WorldWideScience

Sample records for non-racemic sulfinyl imines

  1. Highly Stereoselective Methylene Transfers onto Butanediacetal-Protected Chiral Non-Racemic Sulfinyl Imines Using S-Ylide Technology

    Science.gov (United States)

    Bettigeri, Sampada V.; Pischek, Susanna C.

    2009-01-01

    Reaction of sulfur ylide with chiral non-racemic imine afforded the desired aziridine in excellent yield. Diastereomeric ratios of >95:5 were obtained. Both enantiomeric lines of the butanediacetal-protected chiral non-racemic sulfinyl imines were examined. The sulfur ylides were generated in situ upon thermal decarboxylation of carboxylmethyl betaine functionality. The enantiomeric pairs of D-mannitol with (S)-(-)-2-methyl-2-propane sulfinamide and ascorbic acid with (R)-(-)-2-methyl-2-propane sulfinamide resulted in the highest levels of diastereocontrol when performing aziridination reactions. PMID:19319433

  2. Application of P,N-sulfinyl imine ligands to iridium-catalyzed asymmetric hydrogenation of olefins.

    Science.gov (United States)

    Schenkel, Laurie B; Ellman, Jonathan A

    2004-03-19

    The utility of a novel class of P,N-ligands incorporating a chiral sulfinyl imine moiety is demonstrated in the iridium-catalyzed hydrogenation of both functionalized and unfunctionalized olefins, in which enantioselectivities of up to 94% are achieved. The modularity of the P,N-sulfinyl ligand class is highlighted by the facile preparation of a variety of sterically and electronically different ligands. Interesting structure-activity data for both the phosphine and sulfinamide components is provided by this expanded ligand set.

  3. Carbamoyl anion addition to N-sulfinyl imines: highly diastereoselective synthesis of α-amino amides.

    Science.gov (United States)

    Reeves, Jonathan T; Tan, Zhulin; Herbage, Melissa A; Han, Zhengxu S; Marsini, Maurice A; Li, Zhibin; Li, Guisheng; Xu, Yibo; Fandrick, Keith R; Gonnella, Nina C; Campbell, Scot; Ma, Shengli; Grinberg, Nelu; Lee, Heewon; Lu, Bruce Z; Senanayake, Chris H

    2013-04-17

    Carbamoyl anions, generated from N,N-disubstituted formamides and lithium diisopropylamide, add with high diastereoselectivity to chiral N-sulfinyl aldimines and ketimines to provide α-amino amides. The methodology enables the direct introduction of a carbonyl group without the requirement of unmasking steps as with other nucleophiles. The products may be converted to α-amino esters or 1,2-diamines. Iterative application of the reaction enabled the stereoselective synthesis of a dipeptide. Spectroscopic and computational studies support an anion structure with η(2) coordination of lithium by the carbonyl group.

  4. Non-racemic mixture model: a computational approach.

    Science.gov (United States)

    Polanco, Carlos; Buhse, Thomas

    2017-01-01

    The behavior of a slight chiral bias in favor of l-amino acids over d-amino acids was studied in an evolutionary mathematical model generating mixed chiral peptide hexamers. The simulations aimed to reproduce a very generalized prebiotic scenario involving a specified couple of amino acid enantiomers and a possible asymmetric amplification through autocatalytic peptide self-replication while forming small multimers of a defined length. Our simplified model allowed the observation of a small ascending but not conclusive tendency in the l-amino acid over the d-amino acid profile for the resulting mixed chiral hexamers in computer simulations of 100 peptide generations. This simulation was carried out by changing the chiral bias from 1% to 3%, in three stages of 15, 50 and 100 generations to observe any alteration that could mean a drastic change in behavior. So far, our simulations lead to the assumption that under the exposure of very slight non-racemic conditions, a significant bias between l- and d-amino acids, as present in our biosphere, was unlikely generated under prebiotic conditions if autocatalytic peptide self-replication was the main or the only driving force of chiral auto-amplification.

  5. Enantioselective reduction of ketones and imines catalyzed by (CN-box)Re(V)-oxo complexes.

    Science.gov (United States)

    Nolin, Kristine A; Ahn, Richard W; Kobayashi, Yusuke; Kennedy-Smith, Joshua J; Toste, F Dean

    2010-08-16

    The development and application of chiral, non-racemic Re(V)-oxo complexes to the enantioselective reduction of prochiral ketones is described. In addition to the enantioselective reduction of prochiral ketones, we report the application of these complexes to 1) a tandem Meyer-Schuster rearrangement/reduction to access enantioenriched allylic alcohols and 2) the enantioselective reduction of imines.

  6. Enantioselective sorption of the chiral fungicide metalaxyl on soil from non-racemic aqueous solutions: Environmental implications.

    Science.gov (United States)

    Celis, Rafael; Gámiz, Beatriz; Facenda, Gracia; Hermosín, María C

    2015-12-30

    Mechanisms governing the enantioselectivity of the processes that determine the behavior of chiral pollutants in the environment need to be better understood. Understanding these mechanisms should help improve predictions of the hazards and risks chiral compounds can pose to people and the environment. We report the results of batch sorption experiments indicating that the sorption of the chiral fungicide metalaxyl on soil from non-racemic initial solutions was enantioselective. While from a racemic initial solution the two enantiomers of metalaxyl were sorbed on the soil to the same extent, increasing the fraction of R-enantiomer in the initial solution led to enhanced sorption of this enantiomer and to reduced sorption of the S-enantiomer. Considering the shape of the sorption isotherms (S-type) and the sorption behavior of model sorbents, we attributed this effect to molecular interactions between metalaxyl enantiomer species at the sorbed state, where R-R metalaxyl interactions appeared to be more favorable than R-S metalaxyl interactions. We discuss important environmental implications of the proposed mechanism, such as those related to the fact that the biological degradation of metalaxyl is known to be an enantioselective process that can yield non-racemic residues in soils shortly after application of the fungicide as a racemic mixture. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. A General Method for Imine Formation Using B(OCH2CF3)3.

    Science.gov (United States)

    Reeves, Jonathan T; Visco, Michael D; Marsini, Maurice A; Grinberg, Nelu; Busacca, Carl A; Mattson, Anita E; Senanayake, Chris H

    2015-05-15

    Tris(2,2,2-trifluoroethyl)borate [B(OCH2CF3)3] was found to be a mild and general reagent for the formation of a variety of imines by condensation of amides or amines with carbonyl compounds. N-Sulfinyl, N-toluenesulfonyl, N-(dimethylamino)sulfamoyl, N-diphenylphosphinoyl, N-(α-methylbenzyl), and N-(4-methoxyphenyl) aldimines are all accessible using this reagent at room temperature. The reactions are operationally simple, and the products are obtained without special workup or isolation procedures.

  8. Catalytic imine-imine cross-coupling reactions.

    Science.gov (United States)

    Matsumoto, Masatoshi; Harada, Masashi; Yamashita, Yasuhiro; Kobayashi, Shū

    2014-11-07

    We report here efficient catalytic imine-imine cross-coupling reactions based on an umpolung strategy; an imine bearing a 9-fluorenyl moiety on its nitrogen atom, which acted as a nucleophile, reacted with another imine to afford an imine-imine cross-coupling adduct in high yield. Furthermore, a chiral guanidine acted as a chiral catalyst for these coupling reactions, and optically active 1,2-diamines were obtained in high yields with high enantioselectivities.

  9. Radical aminomethylation of imines.

    Science.gov (United States)

    Fujii, Shintaro; Konishi, Takehito; Matsumoto, Yusuke; Yamaoka, Yousuke; Takasu, Kiyosei; Yamada, Ken-Ichi

    2014-09-05

    Taking advantage of the high level of performance of N-alkoxycarbonyl-imines, we achieved the first example of addition of the aminomethyl radical to imine. The reaction efficiency depended on the structure of the radical precursor, whether it is an iodide or a xanthate, and an electron-withdrawing group on the nitrogen atom of the radical. This reaction allows direct introduction of an N-substituted aminomethyl group onto imine to provide 1,2-diamine as well as the short-step synthesis of ICI-199,441.

  10. Method of producing imines

    Science.gov (United States)

    Sithambaram, Shanthakumar; Son, Young-Chan; Suib, Steven L.

    2008-04-08

    A method for forming an imine comprises reacting a first reactant comprising a hydroxyl functionality, a carbonyl functionality, or both a hydroxyl functionality and a carbonyl functionality with a second reactant having an amine functionality in the presence of ordered porous manganese-based octahedral molecular sieves and an oxygen containing gas at a temperature and for a time sufficient for the imine to be produced.

  11. Non-racemic Amino Acid Production by Ultraviolet Irradiation of Achiral Interstellar Ice Analogs with Circularly Polarized Light

    Science.gov (United States)

    de Marcellus, Pierre; Meinert, Cornelia; Nuevo, Michel; Filippi, Jean-Jacques; Danger, Grégoire; Deboffle, Dominique; Nahon, Laurent; Le Sergeant d'Hendecourt, Louis; Meierhenrich, Uwe J.

    2011-02-01

    The delivery of organic matter to the primitive Earth via comets and meteorites has long been hypothesized to be an important source for prebiotic compounds such as amino acids or their chemical precursors that contributed to the development of prebiotic chemistry leading, on Earth, to the emergence of life. Photochemistry of inter/circumstellar ices around protostellar objects is a potential process leading to complex organic species, although difficult to establish from limited infrared observations only. Here we report the first abiotic cosmic ice simulation experiments that produce species with enantiomeric excesses (e.e.'s). Circularly polarized ultraviolet light (UV-CPL) from a synchrotron source induces asymmetric photochemistry on initially achiral inter/circumstellar ice analogs. Enantioselective multidimensional gas chromatography measurements show significant e.e.'s of up to 1.34% for (13C)-alanine, for which the signs and absolute values are related to the helicity and number of CPL photons per deposited molecule. This result, directly comparable with some L excesses measured in meteorites, supports a scenario in which exogenous delivery of organics displaying a slight L excess, produced in an extraterrestrial environment by an asymmetric astrophysical process, is at the origin of biomolecular asymmetry on Earth. As a consequence, a fraction of the meteoritic organic material consisting of non-racemic compounds may well have been formed outside the solar system. Finally, following this hypothesis, we support the idea that the protosolar nebula has indeed been formed in a region of massive star formation, regions where UV-CPL of the same helicity is actually observed over large spatial areas.

  12. Enantioselective imine reduction catalyzed by imine reductases and artificial metalloenzymes.

    Science.gov (United States)

    Gamenara, Daniela; Domínguez de María, Pablo

    2014-05-21

    Adding value to organic synthesis. Novel imine reductases enable the enantioselective reduction of imines to afford optically active amines. Likewise, novel bioinspired artificial metalloenzymes can perform the same reaction as well. Emerging proof-of-concepts are herein discussed.

  13. Catalytic Hydrogenation ofα,β-Epoxyketones to β-Hydroxy-ketones with Two Sulfinyl Analogues of Coenzyme NADH Models

    Institute of Scientific and Technical Information of China (English)

    XIE,Kun; GUI,Yi; LIU,You-Cheng; FU,Yao

    2007-01-01

    An efficient method for the selective hydrogenation of a series of α,β-epoxyketones to β-hydroxyketones using catalytic amount of two sulfinyl analogues of NAD+ model compounds is reported. The lack of any diastereoselectivily for the formation of β-hydroxyketones with optically pure sulfinyl analogue of NAD+ model supports the radical mechanism proposed previously.

  14. Dynamic imine chemistry.

    Science.gov (United States)

    Belowich, Matthew E; Stoddart, J Fraser

    2012-03-21

    Formation of an imine--from an amine and an aldehyde--is a reversible reaction which operates under thermodynamic control such that the formation of kinetically competitive intermediates are, in the fullness of time, replaced by the thermodynamically most stable product(s). For this fundamental reason, the imine bond has emerged as an extraordinarily diverse and useful one in the hands of synthetic chemists. Imine bond formation is one of a handful of reactions which define a discipline known as dynamic covalent chemistry (DCC), which is now employed widely in the construction of exotic molecules and extended structures on account of the inherent 'proof-reading' and 'error-checking' associated with these reversible reactions. While both supramolecular chemistry and DCC operate under the regime of reversibility, DCC has the added advantage of constructing robust molecules on account of the formation of covalent bonds rather than fragile supermolecules resulting from noncovalent bonding interactions. On the other hand, these products tend to require more time to form--sometimes days or even months--but their formation can often be catalysed. In this manner, highly symmetrical molecules and extended structures can be prepared from relatively simple precursors. When DCC is utilised in conjunction with template-directed protocols--which rely on the use of noncovalent bonding interactions between molecular building blocks in order to preorganise them into certain relative geometries as a prelude to the formation of covalent bonds under equilibrium control--an additional level of control of structure and topology arises which offers a disarmingly simple way of constructing mechanically-interlocked molecules, such as rotaxanes, catenanes, Borromean rings, and Solomon knots. This tutorial review focuses on the use of dynamic imine bonds in the construction of compounds and products formed with and without the aid of additional templates. While synthesis under thermodynamic

  15. Imine reductases (IREDs).

    Science.gov (United States)

    Mangas-Sanchez, Juan; France, Scott P; Montgomery, Sarah L; Aleku, Godwin A; Man, Henry; Sharma, Mahima; Ramsden, Jeremy I; Grogan, Gideon; Turner, Nicholas J

    2017-04-01

    Imine reductases (IREDs) have emerged as a valuable new set of biocatalysts for the asymmetric synthesis of optically active amines. The development of bioinformatics tools and searchable databases has led to the identification of a diverse range of new IRED biocatalysts that have been characterised and employed in different synthetic processes. This review describes the latest developments in the structural and mechanistic aspects of IREDs, together with synthetic applications of these enzymes, and identifies ongoing and future challenges in the field. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Sulfoxide-directed intramolecular [4 + 2] cycloadditions between 2-sulfinyl butadienes and unactivated alkynes.

    Science.gov (United States)

    Fernández de la Pradilla, Roberto; Tortosa, Mariola; Castellanos, Esther; Viso, Alma; Baile, Raquel

    2010-03-05

    Sulfinyl dienynes undergo thermal and catalyzed IMDA cycloadditions, often at room temperature, to produce cyclohexa-1,4-dienes with good yields and high selectivities. Additionally, the products preserve a synthetically useful vinyl sulfoxide functionality. The selective manipulation of the double bonds in the cycloadducts has also been examined in this work.

  17. An efficient synthesis of spiro--lactams having sulfenyl, sulfinyl and sulfonyl moiety

    Indian Academy of Sciences (India)

    Reshma; Renu Arora; Geeta Hundal; Aman Bhalla; S S Bari

    2015-11-01

    An efficient and a facile route to spiro--lactams is described. 3-allyl-3-methylthio--lactams, which are synthesized through a Lewis acid mediated C-3 alkylation of the trans-3-chloro-3-methylthio--lactams, undergo a facile intrasulfenyl cyclization reaction in the presence of halogens like bromine and iodine to give spiro -lactams in good yield. These halospiro--lactams are then subjected to dehalogenation reaction using Raney-nickel. The resulting spiro--lactams are further transformed into their sulfinyl and sulfonyl derivatives by using -chloroperbenzoic acid as an oxidant.

  18. Asymmetric synthesis of substituted homotropinones from N-sulfinyl beta-amino ketone ketals. (-)-Euphococcinine and (-)-adaline.

    Science.gov (United States)

    Davis, Franklin A; Edupuganti, Ram

    2010-02-19

    Sulfinimine-derived N-sulfinyl beta-amino ketone ketals on heating with NH(4)OAc:HOAc undergo a four-step intramolecular Mannich cyclization cascade reaction to give homotropinones, such as (-)-euphococcinine, in excellent yields as single isomers.

  19. Elucidation of Structural Elements for Selectivity across Monoamine Transporters: Novel 2-[(Diphenylmethyl)sulfinyl]acetamide (Modafinil) Analogues

    DEFF Research Database (Denmark)

    Okunola-Bakara, Oluyomi; Cao, Jianjing; Kopajtic, Theresa;

    2014-01-01

    2-[(Diphenylmethyl)sulfinyl]acetamide (modafinil, (±)-1) is a unique dopamine uptake inhibitor that binds the dopamine transporter (DAT) differently than cocaine and may have potential for the treatment of psychostimulant abuse. To further investigate structural requirements for this divergent bi...

  20. Catalytic asymmetric umpolung reactions of imines

    Science.gov (United States)

    Wu, Yongwei; Hu, Lin; Li, Zhe; Deng, Li

    2015-07-01

    The carbon-nitrogen double bonds in imines are fundamentally important functional groups in organic chemistry. This is largely due to the fact that imines act as electrophiles towards carbon nucleophiles in reactions that form carbon-carbon bonds, thereby serving as one of the most widely used precursors for the formation of amines in both synthetic and biosynthetic settings. If the carbon atom of the imine could be rendered electron-rich, the imine could react as a nucleophile instead of as an electrophile. Such a reversal in the electronic characteristics of the imine functionality would facilitate the development of new chemical transformations that convert imines into amines via carbon-carbon bond-forming reactions with carbon electrophiles, thereby creating new opportunities for the efficient synthesis of amines. The development of asymmetric umpolung reactions of imines (in which the imines act as nucleophiles) remains uncharted territory, in spite of the far-reaching impact such reactions would have in organic synthesis. Here we report the discovery and development of new chiral phase-transfer catalysts that promote the highly efficient asymmetric umpolung reactions of imines with the carbon electrophile enals. These catalysts mediate the deprotonation of imines and direct the 2-azaallyl anions thus formed to react with enals in a highly chemoselective, regioselective, diastereoselective and enantioselective fashion. The reaction tolerates a broad range of imines and enals, and can be carried out in high yield with as little as 0.01 mole per cent catalyst with a moisture- and air-tolerant operational protocol. These umpolung reactions provide a conceptually new and practical approach to chiral amino compounds.

  1. Asymmetric Ketone Reduction by Imine Reductases.

    Science.gov (United States)

    Lenz, Maike; Meisner, Jan; Quertinmont, Leann; Lutz, Stefan; Kästner, Johannes; Nestl, Bettina M

    2017-02-01

    The rapidly growing area of asymmetric imine reduction by imine reductases (IREDs) has provided alternative routes to chiral amines. Here we report the expansion of the reaction scope of IREDs by showing the stereoselective reduction of 2,2,2-trifluoroacetophenone. Assisted by an in silico analysis of energy barriers, we evaluated asymmetric hydrogenations of carbonyls and imines while considering the influence of substrate reactivity on the chemoselectivity of this novel class of reductases. We report the asymmetric reduction of C=N as well as C=O bonds catalysed by members of the IRED enzyme family. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Design, synthesis and applications of chiral N-2-phenyl-2-propyl sulfinyl imines for Group-Assisted Purification (GAP) asymmetric synthesis

    Science.gov (United States)

    Pindi, Suresh; Wu, Jianbin; Li, Guigen

    2013-01-01

    A new chiral (Rs)-2-phenyl-2-propyl sulfinamide has been designed and synthesized; its derived aldimines and ketimines have been applied for asymmetric addition reaction with allylmagnesium bromide. The reaction was conveniently performed at room temperature to give a series of homoallylic amines in high yields (up to quant) and diastereoselectivity (up to >99 % de). The pure products were obtained by relying on Group-Assisted Purification (GAP) chemistry to avoid traditional purification methods of column chromatography or recrystallization. The conversion of disulfide to (Rs)-thiosulfinate was also confirmed to be of the GAP chemistry in which washing crude product can generate pure enantiomer. The absolute stereochemistry has been determined by X-ray analysis. PMID:23496279

  3. Stereoselective addition of 2-phenyloxazol-4-yl trifluoromethanesulfonate to N-sulfinyl imines: application to the synthesis of the HCV protease inhibitor boceprevir.

    Science.gov (United States)

    Morris, William J; Muppalla, Kiran K; Cowden, Cameron; Ball, Richard G

    2013-01-18

    The stereoselective addition of 2-phenyloxazol-4-yl trifluoromethanesulfonate to N-sulfinylimines is described. Vinyl anions derived from enol triflate 2 undergo 1,2-addition with a variety of aldimines to afford the corresponding secondary sulfonamides as single diastereomers. The absolute stereochemistry was confirmed by X-ray crystallography which provides support that the reaction proceeds through an open, nonchelate transition state. This methodology has been applied to the synthesis of the ketoamide fragment of the protease inhibitor boceprevir.

  4. Enzyme toolbox: novel enantiocomplementary imine reductases.

    Science.gov (United States)

    Scheller, Philipp N; Fademrecht, Silvia; Hofelzer, Sebastian; Pleiss, Jürgen; Leipold, Friedemann; Turner, Nicholas J; Nestl, Bettina M; Hauer, Bernhard

    2014-10-13

    Reducing reactions are among the most useful transformations for the generation of chiral compounds in the fine-chemical industry. Because of their exquisite selectivities, enzymatic approaches have emerged as the method of choice for the reduction of C=O and activated C=C bonds. However, stereoselective enzymatic reduction of C=N bonds is still in its infancy-it was only recently described after the discovery of enzymes capable of imine reduction. In our work, we increased the spectrum of imine-reducing enzymes by database analysis. By combining the currently available knowledge about the function of imine reductases with the experimentally uncharacterized diversity stored in protein sequence databases, three novel imine reductases with complementary enantiopreference were identified along with amino acids important for catalysis. Furthermore, their reducing capability was demonstrated by the reduction of the pharmaceutically relevant prochiral imine 2-methylpyrroline. These novel enzymes exhibited comparable to higher catalytic efficiencies than previously described enzymes, and their biosynthetic potential is highlighted by the full conversion of 2-methylpyrroline in whole cells with excellent selectivities. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Dramatic Influence of Ionic Liquid and Ultrasound Irradiation on the Electrophilic Sulfinylation of Aromatic Compounds by Sulfinic Esters

    Directory of Open Access Journals (Sweden)

    Ngoc-Lan Thi Nguyen

    2017-09-01

    Full Text Available The sulfinylation reaction of aromatic and hetero-aromatic compounds with sulfinic esters as electrophiles has been investigated in different ionic liquids and by means of different Lewis acid salts in order to get moderate to good yields of asymmetrical sulfoxides. Mixtures of 1-butyl-3-methylimidazolium chloride and aluminum chloride were found to be the most efficient and recyclable reaction framework. Ultrasound sonication appeared to be the most useful and green activation method to afford the sulfoxides in yields better than or equivalent to those obtained under the longer-lasting conventional stirring conditions.

  6. An (R)-Imine Reductase Biocatalyst for the Asymmetric Reduction of Cyclic Imines.

    Science.gov (United States)

    Hussain, Shahed; Leipold, Friedemann; Man, Henry; Wells, Elizabeth; France, Scott P; Mulholland, Keith R; Grogan, Gideon; Turner, Nicholas J

    2015-02-01

    Although the range of biocatalysts available for the synthesis of enantiomerically pure chiral amines continues to expand, few existing methods provide access to secondary amines. To address this shortcoming, we have over-expressed the gene for an (R)-imine reductase [(R)-IRED] from Streptomyces sp. GF3587 in Escherichia coli to create a recombinant whole-cell biocatalyst for the asymmetric reduction of prochiral imines. The (R)-IRED was screened against a panel of cyclic imines and two iminium ions and was shown to possess high catalytic activity and enantioselectivity. Preparative-scale synthesis of the alkaloid (R)-coniine (90 % yield; 99 % ee) from the imine precursor was performed on a gram-scale. A homology model of the enzyme active site, based on the structure of a closely related (R)-IRED from Streptomyces kanamyceticus, was constructed and used to identify potential amino acids as targets for mutagenesis.

  7. On a result of Imin Chen

    CERN Document Server

    Edixhoven, B

    1996-01-01

    We give another proof of Imin Chen's result that the jacobian of the modular curve X(p)_{non-split}, for p a prime number, is isogeneous to the new part of the jacobian of X_0(p^2), using only the representation theory of the group GL_2(Z/pZ). In fact, we prove a generalization of Chen's result for objects with an action by GL_2(Z/pZ) in any pseudo-abelian Q-linear category.

