtained in IGF-II and LEP genes respectively, and two non-synonymous were found in IGFBP-2 and LEP genes, respectively. Seven other mutations were also observed. Thirty-two PCR-RFLP markers were found among 101 polymorphisms of the six genes. The SNP discovered in this study would provide suitable markers for association studies of candidate genes with growth related traits in pig.

  15. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  16. QualitySNP: a pipeline for detecting single nucleotide polymorphisms and insertions/deletions in EST data from diploid and polyploid species

    Directory of Open Access Journals (Sweden)

    Voorrips Roeland E

    2006-10-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are important tools in studying complex genetic traits and genome evolution. Computational strategies for SNP discovery make use of the large number of sequences present in public databases (in most cases as expressed sequence tags (ESTs and are considered to be faster and more cost-effective than experimental procedures. A major challenge in computational SNP discovery is distinguishing allelic variation from sequence variation between paralogous sequences, in addition to recognizing sequencing errors. For the majority of the public EST sequences, trace or quality files are lacking which makes detection of reliable SNPs even more difficult because it has to rely on sequence comparisons only. Results We have developed a new algorithm to detect reliable SNPs and insertions/deletions (indels in EST data, both with and without quality files. Implemented in a pipeline called QualitySNP, it uses three filters for the identification of reliable SNPs. Filter 1 screens for all potential SNPs and identifies variation between or within genotypes. Filter 2 is the core filter that uses a haplotype-based strategy to detect reliable SNPs. Clusters with potential paralogs as well as false SNPs caused by sequencing errors are identified. Filter 3 screens SNPs by calculating a confidence score, based upon sequence redundancy and quality. Non-synonymous SNPs are subsequently identified by detecting open reading frames of consensus sequences (contigs with SNPs. The pipeline includes a data storage and retrieval system for haplotypes, SNPs and alignments. QualitySNP's versatility is demonstrated by the identification of SNPs in EST datasets from potato, chicken and humans. Conclusion QualitySNP is an efficient tool for SNP detection, storage and retrieval in diploid as well as polyploid species. It is available for running on Linux or UNIX systems. The program, test data, and user manual are available at

  17. Convergent evolution of marine mammals is associated with distinct substitutions in common genes

    Science.gov (United States)

    Zhou, Xuming; Seim, Inge; Gladyshev, Vadim N.

    2015-01-01

    Phenotypic convergence is thought to be driven by parallel substitutions coupled with natural selection at the sequence level. Multiple independent evolutionary transitions of mammals to an aquatic environment offer an opportunity to test this thesis. Here, whole genome alignment of coding sequences identified widespread parallel amino acid substitutions in marine mammals; however, the majority of these changes were not unique to these animals. Conversely, we report that candidate aquatic adaptation genes, identified by signatures of likelihood convergence and/or elevated ratio of nonsynonymous to synonymous nucleotide substitution rate, are characterized by very few parallel substitutions and exhibit distinct sequence changes in each group. Moreover, no significant positive correlation was found between likelihood convergence and positive selection in all three marine lineages. These results suggest that convergence in protein coding genes associated with aquatic lifestyle is mainly characterized by independent substitutions and relaxed negative selection. PMID:26549748

  18. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    Science.gov (United States)

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  19. Hexavalent Chromium Substitution Projects

    Science.gov (United States)

    2011-05-12

    Hexavalent Chromium Substitution Projects Date (12 May 2011) Gene McKinley ASC/WNV (937) 255-3596 Gene.McKinley@wpafb.af.mil Aeronautical Systems...valid OMB control number. 1. REPORT DATE 12 MAY 2011 2. REPORT TYPE 3. DATES COVERED 00-00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Hexavalent ...A-10) – AETC (T-6, T-38 and T1A) • Both Cr Primers & Non-Cr primers as well as Cr Surface Treatment – F-22 8 Non- Chrome Tie-coat & touch-up

  20. Muonium substituted molecules

    International Nuclear Information System (INIS)

    Cox, S.F.J.

    1990-12-01

    The manner in which Muon Spin Rotation and Level Crossing Resonance are used to characterise muonium substituted organic radicals is described, and illustrated with spectra for the ethyl radical and related species. Comparison with electron spin resonance data for the unsubstituted radicals reveals significant structural and hyperfine isotope effects which can be traced to the effects of zero point motion. The first comparable results for a diamagnetic species, exhibiting a quadrupole isotope effect by comparison with conventional nuclear quadrupole resonance data, are presented and discussed. (author)

  1. Resources, recycle, and substitution

    International Nuclear Information System (INIS)

    Wymer, R.G.

    A two-fold strategy appears necessary to ensure that the resource needs of the developed and developing nations are met. First, recycle and substitution must be encouraged in those instances where they do find application. Although these measures have limited applicability, they may be of vital importance in those instances where they do apply; in any event, they buy time. Second, practical and economical technologies must be developed to exploit the lower-grade and marginal ores and the oftentimes abundant but highly refractory ores, as well as to greatly increase the recovery of secondary elements present in the ores - elements whose form and amounts in the ores make them economically unrecoverable by themselves, but which are economically recoverable as by-products. It is often the case that if these elements are not recovered during the initial mining and milling operations, they are rendered unrecoverable, in a practical sense, forever. Furthermore, they may even become environmental pollutants. Specific examples of recovery from refractory ores, by-product recovery, and recycle are given. Also, some suggestions of substitutes for important resources are tabulated

  2. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Science.gov (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  3. Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

    Science.gov (United States)

    Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

    2016-01-01

    Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

  4. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  5. Bacterial nucleotide-based second messengers.

    Science.gov (United States)

    Pesavento, Christina; Hengge, Regine

    2009-04-01

    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  6. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  7. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  8. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  9. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  10. Currency substitution in Eastern Europe

    NARCIS (Netherlands)

    van Aarle, B.; Budina, N.

    1995-01-01

    Monetary instability during the transition process from a command economy to a market economy has induced a considerable increase in currency substitution in Eastern Europe. Currency substitution itself affects monetary stability since it reduces the stability of velocity. This paper investigates

  11. Why Does Trigonometric Substitution Work?

    Science.gov (United States)

    Cunningham, Daniel W.

    2018-01-01

    Modern calculus textbooks carefully illustrate how to perform integration by trigonometric substitution. Unfortunately, most of these books do not adequately justify this powerful technique of integration. In this article, we present an accessible proof that establishes the validity of integration by trigonometric substitution. The proof offers…

  12. Substitution of matrices over rings

    NARCIS (Netherlands)

    Hautus, M.L.J.

    1995-01-01

    For a given commutative ring with an identity element, we define and study the substitution of a matrix with entries in into a matrix polynomial or rational function over . A Bezout-type remainder theorem and a "partial-substitution rule" are derived and used to obtain a number of results. The

  13. Substitution in recreation choice behavior

    Science.gov (United States)

    George L. Peterson; Daniel J. Stynes; Donald H. Rosenthal; John F. Dwyer

    1985-01-01

    This review discusses concepts and theories of substitution in recreation choice. It brings together the literature of recreation research, psychology, geography, economics, and transportation. Parallel and complementary developments need integration into an improved theory of substitution. Recreation decision behavior is characterized as a nested or sequential choice...

  14. Biological background of dermal substitutes

    NARCIS (Netherlands)

    van der Veen, V. C.; van der Wal, M.B.; van Leeuwen, M.C.; Ulrich, M.; Middelkoop, E.

    2010-01-01

    Dermal substitutes are of major importance in treating full thickness skin defects, both in acute and chronic wounds. In this review we will outline specific requirements of three classes of dermal substitutes:-natural biological materials, with a more or less intact extracellular matrix

  15. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  16. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  17. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

    2013-01-01

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

  18. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  19. Sorted gene genealogies and species-specific nonsynonymous substitutions point to putative postmating prezygotic isolation genes in Allonemobius crickets

    Directory of Open Access Journals (Sweden)

    Suegene Noh

    2016-02-01

    Full Text Available In the Allonemobius socius complex of crickets, reproductive isolation is primarily accomplished via postmating prezygotic barriers. We tested seven protein-coding genes expressed in the male ejaculate for patterns of evolution consistent with a putative role as postmating prezygotic isolation genes. Our recently diverged species generally lacked sequence variation. As a result, ω-based tests were only mildly successful. Some of our genes showed evidence of elevated ω values on the internal branches of gene trees. In a couple of genes, these internal branches coincided with both species branching events of the species tree, between A. fasciatus and the other two species, and between A. socius and A. sp. nov. Tex. In comparison, more successful approaches were those that took advantage of the varying degrees of lineage sorting and allele sharing among our young species. These approaches were particularly powerful within the contact zone. Among the genes we tested we found genes with genealogies that indicated relatively advanced degrees of lineage sorting across both allopatric and contact zone alleles. Within a contact zone between two members of the species complex, only a subset of genes maintained allelic segregation despite evidence of ongoing gene flow in other genes. The overlap in these analyses was arginine kinase (AK and apolipoprotein A-1 binding protein (APBP. These genes represent two of the first examples of sperm maturation, capacitation, and motility proteins with fixed non-synonymous substitutions between species-specific alleles that may lead to postmating prezygotic isolation. Both genes express ejaculate proteins transferred to females during copulation and were previously identified through comparative proteomics. We discuss the potential function of these genes in the context of the specific postmating prezygotic isolation phenotype among our species, namely conspecific sperm precedence and the superior ability of

  20. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  1. Ciliate telomerase RNA loop IV nucleotides promote hierarchical RNP assembly and holoenzyme stability.

    Science.gov (United States)

    Robart, Aaron R; O'Connor, Catherine M; Collins, Kathleen

    2010-03-01

    Telomerase adds simple-sequence repeats to chromosome 3' ends to compensate for the loss of repeats with each round of genome replication. To accomplish this de novo DNA synthesis, telomerase uses a template within its integral RNA component. In addition to providing the template, the telomerase RNA subunit (TER) also harbors nontemplate motifs that contribute to the specialized telomerase catalytic cycle of reiterative repeat synthesis. Most nontemplate TER motifs function through linkage with the template, but in ciliate and vertebrate telomerases, a stem-loop motif binds telomerase reverse transcriptase (TERT) and reconstitutes full activity of the minimal recombinant TERT+TER RNP, even when physically separated from the template. Here, we resolve the functional requirements for this motif of ciliate TER in physiological RNP context using the Tetrahymena thermophila p65-TER-TERT core RNP reconstituted in vitro and the holoenzyme reconstituted in vivo. Contrary to expectation based on assays of the minimal recombinant RNP, we find that none of a panel of individual loop IV nucleotide substitutions impacts the profile of telomerase product synthesis when reconstituted as physiological core RNP or holoenzyme RNP. However, loop IV nucleotide substitutions do variably reduce assembly of TERT with the p65-TER complex in vitro and reduce the accumulation and stability of telomerase RNP in endogenous holoenzyme context. Our results point to a unifying model of a conformational activation role for this TER motif in the telomerase RNP enzyme.

  2. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    Science.gov (United States)

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  3. Mutations of different molecular origins exhibit contrasting patterns of regional substitution rate variation.

    Directory of Open Access Journals (Sweden)

    Navin Elango

    2008-02-01

    Full Text Available Transitions at CpG dinucleotides, referred to as "CpG substitutions", are a major mutational input into vertebrate genomes and a leading cause of human genetic disease. The prevalence of CpG substitutions is due to their mutational origin, which is dependent on DNA methylation. In comparison, other single nucleotide substitutions (for example those occurring at GpC dinucleotides mainly arise from errors during DNA replication. Here we analyzed high quality BAC-based data from human, chimpanzee, and baboon to investigate regional variation of CpG substitution rates. We show that CpG substitutions occur approximately 15 times more frequently than other single nucleotide substitutions in primate genomes, and that they exhibit substantial regional variation. Patterns of CpG rate variation are consistent with differences in methylation level and susceptibility to subsequent deamination. In particular, we propose a "distance-decaying" hypothesis, positing that due to the molecular mechanism of a CpG substitution, rates are correlated with the stability of double-stranded DNA surrounding each CpG dinucleotide, and the effect of local DNA stability may decrease with distance from the CpG dinucleotide.Consistent with our "distance-decaying" hypothesis, rates of CpG substitution are strongly (negatively correlated with regional G+C content. The influence of G+C content decays as the distance from the target CpG site increases. We estimate that the influence of local G+C content extends up to 1,500 approximately 2,000 bps centered on each CpG site. We also show that the distance-decaying relationship persisted when we controlled for the effect of long-range homogeneity of nucleotide composition. GpC sites, in contrast, do not exhibit such "distance-decaying" relationship. Our results highlight an example of the distinctive properties of methylation-dependent substitutions versus substitutions mostly arising from errors during DNA replication. Furthermore

  4. Molecular evolution of GB virus B hepatitis virus during acute resolving and persistent infections in experimentally infected tamarins

    DEFF Research Database (Denmark)

    Takikawa, Shingo; Engle, Ronald E; Faulk, Kristina N

    2010-01-01

    (-3) substitutions per site year(-1) during weeks 1-52 and 53-104, respectively. Thus, there was a significant decrease in evolution over time, as found for hepatitis C virus. The rate of non-synonymous substitution per non-synonymous site compared with that of synonymous substitution per synonymous site decreased...

  5. Fluorinated Nucleotide Modifications Modulate Allele Selectivity of SNP-Targeting Antisense Oligonucleotides

    Directory of Open Access Journals (Sweden)

    Michael E. Østergaard

    2017-06-01

    Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.

  6. N-substituted iminodiacetic acids

    International Nuclear Information System (INIS)

    Nunn, A.; Loberg, M.

    1982-01-01

    The chemical preparation of several new N-substituted iminodiacetic acid derivatives are described. These compounds when complexed with sup(99m)Tc provide useful radiopharmaceuticals for the external imaging of the hepatobiliary system. (U.K.)

  7. Commercial formalin substitutes for histopathology

    DEFF Research Database (Denmark)

    Prentø, P; Lyon, H

    1997-01-01

    We compared the performance of six commercial fixatives proposed to be formalin substitutes with the performance of buffered formalin, Clarke's ethanol-acetic acid, and ethanol, using rat liver, small intestine, and kidney. We investigated the rate of penetration, mode of fixation, extent of prot...... was obtained by combining formalin fixation with antigen retrieval. We conclude that none of the proposed commercial substitutes for buffered formalin are adequate for critical histology or histopathology....

  8. Stores, Prices, and Currency Substitution

    OpenAIRE

    Gabriele, Camera; Winkler, Johannes

    1999-01-01

    We study endogenous currency substitution in a decentralized trade environment. Sellers maximize profits from sales of imperfectly substitutable goods by posting prices in either one of two currencies. A unique symmetric equilibrium exists where goods are priced only in the local currency. This occurs if foreign trade is sporadic, there is sufficient but not excessive liquidity, and discounting is low. Excess or scarcity of liquidity, however, induces sellers to extract all surplus from bu...

  9. Substitution reactions of technetium complexes

    International Nuclear Information System (INIS)

    Omori, T.

    1997-01-01

    Substitution reactions of a series of technetium complexes are considered in comparison with corresponding reactions of rhenium. Rhenium and technetium complexes are rather inert in substitution reactions, the latter are characterized by greater rate constants when they proceed according to dissociative mechanism. In rare cases when k Tc /k Re id little it is assumed that the reaction proceeds according to the associative mechanism. (author)

  10. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  11. Pitfalls of the most commonly used models of context dependent substitution

    Directory of Open Access Journals (Sweden)

    Huttley Gavin A

    2008-12-01

    Full Text Available Abstract Background Neighboring nucleotides exert a striking influence on mutation, with the hypermutability of CpG dinucleotides in many genomes being an exemplar. Among the approaches employed to measure the relative importance of sequence neighbors on molecular evolution have been continuous-time Markov process models for substitutions that treat sequences as a series of independent tuples. The most widely used examples are the codon substitution models. We evaluated the suitability of derivatives of the nucleotide frequency weighted (hereafter NF and tuple frequency weighted (hereafter TF models for measuring sequence context dependent substitution. Critical properties we address are their relationships to an independent nucleotide process and the robustness of parameter estimation to changes in sequence composition. We then consider the impact on inference concerning dinucleotide substitution processes from application of these two forms to intron sequence alignments from primates. Results We prove that the NF form always nests the independent nucleotide process and that this is not true for the TF form. As a consequence, using TF to study context effects can be misleading, which is shown by both theoretical calculations and simulations. We describe a simple example where a context parameter estimated under TF is confounded with composition terms unless all sequence states are equi-frequent. We illustrate this for the dinucleotide case by simulation under a nucleotide model, showing that the TF form identifies a CpG effect when none exists. Our analysis of primate introns revealed that the effect of nucleotide neighbors is over-estimated under TF compared with NF. Parameter estimates for a number of contexts are also strikingly discordant between the two model forms. Conclusion Our results establish that the NF form should be used for analysis of independent-tuple context dependent processes. Although neighboring effects in general are

  12. Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

    Energy Technology Data Exchange (ETDEWEB)

    Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.

    2016-12-21

    Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.

  13. Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.

    Science.gov (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2017-04-01

    For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  14. Modelling functional and structural impact of non-synonymous ...

    African Journals Online (AJOL)

    ... that could affect protein function and structure. Further wet-lab confirmatory analysis in a pathological association study involving a larger population of goats is required at the DQA1 locus. This would lay a sound foundation for breeding disease-resistant individuals in the future. Keywords: Goats, in silico, mutants, protein, ...

  15. Modelling functional and structural impact of non-synonymous ...

    African Journals Online (AJOL)

    Dr. Abdulmojeed

    2017-02-03

    Feb 3, 2017 ... Based on the PANTHER, PROVEAN and PolyPhen-2 algorithms, there .... ProSA returns a z-score that indicates overall model quality based ..... atomic-style geometrical figures into the computational protocol. Bioinformatics ...

  16. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  17. Approaches in Substitution of Organic Solvents

    DEFF Research Database (Denmark)

    Jacobsen, Thomas

    2000-01-01

    In substitution of harmful chemicals or products with less harmful or harmless ones, there are different approaches according to the different situations, the technical requirements to the substitutes, and the goals for the substitution. Three different cases are presented. The substitution process...

  18. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  19. 40 CFR 721.2577 - Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Copper complex of (substituted... Copper complex of (substituted sulfonaphthyl azo substituted phenyl) disulfonaphthyl azo, amine salt... substances identified generically as copper complex of (substituted sulfonaphthyl azo substituted phenyl...

  20. Substituted decision making: elder guardianship.

    Science.gov (United States)

    Leatherman, Martha E; Goethe, Katherine E

    2009-11-01

    The goal of this column is to help experienced clinicians navigate the judicial system when they are confronted with requests for capacity evaluations that involve guardianship (conservatorship). The interface between the growing elderly medical population and increasing requests for substituted decision making is becoming more complex. This column will help practicing psychiatrists understand the medical, legal, and societal factors involved in adult guardianship. Such understanding is necessary in order to effectively perform guardianship evaluations and adequately inform courts, patients, and families about the psychiatric diagnoses central to substituted decision making.

  1. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  2. Substitution determination of Fmoc‐substituted resins at different wavelengths

    Science.gov (United States)

    Kley, Markus; Bächle, Dirk; Loidl, Günther; Meier, Thomas; Samson, Daniel

    2017-01-01

    In solid‐phase peptide synthesis, the nominal batch size is calculated using the starting resin substitution and the mass of the starting resin. The starting resin substitution constitutes the basis for the calculation of a whole set of important process parameters, such as the number of amino acid derivative equivalents. For Fmoc‐substituted resins, substitution determination is often performed by suspending the Fmoc‐protected starting resin in 20% (v/v) piperidine in DMF to generate the dibenzofulvene–piperidine adduct that is quantified by ultraviolet–visible spectroscopy. The spectrometric measurement is performed at the maximum absorption wavelength of the dibenzofulvene–piperidine adduct, that is, at 301.0 nm. The recorded absorption value, the resin weight and the volume are entered into an equation derived from Lambert–Beer's law, together with the substance‐specific molar absorption coefficient at 301.0 nm, in order to calculate the nominal substitution. To our knowledge, molar absorption coefficients between 7100 l mol−1 cm−1 and 8100 l mol−1 cm−1 have been reported for the dibenzofulvene–piperidine adduct at 301.0 nm. Depending on the applied value, the nominal batch size may differ up to 14%. In this publication, a determination of the molar absorption coefficients at 301.0 and 289.8 nm is reported. Furthermore, proof is given that by measuring the absorption at 289.8 nm the impact of wavelength accuracy is reduced. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd. PMID:28635051

  3. Substitution determination of Fmoc-substituted resins at different wavelengths.

    Science.gov (United States)

    Eissler, Stefan; Kley, Markus; Bächle, Dirk; Loidl, Günther; Meier, Thomas; Samson, Daniel

    2017-10-01

    In solid-phase peptide synthesis, the nominal batch size is calculated using the starting resin substitution and the mass of the starting resin. The starting resin substitution constitutes the basis for the calculation of a whole set of important process parameters, such as the number of amino acid derivative equivalents. For Fmoc-substituted resins, substitution determination is often performed by suspending the Fmoc-protected starting resin in 20% (v/v) piperidine in DMF to generate the dibenzofulvene-piperidine adduct that is quantified by ultraviolet-visible spectroscopy. The spectrometric measurement is performed at the maximum absorption wavelength of the dibenzofulvene-piperidine adduct, that is, at 301.0 nm. The recorded absorption value, the resin weight and the volume are entered into an equation derived from Lambert-Beer's law, together with the substance-specific molar absorption coefficient at 301.0 nm, in order to calculate the nominal substitution. To our knowledge, molar absorption coefficients between 7100 l mol -1  cm -1 and 8100 l mol -1  cm -1 have been reported for the dibenzofulvene-piperidine adduct at 301.0 nm. Depending on the applied value, the nominal batch size may differ up to 14%. In this publication, a determination of the molar absorption coefficients at 301.0 and 289.8 nm is reported. Furthermore, proof is given that by measuring the absorption at 289.8 nm the impact of wavelength accuracy is reduced. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd. © 2017 The Authors Journal of Peptide Science published by European Peptide Society and John Wiley & Sons Ltd.

  4. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  5. Behavioral service substitution (Chapter 9)

    NARCIS (Netherlands)

    Stahl, C.; Aalst, van der W.M.P.; Bouguettaya, A.; Sheng, Q.Z.; Daniel, F.

    2014-01-01

    Service-oriented design supports system evolution and encourages reuse and modularization. A key ingredient of service orientation is the ability to substitute one service by another without reconfiguring the overall system. This chapter aims to give an overview of the state of the art and open

  6. prismane structure by silicon substitution

    Indian Academy of Sciences (India)

    Using the second-order Møller–Plesset perturbation (MP2) theoretic method and the cc-pVDZ basis set, it is shown that with an increase in the number of carbon atoms substituted by silicon, the [6]-prismane structure becomes increasingly more stable, relative to the two isolated benzene (like) structures. A similar trend is ...

  7. Story of skeletally substituted benzenes

    Indian Academy of Sciences (India)

    Unknown

    values are extensively used to define aromaticity quantitatively.3 In a recent study on ... studies were directed to unravel the subtle ways in which the stability, reactivity, and ..... The singlet–triplet gaps of all the skeletally substituted benzenes ...

  8. Complete genome analysis of dengue virus type 3 isolated from the 2013 dengue outbreak in Yunnan, China.

    Science.gov (United States)

    Wang, Xiaodan; Ma, Dehong; Huang, Xinwei; Li, Lihua; Li, Duo; Zhao, Yujiao; Qiu, Lijuan; Pan, Yue; Chen, Junying; Xi, Juemin; Shan, Xiyun; Sun, Qiangming

    2017-06-15

    In the past few decades, dengue has spread rapidly and is an emerging disease in China. An unexpected dengue outbreak occurred in Xishuangbanna, Yunnan, China, resulting in 1331 patients in 2013. In order to obtain the complete genome information and perform mutation and evolutionary analysis of causative agent related to this largest outbreak of dengue fever. The viruses were isolated by cell culture and evaluated by genome sequence analysis. Phylogenetic trees were then constructed by Neighbor-Joining methods (MEGA6.0), followed by analysis of nucleotide mutation and amino acid substitution. The analysis of the diversity of secondary structure for E and NS1 protein were also performed. Then selection pressures acting on the coding sequences were estimated by PAML software. The complete genome sequences of two isolated strains (YNSW1, YNSW2) were 10,710 and 10,702 nucleotides in length, respectively. Phylogenetic analysis revealed both strain were classified as genotype II of DENV-3. The results indicated that both isolated strains of Xishuangbanna in 2013 and Laos 2013 stains (KF816161.1, KF816158.1, LC147061.1, LC147059.1, KF816162.1) were most similar to Bangladesh (AY496873.2) in 2002. After comparing with the DENV-3SS (H87) 62 amino acid substitutions were identified in translated regions, and 38 amino acid substitutions were identified in translated regions compared with DENV-3 genotype II stains Bangladesh (AY496873.2). 27(YNSW1) or 28(YNSW2) single nucleotide changes were observed in structural protein sequences with 7(YNSW1) or 8(YNSW2) non-synonymous mutations compared with AY496873.2. Of them, 4 non-synonymous mutations were identified in E protein sequences with (2 in the β-sheet, 2 in the coil). Meanwhile, 117(YNSW1) or 115 (YNSW2) single nucleotide changes were observed in non-structural protein sequences with 31(YNSW1) or 30 (YNSW2) non-synonymous mutations. Particularly, 14 single nucleotide changes were observed in NS1 sequences with 4/14 non-synonymous

  9. 40 CFR Appendix D to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes

    Science.gov (United States)

    2010-07-01

    ... the following criteria, derived from Society of Automotive Engineers (SAE) standards and recommended... Substitutes] Application Substitute Decision Conditions Comments Electronics Cleaning w/CFC-113 and MCF HFC... Sector [Acceptable Subject to Narrowed Use Limits] Application Substitute Decision Comments Electronics...

  10. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  11. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  12. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  13. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  14. Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

    International Nuclear Information System (INIS)

    Aalto, T.K.; Raivio, K.O.

    1990-01-01

    Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

  15. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl

    2007-01-03

    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  16. Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.

    Science.gov (United States)

    Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris

    2004-07-14

    With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  17. Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†

    Science.gov (United States)

    Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai

    2010-01-01

    Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555

  18. Smart Phones and their Substitutes

    DEFF Research Database (Denmark)

    Bødker, Mads; Gimpel, Gregory; Hedman, Jonas

    2009-01-01

    Drawing on data from a longitudinal field study, this paper investigates the influence of existing, better and stand-alone technology substitutes on the use of smart phones. By applying prospect theory, media richness theory, and business model literature, the purpose of this paper is to improve...... our understanding of the role of substitutes, device content fit issues, and implications for business models by asking the question: What is an effective business model to address the relationship between user preference and the fit of the smart phone and everyday task? The field study data suggest...... the need for business models to recognize that adoption decisions are reference-dependent and strongly influenced by the fit between task and smart phone....

  19. Bone healing and bone substitutes.

    Science.gov (United States)

    Costantino, Peter D; Hiltzik, David; Govindaraj, Satish; Moche, Jason

    2002-02-01

    With the advent of new biomaterials and surgical techniques, the reconstructive surgeon has a wider range of treatment modalities for the rehabilitation and reconstruction of craniofacial skeletal deformities than ever before. These innovative substances act as true bone graft substitutes, thereby allowing the surgeon to avoid the use of autogenous bone grafts and their associated donor site morbidity. Surgeons have long been interested in producing a composite graft that can heal faster by induction, incorporate with surrounding tissues, and be remodeled to resemble native bone. Currently, there are a host of bone graft substitutes available that vary in both their composition and properties. Craniomaxillofacial surgeons must therefore become comfortable with numerous biomaterials to best tailor the treatment for each patient individually. Ongoing investigations into the next phase of tissue engineering will continue to bring us closer to the ability to regenerate or replace bone.

  20. Substituting oil by electric power

    International Nuclear Information System (INIS)

    Lichtenberg, H.

    1981-01-01

    Parting from the development of primary energy use the author refers to the latest investigations and results presented on the 1980 World Energy Conference and with special regard to oil points out the threatening exhaustion of fossil energy resources. Maintaining the economic structure of the Federal Republic of Germany implies an orientation away from oil. Due to its flexible application technology and quasi-inexhaustible energy resources electric power may substantially contribute to oil substitution which as a matter of fact is of particular interest in connection with the heat market. Coal alone cannot substitute both oil and nuclear energy. Thus, the above postulates the use of the latter. Leaving nuclear energy inactive today will effect an increase in the demand for oil the negative consequences of which would weight heavily upon the anyhow unbalanced import/export ratio of the Federal Republic of Germany. (orig.) [de

  1. Substitution of aspartic acid-686 by histidine or asparagine in the human androgen receptor leads to a functionally inactive protein with altered hormone-binding characteristics

    NARCIS (Netherlands)

    Ris-Stalpers, C.; Trifiro, M. A.; Kuiper, G. G.; Jenster, G.; Romalo, G.; Sai, T.; van Rooij, H. C.; Kaufman, M.; Rosenfield, R. L.; Liao, S.

    1991-01-01

    We have identified two different single nucleotide alterations in codon 686 (GAC; aspartic acid) in exon 4 of the human androgen receptor gene in three unrelated families with the complete form of androgen insensitivity. One mutation (G----C) results in an aspartic acid----histidine substitution

  2. 40 CFR 721.4420 - Substituted hydroxylamine.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted hydroxylamine. 721.4420... Substances § 721.4420 Substituted hydroxylamine. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified generically as substituted hydroxylamine (PMN P-84-492) is...

  3. Substituted Indoleacetic Acids Tested in Tissue Cultures

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1978-01-01

    Monochloro substituted IAA inhibited shoot induction in tobacco tissue cultures about as much as IAA. Dichloro substituted IAA inhibited shoot formation less. Other substituted IAA except 5-fluoro- and 5-bromoindole-3-acetic acid were less active than IAA. Callus growth was quite variable...

  4. Substitutes for School Nurses in Illinois

    Science.gov (United States)

    Vollinger, Linda Jeno; Bergren, Martha Dewey; Belmonte-Mann, Frances

    2011-01-01

    The purpose of this descriptive study was to explore utilization of nurse substitutes in the school setting in Illinois. The literature described personnel who staff the school health office in the absence of the school nurse and the barriers to obtaining nurse substitutes. There were no empirical studies conducted on school nurse substitutes in…

  5. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  6. Mutation-selection models of codon substitution and their use to estimate selective strengths on codon usage

    DEFF Research Database (Denmark)

    Yang, Ziheng; Nielsen, Rasmus

    2008-01-01

    Current models of codon substitution are formulated at the levels of nucleotide substitution and do not explicitly consider the separate effects of mutation and selection. They are thus incapable of inferring whether mutation or selection is responsible for evolution at silent sites. Here we impl...... codon usage in mammals. Estimates of selection coefficients nevertheless suggest that selection on codon usage is weak and most mutations are nearly neutral. The sensitivity of the analysis on the assumed mutation model is discussed.......Current models of codon substitution are formulated at the levels of nucleotide substitution and do not explicitly consider the separate effects of mutation and selection. They are thus incapable of inferring whether mutation or selection is responsible for evolution at silent sites. Here we...... implement a few population genetics models of codon substitution that explicitly consider mutation bias and natural selection at the DNA level. Selection on codon usage is modeled by introducing codon-fitness parameters, which together with mutation-bias parameters, predict optimal codon frequencies...

  7. The possible role of human milk nucleotides as sleep inducers.

    Science.gov (United States)

    Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

    2009-02-01

    Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

  8. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  9. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  10. Structure-function relationship of substituted bromomethylcoumarins in nucleoside specificity of RNA alkylation.

    Science.gov (United States)

    Kellner, Stefanie; Kollar, Laura Bettina; Ochel, Antonia; Ghate, Manjunath; Helm, Mark

    2013-01-01

    Selective alkylation of RNA nucleotides is an important field of RNA biochemistry, e.g. in applications of fluorescent labeling or in structural probing experiments, yet detailed structure-function studies of labeling agents are rare. Here, bromomethylcoumarins as reactive compounds for fluorescent labeling of RNA are developed as an attractive scaffold on which electronic properties can be modulated by varying the substituents. Six different 4-bromomethyl-coumarins of various substitution patterns were tested for nucleotide specificity of RNA alkylation using tRNA from Escherichia coli as substrate. Using semi-quantitative LC-MS/MS analysis, reactions at mildly acidic and slightly alkaline pH were compared. For all tested compounds, coumarin conjugates with 4-thiouridine, pseudouridine, guanosine, and uridine were identified, with the latter largely dominating. This data set shows that selectivity of ribonucleotide alkylation depends on the substitution pattern of the reactive dye, and even more strongly on the modulation of the reaction conditions. The latter should be therefore carefully optimized when striving to achieve selectivity. Interestingly, the highest selectivity for labeling of a modified nucleoside, namely of 4-thiouridine, was achieved with a compound whose selectivity was somewhat less dependent on reaction conditions than the other compounds. In summary, bromomethylcoumarin derivatives are a highly interesting class of compounds, since their selectivity for 4-thiouridine can be efficiently tuned by variation of substitution pattern and reaction conditions.

  11. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze; Gehring, Christoph A

    2013-01-01

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

  12. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  13. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  14. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  15. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Science.gov (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

    2011-07-01

    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  17. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  18. Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

    Science.gov (United States)

    Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

    2018-05-01

    Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  20. A universal and label-free impedimetric biosensing platform for discrimination of single nucleotide substitutions in long nucleic acid strands.

    Science.gov (United States)

    Mills, Dawn M; Martin, Christopher P; Armas, Stephanie M; Calvo-Marzal, Percy; Kolpashchikov, Dmitry M; Chumbimuni-Torres, Karin Y

    2018-06-30

    We report a label-free universal biosensing platform for highly selective detection of long nucleic acid strands. The sensor consists of an electrode-immobilized universal stem-loop (USL) probe and two adaptor strands that form a 4J structure in the presence of a specific DNA/RNA analyte. The sensor was characterized by electrochemical impedance spectroscopy (EIS) using K 3 [Fe(CN) 6 ]/K 4 [Fe(CN) 6 ] redox couple in solution. An increase in charge transfer resistance (R CT ) was observed upon 4J structure formation, the value of which depends on the analyte length. Cyclic voltammetry (CV) was used to further characterize the sensor and monitor the electrochemical reaction in conjunction with thickness measurements of the mixed DNA monolayer obtained using spectroscopic ellipsometry. In addition, the electron transfer was calculated at the electrode/electrolyte interface using a rotating disk electrode. Limits of detection in the femtomolar range were achieved for nucleic acid targets of different lengths (22 nt, 60 nt, 200 nt). The sensor produced only a background signal in the presence of single base mismatched analytes, even in hundred times excess in concentration. This label-free and highly selective biosensing platform is versatile and can be used for universal detection of nucleic acids of varied lengths which could revolutionize point of care diagnostics for applications such as bacterial or cancer screening. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Contrasting Patterns of Nucleotide Substitution Rates Provide Insight into Dynamic Evolution of Plastid and Mitochondrial Genomes of Geranium

    OpenAIRE

    Park, Seongjun; Ruhlman, Tracey A.; Weng, Mao-Lun; Hajrah, Nahid H.; Sabir, Jamal S.M.; Jansen, Robert K.

    2017-01-01

    Abstract Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have i...

  2. Examination of the selective pressures on a live PRRS vaccine virus

    DEFF Research Database (Denmark)

    Storgaard, Torben; Oleksiewicz, M.; Bøtner, Anette

    1999-01-01

    of the selective pressure this attenuated virus had experienced during reversion. An analysis of nucleotide mutations showed a similar rate of mutations in the two genes (ORF5 and 7). However, non-synonymous mutations in ORF7 were eliminated by purifying selection. In contrast, non-synonymous mutations in ORF5...

  3. Patterns of genomic variation in the poplar rust fungus Melampsora larici-populina identify pathogenesis-related factors

    Directory of Open Access Journals (Sweden)

    Antoine ePersoons

    2014-09-01

    Full Text Available Melampsora larici-populina is a fungal pathogen responsible for foliar rust disease on poplar trees, which causes damage to forest plantations worldwide, particularly in Northern Europe. The reference genome of the isolate 98AG31 was previously sequenced using a whole genome shotgun strategy, revealing a large genome of 101 megabases containing 16,399 predicted genes, which included secreted protein genes representing poplar rust candidate effectors. In the present study, the genomes of 15 isolates collected over the past 20 years throughout the French territory, representing distinct virulence profiles, were characterized by massively parallel sequencing to assess genetic variation in the poplar rust fungus. Comparison to the reference genome revealed striking structural variations. Analysis of coverage and sequencing depth identified large missing regions between isolates related to the mating type loci. More than 611,824 single-nucleotide polymorphism (SNP positions were uncovered overall, indicating a remarkable level of polymorphism. Based on the accumulation of non-synonymous substitutions in coding sequences and the relative frequencies of synonymous and non-synonymous polymorphisms (i.e. PN/PS, we identify candidate genes that may be involved in fungal pathogenesis. Correlation between non-synonymous SNPs in genes encoding secreted proteins and pathotypes of the studied isolates revealed candidate genes potentially related to virulences 1, 6 and 8 of the poplar rust fungus.

  4. Biologic and synthetic skin substitutes: An overview.

    Science.gov (United States)

    Halim, Ahmad Sukari; Khoo, Teng Lye; Mohd Yussof, Shah Jumaat

    2010-09-01

    The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. Skin substitutes have important roles in the treatment of deep dermal and full thickness wounds of various aetiologies. At present, there is no ideal substitute in the market. Skin substitutes can be divided into two main classes, namely, biological and synthetic substitutes. The biological skin substitutes have a more intact extracellular matrix structure, while the synthetic skin substitutes can be synthesised on demand and can be modulated for specific purposes. Each class has its advantages and disadvantages. The biological skin substitutes may allow the construction of a more natural new dermis and allow excellent re-epithelialisation characteristics due to the presence of a basement membrane. Synthetic skin substitutes demonstrate the advantages of increase control over scaffold composition. The ultimate goal is to achieve an ideal skin substitute that provides an effective and scar-free wound healing.

  5. Biologic and synthetic skin substitutes: An overview

    Directory of Open Access Journals (Sweden)

    Halim Ahmad

    2010-10-01

    Full Text Available The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. Skin substitutes have important roles in the treatment of deep dermal and full thickness wounds of various aetiologies. At present, there is no ideal substitute in the market. Skin substitutes can be divided into two main classes, namely, biological and synthetic substitutes. The biological skin substitutes have a more intact extracellular matrix structure, while the synthetic skin substitutes can be synthesised on demand and can be modulated for specific purposes. Each class has its advantages and disadvantages. The biological skin substitutes may allow the construction of a more natural new dermis and allow excellent re-epithelialisation characteristics due to the presence of a basement membrane. Synthetic skin substitutes demonstrate the advantages of increase control over scaffold composition. The ultimate goal is to achieve an ideal skin substitute that provides an effective and scar-free wound healing.

  6. Computational study of cation substitutions in apatites

    International Nuclear Information System (INIS)

    Tamm, Toomas; Peld, Merike

    2006-01-01

    Density-functional theory plane-wave modeling of fluor- and hydroxyapatites has been performed, where one or two calcium ions per unit cell were replaced with cadmium or zinc cations. It was found that cadmium ions favor Ca(1) positions in fluorapatites and Ca(2) positions in hydroxyapatites, in agreement with experiment. A similar pattern is predicted for zinc substitutions. In the doubly substituted cases, where only hydroxyapatites were modeled, a preference for the substituting ions to be located in Ca(2) position was also observed. Displacement of the hydroxide ions from their symmetrical positions on the hexagonal axis can be used to explain the preferred configurations of substituting ions around the axis. -- Deformation of the hydroxide ion chain due to substitutions around the ion channel in substituted hydroxyapatites

  7. The Morishima Gross elasticity of substitution

    OpenAIRE

    Blackorby, Charles; Primont, Daniel; Russell, R. Robert

    2007-01-01

    We show that the Hotelling-Lau elasticity of substitution, an extension of the Allen-Uzawa elasticity to allow for optimal output-quantity (or utility) responses to changes in factor prices, inherits all of the failings of the Allen-Uzawa elasticity identified by Blackorby and Russell [1989 AER]. An analogous extension of the Morishima elasticity of substitution to allow for output quantity changes preserves the salient properties of the original Hicksian notion of elasticity of substitution.

  8. Statistical Physics of Complex Substitutive Systems

    Science.gov (United States)

    Jin, Qing

    Diffusion processes are central to human interactions. Despite extensive studies that span multiple disciplines, our knowledge is limited to spreading processes in non-substitutive systems. Yet, a considerable number of ideas, products, and behaviors spread by substitution; to adopt a new one, agents must give up an existing one. This captures the spread of scientific constructs--forcing scientists to choose, for example, a deterministic or probabilistic worldview, as well as the adoption of durable items, such as mobile phones, cars, or homes. In this dissertation, I develop a statistical physics framework to describe, quantify, and understand substitutive systems. By empirically exploring three collected high-resolution datasets pertaining to such systems, I build a mechanistic model describing substitutions, which not only analytically predicts the universal macroscopic phenomenon discovered in the collected datasets, but also accurately captures the trajectories of individual items in a complex substitutive system, demonstrating a high degree of regularity and universality in substitutive systems. I also discuss the origins and insights of the parameters in the substitution model and possible generalization form of the mathematical framework. The systematical study of substitutive systems presented in this dissertation could potentially guide the understanding and prediction of all spreading phenomena driven by substitutions, from electric cars to scientific paradigms, and from renewable energy to new healthy habits.

  9. Substitution dynamical systems spectral analysis

    CERN Document Server

    Queffélec, Martine

    2010-01-01

    This volume mainly deals with the dynamics of finitely valued sequences, and more specifically, of sequences generated by substitutions and automata. Those sequences demonstrate fairly simple combinatorical and arithmetical properties and naturally appear in various domains. As the title suggests, the aim of the initial version of this book was the spectral study of the associated dynamical systems: the first chapters consisted in a detailed introduction to the mathematical notions involved, and the description of the spectral invariants followed in the closing chapters. This approach, combined with new material added to the new edition, results in a nearly self-contained book on the subject. New tools - which have also proven helpful in other contexts - had to be developed for this study. Moreover, its findings can be concretely applied, the method providing an algorithm to exhibit the spectral measures and the spectral multiplicity, as is demonstrated in several examples. Beyond this advanced analysis, many...

  10. Controversial issues of maternity substitution

    Directory of Open Access Journals (Sweden)

    Andy Pușcă

    2009-06-01

    Full Text Available Substitute maternity consists in a woman carrying a pregnancy (the implant of an embryo, at therequest of a sterile couple, most of the times in exchange of a sum of money, with her commitment tounconditionally give away the newborn after birth to the couple she concluded the agreement with. Manycontroversies emerged in what concerns the contract between the sterile couple and the carrying mother,especially when this contract is by onerous title, which happens in most of the cases. In that a civil contract? Is ita sales contract for the child? Is it a contract to provide services? Is it body marketing? Between total prohibitionand excessive liberalism, the middle way, which is the regulation according to ethical religious, cultural andsocial norms of each community, represents a realistic solution.

  11. Photoelectron Spectroscopy of Substituted Phenylnitrenes

    Science.gov (United States)

    Wijeratne, Neloni R.; Da Fonte, Maria; Wenthold, Paul G.

    2009-06-01

    Nitrenes are unusual molecular structures with unfilled electronic valences that are isoelectronic with carbenes. Although, both can be generated by either thermal or photochemical decomposition of appropriate precursors they usually exhibit different reactivities. In this work, we carry out spectroscopic studies of substituted phenylnitrene to determine how the introduction of substituents will affect the reactivity and its thermochemical properties. All studies were carried out by using the newly constructed time-of-flight negative ion photoelectron spectrometer (NIPES) at Purdue University. The 355 nm photoelectron spectra of the o-, m-, and p-chlorophenyl nitrene anions are fairly similar to that measured for phenylnitrene anion. All spectra show low energy triplet state and a high energy singlet state. The singlet state for the meta isomer is well-resolved, with a well defined origin and observable vibrational structure. Whereas the singlet states for the ortho and para isomers have lower energy onsets and no resolved structure. The isomeric dependence suggests that the geometry differences result from the resonance interaction between the nitrogen and the substituent. Quinoidal resonance structures are possible for the open-shell singlet states of the o- and p-chlorinated phenyl nitrenes. The advantages of this type of electronic structures for the open-shell singlet states is that the unpaired electrons can be more localized on separate atoms in the molecules, minimizing the repulsion between. Because the meta position is not in resonance with the nitrenes, substitution at that position should not affect the structure of the open-shell singlet state. The measured electron affinities (EA) of the triplet phenylnitrenes are in excellent agreement with the values predicted by electronic structure calculations. The largest EA, 1.82 eV is found for the meta isomer, with para being the smallest, 1.70 eV.

  12. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  13. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  14. Defects in maintenance of mitochondrial DNA are associated with intramitochondrial nucleotide imbalances.

    Science.gov (United States)

    Ashley, Neil; Adams, Susan; Slama, Abdelhamid; Zeviani, Massimo; Suomalainen, Anu; Andreu, Antonio L; Naviaux, Robert K; Poulton, Joanna

    2007-06-15

    Defects in mtDNA maintenance range from fatal multisystem childhood diseases, such as Alpers syndrome, to milder diseases in adults, including mtDNA depletion syndromes (MDS) and familial progressive external ophthalmoplegia (AdPEO). Most are associated with defects in genes involved in mitochondrial deoxynucleotide metabolism or utilization, such as mutations in thymidine kinase 2 (TK2) as well as the mtDNA replicative helicase, Twinkle and gamma polymerase (POLG). We have developed an in vitro system to measure incorporation of radiolabelled dNTPs into mitochondria of saponin permeabilized cells. We used this to compare the rates of mtDNA synthesis in cells from 12 patients with diseases of mtDNA maintenance. We observed reduced incorporation of exogenous alpha (32)P-dTTP in fibroblasts from a patient with Alpers syndrome associated with the A467T substitution in POLG, a patient with dGK mutations, and a patient with mtDNA depletion of unknown origin compared to controls. However, incorporation of alpha (32)P-dTTP relative to either cell doubling time or alpha (32)P-dCTP incorporation was increased in patients with thymidine kinase deficiency or PEO as the result of TWINKLE mutations compared with controls. The specific activity of newly synthesized mtDNA depends on the size of the endogenous pool diluting the exogenous labelled nucleotide. Our result is consistent with a deficiency in the intramitochondrial pool of dTTP relative to dCTP in cells from patients with TK2 deficiency and TWINKLE mutations. Such DNA precursor asymmetry could cause pausing of the replication complex and hence exacerbate the propensity for age-related mtDNA mutations. Because deviations from the normal concentrations of dNTPs are known to be mutagenic, we suggest that intramitochondrial nucleotide imbalance could underlie the multiple mtDNA mutations observed in these patients.

  15. Base-By-Base: Single nucleotide-level analysis of whole viral genome alignments

    Directory of Open Access Journals (Sweden)

    Tcherepanov Vasily

    2004-07-01

    Full Text Available Abstract Background With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes is not feasible without new bioinformatics tools. Results A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1 rapidly identify and correct alignment errors in large, multiple genome alignments; and 2 generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs to retrieve detailed annotation information about the aligned genomes or use information from text files. Conclusion Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  16. No variation and low synonymous substitution rates in coral mtDNA despite high nuclear variation

    Directory of Open Access Journals (Sweden)

    Hellberg Michael E

    2006-03-01

    Full Text Available Abstract Background The mitochondrial DNA (mtDNA of most animals evolves more rapidly than nuclear DNA, and often shows higher levels of intraspecific polymorphism and population subdivision. The mtDNA of anthozoans (corals, sea fans, and their kin, by contrast, appears to evolve slowly. Slow mtDNA evolution has been reported for several anthozoans, however this slow pace has been difficult to put in phylogenetic context without parallel surveys of nuclear variation or calibrated rates of synonymous substitution that could permit quantitative rate comparisons across taxa. Here, I survey variation in the coding region of a mitochondrial gene from a coral species (Balanophyllia elegans known to possess high levels of nuclear gene variation, and estimate synonymous rates of mtDNA substitution by comparison to another coral (Tubastrea coccinea. Results The mtDNA surveyed (630 bp of cytochrome oxidase subunit I was invariant among individuals sampled from 18 populations spanning 3000 km of the range of B. elegans, despite high levels of variation and population subdivision for allozymes over these same populations. The synonymous substitution rate between B. elegans and T. coccinea (0.05%/site/106 years is similar to that in most plants, but 50–100 times lower than rates typical for most animals. In addition, while substitutions to mtDNA in most animals exhibit a strong bias toward transitions, mtDNA from these corals does not. Conclusion Slow rates of mitochondrial nucleotide substitution result in low levels of intraspecific mtDNA variation in corals, even when nuclear loci vary. Slow mtDNA evolution appears to be the basal condition among eukaryotes. mtDNA substitution rates switch from slow to fast abruptly and unidirectionally. This switch may stem from the loss of just one or a few mitochondrion-specific DNA repair or replication genes.

  17. Type Substitution for Object-Oriented Programming

    DEFF Research Database (Denmark)

    Schwartzbach, Michael Ignatieff; Palsberg, Jens

    1990-01-01

    Genericity allows the substitution of types in a class. This is usually obtained through parameterized classes, although they are inflexible since any class can be inherited but is not in itself parameterized. We suggest a new genericity mechanism, type substitution, which is a subclassing concep...