  8. Silyl Ketene Imines: Highly Versatile Nucleophiles for Catalytic, Asymmetric Synthesis

    Science.gov (United States)

    Denmark, Scott E.; Wilson, Tyler W.

    2012-01-01

    This Minireview provides an overview on the development of silyl ketene imines and their recent applications in catalytic, enantioselective reactions. The unique structure of the ketene imine allows a diverse range of reactivity patterns and provides solutions to existing challenges in the enantioselective construction of quaternary stereogenic carbon centers and cross-benzoin adducts. A variety of reactions for which silyl ketene imines have been applied are presented with an overall goal of inspiring new uses for these underutilized nucleophiles. PMID:22968901

  9. Titanium(IV) imido complexes of imine imidazol-2-imine ligands.

    Science.gov (United States)

    Dastgir, Sarim; Lavoie, Gino G

    2012-08-28

    Free imine imidazol-2-imine ligands with two different substitution patterns have been isolated for the first time and they were found to exist as an equilibrium mixture of geometric and mesomeric isomers. The relative ratios of these isomers are dependent on both the nature of the substituents and of the solvent. The synthesis of the titanium(IV) alkyl and arylimido complexes of these ligands was unexpectedly found to be very selective and was successfully achieved only with the lesser sterically-demanding 2,4,6-trimethylphenyl derivative IMesN^Imine 2a. The solid-state structure of the alkylimido complex further confirms the zwitterionic character of the ligand. The isolated titanium imido complexes were found to be active catalysts for the polymerisation of ethylene.

  10. Synthesis and antiulcer activity of 2-[5-substituted-1--benzo(d) imidazol-2-yl sulfinyl]methyl-3-substituted quinazoline-4-(3) ones

    Indian Academy of Sciences (India)

    Avinash Patil; Swastika Ganguly; Sanjay Surana

    2010-05-01

    2-[5-substituted-1--benzo(d)imidazol-2-yl sulfinyl]methyl-3-substituted quinazoline-4-(3)-one derivatives were synthesized and tested for antiulcer activity against pylorus ligation-induced, aspirin induced and ethanol induced ulcer in rat model. All the synthesized compounds were characterized by using IR, MS and 1H NMR spectral and elemental analysis. The compounds were scramed for their antiulcer activity: compounds 5k and 5n showed higher activity than omeprazole used as standard.

  11. Gas-phase reactivity of peptide thiyl (RS•), perthiyl (RSS•), and sulfinyl (RSO•) radical ions formed from atmospheric pressure ion/radical reactions.

    Science.gov (United States)

    Tan, Lei; Xia, Yu

    2013-04-01

    In this study, we demonstrated the formation of gas-phase peptide perthiyl (RSS•) and thiyl (RS•) radical ions besides sulfinyl radical (RSO•) ions from atmospheric pressure (AP) ion/radical reactions of peptides containing inter-chain disulfide bonds. The identity of perthiyl radical was verified from characteristic 65 Da (•SSH) loss in collision-induced dissociation (CID). This signature loss was further used to assess the purity of peptide perthiyl radical ions formed from AP ion/radical reactions. Ion/molecule reactions combined with CID were carried out to confirm the formation of thiyl radical. Transmission mode ion/molecule reactions in collision cell (q2) were developed as a fast means to estimate the population of peptide thiyl radical ions. The reactivity of peptide thiyl, perthiyl, and sulfinyl radical ions was evaluated based on ion/molecule reactions toward organic disulfides, allyl iodide, organic thiol, and oxygen, which followed in order of thiyl (RS•) > perthiyl (RSS•) > sulfinyl (RSO•). The gas-phase reactivity of these three types of sulfur-based radicals is consistent with literature reports from solution studies.

  12. In situ generation of N-unsubstituted imines from alkyl azides and their applications for imine transfer via copper catalysis.

    Science.gov (United States)

    Hu, Lu; Liu, Yahu A; Liao, Xuebin

    2017-08-01

    Although azides have been widely used in nitrene transfer reactions, in situ generation of N-H imines from azides for downstream transformations has rarely been explored. We report copper-mediated formation of N-unsubstituted aliphatic imines from easily available aliphatic azides using a customized phenanthroline-based ligand (L1*). Through trapping in situ-generated N-H imines, multisubstituted pyridines or indoles were readily synthesized. (13)C-labeled azide was used as part of an isotope labeling study, which suggests that the construction of pyridine derivatives involves a three-component dehydrogenative condensation. The construction of 2,3,5-triaryl pyridines using this method provided evidence supporting a proposed pathway involving both imine formation and abnormal Chichibabin pyridine synthesis. The generation of N-unsubstituted imine intermediates was also confirmed by formation of indole derivatives from alkyl azides.

  13. In situ generation of N-unsubstituted imines from alkyl azides and their applications for imine transfer via copper catalysis

    Science.gov (United States)

    Hu, Lu; Liu, Yahu A.; Liao, Xuebin

    2017-01-01

    Although azides have been widely used in nitrene transfer reactions, in situ generation of N-H imines from azides for downstream transformations has rarely been explored. We report copper-mediated formation of N-unsubstituted aliphatic imines from easily available aliphatic azides using a customized phenanthroline-based ligand (L1*). Through trapping in situ–generated N-H imines, multisubstituted pyridines or indoles were readily synthesized. 13C-labeled azide was used as part of an isotope labeling study, which suggests that the construction of pyridine derivatives involves a three-component dehydrogenative condensation. The construction of 2,3,5-triaryl pyridines using this method provided evidence supporting a proposed pathway involving both imine formation and abnormal Chichibabin pyridine synthesis. The generation of N-unsubstituted imine intermediates was also confirmed by formation of indole derivatives from alkyl azides. PMID:28808683

  14. Amine(imine)diphosphine iron catalysts for asymmetric transfer hydrogenation of ketones and imines.

    Science.gov (United States)

    Zuo, Weiwei; Lough, Alan J; Li, Young Feng; Morris, Robert H

    2013-11-29

    A rational approach is needed to design hydrogenation catalysts that make use of Earth-abundant elements to replace the rare elements such as ruthenium, rhodium, and palladium that are traditionally used. Here, we validate a prior mechanistic hypothesis that partially saturated amine(imine)diphosphine ligands (P-NH-N-P) activate iron to catalyze the asymmetric reduction of the polar bonds of ketones and imines to valuable enantiopure alcohols and amines, with isopropanol as the hydrogen donor, at turnover frequencies as high as 200 per second at 28°C. We present a direct synthetic approach to enantiopure ligands of this type that takes advantage of the iron(lI) ion as a template. The catalytic mechanism is elucidated by the spectroscopic detection of iron hydride and amide intermediates.

  15. Enhanced reactivities toward amines by introducing an imine arm to the pincer ligand: Direct coupling of two amines to form an imine without oxidant

    KAUST Repository

    He, Lipeng

    2012-07-23

    Dehydrogenative homocoupling of primary alcohols to form esters and coupling of amines to form imines was accomplished using a class of novel pincer ruthenium complexes. The reactivities of the ruthenium pincer complexes for the direct coupling of amines to form imines were enhanced by introducing an imine arm to the pincer ligand. Selective oxidation of benzylamines to imines was achieved using aniline derivatives as the substrate and solvent. © 2012 American Chemical Society.

  16. Hydride, hydrogen, proton, and electron affinities of imines and their reaction intermediates in acetonitrile and construction of thermodynamic characteristic graphs (TCGs) of imines as a "molecule ID card".

    Science.gov (United States)

    Zhu, Xiao-Qing; Liu, Qiao-Yun; Chen, Qiang; Mei, Lian-Rui

    2010-02-01

    A series of 61 imines with various typical structures were synthesized, and the thermodynamic affinities (defined as enthalpy changes or redox potentials in this work) of the imines to abstract hydride anions, hydrogen atoms, and electrons, the thermodynamic affinities of the radical anions of the imines to abstract hydrogen atoms and protons, and the thermodynamic affinities of the hydrogen adducts of the imines to abstract electrons in acetonitrile were determined by using titration calorimetry and electrochemical methods. The pure heterolytic and homolytic dissociation energies of the C=N pi-bond in the imines were estimated. The polarity of the C=N double bond in the imines was examined using a linear free-energy relationship. The idea of a thermodynamic characteristic graph (TCG) of imines as an efficient "Molecule ID Card" was introduced. The TCG can be used to quantitatively diagnose and predict the characteristic chemical properties of imines and their various reaction intermediates as well as the reduction mechanism of the imines. The information disclosed in this work could not only supply a gap of thermodynamics for the chemistry of imines but also strongly promote the fast development of the applications of imines.

  17. 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides.

    Science.gov (United States)

    Marchán, Vicente; Cieślak, Jacek; Livengood, Victor; Beaucage, Serge L

    2004-08-11

    Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.

  18. Adsorption-driven self-sorting of dynamic imine libraries.

    Science.gov (United States)

    Hsu, Chia-Wei; Miljanić, Ognjen Š

    2015-02-09

    Differences in adsorption among the components of complex mixtures play a role in separations, surface-based sensing, and heterogeneous catalysis, and have been implicated in theories of the origin of life. Herein, we consider mixtures of imines and we show that if such complex mixtures are also dynamic-that is, if their components equilibrate among themselves-then they can dramatically simplify in composition during the course of column chromatography. As they travel down the column, imines continuously trade their aldehyde and amine constituents, favoring the formation of molecules with extremes of polarity at the expense of species with intermediate polarities. Iterative application of this principle leads to simplification of imine libraries containing up to 16 members into 4 major products. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Bicyclic Pyrazolidinone Derivatives from Diastereoselective Catalytic [3 + 3]-Cycloaddition Reactions of Enoldiazoacetates with Azomethine Imines

    Science.gov (United States)

    Qian, Yu; Zavalij, Peter J.; Hu, Wenhao; Doyle, Michael P.

    2013-01-01

    A highly regio- and diastereoselective synthesis of bicyclic pyrazolidinone derivatives by rhodium(II) acetate catalyzed [3+3]-annulation with enoldiazoacetates and azomethine imines has been achieved in high yield. A vinylogous reaction of the metal enol carbene with the azomethine imine initiates [3 + 3]-cycloaddition, whereas reaction at the carbene center effects N-N-cleavage of the azomethine imine. PMID:23477672

  20. Chiral N-phosphonyl imine chemistry:asymmetric additions of glycine enolate to diphenyl diamine-based phosphonyl imines

    Institute of Scientific and Technical Information of China (English)

    PINDI; Suresh; KATTAMURI; Padmanabha; V.

    2010-01-01

    Diphenyl diamine-based phosphonyl imines attached by the N-isopropyl group in the auxiliary have been synthesized in good yields under convenient reaction conditions.These new chiral N-phosphonyl imines can react with glycine enolate smoothly to give chiral α-β diamino esters in good yields(72%-90%) and up to excellent diastereoselectivity(>99:1 dr).By treatment with HBr,the chiral auxiliary can be readily removed.The absolute structure has been unambiguously determined by converting a product to a known sample.

  1. Asymmetric and symmetric bolaform supra-amphiphiles: formation of imine bond influenced by aggregation.

    Science.gov (United States)

    Wang, Guangtong; Wu, Guanglu; Wang, Zhiqiang; Zhang, Xi

    2014-02-18

    A series of bolaform supra-amphilphiles with different symmetries were fabricated through dynamic benzoic imine bond formation. The pH dependence of imine formations of these supra-amphiphiles were characterazied. We found that the extent of the imine formation of these supra-amphiphies were different. The supra-amphiphiles with a poorer symmetry always exhibited a lower imine formation at a given pH. Therefore, the varied extent of imine bond formation indicate the different aggregations of these supra-amphilphiles, which are controlled by the molecular symmetry of the supra-amphiphiles.

  2. Well-defined silica-supported zirconium–imido complexes mediated heterogeneous imine metathesis

    KAUST Repository

    Hamzaoui, Bilel

    2016-02-15

    Upon prolonged thermal exposure under vacuum, a well-defined single-site surface species [(≡Si-O-)Zr(NEt2)3] (1) evolves into an ethylimido complex [(≡Si-O-)Zr(=NEt)NEt2] (2). Reactions of 2 with an imine substrate result in imido/imine (=NRi, R: Et, Ph) exchange (metathesis) with the formation of [(≡Si-O-)Zr(=NPh)NEt2] (3). Compounds 2 and 3 effectively catalyze imine/imine cross-metathesis and are thus considered as the first heterogeneous catalysts active for imine metathesis. © The Royal Society of Chemistry 2016.

  3. Asymmetric phase-transfer-catalyzed conjugate addition of glycine imine to exocyclic α,β-unsaturated ketones: construction of polycyclic imines containing three stereocenters.

    Science.gov (United States)

    Nie, Jing; Hua, Ming-Qing; Xiong, Heng-Ying; Zheng, Yan; Ma, Jun-An

    2012-05-04

    We developed a facile, one-pot, multistep transformation between glycine imine and exocyclic α,β-unsaturated ketones in reactions catalyzed by chiral phase-transfer catalysts (PTC). A series of polycyclic imines containing three adjacent stereocenters were obtained in good to high yields with high diastereo- and enantioselectivities. Further transformation of the imines could afford N-fused polycyclic compounds with four adjacent stereocenters.

  4. Cyclic imines: chemistry and mechanism of action: a review.

    Science.gov (United States)

    Otero, Alberto; Chapela, María-José; Atanassova, Miroslava; Vieites, Juan M; Cabado, Ana G

    2011-11-21

    In recent years, there has been an increase in the production of shellfish and in global demand for seafood as nutritious and healthy food. Unfortunately, a significant number of incidences of shellfish poisoning occur worldwide, and microalgae that produce phycotoxins are responsible for most of these. Phycotoxins include several groups of small to medium sized natural products with molecular masses ranging from 300 to over 3000 Da. Cyclic imines (CIs) are a recently discovered group of marine biotoxins characterized by their fast acting toxicity, inducing a characteristic rapid death in the intraperitoneal mouse bioassay. These toxins are macrocyclic compounds with imine (carbon-nitrogen double bond) and spiro-linked ether moieties. They are grouped together due to the imino group functioning as their common pharmacore and due to the similarities in their intraperitoneal toxicity in mice. Spirolides (SPXs) are the largest group of CIs cyclic imines that together with gymnodimines (GYMs) are best characterized. Although the amount of cyclic imines in shellfish is not regulated and these substances have not been categorically linked to human intoxication, they trigger high intraperitoneal toxicity in rodents. In this review, the corresponding chemical structures of each member of the CIs and their derivatives are reviewed as well as all the data accumulated on their mechanism of action at cellular level.

  5. Enhanced Ionic Conductivity of Poly(Ethylene Imine) Phosphate

    DEFF Research Database (Denmark)

    Senadeera, G.K.R.; Careem, M.A.; Skaarup, Steen;

    1996-01-01

    The conductivity of mixtures of phosphoric acid with poly(ethylene imine) has been studied, and it was found that the conductivity of such mixtures with high acid content can be enhanced by the addition of highly dispersed silica (fumed silica). At the same time, silica addition increases the sti...

  6. Heck-type reactions of imine derivatives: a DFT study.

    Science.gov (United States)

    Li, Zhe; Fu, Yao; Zhang, Song-Lin; Guo, Qing-Xiang; Liu, Lei

    2010-06-01

    The mechanism of a recently discovered intramolecular Heck-type coupling of oximes with aryl halides (Angew. Chem. Int. Ed. 2007, 46, 6325) was systematically studied by using density functional methods enhanced with a polarized continuum solvation model. The overall catalytic cycle of the reaction was found to consist of four steps: oxidative addition, migratory insertion, beta-H elimination, and catalyst regeneration, whereas an alternative base-promoted C-H activation pathway was determined to be less favorable. Migratory insertion was found to be the rate determining step in the catalytic cycle. The apparent activation barrier of migratory insertion of the (E)-oxime was +20.5 kcal mol(-1), whereas the barrier of (Z)-oxime was as high as +32.7 kcal mol(-1). However, (Z)-oxime could isomerize to form the more active (E)-oxime with the assistance of K(2)CO(3), so that both the (E)- and (Z)-oxime substrates could be transformed to the desired product. Our calculations also indicated that the Z product was predominant in the equilibrium of the isomerization of the imine double bond, which constituted the reason for the good Z-selectivity observed for the reaction. Furthermore, we examined the difference between the intermolecular Heck-type reactions of imines and of olefins. It was found that in the intermolecular Heck-type coupling of imines, the apparent activation barrier of migratory insertion was as high as +35 kcal mol(-1), which should be the main obstacle of the reaction. The analysis also revealed the main problem for the intermolecular Heck-type reactions of imines, which was that the breaking of a C=N pi bond was much more difficult than the breaking of a C=C pi bond. After systematic examination of a series of substituted imines, (Z)-N-amino imine and N-acetyl imine were found to have relatively low barriers of migratory insertion, so that they might be possible substrates for intermolecular Heck-type coupling.

  7. Chiral N-phosphonyl imine chemistry: asymmetric synthesis of alpha-alkyl beta-amino ketones by reacting phosphonyl imines with ketone-derived enolates.

    Science.gov (United States)

    Ai, Teng; Han, Jianlin; Chen, Zhong-Xiu; Li, Guigen

    2009-02-01

    A series of new chiral syn-alpha-branched beta-amino ketones has been synthesized by reacting chiral phosphonyl imines with ketone-derived enolates. The N-protection group on imine auxiliary was found to be crucial to the asymmetric induction. The absolute stereochemistry has been unambiguously determined by converting a product to a known sample.

  8. Synthesis of 2-azaanthracenes via a sequential Sonogashira coupling/alkynyl imine-allenyl imine isomerization/aza-Diels-Alder/elimination-aromatization reaction.

    Science.gov (United States)

    Cao, Jian; Yang, Xiongfa; Hua, Xilin; Deng, Yuan; Lai, Guoqiao

    2011-02-04

    An interesting sequential Sonogashira coupling/alkynyl imine-allenyl imine isomerization/aza-Diels-Alder/elimination-aromatization reaction, providing a facile synthesis of substituted 2-azaanthracenes from 1,6-diynes and imidoyl chlorides, is reported. The easy procedure accessing the products efficiently from readily available starting materials may imply a potential synthetic application.

  9. Quantum chemical study on asymmetric catalysis reduction of imine

    Institute of Scientific and Technical Information of China (English)

    LI; Ming; (李明); TIAN; Anmin; (田安民)

    2003-01-01

    The quantum chemical method is employed to study the enantioselective reduction of imine with borane catalyzed by chiral oxazaborolidine. All the structures are optimized completely at the B3LYP/6-31G(d) level. The catalysis property of oxazaborolidine is notable. The reduction goes mainly through the formations of the catalyst-borane adduct, the catalyst-borane-imine adduct, and the catalyst-amidoborane adduct and the dissociation of the catalyst-amidoborane adduct with the regeneration of the catalyst. The controlling step for the reduction is the dissociation of the catalyst-amidoborane adduct. The main reduced product predicted theoretically is (R )-sec- ondary amine, which is in agreement with the experiment.

  10. Study on Unexpected Cycloaddition Reactions of Imines with THF

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    An unexpected tricyclic compound 2,3,3a,4,5,9b-hexahydrophenylfuro[3,2-c] quinoline 4 and its aromatized product 6 were obtained when the cycloaddtion of imine 1 and substituted norbornene 2 was carried out in THF with a catalytic amount of boron trifluoride. The structures of the products were determined by spectral data, and the mechanism of reaction was substantiated by the imitation reaction.

  11. Staudinger ketene-imine cycloaddition, RCM approach to macrocrocyclic bisazetidinones.

    Science.gov (United States)

    Ibrahim, Yehia A; Al-Azemi, Talal F; Abd El-Halim, Mohamed D; John, Elizabeth

    2009-06-05

    Application of Staudinger ketene-imine cycloaddition reaction to bis-o-allyloxyarylideneamines afforded the corresponding bisallyloxyazetidinones as the cis-cis diastereomers, exclusively obtained as a mixture of cis-syn-cis and cis-anti-cis. RCM of the latter using Grubbs' catalysts afforded the corresponding macrocyclic bisazetidinones in good yields. The cis-anti-cis bisazetidinones are readily identified by (1)H NMR using Eu(hfc)(3) chiral shift reagent.

  12. Imine Hydrogels with Tunable Degradability for Tissue Engineering.

    Science.gov (United States)

    Boehnke, Natalie; Cam, Cynthia; Bat, Erhan; Segura, Tatiana; Maynard, Heather D

    2015-07-13

    A shortage of available organ donors has created a need for engineered tissues. In this context, polymer-based hydrogels that break down inside the body are often used as constructs for growth factors and cells. Herein, we report imine cross-linked gels where degradation is controllable by the introduction of mixed imine cross-links. Specifically, hydrazide-functionalized poly(ethylene glycol) (PEG) reacts with aldehyde-functionalized PEG (PEG-CHO) to form hydrazone linked hydrogels that degrade quickly in media. The time to degradation can be controlled by changing the structure of the hydrazide group or by introducing hydroxylamines to form nonreversible oxime linkages. Hydrogels containing adipohydrazide-functionalized PEG (PEG-ADH) and PEG-CHO were found to degrade more rapidly than gels formed from carbodihydrazide-functionalized PEG (PEG-CDH). Incorporating oxime linkages via aminooxy-functionalized PEG (PEG-AO) into the hydrazone cross-linked gels further stabilized the hydrogels. This imine cross-linking approach should be useful for modulating the degradation characteristics of 3D cell culture supports for controlled cell release.

  13. Optical properties of unsymmetrical azomethines with one imine bonds.

    Science.gov (United States)

    Iwan, Agnieszka; Schab-Balcerzak, Ewa; Grucela-Zajac, Marzena; Skorka, Lukasz

    2014-01-03

    We have explored the photoluminescence (PL) and electronic properties, that is, orbital energies and resulting energy gap calculated theoretically by density functional theory (DFT) of four unsymmetrical (UAz1-UAz4) azomethines. All of the investigated compounds exhibited mesomorphic behavior. The photoluminescence studies have shown that molecular structure of the imines influenced both the PL properties and HOMO-LUMO levels of azomethines. Azomethines emitted violet, blue or green light. The effect of excitation wavelength and concentration on the PL properties has been detected as well. Unsymmetrical imine UAz3 posses carbazole unit exhibited lower both HOMO and LUMO energies compare to others investigated azomethines. Additionally, azomethines were investigated by cyclic voltammetry (CV) and differential pulse voltammetry (DPV). Two unsymmetrical imines (UAz2 and UAz3) exhibited irreversible oxidation behavior. The HOMO level of the compound with ethylcarbazole (UAz2) moiety was observed at -5.22 eV, while for the UAz3 with phenoxybiphenyl unit was found at -5.64 eV. The data obtained by theoretical calculation using DFT method was very similar to the results obtained by electrochemical measurements. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Enzymatic Ugi Reaction with Amines and Cyclic Imines.

    Science.gov (United States)

    Żądło-Dobrowolska, Anna; Kłossowski, Szymon; Koszelewski, Dominik; Paprocki, Daniel; Ostaszewski, Ryszard

    2016-11-07

    The application of the Ugi reaction to the construction of new peptide scaffolds is an important goal of organic chemistry. To date, there are no examples of the Ugi reaction being performed with a cyclic imine and amine simultaneously. The application of 2-substituted cyclic imines in an enzymatic three-component Ugi-type reaction provides an elegant and attractive synthesis of substituted pyrrolidine and piperidine derivatives in up to 60 % yield. Results on studies of the selection of an enzyme, amount of water, and solvent used in a novel three-component Ugi reaction and the limitations thereof are reported herein. The presented methodology exploiting enzyme promiscuity in the multicomponent reaction fulfills the requirements associated with green chemistry. Several methods, such as isotope labeling and enzyme inhibition, were used to probe the possible mechanism of this complex synthesis. This research is the first example of an enzyme-catalyzed Ugi-type reaction with an imine, amine, and isocyanide. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Studies on the interaction of isocyanides with imines: reaction scope and mechanistic variations

    Directory of Open Access Journals (Sweden)

    Ouldouz Ghashghaei

    2014-01-01

    Full Text Available The interaction of imines with isocyanides has been studied. The main product results from a sequential process involving the attack of two units of isocyanide, under Lewis acid catalysis, upon the carbon–nitrogen double bond of the imine to form the 4-membered ring system. The scope of the reaction regarding the imine and isocyanide ranges has been determined, and also some mechanistic variations and structural features have been described.