  18. Multisensory integration, sensory substitution and visual rehabilitation

    DEFF Research Database (Denmark)

    Proulx, Michael J; Ptito, Maurice; Amedi, Amir

    2014-01-01

    Sensory substitution has advanced remarkably over the past 35 years since first introduced to the scientific literature by Paul Bach-y-Rita. In this issue dedicated to his memory, we describe a collection of reviews that assess the current state of neuroscience research on sensory substitution...

  19. Educators Take Another Look at Substitutes

    Science.gov (United States)

    Zubrzycki, Jaclyn

    2012-01-01

    The mythology surrounding the substitute teacher is not a pretty one: Paper airplanes, lost learning, bullying. But as schools collect more information about teacher absenteeism and its consequences, districts and schools are exploring ways to professionalize substitute teaching--or experiment with alternative ways of coping with teacher absences.…

  20. Substitution between cars within the household

    DEFF Research Database (Denmark)

    De Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    2016-01-01

    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars of different fuel efficiency in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate – for each car owned by the household...... – own and cross-price effects of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, the basic model yielded fuel price elasticities of 0.......98 and 1.41 for the primary and secondary cars, respectively. Accounting for substitution effects, these figures reduce to, respectively, 0.32 and 0.45. Consistent with substitution behaviour, we find that the fuel price elasticity of fuel demand exceeds the elasticity of kilometre demands with respect...

  1. Elasticity of Substitution and Antidumping Measures

    DEFF Research Database (Denmark)

    Drud Hansen, Jørgen; Meinen, Philipp; Nielsen, Jørgen Ulff-Møller

    Abstract This paper analyzes the role of the elasticity of substitution for anti-dumping decisions across countries. In monopolistic competition models with cost heterogeneous firms across countries, price differences vary inversely with the elasticity of substitution. Anti-dumping duties should...... therefore also vary inversely with the elasticity of substitution at least for countries which have a strong focus on prices in the determination of their anti-dumping measures. We test this for ten countries from 1990 to 2009 using data on anti-dumping from Chad Bown (2010) and US-data at 8-digit level...... in our empirical investigation support the predicted role of the elasticity of substitution as we find a significant negative relation between the elasticity of substitution and the final anti-dumping duties for the ‘lesser duty rule’ group of countries. The countries which do not follow the ‘lesser duty...

  2. Simvastatin-induced nocturnal leg pain disappears with pravastatin substitution

    Directory of Open Access Journals (Sweden)

    Stojaković Nataša

    2013-01-01

    Full Text Available Introduction. Statins have similar side effects that do not always occur at the same rate among the various statins. We present a case of simvastatin-induced muscle toxicity that disappeared when pravastatin was substituted for the original drug. Case Outline. A 74-year-old male, a nonsmoker, complained of severe nocturnal leg cramps. The patient also complained that similar painful cramping occurred when he walked rapidly or jogged. Because some components of his lipid panel exceeded the ‘desirable’ range, and as he had a history of myocardial infarction, his family physician prescribed simvastatin (40 mg/day. The patient had taken this medication for the past eight years. The painful nocturnal episodes started two years ago and affected either one or the other leg. Four months ago we discontinued his simvastatin and prescribed pravastatin (80 mg/day. At a follow-up visit six weeks later, the patient reported that his leg pains at night and the pain experienced after brisk walking had disappeared. Four months after the substitution of pravastatin for simvastatin, the patient reported that his complete lack of symptoms had continued. Conclusion. These painful muscle cramps were probably caused by an inadequate vascular supply to the calf and foot muscles. Perhaps a combination of advanced age and atherosclerotic changes created a predisposition for the simvastatin-induced leg cramps. Pravastatin differs from simvastatin in several ways. It is not metabolized by cytochrome P450 (CYP 3A4 oxidases, and thus is not influenced by CYP 3A4 inhibitors like simvastatin. Also, simvastatin is associated with single-nucleotide polymorphisms located within the SLCO1B1 gene on the chromosome 12 and established myopathy, while pravastatin lacks this association. These differences may contribute to increased tolerance to pravastatin in this particular case.

  3. Simvastatin-lnduced nocturnal leg pain disappears with pravastatin substitution.

    Science.gov (United States)

    Stojaković, Natasa; Igić, Rajko

    2013-01-01

    Statins have similar side effects that do not always occur at the same rate among the various statins. We present a case of simvastatin-induced muscle toxicity that disappeared when pravastatin was substituted for the original drug. A 74-year-old male, a nonsmoker, complained of severe nocturnal leg cramps. The patient also complained that similar painful cramping occurred when he walked rapidly or jogged. Because some components of his lipid panel exceeded the'desirable' range, and as he had a history of myocardial infarction, his family physician prescribed simvastatin (40 mg/day). The patient had taken this medication for the past eight years. The painful nocturnal episodes started two years ago and affected either one or the other leg. Four months ago we discontinued his simvastatin and prescribed pravastatin (80 mg/day). At a follow-up visit six weeks later, the patient reported that his leg pains at night and the pain experienced after brisk walking had disappeared. Four months after the substitution of pravastatin for simvastatin, the patient reported that his complete lack of symptoms had continued. These painful muscle cramps were probably caused by an inadequate vascular supply to the calf and foot muscles. Perhaps a combination of advanced age and atherosclerotic changes created a predisposition for the simvastatin-induced leg cramps. Pravastatin differs from simvastatin in several ways.l It is not metabolized by cytochrome P450 (CYP) 3A4 oxidases, and thus is not influenced by CYP 3A4 inhibitors like simvastatin. Also, simvastatin is associated with single-nucleotide polymorphisms located within the SLCO1B1 gene on the chromosome 12 and established myopathy, while pravastatin lacks this association. These differences may contribute to increased tolerance to pravastatin in this particular case.

  4. Substituted Hydroxyapatites with Antibacterial Properties

    Directory of Open Access Journals (Sweden)

    Joanna Kolmas

    2014-01-01

    Full Text Available Reconstructive surgery is presently struggling with the problem of infections located within implantation biomaterials. Of course, the best antibacterial protection is antibiotic therapy. However, oral antibiotic therapy is sometimes ineffective, while administering an antibiotic at the location of infection is often associated with an unfavourable ratio of dosage efficiency and toxic effect. Thus, the present study aims to find a new factor which may improve antibacterial activity while also presenting low toxicity to the human cells. Such factors are usually implemented along with the implant itself and may be an integral part of it. Many recent studies have focused on inorganic factors, such as metal nanoparticles, salts, and metal oxides. The advantages of inorganic factors include the ease with which they can be combined with ceramic and polymeric biomaterials. The following review focuses on hydroxyapatites substituted with ions with antibacterial properties. It considers materials that have already been applied in regenerative medicine (e.g., hydroxyapatites with silver ions and those that are only at the preliminary stage of research and which could potentially be used in implantology or dentistry. We present methods for the synthesis of modified apatites and the antibacterial mechanisms of various ions as well as their antibacterial efficiency.

  5. Substituted Hydroxyapatites with Antibacterial Properties

    Science.gov (United States)

    Kolmas, Joanna; Groszyk, Ewa; Kwiatkowska-Różycka, Dagmara

    2014-01-01

    Reconstructive surgery is presently struggling with the problem of infections located within implantation biomaterials. Of course, the best antibacterial protection is antibiotic therapy. However, oral antibiotic therapy is sometimes ineffective, while administering an antibiotic at the location of infection is often associated with an unfavourable ratio of dosage efficiency and toxic effect. Thus, the present study aims to find a new factor which may improve antibacterial activity while also presenting low toxicity to the human cells. Such factors are usually implemented along with the implant itself and may be an integral part of it. Many recent studies have focused on inorganic factors, such as metal nanoparticles, salts, and metal oxides. The advantages of inorganic factors include the ease with which they can be combined with ceramic and polymeric biomaterials. The following review focuses on hydroxyapatites substituted with ions with antibacterial properties. It considers materials that have already been applied in regenerative medicine (e.g., hydroxyapatites with silver ions) and those that are only at the preliminary stage of research and which could potentially be used in implantology or dentistry. We present methods for the synthesis of modified apatites and the antibacterial mechanisms of various ions as well as their antibacterial efficiency. PMID:24949423

  6. Identification and analysis of Single Nucleotide Polymorphisms (SNPs in the mosquito Anopheles funestus, malaria vector

    Directory of Open Access Journals (Sweden)

    Hemingway Janet

    2007-01-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most common source of genetic variation in eukaryotic species and have become an important marker for genetic studies. The mosquito Anopheles funestus is one of the major malaria vectors in Africa and yet, prior to this study, no SNPs have been described for this species. Here we report a genome-wide set of SNP markers for use in genetic studies on this important human disease vector. Results DNA fragments from 50 genes were amplified and sequenced from 21 specimens of An. funestus. A third of specimens were field collected in Malawi, a third from a colony of Mozambican origin and a third form a colony of Angolan origin. A total of 494 SNPs including 303 within the coding regions of genes and 5 indels were identified. The physical positions of these SNPs in the genome are known. There were on average 7 SNPs per kilobase similar to that observed in An. gambiae and Drosophila melanogaster. Transitions outnumbered transversions, at a ratio of 2:1. The increased frequency of transition substitutions in coding regions is likely due to the structure of the genetic code and selective constraints. Synonymous sites within coding regions showed a higher polymorphism rate than non-coding introns or 3' and 5'flanking DNA with most of the substitutions in coding regions being observed at the 3rd codon position. A positive correlation in the level of polymorphism was observed between coding and non-coding regions within a gene. By genotyping a subset of 30 SNPs, we confirmed the validity of the SNPs identified during this study. Conclusion This set of SNP markers represents a useful tool for genetic studies in An. funestus, and will be useful in identifying candidate genes that affect diverse ranges of phenotypes that impact on vector control, such as resistance insecticide, mosquito behavior and vector competence.

  7. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  8. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  9. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  10. Involvement of cyclic nucleotides in locust flight muscle metabolism

    NARCIS (Netherlands)

    Worm, R.A.A.

    1980-01-01

    1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in

  11. Analysis of single nucleotide polymorphisms in case-control studies.

    Science.gov (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  12. Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy

    NARCIS (Netherlands)

    Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan

    1997-01-01

    The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the

  13. Nucleotide excision repair II: From yeast to mammals

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

  14. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  15. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  16. DNA Nucleotides Detection via capacitance properties of Graphene

    Science.gov (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  17. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  18. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  19. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  20. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  1. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...

  2. Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

    Science.gov (United States)

    Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

    2017-03-01

    Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

  3. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

    2015-09-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

  4. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

    2015-01-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  5. EST-derived SNP discovery and selective pressure analysis in Pacific white shrimp ( Litopenaeus vannamei)

    Science.gov (United States)

    Liu, Chengzhang; Wang, Xia; Xiang, Jianhai; Li, Fuhua

    2012-09-01

    Pacific white shrimp has become a major aquaculture and fishery species worldwide. Although a large scale EST resource has been publicly available since 2008, the data have not yet been widely used for SNP discovery or transcriptome-wide assessment of selective pressure. In this study, a set of 155 411 expressed sequence tags (ESTs) from the NCBI database were computationally analyzed and 17 225 single nucleotide polymorphisms (SNPs) were predicted, including 9 546 transitions, 5 124 transversions and 2 481 indels. Among the 7 298 SNP substitutions located in functionally annotated contigs, 58.4% (4 262) are non-synonymous SNPs capable of introducing amino acid mutations. Two hundred and fifty nonsynonymous SNPs in genes associated with economic traits have been identified as candidates for markers in selective breeding. Diversity estimates among the synonymous nucleotides were on average 3.49 times greater than those in non-synonymous, suggesting negative selection. Distribution of non-synonymous to synonymous substitutions (Ka/Ks) ratio ranges from 0 to 4.01, (average 0.42, median 0.26), suggesting that the majority of the affected genes are under purifying selection. Enrichment analysis identified multiple gene ontology categories under positive or negative selection. Categories involved in innate immune response and male gamete generation are rich in positively selected genes, which is similar to reports in Drosophila and primates. This work is the first transcriptome-wide assessment of selective pressure in a Penaeid shrimp species. The functionally annotated SNPs provide a valuable resource of potential molecular markers for selective breeding.

  6. Evolution of hypothalamus-pituitary growth axis among fish, amphibian, birds and mammals

    Directory of Open Access Journals (Sweden)

    Moaeen-Ud-Din M.

    2015-01-01

    Full Text Available Hypothalamus-pituitary growth axis (HP growth axis regulates animal growth and development in pre-natal and post natal life governed by many factors. However, until recently, the evolutionary history of this axis among lineages is not understood. Aim of the present study was to understand the major events in evolution and evolutionary history and trend of HP growth axis. The diversity among Homo sapience, Mus musculus, Rattus norvegicus, Gallus gallus, Danio rerio and Xenopus laevis was determined for genes involved in HP growth axis in current study. Sequences of HP growth axis genes were retrieved from NCBI (http://www.ncbi.nlm.nih.gov/. Nucleotide diversity using Kimura’s two-parameter method; codon-based test of positive selection using the Nei-Gojobori; equality of evolutionary rate with Tajima's relative rate test and phylogenetic history using the RelTime method were estimated in MEGA6. Estimates of the coefficients of evolutionary differentiation based on nucleotides and amino acids substitution patterns of HP growth axis genes showed contrasting evolutionary patterns among the lineages. The results demonstrated that although these genes might have crucial functional roles in each of the species, however, their sequence divergence did not necessarily reflect similar molecular evolution among the species. Codon-based test of positive selection revealed that Human vs Mouse, Chicken vs Rat, Human vs Rat and Mouse vs Rat had similar and higher non synonymous substitutions (P > 0.05. Higher rate of non-synonymous substitutions at similar orthologs level among species indicated a similar positive selection pressure in these species. Results for relative rate test assessed with the chi-squared test showed difference on unique mutations among lineages at synonymous and non synonymous sites except Chicken vs Mouse, Human vs Mouse, Chicken vs Rat, Human vs Rat and Mouse vs Rat. This indicated that the mutagenic process that generates

  7. Modeling competitive substitution in a polyelectrolyte complex

    International Nuclear Information System (INIS)

    Peng, B.; Muthukumar, M.

    2015-01-01

    We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longer than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution

  8. Determinants of generic drug substitution in Switzerland

    Directory of Open Access Journals (Sweden)

    Lufkin Thomas M

    2011-01-01

    Full Text Available Abstract Background Since generic drugs have the same therapeutic effect as the original formulation but at generally lower costs, their use should be more heavily promoted. However, a considerable number of barriers to their wider use have been observed in many countries. The present study examines the influence of patients, physicians and certain characteristics of the generics' market on generic substitution in Switzerland. Methods We used reimbursement claims' data submitted to a large health insurer by insured individuals living in one of Switzerland's three linguistic regions during 2003. All dispensed drugs studied here were substitutable. The outcome (use of a generic or not was modelled by logistic regression, adjusted for patients' characteristics (gender, age, treatment complexity, substitution groups and with several variables describing reimbursement incentives (deductible, co-payments and the generics' market (prices, packaging, co-branded original, number of available generics, etc.. Results The overall generics' substitution rate for 173,212 dispensed prescriptions was 31%, though this varied considerably across cantons. Poor health status (older patients, complex treatments was associated with lower generic use. Higher rates were associated with higher out-of-pocket costs, greater price differences between the original and the generic, and with the number of generics on the market, while reformulation and repackaging were associated with lower rates. The substitution rate was 13% lower among hospital physicians. The adoption of the prescribing practices of the canton with the highest substitution rate would increase substitution in other cantons to as much as 26%. Conclusions Patient health status explained a part of the reluctance to substitute an original formulation by a generic. Economic incentives were efficient, but with a moderate global effect. The huge interregional differences indicated that prescribing behaviours and

  9. Sensory Substitution and Multimodal Mental Imagery.

    Science.gov (United States)

    Nanay, Bence

    2017-09-01

    Many philosophers use findings about sensory substitution devices in the grand debate about how we should individuate the senses. The big question is this: Is "vision" assisted by (tactile) sensory substitution really vision? Or is it tactile perception? Or some sui generis novel form of perception? My claim is that sensory substitution assisted "vision" is neither vision nor tactile perception, because it is not perception at all. It is mental imagery: visual mental imagery triggered by tactile sensory stimulation. But it is a special form of mental imagery that is triggered by corresponding sensory stimulation in a different sense modality, which I call "multimodal mental imagery."

  10. Biologic and synthetic skin substitutes: An overview

    OpenAIRE

    Halim, Ahmad Sukari; Khoo, Teng Lye; Mohd. Yussof, Shah Jumaat

    2010-01-01

    The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. Skin substitutes have important roles in the treatment of deep dermal and full thickness wounds of various aetiologies. At present, there is no ideal substitute in the market. Skin substit...

  11. Estimating the Nucleotide Diversity in Ceratodon purpureus (Ditrichaceae from 218 Conserved Exon-Primed, Intron-Spanning Nuclear Loci

    Directory of Open Access Journals (Sweden)

    Stuart F. McDaniel

    2013-04-01

    Full Text Available Premise of the study: We developed and tested primers for 218 nuclear loci for studying population genetics, phylogeography, and genome evolution in bryophytes. Methods and Results: We aligned expressed sequence tags (ESTs from Ceratodon purpureus to the Physcomitrella patens genome sequence, and designed primers that are homologous to conserved exons but span introns in the P. patens genome. We tested these primers on four isolates from New York, USA; Otavalo, Ecuador; and two laboratory isolates from Austria (WT4 and GG1. The median genome-wide nucleotide diversity was 0.008 substitutions/site, but the range was large (0–0.14, illustrating the among-locus heterogeneity in the species. Conclusions: These loci provide a valuable resource for finely resolved, genome-wide population genetic and species-level phylogenetic analyses of C. purpureus and its relatives.

  12. Allele specific LAMP- gold nanoparticle for characterization of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Fábio Ferreira Carlos

    2017-12-01

    Full Text Available Due to their relevance as disease biomarkers and for diagnostics, screening of single nucleotide polymorphism (SNPs requires simple and straightforward strategies capable to provide results in medium throughput settings. Suitable approaches relying on isothermal amplification techniques have been evolving to substitute the cumbersome and highly specialized PCR amplification detection schemes. Nonetheless, identification of an individual’s genotype still requires sophisticated equipment and laborious methods.Here, we present a low-cost and reliable approach based on the allele specific loop-mediated isothermal amplification (AS-LAMP coupled to ssDNA functionalized gold nanoparticle (Au-nanoprobe colorimetric sequence discrimination. The Au-nanoprobe integration allows for the colorimetric detection of AS-LAMP amplification product that can be easily interpreted in less than 15 min. We targeted a clinical relevant SNP responsible for lactose intolerance (-13910C/T dbSNP rs#: 4988235 to demonstrate its proof of concept and full potential of this novel approach. Keywords: SNP, Isothermal amplification, Gold nanoparticles, Gold nanoprobes, Lactose intolerance

  13. Substitution within the Danish printing industry

    DEFF Research Database (Denmark)

    Larsen, Henrik Fred; Bøg, Carsten

    2009-01-01

    are running a substitution project. A major part of the work has been mapping the presence of chemicals which are potential candidates for substitution (e.g. PBT, CMR, vPvB, EDS) within the Danish printing industry and this work was recently finished. The mapping comprises a combination of a literature study......The implementation of the EU REACH regulation will most probably promote substitution within sectors handling a lot of different chemicals like the printing industry. With the aim of being at the cutting edge of this development the Danish EPA together with the Danish printing industry and IPU...... total 15 substances) were found in the Danish printing industry. This paper presents the results of the mapping of chemical candidates and the first results on preparing for actual substitutions....

  14. Substituted hydroxyapatites for biomedical applications: A review

    Czech Academy of Sciences Publication Activity Database

    Šupová, Monika

    2015-01-01

    Roč. 41, č. 8 (2015), s. 9203-9231 ISSN 0272-8842 Institutional support: RVO:67985891 Keywords : bioapatite * calcium phosphate * hydroxyapatite * substitution Subject RIV: JJ - Other Materials Impact factor: 2.758, year: 2015

  15. Dodecatungstocobaltate and Sn (IV)-Substituted Polyoxometalate ...

    African Journals Online (AJOL)

    NICO

    work metals, or substituting different cations for the protons to make their acidic or neutral ... corrosive materials in comparison with traditional Lewis acids. The importance of .... salt by treatment with potassium chloride. Finally, the cobalt (II).

  16. Questioning nuclear waste substitution: a case study.

    Science.gov (United States)

    Marshall, Alan

    2007-03-01

    This article looks at the ethical quandaries, and their social and political context, which emerge as a result of international nuclear waste substitution. In particular it addresses the dilemmas inherent within the proposed return of nuclear waste owned by Japanese nuclear companies and currently stored in the United Kingdom. The UK company responsible for this waste, British Nuclear Fuels Limited (BNFL), wish to substitute this high volume intermediate-level Japanese-owned radioactive waste for a much lower volume of much more highly radioactive waste. Special focus is given to ethical problems that they, and the UK government, have not wished to address as they move forward with waste substitution. The conclusion is that waste substitution can only be considered an ethical practice if a set of moderating conditions are observed by all parties. These conditions are listed and, as of yet, they are not being observed.

  17. DOES CURRENCY SUBSTITUTION AFFECT EXCHANGE RATE VOLATILITY?

    Directory of Open Access Journals (Sweden)

    Hisao Kumamoto

    2014-10-01

    Full Text Available This study investigates the impacts of the degree of currency substitution on nominal exchange rate volatility in seven countries (Indonesia, the Philippines, the Czech Republic, Hungary, Poland, Argentina, and Peru. We use the Threshold ARCH model to consider the ratchet effect of currency substitution and sample periods in the 2000s, during which time the economies of the sample countries stabilized, while the U.S. dollar and euro depreciated against other major currencies following the recent global financial crisis. The presented empirical analyses show that the degree of currency substitution has significant positive effects on the conditional variance of the depreciation rate of the nominal exchange rate in most sample countries. Moreover, a shock to the depreciation rate of the nominal exchange rate has asymmetric effects on the conditional variance, depending on the sign. One possible explanation for these differential effects is the existence of the ratchet effect of currency substitution.

  18. Development of a diesel substitute fuel

    Energy Technology Data Exchange (ETDEWEB)

    Reiter, Anton; Mair-Zelenka, Philipp [Graz Univ. of Technology (Austria). Inst. of Chemical Engineering and Environmental Technology; Zeymer, Marc [OMV Refining and Marketing GmbH, Vienna (Austria). MRDI-D Product Development and Innovation

    2013-06-01

    Substitute fuels composed of few real chemical compounds are an alternative characterisation approach for conventional fuels as opposed to the traditional pseudo-component method. With the algorithm proposed in this paper the generation of such substitutes will be facilitated and well-established thermodynamic methods can be applied for physical property-data prediction. Based on some quality criteria like true boiling-point curve, liquid density, C/H ratio, or cloud point of a target fuel a surrogate which meets these properties is determined by fitting its composition. The application and capabilities of the algorithm developed are demonstrated by means of an exemplary diesel substitute fuel. The substitute mixture obtained can be generated and used for evaluation of property-prediction methods. Furthermore this approach can help to understand the effects of mixing fossil fuels with biogenic compounds. (orig.)

  19. Mutation analysis of GLDC, AMT and GCSH in cataract captive-bred vervet monkeys (Chlorocebus aethiops).

    Science.gov (United States)

    Chauke, Chesa G; Magwebu, Zandisiwe E; Sharma, Jyoti R; Arieff, Zainunisha; Seier, Jürgen V

    2016-08-01

    Non-ketotic hyperglycinaemia (NKH) is an autosomal recessive inborn error of glycine metabolism characterized by accumulation of glycine in body fluids and various neurological symptoms. This study describes the first screening of NKH in cataract captive-bred vervet monkeys (Chlorocebus aethiops). Glycine dehydrogenase (GLDC), aminomethyltransferase (AMT) and glycine cleavage system H protein (GCSH) were prioritized. Mutation analysis of the complete coding sequence of GLDC and AMT revealed six novel single-base substitutions, of which three were non-synonymous missense and three were silent nucleotide changes. Although deleterious effects of the three amino acid substitutions were not evaluated, one substitution of GLDC gene (S44R) could be disease-causing because of its drastic amino acid change, affecting amino acids conserved in different primate species. This study confirms the diagnosis of NKH for the first time in vervet monkeys with cataracts. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Hyperfine magnetic fields in substituted Finemet alloys

    Energy Technology Data Exchange (ETDEWEB)

    Brzózka, K., E-mail: k.brzozka@uthrad.pl [University of Technology and Humanities in Radom, Department of Physics (Poland); Sovák, P. [P.J. Šafárik University, Institute of Physics (Slovakia); Szumiata, T.; Gawroński, M.; Górka, B. [University of Technology and Humanities in Radom, Department of Physics (Poland)

    2016-12-15

    Transmission Mössbauer spectroscopy was used to determine the hyperfine fields of Finemet-type alloys in form of ribbons, substituted alternatively by Mn, Ni, Co, Al, Zn, V or Ge of various concentration. The comparative analysis of magnetic hyperfine fields was carried out which enabled to understand the role of added elements in as-quenched as well as annealed samples. Moreover, the influence of the substitution on the mean direction of the local hyperfine magnetic field was examined.

  1. Trace maps of general substitutional sequences

    International Nuclear Information System (INIS)

    Kolar, M.; Nori, F.

    1990-01-01

    It is shown that for arbitrary n, there exists a trace map for any n-letter substitutional sequence. Trace maps are explicitly obtained for the well-known circle and Rudin-Shapiro sequences which can be defined by means of substitution rules on three and four letters, respectively. The properties of the two trace maps and their consequences for various spectral properties are briefly discussed

  2. Product portfolio optimization based on substitution

    DEFF Research Database (Denmark)

    Myrodia, Anna; Moseley, A.; Hvam, Lars

    2017-01-01

    The development of production capabilities has led to proliferation of the product variety offered to the customer. Yet this fact does not directly imply increase of manufacturers' profitability, nor customers' satisfaction. Consequently, recent research focuses on portfolio optimization through...... substitution and standardization techniques. However when re-defining the strategic market decisions are characterized by uncertainty due to several parameters. In this study, by using a GAMS optimization model we present a method for supporting strategic decisions on substitution, by quantifying the impact...

  3. Currency Substitution and Inflation in Peru

    OpenAIRE

    Liliana Rojas-Suárez

    1992-01-01

    This paper shows that there is a long-run relationship between the expected rate of depreciation in the black-market-exchange rate and the ratio of domestic to foreign money in Peru; that is, the hypothesis of currency substitution can explain the behavior of real holdings of money in Peru. The paper also shows that, while the importance of currency substitution as a transmission mechanism through which domestic policies affected the dynamics of inflation was relatively small during a period ...

  4. Mutations in the nucleotide binding pocket of MreB can alter cell curvature and polar morphology in Caulobacter.

    Science.gov (United States)

    Dye, Natalie A; Pincus, Zachary; Fisher, Isabelle C; Shapiro, Lucy; Theriot, Julie A

    2011-07-01

    The maintenance of cell shape in Caulobacter crescentus requires the essential gene mreB, which encodes a member of the actin superfamily and the target of the antibiotic, A22. We isolated 35 unique A22-resistant Caulobacter strains with single amino acid substitutions near the nucleotide binding site of MreB. Mutations that alter cell curvature and mislocalize the intermediate filament crescentin cluster on the back surface of MreB's structure. Another subset have variable cell widths, with wide cell bodies and actively growing thin extensions of the cell poles that concentrate fluorescent MreB. We found that the extent to which MreB localization is perturbed is linearly correlated with the development of pointed cell poles and variable cell widths. Further, we find that a mutation to glycine of two conserved aspartic acid residues that are important for nucleotide hydrolysis in other members of the actin superfamily abolishes robust midcell recruitment of MreB but supports a normal rate of growth. These mutant strains provide novel insight into how MreB's protein structure, subcellular localization, and activity contribute to its function in bacterial cell shape. © 2011 Blackwell Publishing Ltd.

  5. Substituting missing data in compositional analysis

    Energy Technology Data Exchange (ETDEWEB)

    Real, Carlos, E-mail: carlos.real@usc.es [Area de Ecologia, Departamento de Biologia Celular y Ecologia, Escuela Politecnica Superior, Universidad de Santiago de Compostela, 27002 Lugo (Spain); Angel Fernandez, J.; Aboal, Jesus R.; Carballeira, Alejo [Area de Ecologia, Departamento de Biologia Celular y Ecologia, Facultad de Biologia, Universidad de Santiago de Compostela, 15782 Santiago de Compostela (Spain)

    2011-10-15

    Multivariate analysis of environmental data sets requires the absence of missing values or their substitution by small values. However, if the data is transformed logarithmically prior to the analysis, this solution cannot be applied because the logarithm of a small value might become an outlier. Several methods for substituting the missing values can be found in the literature although none of them guarantees that no distortion of the structure of the data set is produced. We propose a method for the assessment of these distortions which can be used for deciding whether to retain or not the samples or variables containing missing values and for the investigation of the performance of different substitution techniques. The method analyzes the structure of the distances among samples using Mantel tests. We present an application of the method to PCDD/F data measured in samples of terrestrial moss as part of a biomonitoring study. - Highlights: > Missing values in multivariate data sets must be substituted prior to analysis. > The substituted values can modify the structure of the data set. > We developed a method to estimate the magnitude of the alterations. > The method is simple and based on the Mantel test. > The method allowed the identification of problematic variables in a sample data set. - A method is presented for the assessment of the possible distortions in multivariate analysis caused by the substitution of missing values.

  6. Substituting missing data in compositional analysis

    International Nuclear Information System (INIS)

    Real, Carlos; Angel Fernandez, J.; Aboal, Jesus R.; Carballeira, Alejo

    2011-01-01

    Multivariate analysis of environmental data sets requires the absence of missing values or their substitution by small values. However, if the data is transformed logarithmically prior to the analysis, this solution cannot be applied because the logarithm of a small value might become an outlier. Several methods for substituting the missing values can be found in the literature although none of them guarantees that no distortion of the structure of the data set is produced. We propose a method for the assessment of these distortions which can be used for deciding whether to retain or not the samples or variables containing missing values and for the investigation of the performance of different substitution techniques. The method analyzes the structure of the distances among samples using Mantel tests. We present an application of the method to PCDD/F data measured in samples of terrestrial moss as part of a biomonitoring study. - Highlights: → Missing values in multivariate data sets must be substituted prior to analysis. → The substituted values can modify the structure of the data set. → We developed a method to estimate the magnitude of the alterations. → The method is simple and based on the Mantel test. → The method allowed the identification of problematic variables in a sample data set. - A method is presented for the assessment of the possible distortions in multivariate analysis caused by the substitution of missing values.

  7. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal

    1983-01-01

    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  8. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  9. Importance of specific nucleotides in the folding of the natural form of the hairpin ribozyme.

    Science.gov (United States)

    Wilson, T J; Zhao, Z Y; Maxwell, K; Kontogiannis, L; Lilley, D M

    2001-02-20

    The hairpin ribozyme in its natural context consists of two loops in RNA duplexes that are connected as arms of a four-way helical junction. Magnesium ions induce folding into the active conformation in which the two loops are in proximity. In this study, we have investigated nucleotides that are important to this folding process. We have analyzed the folding in terms of the cooperativity and apparent affinity for magnesium ions as a function of changes in base sequence and functional groups, using fluorescence resonance energy transfer. Our results suggest that the interaction between the loops is the sum of a number of component interactions. Some sequence variants such as A10U, G+1A, and C25U exhibit loss of cooperativity and reduced affinity of apparent magnesium ion binding. These variants are also very impaired in ribozyme cleavage activity. Nucleotides A10, G+1, and C25 thus appear to be essential in creating the conformational environment necessary for ion binding. The double variant G+1A/C25U exhibits a marked recovery of both folding and catalytic activity compared to either individual variant, consistent with the proposal of a triple-base interaction among A9, G+1, and C25 [Pinard, R., Lambert, D., Walter, N. G., Heckman, J. E., Major, F., and Burke, J. M. (1999) Biochemistry 38, 16035-16039]. However, substitution of A9 leads to relatively small changes in folding properties and cleavage activity, and the double variant G+1DAP/C25U (DAP is 2,6-diaminopurine), which could form an isosteric triple-base interaction, exhibits folding and cleavage activities that are both very impaired compared to those of the natural sequence. Our results indicate an important role for a Watson--Crick base pair between G+1 and C25; this may be buttressed by an interaction with A9, but the loss of this has less significant consequences for folding. 2'-Deoxyribose substitution leads to folding with reduced magnesium ion affinity in the following order: unmodified RNA > dA9

  10. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  11. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  12. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  13. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  14. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  16. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John

    2004-04-01

    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  17. Identification of an alternative knockdown resistance (kdr)-like mutation, M918L, and a novel mutation, V1010A, in the Thrips tabaci voltage-gated sodium channel gene.

    Science.gov (United States)

    Wu, Meixiang; Gotoh, Hiroki; Waters, Timothy; Walsh, Douglas B; Lavine, Laura Corley

    2014-06-01

    Knockdown resistance (kdr) has been identified as a main mechanism against pyrethroid insecticides in many arthropod pests including in the onion thrips, Thrips tabaci. To characterize and identify pyrethroid-resistance in onion thrips in Washington state, we conducted insecticide bioassays and sequenced a region of the voltage gated sodium channel gene from several different T. tabaci populations. Field collected Thrips tabaci were found to have large variations in resistance to the pyrethroid insecticide lambda-cyhalothrin. We identified two single nucleotide substitutions in our analysis of a partial sequence of the T. tabaci voltage-gated sodium channel gene. One mutation resulted in the non-synonymous substitution of methionine with leucine (M918L), which is well known to be responsible for super knockdown resistance in some pest species. Another non-synonymous substitution, a valine (GTT) to alanine (GCT) replacement at amino acid 1010 (V1010A) was identified in our study and was associated with lambda-cyhalothrin resistance. We have characterized a known kdr mutation and identified a novel mutation in the voltage-gated sodium channel gene of Thrips tabaci associated with resistance to lambda-cyhalothrin. This gene region and these mutations are expected to be useful in the development of a diagnostic test to detect kdr resistance in many onion thrips populations. © 2013 Society of Chemical Industry.

  18. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  19. Identification of physicochemical selective pressure on protein encoding nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Sainudiin Raazesh

    2006-03-01

    Full Text Available Abstract Background Statistical methods for identifying positively selected sites in protein coding regions are one of the most commonly used tools in evolutionary bioinformatics. However, they have been limited by not taking the physiochemical properties of amino acids into account. Results We develop a new codon-based likelihood model for detecting site-specific selection pressures acting on specific physicochemical properties. Nonsynonymous substitutions are divided into substitutions that differ with respect to the physicochemical properties of interest, and those that do not. The substitution rates of these two types of changes, relative to the synonymous substitution rate, are then described by two parameters, γ and ω respectively. The new model allows us to perform likelihood ratio tests for positive selection acting on specific physicochemical properties of interest. The new method is first used to analyze simulated data and is shown to have good power and accuracy in detecting physicochemical selective pressure. We then re-analyze data from the class-I alleles of the human Major Histocompatibility Complex (MHC and from the abalone sperm lysine. Conclusion Our new method allows a more flexible framework to identify selection pressure on particular physicochemical properties.

  20. [Guidelines for substitution treatments in prison populations].

    Science.gov (United States)

    Michel, L; Maguet, O

    2005-01-01

    Care access for the drug addict patients in prison (in particular for the treatments of substitution) in France is very unequal from one establishment to another. This reflects the great variability of the practices of substitution and especially the absence of consensus on the methods of adaptation of these practices to the prison environment. Because of difficulties expressed by prisoners and medical staff on this subject and of stakes (let us recall that approximately 30% of the prisoners are dependent or abusers of one or more psychoactive substances), the formulation of recommendations or of a good practices guide of substitution in prison appeared necessary. Work that we detail here answers a ordering of the Advisory Commission of the Treatments of Substitution (September 2001) whose authors are members. It was presented at the session April 2003. It results from the confrontation of a review of the literature (including legal texts and official reports concerning substitution, the organization of the care in prison environment and the lawful framework), with a vast investigation. The latter was carried out near medical staff (22 prisons), penitentiary staff (3 prisons, 27 people met including directors of these establishments) and prisoners (7 establishments, 28 prisoners met) in the form of individual talks (semi-directing interviews with evaluation of the type of existing device and its knowledge by the penitentiary staff and the prisoners; statement of the suggestions, needs and requests of the medical, penitentiary staffs and of the prisoners). In the whole visited prisons, 7.8% (870) of the prisoners received substitution treatments (6.35% by buprenorphine, 1.44% by methadone), representing a proportion of substituted drug addicts (870 substituted for an evaluation of 3,350 prisoners drug addicts among the 11,168 prisoners of the 22 visited prisons) notably lower than that in free environment (56%, ie 96,000 substituted for an evaluated population of

  1. Amino Acid Substitution in Trichophyton rubrum Squalene Epoxidase Associated with Resistance to Terbinafine

    Science.gov (United States)

    Osborne, Colin S.; Leitner, Ingrid; Favre, Bertrand; Ryder, Neil S.

    2005-01-01

    There has only been one clinically confirmed case of terbinafine resistance in dermatophytes, where six sequential Trichophyton rubrum isolates from the same patient were found to be resistant to terbinafine and cross-resistant to other squalene epoxidase (SE) inhibitors. Microsomal SE activity from these resistant isolates was insensitive to terbinafine, suggesting a target-based mechanism of resistance (B. Favre, M. Ghannoum, and N. S. Ryder, Med. Mycol. 42:525-529, 2004). In this study, we have characterized at the molecular level the cause of the resistant phenotype of these clinical isolates. Cloning and sequencing of the SE gene and cDNA from T. rubrum revealed the presence of an intron in the gene and an open reading frame encoding a protein of 489 residues, with an equivalent similarity (57%) to both yeast and mammalian SEs. The nucleotide sequences of SE from two terbinafine-susceptible strains were identical whereas those of terbinafine-resistant strains, serially isolated from the same patient, each contained the same single missense introducing the amino acid substitution L393F. Introduction of the corresponding substitution in the Candida albicans SE gene (L398F) and expression of this gene in Saccharomyces cerevisiae conferred a resistant phenotype to the transformants when compared to those expressing the wild-type sequence. Terbinafine resistance in these T. rubrum clinical isolates appears to be due to a single amino acid substitution in SE. PMID:15980358

  2. Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

    International Nuclear Information System (INIS)

    Vetter, I.R.; Reinstein, J.; Roesch, P.

    1990-01-01

    One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

  3. AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

    DEFF Research Database (Denmark)

    Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg

    2009-01-01

    is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

  4. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  5. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. 40 CFR Appendix B to Subpart G of... - Substitutes Subject to Use Restrictions and Unacceptable Substitutes

    Science.gov (United States)

    2010-07-01

    ... demonstrate it can be used safely in this end-use. CFC-12 Motor Vehicle Air Conditioners (Retrofit and New... Conditions Application Substitute Decision Conditions Comments CFC-12 Automobile Motor Vehicle Air... refrigerant. CFC-12 Automobile Motor Vehicle Air Conditioning (New equipment only) R-152a as a substitute for...

  7. Optimal ordering quantities for substitutable deteriorating items under joint replenishment with cost of substitution

    Science.gov (United States)

    Mishra, Vinod Kumar

    2017-09-01

    In this paper we develop an inventory model, to determine the optimal ordering quantities, for a set of two substitutable deteriorating items. In this inventory model the inventory level of both items depleted due to demands and deterioration and when an item is out of stock, its demands are partially fulfilled by the other item and all unsatisfied demand is lost. Each substituted item incurs a cost of substitution and the demands and deterioration is considered to be deterministic and constant. Items are order jointly in each ordering cycle, to take the advantages of joint replenishment. The problem is formulated and a solution procedure is developed to determine the optimal ordering quantities that minimize the total inventory cost. We provide an extensive numerical and sensitivity analysis to illustrate the effect of different parameter on the model. The key observation on the basis of numerical analysis, there is substantial improvement in the optimal total cost of the inventory model with substitution over without substitution.

  8. Single Nucleotide Polymorphisms of Gene and Association with Non-specific Digestive Disorder in Rabbit

    Directory of Open Access Journals (Sweden)

    Yun-Fu Liu

    2013-08-01

    Full Text Available The NLRP12 (NLR family, pyrin domain containing 12 serves as a suppressor factor in the inflammatory response and protects the host against inflammation-induced damage. In the present study, we aimed to study the polymorphisms of NLRP12 gene and its association with susceptibility to non-specific digestive disorder (NSDD in rabbits. We re-sequenced the entire coding region of the rabbit NLRP12 gene and detected a total of 19 SNPs containing 14 synonymous and five non-synonymous variations. Among them, the coding SNP (c.1682A>G, which would carry a potential functional implication, was subsequently subjected to genotyping for case-control association study (272 cases and 267 controls. The results revealed that allele A was significantly protective against NSDD with an odds ratio value of 0.884 (95% confidence interval, 0.788 to 0.993; p = 0.038. We also experimentally induced NSDD in growing rabbits by feeding a fibre-deficient diet and subsequently investigated NLRP12 mRNA expression. The mRNA expression of NLRP12 in healthy status was significantly higher than that in severe NSDD (p = 0.0016. The highest expression was observed in individuals carrying the protective genotype AA (p = 0.0108. These results suggested that NLRP12 was significantly associated with the NSDD in rabbits. However, the precise molecular mechanism of NLRP12 involving in the development of rabbit NSDD requires further research.

  9. [Contingency management in opioid substitution treatment].

    Science.gov (United States)

    Specka, M; Böning, A; Scherbaum, N

    2011-07-01

    The majority of opiate-dependent patients in substitution treatment show additional substance-related disorders. Concomitant use of heroin, alcohol, benzodiazepines or cocaine compromises treatment success. Concomitant drug use may be treated by using contingency management (CM) which is based on learning theory. In CM, abstinence from drugs, as verified by drug screenings, is reinforced directly and contingently. Reinforcers used in CM studies with substituted patients were, amongst others, vouchers and take-home privileges. Studies in the USA show a medium average effect of CM on drug consumption rates and abstinence. The effects decrease markedly after the end of the intervention. We discuss whether CM is applicable within the German substitution treatment system and how it can be combined with other interventions such as selective detoxification treatments or cognitive-behavioural programmes. © Georg Thieme Verlag KG Stuttgart · New York.

  10. Biomaterials in search of a meniscus substitute.

    Science.gov (United States)

    Rongen, Jan J; van Tienen, Tony G; van Bochove, Bas; Grijpma, Dirk W; Buma, Pieter

    2014-04-01

    The menisci fulfill key biomechanical functions in the tibiofemoral (knee) joint. Unfortunately meniscal injuries are quite common and most often treated by (partial) meniscectomy. However, some patients experience enduring symptoms, and, more importantly, it leads to an increased risk for symptomatic osteoarthritis. Over the past decades, researchers have put effort in developing a meniscal substitute able to prevent osteoarthritis and treat enduring clinical symptoms. Grossly, two categories of substitutes are observed: First, a resorbable scaffold mimicking biomechanical function which slowly degrades while tissue regeneration and organization is promoted. Second, a non resorbable, permanent implant which mimics the biomechanical function of the native meniscus. Numerous biomaterials with different (material) properties have been used in order to provide such a substitute. Nevertheless, a clinically applicable cartilage protecting material is not yet emerged. In the current review we provide an overview, and discuss, these different materials and extract recommendations regarding material properties for future developmental research. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Substitution between Cars within the Household

    DEFF Research Database (Denmark)

    de Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    In this paper we study the demand for car kilometres in two-car households, focusing on the substitution between cars in response to fuel price changes. We use a large sample of detailed Danish data on two-car households to estimate—for each car owned by the household—own and cross-price effects...... of increases in fuel costs per kilometre. The empirical results show that failure to capture substitution between cars within the household can result in substantial misspecification biases. Ignoring substitution, we estimate fuel price elasticities of –0.81 and -0.65 for the primary and secondary cars...... efficient car, finding partial support for the underlying hypothesis. More importantly, the results of this extended model emphasize the importance of behavioural differences related to the position of the most fuel efficient car in the household, suggesting that households’ fuel efficiency choices...

  12. Substitute energy resource policy in Japan

    International Nuclear Information System (INIS)

    Umehara, Katsuhiko

    1980-01-01

    Japan depends 88% of energy resources and 99.8% of petroleum on imports. The solution of energy problems is now made internationally. As the means for Japan, there are the substitution of other resources for petroleum and its promotion. However, this involves the considerable funds for the development and utilization, which must be borne by the people in the form of tax. For governmental financing, a special account must be set up for the particular purpose. In the research and development of new energy resources, new institution is required. The following matters are described: petroleum shortage coming even in 1980s, the international need of substitute energy development, the need for establishing measures for substitute energy resources, acquisition of the funds, special-account governmental financing, and an institute of new energy development. (author)

  13. Substituting telecommunications for travel - Feasible or desirable

    Science.gov (United States)

    Van Vleck, E. M.

    1974-01-01

    This paper reviews recent advances in telecommunications and examines the detailed structure of travel to estimate the feasibility of substituting telecommunications for various travel objectives. The impact of travel is analyzed from a social, economic, energy, and pollution standpoint to assess the desirability of substitution. Perhaps 35-50% of the nation's travel could, in theory, be replaced by very advanced telecommunications (such as a much improved large-screen teleconferencing network), but public resistance would be massive. Much economic dislocation would result since, for example, over 25% of retail sales are travel-related. The energy savings would be modest since only 25% of the nation's energy is consumed by transportation. However, all pollution would be reduced substantially since transportation accounts for 75% of the carbon monoxide, 60% of the hydrocarbon, and 55% of the nitrogen oxide pollution in the nation. Problems related to the implementation of large-scale substitution are discussed.

  14. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  15. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  16. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  17. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  18. SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.

    Science.gov (United States)

    Singer, Maxine; Winocour, Ernest

    2011-04-10

    The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. A New Substitution Cipher - Random-X

    Directory of Open Access Journals (Sweden)

    Falguni Patel

    2015-08-01

    Full Text Available Ciphers are the encryption methods to prepare the algorithm for encryption and decryption. The currently known ciphers are not strong enough to protect the data. A new substitution cipher Random-X that we introduce in this paper can be used for password encryption and data encryption. Random-X cipher is a unique substitution cipher which replaces the units of plaintext with triplets of letters. The beauty of this cipher is that the encrypted string of the same plain text is not always same. This makes it strong and difficult to crack. This paper covers the principle the implementation ideas and testing of Random-X cipher.

  20. Hydrophosphorylation of substituted alkynes by phosphonic acids

    International Nuclear Information System (INIS)

    Nifant'ev, E.F.; Solovetskaya, L.A.; Maslennikova, V.I.; Sergeev, N.M.

    1987-01-01

    Hydrophosphorylation of functionally substituted alkynes by phosphonic acids can be a convenient method for synthesis of functionally substituted mono- and diphosphine oxides. The ease of hydrophosphorylation is determined by the strength of the negative inductive effect of the substituents on the triple bond and the steric factor. The structure of the bis-adducts was confirmed by elementary analysis and the 31 P and 13 C NMR spectra. The 31 P NMR spectrum is an AB two-spin system. The values of the chemical shifts and spin-spin interaction constants 3 J/sub PP/ are in agreement with the data in the literature for similar compounds

  1. Substitution between cars within the household

    DEFF Research Database (Denmark)

    De Borger, Bruno; Mulalic, Ismir; Rouwendal, Jan

    The purpose of this paper is to study to what extent two-car households substitute the use of their less fuel efficient car by the use of their more fuel efficient car after an increase in fuel prices. Based on a simple theoretical framework we use a large sample of detailed Danish data on two-car...... households to estimate, for each car owned by the household, own and cross-price effects of increases in fuel costs per kilometer. The empirical results point at important substitution effects, so that models that estimate responses to fuel prices on the implicit or explicit assumption of one car per...

  2. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

    Science.gov (United States)

    E, Chao; Duan, Baogen; Yu, Jin

    2017-04-20

    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  3. Identification of Four Novel Synonymous Substitutions in the X-Linked Genes Neuroligin 3 and Neuroligin 4X in Japanese Patients with Autistic Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Kumiko Yanagi

    2012-01-01

    Full Text Available Mutations in the X-linked genes neuroligin 3 (NLGN3 and neuroligin 4X (NLGN4X were first implicated in the pathogenesis of X-linked autism in Swedish families. However, reports of mutations in these genes in autism spectrum disorder (ASD patients from various ethnic backgrounds present conflicting results regarding the etiology of ASD, possibly because of genetic heterogeneity and/or differences in their ethnic background. Additional mutation screening study on another ethnic background could help to clarify the relevance of the genes to ASD. We scanned the entire coding regions of NLGN3 and NLGN4X in 62 Japanese patients with ASD by polymerase chain reaction-high-resolution melting curve and direct sequencing analyses. Four synonymous substitutions, one in NLGN3 and three in NLGN4X, were identified in four of the 62 patients. These substitutions were not present in 278 control X-chromosomes from unrelated Japanese individuals and were not registered in the database of Single Nucleotide Polymorphisms build 132 or in the Japanese Single Nucleotide Polymorphisms database, indicating that they were novel and specific to ASD. Though further analysis is necessary to determine the physiological and clinical importance of such substitutions, the possibility of the relevance of both synonymous and nonsynonymous substitutions with the etiology of ASD should be considered.