  16. Asymmetric Intramolecular Alkylation of Chiral Aromatic Imines via Catalytic C-H Bond Activation

    Energy Technology Data Exchange (ETDEWEB)

    Watzke, Anja; Wilson, Rebecca; O' Malley, Steven; Bergman, Robert; Ellman, Jonathan

    2007-04-16

    The asymmetric intramolecular alkylation of chiral aromatic aldimines, in which differentially substituted alkenes are tethered meta to the imine, was investigated. High enantioselectivities were obtained for imines prepared from aminoindane derivatives, which function as directing groups for the rhodium-catalyzed C-H bond activation. Initial demonstration of catalytic asymmetric intramolecular alkylation also was achieved by employing a sterically hindered achiral imine substrate and catalytic amounts of a chiral amine.

  17. Dextran-graft-linear poly(ethylene imine)s for gene delivery: importance of the linking strategy.

    Science.gov (United States)

    Ochrimenko, Sofia; Vollrath, Antje; Tauhardt, Lutz; Kempe, Kristian; Schubert, Stephanie; Schubert, Ulrich S; Fischer, Dagmar

    2014-11-26

    Low molar mass linear poly(ethylene imine)s (lPEI) were grafted onto dextran via different synthesis routes aiming at the elucidation of structure-property relationships of dextran-graft-linear poly(ethylene imine) (dex-g-lPEI) conjugates for gene delivery applications. Beside the molar mass of well-defined lPEIs and the linker unit, also the amount of lPEI in the polymeric vectors was varied. The synthesized dextran modifications were characterized regarding their chemical structure and showed enhanced complexation and stabilization of DNA against enzymatic degradation. The transfection efficiency of dex-g-lPEIs was increased compared to unmodified lPEI and revealed a dependency of the used linking strategy. All complexes of DNA and dex-g-lPEIs were found to be nontoxic, but the synthesis route showed a strong influence on the aggregation of red blood cells. In conclusion, the linking strategy of lPEI to dextran has a significant impact on the physicochemical characteristics of DNA/polymer complexes, the biocompatibility as well as the transfection efficiency. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. The Zinc Mediated Condensation of Amino Acid Esters with Imines to b-Lactams

    NARCIS (Netherlands)

    Koten, G. van; Jastrzebski, J.T.B.H.

    1993-01-01

    An experimentally attractive stereoselectie 'one pot' synthesis of beta-lactams is described. This route is based on the zinc mediated condensation of an alpha-amino acid ester with an imine via a zinc ester enolate. Making use of proper substituents in both the amino acid ester and the imine the st

  19. PROGRESS IN PROCESS INTENSIFICATION: SYNTHESIS OF IMINES USING A SPINNING TUBE-IN-TUBE REACTOR

    Science.gov (United States)

    The high purity, high throughput synthesis of a number of imines (Schiff bases) using a spinning tube-in-tube reactor (STT, Kreido Laboratories, Camarillo, CA) has been carried out. The STT reactor allows the high throughput production of high purity imines from a wide variety of...

  20. PROGRESS IN PROCESS INTENSIFICATION: SYNTHESIS OF IMINES USING A SPINNING TUBE-IN-TUBE REACTOR

    Science.gov (United States)

    The high purity, high throughput synthesis of a number of imines (Schiff bases) using a spinning tube-in-tube reactor (STT, Kreido Laboratories, Camarillo, CA) has been carried out. The STT reactor allows the high throughput production of high purity imines from a wide variety of...

  1. Palladium-catalyzed aerobic dehydrogenative aromatization of cyclohexanone imines to arylamines.

    Science.gov (United States)

    Hajra, Alakananda; Wei, Ye; Yoshikai, Naohiko

    2012-11-02

    Dehydrogenative aromatization of cyclohexanone imines to arylamines has been achieved using a palladium catalyst under aerobic conditions. The reaction is applicable to a variety of imines that are either preformed or generated in situ from cyclohexanone derivatives and aryl or alkylamines.

  2. Imines that React with Phenols in Water over a Wide pH Range

    Science.gov (United States)

    Minakawa, Maki; Guo, Hai-Ming

    2009-01-01

    Cyclic imine derivatives that react with phenols, including tyrosine residues of peptides, have been developed. Reactions of the imines with phenols proceeded in water over a wide pH range (pH 2-10) at room temperature to 37 °C and afforded Mannich products without the need of additional catalysts. PMID:18844415

  3. Copper-catalyzed oxidative alkynylation of diaryl imines with terminal alkynes: a facile synthesis of ynimines.

    Science.gov (United States)

    Laouiti, Anouar; Rammah, Mohamed M; Rammah, Mohamed B; Marrot, Jérome; Couty, François; Evano, Gwilherm

    2012-01-06

    An efficient copper-mediated method for the oxidative alkynylation of diaryl imines with terminal alkynes is reported. This reaction provides the first catalytic and general synthesis of ynimines and allows for an easy preparation of these useful building blocks. An improved copper-catalyzed oxidative dimerization of imines to azines and the synthesis of dienes and azadienes from ynimines are also described.

  4. Identification of imine reductase-specific sequence motifs.

    Science.gov (United States)

    Fademrecht, Silvia; Scheller, Philipp N; Nestl, Bettina M; Hauer, Bernhard; Pleiss, Jürgen

    2016-05-01

    Chiral amines are valuable building blocks for the production of a variety of pharmaceuticals, agrochemicals and other specialty chemicals. Only recently, imine reductases (IREDs) were discovered which catalyze the stereoselective reduction of imines to chiral amines. Although several IREDs were biochemically characterized in the last few years, knowledge of the reaction mechanism and the molecular basis of substrate specificity and stereoselectivity is limited. To gain further insights into the sequence-function relationships, the Imine Reductase Engineering Database (www.IRED.BioCatNet.de) was established and a systematic analysis of 530 putative IREDs was performed. A standard numbering scheme based on R-IRED-Sk was introduced to facilitate the identification and communication of structurally equivalent positions in different proteins. A conservation analysis revealed a highly conserved cofactor binding region and a predominantly hydrophobic substrate binding cleft. Two IRED-specific motifs were identified, the cofactor binding motif GLGxMGx(5 )[ATS]x(4) Gx(4) [VIL]WNR[TS]x(2) [KR] and the active site motif Gx[DE]x[GDA]x[APS]x(3){K}x[ASL]x[LMVIAG]. Our results indicate a preference toward NADPH for all IREDs and explain why, despite their sequence similarity to β-hydroxyacid dehydrogenases (β-HADs), no conversion of β-hydroxyacids has been observed. Superfamily-specific conservations were investigated to explore the molecular basis of their stereopreference. Based on our analysis and previous experimental results on IRED mutants, an exclusive role of standard position 187 for stereoselectivity is excluded. Alternatively, two standard positions 139 and 194 were identified which are superfamily-specifically conserved and differ in R- and S-selective enzymes. © 2016 Wiley Periodicals, Inc.

  5. Exciton migration and quenching in poly(propylene imine) dendrimers

    Science.gov (United States)

    Minevičiūtė, I.; Gulbinas, V.; Franckevičius, M.; Vaišnoras, R.; Marcos, M.; Serrano, J. L.

    2009-05-01

    Exciton migration between chromophore groups of the poly(propylene imine) dendrimer in chloroform solution and in solid state has been investigated by means of the time-resolved fluorescence measurements. Fluorescence decay kinetics, dynamic band shift and the depolarization rate have been analyzed. Exciton migration in a single dendrimer was found to be slow in comparison with temperature-dependent chromophore reorientation time of 150-600 ps. In a solid state chromophore groups form collective excitonic states responsible for the dendrimer film fluorescence. Exciton migration and localization to the lowest energy sites within the distributed density of states take place on a subnanosecond-nanosecond time scale.

  6. Cyclic imines evaluation in European commercial shellfish samples

    DEFF Research Database (Denmark)

    Rambla, Maria; Fernandez-Tejedor, Margarita; Miles, Christopher O.

    not been linked yet to human poisoning and are not regulated in Europe, although the EFSA requires more data to perform conclusive risk assessment for consumers. Spirolides (SPXs) are produced by the dinoflagellate Alexandrium ostenfeldii, gymnodimines (GYMs) are also produced by A. ostenfeldii...... and by Karenia selliformis. The dinoflagellate Vulcanodinium rugosum produces pinnatoxins (PnTXs). In addition, not all cyclic imines are equally potent: SPX-1 showed about 300 fold more activity than GYM-A on equimolar basis in a in vivo study about neuromuscular excitability in mice. Oral toxicity of SPXs...

  7. Asymmetry in the N-inversion of heteroarene imines: pyrimidin-4(3H)-imine, pyridin-2(1H)-imine, and 1H-purine-6(9H)-imine.

    Science.gov (United States)

    Glaser, Rainer; Yin, Jian; Miller, Stephanie

    2010-02-19

    The uncatalyzed, thermal N-inversion reactions were studied of pyrimidin-4(3H)-imine (PMI), pyridin-2(1H)-imine (PYI), and 1H-purine-6(9H)-imine (PUI). Relevant regions of the potential energy surfaces were explored with second-order Moller-Plesset perturbation theory (MP2(full)/6-31G(d)) and with coupled cluster theory (CCSD/6-31G(d), CCSD/6-31+G(d)). The thermochemistry of stationary structures was evaluated at the MP2 level and their energies also were computed at the levels CCSD(T)/6-311+G(d,p) and CCSD(T)/6-311+G(2df,2p) and with structures optimized at lower CCSD levels. The best estimates for the (E)-preference free enthalpies DeltaG(298)(Z vs. E) are 2.6 (PMI), 2.3 (PYI), and 6.0 (PUI) kcal/mol and for the free enthalpies of activation DeltaG(298)(Z --> E) they are 21.6 (PMI), 21.1 (PYI) and 19.7 (PUI) kcal/mol. Nonplanar N-inversion transition state (ITS) structures occur along enantiomeric reaction paths and stationary structures for in-plane N-inversion correspond to second-order saddle points (SOSP) on the potential energy surface. The deformation energy DeltaE(def) = E(SOSP) - E(ITS) is less than 0.5 kcal/mol for PMI and PUI, but it is as high as DeltaE(def) approximately = 2 kcal/mol for PYI. The detailed study of structures and electronic structures along the entire N-inversion path of the isomerization (Z)-PMI (E)-PMI revealed a remarkable stabilization due to asymmetry in the ascent region from the (E)-isomer to ITS. Structures in this region of the potential energy surface allow best for additional bonding overlaps in the HOMO, and this amidine effect predicts lower N-inversion barriers in analogous imines with (Z)-preference energies. The discussion of the halogen-bonded aggregate PMI x ClCH(3) exemplifies that the asymmetry in N-inversion paths is retained and perhaps even enhanced in chlorinated solvents of low polarity.

  8. Catalytic Asymmetric Transfer Hydrogenation of Imines: Recent Advances.

    Science.gov (United States)

    Foubelo, Francisco; Yus, Miguel

    2015-10-01

    In this review article recent developments in the asymmetric transfer hydrogenation of imines from 2008 up to today are presented. The main methodology involves either metal-catalyzed procedures in the presence of a chiral ligand or organocatalyzed technologies using a Hantzsch ester and a chiral BINOL-derived phosphoric acid. The most important procedures are collected, paying special attention to the application of this methodology in synthetic organic chemistry. Copyright © 2015 The Chemical Society of Japan and Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. High performance of N-alkoxycarbonyl-imines in triethylborane-mediated tin-free radical addition.

    Science.gov (United States)

    Yamada, Ken-ichi; Konishi, Takehito; Nakano, Mayu; Fujii, Shintaro; Cadou, Romain; Yamamoto, Yasutomo; Tomioka, Kiyoshi

    2012-02-03

    Triethylborane-mediated tin-free radical alkylation of N-alkoxycarbonyl-imines, such as N-Boc-, N-Cbz-, and N-Teoc-imines, proceeded smoothly at a low temperature (-78 to -20 °C) to give the corresponding adducts in high yield. Although the formation of isocyanate was the major unfavorable reaction at room temperature, a one-pot conversion of N-Boc-imine to N-ethoxycarbonyl-adduct was possible through the corresponding isocyanate generated in situ. The higher performance of N-alkoxycarbonyl-imine than those of N-Ts- and N-PMP-imines is rationalized by a moderate electron-withdrawing character of an alkoxycarbonyl group that makes both addition of alkyl radical and trapping of the resulting aminyl radical by triethylborane efficiently fast.

  10. Transimination of quinone imines: a mechanism for embedding exogenous redox activity into the nucleosome.

    Science.gov (United States)

    Ye, Wenjie; Seneviratne, Uthpala I; Chao, Ming-Wei; Ravindra, Kodihalli C; Wogan, Gerald N; Tannenbaum, Steven R; Skipper, Paul L

    2012-12-17

    Aminophenols can redox cycle through the corresponding quinone imines to generate ROS. The electrophilic quinone imine intermediate can react with protein thiols as a mechanism of immobilization in vivo. Here, we describe the previously unkown transimination of a quinone imine by lysine as an alternative anchoring mechanism. The redox properties of the condensation product remain largely unchanged because the only structural change to the redox nucleus is the addition of an alkyl substituent to the imine nitrogen. Transimination enables targeting of histone proteins since histones are lysine-rich but nearly devoid of cysteines. Consequently, quinone imines can be embedded in the nucleosome and may be expected to produce ROS in maximal proximity to the genome.

  11. Well-defined silica-supported zirconium-imido complexes mediated heterogeneous imine metathesis.

    Science.gov (United States)

    Hamzaoui, Bilel; Pelletier, Jérémie D A; Abou-Hamad, Edy; Basset, Jean-Marie

    2016-03-28

    Upon prolonged thermal exposure under vacuum, a well-defined single-site surface species [([triple bond, length as m-dash]Si-O-)Zr(NEt2)3] () evolves into an ethylimido complex [([triple bond, length as m-dash]Si-O-)Zr([double bond, length as m-dash]NEt)NEt2] (). Reactions of with an imine substrate result in imido/imine ([double bond, length as m-dash]NRi, R: Et, Ph) exchange (metathesis) with the formation of [([triple bond, length as m-dash]Si-O-)Zr([double bond, length as m-dash]NPh)NEt2] (). Compounds and effectively catalyze imine/imine cross-metathesis and are thus considered as the first heterogeneous catalysts active for imine metathesis.

  12. Intracellular Delivery and Triggered Release of DNA Using Biodegradable Poly(2-hydroxypropylene imine)s Containing Cystamine Units.

    Science.gov (United States)

    Bockuviene, Alma; Slavuckyte, Kristina; Vareikis, Ausvydas; Zigmantas, Sarunas; Zaliauskiene, Lolita; Makuska, Ricardas

    2016-10-01

    Poly(2-hydroxypropylene imine)s containing segments of cystamine (PHPI-CA) are synthesized by polycondensation of 1,3-dibromo-2-propanol with a mixture of 1,3-diamino-2-propanol and cystamine. High molecular weight fractions of these polymers are collected by ultrafiltration and characterized by chemical analysis, (1) H and (13) C-NMR spectroscopy, size-exclusion chromatography with triple detection, and potentiometric titration, and are tested for DNA delivery in vitro. It is shown that PHPI-CA are highly branched polymers containing disulfide linkages. Transfection efficiency of PHPI-CA for DNA gives similar results to that of PHPI with GFP(+) cell percent reaching 80-90%. Cytotoxicity levels for PHPI-CA are lower than that of PHPI. Novel polymers containing different amounts of disulfide linkages are able to disintegrate and release DNA following the treatment with reducing agent 1,4-dithiothreitol. Downstream application of PHPI-CA transfected cells for RNA purification shows that RNA yield is not affected even after the double transfection suggesting that these polymers could be great candidates for in vitro and in vivo transfection. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Efficient gene transfection using novel cationic polymers poly(hydroxyalkylene imines).

    Science.gov (United States)

    Zaliauskiene, Lolita; Bernadisiute, Ula; Vareikis, Ausvydas; Makuska, Ricardas; Volungeviciene, Ieva; Petuskaite, Agne; Riauba, Laurynas; Lagunavicius, Arunas; Zigmantas, Sarunas

    2010-09-15

    A series of novel cationic polymers poly(hydroxyalkylene imines) were synthesized and tested for their ability to transfect cells in vitro and in vivo. Poly(hydroxyalkylene imines), in particular, poly(2-hydroxypropylene imine) (pHP), poly(2-hydroxypropylene imine ethylene imine) (pHPE), and poly(hydroxypropylene imine propylene imine) (pHPP) were synthesized by polycondensation reaction from 1,3-diamino-2-propanol and the appropriate dibromide. Electron microscopic examination demonstrated that the resulting polymers condensed DNA into toroid shape complexes of 100-150 nm in size. Transfection studies showed that all three polymers were able to deliver genetic material into the cell, with pHP being superior to pHPP and pHPE. pHP acted as an efficient gene delivery agent in a variety of different cell lines and outcompeted most of the widely used polymer or lipid based transfection reagents. Intravenous administration of pHP-DNA polyplexes in mice followed by the reporter gene analysis showed that the reagent was suitable for in vivo applications. In summary, the results indicate that pHP is a new efficient reagent for gene delivery in vitro and in vivo.

  14. Developing a novel catalytic approach for imine formation by using self-replicating catalyst

    Science.gov (United States)

    Nasir, Fatin Ilyani; Philp, Douglas; Hasbullah, Siti Aishah; Hassan, Nurul Izzaty

    2015-09-01

    Synthesis of imine compounds usually results in moderate yield due its reversibility characteristic and prone to hydrolysis. Hence, to increase the formation of imine compound, self-replicating catalyst was introduced. The self-replicating catalyst is the imine product itself. The first imine compound, 4-{[4-(3,5-Dimethyl-phenylcarbamoyl)-benzylidene]-amino}-phenyl)-acetic acid has been synthesized from 4-Amino-N-(3,5-dimethyl-phenyl)-benzamide and (4-formyl-phenyl)-acetic acid. Simultaneously, 4-formylbenzoic acid was reacted with thionyl chloride to produce 4-formylbenzoyl chloride, which was then reacted with 2-amino-4,6-dimethylpyridine in the presence of triethylamine to afford N-(4,6-dimethyl-pyridin-2-yl)-4-formyl-benzamide. N-(4,6-dimethyl-pyridin-2-yl)-4-formyl-benzamide formed then reacted with 4-amino-2-methylbenzoic acid to form the second imine derivative, 4-{[4-(4,6-dimethyl-pyridin-2-ylcarbamoyl)-benzylidene]-amino}-2-methyl-benzoic acid. The concentration time profile for the synthesis of self-replicating imine 1 reveals the classic sigmoidal shape characteristics of an autocatalytic process and the rate of the reaction are higher than that observed in the absence of recognition. In order to demonstrate the nature of self-replicating catalyst, a preformed imine 1 was doped into the reaction mixture of amine 1 and the corresponding aldehyde, 4-formylbenzoic acid. The insertion of substoichiometric amounts (15 mol%) of imine 1 at the start of the reaction has accelerated the rate formation of imine 1.

  15. Asymmetric transfer hydrogenation of imines catalyzed by a polymer-immobilized chiral catalyst.

    Science.gov (United States)

    Haraguchi, Naoki; Tsuru, Keiichi; Arakawa, Yukihiro; Itsuno, Shinichi

    2009-01-07

    The asymmetric transfer hydrogenation of imines was performed with the use of a polymer-immobilized chiral catalyst. The chiral catalyst, prepared from crosslinked polystyrene-immobilized chiral 1,2-diamine monosulfonamide, was effective in the asymmetric transfer hydrogenation of N-benzyl imines in CH(2)Cl(2) to give a chiral amine in high yield and good enantioselectivity. Furthermore, an amphiphilic polymeric catalyst prepared from crosslinked polystyrene containing sulfonated groups successfully catalyzed the asymmetric transfer hydrogenation of cyclic imines in water. Enantioenriched secondary amines with up to 94% ee were obtained by using a polymeric catalyst.

  16. Semi-catalytic reduction of secondary amides to imines and aldehydes.

    Science.gov (United States)

    Lee, Sun-Hwa; Nikonov, Georgii I

    2014-06-21

    Secondary amides can be reduced by silane HSiMe2Ph into imines and aldehydes by a two-stage process involving prior conversion of amides into iminoyl chlorides followed by catalytic reduction mediated by the ruthenium complex [Cp(i-Pr3P)Ru(NCCH3)2]PF6 (1). Alkyl and aryl amides bearing halogen, ketone, and ester groups were converted with moderate to good yields under mild reaction conditions to the corresponding imines and aldehydes. This procedure does not work for substrates bearing the nitro-group and fails for heteroaromatic amides. In the case of cyano substituted amides, the cyano group is reduced to imine.

  17. Asymmetric Friedel-Crafts Reaction of Indoles with Imines by an Organic Catalyst

    Science.gov (United States)

    Wang, Yong-Qiang; Song, Jun; Hong, Ran; Li, Hongming; Deng, Li

    2011-01-01

    In this communication, we report an asymmetric Friedel-Crafts reaction of indoles with imines catalyzed by a bifunctional cinchona alkaloid catalyst. This is the first efficient organocatalytic asymmetric Friedel-Crafts reaction of indoles with imines. This reaction is operationally simple and, unprecedently, affords high enantioselectivity for a wide range of indoles and both aryl and alkyl imines. This establishes a direct, convergent and versatile approach to optically active 3-indolyl-methanamines, a structural motif embedded in numerous indole alkaloids and synthetic indole derivatives. PMID:16787078

  18. Synthesis and Biological Activities of Camphor Hydrazone and Imine Derivatives

    Science.gov (United States)

    da Silva, Emerson T.; da Silva Araújo, Adriele; Moraes, Adriana M.; de Souza, Leidiane A.; Silva Lourenço, Maria Cristina; de Souza, Marcus V. N.; Wardell, James L.; Wardell, Solange M. S. V.

    2015-01-01

    Both sonochemical and classical methodologies have been employed to convert camphor, 1,7,7-trimethylbicyclo[2.2.1]heptan-2-one, C9H16C=O, into a number of derivatives including hydrazones, C9H16C=N-NHAr 3, imines, C9H16C=N-R 7, and the key intermediate nitroimine, C9H16C=N-NO2 6. Reactions of nitroamine 6 with nucleophiles by classical methods provided the desired compounds in a range of yields. In evaluations of activity against Mycobacterium tuberculosis, compound 7j exhibited the best activity (minimal inhibitory concentration (MIC) = 3.12 µg/mL), comparable to that of the antitubercular drug ethambutol. The other derivatives displayed modest antimycobacterial activities at 25–50 µg/mL. In in vitro tests against cancer cell lines, none of the synthesized camphor compounds exhibited cytotoxic activities.

  19. Addition of Allyltrimethylsilane to tert-Butanesulfinyl Imines Triggered by Tetra-n-butylammonium Fluoride

    Institute of Scientific and Technical Information of China (English)

    Wan Xuan ZHANG; Xue Long HOU

    2006-01-01

    The addition of allyltrimethylsilane to tert-butanesulfinyl imines triggered by tetra-n-butylammonium fluoride (TBAF) in the presence of 4A molecular sieves has been studied, and homoallylsulfinamides were obtained in good yields with moderate to high diastereoselectivitics.