  4. Removal of misincorporated ribonucleotides from prokaryotic genomes: an unexpected role for nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Alexandra Vaisman

    2013-11-01

    Full Text Available Stringent steric exclusion mechanisms limit the misincorporation of ribonucleotides by high-fidelity DNA polymerases into genomic DNA. In contrast, low-fidelity Escherichia coli DNA polymerase V (pol V has relatively poor sugar discrimination and frequently misincorporates ribonucleotides. Substitution of a steric gate tyrosine residue with alanine (umuC_Y11A reduces sugar selectivity further and allows pol V to readily misincorporate ribonucleotides as easily as deoxynucleotides, whilst leaving its poor base-substitution fidelity essentially unchanged. However, the mutability of cells expressing the steric gate pol V mutant is very low due to efficient repair mechanisms that are triggered by the misincorporated rNMPs. Comparison of the mutation frequency between strains expressing wild-type and mutant pol V therefore allows us to identify pathways specifically directed at ribonucleotide excision repair (RER. We previously demonstrated that rNMPs incorporated by umuC_Y11A are efficiently removed from DNA in a repair pathway initiated by RNase HII. Using the same approach, we show here that mismatch repair and base excision repair play minimal back-up roles in RER in vivo. In contrast, in the absence of functional RNase HII, umuC_Y11A-dependent mutagenesis increases significantly in ΔuvrA, uvrB5 and ΔuvrC strains, suggesting that rNMPs misincorporated into DNA are actively repaired by nucleotide excision repair (NER in vivo. Participation of NER in RER was confirmed by reconstituting ribonucleotide-dependent NER in vitro. We show that UvrABC nuclease-catalyzed incisions are readily made on DNA templates containing one, two, or five rNMPs and that the reactions are stimulated by the presence of mispaired bases. Similar to NER of DNA lesions, excision of rNMPs proceeds through dual incisions made at the 8(th phosphodiester bond 5' and 4(th-5(th phosphodiester bonds 3' of the ribonucleotide. Ribonucleotides misinserted into DNA can therefore be

  5. Shifts in the evolutionary rate and intensity of purifying selection between two Brassica genomes revealed by analyses of orthologous transposons and relics of a whole genome triplication.

    Science.gov (United States)

    Zhao, Meixia; Du, Jianchang; Lin, Feng; Tong, Chaobo; Yu, Jingyin; Huang, Shunmou; Wang, Xiaowu; Liu, Shengyi; Ma, Jianxin

    2013-10-01

    Recent sequencing of the Brassica rapa and Brassica oleracea genomes revealed extremely contrasting genomic features such as the abundance and distribution of transposable elements between the two genomes. However, whether and how these structural differentiations may have influenced the evolutionary rates of the two genomes since their split from a common ancestor are unknown. Here, we investigated and compared the rates of nucleotide substitution between two long terminal repeats (LTRs) of individual orthologous LTR-retrotransposons, the rates of synonymous and non-synonymous substitution among triplicated genes retained in both genomes from a shared whole genome triplication event, and the rates of genetic recombination estimated/deduced by the comparison of physical and genetic distances along chromosomes and ratios of solo LTRs to intact elements. Overall, LTR sequences and genic sequences showed more rapid nucleotide substitution in B. rapa than in B. oleracea. Synonymous substitution of triplicated genes retained from a shared whole genome triplication was detected at higher rates in B. rapa than in B. oleracea. Interestingly, non-synonymous substitution was observed at lower rates in the former than in the latter, indicating shifted densities of purifying selection between the two genomes. In addition to evolutionary asymmetry, orthologous genes differentially regulated and/or disrupted by transposable elements between the two genomes were also characterized. Our analyses suggest that local genomic and epigenomic features, such as recombination rates and chromatin dynamics reshaped by independent proliferation of transposable elements and elimination between the two genomes, are perhaps partially the causes and partially the outcomes of the observed inter-specific asymmetric evolution. © 2013 Purdue University The Plant Journal © 2013 John Wiley & Sons Ltd.

  6. Exponential decay of GC content detected by strand-symmetric substitution rates influences the evolution of isochore structure.

    Science.gov (United States)

    Karro, J E; Peifer, M; Hardison, R C; Kollmann, M; von Grünberg, H H

    2008-02-01

    The distribution of guanine and cytosine nucleotides throughout a genome, or the GC content, is associated with numerous features in mammals; understanding the pattern and evolutionary history of GC content is crucial to our efforts to annotate the genome. The local GC content is decaying toward an equilibrium point, but the causes and rates of this decay, as well as the value of the equilibrium point, remain topics of debate. By comparing the results of 2 methods for estimating local substitution rates, we identify 620 Mb of the human genome in which the rates of the various types of nucleotide substitutions are the same on both strands. These strand-symmetric regions show an exponential decay of local GC content at a pace determined by local substitution rates. DNA segments subjected to higher rates experience disproportionately accelerated decay and are AT rich, whereas segments subjected to lower rates decay more slowly and are GC rich. Although we are unable to draw any conclusions about causal factors, the results support the hypothesis proposed by Khelifi A, Meunier J, Duret L, and Mouchiroud D (2006. GC content evolution of the human and mouse genomes: insights from the study of processed pseudogenes in regions of different recombination rates. J Mol Evol. 62:745-752.) that the isochore structure has been reshaped over time. If rate variation were a determining factor, then the current isochore structure of mammalian genomes could result from the local differences in substitution rates. We predict that under current conditions strand-symmetric portions of the human genome will stabilize at an average GC content of 30% (considerably less than the current 42%), thus confirming that the human genome has not yet reached equilibrium.

  7. Substituting freshwater: Can ocean desalination and water recycling capacities substitute for groundwater depletion in California?

    Science.gov (United States)

    Badiuzzaman, Pierre; McLaughlin, Eoin; McCauley, Darren

    2017-12-01

    While the sustainability of resource depletion is a longstanding environmental concern, wider attention has recently been given to growing water scarcity and groundwater depletion. This study seeks to test the substitutability assumption embedded in weak sustainability indicators using a case study of Californian water supply. The volume of groundwater depletion is used as a proxy for unsustainable water consumption, and defined by synthesising existing research estimates into low, medium and high depletion baselines. These are compared against projected water supply increases from ocean desalination and water recycling by 2035, to determine whether new, drought-proof water sources can substitute for currently unsustainable groundwater consumption. Results show that the maximum projected supply of new water, 2.47 million acre-feet per year (MAF/yr), is sufficient to meet low depletion estimates of 2.02 MAF/yr, but fails to come near the high depletion estimate of 3.44 MAF/yr. This does not necessarily indicate physical limitations of substitutability, but more so socio-economic limitations influenced by high comparative costs. By including capacities in demand-substitutability via urban water conservation, maximum predicted capacities reach 5.57 MAF/yr, indicating wide room for substitution. Based on these results, investment in social and institutional capital is an important factor to enhance demand-side substitutability of water and other natural resources, which has been somewhat neglected by the literature on the substitutability of natural resources. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1988-01-01

    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

  9. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis

    2018-03-01

    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  10. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  11. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A; Turek, Ilona S.

    2017-01-01

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  12. Modification of synthesis nucleotides [γ-32P] ATP

    International Nuclear Information System (INIS)

    Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti

    2013-01-01

    In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  13. Nucleobases, nucleosides, and nucleotides: versatile biomolecules for generating functional nanomaterials.

    Science.gov (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2018-02-21

    The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.

  14. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Manganiello, V.C.

    1988-01-01

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  15. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  16. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  17. Nonrandom Distribution of miRNAs Genes and Single Nucleotide Variants in Keratoconus Loci.

    Directory of Open Access Journals (Sweden)

    Dorota M Nowak

    Full Text Available Despite numerous studies, the causes of both development and progression of keratoconus remain elusive. Previous studies of this disorder focused mainly on one or two genetic factors only. However, in the analysis of such complex diseases all potential factors should be taken into consideration. The purpose of this study was a comprehensive analysis of known keratoconus loci to uncover genetic factors involved in this disease causation in the general population, which could be omitted in the original studies. In this investigation genomic data available in various databases and experimental own data were assessed. The lists of single nucleotide variants and miRNA genes localized in reported keratoconus loci were obtained from Ensembl and miRBase, respectively. The potential impact of nonsynonymous amino acid substitutions on protein structure and function was assessed with PolyPhen-2 and SIFT. For selected protein genes the ranking was made to choose those most promising for keratoconus development. Ranking results were based on topological features in the protein-protein interaction network. High specificity for the populations in which the causative sequence variants have been identified was found. In addition, the possibility of links between previously analyzed keratoconus loci was confirmed including miRNA-gene interactions. Identified number of genes associated with oxidative stress and inflammatory agents corroborated the hypothesis of their effect on the disease etiology. Distribution of the numerous sequences variants within both exons and mature miRNA which forces you to search for a broader look at the determinants of keratoconus. Our findings highlight the complexity of the keratoconus genetics.

  18. Identification of Functional Single-Nucleotide Polymorphisms Affecting Leaf Hair Number in Brassica rapa.

    Science.gov (United States)

    Zhang, Wenting; Mirlohi, Shirin; Li, Xiaorong; He, Yuke

    2018-06-01

    Leaf traits affect plant agronomic performance; for example, leaf hair number provides a morphological indicator of drought and insect resistance. Brassica rapa crops have diverse phenotypes, and many B. rapa single-nucleotide polymorphisms (SNPs) have been identified and used as molecular markers for plant breeding. However, which SNPs are functional for leaf hair traits and, therefore, effective for breeding purposes remains unknown. Here, we identify a set of SNPs in the B. rapa ssp. pekinenesis candidate gene BrpHAIRY LEAVES1 ( BrpHL1 ) and a number of SNPs of BrpHL1 in a natural population of 210 B. rapa accessions that have hairy, margin-only hairy, and hairless leaves. BrpHL1 genes and their orthologs and paralogs have many SNPs. By intensive mutagenesis and genetic transformation, we selected the functional SNPs for leaf hairs by the exclusion of nonfunctional SNPs and the orthologous and paralogous genes. The residue tryptophan-92 of BrpHL1a was essential for direct interaction with GLABROUS3 and, thus, necessary for the formation of leaf hairs. The accessions with the functional SNP leading to substitution of the tryptophan-92 residue had hairless leaves. The orthologous BrcHL1b from B. rapa ssp. chinensis regulates hair formation on leaf margins rather than leaf surfaces. The selected SNP for the hairy phenotype could be adopted as a molecular marker for insect resistance in Brassica spp. crops. Moreover, the procedures optimized here can be used to explain the molecular mechanisms of natural variation and to facilitate the molecular breeding of many crops. © 2018 American Society of Plant Biologists. All rights reserved.

  19. P. Electricity demand, substitution and resources

    International Nuclear Information System (INIS)

    1976-01-01

    This report discusses the demand for electricity in New Zealand, the accuracy of demand predictions, and whether some other form of energy could be substituted for electricity. It then discusses past and possible future electricity generation in New Zealand by geothermal steam and hydro power and the resources of gas and coal that could be made available for electricity generation

  20. Endogenous cueing attenuates object substitution masking.

    Science.gov (United States)

    Germeys, Filip; Pomianowska, I; De Graef, P; Zaenen, P; Verfaillie, K

    2010-07-01

    Object substitution masking (OSM) is a form of visual masking in which a briefly presented target surrounded by four small dots is masked by the continuing presence of the four dots after target offset. A major parameter in the prediction of OSM is the time required for attention to be directed to the target following its onset. Object substitution theory (Di Lollo et al. in J Exp Psychol Gen 129:481-507, 2000) predicts that the sooner attention can be focused at the target's location, the less masking will ensue. However, recently Luiga and Bachmann (Psychol Res 71:634-640, 2007) presented evidence that precueing of attention to the target location prior to target-plus-mask onset by means of a central (endogenous) arrow cue does not reduce OSM. When attention was cued exogenously, OSM was attenuated. Based on these results, Luiga and Bachmann argued that object substitution theory should be adapted by differentiating the ways of directing attention to the target location. The goal of the present study was to further examine the dissociation between the effects of endogenous and exogenous precueing on OSM. Contrary to Luiga and Bachmann, our results show that prior shifts of attention to the target location initiated by both exogenous and endogenous cues reduce OSM as predicted by object substitution theory and its computational model CMOS.

  1. Substitute fluid examinations for liquid manure

    Directory of Open Access Journals (Sweden)

    Schrader Kevin

    2017-01-01

    Full Text Available For the farming industry it is essential to use liquid manure as natural fertilizer. Through new agricultural regulation 2015 in Germany the industry must develop new liquid manure spreader systems because the ammonia and methane emission are limited. In a research project the University of Applied Sciences Zwickau and some other industry partners will develop such a new innovative liquid manure spreader. The new liquid manure spreader should use pulsating air to distribute the liquid manure exactly. The pulsating air, which flows through the pipelines, should be analysed at a test station. For examinations at this test station it is important to find another substitute fluid because liquid manure smells strong, is not transparent and is also not homogeneous enough for scientific investigations. Furthermore it is important to ensure that the substitute fluid is, like liquid manure, a non-Newtonian fluid. The substitute fluid must be a shear-thinning substance - this means the viscosity decrease at higher shear rate. Many different samples like soap-water-farragoes, jelly-water-farragoes, agar-water-farragoes, soap-ethanol-farragoes and more are, for the project, examined in regard of their physical properties to find the best substitute fluid. The samples are examined at the rotational viscometer for viscosity at various shear rates and then compared with the viscosity values of liquid manure.

  2. Substitute fluid examinations for liquid manure

    Science.gov (United States)

    Schrader, Kevin; Riedel, Marco; Eichert, Helmut

    For the farming industry it is essential to use liquid manure as natural fertilizer. Through new agricultural regulation 2015 in Germany the industry must develop new liquid manure spreader systems because the ammonia and methane emission are limited. In a research project the University of Applied Sciences Zwickau and some other industry partners will develop such a new innovative liquid manure spreader. The new liquid manure spreader should use pulsating air to distribute the liquid manure exactly. The pulsating air, which flows through the pipelines, should be analysed at a test station. For examinations at this test station it is important to find another substitute fluid because liquid manure smells strong, is not transparent and is also not homogeneous enough for scientific investigations. Furthermore it is important to ensure that the substitute fluid is, like liquid manure, a non-Newtonian fluid. The substitute fluid must be a shear-thinning substance - this means the viscosity decrease at higher shear rate. Many different samples like soap-water-farragoes, jelly-water-farragoes, agar-water-farragoes, soap-ethanol-farragoes and more are, for the project, examined in regard of their physical properties to find the best substitute fluid. The samples are examined at the rotational viscometer for viscosity at various shear rates and then compared with the viscosity values of liquid manure.

  3. Trace maps for arbitrary substitution sequences

    International Nuclear Information System (INIS)

    Avishai, Y.

    1993-01-01

    The discovery of quasi-crystals and their 1-dimensional modeling have led to a deep mathematical study of Schroedinger operators with an arbitrary deterministic potential sequence. In this work we address this problem and find trace maps for an arbitrary substitution sequence. our trace maps have lower dimensionality than those of Kolar and Nori, which make them quite attractive for actual applications. (authors)

  4. Fossil Fuels, Backstop Technologies, and Imperfect Substitution

    NARCIS (Netherlands)

    van der Meijden, G.C.; Pittel, Karen; van der Ploeg, Frederick; Withagen, Cees

    2014-01-01

    This chapter studies the transition from fossil fuels to backstop technologies in a general equilibrium model in which growth is driven by research and development. The analysis generalizes the existing literature by allowing for imperfect substitution between fossil fuels and the new energy

  5. 3-Substituted 2-phenyl-indoles

    DEFF Research Database (Denmark)

    Johansson, Karl Henrik; Jørgensen, T.B.; Gloriam, D.E.

    2013-01-01

    -indoles with a variety of substituents at the indole 3-position. Herein we describe the development of optimised and efficient synthetic routes to a series of new 2-phenyl-indole building blocks 3 to 9 and show that these can be used to generate a broad variety of 3-substituted 2-phenyl-indoles of interest to medicinal...

  6. Law of substitution for mixed arrays

    International Nuclear Information System (INIS)

    Koudelka, A.J.

    1987-01-01

    The nuclear safety justification of a mixed array of dissimilar fissile units of metal units and dilute solution units, according to Clayton, has been a persistent and nagging problem. Dissimilar uranium metal or dissimilar uranium solution units in a mixed array can also create a modeling nightmare for the nuclear criticality safety engineer. Now, a calculational method known as the Law of Substitution has been developed to ensure that the k/sub eff/ of an array of uranium metal and uranium solution units will satisfy any k/sub eff/ limit set by the nuclear safety engineer. The nuclear criticality safety engineer can utilize the Law of Substitution to safely mix or substitute different uranium metal units, different uranium solution units, and more importantly, uranium metal and dilute UO 2 solution units in an array. The Law of Substitution is as follows: (1) calculate the k/sub eff/ of each unit type in its own infinite planar array. (2) Determine the edge-to-edge spacing of the infinite planar array of each type of unit to satisfy a desired k/sub eff/. (3) Select the largest edge-to-edge spacing from among the similar units in their infinite planar arrays and use that spacing for the finite or infinite planar array of mixed units

  7. Thermal stability of 4-substituted benzenediazonium tetrafluoroborates

    International Nuclear Information System (INIS)

    Bruner, V.Ya.

    1990-01-01

    Heating of tetraborates of 4-methyl-, 4-phenyl- and 4-dimethylaminobenzenediazonium at 95, 120 and 148 deg, correspondingly, causes their autocatalytic destruction, two moles of gas (nitrogen, boron fluoride) being liberated. The thermal stability of 4-substituted benzenediazonium tetrafluoroborates increases with the increase of the electron-donor activity of the substituent at benzene ring

  8. complexes based on meso-substituted dipyrrins

    Indian Academy of Sciences (India)

    Keywords. Coordination polymers; meso-substituted dipyrrins; heteroleptic; acetylacetonato; ... Room temperature magnetic susceptibility measurements were ... After cooling to ambient tem- perature it ... crystals of 1 were obtained from CH2Cl2/ hexane (1. : 1) solution. .... are air-stable, crystalline solids, soluble in common.

  9. Facile Synthesis of N -Substituted Benzimidazoles

    NARCIS (Netherlands)

    Kurhade, Santosh; Rossetti, Arianna; Dömling, Alexander

    2016-01-01

    A particularly mild and efficient one-pot synthesis of N-substituted benzimidazole derivatives was developed. 2-Fluoro-5-nitrophenylisocyanide reacts with a diverse set of primary amines to afford the respective products in moderate to very good yield (35-95%; 20 examples).

  10. Symptomatic hemorrhagic complications associated with dural substitutes

    Directory of Open Access Journals (Sweden)

    Po-Yuan Chen

    2018-01-01

    Conclusion: The increased risk of hemorrhagic complications associated with craniotomy is modified by choice of dural replacement. Our results could assist clinicians in their decision-making with respect to the optimal timing for synthetic dural substitutes in patients with tumor infiltration of the patient's dura, severe brain swelling in traumatic brain injury, or a result of shrinkage from exposure and electrocautery.

  11. Stochastic diffusion models for substitutable technological innovations

    NARCIS (Netherlands)

    Wang, L.; Hu, B.; Yu, X.

    2004-01-01

    Based on the analysis of firms' stochastic adoption behaviour, this paper first points out the necessity to build more practical stochastic models. And then, stochastic evolutionary models are built for substitutable innovation diffusion system. Finally, through the computer simulation of the

  12. Ultrasound Promoted Synthesis of Bis(substituted pyrazol-4-ylcarbonyl-Substituted Thioureas

    Directory of Open Access Journals (Sweden)

    Li Xiao

    2009-03-01

    Full Text Available A series of novel bis(substituted pyrazol-4-ylcarbonyl-substituted thioureas have been synthesized by the reactions of substituted pyrazol-4-ylcarbonyl isothiocyanates with different diamines under ultrasound irradiation and classical heating method at 20-25 °C. In general, substantial improvement in rates and modest yields increases were observed when reactions were carried out under sonication, compared with the classical heating method. The structures of these compounds have been elucidated by elemental and spectral (IR, 1H-NMR analysis.

  13. Coupling of the nucleotide incision and 3' {yields} 5' exonuclease activities in Escherichia coli endonuclease IV: Structural and genetic evidences

    Energy Technology Data Exchange (ETDEWEB)

    Golan, Gali [Hebrew University of Jerusalem, Jerusalem 91904 (Israel); Ishchenko, Alexander A. [Groupe Reparation de l' ADN, CNRS UMR 8126, Univ. Paris-Sud, Institut de Cancerologie Gustave Roussy, 39, rue Camille Desmoulins, F-94805 Villejuif Cedex (France); Khassenov, Bekbolat [National Center for Biotechnology, Astana (Kazakhstan); Shoham, Gil, E-mail: gil2@vms.huji.ac.il [Hebrew University of Jerusalem, Jerusalem 91904 (Israel); Saparbaev, Murat K., E-mail: smurat@igr.fr [Groupe Reparation de l' ADN, CNRS UMR 8126, Univ. Paris-Sud, Institut de Cancerologie Gustave Roussy, 39, rue Camille Desmoulins, F-94805 Villejuif Cedex (France)

    2010-03-01

    Aerobic respiration generates reactive oxygen species (ROS) as a by-product of cellular metabolism which can damage DNA. The complex nature of oxidative DNA damage requires actions of several repair pathways. Oxidized DNA bases are substrates for two overlapping pathways: base excision repair (BER) and nucleotide incision repair (NIR). In the BER pathway a DNA glycosylase cleaves the N-glycosylic bond between the abnormal base and deoxyribose, leaving either an abasic site or single-stranded DNA break. Alternatively, in the NIR pathway, an apurinic/apyrimidinic (AP) endonuclease incises duplex DNA 5' next to oxidatively damaged nucleotide. The multifunctional Escherichia coli endonuclease IV (Nfo) is involved in both BER and NIR pathways. Nfo incises duplex DNA 5' of a damaged residue but also possesses an intrinsic 3' {yields} 5' exonuclease activity. Herein, we demonstrate that Nfo-catalyzed NIR and exonuclease activities can generate a single-strand gap at the 5' side of 5,6-dihydrouracil residue. Furthermore, we show that Nfo mutants carrying amino acid substitutions H69A and G149D are deficient in both NIR and exonuclease activities, suggesting that these two functions are genetically linked and governed by the same amino acid residues. The crystal structure of Nfo-H69A mutant reveals the loss of one of the active site zinc atoms (Zn1) and rearrangements of the catalytic site, but no gross changes in the overall enzyme conformation. We hypothesize that these minor changes strongly affect the DNA binding of Nfo. Decreased affinity may lead to a different kinking angle of the DNA helix and this in turn thwart nucleotide incision and exonuclease activities of Nfo mutants but to lesser extent of their AP endonuclease function. Based on the biochemical and genetic data we propose a model where nucleotide incision coupled to 3' {yields} 5' exonuclease activity prevents formation of lethal double-strand breaks when repairing bi

  14. Significant contribution of the 3′→5′ exonuclease activity to the high fidelity of nucleotide incorporation catalyzed by human DNA polymerase ϵ

    Science.gov (United States)

    Zahurancik, Walter J.; Klein, Seth J.; Suo, Zucai

    2014-01-01

    Most eukaryotic DNA replication is performed by A- and B-family DNA polymerases which possess a faithful polymerase activity that preferentially incorporates correct over incorrect nucleotides. Additionally, many replicative polymerases have an efficient 3′→5′ exonuclease activity that excises misincorporated nucleotides. Together, these activities contribute to overall low polymerase error frequency (one error per 106–108 incorporations) and support faithful eukaryotic genome replication. Eukaryotic DNA polymerase ϵ (Polϵ) is one of three main replicative DNA polymerases for nuclear genomic replication and is responsible for leading strand synthesis. Here, we employed pre-steady-state kinetic methods and determined the overall fidelity of human Polϵ (hPolϵ) by measuring the individual contributions of its polymerase and 3′→5′ exonuclease activities. The polymerase activity of hPolϵ has a high base substitution fidelity (10−4–10−7) resulting from large decreases in both nucleotide incorporation rate constants and ground-state binding affinities for incorrect relative to correct nucleotides. The 3′→5′ exonuclease activity of hPolϵ further enhances polymerization fidelity by an unprecedented 3.5 × 102 to 1.2 × 104-fold. The resulting overall fidelity of hPolϵ (10−6–10−11) justifies hPolϵ to be a primary enzyme to replicate human nuclear genome (0.1–1.0 error per round). Consistently, somatic mutations in hPolϵ, which decrease its exonuclease activity, are connected with mutator phenotypes and cancer formation. PMID:25414327

  15. Theileria parva antigens recognized by CD8+ T cells show varying degrees of diversity in buffalo-derived infected cell lines.