  20. Light-Activated Reversible Imine Isomerization: Towards a Photochromic Protein Switch.

    Science.gov (United States)

    Berbasova, Tetyana; Santos, Elizabeth M; Nosrati, Meisam; Vasileiou, Chrysoula; Geiger, James H; Borhan, Babak

    2016-03-02

    Mutants of cellular retinoic acid-binding protein II (CRABPII), engineered to bind all-trans-retinal as an iminium species, demonstrate photochromism upon irradiation with light at different wavelengths. UV light irradiation populates the cis-imine geometry, which has a high pKa , leading to protonation of the imine and subsequent "turn-on" of color. Yellow light irradiation yields the trans-imine isomer, which has a depressed pKa , leading to loss of color because the imine is not protonated. The protein-bound retinylidene chromophore undergoes photoinduced reversible interconversion between the colored and uncolored species, with excellent fatigue resistance. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Rhodium catalysed conversion of carbenes into ketenes and ketene imines using PNN pincer complexes

    NARCIS (Netherlands)

    Tang, Z.; Mandal, S.; Paul, N.D.; Lutz, M.; Li, P.; van der Vlugt, J.I.; de Bruin, B.

    2015-01-01

    Ketene synthesis involving catalytic carbonylation of carbenes is an interesting alternative to traditional synthetic protocols, offering milder conditions to diversified products. Analogous catalytic ketene imine production from carbenes and isocyanides is also a promising reaction. However, both m

  2. Copper-mediated electrophilic imination of alkenylzirconocenes with O-benzoyl ketoximes and aldoximes.

    Science.gov (United States)

    Liu, Hailan; Yan, Xiaoyu; Chen, Chao; Liu, Qingbin; Xi, Chanjuan

    2013-06-18

    Copper-mediated electrophilic imination of alkenylzirconocenes generated in situ from alkynes and zirconocenes is accomplished under mild reaction conditions. The reaction can be used to prepare various 2-azadienes.

  3. Addition of boranes to N-aryl-salicylaldimines: intramolecular hydrogenation of imines.

    Science.gov (United States)

    Barnes, Stephanie S; Vogels, Christopher M; Decken, Andreas; Westcott, Stephen A

    2011-05-07

    Addition of boranes to N-aryl-salicylaldimines takes place initially at the reactive phenolic O-H bond to give an activated boron-containing imine and dihydrogen. In some cases a subsequent intramolecular hydrogenation step is observed and the C=N imine bond is reduced to the corresponding amine. Reactions with dimesitylborane in THF are unique in that the reduced amine product is the major product observed in solution.

  4. Visible Light Induced Green Transformation of Primary Amines to Imines Using a Silicate Supported Anatase Photocatalyst

    Directory of Open Access Journals (Sweden)

    Sifani Zavahir

    2015-01-01

    Full Text Available Catalytic oxidation of amine to imine is of intense present interest since imines are important intermediates for the synthesis of fine chemicals, pharmaceuticals, and agricultural chemicals. However, considerable efforts have been made to develop efficient methods for the oxidation of secondary amines to imines, while little attention has until recently been given to the oxidation of primary amines, presumably owing to the high reactivity of generated imines of primary amines that are easily dehydrogenated to nitriles. Herein, we report the oxidative coupling of a series of primary benzylic amines into corresponding imines with dioxygen as the benign oxidant over composite catalysts of TiO2 (anatase-silicate under visible light irradiation of λ > 460 nm. Visible light response of this system is believed to be as a result of high population of defects and contacts between silicate and anatase crystals in the composite and the strong interaction between benzylic amine and the catalyst. It is found that tuning the intensity and wavelength of the light irradiation and the reaction temperature can remarkably enhance the reaction activity. Water can also act as a green medium for the reaction with an excellent selectivity. This report contributes to the use of readily synthesized, environmentally benign, TiO2 based composite photocatalyst and solar energy to realize the transformation of primary amines to imine compounds.

  5. Anticancer, photoluminescence and electrochemical properties of structurally characterized two imine derivatives.

    Science.gov (United States)

    Ceyhan, Gökhan; Köse, Muhammet; Tümer, Mehmet; Demirtaş, İbrahim

    2015-01-01

    Two imine compounds, 4-[(E)-(2-methoxybenzylidene)amino]phenol (L(1)) and 4-[(E)-(3,4-dimethoxybenzylidene)amino]phenol (L(2)) were synthesized and characterized by the analytical and spectroscopic methods. The electrochemical and photoluminescence properties of the imine compounds L(1) and L(2) were investigated in different solvents. The compounds L(1) and L(2) show different redox processes at some potentials. The molecular structures of two Schiff base compounds are broadly similar, differing principally in the position, the number of methoxy (-OCH3) groups and dihedral angles between aromatic rings. While the compound L(1) has only one methoxy group located on the o-position with respect to the imine bond (C=N), the L(2) contains two methoxy groups on the p-m-positions with respect to the imine bond. The imine compounds show two or three emission bands in the 619-832 nm range in organic solvents. In the 1.0×10(-3) M concentration, the compounds have the highest excitation and emission bands. The imine compounds L(1) and L(2) were screened for their in vitro cytotoxicity on HeLa cell lines using the xCELLigence system (Real Time Cell Analyzer). Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Identification of quinone imine containing glutathione conjugates of diclofenac in rat bile.

    Science.gov (United States)

    Waldon, Daniel J; Teffera, Yohannes; Colletti, Adria E; Liu, Jingzhou; Zurcher, Danielle; Copeland, Katrina W; Zhao, Zhiyang

    2010-12-20

    High-resolution accurate MS with an LTQ-Orbitrap was used to identify quinone imine metabolites derived from the 5-hydroxy (5-OH) and 4 prime-hydroxy (4'-OH) glutathione conjugates of diclofenac in rat bile. The initial quinone imine metabolites formed by oxidation of diclofenac have been postulated to be reactive intermediates potentially involved in diclofenac-mediated hepatotoxicity; while these metabolites could be formed using in vitro systems, they have never been detected in vivo. This report describes the identification of secondary quinone imine metabolites derived from 5-OH and 4'-OH diclofenac glutathione conjugates in rat bile. To verify the proposed structures, the diclofenac quinone imine GSH conjugate standards were prepared synthetically and enzymatically. The novel metabolite peaks displayed the identical retention times, accurate mass MS/MS spectra, and the fragmentation patterns as the corresponding authentic standards. The formation of these secondary quinone metabolites occurs only under conditions where bile salt homeostasis was experimentally altered. Standard practice in biliary excretion experiments using bile duct-cannulated rats includes infusion of taurocholic acid and/or other bile acids to replace those lost due to continuous collection of bile; for this experiment, the rats received no replacement bile acid infusion. High-resolution accurate mass spectrometry data and comparison with chemically and enzymatically prepared quinone imines of diclofenac glutathione conjugates support the identification of these metabolites. A mechanism for the formation of these reactive quinone imine containing glutathione conjugates of diclofenac is proposed.

  7. Dehydrogenative Synthesis of Imines from Alcohols and Amines Catalyzed by a Ruthenium N-Heterocyclic Carbene Complex

    DEFF Research Database (Denmark)

    Maggi, Agnese; Madsen, Robert

    2012-01-01

    A new method for the direct synthesis of imines from alcohols and amines is described where hydrogen gas is liberated. The reaction is catalyzed by the ruthenium N-heterocyclic carbene complex [RuCl2(IiPr)(p-cymene)] in the presence of the ligand DABCO and molecular sieves. The imination can be a...... to the aldehyde, which stays coordinated to ruthenium. Nucleophilic attack of the amine affords the hemiaminal, which is released from ruthenium and converted into the imine....

  8. Brønsted Acid Catalysis—Structural Preferences and Mobility in Imine/Phosphoric Acid Complexes

    Science.gov (United States)

    2016-01-01

    Despite the huge success of enantioselective Brønsted acid catalysis, experimental data about structures and activation modes of substrate/catalyst complexes in solution are very rare. Here, for the first time, detailed insights into the structures of imine/Brønsted acid catalyst complexes are presented on the basis of NMR data and underpinned by theoretical calculations. The chiral Brønsted acid catalyst R-TRIP (3,3′-bis(2,4,6-triisopropylphenyl)-1,1′-binaphthyl-2,2′-diyl hydrogen phosphate) was investigated together with six aromatic imines. For each investigated system, an E-imine/R-TRIP complex and a Z-imine/R-TRIP complex were observed. Each of these complexes consists of two structures, which are in fast exchange on the NMR time scale; i.e., overall four structures were found. Both identified E-imine/R-TRIP structures feature a strong hydrogen bond but differ in the orientation of the imine relative to the catalyst. The exchange occurs by tilting the imine inside the complex and thereby switching the oxygen that constitutes the hydrogen bond. A similar situation is observed for all investigated Z-imine/R-TRIP complexes. Here, an additional exchange pathway is opened via rotation of the imine. For all investigated imine/R-TRIP complexes, the four core structures are highly preserved. Thus, these core structures are independent of electron density and substituent modulations of the aromatic imines. Overall, this study reveals that the absolute structural space of binary imine/TRIP complexes is large and the variations of the four core structures are small. The high mobility is supposed to promote reactivity, while the preservation of the core structures in conjunction with extensive π–π and CH−π interactions leads to high enantioselectivities and tolerance of different substrates. PMID:27960345

  9. Implications of dynamic imine chemistry for the sustainable synthesis of nitrogen heterocycles via transimination followed by intramolecular cyclisation.

    Science.gov (United States)

    Laha, Joydev K; Tummalapalli, K S Satyanarayana; Jethava, Krupal P

    2016-02-28

    An exploration of a tandem approach to the sustainable synthesis of N-heterocycles from readily available N-aryl benzylamines or imines and ortho-substituted anilines is described, which demonstrates, for the first time, an important synthetic application of dynamic imine chemistry. The key features to the successful development of this protocol include the utilisation of N-aryl benzylamines as imine precursors in transimination, the occurrence of transimination in acetonitrile in the absence of any catalysts, an intramolecular nucleophilic addition occurring in the newly formed imine causing irreversible transimination, and the tandem event occurring under green conditions.

  10. N-Substituted Imines by the Copper-Catalyzed N-Imination of Boronic Acids and Organostannanes with O-Acyl Ketoximes

    Science.gov (United States)

    Liu, Songbai; Yu, Ying; Liebeskind, Lanny S.

    2009-01-01

    Catalytic quantities of copper (I) or copper (II) sources catalyze the N-imination of boronic acids and organostannanes through reaction with oxime O-carboxylates under non-basic conditions. This method tolerates various functional groups and takes place efficiently using aryl, heteroaryl, and alkenyl boronic acids and stannanes. PMID:17444649

  11. Thermally Stable Heterocyclic Imines as New Potential Nonlinear Optical Materials

    Science.gov (United States)

    Nesterov, Volodymyr V.; Antipin, Mikhail Y.; Nesterov, Vladimir N.; Moore, Craig E.; Cardelino, Beatriz H.; Timofeeva, Tatiana V.

    2004-01-01

    In the course of a search for new thermostable acentric nonlinear optical crystalline materials, several heterocyclic imine derivatives were designed, with the general structure D-pi-A(D'). Introduction of a donor amino group (D') into the acceptor moiety was expected to bring H-bonds into their crystal structures, and so to elevate their melting points and assist in an acentric molecular packing. Six heterocycle-containing compounds of this type were prepared, single crystals were grown for five of them, and these crystals were characterized by X-ray analysis. A significant melting temperature elevation was found for all of the synthesized compounds. Three of the compounds were also found to crystallize in acentric space groups. One of the acentric compounds is built as a three-dimensional H-bonded molecular network. In the other two compounds, with very similar molecular structure, the molecules form one-dimensional H-bonded head-to-head associates (chains). These chains are parallel in two different crystallographic directions and form very unusual interpenetrating chain patterns in an acentric crystal. Two of the compounds crystallized with centrosymmetric molecular packing.

  12. Sphingosine induces the aggregation of imine-containing peroxidized vesicles.

    Science.gov (United States)

    Jiménez-Rojo, Noemi; Viguera, Ana R; Collado, M Isabel; Sims, Kacee H; Constance, Chad; Hill, Kasey; Shaw, Walt A; Goñi, Félix M; Alonso, Alicia

    2014-08-01

    Lipid peroxidation plays a central role in the pathogenesis of many diseases like atherosclerosis and multiple sclerosis. We have analyzed the interaction of sphingosine with peroxidized bilayers in model membranes. Cu(2+) induced peroxidation was checked following UV absorbance at 245nm, and also using the novel Avanti snoopers®. Mass spectrometry confirms the oxidation of phospholipid unsaturated chains. Our results show that sphingosine causes aggregation of Cu(2+)-peroxidized vesicles. We observed that aggregation is facilitated by the presence of negatively-charged phospholipids in the membrane, and inhibited by anti-oxidants e.g. BHT. Interestingly, long-chain alkylamines (C18, C16) but not their short-chain analogues (C10, C6, C1) can substitute sphingosine as promoters of vesicle aggregation. Furthermore, sphinganine but not sphingosine-1-phosphate can mimic this effect. Formation of imines in the membrane upon peroxidation was detected by (1)H-NMR and it appeared to be necessary for the aggregation effect. (31)P-NMR spectroscopy reveals that sphingosine facilitates formation of non-lamellar phase in parallel with vesicle aggregation. The data might suggest a role for sphingosine in the pathogenesis of atherosclerosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Coupling the Torpedo microplate-receptor binding assay with mass spectrometry to detect cyclic imine neurotoxins.

    Science.gov (United States)

    Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi

    2012-12-04

    Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.

  14. Syntheses of Azo-Imine Derivatives from Vanillin as an Acid Base Indicator

    Directory of Open Access Journals (Sweden)

    Bambang Purwono

    2013-05-01

    Full Text Available Preparations of azo, imine and azo-imine derivatives from vanillin as an indicator of acid-base titration have been carried out. The azo derivative of 4-hydroxy-3-methoxy-5-(phenylazobenzaldehyde 2 was produced by diazotitation reaction of vanillin in 37.04% yield. The azo product was then refluxed with aniline in ethanol to yield azo-imine derivatives, 2-methoxy-6-(phenylazo-4-((phenyliminomethylphenol 1 in 82.21% yield. The imine derivative, 2-methoxy-4-((phenyliminomethyl-phenol 3 was obtained by refluxing of vanillin and aniline mixture in ethanol solvent and produced 82.17% yield. The imine product was then reacted with benzenediazonium chloride salt. However, the products indicated hydrolyzed product of 4-hydroxy-3-methoxy-5-(phenylazobenzaldehyde 2 in 22.15% yield. The 2-methoxy-4-((phenyliminomethylphenol 2 could be used as an indicator for titration of NaOH by H2C2O4 with maximum concentration of H2C2O4 0.1 M while the target compound 1 could be used as titration indicator for titration of NaOH with H2C2O4 with same result using phenolphthalein indicator.

  15. Polyspermine imine, a pH responsive polycationic siRNA carrier degradable to endogenous metabolites.

    Science.gov (United States)

    Du, Zixiu; Xiang, Shengnan; Zang, Yi; Zhou, Yi; Wang, Chuandong; Tang, Hailing; Jin, Tuo; Zhang, Xiaoling

    2014-10-06

    Cationic polymers readily degradable in response to cellular environment are especially favored as easy-formulating materials to pack siRNA into a nanoparticle and to release the cargo in the cytoplasm in time. In addition to the efficiency of cytosomal release, the degradation products should best be free of safety concerns, a typical challenge for cationic polymers. To satisfy the two criteria, we report a new cationic polymer, polyspermine imine, named as PSP-Imine, which is formed by condensing two endogenous molecules, spermine and glyoxal, through conjugated π linkage, -N═C-C═N- (Schiff base reaction), a poly linkage structure sufficiently stable under neutral condition but dissociative under the endosomal pH. Cellular assays under a confocal microscope indicated that the polyplex formed of PSP-Imine readily released the loaded siRNA to the cytoplasm after being engulfed in the target cells and efficiently silenced the target genes in different cell lines and xenograft mouse model of human cervical carcinoma, as compared with nondegradable PEI 25 kDa. Cell viability assays confirmed that PSP-Imine showed no visible cytotoxicity within the concentration being tested. The present study suggests that PSP-Imine is an excellent siRNA condensing material for forming the core of a therapeutically feasible synthetic carrier system.

  16. Conserved YjgF protein family deaminates reactive enamine/imine intermediates of pyridoxal 5'-phosphate (PLP)-dependent enzyme reactions

    National Research Council Canada - National Science Library

    Lambrecht, Jennifer A; Flynn, Jeffrey M; Downs, Diana M

    2012-01-01

    .... Our data support the conclusion that YjgF proteins have enamine/imine deaminase activity and accelerate the release of ammonia from reactive enamine/imine intermediates of the pyridoxal 5'-phosphate...

  17. Reactions of sulfur- and phosphorus-substituted fluoroalkylating silicon reagents with imines and enamines under acidic conditions.

    Science.gov (United States)

    Kosobokov, Mikhail D; Dilman, Alexander D; Struchkova, Marina I; Belyakov, Pavel A; Hu, Jinbo

    2012-02-17

    Nucleophilic fluoroalkylation reactions of imines and enamines with α-phenylthio, α-phenylsulfonyl, and α-diethylphosphoryl substituted fluorinated silanes have been investigated. The reactions are promoted by hydrofluoric acid generated in situ from potassium hydrodifluoride and trifluoroacetic acid. Sulfur reagents worked well with both imines and enamines, whereas phosphorus reagent efficiently coupled only with enamines.

  18. Synthesis of Imine-Bearing ZnO Nanoparticle Thin Films and Characterization of Their Structural, Morphological and Optical Properties.

    Science.gov (United States)

    Kaur, Narinder; Sharma, Sanjeev K; Kim, Deuk Young; Sharma, Hemant; Singh, Narinder

    2015-10-01

    We are presenting the first report on the fabrication of imine-bearing ZnO nanoparticle thin films grown on Corning glass by spin coating. The sol was prepared by dissolving imine-bearing ZnO nanoparticles in dimethylsulfoxide (DMSO). The thickness of the films was manipulated to be 125-200 nm. The X-ray diffraction (XRD) analysis showed hexagonal wurtzite structure of imine-bearing ZnO nanoparticles thin films with a (002) preferential orientation. The stretching of chemical bonds of the imine linkage and Zn-O in imine-bearing ZnO nanoparticle thin films was confirmed by Fourier transform infrared spectroscopy (FTIR). The grain size of the films increased with increasing the thickness of the films due to the number of coatings and subsequently dried at 200 °C. The transmittance of imine-bearing ZnO nanoparticle thin films was observed to be ≥94%, which was in close agreement to pure ZnO thin films in the visible region. The bandgap of imine-bearing ZnO nanoparticle thin films (3.04 eV), evaluated from Tauc's plot, was observed to be lower than that of pure ZnO (3.21 eV), which is attributed to the interaction of the ZnO nanoparticles with the imine receptor.

  19. Asymmetric Transfer Hydrogenation of Imines in Water by Varying the Ratio of Formic Acid to Triethylamine.

    Science.gov (United States)

    Shende, Vaishali S; Deshpande, Sudhindra H; Shingote, Savita K; Joseph, Anu; Kelkar, Ashutosh A

    2015-06-19

    Asymmetric transfer hydrogenation (ATH) of imines has been performed with variation in formic acid (F) and triethylamine (T) molar ratios in water. The F/T ratio is shown to affect both the reduction rate and enantioselectivity, with the optimum ratio being 1.1 in the ATH of imines with the Rh-(1S,2S)-TsDPEN catalyst. Use of methanol as a cosolvent enhanced reduction activity. A variety of imine substrates have been reduced, affording high yields (94-98%) and good to excellent enantioselectivities (89-98%). In comparison with the common azeotropic F-T system, the reduction with 1.1/1 F/T is faster.

  20. Experimental and theoretical perspectives of the Noyori-Ikariya asymmetric transfer hydrogenation of imines.

    Science.gov (United States)

    Václavík, Jiří; Sot, Petr; Pecháček, Jan; Vilhanová, Beáta; Matuška, Ondřej; Kuzma, Marek; Kačer, Petr

    2014-05-28

    The asymmetric transfer hydrogenation (ATH) of imines catalyzed by the Noyori-Ikariya [RuCl(η6-arene)(N-arylsulfonyl-DPEN)] (DPEN=1,2-diphenylethylene-1,2-diamine) half-sandwich complexes is a research topic that is still being intensively developed. This article focuses on selected aspects of this catalytic system. First, a great deal of attention is devoted to the N-arylsulfonyl moiety of the catalysts in terms of its interaction with protonated imines (substrates) and amines (components of the hydrogen-donor mixture). The second part is oriented toward the role of the η6-coordinated arene. The final part concerns the imine substrate structural modifications and their importance in connection with ATH. Throughout the text, the summary of known findings is complemented with newly-presented ones, which have been approached both experimentally and computationally.

  1. Base-switched annuloselectivity in the reactions of ethyl malonyl chloride and imines.

    Science.gov (United States)

    Yang, Zhanhui; Li, Siqi; Zhang, Zhong; Xu, Jiaxi

    2014-12-28

    The base-switched annuloselectivity, namely [2 + 2] and [2 + 2 + 2] selectivity, in the reactions of ethyl malonyl chloride and imines is successfully realized. In the presence of the weak nucleophilic base 2-chloropyridine, the reactions deliver ethyl trans-β-lactam-3-carboxylates as the exclusive [2 + 2] products in up to 93% yields, while with the strong nucleophilic N-methylimidazole as the base, the reactions give rise to 2,3-dihydro-1,3-oxazin-4-one derivatives as the sole products in up to 99% yields via the formal [2 + 2 + 2] cycloaddition involving one molecule of the imine and two molecules of the ketene generated from malonyl chloride. Notably, ethyl trans-β-lactam-3-carboxylates are synthesized for the first time directly from the reactions of ethyl malonyl chloride and imines. Mechanistic discussions reveal that the annuloselectivity is controlled by the nucleophilicity of organic bases.

  2. "Click" Chemistry: Application of Copper Metal in Cu-Catalyzed Azomethine Imine-Alkyne Cycloadditions.

    Science.gov (United States)

    Pušavec Kirar, Eva; Grošelj, Uroš; Mirri, Giorgio; Požgan, Franc; Strle, Gregor; Štefane, Bogdan; Jovanovski, Vasko; Svete, Jurij

    2016-07-15

    A series of 16 copper-catalyzed azomethine imine-alkyne cycloaddition (CuAIAC) reactions between four pyrazolidinone-1-azomethine imines and four terminal ynones gave the corresponding fluorescent cycloadducts as bimane analogues in very high yields. The applicability of CuAIAC was demonstrated by the fluorescent labeling of functionalized polystyrene and by using Cu-C and Cu-Fe as catalysts. Experimental evidence, kinetic measurements, and correlation between a clean catalyst surface and the reaction rate are in agreement with a homotopic catalytic system with catalytic Cu(I)-acetylide formed from Cu(0) by "in situ" oxidation. The availability of azomethine imines, mild reaction conditions, simple workup, and scalability make CuAIAC a viable supplement to the Cu-catalyzed azide-alkyne cycloaddition reaction in "click" chemistry.