    Science.gov (United States)

    Sitt, Tatjana; Pelle, Roger; Chepkwony, Maurine; Morrison, W Ivan; Toye, Philip

    2018-05-06

    The extent of sequence diversity among the genes encoding 10 antigens (Tp1-10) known to be recognized by CD8+ T lymphocytes from cattle immune to Theileria parva was analysed. The sequences were derived from parasites in 23 buffalo-derived cell lines, three cattle-derived isolates and one cloned cell line obtained from a buffalo-derived stabilate. The results revealed substantial variation among the antigens through sequence diversity. The greatest nucleotide and amino acid diversity were observed in Tp1, Tp2 and Tp9. Tp5 and Tp7 showed the least amount of allelic diversity, and Tp5, Tp6 and Tp7 had the lowest levels of protein diversity. Tp6 was the most conserved protein; only a single non-synonymous substitution was found in all obtained sequences. The ratio of non-synonymous: synonymous substitutions varied from 0.84 (Tp1) to 0.04 (Tp6). Apart from Tp2 and Tp9, we observed no variation in the other defined CD8+ T cell epitopes (Tp4, 5, 7 and 8), indicating that epitope variation is not a universal feature of T. parva antigens. In addition to providing markers that can be used to examine the diversity in T. parva populations, the results highlight the potential for using conserved antigens to develop vaccines that provide broad protection against T. parva.

  16. Currency Substitution and Inflation in Peru Currency Substitution and Inflation in Peru

    OpenAIRE

    Liliana Rojas-Suarez

    1992-01-01

    This paper shows that there is a long-run relationship between the expected rate of depreciation in the black-market-exchange rate and the ratio of domestic to foreign money in Peru: that is, the hypothesis of currency substitution can explain the behavior of real holdings of money in Peru. The paper also shows that, while, the importance of currency substitution as a transmission mechanism through which domestic policies affected the dynamics of inflation was relatively small during a period...

  17. Substitution treatment for opioid addicts in Germany

    Directory of Open Access Journals (Sweden)

    Gerlach Ralf

    2007-02-01

    Full Text Available Abstract Background After a long and controversial debate methadone maintenance treatment (MMT was first introduced in Germany in 1987. The number of patients in MMT – first low because of strict admission criteria – increased considerably since the 1990s up to some 65,000 at the end of 2006. In Germany each general practitioner (GP, who has completed an additional training in addiction medicine, is allowed to prescribe substitution drugs to opioid dependent patients. Currently 2,700 GPs prescribe substitution drugs. Psychosocial care should be made available to all MMT patients. Results The results of research studies and practical experiences clearly indicate that patients benefit substantially from MMT with improvements in physical and psychological health. MMT proves successful in attaining high retention rates (65 % to 85 % in the first years, up to 50 % after more than seven years and plays a major role in accessing and maintaining ongoing medical treatment for HIV and hepatitis. MMT is also seen as a vital factor in the process of social re-integration and it contributes to the reduction of drug related harms such as mortality and morbidity and to the prevention of infectious diseases. Some 10 % of MMT patients become drug-free in the long run. Methadone is the most commonly prescribed substitution medication in Germany, although buprenorphine is attaining rising importance. Access to MMT in rural areas is very patchy and still constitutes a problem. There are only few employment opportunities for patients participating in MMT, although regular employment is considered unanimously as a positive factor of treatment success. Substitution treatment in German prisons is heterogeneous in access and treatment modalities. Access is very patchy and the number of inmates in treatment is limited. Nevertheless, substitution treatment plays a substantial part in the health care system provided to drug users in Germany. Conclusion In Germany, a

  18. Substitution treatment for opioid addicts in Germany.

    Science.gov (United States)

    Michels, Ingo Ilja; Stöver, Heino; Gerlach, Ralf

    2007-02-02

    After a long and controversial debate methadone maintenance treatment (MMT) was first introduced in Germany in 1987. The number of patients in MMT--first low because of strict admission criteria--increased considerably since the 1990s up to some 65,000 at the end of 2006. In Germany each general practitioner (GP), who has completed an additional training in addiction medicine, is allowed to prescribe substitution drugs to opioid dependent patients. Currently 2,700 GPs prescribe substitution drugs. Psychosocial care should be made available to all MMT patients. The results of research studies and practical experiences clearly indicate that patients benefit substantially from MMT with improvements in physical and psychological health. MMT proves successful in attaining high retention rates (65% to 85% in the first years, up to 50% after more than seven years) and plays a major role in accessing and maintaining ongoing medical treatment for HIV and hepatitis. MMT is also seen as a vital factor in the process of social re-integration and it contributes to the reduction of drug related harms such as mortality and morbidity and to the prevention of infectious diseases. Some 10% of MMT patients become drug-free in the long run. Methadone is the most commonly prescribed substitution medication in Germany, although buprenorphine is attaining rising importance. Access to MMT in rural areas is very patchy and still constitutes a problem. There are only few employment opportunities for patients participating in MMT, although regular employment is considered unanimously as a positive factor of treatment success. Substitution treatment in German prisons is heterogeneous in access and treatment modalities. Access is very patchy and the number of inmates in treatment is limited. Nevertheless, substitution treatment plays a substantial part in the health care system provided to drug users in Germany. In Germany, a history of substitution treatment spanning 20 years has meanwhile

  19. [The substitution effect of leadership substitutes for transformational leadership in nursing organization].

    Science.gov (United States)

    Kim, Jeong-Hee

    2006-04-01

    This paper was conducted to examine the effects of transformational leadership behaviors, within the substitutes for leadership model (Kerr & Jermier, 1978). Data was collected from 181 staff nurses in 3 general hospitals, with self-reporting questionnaires (MLQ developed by Bass, rd-SLS developed by Podsakoff, et al., and MSQ developed by Weiss, et al.). Descriptive statistics, factor analysis, Cronbach's alpha and moderated regression analysis were used. 1) The transformational leader behaviors and substitutes for leadership each had correlations with job satisfaction. 2) The total amount of variance accounted for by the substitutes for leadership was substantially greater than by the transformational leadership behaviors. 3) Few of the substitutes variables moderated the relationships between the transformational leader behaviors and job satisfaction in a manner consistent with that specified by Howell, Dorfman, and Kerr (1986). The finding of this study suggest that leaders need to have a better understanding of those contextual variables that influence job satisfaction. Thus future research should focus attention on the moderating effects of substitutes, as well as the things that leaders can do to influence them. In addition, it may be good to examine the effects of substitutes on other criterion variables.

  20. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

    2015-01-01

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  1. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    Przybytniak, G.

    2004-01-01

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  2. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

    Science.gov (United States)

    Berti, Lorenzo; Burley, Glenn A.

    2008-02-01

    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  3. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    ) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pheat stress trial (P

  4. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  5. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...

  6. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  7. High pressure {sup 31}P NMR spectroscopy on guanine nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)

    2017-01-15

    The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.

  8. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Science.gov (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  9. SUBSTITUTION OF CADMIUM CYANIDE ELECTROPLATING WITH ZINC CHLORIDE ELECTROPLATING

    Science.gov (United States)

    The study evaluated the zinc chloride electroplating process as a substitute for cadmium cyanide electroplating in the manufacture of industrial connectors and fittings at Aeroquip Corporation. The process substitution eliminates certain wastes, specifically cadmium and cyanide, ...

  10. Convergent synthesis of 6-substituted phenanthridines via anionic ring closure

    DEFF Research Database (Denmark)

    Lysén, M.; Kristensen, Jesper Langgaard; Vedsø, P.

    2002-01-01

    Chemical equation presented The addition of organometallic derivatives to the cyano group of 2-(2-fluorophenyl)benzonitrile followed by intramolecular nucleophilic substitution produces 6-substituted phenanthridines. Alkyllithiums, aryllithiums, and sterically nondemanding lithium amides reacted ...

  11. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  12. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  13. Characterization of hydroxyapatite substituted with silicon

    International Nuclear Information System (INIS)

    Silva, H.M. da; Soares, G.A.; Mateescu, M.; Anselme, K.; Palard, M.; Champion, E.

    2009-01-01

    Incorporation of silicon (Si) ions into hydroxyapatite structure (HA) influences on physical, chemical and physiological properties. Some studies reported the improved bioactivity Si substitution, and it also accelerates the biomineralization process. The main objective of this work is to characterize stoichiometric hydroxyapatite and hydroxyapatite substituted with 1.13% in weight of Si (SiHA) using a wet precipitation method followed by a heat treatment. SEM/EDS, AFM, DRX and FTIR analyses were used to characterize the samples. EDS and FTIR results confirmed the presence of Si. Silicon induces small changes on crystal structure of HA, not detected on X-ray diffraction patterns of sintered tablets of SiHA and HA. No secondary phases were observed, that indicates the Si had entered the HA lattice. (author)

  14. The substitution bias of the consumer price index

    OpenAIRE

    Frenger, Petter

    2006-01-01

    Abstract: The paper uses elementary consumer theory to propose an inflation independent ratio definition of the substitution bias of the Laspeyres consumer price index, and derives an approximate substitution bias which depends on the size of the price change as measured by a norm in the Laspeyres plane and on the elasticity of substitution in the direction of the price change. This norm or distance measure can be interpreted as a price substitution index which yields useful in...

  15. Unemployment, Factor Substitution, and Capital Formation

    OpenAIRE

    Leo Kaas; Leopold von Thadden

    2001-01-01

    We incorporate a wage bargaining structure in a dynamic general equilibrium model and show how this feature changes short and long-run properties of equilibria compared with a perfectly competitive setting. We discuss how employment, capital, and income shares respond to wage setting shocks and show that adjustment dynamics depend decisively on the magnitude of the elasticity of substitution between labour and capital. Values of the elasticity below unity add persistence, tend to preserve sta...

  16. Mindfulness as substitute for transformational leadership

    OpenAIRE

    Kroon, B.; van Woerkom, M.; Menting, Charlotte

    2017-01-01

    Purpose Transformational leaders spark the intrinsic motivation of employees, thereby stimulating their extra-role performance. However, not all employees are lucky enough to have a transformational leader. The purpose of this paper is to investigate to what extent mindfulness can function as a substitute for transformational leadership. By being attentive to and aware of what is taking place in the present, mindfulness provides employees with a source of intrinsic motivation that lies within...

  17. Neutron scattering from a substitutional mass defect

    International Nuclear Information System (INIS)

    Williams, R.D.; Lovesey, S.W.

    1985-06-01

    The dynamic structure factor is calculated for a low concentration of light mass scatterers substituted in a cubic crystal matrix. A new numerical method for the exact calculation is demonstrated. A local density of states for the low momentum transfer limit, and the shifts and widths of the oscillator peaks in the high momentum transfer limit are derived. The limitations of an approximation which decouples the defect from the lattice is discussed. (author)

  18. Substitution biases in price indices during transition

    Czech Academy of Sciences Publication Activity Database

    Hanousek, Jan; Filer, Randall K.

    2004-01-01

    Roč. 21, č. 2 (2004), s. 167-177 ISSN 0167-8000 R&D Projects: GA MŠk ME 595 Institutional research plan: CEZ:AV0Z7085904 Keywords : price liberalization * substitution bias * transition economies Subject RIV: AH - Economics http://search. ebscohost .com/login.aspx?direct=true&db=a9h&AN=17109091&site=ehost-live

  19. Synthesis of 2-azetidinones substituted quinoline derivative

    Directory of Open Access Journals (Sweden)

    Mashelkar Uday C.

    2013-01-01

    Full Text Available Acetanilide is converted into 2-chloro-3-formyl quinoline by reacting with DMF-POCl3 at 80-90ºC and then condensed with aromatic primary amines to give Schiff bases (3a-3c. These Schiff bases are then reacted with acid chlorides in the presence of base in toluene to give 1, 3, 4-substituted 2-azetidinones.

  20. The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

    International Nuclear Information System (INIS)

    Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

    1977-01-01

    In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

  1. Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

    Science.gov (United States)

    Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

    2013-07-01

    Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

  2. Interfuel substitution in the United States

    Energy Technology Data Exchange (ETDEWEB)

    Serletis, Apostolos; Vasetsky, Olexandr [Department of Economics, University of Calgary, Calgary, Alberta (Canada); Timilsina, Govinda R. [Development Research Group, The World Bank, 1818 H Street N.W., Washington, DC 20433 (United States)

    2010-05-15

    In this paper, we use the locally flexible translog functional form to investigate the demand for energy and interfuel substitution in the United States and to provide a comparison of our results with most of the existing empirical energy demand literature. Motivated by the widespread practice of ignoring theoretical regularity, we follow Barnett's (2002) suggestions and estimate the model subject to theoretical regularity, using methods developed by Diewert and Wales (1987) and Ryan and Wales (2000), in an attempt to produce inference consistent with neoclassical microeconomic theory. Moreover, we use the most recent data, published by the U.S. Energy Information Administration (EIA), and in addition to investigating interfuel substitution possibilities in total U.S. energy demand, we follow Serletis et al. (2009) and also examine interfuel substitution possibilities in energy demand by sector. Moreover, we test for weak separability, with the objective of discovering the structure of the functional form in total energy demand as well as energy demand by sector. (author)

  3. 40 CFR 721.4596 - Diazo substituted carbomonocyclic metal complex.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Diazo substituted carbomonocyclic... Specific Chemical Substances § 721.4596 Diazo substituted carbomonocyclic metal complex. (a) Chemical... as a diazo substituted carbomonocyclic metal complex (PMN P-94-1039) is subject to reporting under...

  4. 40 CFR 721.5350 - Substituted nitrile (generic name).

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Substituted nitrile (generic name... Substances § 721.5350 Substituted nitrile (generic name). (a) Chemical substances and significant new uses subject to reporting. (1) The chemical substance identified generically as a substituted nitrile (PMN P-83...

  5. 40 CFR 721.10043 - Dineopentyl-4-substituted phthalate (generic).

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Dineopentyl-4-substituted phthalate... Specific Chemical Substances § 721.10043 Dineopentyl-4-substituted phthalate (generic). (a) Chemical... as dineopentyl-4-substituted phthalate (PMN P-02-697) is subject to reporting under this section for...

  6. Arylazoindazole Photoswitches : Facile Synthesis and Functionalization via SNAr Substitution

    NARCIS (Netherlands)

    Travieso-Puente, Raquel; Budzak, Simon; Chen, Juan; Stacko, Peter; Jastrzebski, Johann T B H; Jacquemin, Denis; Otten, Edwin

    2017-01-01

    A straightforward synthetic route to arylazoindazoles via nucleophilic aromatic substitution is presented. Upon deprotonation of the NH group, a C6F5-substituted formazan undergoes facile cyclization as a result of intermolecular nucleophilic substitution (SNAr). This new class of azo photoswitches

  7. Proportionally more deleterious genetic variation in European than in African populations

    DEFF Research Database (Denmark)

    Lohmueller, Kirk E; Indap, Amit R; Schmidt, Steffen

    2008-01-01

    of functional SNPs considered, including synonymous, non-synonymous, predicted 'benign', predicted 'possibly damaging' and predicted 'probably damaging' SNPs. This result is wholly consistent with previous work showing higher overall levels of nucleotide variation in African populations than in Europeans. EA...... individuals, in contrast, have significantly more genotypes homozygous for the derived allele at synonymous and non-synonymous SNPs and for the damaging allele at 'probably damaging' SNPs than AAs do. For SNPs segregating only in one population or the other, the proportion of non-synonymous SNPs...

  8. Adenine Nucleotide Analogues Locked in a Northern Methanocarba Conformation: Enhanced Stability and Potency as P2Y1 Receptor Agonists

    Science.gov (United States)

    Ravi, R. Gnana; Kim, Hak Sung; Servos, Jörg; Zimmermann, Herbert; Lee, Kyeong; Maddileti, Savitri; Boyer, José L.; Harden, T. Kendall; Jacobson, Kenneth A.

    2016-01-01

    Preference for the Northern (N) ring conformation of the ribose moiety of nucleotide 5′-triphosphate agonists at P2Y1, P2Y2, P2Y4, and P2Y11 receptors, but not P2Y6 receptors, was established using a ring-constrained methanocarba (a 3.1.0-bicyclohexane) ring as a ribose substitute (Kim et al. J. Med. Chem. 2002, 45, 208–218.). We have now combined the ring-constrained (N)-methanocarba modification of adenine nucleotides with other functionalities known to enhance potency at P2 receptors. The potency of the newly synthesized analogues was determined in the stimulation of phospholipase C through activation of turkey erythrocyte P2Y1 or human P2Y1 and P2Y2 receptors stably expressed in astrocytoma cells. An (N)-methanocarba-2-methylthio-ADP analogue displayed an EC50 at the hP2Y1 receptor of 0.40 nM and was 55-fold more potent than the corresponding triphosphate and 16-fold more potent than the riboside 5′-diphosphate. 2-Cl–(N)-methanocarba-ATP and its N6-Me analogue were also highly selective, full agonists at P2Y1 receptors. The (N)-methanocarba-2-methylthio and 2-chloromonophosphate analogues were full agonists exhibiting micromolar potency at P2Y1 receptors, while the corresponding ribosides were inactive. Although β,γ-methylene-ATP was inactive at P2Y receptors, β,γ-methylene-(N)-methanocarba-ATP was a potent hP2Y1 receptor agonist with an EC50 of 160 nM and was selective versus hP2Y2 and hP2Y4 receptors. The rates of hydrolysis of Northern (N) and Southern (S) methanocarba analogues of AMP by rat 5′-ectonucleotidase were negligible. The rates of hydrolysis of the corresponding triphosphates by recombinant rat NTPDase1 and 2 were studied. Both isomers were hydrolyzed by NTPDase 1 at about half the rate of ATP hydrolysis. The (N) isomer was hardly hydrolyzed by NTPDase 2, while the (S) isomer was hydrolyzed at one-third of the rate of ATP hydrolysis. This suggests that new, more stable and selective nucleotide agonists may be designed on the basis of

  9. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  10. Implication of SUMO E3 ligases in nucleotide excision repair.

    Science.gov (United States)

    Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji

    2015-08-01

    Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.

  11. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  12. Myristoylated α subunits of guanine nucleotide-binding regulatory proteins

    International Nuclear Information System (INIS)

    Buss, J.E.; Mumby, S.M.; Casey, P.J.; Gilman, A.G.; Sefton, B.M.

    1987-01-01

    Antisera directed against specific subunits of guanine nucleotide-binding regulatory proteins (G proteins) were used to immunoprecipitate these polypeptides from metabolically labeled cells. This technique detects, in extracts of a human astrocytoma cell line, the α subunits of G/sub s/ (stimulatory) (α 45 and α 52 ), a 41-kDa subunit of G/sub i/ (inhibitory) (α 41 ), a 40-kDa protein (α 40 ), and the 36-kDa β subunit. No protein that comigrated with the α subunit of G 0 (unknown function) (α 39 ) was detected. In cells grown in the presence of [ 3 H]myristic acid, α 41 and α 40 contained 3 H label, while the β subunit did not. Chemical analysis of lipids attached covalently to purified α 41 and α 39 from bovine brain also revealed myristic acid. Similar analysis of brain G protein β and γ subunits and of G/sub t/ (Transducin) subunits (α, β, and γ) failed to reveal fatty acids. The fatty acid associated with α 41 , α 40 , and α 39 was stable to treatment with base, suggesting that the lipid is linked to the polypeptide via an amide bond. These GTP binding proteins are thus identified as members of a select group of proteins that contains myristic acid covalently attached to the peptide backbone. Myristate may play an important role in stabilizing interactions of G proteins with phospholipid or with membrane-bound proteins

  13. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  14. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    International Nuclear Information System (INIS)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp

  15. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  16. Adenine nucleotide translocator transports haem precursors into mitochondria.

    Directory of Open Access Journals (Sweden)

    Motoki Azuma

    2008-08-01

    Full Text Available Haem is a prosthetic group for haem proteins, which play an essential role in oxygen transport, respiration, signal transduction, and detoxification. In haem biosynthesis, the haem precursor protoporphyrin IX (PP IX must be accumulated into the mitochondrial matrix across the inner membrane, but its mechanism is largely unclear. Here we show that adenine nucleotide translocator (ANT, the inner membrane transporter, contributes to haem biosynthesis by facilitating mitochondrial accumulation of its precursors. We identified that haem and PP IX specifically bind to ANT. Mitochondrial uptake of PP IX was inhibited by ADP, a known substrate of ANT. Conversely, ADP uptake into mitochondria was competitively inhibited by haem and its precursors, suggesting that haem-related porphyrins are accumulated into mitochondria via ANT. Furthermore, disruption of the ANT genes in yeast resulted in a reduction of haem biosynthesis by blocking the translocation of haem precursors into the matrix. Our results represent a new model that ANT plays a crucial role in haem biosynthesis by facilitating accumulation of its precursors into the mitochondrial matrix.

  17. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  18. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  19. Domestication rewired gene expression and nucleotide diversity patterns in tomato.

    Science.gov (United States)

    Sauvage, Christopher; Rau, Andrea; Aichholz, Charlotte; Chadoeuf, Joël; Sarah, Gautier; Ruiz, Manuel; Santoni, Sylvain; Causse, Mathilde; David, Jacques; Glémin, Sylvain

    2017-08-01

    Plant domestication has led to considerable phenotypic modifications from wild species to modern varieties. However, although changes in key traits have been well documented, less is known about the underlying molecular mechanisms, such as the reduction of molecular diversity or global gene co-expression patterns. In this study, we used a combination of gene expression and population genetics in wild and crop tomato to decipher the footprints of domestication. We found a set of 1729 differentially expressed genes (DEG) between the two genetic groups, belonging to 17 clusters of co-expressed DEG, suggesting that domestication affected not only individual genes but also regulatory networks. Five co-expression clusters were enriched in functional terms involving carbohydrate metabolism or epigenetic regulation of gene expression. We detected differences in nucleotide diversity between the crop and wild groups specific to DEG. Our study provides an extensive profiling of the rewiring of gene co-expression induced by the domestication syndrome in one of the main crop species. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  20. Nucleotide diversity and linkage disequilibrium in five Lolium perenne genes with putative role in shoot branching

    DEFF Research Database (Denmark)

    Brazauskas, Gintaras; Pašakinskienė, Izolda; Asp, Torben

    2010-01-01

    Knowledge on nucleotide diversity and linkage disequilibrium (LD) patterns is prerequisite for association analyses. However, little is known about the nucleotide diversity in the evolutionary important ryegrass shoot morphology genes. Five candidate genes, LpIAA1, LpRUB1, LpBRI1, LpSHOOT1 and Lp...

  1. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  2. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  3. Alkylation of N-substituted 2-phenylacetamides

    Directory of Open Access Journals (Sweden)

    SLOBODAN D. PETROVIC

    2004-10-01

    Full Text Available Various N-substituted phenylacetamides were alkylated using different alkylating agents under neutral and basic conditions. Reactions were performed at different reaction temperatures and in various solvents. Also, a number of various catalysts were used including phase-transfer catalysts. Reactions were followed using GC or GC-MS technique and the presence as well as the yields of the alkylation products were established. Generally, the best yield and high selectivity in the studied reactions were achieved under basic conditions where in the certain cases some products, mostly N-product, were obtained solely in quantitative yields.

  4. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  5. Genetic differentiation between fake abalone and genuine Haliotis species using the forensically informative nucleotide sequencing (FINS) method.

    Science.gov (United States)

    Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S

    2011-05-25

    Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.

  6. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    Science.gov (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

  7. Advances in Osteobiologic Materials for Bone Substitutes.

    Science.gov (United States)

    Hasan, Anwarul; Byambaa, Batzaya; Morshed, Mahboob; Cheikh, Mohammad Ibrahim; Shakoor, Rana Abdul; Mustafy, Tanvir; Marei, Hany

    2018-04-27

    A significant challenge in the current orthopedics is the development of suitable osteobiologic materials that can replace the conventional allografts, autografts and xenografts, and thereby serve as implant materials as bone substitutes for bone repair or remodeling. The complex biology behind the nano-microstructure of bones and their repair mechanisms, which involve various types of chemical and biomechanical signaling amongst different cells, has set strong requirements for biomaterials to be used in bone tissue engineering. This review presents an overview of various types of osteobiologic materials to facilitate the formation of the functional bone tissue and healing of the bone, covering metallic, ceramic, polymeric and cell-based graft substitutes, as well as some biomolecular strategies including stem cells, extracellular matrices, growth factors and gene therapies. Advantages and disadvantages of each type, particularly from the perspective of osteoinductive and osteoconductive capabilities, are discussed. Although the numerous challenges of bone regeneration in tissue engineering and regenerative medicine are yet to be entirely addressed, further advancements in osteobiologic materials will pave the way towards engineering fully functional bone replacement grafts. This article is protected by copyright. All rights reserved.