  3. Versatile In Situ Generated N-Boc-Imines: Application to Phase-Transfer-Catalyzed Asymmetric Mannich-Type Reactions.

    Science.gov (United States)

    Kano, Taichi; Kobayashi, Ryohei; Maruoka, Keiji

    2015-07-13

    The efficient construction of nitrogen-containing organic compounds is a major challenge in chemical synthesis. Imines are one of the most important classes of electrophiles for this transformation. However, both the available imines and applicable nucleophiles for them are quite limited given the existing preparative methods. Described herein are imine precursors which generate reactive imines with a wide variety of substituents under mild basic conditions. This approach enables the construction of various nitrogen-containing molecules which cannot be accessed by the traditional approach. The utility of the novel imine precursor was demonstrated in the asymmetric Mannich-type reaction under phase-transfer conditions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. SYNTHESIS AND CHARACTERIZATION OF PALLADIUM COORDINATING IMINE SIDE CHAIN LIQUID CRYSTALLINE POLYSILOXANES

    Institute of Scientific and Technical Information of China (English)

    CHEN Gang; ZHANG Rongben

    1991-01-01

    New thermotropic chloro-bridged dinuclear palladium coordinating imine side chain liquid crystalline polysiloxanes have been synthesized. Their mesomorphic properties have been investigated by DSC, X-ray diffraction and polarizing microscopy. The polymeric complexes show nematicdiscotic (Nd) mesophase. It is found that the temperature range of liquid crystalline state of chloro-bridged polymeric complexes is much wider than that of acetato-bridged ones and imine side chain polysiloxane. This indicates that the disc-like chloro-bridged palladium complexing units play a role as mesogen in mesophase.

  5. Colorimetric and electrochemical Pb2+ detection by imine-bridged tetrathiafulvalene-pyridine derivatives

    Institute of Scientific and Technical Information of China (English)

    TUNG; ChenHo

    2009-01-01

    Imine-bridged TTF-π-pyridine derivatives, 2NTTF, 3NTTF and 4NTTF, were synthesized and the cation-binding study was performed. It is noted that with the addition of the micromolar concentration of Pb2+ to the solution, these compounds display remarkable changes in solution color, 1H NMR spectra and electrochemical properties. The nitrogen atom of the imine-bridge in 2NTTF not only serves as a π-conjugated spacer but also participates in the sensing and coordinating properties.

  6. Chiral N-phosphonyl imine chemistry: asymmetric synthesis of alpha,beta-diamino esters by reacting phosphonyl imines with glycine enolates.

    Science.gov (United States)

    Ai, Teng; Li, Guigen

    2009-07-15

    Chiral phosphonyl imines attached with N-isopropyl protection group were found to react with lithium glycine enolates under convenient conditions to give alpha,beta-diamino esters. Thirteen examples have been examined in good to excellent chemical yields (85-97%) diastereoselectivity (up to 99% de). By treating with HBr at room temperature, the chiral auxiliary can be readily removed and recycled. The absolute structure has been unambiguously determined by converting a product to a known sample.

  7. Thermal curing of an epoxy-anhydride system modified with hyperbranched poly(ethylene imine)s with different terminal groups

    OpenAIRE

    Morancho Llena, José María; Fernández Francos, Xavier; Acebo Gorostiza, Cristina; Ramis Juan, Xavier; Salla Tarragó, José María; Serra Albet, Àngels

    2017-01-01

    New hyperbranched polymers (HBP) have been synthesized by reaction of a poly(ethylene imine) with phenyl and t-butyl isocyanates. These HBPs have been characterized by 1H-NMR (nuclear magnetic resonance of hydrogen) and Fourier transform infrared spectroscopy. Their influence on the curing and properties of epoxy-anhydride thermosets has been studied by different techniques: differential scanning calorimetry (DSC), dynamic mechanical analysis (DMA), and thermogravimetry (TG). The ...

  8. N-phosphinyl imine chemistry (I): design and synthesis of novel N-phosphinyl imines and their application to asymmetric aza-Henry reaction.

    Science.gov (United States)

    Pindi, Suresh; Kaur, Parminder; Shakya, Gaurav; Li, Guigen

    2011-01-01

    Novel chiral N-phosphinamide and N-phosphinyl imines have been designed, synthesized and applied to asymmetric aza-Henry reaction to give excellent chemical yields (92%- quant.) and diastereoselectivity (91% to >99%de). The reaction showed a great substrate scope in which aromatic/aliphatic aldehyde- and ketone-derived N-phosphinyl imines can be employed as electrophiles. The chiral N-phosphinamide can be stored at room temperature for more than 2 months without inert gas protection, and chiral N-phosphinyl imines were also proven to be highly stable at room temperature for a long period under inert gas protection. The N-phosphinyl group enabled the product purification to be performed simply by washing crude product with EtOAc and hexane. This reaction joined other eight GAP (Group-Assistant-Purification) chemistry processes that were developed in our laboratories. The absolute configuration has been unambiguously determined by converting a β-nitroamine product into a known N-Boc sample. © 2010 John Wiley & Sons A/S.

  9. Highly selective formation of imines catalyzed by silver nanoparticles supported on alumina

    DEFF Research Database (Denmark)

    Mielby, Jerrik Jørgen; Poreddy, Raju; Engelbrekt, Christian

    2014-01-01

    The oxidative dehydrogenation of alcohols to aldehydes catalyzed by Ag nanoparticles supported on Al2O3 was studied. The catalyst promoted the direct formation of imines by tandem oxidative dehydrogenation and condensation of alcohols and amines. The reactions were performed under mild conditions...

  10. Diastereoselective Hydrogenation and Kinetic Resolution of Imines Using Rhodium/Diphosphine Catalyzed Hydrogenation.

    NARCIS (Netherlands)

    Lensink, Cornelis; Vries, Johannes G. de

    1993-01-01

    Kinetic resolution of racemic α-methylbenzyl amine can be achieved with 98% ee. of the remaining amine at 70% conversion using the Rhodium/2S,4S-BDPP catalyzed asymmetric hydrogenation of imines. The same catalyst will hydrogenate optically pure α-methylbenzyl amines with a diastereoselectivity of u

  11. Temperature-dependent annuloselectivity and stereochemistry in the reactions of methanesulfonyl sulfene with imines.

    Science.gov (United States)

    Wu, Qiuyue; Yang, Zhanhui; Xu, Jiaxi

    2016-07-26

    The annuloselectivity in the reactions of methanesulfonyl sulfene and imines varies with temperature. At a relatively higher temperature of 20 °C, the [2(s) + 2(i)] annulation of different N-alkyl imines occurs exclusively, giving four-membered trans-β-sultams in up to 69% yields. At a lower temperature of -78 °C, the [2(s) + 2(i) + 2(i)] annulation of N-methyl imines takes place specifically, delivering six-membered 1,2,4-thiadiazine 1,1-dioxides, 4-aza-δ-sultams, in up to 80% yields, with diverse configurations at the C3, C5, and C6 stereocenters. The trans-stereochemistry involved in the [2(s) + 2(i)] annulations is attributed to the conrotatory ring closure of the thermodynamically stable 2,3-thiazabutadiene-type zwitterionic intermediates, while the diverse stereochemical outcomes in the [2(s) + 2(i) + 2(i)] annulations are caused by the iminium isomerization in the stepwise nucleophilic [4 + 2] annulation between the same zwitterionic intermediates and a second molecule of N-methyl imines.

  12. In(OTf)3 catalyzed allylation reaction of imines with tetraallyltin

    Institute of Scientific and Technical Information of China (English)

    Xiao Ning Wei; Ling Yan Liu; Bing Wang; Wei Xing Chang; Jing Li

    2009-01-01

    In the presence of catalytic amount of In(OTf)3 (10 mol%), a series of aldimines reacted with tetraallyltin in a 2:1 molar ratio to afford the corresponding homoallylic amines in good yields. The good atom efficiency was achieved under mild reaction conditions and a new protocol (allyl)4Sn/In(OTf)3 for simple imines was developed.

  13. Hydroxypyridyl Imines: Enhancing Chromatographic Separation and Stereochemical Analysis of Chiral Amines via Circular Dichroism.

    Science.gov (United States)

    Joyce, Leo A; Regalado, Erik L; Welch, Christopher J

    2016-09-16

    Imine-bond formation between chiral amines and commercially available 3-hydroxypyridine-2-carboxaldehyde (HCA) was exploited for rapid determination of stereochemical composition. Chiral supercritical fluid chromatography (SFC) screening of the derivatized imine compounds led to the elucidation of multiple combinations of mobile and stationary phases that gave resolution of all members of a series of chiral amines. The first eluting enantiomer was generally the derivative of the (R)-amine enantiomer across the series that was studied, indicating that the imine formed from the (S)-amine has more favorable interaction with the chiral stationary phase of the column. These conditions were then applied to more challenging compounds, namely amino alcohols and diastereomers possessing more than one stereocenter. The approach was utilized to monitor stereoselective biocatalytic transamination and assign the absolute configuration of the enantiomeric products. Finally, hydrolysis of the imine bond of the derivative was shown to generate enantiopure amine starting materials without racemization. This further highlights the value of this approach for creating readily reversed derivatives that enhance chromatographic separation and aid in the determination of absolute configuration.

  14. Palladium-Catalyzed Asymmetric [3+2] Cycloaddition of Trimethylenemethane with Imines

    Science.gov (United States)

    Trost, Barry M.; Silverman, Steven M.; Stambuli, James P.

    2008-01-01

    The transition metal catalyzed trimethylenemethane [3+2] cycloaddition provides a direct route to functionalized heterocycles. Herein, we describe a catalytic, asymmetric protocol for the reaction between 3-acetoxy-2-trimethylsilylmethyl-1-propene and various imines. The corresponding pyrrolidines were obtained in excellent yields and enantioselectivities making use of the novel phosphoramidite L10. PMID:17887679

  15. Catalytic, Enantioselective 1,3-Dipolar Cycloadditions of Nitrile Imines with Methyleneindolinones

    Science.gov (United States)

    Gerten, Anthony L.; Slade, Michael C.; Pugh, Kelsie M.

    2013-01-01

    Catalytic, enantioselective 1,3-dipolar cycloadditions of nitrile imines with methyleneindolinones are reported. The spiro[pyrazolin[3,3′-oxindole] products are formed in good yields (up to 98%) and high enantioselectivity (up to 99% ee). PMID:24132663

  16. Linear poly(ethylene imine)-based hydrogels for effective binding and release of DNA.

    Science.gov (United States)

    Englert, Christoph; Tauhardt, Lutz; Hartlieb, Matthias; Kempe, Kristian; Gottschaldt, Michael; Schubert, Ulrich S

    2014-04-14

    A series of copolymers containing both amine groups of linear poly(ethylene imine) (LPEI) and double bonds of poly(2-(3-butenyl)-2-oxazoline) (PButEnOx) was prepared. To this end, a poly(2-ethyl-2-oxazoline) (PEtOx) precursor was hydrolyzed to the respective LPEI and functionalized in an amidation reaction with butenyl groups resulting in the double bond containing poly(2-(3-butenyl-2-oxazoline)-co-ethylene imine) (P(ButEnOx-co-EI)). Hydrogels were obtained by cross-linking with dithiols under UV-irradiation resulting in networks with different properties in dependence of the content of double bonds. The developed method allows the exact control of the amount of ethylene imine units within the copolymer and, thus, within the resulting hydrogels. The gel structures were characterized by solid state NMR and infrared spectroscopy. In addition the water uptake behavior from the liquid and the gas phase was investigated. It was shown by an ethidium bromide assay (EBA) that the copolymers and the respective hydrogels were able to bind and release DNA. Furthermore, the influence of the ethylene imine content on this interaction was investigated.

  17. Chemical and electronic non-innocence of the bis(imine) pyridine ligand

    NARCIS (Netherlands)

    Knijnenburg, Q.

    2006-01-01

    Bis(imine) pyridine ligands combine two striking characteristics. On the one hand, they are extremely non-innocent in the sense that they interfere in the chemistry of their complexes, both chemically and electronically. On the other hand, their Fe and Co complexes form one of the known two late tra

  18. Mesoporous carbon derived from vitamin B12: a high-performance bifunctional catalyst for imine formation.

    Science.gov (United States)

    Chen, Bo; Shang, Sensen; Wang, Lianyue; Zhang, Yi; Gao, Shuang

    2016-01-11

    Mesoporous carbon derived from natural vitamin B12 is applied for the first time in organic synthesis and exhibits exceptionally high dual activity for imine formation via the cross-coupling of alcohols with amines and the self-coupling of primary amines using molecular oxygen or air as the terminal oxidant.

  19. The Isomerization of Allylrhodium Intermediates in the Rhodium-Catalyzed Nucleophilic Allylation of Cyclic Imines**

    Science.gov (United States)

    Hepburn, Hamish B; Lam, Hon Wai

    2014-01-01

    Allylrhodium species generated from potassium allyltrifluoroborates can undergo isomerization by 1,4-rhodium(I) migration to give more complex isomers, which then react with cyclic imines to provide products with up to three new stereochemical elements. High enantioselectivities are obtained using chiral diene–rhodium complexes. PMID:25205604

  20. Branched and linear poly(ethylene imine)-based conjugates: synthetic modification, characterization, and application.

    Science.gov (United States)

    Jäger, Michael; Schubert, Stephanie; Ochrimenko, Sofia; Fischer, Dagmar; Schubert, Ulrich S

    2012-07-07

    Poly(ethylene imine)s (PEIs) are widely used in different applications, but most extensively investigated as non-viral vector systems. The high ability of cationic PEIs to complex and condense negatively charged DNA and RNA combined with their inherent proton sponge behavior accounts for the excellent efficiency in gene delivery. Further chemical modifications of the polymer expand the application potential, primarily aiming at increased transfection efficiency, cell selectivity and reduced cytotoxicity. Improvements in the synthesis of tailor-made PEIs in combination with new in-depth analytical techniques offer the possibility to produce highly purified polymers with defined structures. The contemporary strategies towards linear and branched poly(ethylene imine)s with modified surface characteristics, PEI-based copolymers as well as conjugates with bioactive molecules will be discussed. In this regard, the versatile branched PEIs have been successfully modified in a statistical manner, whereas the linear counterparts open avenues to design and synthesize well-defined architectures, in order to exploit their high potential in gene delivery.

  1. An atom efficiency, solvent-free synthesis of some new heterocyclic imines and antibacterial activity

    Directory of Open Access Journals (Sweden)

    Subhash B. Junne

    2012-04-01

    Full Text Available A solvent-free condensation of substituted aryl amines with indole-3-aldehyde in presence of catalytic amount of acetic acid at room temperature in combination with grinding to yield new series of heterocyclic imines (Schiff bases. The simple reaction procedure, short reaction time, no need of organic solvent and high yields make this protocol practical and economically attractive.

  2. Enantioselective Addition of Organolithium Reagents to Imines Mediated by C2-Symmetric Bis(aziridine) Ligands

    DEFF Research Database (Denmark)

    Johansson, F.; Tanner, David Ackland

    1998-01-01

    The C-2-symmetric bis(aziridine) ligands 1 - 5 have been screened in the enantioselective addition of organolithium reagents to imines. Ligand 1 (used in stoichiometric amounts) was found to be superior in terms of chemical yield and enantioselectivity, the best result being 90% yield and 89% e.e...

  3. Relative Stability of the Key Enamine,Oxazolidinone, and Imine Intermediates in Some Proline-catalyzed Asymmetric Reactions

    Institute of Scientific and Technical Information of China (English)

    HU Yi-Fan; LU Xin

    2008-01-01

    Many proline-catalyzed asymmetric addition reactions with ketones as substrates were assumed to involve a key intermediate, an enamine, produced by the condensation of proline and ketone. In this paper, the key intermediate enamines derived from L-proline and cyclohexanone (or acetone) as well as the corresponding oxazolidinone and imine tautomers have been investigated by means of density functional calculations at the B3LYP/6-311+G** level. The predicted order of stability for these tautomers is oxazolidinones > enamines > imines in gas phase and oxazolidinones > imines > enamines in aprotic THF solvent. This prediction explains why enamine intermediate can not be observed experimentally. The predicted energy/enthalpy difference between the formal oxazolidinone structure and the zwitterionic imine structures is very small in THF solvent, suggesting the oxazolidinone-to-imine tautomerization can be readily induced in solvent. 13C NMR chemical shifts of the oxazolidinone and imine structures have been computed and used to explain the experimental NMR spectra observed in oxazolidinone-to-imine tautomerization induced by protic solvent.

  4. Synthetic Molecular Motors: Thermal N Inversion and Directional Photoinduced C=N Bond Rotation of Camphorquinone Imines.

    Science.gov (United States)

    Greb, Lutz; Eichhöfer, Andreas; Lehn, Jean-Marie

    2015-11-23

    The thermal and photochemical E/Z isomerization of camphorquinone-derived imines was studied by a combination of kinetic, structural, and computational methods. The thermal isomerization proceeds by linear N inversion, whereas the photoinduced process occurs through C=N bond rotation with preferred directionality as a result of diastereoisomerism. Thereby, these imines are arguably the simplest example of synthetic molecular motors. The generality of the orthogonal trajectories of the thermal and photochemical pathways allows for the postulation that every suitable chiral imine qualifies, in principle, as a molecular motor driven by light or heat.

  5. Radical cyclizations of cyclic ene sulfonamides occur with β-elimination of sulfonyl radicals to form polycyclic imines.

    Science.gov (United States)

    Zhang, Hanmo; Hay, E Ben; Geib, Steven J; Curran, Dennis P

    2013-11-06

    Radical cyclizations of cyclic ene sulfonamides provide stable bicyclic and tricyclic aldimines and ketimines in good yields. Depending on the structure of the precursor, the cyclizations occur to provide fused and spirocyclic imines with five-, six-, and seven-membered rings. The initial radical cyclization produces an α-sulfonamidoyl radical that undergoes elimination to form the imine and a phenylsulfonyl radical. In a related method, 3,4-dihydroquinolines can also be produced by radical translocation reactions of N-(2-iodophenylsulfonyl)tetrahydroiso-quinolines. In either case, very stable sulfonamides are cleaved to form imines (rather than amines) under mild reductive conditions.

  6. N-cyanoimidazole and diimidazole imine: water-soluble condensing agents for the formation of the phosphodiester bond

    Science.gov (United States)

    Ferris, J. P.; Huang, C. H.; Hagan, W. J. Jr

    1989-01-01

    The reaction of BrCN with imidazole results in the formation of N-cyanoimidazole and diimidazole imine. These compounds were shown to be useful condensing agents for the formation of the phosphodiester bound in aqueous solution.

  7. Deciphering Piperidine Formation in Polyketide-Derived Indolizidines Reveals a Thioester Reduction, Transamination, and Unusual Imine Reduction Process.

    Science.gov (United States)

    Peng, Haidong; Wei, Erman; Wang, Jiali; Zhang, Yanan; Cheng, Lin; Ma, Hongmin; Deng, Zixin; Qu, Xudong

    2016-12-16

    Piperidine and indolizidine are two basic units of alkaloids that are frequently observed in natural and synthetic compounds. Their biosynthesis in natural products is highly conserved and mostly derived from the incorporation of lysine cyclization products. Through in vitro reconstitution, we herein identified a novel pathway involving a group of polyketide-derived indolizidines, which comprises the processes of tandem two-electron thioester reduction, transamination, and imine reduction to convert acyl carrier protein (ACP)-tethered polyketide chains into the piperidine moieties of their indolizidine scaffolds. The enzymes that catalyze the imine reduction are distinct from previous known imine reductases, which have a fold of acyl-CoA dehydrogenase but do not require flavin for reduction. Our results not only provide a new way for the biosynthesis of the basic units of alkaloids but also show a novel class of imine reductases that may benefit the fields of biocatalysis and biomanufacturing.

  8. A diastereoselective cyclic imine cycloaddition strategy to access polyhydroxylated indolizidine skeleton: concise syntheses of (+)-/(-)-lentiginosines and (-)-2-epi-steviamine.

    Science.gov (United States)

    Shao, Jia; Yang, Jin-Song

    2012-09-21

    We describe in this paper the development of a novel diastereoselective cyclic imine cycloaddition strategy to access the polyhydroxylated indolizidine skeleton and its application in the concise syntheses of (+)-/(-)-lentiginosines and (-)-2-epi-steviamine.

  9. Asymmetric Hetero Diels-Alder Reaction of Chiral Imines with Danishefsky' s Diene Catalyzed by Yb(OTf) 3

    Institute of Scientific and Technical Information of China (English)

    QIAN, Chang- Tao; WANG, Long-Cheng; CHEN,Rui-Fang

    2001-01-01

    Rcaction of chirai imines with Danishefsky' s diene in the presence of a catalytic amount (20 mol% ) of ytterbium trffiate afforded the corresponding hetero Diels-Alder adducts with a moderate to good diastereoselectivity.

  10. Chiral magnesium BINOL phosphate-catalyzed phosphination of imines: access to enantioenriched α-amino phosphine oxides.

    Science.gov (United States)

    Ingle, Gajendrasingh K; Liang, Yuxue; Mormino, Michael G; Li, Guilong; Fronczek, Frank R; Antilla, Jon C

    2011-04-15

    A new method to synthesize chiral α-amino phosphine oxides is reported. The reaction combines N-substituted imines and diphenylphosphine oxide and is catalyzed by a chiral magnesium phosphate salt. A wide variety of aliphatic and aromatic aldimines substituted by electron-neutral benzhydryl or dibenzocycloheptene groups were excellent substrates for the addition reaction. The dibenzocycloheptene protected imines afforded improved enantioselectivity in the resulting products. Substituted diphenylphosphine oxide nucleophiles also showed good reactivity.

  11. Transition metal-free generation of N-unsubstituted imines from benzyl azides: synthesis of N-unsubstituted homoallylic amines.

    Science.gov (United States)

    Pramanik, Suman; Reddy, Reddy Rajasekhar; Ghorai, Prasanta

    2015-04-03

    An efficient transition metal-free approach for the generation of N-unsubstituted imines from azides followed by trapping with allyl nucleophile to provide N-unsubstituted homoallylic amines has been described. Although catalytic KO(t)Bu in DMSO is sufficient to allow imine generation, stoichiometric KO(t)Bu is essential in THF. Further, an enantio- and diastereoselective synthesis of homoallylic amines from benzyl azide has also been exemplified.

  12. Organocatalytic azomethine imine-olefin click reaction: high-yielding stereoselective synthesis of spiroindane-1,3-dione-pyrazolidinones.

    Science.gov (United States)

    Ramachary, Dhevalapally B; Prabhakar Reddy, T; Suresh Kumar, A

    2016-07-06

    In search of developing new useful "click reactions", herein we report the organocatalytic azomethine imine-olefin [3 + 2]-cycloaddition as a new click reaction for the synthesis of drug-like spiroindane-1,3-dione-pyrazolidinones from indane-1,3-diones, aldehydes and N,N-cyclic azomethine imines through amino acid-catalysis. The scope of this new click reaction is demonstrated using many examples with high reactivity, selectivity and yields.

  13. [Synthesis of stable solvates of monosodium 2-[R*s,9S*)-(4-methoxy-6,7,8, 9-tetrahydro-5H-cyclohepta[b]pyridin-9-yl)sulfinyl]-1H-benzimidazole].

    Science.gov (United States)

    Yamada, S; Goto, T; Yuasa, S; Yamaguchi, T; Kogi, K

    1996-08-01

    Monosodium 2-[(R*s,9S*)-(4-methoxy-6,7,8, 9-tetrahydro-5H-cyclohepta-[b]pyridin-9-yl)sulfinyl]-1H-benzimidazole (3A), a novel antiulcer agent previously reported by us, was found to be easily decomposed in weakly acidic solutions. In order to improve the stability of the parent compound, 3A, the preparation of 1-substituted benzimidazoles (4A) was attempted. However, the inhibitory effect of 4A against gastric acid secretion was less potent than that of 3A. Then 3A was solvated by EtOH or H2O to afford 5A or 6A, respectively. On the other hand, an another diastereoisomer, (R*s,9R*)-3B, was not solvated by EtOH or H2O under the same conditions. The thus obtained solvates (5A, 6A) are much more stable than that of 3A. The antiulcer activities of 5A and 6A were found to be similar to that of the parent compound (3A). Consequently, 6A was selected as an antiulcer agent for the development.

  14. Autoinduced catalysis and inverse equilibrium isotope effect in the frustrated Lewis pair catalyzed hydrogenation of imines.