  8. Pressure-induced polymerization in substituted acetylenes

    Energy Technology Data Exchange (ETDEWEB)

    Chellappa, Raja S.; Dattelbaum, Dana M.; Sheffield, Stephen; Robbins, David (LANL)

    2012-04-10

    A fundamental understanding of shock-induced chemical reactions in organics is still lacking and there are limited studies devoted to determining reaction mechanisms, evolution of bonding, and effect of functional group substitutions. The fast timescale of reactions occurring during shock compression create significant experimental challenges (diagnostics) to fully quantify the mechanisms involved. Static compression combined with temperature provides a complementary route to investigate the equilibrium phase space and metastable intermediates under extreme P-T conditions. In this study, we present our results from our ongoing high pressure in situ synchrotron x-ray diffraction experiments on substituted acetylenes: tert-butyl acetylene [TBA: (CH{sub 3}){sub 3}-C=CH] and ethynyl trimethylsilane [ETMS: (CH{sub 3}){sub 3}-SiC=CH]. We observed that the onset pressure of chemical reactions (at room temperature) in these compounds is higher under static compression (TBA: 12 GPa and ETMS: 17.6 GPa) when compared to shock input pressures (TBA: 6.1 GPa and ETMS: 6.6 GPa). At elevated temperatures, reactivity was observed to occur at pressures comparable to shock conditions. The products were polymeric in nature, recovered to ambient conditions with little degradation.

  9. Challenges in drug discovery for thiazolidinedione substitute

    Directory of Open Access Journals (Sweden)

    Jian-ping Ye

    2011-10-01

    Full Text Available Thiazolidinedione (TZD is a powerful insulin sensitizer in the treatment of type 2 diabetes. It acts as a ligand to the nuclear receptor PPARγ (peroxisome proliferator-activated receptor-gamma and induces transcription of PPARγ-responsive genes. TZD controls lipid synthesis and storage in adipose tissue, liver and many other tissues through PPARγ. Derivatives of TZD, such as rosiglitazone (Avandia and pioglitazone (Actos, are more powerful than metformin or berberine in insulin sensitization. Although they have common side effects such as weight gain and edema, these did not influence their clinical application in general. However, recent findings of risk for congestive heart failure and bladder cancer have significantly impaired their future in many countries. European countries have prohibited those drugs, and US will terminate application of rosiglitazone in clinics and hospitals. The multiple country actions may mark the end of TZD era. As a result, there is a strong demand for identification of TZD substitute in the treatment of type 2 diabetes. In this regard, literature about PPARγ ligands and potential TZD substitute are reviewed in this article. Histone deacetylase (HDAC inhibitor is emphasized as a new class of insulin sensitizer here. Regulators of SIRT1, CREB, NO, p38, ERK and Cdk5 are discussed in the activation of PPARγ.

  10. Substitution of thoriated tungsten electrodes in Switzerland

    International Nuclear Information System (INIS)

    Kunz, H.; Piller, G.

    2006-01-01

    Thoriated tungsten electrodes are frequently used for inert gas welding (TIG/WIG). The use of these electrodes can lead to doses which are well above the limit for the general population (1mSv/year). This has been shown by different investigations, for example from the ''Berufsgenossenschaft''. With these findings in mind, the regulatory authorities (Swiss Federal Office of Public Health (SFOPH) and Swiss National Accident Insurance Association (Suva)) started in 1999 to examine the justification of thoriated tungsten electrodes and a possible substitution with products containing no radioactive material. Up to this time, the use of thoriated tungsten electrodes could be justified since no thorium-free products leading to comparable results were available on the market. This was also the reason why the SFOPH approved several types of these electrodes. Discussions with formation centers for welding and inquiries made at welding shops, trading companies and producers showed that in the mean-time thorium-free products with comparable welding specifications and results became available on the market. Since the 1 January 2004, thoriated tungsten electrodes can only be used if the user has obtained the corresponding license from the SFOPH. The use of thoriated tungsten electrodes is thus not completely forbidden, but very strict conditions have to be fulfilled. Up to now and due to the involvement of the relevant partners, the substitution process has not met any problem. Neither trading companies nor users made any opposition and no request for obtaining a license for thoriated tungsten electrodes was made. (orig.)

  11. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Mostapha, Sarah

    2013-01-01

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  12. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  13. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin

    2008-01-01

    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  14. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  15. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  16. Deregulation of ocular nucleotide homeostasis in patients with diabetic retinopathy.

    Science.gov (United States)

    Loukovaara, Sirpa; Sandholm, Jouko; Aalto, Kristiina; Liukkonen, Janne; Jalkanen, Sirpa; Yegutkin, Gennady G

    2017-02-01

    Clear signaling roles for ATP and adenosine have been established in all tissues, including the eye. The magnitude of signaling responses is governed by networks of enzymes; however, little is known about the regulatory mechanisms of purinergic signaling in the eye. By employing thin-layer chromatographic assays with 3 H-labeled substrates, this study aimed to evaluate the role of nucleotide homeostasis in the pathogenesis of vitreoretinal diseases in humans. We have identified soluble enzymes ecto-5'-nucleotidase/CD73, adenylate kinase-1, and nucleoside diphosphate kinase in the vitreous fluid that control active cycling between pro-inflammatory ATP and anti-inflammatory adenosine. Strikingly, patients with proliferative form of diabetic retinopathy (DR) had higher adenylate kinase activity and ATP concentration, when compared to non-proliferative DR eyes and non-diabetic controls operated for rhegmatogenous retinal detachment, macular hole, and pucker. The non-parametric correlation analysis revealed positive correlations between intravitreal adenylate kinase and concentrations of ATP, ADP, and other angiogenic (angiopoietins-1 and -2), profibrotic (transforming growth factor-β1), and proteolytic (matrix metalloproteinase-9) factors but not erythropoietin and VEGF. Immunohistochemical staining of postmortem human retina additionally revealed selective expression of ecto-5'-nucleotidase/CD73 on the rod-and-cone-containing photoreceptor cells. Collectively, these findings provide novel insights into the regulatory mechanisms that influence purinergic signaling in diseased eye and open up new possibilities in the development of enzyme-targeted therapeutic approaches for prevention and treatment of DR. Ecto-5'-nucleotidase/CD73 and adenylate kinase-1 circulate in human vitreous fluid. Adenylate kinase activity is high in diabetic eyes with proliferative retinopathy. Diabetic eyes display higher intravitreal ATP/ADP ratio than non-diabetic controls. Soluble adenylate

  17. Long term expression of Drosophila melanogaster nucleoside kinase in thymidine kinase 2-deficient mice with no lethal effects caused by nucleotide pool imbalances.

    Science.gov (United States)

    Krishnan, Shuba; Paredes, João A; Zhou, Xiaoshan; Kuiper, Raoul V; Hultenby, Kjell; Curbo, Sophie; Karlsson, Anna

    2014-11-21

    Mitochondrial DNA depletion caused by thymidine kinase 2 (TK2) deficiency can be compensated by a nucleoside kinase from Drosophila melanogaster (Dm-dNK) in mice. We show that transgene expression of Dm-dNK in Tk2 knock-out (Tk2(-/-)) mice extended the life span of Tk2(-/-) mice from 3 weeks to at least 20 months. The Dm-dNK(+/-)Tk2(-/-) mice maintained normal mitochondrial DNA levels throughout the observation time. A significant difference in total body weight due to the reduction of subcutaneous and visceral fat in the Dm-dNK(+/-)Tk2(-/-) mice was the only visible difference compared with control mice. This indicates an effect on fat metabolism mediated through residual Tk2 deficiency because Dm-dNK expression was low in both liver and fat tissues. Dm-dNK expression led to increased dNTP pools and an increase in the catabolism of purine and pyrimidine nucleotides but these alterations did not apparently affect the mice during the 20 months of observation. In conclusion, Dm-dNK expression in the cell nucleus expanded the total dNTP pools to levels required for efficient mitochondrial DNA synthesis, thereby compensated the Tk2 deficiency, during a normal life span of the mice. The Dm-dNK(+/-) mouse serves as a model for nucleoside gene or enzyme substitutions, nucleotide imbalances, and dNTP alterations in different tissues. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  19. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  20. DNA template dependent accuracy variation of nucleotide selection in transcription.

    Directory of Open Access Journals (Sweden)

    Harriet Mellenius

    Full Text Available It has been commonly assumed that the effect of erroneous transcription of DNA genes into messenger RNAs on peptide sequence errors are masked by much more frequent errors of mRNA translation to protein. We present a theoretical model of transcriptional accuracy. It uses experimentally estimated standard free energies of double-stranded DNA and RNA/DNA hybrids and predicts a DNA template dependent transcriptional accuracy variation spanning several orders of magnitude. The model also identifies high-error as well a high-accuracy transcription motifs. The source of the large accuracy span is the context dependent variation of the stacking free energy of pairs of correct and incorrect base pairs in the ever moving transcription bubble. Our model predictions have direct experimental support from recent single molecule based identifications of transcriptional errors in the C. elegans transcriptome. Our conclusions challenge the general view that amino acid substitution errors in proteins are mainly caused by translational errors. It suggests instead that transcriptional error hotspots are the dominating source of peptide sequence errors in some DNA template contexts, while mRNA translation is the major cause of protein errors in other contexts.

  1. Regulation of formyl peptide receptor binding to rabbit neutrophil plasma membranes. Use of monovalent cations, guanine nucleotides, and bacterial toxins to discriminate among different states of the receptor

    International Nuclear Information System (INIS)

    Feltner, D.E.; Marasco, W.A.

    1989-01-01

    The regulation by monovalent cations, guanine nucleotides, and bacterial toxins of [3H]FMLP binding to rabbit neutrophil plasma membranes was studied by using dissociation techniques to identify regulatory effects on separate receptor states. Under conditions of low receptor occupancy (1 nM [3H]FMLP) and in both Na+ and K+ buffers, dissociation is heterogenous, displaying two distinct, statistically significant off rates. [3H]FMLP binding was enhanced by substituting other monovalent cations for Na+. In particular, enhanced binding in the presence of K+ relative to Na+ was caused by additional binding to both rapidly and slowly dissociating receptors. Three receptor dissociation rates, two of which appear to correspond to the two affinity states detected in equilibrium binding studies, were defined by specific GTP and pertussis toxin (PT) treatments. Neither GTP, nor PT or cholera toxins (CT) had an effect on the rate of dissociation of [3H]FMLP from the rapidly dissociating form of the receptor. Both 100 microM GTP and PT treatments increased the percentage of rapidly dissociating receptors, correspondingly decreasing the percentage of slowly dissociating receptors. The observed changes in the rapidly and slowly dissociating receptors after GTP, PT, and CT treatments were caused by an absolute decrease in the amount of binding to the slowly dissociating receptors. However, complete inhibition of slowly dissociating receptor binding by GTP, PT, or both was never observed. Both GTP and PT treatments, but not CT treatment, increased by two-fold the rate of dissociation of 1 nM [3H]FMLP from the slowly dissociating form of the receptor, resulting in a third dissociation rate. Thus, slowly dissociating receptors comprise two different receptor states, a G protein-associated guanine nucleotide and PT-sensitive state and a guanine nucleotide-insensitive state

  2. Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

    Directory of Open Access Journals (Sweden)

    Tobias Fromme

    2018-02-01

    Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

  3. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  4. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

    Science.gov (United States)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

  5. Cation Radical Accelerated Nucleophilic Aromatic Substitution via Organic Photoredox Catalysis.

    Science.gov (United States)

    Tay, Nicholas E S; Nicewicz, David A

    2017-11-15

    Nucleophilic aromatic substitution (S N Ar) is a direct method for arene functionalization; however, it can be hampered by low reactivity of arene substrates and their availability. Herein we describe a cation radical-accelerated nucleophilic aromatic substitution using methoxy- and benzyloxy-groups as nucleofuges. In particular, lignin-derived aromatics containing guaiacol and veratrole motifs were competent substrates for functionalization. We also demonstrate an example of site-selective substitutive oxygenation with trifluoroethanol to afford the desired trifluoromethylaryl ether.

  6. Perron-Frobenius theory and frequency convergence for reducible substitutions

    OpenAIRE

    Lustig, Martin; Uyanik, Caglar

    2016-01-01

    We prove a general version of the classical Perron-Frobenius convergence property for reducible matrices. We then apply this result to reducible substitutions and use it to produce limit frequencies for factors and hence invariant measures on the associated subshift. The analogous results are well known for primitive substitutions and have found many applications, but for reducible substitutions the tools provided here were so far missing from the theory.

  7. Goods-Time Elasticity of Substitution in Health Production.

    Science.gov (United States)

    Du, Juan; Yagihashi, Takeshi

    2017-11-01

    We examine how inputs for health production, in particular, medical care and health-enhancing time, are combined to improve health. The estimated elasticity of substitution from a constant elasticity of substitution production function is significantly less than one for the working-age population, rejecting the unit elasticity of substitution used in previous studies. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  8. Prediction of single-nucleotide substitutions that result in exon skipping: identification of a splicing silencer in BRCA1 exon 6

    Czech Academy of Sciences Publication Activity Database

    Raponi, M.; Kralovicova, J.; Copson, E.; Divina, Petr; Eccles, D.; Johnson, P.; Baralle, D.; Vorechovsky, I.

    2011-01-01

    Roč. 32, č. 4 (2011), s. 436-444 ISSN 1059-7794 Grant - others:EK(XE) 518238 Institutional research plan: CEZ:AV0Z50520514 Keywords : RNA * BRCA1 * splicing * gene Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.686, year: 2011

  9. Subnanomole detection and quantitation of high specific activity 32P-nucleotides

    International Nuclear Information System (INIS)

    Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

    1991-01-01

    Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

  10. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  11. Import Substitution in Regional Industrial Production: Theoretical and Practical Aspects

    Directory of Open Access Journals (Sweden)

    Yevgeniy Georgievich Animitsa

    2015-09-01

    Full Text Available The article proves the important role of import substitution in the economic security protection of state and its regions, especially in times of crisis, geopolitical and economical instability. The authors argue that the problem of import substitution is not modern, trendy scientific stream. The issue of displacement of import goods by domestic ones was brought up in famous classic theories of mercantilists. The particular emphasis is placed on the analysis and systematization of different scientific approaches, which are utilized by native and foreign scientists to bring out the matter of “import substitution,” to determine its essential characteristics. The authors suggest their own interpretation of the import substitution notion. In the article, the most significant pro and contra arguments in import substitution policy are defined. The regional aspects in the import substitution are approved: case study — organization of industrial import substitution in the Sverdlovsk region. In the article, the authors analyze the subject matter of the Program “Development of Intraregional Industrial Cooperation and Implementation of an Import Substitution in Branches of Industry in the Sverdlovsk Region.” It is resumed, that active policy of import substitution in the industry may become the driver of regional economic development.

  12. Zinc and Carbonate Co-Substituted Nano-Hydroxyapatite

    Science.gov (United States)

    Girija, E. K.; Kumar, G. Suresh; Thamizhavel, A.

    2011-07-01

    Synthesis of Zn or CO32- substituted nano-hydroxyapatite (HA) and its physico-chemical properties have been well documented. However, the effects of the simultaneous substitution of Zn and CO32- in nano-HA have not been reported. In the present study, Zn and CO32- substitutions in nano HA independently and concurrently have been done by wet precipitation method and characterized by XRD and FT-IR for its phase purity and chemical homogeneity. Further modulations of the bioactivity and thermal stability of HA due to the substitutions have been studied.

  13. Technological substitution options for controlling greenhouse gas emissions

    International Nuclear Information System (INIS)

    Barbier, E.B.; Burgess, J.C.; Pearce, D.W.

    1991-01-01

    This chapter is concerned with technological options for greenhouse gas substitution. The authors interpret the term substitution to exclude energy conservation/efficiency measures, investments in afforestation (sinks), and greenhouse gas removal or abatement technologies. Their working definition of greenhouse gas substitution includes (1) replacement technologies, for example, substituting a greenhouse gas technology with a nongreenhouse gas technology; and (2) reduction technologies, for example, substituting a greenhouse gas technology with an alternative technology that reduces greenhouse gas emissions. Essentially, replacement technologies involve 100 percent reduction in CO 2 ; reduction technologies involve a partial reduction in CO 2 . Of the man-made sources of greenhouse gases, energy is the most important and is expected to contribute to at least half of the global warming effect in the near future. The majority of this impact is from fossil fuel combustion as a source of carbon dioxide (CO 2 ), although fossil fuels also contribute significantly to methane (CH 4 ), to nitrous oxide (N 2 O), and to low-level ozone (O 3 ) through production of various nitrogen gases (NO x ) and carbon monoxide (CO). This study analyzes the available greenhouse gas substitutions and their costs. The authors concentrate particularly on substitutions for fossil-fuel combustion and CFC production and consumption. They conclude by summarizing the potential for greenhouse gas substitution, the cost-effectiveness of the various options and the design of incentives for substitution

  14. Time and Money - Are they Substitutes?

    DEFF Research Database (Denmark)

    Bonke, Jens; Deding, Mette; Lausten, Mette

    In this paper, we analyse the distribution of time and money for Danish wage earner couples, where time is defined as leisure time and money as extended income, i.e. the sum of disposable income and the value of housework. The hypothesis is that individuals being rich in one dimension are more...... likely to be poor in the other dimension, such that individuals can be classified as either money-poor/time-rich or money-rich/time-poor. We analyse two different distributions of income, where the first assumes no sharing and the second complete sharing of income between spouses. The data are from...... the Danish Time-Use Survey 2001, merged with register data. Results show that the substitution of money for time is more prominent for women than for men, because they have a larger income share of time-intensive value of housework, while men have the larger share of disposable income. Furthermore, when...

  15. SYNTHESIS OF SUBSTITUTED QUINOLINE-3-CARBALDEHYDES

    Directory of Open Access Journals (Sweden)

    L. G. Klad'ko

    2015-12-01

    Full Text Available Dehalogenation of а series substituted 2-chloroquinoline-3-carbaldehydes was investigated. It was found that zinc dust in alkali ethanol practically do not react with 2-chloro-3-(1,3-dioxolan-2-yl-7-methylquinolines for a 5 day at ambient temperature. Increase temperature to boiling point of reaction mixture lead to increase yield 7-methylquinoline-3-carbaldehyde to 12.5%. This reaction with 2-chloro-3-dimetoxymetyl-7-methylquinoline give 26.5 above aldehyde. Replacement of ethanol to methanol give only traces of desired aldehyde. Neither 2-chloro-7-methylquinoline-3-carbaldehyde, nor his acetals do not react with sodium dithionite. Furthermore for activation of halogen we replaced chloraldehydes to iodoaldehydes by Finkelstein reaction, then protect aldehyde function by formation of dimethylacetals and treatment his by sodium dithionite in mixture pyridine-water. Desired aldehydes was obtained with poor to moderate yields. Increasing yields of this reaction is goal our further investigations.

  16. Porous bioresorbable magnesium as bone substitute

    Energy Technology Data Exchange (ETDEWEB)

    Wen, C.E.; Yamada, Y.; Shimojima, K.; Chino, Y.; Hosokawa, H.; Mabuchi, M. [Inst. for Structural and Engineering Materials, National Inst. of Advanced Industrial Science and Technology, Nagoya (Japan)

    2003-07-01

    Recently magnesium has been recognized as a very promising biomaterial for bone substitutes because of its excellent properties of biocompatibility, biodegradability and bioresorbability. In the present study, magnesium foams were fabricated by using a powder metallurgical process. Scanning electron microscopy equipped with energy dispersive X-ray spectrometer (EDS) and compressive tester were used to characterize the porous magnesium. Results show that the Young's modulus and the peak stress of the porous magnesium increase with decreasing porosity and pore size. This study suggests that the mechanical properties of the porous magnesium with the low porosity of 35% and/or with the small pore size of about 70 {mu}m are close to those of human cancellous bones. (orig.)

  17. Substitution reactions of carbon nanotube template

    Science.gov (United States)

    Li, Chi Pui; Chen, Ying; Gerald, John Fitz

    2006-05-01

    Substitution reactions between carbon nanotube (CNT) template and SiO with the formation of carbon rich silicon oxide nanowires (SiO-C-NWs) have been investigated using transmission electron microscopy and x-ray energy dispersive spectroscopy. The reaction was carried out by thermal annealing at 1200°C for 1h of a mixture of silicon monoxide (SiO) and iron (II) phthalocyanine, FeC32N8H16 (FePc) powders. Multiwalled CNTs were produced first via pyrolysis of FePc at a lower temperature (1000°C ). SiO vapors reacted with the CNTs at higher temperatures to produce amorphous SiO-C-NWs with a uniform diameter and a length in tens of micrometers. The special bamboolike structure of the CNTs allows the reaction to start from the external surface of the tubes and transform each CNT into a solid nanowire section by section.

  18. Packing and Disorder in Substituted Fullerenes

    KAUST Repository

    Tummala, Naga Rajesh

    2016-07-15

    Fullerenes are ubiquitous as electron-acceptor and electron-transport materials in organic solar cells. Recent synthetic strategies to improve the solubility and electronic characteristics of these molecules have translated into a tremendous increase in the variety of derivatives employed in these applications. Here, we use molecular dynamics (MD) simulations to examine the impact of going from mono-adducts to bis- and tris-adducts on the structural, cohesive, and packing characteristics of [6,6]-phenyl-C60-butyric acid methyl ester (PCBM) and indene-C60. The packing configurations obtained at the MD level then serve as input for density functional theory calculations that examine the solid-state energetic disorder (distribution of site energies) as a function of chemical substitution. The variations in structural and site-energy disorders reflect the fundamental materials differences among the derivatives and impact the performance of these materials in thin-film electronic devices.

  19. Crossmodal Perceptual Learning and Sensory Substitution

    Directory of Open Access Journals (Sweden)

    Michael J Proulx

    2011-10-01

    Full Text Available A sensory substitution device for blind persons aims to provide the missing visual input by converting images into a form that another modality can perceive, such as sound. Here I will discuss the perceptual learning and attentional mechanisms necessary for interpreting sounds produced by a device (The vOICe in a visuospatial manner. Although some aspects of the conversion, such as relating vertical location to pitch, rely on natural crossmodal mappings, the extensive training required suggests that synthetic mappings are required to generalize perceptual learning to new objects and environments, and ultimately to experience visual qualia. Here I will discuss the effects of the conversion and training on perception and attention that demonstrate the synthetic nature of learning the crossmodal mapping. Sensorimotor experience may be required to facilitate learning, develop expertise, and to develop a form of synthetic synaesthesia.

  20. Magnetic disaccommodation in Sn substituted magnetite

    International Nuclear Information System (INIS)

    Hernandez-Gomez, P.; Bendimya, K.; Francisco, C. de; Munoz, J.M.; Alejos, O.; Torres, C.

    2001-01-01

    The relaxation of the initial magnetic permeability has been measured in polycrystalline Sn-doped magnetite with nominal composition Sn x Fe 3-x O 4 with x ranging from x=0 to 0.6. In the temperature range between 80 and 500 K, the time decay of the initial permeability after sample demagnetization has been represented by means of isochronal disaccommodation curves, which show the presence of different relaxation processes at 250 K (IV' peak), 275 K (IV), 300 K (III), 400 K (II) and 440 K (I). This behavior is explained on the basis of the disaccommodation of vacancy-doped magnetite and another similar tetravalent substitution, as the previously analyzed Ti-doped magnetite

  1. Hazardous Solvent Substitution Data System tutorial

    International Nuclear Information System (INIS)

    Twitchell, K.E.; Skinner, N.L.

    1993-07-01

    This manual is the tutorial for the Hazardous Solvent Substitution Data System (HSSDS), an online, comprehensive system of information on alternatives to hazardous solvents and related subjects. The HSSDS data base contains product information, material safety data sheets, toxicity reports, usage reports, biodegradable data, product chemical element lists, and background information on solvents. HSSDS use TOPIC reg-sign to search for information based on a query defined by the user. TOPIC provides a full text retrieval of unstructured source documents. In this tutorial, a series of lessons is provided that guides the user through basic steps common to most queries performed with HSSDS. Instructions are provided for both window-based and character-based applications

  2. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  3. Substitution effects in magnetic and superconducting materials

    Directory of Open Access Journals (Sweden)

    Peña, O.

    1999-10-01

    Full Text Available Chemical substitutions at very low level have been proved to be a very effective tool to change important physical parameters in many kinds of materials. These modifications may be the result of, for instance, subtle variations of the position of the Fermi level with respect to the density of states, presence of additional electrons which may change the hole carrier concentration, steric effects which impose contraints in the crystallographic lattice, mixed-valence states resultating from the dismutation of chemical components, etc. We review herein three systems in which the substitution effects are at the origin of new physical states : the high-Tc superconductor bismuth cuprate of the 2212 family, the mixed-valence manganese perovskites representative of giant magneto-resistive compounds, and the Chevrel phase materials in which a structural transition may inhibit the superconducting state.