    Science.gov (United States)

    Tussing, Sebastian; Greb, Lutz; Tamke, Sergej; Schirmer, Birgitta; Muhle-Goll, Claudia; Luy, Burkhard; Paradies, Jan

    2015-05-26

    The frustrated Lewis pair (FLP)-catalyzed hydrogenation and deuteration of N-benzylidene-tert-butylamine (2) was kinetically investigated by using the three boranes B(C6F5)3 (1), B(2,4,6-F3-C6H2)3 (4), and B(2,6-F2-C6H3)3 (5) and the free activation energies for the H2 activation by FLP were determined. Reactions catalyzed by the weaker Lewis acids 4 and 5 displayed autoinductive catalysis arising from a higher free activation energy (2 kcal mol(-1)) for the H2 activation by the imine compared to the amine. Surprisingly, the imine reduction using D2 proceeded with higher rates. This phenomenon is unprecedented for FLP and resulted from a primary inverse equilibrium isotope effect.

  15. Expanding the Imine Reductase Toolbox by Exploring the Bacterial Protein-Sequence Space.

    Science.gov (United States)

    Wetzl, Dennis; Berrera, Marco; Sandon, Nicolas; Fishlock, Dan; Ebeling, Martin; Müller, Michael; Hanlon, Steven; Wirz, Beat; Iding, Hans

    2015-08-17

    Recent investigations on imine reductases (IREDs) have enriched the toolbox of potential catalysts for accessing chiral amines, which are important building blocks for the pharmaceutical industry. Herein, we describe the characterization of 20 new IREDs. A C-terminal domain clustering of the bacterial protein-sequence space was performed to identify the novel IRED candidates. Each of the identified enzymes was characterized against a set of nine cyclic imine model substrates. A refined clustering towards putative active-site residues was performed and was consistent both with our screening and previously reported results. Finally, preparative scale experiments on a 100 mg scale with two purified IREDs, IR_20 from Streptomyces tsukubaensis and IR_23 from Streptomyces vidiochromogenes, were carried out to provide (R)-2-methylpiperidine in 98% ee (71% yield) and (R)-1-methyl-1,2,3,4-tetrahydroisoquinoline in >98% ee (82% yield). © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Exogenous-Base-Free Palladacycle-Catalyzed Highly Enantioselective Arylation of Imines with Arylboroxines.

    Science.gov (United States)

    Schrapel, Carmen; Peters, René

    2015-08-24

    Enantiomerically pure benzylic amines are important for the development of new drugs. A readily accessible planar-chiral ferrocene-derived palladacycle is shown to be a highly efficient catalyst for the formation of N-substituted benzylic stereocenters; this catalyst accelerates the 1,2-addition of arylboroxines to aromatic and aliphatic imines with exceptional levels of enantioselectivity. Using aldimines an exogenous base was not necessary for the activation of the boroxines, when acetate was used as an anionic ligand. Common problems such as aryl-aryl homocouplings and imine hydrolysis were fully overcome, the latter even in the absence of molecular sieves. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Synthesis of platinum and palladium complexes with bis-(hydroxy imines

    Directory of Open Access Journals (Sweden)

    Lucas M. Arantes

    2012-06-01

    Full Text Available The Schiff bases are an important class of compounds well used as ligands in coordination chemistry. The functionalized bis-imines, that represent a specific group of Schiff base, have been studied in our research group both for the evaluation of biological activity, against fungi and cancer, as for organocatalyst. Here the bis-imines 1 and 4 were synthesized in good yields by condensation of hydroxylated benzaldehydes with phenylenediamines. After that they were matched with Platinum and palladium salts providing three metallic complex (2, 3 and 5 that were fully characterized by nuclear magnetic resonance and mass spectrometry with electrospray ionization. Now these complexes are being tested in cross-coupling reactions of Heck and Suzuki.

  18. Luminescent liquid crystalline materials based on palladium(II) imine derivatives containing the 2-phenylpyridine core.

    Science.gov (United States)

    Micutz, Marin; Iliş, Monica; Staicu, Teodora; Dumitraşcu, Florea; Pasuk, Iuliana; Molard, Yann; Roisnel, Thierry; Cîrcu, Viorel

    2014-01-21

    In this work we report our studies concerning the synthesis and characterisation of a series of imine derivatives that incorporate the 2-phenylpyridine (2-ppy) core. These derivatives were used in the cyclometalating reactions of platinum(II) or palladium(II) in order to prepare several complexes with liquid crystalline properties. Depending on the starting materials used as well as the solvents employed, different metal complexes were obtained, some of them showing both liquid crystalline behaviour and luminescence properties at room temperature. It was found that, even if there are two competing coordination sites, the cyclometalation process takes place always at the 2-ppy core with (for Pt) or without (for Pd) the imine bond cleavage. We successfully showed that it is possible to prepare emissive room temperature liquid crystalline materials based on double cyclopalladated heteroleptic complexes by varying the volume fraction of the long flexible alkyl tails on the ancillary benzoylthiourea (BTU) ligands.

  19. Boron-Catalyzed Silylative Reduction of Nitriles in Accessing Primary Amines and Imines.

    Science.gov (United States)

    Gandhamsetty, Narasimhulu; Jeong, Jinseong; Park, Juhyeon; Park, Sehoon; Chang, Sukbok

    2015-07-17

    Silylative reduction of nitriles was studied under transition metal-free conditions by using B(C6F5)3 as a catalyst with hydrosilanes as a reductant. Alkyl and (hetero)aryl nitriles were efficiently converted to primary amines or imines under mild conditions. The choice of silanes was found to determine the selectivity: while a full reduction of nitriles was highly facile, the use of sterically bulky silanes allowed for the partial reduction leading to N-silylimines.

  20. Enantioselective Brønsted acid catalyzed transfer hydrogenation: organocatalytic reduction of imines.

    Science.gov (United States)

    Rueping, Magnus; Sugiono, Erli; Azap, Cengiz; Theissmann, Thomas; Bolte, Michael

    2005-08-18

    The first enantioselective Brønsted acid catalyzed reduction of imines has been developed. This new organocatalytic transfer hydrogenation of ketimines with Hantzsch dihydropyridine as the hydrogen source offers a mild method to various chiral amines with high enantioselectivity. The stereochemistry of the chiral amines can be rationalized by a stereochemical model derived from an X-ray crystal structure of a chiral BINOL phosphate catalyst. [reaction: see text

  1. Preparation of Stereodefined Homoallylic Amines from the Reductive Cross-Coupling of Allylic Alcohols with Imines

    Science.gov (United States)

    Chen, Ming Z.; McLaughlin, Martin; Takahashi, Masayuki; Tarselli, Michael A.; Yang, Dexi; Umemura, Shuhei; Micalizio, Glenn C.

    2010-01-01

    Regio-, diastereo-, and enantioselective coupling reactions between imines and allylic alcohols have been developed. These coupling reactions deliver complex homoallylic amine products through a convergent C–C bond forming process that does not proceed through intermediate allylic organometallic reagents. In general, convergent coupling, by exposure of an allylic alkoxide to a preformed Ti–imine complex, occurs with allylic transposition in a predictable and stereocontrolled manner. While simple diastereoselection in these reactions is high, delivering anti-products with ≥ 20:1 selectivity, the organometallic transformation described is compatible with a diverse range of functionality and substrates (including: aliphatic and aromatic imines, allylic silanes, trisubstituted alkenes, vinyl- and aryl halides, trifluoromethyl groups, thioethers, and aromatic heterocycles). Alkene geometry of the products is a complex function of the allylic alcohol structure, and is consistent with a mechanistic proposal based on syn-carbometalation followed by syn-elimination by way of a boat-like transition state geometry. Single asymmetric coupling reactions provide a means to translate the stereochemical information of the allylic alcohol to the homoallylic amine with very high levels of fidelity, or to control diastereoselection in the coupling reactions of achiral allylic alcohols with chiral imines. Double asymmetric coupling reactions are also described that afford a unique means to control stereoselection in these complex convergent coupling processes. Finally, empirical models are proposed that are consistent with the observed stereochemical course of these coupling reactions en route to chiral homoallylic amines possessing di- or trisubstituted alkenes, and anti- or syn- relative stereochemistry at the allylic and homoallylic positions. Overall, the bond construction enabled by this Ti-mediated reductive cross-coupling is unmatched by available methods in organic

  2. Highly diastereoselective zinc-catalyzed propargylation of tert-butanesulfinyl imines.

    Science.gov (United States)

    Fandrick, Daniel R; Johnson, Courtney S; Fandrick, Keith R; Reeves, Jonathan T; Tan, Zhulin; Lee, Heewon; Song, Jinhua J; Yee, Nathan K; Senanayake, Chris H

    2010-02-19

    A zinc-catalyzed diastereoselective propargylation of t-butanesulfinyl imines is presented. The methodology provided both aliphatic and aryl homopropargylic amines in up to 98:2 and 99.8:0.2 dr, respectively. The utility of the homopropargylic amines was demonstrated by the application to the synthesis of a cis-substituted pyrido-indole through a diastereoselective Pictet-Spengler cyclization.

  3. N-Aryl-oxazolidin-2-imine Muscle Selective Androgen Receptor Modulators Enhance Potency through Pharmacophore Reorientation

    Energy Technology Data Exchange (ETDEWEB)

    Nirschl, Alexandra A.; Zou, Yan; Krystek, Jr., Stanley R.; Sutton, James C.; Simpkins, Ligaya M.; Lupisella, John A.; Kuhns, Joyce E.; Seethala, Ramakrishna; Golla, Rajasree; Sleph, Paul G.; Beehler, Blake C.; Grover, Gary J.; Egan, Donald; Fura, Aberra; Vyas, Viral P.; Li, Yi-Xin; Sack, John S.; Kish, Kevin F.; An, Yongmi; Bryson, James A.; Gougoutas, Jack Z.; DiMarco, John; Zahler, Robert; Ostrowski, Jacek; Hamann, Lawrence G.; (BMS)

    2010-11-09

    A novel selective androgen receptor modulator (SARM) scaffold was discovered as a byproduct obtained during synthesis of our earlier series of imidazolidin-2-ones. The resulting oxazolidin-2-imines are among the most potent SARMs known, with many analogues exhibiting sub-nM in vitro potency in binding and functional assays. Despite the potential for hydrolytic instability at gut pH, compounds of the present class showed good oral bioavailability and were highly active in a standard rodent pharmacological model.

  4. Zinc(II) mediated imine-enamine tautomerization as a new chemosensory protocol

    Science.gov (United States)

    Basa, Premnath

    Zinc (II) and copper (II) are prime transition cations that are not only abundant in free state in the human body but also in bound form. They play a key role in enzymes, electron transport, and oxygen transport systems. Recently, these cations have gained interest because of their implications in Alzheimer's disease, Parkinson's disease, and other neurodegenerative disorders. Although numerous fluorescent chemosensors are currently available, less is known about their homeostasis or their etiological role in serious neurological disorders. Therefore, the current research is dedicated to developing novel chemosensors with excellent photophysical and photochemical properties and investigating their potential application for real-life problems. The dynamic nature of imines has been well utilized for the selective detection of zinc by blocking the E/Z isomerization process. However, other mechanistic pathways are available for imines; analyte-induced imine hydrolysis and metal-triggered tautomerization approaches are proving to be attractive sensory protocols. The current project is focused on understanding the basic principles that dictate Zn(II)-triggered tautomerization as a new "OFF-ON" type chemosensor. Synthesis of target compounds was achieved and confirmed through elemental analysis, 1H NMR and 13C NMR, ESI-MS, FTIR, and single-crystal XRD techniques. Zinc sensitivity and selectivity in the presence of 16 other transition, alkali, and alkaline earth cations was monitored by means of various spectroscopic and spectrometric techniques (fluorescence, UV-Vis absorbance, NMR and ESI-MS). The environmental parameters (solvents, pH) of zinc-induced fluorescence were also investigated and details will be discussed. A second project that describes Cu(II)-catalyzed imine hydrolysis via colorimetric and fluorescence change was also investigated.

  5. Synthesis of imine and reduced imine compounds containing aromatic sulfonamide: use as catalyst for in situ generation of ruthenium catalysts in transfer hydrogenation of acetophenone derivatives.

    Science.gov (United States)

    Dayan, Serkan; Arslan, Fatma; Kayacı, Nilgün; Kalaycioglu, Nilgun Ozpozan

    2014-01-01

    Three imine and three reduced imine ligands containing aromatic sulfonamide (2-7) were isolated by a simple method and characterized by FT-IR, NMR, and elemental analysis. Meanwhile, the interaction of 2-7 ligands with [(p-cymene)RuCl2]2 was analyzed in situ by UV-vis spectrophotometer. The in situ generated catalytic system derived from N-(2-(benzylideneamino)phenyl)-2,4,6-trimethyl-benzenesulfonamides and N-(2-(benzylamino)phenyl)-2,4,6-trimethyl-benzenesulfonamides with [(p-cymene)RuCl2]2 was used as a catalyst in the transfer hydrogenation (TH) of p-substituted acetophenone derivatives. The catalytic systems displayed high activities, which increased in the order 7<4<5<6<1<2<3. The best activity for the TH of 4-chloroacetophenone was provided with the [(p-cymene)RuCl2]2/ligand (3) catalytic system (turnover frequency values: 720 h(-1) for 10 min on S/C: 500/1). Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Electric-field triggered controlled release of bioactive volatiles from imine-based liquid crystalline phases.

    Science.gov (United States)

    Herrmann, Andreas; Giuseppone, Nicolas; Lehn, Jean-Marie

    2009-01-01

    Application of an electric field to liquid crystalline film forming imines with negative dielectric anisotropy, such as N-(4-methoxybenzylidene)-4-butylaniline (MBBA, 1), results in the expulsion of compounds that do not participate in the formation of the liquid crystalline phase. Furthermore, amines and aromatic aldehydes undergo component exchange with the imine by generating constitutional dynamic libraries. The strength of the electric field and the duration of its application to the liquid crystalline film influence the release rate of the expelled compounds and, at the same time, modulate the equilibration of the dynamic libraries. The controlled release of volatile organic molecules with different chemical functionalities from the film was quantified by dynamic headspace analysis. In all cases, higher headspace concentrations were detected in the presence of an electric field. These results point to the possibility of using imine-based liquid crystalline films to build devices for the controlled release of a broad variety of bioactive volatiles as a direct response to an external electric signal.

  7. Structural, vibrational, NMR, quantum chemical, DNA binding and protein docking studies of two flexible imine oximes

    Indian Academy of Sciences (India)

    YUNUS KAYA

    2016-09-01

    Two flexible imine oxime molecules, namely, 3-(pyridin-2-ylmethylimino)-butan-2-one oxime (HL¹) and 3-(pyridin-2-ylmethylimino)-pentan-2-one oxime (HL²) have been synthesized and characterized by elemental analysis, IR and NMR techniques. The conformational behavior was investigated using the density functional theory (DFT) with the B3LYP method combined with the 6-311++G(d,p) basis set. As a result of the conformational studies, three stable molecules and the most stable conformer were determined for the both imine oximes. The spectroscopic properties such as vibrational and NMR were calculated for the most stable conformer of the HL¹ and HL². The calculation results were applied to simulate infrared spectra of the title compounds, which show good agreement with observed spectra. In addition, the stable three molecules of the both imine oximes have been used to carry out DNA binding and protein docking studies with DNA and protein structures (downloaded from Protein Data Bank) using Discovery Studio 3.5 to find the most preferred binding mode of the ligands inside the DNA and protein cavity.

  8. Facile Access to Stable Silylium Ions Stabilized by N-Heterocyclic Imines

    Directory of Open Access Journals (Sweden)

    Tatsumi Ochiai

    2016-08-01

    Full Text Available Novel silylium ions with N-heterocyclic imines were successfully synthesized. The reaction of trimethylsilyl imidazolin-2-imine Me3SiNIPr (NIPr = bis(2,6-diisopropylphenyl-imidazolin-2-imino with B(C6F53 leads to dimeric imino-substituted silylium ions through a methyl group abstraction on the silicon atom. Meanwhile, the intermolecular imino-coordinated silylium ion is formed by using the less sterically crowded imine Me3SiNItBu (NItBu = bis(tert-butyl-imidazolin-2-imino. Furthermore, the treatment of dimethylchlorosilane Me2(ClSiNIPr with AgOTf affords the contact ion pair Me2(OTfSiNIPr by substitution of the chloride. A novel complex with the formula [Me2(DMAPSiNIPr][OTf] was prepared by coordination with 4-dimethylamino-pyridine (DMAP. In the solid state, the DMAP adduct [Me2(DMAPSiNIPr][OTf] contains a distinct [Me2(DMAPSiNIPr]+ moiety.

  9. Stereochemistry and Mechanistic Insight in the [2(k)+2(i)+2(i)] Annulations of Ketenes and Imines.

    Science.gov (United States)

    Yang, Zhanhui; He, Wei; Cheng, Baoxiang; Xu, Jiaxi

    2016-06-03

    The stereochemistry and mechanistic insight in the annulations of one ketene molecule with two imine molecules ([2(k)+2(i)+2(i)] annulation) are studied by using six-membered 3,4-dihydroisoquinoline as an imine probe. A concerted hetero-Diels-Alder cycloaddition mechanism is proposed to explain the stereochemical outcomes. In most cases, the zwitterionic 2-aza-1,3-butadiene-type intermediates, generated from ketenes and imines, undergo endo hetero-Diels-Alder cycloaddition with the second imine molecule. For ketenes with electron-donating substituents, (2,4)-cis-(4,5)-cis-[2(k)+2(i)+2(i)] annuladducts formed stereospecifically, while, for ketenes with electron-accepting substituents, (2,4)-cis-(4,5)-trans-[2(k)+2(i)+2(i)] annuladducts are generated stereospecifically. The [2(k)+2(i)+2(i)] annulations of aryloxyketenes and 3,4-dihydroisoquinoline give stereodivergent products due to the occurrence of the stepwise nucleophilic annulation. However, in the [2(k)+2(i)+2(i)] annulations of seven-membered cyclic imine dibenzo[b,f][1,4]oxazepine, the zwitterionic aza-butadiene-type intermediates exclusively undergo exo hetero-Diels-Alder cycloadditions with another molecule of imine to yield (2,4)-trans-(4,5)-trans-[2(k)+2(i)+2(i)] annuladducts stereospecifically, regardless of the ketene substituents. The mechanistic model not only discloses the nature of the [2(k)+2(i)+2(i)] annulations, but also can be used to explain and predict the stereochemistry of the [2(k)+2(i)+2(i)] annuladducts from different ketenes and imines.

  10. Pt-Sn/γ-Al2O3-catalyzed highly efficient direct synthesis of secondary and tertiary amines and imines.

    Science.gov (United States)

    He, Wei; Wang, Liandi; Sun, Chenglin; Wu, Kaikai; He, Songbo; Chen, Jiping; Wu, Ping; Yu, Zhengkun

    2011-11-18

    Versatile syntheses of secondary and tertiary amines by highly efficient direct N-alkylation of primary and secondary amines with alcohols or by deaminative self-coupling of primary amines have been successfully realized by means of a heterogeneous bimetallic Pt-Sn/γ-Al(2)O(3) catalyst (0.5 wt % Pt, Pt/Sn molar ratio=1:3) through a borrowing-hydrogen strategy. In the presence of oxygen, imines were also efficiently prepared from the tandem reactions of amines with alcohols or between two primary amines. The proposed mechanism reveals that an alcohol or amine substrate is initially dehydrogenated to an aldehyde/ketone or NH-imine with concomitant formation of a [PtSn] hydride. Condensation of the aldehyde/ketone species or deamination of the NH-imine intermediate with another molecule of amine forms an N-substituted imine which is then reduced to a new amine product by the in-situ generated [PtSn] hydride under a nitrogen atmosphere or remains unchanged as the final product under an oxygen atmosphere. The Pt-Sn/γ-Al(2)O(3) catalyst can be easily recycled without Pt metal leaching and has exhibited very high catalytic activity toward a wide range of amine and alcohol substrates, which suggests potential for application in the direct production of secondary and tertiary amines and N-substituted imines. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Synthesis of a Two-Dimensional Covalent Organic Monolayer through Dynamic Imine Chemistry at the Air/Water Interface.

    Science.gov (United States)

    Dai, Wenyang; Shao, Feng; Szczerbiński, Jacek; McCaffrey, Ryan; Zenobi, Renato; Jin, Yinghua; Schlüter, A Dieter; Zhang, Wei

    2016-01-01

    A two-dimensional covalent organic monolayer was synthesized from simple aromatic triamine and dialdehyde building blocks by dynamic imine chemistry at the air/water interface (Langmuir-Blodgett method). The obtained monolayer was characterized by optical microscopy, scanning electron microscopy, and atomic force microscopy, which unambiguously confirmed the formation of a large (millimeter range), unimolecularly thin aromatic polyimine sheet. The imine-linked chemical structure of the obtained monolayer was characterized by tip-enhanced Raman spectroscopy, and the peak assignment was supported by spectra simulated by density functional theory. Given the modular nature and broad substrate scope of imine formation, the work reported herein opens up many new possibilities for the synthesis of customizable 2D polymers and systematic studies of their structure-property relationships.

  12. Enantioselective Construction of Pyrrolidines by Palladium-Catalyzed Asymmetric [3+2] Cycloaddition of Trimethylenemethane with Imines

    Science.gov (United States)

    Trost, Barry M.; Silverman, Steven M.

    2012-01-01

    A protocol for the enantioselective [3+2] cycloaddition of trimethylenemethane (TMM) with imines has been developed. Central to this effort were the novel phosphoramidite ligands developed in our laboratories. The conditions developed to effect an asymmetric TMM reaction using 2-trimethylsilylmethyl allyl acetate were shown to be tolerant of a wide variety of imine acceptors to provide the corresponding pyrrolidine cycloadducts with excellent yields and selectivities. Use of a bis-2-naphthyl phosphoramidite allowed the successful cycloaddition of the parent TMM with N-Boc imines, and has further permitted the reaction of substituted donors with N-tosyl aldimines and ketimines in high regio-, diastereo-, and enantioselectivity. Use of a diphenylazetidine ligand allows the complimentary synthesis of the exocyclic nitrile product shown, and we demonstrate control of the regioselectivity of the product based on manipulation of the reaction parameters. PMID:22309214

  13. Mechanism of Amido-Thiourea Catalyzed Enantioselective Imine Hydrocyanation: Transition State Stabilization via Multiple Non-Covalent Interactions

    Science.gov (United States)

    Zuend, Stephan J.

    2009-01-01

    An experimental and computational investigation of amido-thiourea promoted imine hydrocyanation has revealed a new and unexpected mechanism of catalysis. Rather than direct activation of the imine by the thiourea, as had been proposed previously in related systems, the data are consistent with a mechanism involving catalyst-promoted proton transfer from hydrogen isocyanide to imine to generate diastereomeric iminium/cyanide ion pairs that are bound to catalyst through multiple non-covalent interactions; these ion pairs collapse to form the enantiomeric α-aminonitrile products. This mechanistic proposal is supported by the observation of a statistically significant correlation between experimental and calculated enantioselectivities induced by eight different catalysts (P ≪ 0.01). The computed models reveal a basis for enantioselectivity that involves multiple stabilizing and destabilizing interactions between substrate and catalyst, including thiourea-cyanide and amide-iminium interactions. PMID:19778044

  14. N,N-Diisopropyl-N-phosphonyl Imines Lead to Efficient Asymmetric Synthesis of Aziridine-2-Carboxylic Esters

    Science.gov (United States)

    Kattamuri, Padmanabha V.; Xiong, Yiwen; Pan, Yi; Li, Guigen

    2013-01-01

    Highly diastereoselective asymmetric synthesis of chiral aziridine-2-carboxylic esters is reported for 20 examples with good yields (51–87%) and excellent diastereoselectivities (>99:1 dr for most cases). The modified N-phosphonyl imines are proven to be superior to previous imine auxiliaries for the aza Darzens reaction by using secondary isopropyl to replace primary benzyl group for N,N-diamino protection. In the meanwhile, a special operation by slowly adding the pre-cooled imine solution at −78 °C into the preformed β-bromo lithium enolate mixture at this temperature in the presence of 4 Å molecular sieves was found to be crucial in terms of yields and diastereoselectivity. The present method can provide an easy and general access to β-hydroxy α-amino acids and other important amino building blocks. PMID:23563304

  15. Design, synthesis, and characterization of TPA-thiophene-based amide or imine functionalized molecule for potential optoelectronic devices

    Science.gov (United States)

    Sarswat, Prashant K.; Sathyapalan, Amarchand; Zhu, Yakun; Free, Michael L.

    2013-01-01

    New sets of molecules containing tri-phenyl-amine (TPA) core and thiophene unit with amide and imine functional groups are designed, synthesized, characterized, and compared. These are solution processable small molecules with high mobility. The newly designed molecules have better solubility due to the C=N (imine) and CONH2 (amide) moiety as compared to the established molecules with CH=CH (methine) for optoelectronic applications. They have an optimal energy band gap, which indicates their potential utility in a variety of optoelectronic applications. These molecules also show efficient intermolecular charge transfer mechanisms similar to conventional organic semiconducting molecules as evidenced by optical measurements. Density functional theory simulation results show that the localization of the frontier highest occupied molecular orbital is around the TPA core for molecules coupled with imine and amide, and is reasonably stable.

  16. Silver nanoparticles supported on alumina-​a highly efficient and selective nanocatalyst for imine reduction

    DEFF Research Database (Denmark)

    Poreddy, Raju; Garcia-Suarez, Eduardo J.; Riisager, Anders

    2014-01-01

    organic synthesis. Due to the mild reaction conditions and high conversion as well as high selectivity, we consider that the utilization of silver nanoparticles supported on alumina represents an attractive and environmentally friendly alternative to the current synthesis of N-alkyl amines.......Silver nanoparticles supported on alumina were prepared and tested in the catalytic reduction of various imines to primary and secondary amines and were shown to be exceptionally active and chemoselective. Furthermore, the catalytic activity of the prepared nanocatalyst was also tested...

  17. On the mechanism of imine elimination from Fischer tungsten carbene complexes

    OpenAIRE

    Philipp Veit; Christoph Förster; Katja Heinze

    2016-01-01

    (Aminoferrocenyl)(ferrocenyl)carbene(pentacarbonyl)tungsten(0) (CO)5W=C(NHFc)Fc (W(CO)5(E-2)) is synthesized by nucleophilic substitution of the ethoxy group of (CO)5W=C(OEt)Fc (M(CO)5(1Et)) by ferrocenyl amide Fc-NH– (Fc = ferrocenyl). W(CO)5(E-2) thermally and photochemically eliminates bulky E-1,2-diferrocenylimine (E-3) via a formal 1,2-H shift from the N to the carbene C atom. Kinetic and mechanistic studies to the formation of imine E-3 are performed by NMR, IR and UV–vis spectroscopy a...

  18. Additive-Free Pd-Catalyzed α-Allylation of Imine-Containing Heterocycles.

    Science.gov (United States)

    Kljajic, Marko; Puschnig, Johannes G; Weber, Hansjörg; Breinbauer, Rolf

    2017-01-06

    An additive-free Pd-catalyzed α-allylation of different imino-group-ontaining heterocycles is reported. The activation of α-CH pronucleophiles (pKa (DMSO) > 25) occurs without the addition of strong bases or Lewis acids using only the Pd/Xantphos catalyst system. The reaction scope has been studied for various 5- and 6-membered nitrogen-containing heterocycles (yields up to 96%). Mechanistic investigations suggest an initial allylation of the imine-N followed by a Pd-catalyzed formal aza-Claisen rearrangement.

  19. Amino Azaxylylenes Photogenerated from o-Amido Imines: Photoassisted Access to Complex Spiro-Poly-Heterocycles.

    Science.gov (United States)

    Mukhina, Olga A; Kuznetsov, Dmitry M; Cowger, Teresa M; Kutateladze, Andrei G

    2015-09-21

    Upon irradiation, cyclic imines containing o-amido groups are shown to produce reactive intermediates, amino azaxylylenes, which undergo intramolecular cycloadditions to tethered unsaturated pendants to yield complex N,O-heterocycles having an additional spiro-connected nitrogen heterocyclic moiety. Modular assembly of the photoprecursors allows expeditious increase of the complexity of the target poly-heterocyclic scaffolds with a minimal number of experimentally simple reaction steps. The photocyclization and subsequent postphotochemical transformations are accompanied by an increase of Lovering's fsp3 factor, thus producing unprecedented three-dimensional molecular architectures, and offering extended sampling of chemical space.

  20. Harvesting Covert Networks: The Case Study of the iMiner Database

    DEFF Research Database (Denmark)

    Memon, Nasrullah; Wiil, Uffe Kock; Alhajj, Reda

    2011-01-01

    collected by intelligence agencies and government organisations is inaccessible to researchers. To counter the information scarcity, we designed and built a database of terrorist-related data and information by harvesting such data from publicly available authenticated websites. The database...... was incorporated in the iMiner prototype tool, which makes use of investigative data mining techniques to analyse data. This paper will present the developed framework along with the form and structure of the terrorist data in the database. Selected cases will be referenced to highlight the effectiveness of the i...

  1. Well-Defined Silica Grafted Molybdenum Bis(imido) Catalysts for Imine Metathesis Reactions

    KAUST Repository

    Barman, Samir

    2017-04-06

    Novel site-isolated tetracoordinated molybdenum complexes possessing bis(imido) ligands, [(≡Si–O)2Mo(═NR)2] (R = t-Bu, 2,6-C6H3-i-Pr2), were immobilized on partially dehydroxylated silica (SiO2-200) by a rigorous surface organometallic chemistry protocol. The newly developed materials adorned with bis(imido) functional units, which were previously exploited mainly as spectator ligands on silica-supported olefin metathesis molybdenum catalysts, are found to be efficient heterogeneous catalytic systems for imine cross metathesis under mild conditions.

  2. Synthesis and biology of cyclic imine toxins, an emerging class of potent, globally distributed marine toxins.

    Science.gov (United States)

    Stivala, Craig E; Benoit, Evelyne; Aráoz, Rómulo; Servent, Denis; Novikov, Alexei; Molgó, Jordi; Zakarian, Armen

    2015-03-01

    From a small group of exotic compounds isolated only two decades ago, Cyclic Imine (CI) toxins have become a major class of marine toxins with global distribution. Their distinct chemical structure, biological mechanism of action, and intricate chemistry ensures that CI toxins will continue to be the subject of fascinating fundamental studies in the broad fields of chemistry, chemical biology, and toxicology. The worldwide occurrence of potent CI toxins in marine environments, their accumulation in shellfish, and chemical stability are important considerations in assessing risk factors for human health. This review article aims to provide an account of chemistry, biology, and toxicology of CI toxins from their discovery to the present day.

  3. Novel cycloalkylthiophene-imine derivatives bearing benzothiazole scaffold: synthesis, characterization and antiviral activity evaluation.

    Science.gov (United States)

    Ke, Shaoyong; Wei, Yanhong; Yang, Ziwen; Wang, Kaimei; Liang, Ying; Shi, Liqiao

    2013-09-15

    A series of novel cycloalkylthiophene-imine derivatives containing benzothiazole unit were designed, synthesized and evaluated for their anti-viral activities. The bio-evaluation results indicated that some of the target compounds (such as 5g, 5i, 5u) exhibited good to moderate antiviral effect on CVB5, ADV7 and EV71 viruses, however, these compounds did not have inhibition activity against H1N1 virus. Especially, the compounds 4c and 4d also exhibited high antiviral activities, which provide a new and efficient approach to evolve novel multi-functional antiviral agents by rational integration of active pharmacophores. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Tissue-Integratable and Biocompatible Photogelation by the Imine Crosslinking Reaction.

    Science.gov (United States)

    Yang, Yunlong; Zhang, Jieyuan; Liu, Zhenzhen; Lin, Qiuning; Liu, Xiaolin; Bao, Chunyan; Wang, Yang; Zhu, Linyong

    2016-04-13

    A novel photogelling mechanism by the phototriggered-imine-crosslinking (PIC) reaction is demonstrated. Hyaluronic acid grafted with o-nitrobenzene, a photogenerated aldehyde group, can quickly photo-crosslink with amino-bearing polymers or proteins. Once the in situ photogelling on a wound occurs, the PIC gelling process can well integrate a hydrogel with surrounding tissue by covalent bonding, thus making it a powerful tool for tissue engineering and regenerative medicine. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Homo- and Copolymerization of Ethylene and Norbornene with Anilido–Imine Chromium Catalysts

    Directory of Open Access Journals (Sweden)

    Lixia Pei

    2016-03-01

    Full Text Available A series of anilido–imine chromium complexes have been used as precursors to catalyze homo- and copolymerization of ethylene and norbornene. The chromium complexes activated with methylalumoxane (MAO exhibit good activities for homopolymerization of ethylene (E to produce linear polyethylene and moderate activities for norbornene (N polymerization to afford vinyl-type polynorbornene. Ethylene–norbornene copolymers with high incorporation of norbornene can be also produced by these catalysts. 13C NMR and differential scanning calorimetry (DSC analyses show that the copolymers are random products, and –NNN– and –EEE– units can be observed in the microstructure of the copolymers.

  6. Insight into the crystallization of amorphous imine-linked polymer networks to 2D covalent organic frameworks.

    Science.gov (United States)

    Smith, Brian J; Overholts, Anna C; Hwang, Nicky; Dichtel, William R

    2016-03-04

    We explore the crystallization of a high surface area imine-linked two-dimensional covalent organic framework (2D COF). The growth process reveals rapid initial formation of an amorphous network that subsequently crystallizes into the layered 2D network. The metastable amorphous polymer may be isolated and resubjected to growth conditions to form the COF. These experiments provide the first mechanistic insight into the mechanism of imine-linked 2D COF formation, which is distinct from that of boronate-ester linked COFs.

  7. Trypsin-catalyzed multicomponent reaction: A novel and efficient one-pot synthesis of thiazole-2-imine derivatives.

    Science.gov (United States)

    Zhou, Junbin; Huang, Xingtian; Zhang, Zhuan; Song, Ping; Li, Yiqun

    2017-01-10

    The first Trypsin from porcine pancreas catalyzed a novel one-pot three-component reaction of α-bromoketone, primary alkylamines, and phenylisothiocyanate for the synthesis of thiazole-imine derivatives with high yields (up to 98%) in a short time under mild conditions. The results revealed that Trypsin exhibited excellent catalytic activity and great tolerance for broad substrates. This Trypsin-catalyzed three component convergent method provides a novel strategy for the synthesis of thiazole-2-imine derivatives and expands the promiscuous functions of enzymes in organic synthesis. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. An Overview Of Photosubstitution Reactions Of Ru(II) Imine Complexes And Their Application In Photobiology And Photodynamic Therapy.

    Science.gov (United States)

    White, Jessica K; Schmehl, Russell H; Turro, Claudia

    2017-01-01

    This article is a short review that presents a short review of photosubstitution reactions of Ru(II) imine complexes and illustrates their use in the development of therapeutic agents. The review begins with an overview of the photophysical behavior and common photoreactions of Ru(II) imine complexes, with select examples from the literature since the 1960s. It is followed by a more detailed picture of the application of knowledge gained over the years in the development of Ru(II) complexes for photobiology and photodynamic therapy.

  9. Imine-linked receptors decorated ZnO-based dye-sensitized solar cells

    Indian Academy of Sciences (India)

    SATBIR SINGH; AMARPAL SINGH; NAVNEET KAUR

    2016-10-01

    This study reports the synthesis, characterization and photophysical properties of imine-linked receptors decorated ZnO nanoparticles using wet precipitation method. Initially, polymer dye 3 was synthesized usingcondensation reaction between 2-furancarboxaldehyde 1 and polyethylenimine 2. The decoration of imine-linked receptors on ZnO nanoparticles (sample A) was characterized and investigated by X-ray diffraction, scanning electronmicroscope and dynamic light scattering spectroscopic studies. Further, polymer dye 3 was added to ruthenium chloride (RuCl$_3$) to form a polymer–ruthenium-based composite dye-capped ZnO nanoparticles (sample B).The optical properties of sample A were evaluated by fluorescence and UV–Vis spectroscopy. The samples A and B were further processed to dye-sensitized solar cells using wet precipitation method. The results of observationsrevealed that the addition of ruthenium–polymer dye molecules increased the light harvesting capacity of ZnO-based DSSCs. A maximum solar power to electricity conversion efficiency ($\\eta$) of 3.83% was recorded for sample B-based DSSCs with ruthenium–metal complex dye as a good photosensitizer. The recorded photovoltaic efficiency of sample B-based DSSCs was enhanced by 1.36% compared to sample A-based DSSCs.

  10. A catalyst-free addition reaction of zinc amide enolates to N-sulfonyle imines

    Energy Technology Data Exchange (ETDEWEB)

    Joo, Seong Ryu; Im, Pyeong Won; Kim, Jong Sung; Kim, Seung Hoi [Dept. of Chemistry, Dankook University, Cheonan (Korea, Republic of); Park Soo Youl [Interface Chemistry and Engineering Research Team, Korea Research Institute of Chemical Technology, Daejon (Korea, Republic of)

    2016-12-15

    Despite the remarkable expansion of the imino-Reformatsky reaction, one interesting aspect is that, to the best of our knowledge, zinc enolates derived solely from α-halo esters have been mainly used in the recent progress. In contrast, a few limited examples have been reported concerning the application of zinc enolates derived from α-halo amide to the imino-Reformatsky reaction. In recent years, Rodriguez-Solla and co-workers reported the addition reaction of samarium enolates derived from both α-halo esters and amides to imines, resulting in the synthe- sis of β-amino esters or amides. In conclusion, we established a potential synthetic proto- col for the preparation of β-amino amides. This work was accomplished by the direct addition of zinc amide enolates to N-sulfonyl imines in the absence of any metal-catalyst under mild conditions. Due to the operational simplicity of the proposed method, it can be further utilized in synthetic organic chemistry. Further studies to elucidate the scope of this approach are currently underway in our laboratory.

  11. Ionic Liquids as Catalysts for the Radical Acrylate Polymerization Co-initiated by Imine Bases

    Science.gov (United States)

    Polenz, I.; Spange, S.

    2014-08-01

    The catalysis of the imine base acrylate (IBA) polymerization by Ionic Liquids (ILs) is reported. Addition of IL traces (~10-50 mM) to an imine base / acrylate mixture leads to both a significant decrease of the activation temperature (40 °C) required for the IBA polymerization process and an increase in the polymerization rate by a factor of 5-40 depending on the IL species. The radical character of the polymerization is proved by copolymerization experiments using methyl methacrylate (MMA) and methacrylonitrile (MAN) and comparison with literature known values of copolymerization parameters rMMA and rMAN of these co-monomers. The influence of the IL on the polymerization kinetics is quantified by the polymerization rate law; the order referring to the IL is 1 indicating its crucial impact on the monomer activation. The IBA activation properties are strongly dependent on the IL interaction strengths with the IBA components verified by the KAMELT-TAFT hydrogen bond donating ability α. The stronger the interaction (higher α) is, the less the IBA polymerization activation. The temperature dependence of four different IL catalysed IBA polymerization is investigated, allows a classification and anomalous non-ARRHENIUS regimes are discussed. Activation energies EA,P span over 20 and 50 kJ·mol-1, which is between the values of thermal- (~80 kJ·mol-1) and photo-initiation (~20 kJ·mol-1).

  12. Ferrocenyl branched poly (ethylene imine) micelles as reductive templates for the preparation of silver nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Leize; Zhou Wenbo; Ji Jian, E-mail: jijian@zju.edu.c [Zhejiang University, Department of Polymer Science, Key Laboratory of Macromolecule Synthesis and Functionalization of Minister of Education (China)

    2010-08-15

    Polymeric micelles with a branched poly (ethylene imine) shell and a reductive ferrocene core were prepared via self-assembly of ferrocene modified branched poly (ethylene imine) (BPEI-Fc). The well-controlled polymeric micelles with a reductive core were used as templates to prepare core-shell-structured silver nanoparticles (AgNPs) in aqueous solution. The as-prepared nanoparticles were characterized by UV-Vis spectrophotometer, transmission electron microscope (TEM), selected-area electron diffraction (SAED), thermogravimetry analyzer (TGA), and dynamic light scattering (DLS). The AgNPs of 39 {+-} 9 nm with a 39-nm BPEI layer were obtained. It is demonstrated that ferrocene, which is a neutral, chemically stable, and nontoxic molecule, plays a dual role as the hydrophobe and as the electron donating group. Moreover, the formation of these particles was monitored in situ by UV-Vis spectrophotometer. It is found that the growth of AgNPs through reductive templates is much slower than that reduced by NaBH{sub 4}. Meanwhile, the size distribution of AgNPs becomes narrower during the reaction. BPEI-covered AgNPs (Ag-BPEI) are stable up to 3 months and carry amino groups, which can further be bioconjugated. These core-shell-structured nanoparticles may enable them to be used for wide applications in aqueous solution.

  13. Nanomechanical properties of hydroxyapatite (HAP) with DAB dendrimers (poly-propylene imine) coatings onto titanium surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Charitidis, Costas A., E-mail: charitidis@chemeng.ntua.gr [School of Chemical Engineering, National Technical University of Athens, Iroon Polytechniou, Zografou, 15780 Athens (Greece); Skarmoutsou, Amalia [School of Chemical Engineering, National Technical University of Athens, Iroon Polytechniou, Zografou, 15780 Athens (Greece); Tsetsekou, Athena; Brasinika, Despina [School of Mining Engineering and Metallurgy, National Technical University of Athens, Iroon Polytechniou, Zografou, 15780 Athens (Greece); Tsiourvas, Dimitris [National Centre for Scientific Research “Demokritos”, Institute of Physical Chemistry, Agia Paraskevi, 15310 Athens (Greece)

    2013-04-20

    Highlights: ► The synthesis of hydroxyapatite (HAP) nanoparticles in the presence of a cationic fourth generation diaminobutane poly(propylene imine) dendrimer (DAB). ► The nanomechanical properties of different HAP-DAB coatings onto titanium surfaces. ► Wear resistance and adhesion properties of the synthesized coatings quantified by nanoindentation data analysis. -- Abstract: Coatings of hydroxyapatite (HAP) nanorods onto titanium surfaces were synthesized with the aim to improve coatings’ mechanical properties and adhesion to the substrate. The coatings are consisting of HAP nanorods synthesized in the presence of a cationic fourth generation diaminobutane poly(propylene imine) dendrimer (DAB) bearing 32 amine end groups employing varying calcium: dendrimer ratios and varying hydrothermal treatments. The quality, surface morphology and structure of the coatings were characterized with X-ray diffraction, thermogravimetric analysis, scanning electron microscopy and energy dispersive microanalysis. Wear resistance and adhesion properties of the coatings onto titanium substrates were studied through nanoindentation analysis. The experimental conditions, namely the calcium: dendrimer molar ratio and the hydrothermal treatment temperature were carefully selected; thus, it was possible to produce coatings of high hardness and elastic modulus values (ranging between 1–4.5 GPa and 40–150 GPa, respectively) and/or high wear resistance and plastic deformation values.

  14. Osmium(ii) complexes for light-driven aerobic oxidation of amines to imines.

    Science.gov (United States)

    Li, Yong-Hui; Liu, Xiao-Le; Yu, Zhen-Tao; Li, Zhao-Sheng; Yan, Shi-Cheng; Chen, Guang-Hui; Zou, Zhi-Gang

    2016-08-02

    Herein, we describe the synthesis and characterization of three Os(ii) complexes (i.e., [Os(fptz)2(PPhMe2)2] (1, fptzH = 3-trifluoromethyl-5-pyridyl-1,2,4-triazole), [Os(fptz)2(CO)(L1)] (2, L1 = PPh3; 3, L1 = pyridine)) that have been successfully utilized as good photocatalysts to promote aerobic oxidative coupling of amines to imines with molecular oxygen in air as a green oxidant. Complex 1 is the most effective catalyst for the oxidative coupling of benzylamine with molecular O2 (air) as the oxidant because of the complex's strong absorption of visible light and long-lived triplet state. The application of a low catalyst loading (0.06 mol%) of complex 1 to the oxidative coupling of a wide range of amines affords the corresponding imines efficiently and selectively in most cases. The reaction mechanism was investigated via relevant control and quenching experiments. The results indicated that the reaction occurs via an active (1)O2-involved pathway. The (1)O2-generating ability of complex 1 as a photosensitizer was evaluated using 9,10-dimethylanthracene (DMA) as a chemical trap for (1)O2.

  15. Ferrocenyl branched poly (ethylene imine) micelles as reductive templates for the preparation of silver nanoparticles

    Science.gov (United States)

    Zhu, Lei-ze; Zhou, Wen-bo; Ji, Jian

    2010-08-01

    Polymeric micelles with a branched poly (ethylene imine) shell and a reductive ferrocene core were prepared via self-assembly of ferrocene modified branched poly (ethylene imine) (BPEI-Fc). The well-controlled polymeric micelles with a reductive core were used as templates to prepare core-shell-structured silver nanoparticles (AgNPs) in aqueous solution. The as-prepared nanoparticles were characterized by UV-Vis spectrophotometer, transmission electron microscope (TEM), selected-area electron diffraction (SAED), thermogravimetry analyzer (TGA), and dynamic light scattering (DLS). The AgNPs of 39 ± 9 nm with a 39-nm BPEI layer were obtained. It is demonstrated that ferrocene, which is a neutral, chemically stable, and nontoxic molecule, plays a dual role as the hydrophobe and as the electron donating group. Moreover, the formation of these particles was monitored in situ by UV-Vis spectrophotometer. It is found that the growth of AgNPs through reductive templates is much slower than that reduced by NaBH4. Meanwhile, the size distribution of AgNPs becomes narrower during the reaction. BPEI-covered AgNPs (Ag@BPEI) are stable up to 3 months and carry amino groups, which can further be bioconjugated. These core-shell-structured nanoparticles may enable them to be used for wide applications in aqueous solution.

  16. Background defining during the imine formation reaction in FT-IR liquid cell

    Science.gov (United States)

    Namli, Hilmi; Turhan, Onur

    2006-05-01

    Imine formation is a very important chemical reaction because of its relevance to biological process. Therefore, it is crucial to follow whole reaction process in detail. The current work performed to monitor the whole imination reaction in real time in liquid cell by FT-IR spectroscopy. The complex spectral futures due to solvent, unreacted reagents, acid catalysis and other additives are eliminated by defining a background at the beginning or at any time during the reaction. This procedure also makes it possible to monitor the changes in the concentration of each component in the liquid cell. The consumption of the functional groups of the reagents results in absorbance due to the direct difference spectra while the appearance of functional groups is monitored as percentage transmittance. The concentration changes in the cell arising from the reaction gives the product spectra without having to isolate it from the mixture. It is also possible to see the intermediates appearing and disappearing during the reaction. This report also illustrates a brief application of the technique by time dependence of the peak highs in absorption (ABS) mode.

  17. Multiconfiguration Self-Consistent Field Study on Formonitrile Imine and N-Substituted Nitrile Imines HCN2-R: Energy Component Analysis of the Pseudo-Jahn-Teller Effect.