    Las substituciones químicas a un nivel muy pequeño se han probado como una importante herramienta para cambiar los parámetros físicos en una gran variedad de materiales. Estas modificaciones pueden ser el resultado de, por ejemplo, muy ligeras variaciones de la posición del nivel de Fermi con respecto a la densidad de estados, presencia de electrones adicionales que pueden cambiar la concentración de portadores tipo huecos, efectos estéricos que imponen restricciones en la red cristalográfica, estados de valencia mixtos resultantes de la dismutación de los componentes químicos, etc. Aquí se revisan tres sistemas donde los efectos de substitución son el origen de nuevos estados físicos: los superconductores de alta temperatura basados en cupratos de bismuto de la familia 2212, las perovskitas de manganeso de valencia mixta representantes de compuestos con magnetorresistencia gigante, y los materiales con fases de Chevrelt cuya transición estructural puede inhibir el estado superconductor.

  4. Substituted Pyrazinecarboxamides: Synthesis and Biological Evaluation

    Directory of Open Access Journals (Sweden)

    Katarina Kralova

    2006-03-01

    Full Text Available Condensation of the corresponding chlorides of some substituted pyrazine-2-carboxylic acids (pyrazine-2-carboxylic acid, 6-chloropyrazine-2-carboxylic acid, 5-tert-butylpyrazine-2-carboxylic acid or 5-tert-butyl-6-chloropyrazine-2-carboxylic acid withvarious ring-substituted aminothiazoles or anilines yielded a series of amides. Thesyntheses, analytical and spectroscopic data of thirty newly prepared compounds arepresented. Structure-activity relationships between the chemical structures and the anti-mycobacterial, antifungal and photosynthesis-inhibiting activity of the evaluatedcompounds are discussed. 3,5-Bromo-4-hydroxyphenyl derivatives of substitutedpyrazinecarboxylic acid, 16-18, have shown the highest activity against Mycobacteriumtuberculosis H37Rv (54-72% inhibition. The highest antifungal effect againstTrichophyton mentagrophytes, the most susceptible fungal strain tested, was found for5-tert-butyl-6-chloro-N-(4-methyl-1,3-thiazol-2-ylpyrazine-2-carboxamide (8, MIC =31.25 μmol·mL-1. The most active inhibitors of oxygen evolution rate in spinachMolecules 2006, 11 243 chloroplasts were the compounds 5-tert-butyl-6-chloro-N-(5-bromo-2-hydroxyphenyl- pyrazine-2-carboxamide (27, IC50 = 41.9 μmol·L-1 and 5-tert-butyl-6-chloro-N-(1,3- thiazol-2-yl-pyrazine-2-carboxamide (4, IC50 = 49.5 μmol·L-1.

  5. Polyphosphates substitution for zeolite to in detergents

    International Nuclear Information System (INIS)

    Restrepo V, Gloria M.; Ocampo G, Aquiles; Saldarriaga M, Carlos

    1996-01-01

    The detergents, as well as the cleaning products, contain active ingredients that are good to increase their efficiency and some of them, as the sodium Tripoli-phosphate (TPF), they have turned out to be noxious for the environment. The zeolites use in the formulation of detergents has grown substantially since they fulfill the same function of the TPF and they have been recommended ecologically as substitutes from these when not being polluting. The objective of this work is to obtain a zeolite with appropriate characteristics for its use in the formulation of detergents, reproducing those of the zeolites used industrially. The zeolite synthesis is studied 4A starting from hydro-gels of different composition, varying the operation conditions and using two raw materials: (sodium meta-silicate, commercial degree and metallic aluminum) and clay type kaolin like silica source and aluminum It is looked for to get a product of beveled cubic morphology, or spherical, with glass size between 1 and 3 microns and that it possesses good capacity of conical exchange. Since the capacity and speed of ionic exchange is influenced by the particle size, time of contact and temperature, experimentation conditions settle down to measure the exchange of ions calcium and magnesium in watery solutions that they simulate the real situation of a laundry process in the country. This way the ability of the zeolite 4A obtained to diminish the concentration of these ions in the laundry waters is evaluated and its possibilities like component in the formulation of detergents non-phosphatates. Of the synthesized zeolites, the best in agreement is chosen with chemical properties as ionic and physical exchange capacity as crystalline, particle size and color, to prepare a detergent in which the polyphosphates is substituted partial and totally for the synthesized zeolite

  6. Stabilization of a nucleotide-binding domain of the cystic fibrosis transmembrane conductance regulator yields insight into disease-causing mutations.

    Science.gov (United States)

    Vernon, Robert M; Chong, P Andrew; Lin, Hong; Yang, Zhengrong; Zhou, Qingxian; Aleksandrov, Andrei A; Dawson, Jennifer E; Riordan, John R; Brouillette, Christie G; Thibodeau, Patrick H; Forman-Kay, Julie D

    2017-08-25

    Characterization of the second nucleotide-binding domain (NBD2) of the cystic fibrosis transmembrane conductance regulator (CFTR) has lagged behind research into the NBD1 domain, in part because NBD1 contains the F508del mutation, which is the dominant cause of cystic fibrosis. Research on NBD2 has also been hampered by the overall instability of the domain and the difficulty of producing reagents. Nonetheless, multiple disease-causing mutations reside in NBD2, and the domain is critical for CFTR function, because channel gating involves NBD1/NBD2 dimerization, and NBD2 contains the catalytically active ATPase site in CFTR. Recognizing the paucity of structural and biophysical data on NBD2, here we have defined a bioinformatics-based method for manually identifying stabilizing substitutions in NBD2, and we used an iterative process of screening single substitutions against thermal melting points to both produce minimally mutated stable constructs and individually characterize mutations. We present a range of stable constructs with minimal mutations to help inform further research on NBD2. We have used this stabilized background to study the effects of NBD2 mutations identified in cystic fibrosis (CF) patients, demonstrating that mutants such as N1303K and G1349D are characterized by lower stability, as shown previously for some NBD1 mutations, suggesting a potential role for NBD2 instability in the pathology of CF. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Nucleotide and deduced amino acid sequence of the envelope gene of the Vasilchenko strain of TBE virus; comparison with other flaviviruses.

    Science.gov (United States)

    Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A

    1993-02-01

    A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.

  8. Blocking of proteolytic processing and deletion of glycosaminoglycan side chain of mouse DMP1 by substituting critical amino acid residues.

    Science.gov (United States)

    Peng, Tao; Huang, Bingzhen; Sun, Yao; Lu, Yongbo; Bonewald, Lynda; Chen, Shuo; Butler, William T; Feng, Jerry Q; D'Souza, Rena N; Qin, Chunlin

    2009-01-01

    Dentin matrix protein 1 (DMP1) is present in the extracellular matrix (ECM) of dentin and bone as processed NH(2)- and COOH-terminal fragments, resulting from proteolytic cleavage at the NH(2) termini of 4 aspartic acid residues during rat DMP1 processing. One cleavage site residue, Asp(181) (corresponding to Asp(197) of mouse DMP1), and its flanking region are highly conserved across species. We speculate that cleavage at the NH(2) terminus of Asp(197) of mouse DMP1 represents an initial, first-step scission in the whole cascade of proteolytic processing. To test if Asp(197) is critical for initiating the proteolytic processing of mouse DMP1, we substituted Asp(197) with Ala(197) by mutating the corresponding nucleotides of mouse cDNA that encode this amino acid residue. This mutant DMP1 cDNA was cloned into a pcDNA3.1 vector. Data from transfection experiments indicated that this single substitution blocked the proteolytic processing of mouse DMP1 in HEK-293 cells, indicating that cleavage at the NH(2) terminus of Asp(197) is essential for exposing other cleavage sites for the conversion of DMP1 to its fragments. The NH(2)-terminal fragment of DMP1 occurs as a proteoglycan form (DMP1-PG) that contains a glycosaminoglycan (GAG) chain. Previously, we showed that a GAG chain is linked to Ser(74) in rat DMP1 (Ser(89) in mouse DMP1). To confirm that mouse DMP1-PG possesses a single GAG chain attached to Ser(89), we substituted Ser(89) by Gly(89). Data from transfection analysis indicated that this substitution completely prevented formation of the GAG-containing form, confirming that DMP1-PG contains a single GAG chain attached to Ser(89) in mouse DMP1. Copyright 2008 S. Karger AG, Basel.

  9. Measuring the prevalence of regional mutation rates: an analysis of silent substitutions in mammals, fungi, and insects

    Directory of Open Access Journals (Sweden)

    Tuch Brian B

    2008-06-01

    Full Text Available Abstract Background The patterns of mutation vary both within and across genomes. It has been shown for a few mammals that mutation rates vary within the genome, while for unknown reasons, the sensu stricto yeasts have uniform rates instead. The generality of these observations has been unknown. Here we examine silent site substitutions in a more expansive set (20 mammals, 27 fungi, 4 insects to determine why some genomes demonstrate this mosaic distribution and why others are uniform. Results We applied several intragene and intergene correlation tests to measure regional substitution patterns. Assuming that silent sites are a reasonable approximation to neutrally mutating sequence, our results show that all multicellular eukaryotes exhibit mutational heterogeneity. In striking contrast, all fungi are mutationally uniform – with the exception of three Candida species: C. albicans, C. dubliniensis, and C. tropicalis. We speculate that aspects of replication timing may be responsible for distinguishing these species. Our analysis also reveals classes of genes whose silent sites behave anomalously with respect to the mutational background in many species, indicating prevalent selective pressures. Genes associated with nucleotide binding or gene regulation have consistently low silent substitution rates in every mammalian species, as well as multiple fungi. On the other hand, receptor genes repeatedly exhibit high silent substitution rates, suggesting they have been influenced by diversifying selection. Conclusion Our findings provide a framework for understanding the regional mutational properties of eukaryotes, revealing a sharp difference between fungi and multicellular species. They also elucidate common selective pressures acting on eukaryotic silent sites, with frequent evidence for both purifying and diversifying selection.

  10. Analysis of 6912 unselected somatic hypermutations in human VDJ rearrangements reveals lack of strand specificity and correlation between phase II substitution rates and distance to the nearest 3' activation-induced cytidine deaminase target

    DEFF Research Database (Denmark)

    Ohm-Laursen, Line; Barington, Torben

    2007-01-01

    -23*01) from blood B lymphocytes enriched for CD27-positive memory cells. Analyses of 6,912 unique, unselected substitutions showed that in vivo hot and cold spots for the SHM of C and G residues corresponded closely to the target preferences reported for AID in vitro. A detailed analysis of all possible four......-nucleotide motifs present on both strands of the V(H) gene showed significant correlations between the substitution frequencies in reverse complementary motifs, suggesting that the SHM machinery targets both strands equally well. An analysis of individual J(H) and D gene segments showed that the substitution...... rates in G and T residues correlated inversely with the distance to the nearest 3' WRC AID hot spot motif on both the nontranscribed and transcribed strands. This suggests that phase II SHM takes place 5' of the initial AID deamination target and primarily targets T and G residues or, alternatively...

  11. Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

    NARCIS (Netherlands)

    Corradini, E.

    2015-01-01

    Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

  12. Study on the change of cyclic nucleotide in mice with yang vacuity disease

    International Nuclear Information System (INIS)

    Zhu Xinhua; Shen Ling; Wang Shuguang

    2002-01-01

    To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

  13. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  14. Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein

    International Nuclear Information System (INIS)

    Zhang, Xinsheng; Wallace, Olivia L.; Domi, Arban; Wright, Kevin J.; Driscoll, Jonathan; Anzala, Omu; Sanders, Eduard J.; Kamali, Anatoli; Karita, Etienne; Allen, Susan; Fast, Pat; Gilmour, Jill; Price, Matt A.; Parks, Christopher L.

    2015-01-01

    Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance

  15. Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xinsheng, E-mail: xzhang@iavi.org [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY (United States); Wallace, Olivia L.; Domi, Arban; Wright, Kevin J.; Driscoll, Jonathan [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Anzala, Omu [Kenya AIDS Vaccine Initiative (KAVI)-Institute of Clinical Research, Nairobi (Kenya); Sanders, Eduard J. [Centre for Geographic Medicine Research, Kenya Medical Research Institute (KEMRI), Kilifi, Kenya & Centre for Clinical Vaccinology and Tropical Medicine, University of Oxford, Headington (United Kingdom); Kamali, Anatoli [MRC/UVRI Uganda Virus Research Unit on AIDS, Masaka and Entebbe (Uganda); Karita, Etienne [Projet San Francisco, Kigali (Rwanda); Allen, Susan [Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA (United States); Fast, Pat [Department of Medical Affairs, International AIDS Vaccine Initiative, NY, NY (United States); Gilmour, Jill [Human Immunology Laboratory, International AIDS Vaccine Initiative, London (United Kingdom); Price, Matt A. [Department of Medical Affairs, International AIDS Vaccine Initiative, NY, NY (United States); Department of Epidemiology and Biostatistics, University of California at San Francisco, San Francisco, CA (United States); Parks, Christopher L. [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY (United States)

    2015-08-15

    Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance.

  16. Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein.

    Science.gov (United States)

    Zhang, Xinsheng; Wallace, Olivia L; Domi, Arban; Wright, Kevin J; Driscoll, Jonathan; Anzala, Omu; Sanders, Eduard J; Kamali, Anatoli; Karita, Etienne; Allen, Susan; Fast, Pat; Gilmour, Jill; Price, Matt A; Parks, Christopher L

    2015-08-01

    Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.

    Directory of Open Access Journals (Sweden)

    Quan Li

    Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.

  18. Computational Profiling of Deleterious Non-Synonymous SNP’s in HFE

    Directory of Open Access Journals (Sweden)

    S. Sarath Raj

    2017-12-01

    Full Text Available Liver cirrhosis describes a condition where scar tissue gradually replaces healthy cells in liver. The main causes are sustained, excessive alcohol consumption, viral hepatitis B and C, and fatty liver disease - however, there are other possible causes. Hemochromatosis is most common form of iron overload disease. Three types of hemochromatosis are primary hemochromatosis, also called hereditary hemochromatosis; secondary hemochromatosis; and neonatal hemochromatosis. The HFE gene helps regulate the amount of iron absorbed from food and inherited genetic defects or mutation in HFE [C282Y] cause primary hemochromatosis. Computational approach is sought to determine other similar mutations in this gene. In-silico tools such as SIFT, Polyphen 2.0, and PROVEAN were employed to determine the various deleterious ns-SNPs of HFE that may influence cystic fibrosis.

  19. Importance of non-synonymous OCA2 variants in human eye colour prediction

    DEFF Research Database (Denmark)

    Andersen, Jeppe Dyrberg; Pietroni, Carlotta; Johansen, Peter

    2016-01-01

    in the promotor region of OCA2 (OMIM #611409). Nevertheless, many eye colors cannot be explained by only considering rs12913832:A>G. Methods: In this study, we searched for additional variants in OCA2 to explain human eye color by sequencing a 500 kbp region, encompassing OCA2 and its promotor region. Results: We...... identified three nonsynonymous OCA2 variants as important for eye color, including rs1800407:G>A (p.Arg419Gln) and two variants, rs74653330:A>T (p.Ala481Thr) and rs121918166:G>A (p.Val443Ile), not previously described as important for eye color variation. It was shown that estimated haplotypes consisting...

  20. The effect of exhaustive exercise on the concentration of purine nucleotides and their metabolites in erythrocytes

    OpenAIRE

    E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak

    2008-01-01

    In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...

  1. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    International Nuclear Information System (INIS)

    Boulias, C.; Moscarello, M.A.

    1989-01-01

    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides

  2. Congenital syndactyly in cattle: four novel mutations in the low density lipoprotein receptor-related protein 4 gene (LRP4

    Directory of Open Access Journals (Sweden)

    Höltershinken Martin

    2007-02-01

    Full Text Available Abstract Background Isolated syndactyly in cattle, also known as mulefoot, is inherited as an autosomal recessive trait with variable penetrance in different cattle breeds. Recently, two independent mutations in the bovine LRP4 gene have been reported as the primary cause of syndactyly in the Holstein and Angus cattle breeds. Results We confirmed the previously described LRP4 exon 33 two nucleotide substitution in most of the affected Holstein calves and revealed additional evidence for allelic heterogeneity by the identification of four new LRP4 non-synonymous point mutations co-segregating in Holstein, German Simmental and Simmental-Charolais families. Conclusion We confirmed a significant role of LRP4 mutations in the pathogenesis of congenital syndactyly in cattle. The newly detected missense mutations in the LRP4 gene represent independent mutations affecting different conserved protein domains. However, the four newly described LRP4 mutations do still not explain all analyzed cases of syndactyly.

  3. Canonical A-to-I and C-to-U RNA editing is enriched at 3'UTRs and microRNA target sites in multiple mouse tissues.

    Directory of Open Access Journals (Sweden)

    Tongjun Gu

    Full Text Available RNA editing is a process that modifies RNA nucleotides and changes the efficiency and fidelity of the central dogma. Enzymes that catalyze RNA editing are required for life, and defects in RNA editing are associated with many diseases. Recent advances in sequencing have enabled the genome-wide identification of RNA editing sites in mammalian transcriptomes. Here, we demonstrate that canonical RNA editing (A-to-I and C-to-U occurs in liver, white adipose, and bone tissues of the laboratory mouse, and we show that apparent non-canonical editing (all other possible base substitutions is an artifact of current high-throughput sequencing technology. Further, we report that high-confidence canonical RNA editing sites can cause non-synonymous amino acid changes and are significantly enriched in 3' UTRs, specifically at microRNA target sites, suggesting both regulatory and functional consequences for RNA editing.

  4. Sequence Variation of MHC Class II DQB Gene in Bottlenose Dolphin (Tursiops truncatus from Taiwanese Waters

    Directory of Open Access Journals (Sweden)

    Wei-Cheng Yang

    2008-03-01

    Full Text Available The major histocompatibility complex (MHC is a large multigene coding for glycoproteins that play a key role in the initiation of immune responses in vertebrates. For a better understanding of the immunologic diversity in thriving marine mammal species, the sequence variation of the exon 2 region of MHC DQB locus was analyzed in 42 bottlenose dolphins (Tursiops truncatus collected from strandings and fishery bycatch in Taiwanese waters. The 172 bp sequences amplified showed no more than two alleles in each individual. The high proportion of non-synonymous nucleotide substitutions and the moderate amount of variation suggest positive selection pressure on this locus, arguing against a reduction in the marine environment selection pressure. The phylogenetic relationship among DQB exon 2 sequences of T. truncatus and other cetaceans did not coincide with taxonomic relationship, indicating a trans-species evolutionary pattern.

  5. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Science.gov (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.

    2014-01-01

    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  6. Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A

    1987-10-01

    The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

  7. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

    Science.gov (United States)

    Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

    1978-01-01

    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

  8. 49 CFR 383.77 - Substitute for driving skills tests.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Substitute for driving skills tests. 383.77... Substitute for driving skills tests. At the discretion of a State, the driving skill test as specified in... acceptable skills test, or an applicant's driving record in combination with certain driving experience. The...

  9. Substitute equations for index reduction and discontinuity handling

    NARCIS (Netherlands)

    Fabian, G.; Beek, van D.A.; Rooda, J.E.

    2000-01-01

    Several techniques exist for index reduction and consistent initialization of higher index DAEs. Many such techniques change the original set of equations by differentiation, substitution, and/or introduction of new variables. This paper introduces substitute equations as a new language element. By

  10. Control of Chemical Risks by Substitution of Harmful Substances

    DEFF Research Database (Denmark)

    Jacobsen, Thomas

    1997-01-01

    Substitution of volatile, organic solvents with non-volatile, low-toxic esters of fatty acids for cleaning purposes in offset printing has successfully been implemented in several European countries. Similar substitutions in other industrial cleaning processes seem possible, especially regarding...

  11. Mass spectrometric investigation of vinyl-substituted organic boron compounds

    International Nuclear Information System (INIS)

    Tarielashvili, V.O.; Ordzhonikidze, K.G.; Parulava, L.P.; Vakhaniya, G.V.

    1992-01-01

    Mass spectrometric investigation of vinyl-substituted organic compounds was conducted. Ionization was performed by electron shock. Possibility of determining boron isotope content is all analyzed organic boron vinyl-substituted compounds by direct method is shown. This simplifies sufficiently and lowers the price of analysis, improves its accuracy and rapidity

  12. Design, Synthesis and Insecticidal Activities of Novel Phenyl Substituted Isoxazolecarboxamides

    Institute of Scientific and Technical Information of China (English)

    LIU Peng-fei; ZHANG Ji-feng; YAN Tao; XIONG Li-xia; LI Zheng-ming

    2012-01-01

    Thirteen novel phenyl substituted isoxazolecarboxamides were synthesized,and their structures were characterized by 1H NMR,elementary analysis and high-resolution mass spectrometry(HRMS) techniques.Their evaluated insecticidal activities against oriental armyworm(Mythimna separata) indicate that the phcnyl substituted isoxazolecarboxamides exhibited moderate insecticidal activities,among which compounds 9c and 9k showed comparatively higher activities.

  13. Sublattice imbalance of substitutionally doped nitrogen in graphene

    DEFF Research Database (Denmark)

    Lawlor, James A.; Gorman, Paul D.; Power, Stephen

    2014-01-01

    Motivated by the recently observed sublattice asymmetry of substitutional nitrogen impurities in CVD grown graphene, we show, in a mathematically transparent manner, that oscillations in the local density of states driven by the presence of substitutional impurities are responsible for breaking......, but should be present in other impurities. (C) 2014 Elsevier Ltd. All rights reserved....

  14. Effect of Honey as Partial Sugar Substitute on Pasting Properties ...

    African Journals Online (AJOL)

    The effect of partial substitution of sugar with liquid honey on the pasting properties of cooked dough made from cassava-wheat composite (10:90) flour as well as the sensory preference and shelf stability of its bread was investigated. Sucrose (S) in the bread recipe formulation was substituted with honey (H) at levels 0, 10, ...

  15. Thermal stability of substitutional ag in CdTe

    NARCIS (Netherlands)

    Jahn, SG; Hofsass, H; Restle, M; Ronning, C; Quintel, H; BharuthRam, K; Wahl, U

    The thermal stability of substitutional Ag in CdTe was deduced from lattice location measurements at different temperatures. Substitutional Ag probe atoms were generated via transmutation doping from radioactive Cd isotopes. The lattice sites of Ag isotopes were determined by measuring the

  16. Influence of higher sodium substitutions on magnetic entropy ...

    Indian Academy of Sciences (India)

    The change in entropy also decreases with increase in substitution of sodium. A notable change ... of substituting elements for A and B ions, valence states of. Mn and the oxygen ... applied external magnetic field of 7 T.17 Sodium substitu- ..... Bohigas X, Tejada J, Del Barco E, Zhang X X and Sales M. 1998 Appl. Phys. Lett.

  17. 21 CFR 184.1259 - Cocoa butter substitute.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Cocoa butter substitute. 184.1259 Section 184.1259... FOR HUMAN CONSUMPTION (CONTINUED) DIRECT FOOD SUBSTANCES AFFIRMED AS GENERALLY RECOGNIZED AS SAFE Listing of Specific Substances Affirmed as GRAS § 184.1259 Cocoa butter substitute. (a) The common or...

  18. 76 FR 8666 - Substitution in Case of Death of Claimant

    Science.gov (United States)

    2011-02-15

    ... DEPARTMENT OF VETERANS AFFAIRS 38 CFR Parts 3, 14, 20 RIN 2900-AN91 Substitution in Case of Death... Veterans Affairs (VA) proposes to amend its regulations concerning adjudication of claims, representation..., not later than one year after the death of the claimant, request to be substituted for the claimant...

  19. Labour migration and substitution (updated) : Second, revised version

    NARCIS (Netherlands)

    Cremers, Jan

    2017-01-01

    This (revised) paper compares the outcomes of several national and international studies on substitution as a consequence of migrants entering the labour market. Substitution appears if finding a job by one person results in the job loss (or non-obtaining of a job) of another person. The recruitment

  20. Substitution as a Device of Grammatical Cohesion in English Contexts

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Hasannejad

    2012-05-01

    Full Text Available The present study set out to investigate the effect of teaching substitution as a kind of grammatical cohesion on the true identification of confusing substitution elements with cohesive or non-cohesive roles in different contexts and also the production of modal, reporting and conditional contexts through clausal substitution acquaintance. To this end, the following procedures were taken. First 120 male and female EFL students were selected from Iranshahr Azad University. Having administered the language proficiency test, researchers selected 80 students as intermediate subjects according to their TOEFL band scores. First, pretests of cohesion identification (substitution and production of modal, reporting and conditional environments were administered to both control and experimental groups. Then, the experimental group was exposed to the teaching of the above-said above-mentioned cohesive device. Finally, post-tests of substitution elements’ identification and modal, reporting and conditional contexts’ production through clausal substitution familiarity were administered. The results showed that cohesive device treatment helped students on the true identification of substitution elements. Another finding proved that EFL students might have no difficulty in learning certain rules or classification of rules and application of their clausal substitution knowledge in creating modal, reporting and conditional contexts. Our findings can have implications for the field of language learning and teaching.