    Science.gov (United States)

    Toyota, Azumao; Muramatsu, Takashi; Koseki, Shiro

    2017-03-23

    Stable geometrical structures for formonitrile imine (1) and N-substituted nitrile imines HCN2-R (R = Li, BeH, BH2, CH3, CN, CCH, C6H5, NH2, OH, and F) (2-11) were examined by using the multiconfiguration self-consistent-field (MCSCF) method followed by second-order configuration interaction (SOCI) calculations and second-order multiconfiguration quasi-degenerate perturbation theory (MCQDPT2) calculations, together with the aug-cc-pVTZ basis sets. The results show that 1 suffers a pseudo-Jahn-Teller (JT) distortion from a linear C∞v structure to a C1 structure via a planar bent Cs structure. Each of the others is found to undergo pseudo-JT distortion from a symmetrical structure to a planar bent Cs structure for 2, 3, and 7 and to a C1 structure for 4, 5, 6, 8, 9, 10, and 11. At the stationary structures of 1-11, the structural characteristics were briefly discussed in terms of allenic and propargylic. To elucidate the nature of pseudo-JT distortions, energy component analyses were carried out at the MCSCF+SOCI level of theory at all of the stationary structures for the relevant molecules. In most of the molecules examined, pseudo-JT stabilizations were classified into two groups, one in which the stability arises from a lowering of the energy of the attractive term Ven and the other in which the stability results from a lowering of the energy of the repulsive terms Vnn and Vee. In addition to the above two groups, it was also found that the following three groups are responsible for the pseudo-JT stabilizations in a certain stage of the structural changes. Namely, one is a lowering of the energy of the term Vee observed in 6, another is a lowering of the energy of the terms Vee and Ven observed in 9-11, and the other is a lowering of the energy of the terms Ven and Vnn observed in 10. These energetic behaviors were accounted in terms of an elongation or a contraction of the molecular skeleton, a migration of electrons from one part of the molecule to other parts

  18. Maltose- and maltotriose-modified, hyperbranched poly(ethylene imine)s (OM-PEIs): Physicochemical and biological properties of DNA and siRNA complexes.

    Science.gov (United States)

    Höbel, Sabrina; Loos, Andrea; Appelhans, Dietmar; Schwarz, Simona; Seidel, Jürgen; Voit, Brigitte; Aigner, Achim

    2011-01-20

    Polycationic non-viral polymers are widely employed as delivery platforms of plasmid DNA, or of small interfering RNAs (siRNAs) for the induction of RNA interference (RNAi). Among those, poly(ethylene imine)s (PEIs) take a prominent position due to their relatively high efficacy; however, their biodistribution profiles upon systemic delivery and their toxicity pose limitations which can be addressed by the introduction of PEI modifications. In this paper, we systematically analyse physicochemical and biological properties of DNA and siRNA complexes prepared from a set of maltose-, maltotriose- or maltoheptaose-modified hyperbranched PEIs (termed (oligo-)maltose-modified PEIs; OM-PEIs). We show that pH-dependent charge densities of the OM-PEIs correlate with the structure and degree of grafting, and the length of the oligomaltose. Decreased zeta potentials of OM-PEI-based complexes and changes in the thermodynamics of DNA complex formation are observed, while the complex sizes are largely unaffected by maltose grafting and the presence of serum proteins. Furthermore, although complexation efficacies of siRNAs are not altered, complex stabilities are markedly increased in OM-PEI complexes. DNA complex uptake and transfection kinetics are slowed down upon maltose-grafting of the PEI which can be attributed to decreased zeta potentials, and alterations in the uptake mechanisms (clathrin-dependent/clathrin-independent endocytosis) are observed. Independent of the maltose architecture, DNA and siRNA complexes based on maltose-grafted PEI show considerably lower cytotoxicity as compared to PEI complexes. While maltose grafting generally leads to reduced in vitro transfection efficacies, this effect is less profound in some OM-PEI/siRNA complexes as compared to OM-PEI/DNA complexes. Importantly, upon their systemic application in vivo, OM-PEI/siRNA complexes show marked differences in the siRNA biodistribution profile with e.g. substantially decreased siRNA levels in the

  19. A Dinâmica do Significado do Trabalho na Iminência de uma Privatização

    Directory of Open Access Journals (Sweden)

    Marcia Prezotti Palassi

    2014-04-01

    Full Text Available http://dx.doi.org/10.5007/2175-8077.2014v16n38p47Este artigo visa a evidenciar a dinâmica do significado do trabalho na iminência da privatização de uma empresa do setor de saneamento brasileiro. A discussão apoia-se nas ideias do MOW (1987 sobre a construção do significado do trabalho e de Tajfel (1981 sobre a pertença a grupos sociais. A ênfase na iminência baseia-se no entendimento de Figueiredo e Viana (1982 de que a contínua expectativa de frustração gera impacto diferenciado em relação a uma situação definida. Os dados foram coletados por meio de observação participante e de questionários. Os dados quantitativos foram analisados através da estatística descritiva e os qualitativos submetidos à análise de conteúdo. Os resultados revelaram uma dinâmica que fragmenta os significados do trabalho na iminência da privatização e se apresenta associada a diferentes sentidos e aspectos da situação. Propõe-se que a fragmentação do significado do trabalho diante da iminência de determinadas situações repita-se em outros contextos na atualidade.

  20. Diastereoselective Addition of α-Metalated Sulfoxides to Imines Revisited: Mechanism, Computational Studies, and the Effect of External Chiral Ligands

    DEFF Research Database (Denmark)

    Pedersen, Brian; Rein, Tobias; Søtofte, Inger;

    2003-01-01

    Some new results on asymmetric synthesis via the addition of a-metalated methyl tolyl sulfoxides to imines are presented. Good diastereoselectivity (up to > 98% d.e. for product 3g) can be obtained under conditions of kinetic control (short reaction time, low temperature). The transition state (a...

  1. Hydrogenation of imines catalysed by ruthenium(II) complexes based on lutidine-derived CNC pincer ligands.

    Science.gov (United States)

    Hernández-Juárez, Martín; Vaquero, Mónica; Álvarez, Eleuterio; Salazar, Verónica; Suárez, Andrés

    2013-01-14

    The preparation of new Ru(II) complexes incorporating fac-coordinated lutidine-derived CNC ligands is reported. These derivatives are selectively deprotonated by (t)BuOK at one of the methylene arms of the pincer, leading to catalytically active species in the hydrogenation of imines.

  2. Formation of imines by selective gold-catalysed aerobic oxidative coupling of alcohols and amines under ambient conditions

    DEFF Research Database (Denmark)

    Kegnæs, Søren; Mielby, Jerrik Jørgen; Mentzel, Uffe Vie

    2010-01-01

    The formation of imines by aerobic oxidative coupling of mixtures of alcohols and amines was studied using gold nanoparticles supported on titanium dioxide, TiO2, as a heterogeneous catalyst. The reactions were performed at ambient conditions (room temperature and atmospheric pressure) and occurred...

  3. Light-driven nitrile imine-mediated tetrazole-ene cycloaddition as a versatile platform for fullerene conjugation.

    Science.gov (United States)

    Sugawara, Yuuki; Jasinski, Nils; Kaupp, Michael; Welle, Alexander; Zydziak, Nicolas; Blasco, Eva; Barner-Kowollik, Christopher

    2015-08-21

    An efficient methodology for modular fullerene functionalization via the photo-induced nitrile imine-mediated tetrazole-ene cycloaddition (NITEC) is introduced. The versatility and platform character of the method is illustrated by the light-driven reaction of fullerenes with small molecule, polymeric and surface-immobilized tetrazoles. The efficient fullerene conjugation is evidenced via mass spectrometric techniques.

  4. Azeotropic Preparation of a "C"-Phenyl "N"-Aryl Imine: An Introductory Undergraduate Organic Chemistry Laboratory Experiment

    Science.gov (United States)

    Silverberg, Lee J.; Coyle, David J.; Cannon, Kevin C.; Mathers, Robert T.; Richards, Jeffrey A.; Tierney, John

    2016-01-01

    Imines are important in biological chemistry and as intermediates in organic synthesis. An experiment for introductory undergraduate organic chemistry is presented in which benzaldehyde was condensed with "p"-methoxyaniline in toluene to give 4-methoxy-"N"-(phenylmethylene)benzenamine. Water was removed by azeotropic…

  5. Rhodium-catalyzed imination of sulfoxides and sulfides: efficient preparation of N-unsubstituted sulfoximines and sulfilimines.

    Science.gov (United States)

    Okamura, Hiroaki; Bolm, Carsten

    2004-04-15

    The Rh(II)-catalyzed imination of sulfoxides and sulfides using [Rh(2)(OAc)(4)] as a catalyst and trifluoroacetamide or sulfonylamides in combination with iodobenzene diacetate and magnesium oxide affords sulfoximines and sulfilimines, respectively, in a stereospecific manner. [reaction: see text

  6. Azeotropic Preparation of a "C"-Phenyl "N"-Aryl Imine: An Introductory Undergraduate Organic Chemistry Laboratory Experiment

    Science.gov (United States)

    Silverberg, Lee J.; Coyle, David J.; Cannon, Kevin C.; Mathers, Robert T.; Richards, Jeffrey A.; Tierney, John

    2016-01-01

    Imines are important in biological chemistry and as intermediates in organic synthesis. An experiment for introductory undergraduate organic chemistry is presented in which benzaldehyde was condensed with "p"-methoxyaniline in toluene to give 4-methoxy-"N"-(phenylmethylene)benzenamine. Water was removed by azeotropic…

  7. Diastereoselective Allylation of "N"-"Tert"-Butanesulfinyl Imines: An Asymmetric Synthesis Experiment for the Undergraduate Organic Laboratory

    Science.gov (United States)

    Chen, Xiao-Yang; Sun, Li-Sen; Gao, Xiang; Sun, Xing-Wen

    2015-01-01

    An asymmetric synthetic experiment that encompasses both diastereoselectivity and enantioselectivity is described. In this experiment, Zn-mediated allylation of an ("R")-"N"-"tert"-butanesulfinyl imine is first performed to obtain either diastereomer using two different solvent systems, followed by oxidation of the…

  8. The biochemical characterization of three imine-reducing enzymes from Streptosporangium roseum DSM43021, Streptomyces turgidiscabies and Paenibacillus elgii.

    Science.gov (United States)

    Scheller, Philipp N; Nestl, Bettina M

    2016-12-01

    Recently imine reductases (IREDs) have emerged as promising biocatalysts for the synthesis of a wide variety of chiral amines. To promote their application, many novel enzymes were reported, but only a few of them were biochemically characterized. To expand the available knowledge about IREDs, we report the characterization of two recently identified (R)-selective IREDs from Streptosporangium roseum DSM43021 and Streptomyces turgidiscabies and one (S)-selective IRED from Paenibacillus elgii. The biochemical properties including pH profiles, temperature stabilities, and activities of the enzymes in the presence of organic solvents were investigated. All three enzymes showed relatively broad pH spectra with maximum activities in the neutral range. While the (R)-selective IREDs displayed only limited thermostabilities, the (S)-selective enzyme was found to be the most thermostable IRED known to date. The activity of this IRED proved also to be most tolerant towards the investigated co-solvents DMSO and methanol. We further studied activities and selectivities towards a panel of cyclic imine model substrates to compare these enzymes with other IREDs. In biotransformations, IREDs showed high conversions and the amine products were obtained with up to 99 % ee. By recording the kinetic constants for these compounds, substrate preferences of the IREDs were investigated and it was shown that the (S)-IRED favors the transformation of bulky imines contrary to the (R)-selective IREDs. Finally, novel exocyclic imine substrates were tested and also high activities and selectivities detected.

  9. Identification of imine or enamine drug metabolites using online hydrogen/deuterium exchange and exact mass measurements.

    Science.gov (United States)

    Li, Austin C; Yu, Erya; Ring, Steven C; Chovan, James P

    2012-04-30

    Drug metabolites that have imine or enamine partial structures cause extra mass-to-charge (m/z) increases in online hydrogen/deuterium exchange (HDX) in addition to hydroxyl or amine protons. Online HDX and exact mass measurement were used herein to characterize this extra increase property, and to further confirm proposed metabolite structures. Metabolites of two proprietary compounds as well as two commercially available compounds were analyzed using aqueous and HDX liquid chromatography coupled with an LTQ-Orbitrap. The exact mass measurements of both the precursor ions and product ions were acquired through data-dependent acquisition and compared with theoretical values of proposed fragment ions. Analysis of exact mass measurements of metabolite product ions under both normal aqueous and HDX conditions led to the identification of the isoxazole ring opening of compound C-1, and a double-bond formation on the methylpyrrolidine ring of compound C-2 during biotransformation. In both cases, imine or enamine structures formed in the metabolites caused extra m/z increases upon HDX that contributed confirmatory information to the structure identification. The compound 3,3-diphenyl-2-ethyl-1-pyrroline also demonstrated that the methylene protons adjacent to the imine were exchanged during online HDX. The exchangeability of methylene protons adjacent to imine or enamine moieties proved to be useful to narrow down or even pinpoint the metabolism sites of parent drugs when high-resolution exact mass measurement and online HDX were used. Copyright © 2012 John Wiley & Sons, Ltd.

  10. Microphase separation of diblock copolymers consisting of polystyrene and acid-functionalized poly(propylene imine) dendrimers

    NARCIS (Netherlands)

    Román, C.; Fischer, H.R.; Meijer, E.W.

    1999-01-01

    Diblock copolymers consisting of polystyrene and acid-functionalized poly(propylene imine) dendrimers have been found to self-assemble spontaneously into regular microdomains. The hybride dendrimer-linear chain block copolymers yield highly asymmetric molecules which display an aggregation behavior

  11. Total synthesis of (±)-hirsutine: application of phosphine-catalyzed imine-allene [4 + 2] annulation.

    Science.gov (United States)

    Villa, Reymundo A; Xu, Qihai; Kwon, Ohyun

    2012-09-07

    The total synthesis of the indole alkaloid hirsutine has been achieved, with a key step being the application of our phosphine-catalyzed [4 + 2] annulation of an imine with ethyl α-methylallenoate. From commercially available indole-2-carboxaldehyde, the target was synthesized in 14 steps and 6.7% overall yield.

  12. SPINOL-derived phosphoric acids: synthesis and application in enantioselective Friedel-Crafts reaction of indoles with imines.

    Science.gov (United States)

    Xu, Fangxi; Huang, Dan; Han, Chao; Shen, Wei; Lin, Xufeng; Wang, Yanguang

    2010-12-17

    A new class of chiral phosphoric acids with spirobiindane as scaffold were conveniently synthesized from (S)-1,1'-spirobiindane-7,7'-diol ((S)-SPINOL) and employed to catalyze the asymmetric Friedel-Crafts reaction of indoles with imines to afford 3-indolyl methanamines. High yields (68-97%) and excellent enantioselectivities (up to 99% ee) were obtained.

  13. Application of monodentate secondary phosphine oxides, a new class of chiral ligands, in Ir(I)-catalyzed asymmetric imine hydrogenation

    NARCIS (Netherlands)

    Jiang, X.B.; Minnaard, A.J.; Hessen, B.; Feringa, B.L.; Duchateau, A.L.L.; Andrien, J.G.O.; Boogers, J.A.F.; de Vries, J.G.; L. L. Duschateau, A.

    2003-01-01

    Secondary phosphine oxides were prepared from R1PCl2 and R2MgBr, followed by hydrolysis. They were obtained in an enantiopure form by preparative chiral HPLC. These new monodentate ligands were tested in the iridium-catalyzed hydrogenation of imines at 25 bar. Enantioselectivities up to 76% were obt

  14. Asymmetric cinnamylation of N-tert-butanesulfinyl imines with cinnamyl acetates: total syntheses of (+)-lycoricidine and (+)-7-deoxypancratistatin.

    Science.gov (United States)

    Cai, Sen-Lin; Yuan, Bin-Hua; Jiang, Yi-Xiang; Lin, Guo-Qiang; Sun, Xing-Wen

    2017-03-23

    Highly diastereoselective palladium catalyzed cinnamylation of N-tert-butanesulfinyl imines with cinnamyl acetates has been established to provide enantioenriched β-aryl homoallylic amines. The synthetic application of this stragety has been successfully demonstrated in the concise total syntheses of antitumor natural products (+)-lycoricidine and (+)-7-deoxypancratistatin.

  15. Highly diastereoselective synthesis of quaternary α-trifluoromethyl α-amino acids from chiral imines of trifluoropyruvate.

    Science.gov (United States)

    Min, Qiao-Qiao; He, Chun-Yang; Zhou, Haibing; Zhang, Xingang

    2010-11-14

    An efficient method for highly diastereoselective synthesis of quaternary α-trifluoromethyl α-amino acids was developed via indium mediated allylation of (R)-phenylglycinol methyl ether based imines of trifluoropyruvate in good yields with high diastereoselectivities at room temperature; to illustrate the application of this method in organic synthesis, 2-allyl-2-(trifluoromethyl) aziridine was prepared in an efficient manner.

  16. Phosphine-catalyzed [4 + 1] annulation between α,β-unsaturated imines and allylic carbonates: synthesis of 2-pyrrolines.

    Science.gov (United States)

    Tian, Junjun; Zhou, Rong; Sun, Haiyun; Song, Haibin; He, Zhengjie

    2011-04-01

    In this report, a phosphine-catalyzed [4 + 1] annulation between α,β-unsaturated imines and allylic carbonates is described. This reaction represents the first realization of catalytic [4 + 1] cyclization of 1,3-azadienes with in situ formed phosphorus ylides, which provides highly efficient and diastereoselective synthesis of 2-pyrrolines.

  17. Towards HIV detection: Novel Poly(propylene imine) Dendrimer-Streptavidin platform for electrochemical DNA and gp120 aptamer biosensors

    CSIR Research Space (South Africa)

    John, SV

    2014-07-01

    Full Text Available The detection of sequence – specific DNA and HIV glycoprotein 120 (gp120) based on novel generation 4 poly(propylene imine) dendrimer/streptavidin platform is reported. The platform was prepared by the electrodeposition of the dendrimer on a carbon...

  18. Total facial selectivity of a D-erythrosyl aromatic imine in [4π + 2π] cycloadditions; synthesis of 2-alkylpolyol 1,2,3,4-tetrahydroquinolines.

    Science.gov (United States)

    Ferreira, Juliana; Duarte, Vera C M; Noro, Jennifer; Gil Fortes, António; Alves, Maria J

    2016-03-14

    Different electron-rich dienophiles were combined with the imine obtained from 2,4-O-benzylidene-d-erythrose and p-anisidine furnishing enantiomerically pure tetrahydroquinolines, by inverse electron-demand [4π + 2π] cycloaddition. The imine was also reacted with 2-substituted electron-rich 1,3-butadienes giving the diastereomeric pure product, resulting from the normal electron demand cycloaddition. The facial selectivity of both processes is proposed on the basis of a 1,4-relationship between the hydroxyl group and the nitrogen atom in the chiral N-(p-methoxyphenyl)imine derivative.

  19. Anionic Synthesis of Primary and Secondary Amine-Functionalized Polymers Using Imine Chemistry

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A review of methods for the anionic synthesis of well-defined, amine-functional-ized polymers using imines as functionalizing agents is provided. The disparate results in theliterature regarding functionalizations with N-(benzylidene)trimethylsilylamine to form pri-mary amine functionalized polymers are discussed ; the efficiency of functionalization dependson the molecular weight of the polymeric organolithium(PLi). Efficient functionalizationsare observed for PLi with Kn>10 000 g/mol. The poor functionalization yields using ke-timines with enolizable hydrogens is explained. The use of N-trimethylsi-lyldiphenylcarbimide as a quantitative primary amine functionalizing reagent is described.Recent results on the anionic synthesis of secondary amine-functionalized polymers using N-(benzylidene)methylamine as the functionalization agent are presented.

  20. Polymer electrolyte based on poly(ethylene imine) and lithium salts

    Science.gov (United States)

    Chiang, C. K.; Davis, G. T.; Harding, C. A.; Takahashi, T.

    1985-10-01

    The dissolution of lithium salts in linear poly(ethylene imine) has been investigated because of its possible role as a solid electrolyte in lithium batteries. Lithium salts included in the study are LiF, LiCl, LiBr, LiI, LiSCN, LiCl104 and LiBF4. When cast from solution in a common solvent, a uniform mixture is obtained (expect for the case of LiF). Interaction of the salt and polymer can be characterized by observing a loss in crystallinity of the polymer and an increase in the glass transition temperature. At concentrations of salt below 10 mole percent, the polymer can slowly recrystallize at room temperature, but at higher concentrations the mixture remains amorphous for an indefinite period of time. DC conductivity at room temperature is about .0000001 S/cm but increases to .001 S/cm at 150 C.

  1. Discovery of a new class of antiviral compounds: camphor imine derivatives.

    Science.gov (United States)

    Sokolova, Anastasiya S; Yarovaya, Olga I; Shernyukov, Andrey V; Gatilov, Yuriy V; Razumova, Yuliya V; Zarubaev, Vladimir V; Tretiak, Tatiana S; Pokrovsky, Andrey G; Kiselev, Oleg I; Salakhutdinov, Nariman F

    2015-11-13

    A new class of compounds featuring a camphor moiety has been discovered that exhibits potent inhibitory activity against influenza A(H1N1)pdm09 and A(H5N1) viruses. The synthesized compounds were characterized by spectroscopic analysis; in addition the structures of compound 2 and 14 were elucidated by the X-ray diffraction technique. Structure-activity relationship studies have been conducted to identify the 1,7,7-trimethylbicyclo[2.2.1]heptanes2-ylidene group as the key functional group responsible for the observed antiviral activity. The most potent antiviral compound is imine 2 with therapeutic index more than 500. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  2. Poly(Propylene Imine Dendrimers and Amoxicillin as Dual-Action Antibacterial Agents

    Directory of Open Access Journals (Sweden)

    Natalia Wrońska

    2015-10-01

    Full Text Available Besides acting as antimicrobial compounds, dendrimers can be considered as agents that improve the therapeutic effectiveness of existing antibiotics. In this work we present a new approach to using amoxicillin (AMX against reference strains of common Gram-negative pathogens, alone and in combination with poly(propylene imine (PPI dendrimers, or derivatives thereof, in which 100% of the available hydrogen atoms are substituted with maltose (PPI 100%malG3. The concentrations of dendrimers used remained in the range non-toxic to eukaryotic cells. The results indicate that PPI dendrimers significantly enhance the antibacterial effect of amoxicillin alone, allowing antibiotic doses to be reduced. It is important to reduce doses of amoxicillin because its widespread use in medicine could lead to the development of bacterial resistance and environmental pollution. This is the first report on the combined antibacterial activity of PPI surface-modified maltose dendrimers and amoxicillin.

  3. (Benzophenone imine-κNchlorido(hydridotripyrazolylborato(triphenylphosphineruthenium(II diethyl ether solvate

    Directory of Open Access Journals (Sweden)

    Hung-Chun Tong

    2008-11-01

    Full Text Available The reaction of RuCl(Tp(Ph3P2, where Tp is [(CH3N2]3BH, with benzophenone imine leads to the formation of the title compound, [Ru(C9H10BN6Cl(C13H11N(C18H15P]·C4H10O. The environment about the Ru atom corresponds to a slightly distorted octahedron and the bite angle of the Tp ligand produces an average N—Ru—N angle of 86.3 (9°. The three Ru—N(Tp bond lengths [2.117 (2, 2.079 (2 and 2.084 (2 Å] are slightly longer than the average distance (2.038 Å in other ruthenium–Tp complexes.

  4. The Scavenging of DPPH, Galvinoxyl and ABTS Radicals by Imine Analogs of Resveratrol.

    Science.gov (United States)

    Kotora, Peter; Šeršeň, František; Filo, Juraj; Loos, Dušan; Gregáň, Juraj; Gregáň, Fridrich

    2016-01-21

    Resveratrol (3,5,4'-trihydroxystilbene) is a phytoalexin produced by plants. Resveratrol is known for its anti-cancer, antiviral and antioxidant properties. We prepared imine analogs of resveratrol ((hydroxyphenyliminomethyl)phenols) and tested their antioxidant activity. All prepared resveratrol analogs were able to scavenge 2,2-diphenyl-1-picrylhydrazyl (DPPH), galvinoxyl radical (GOR) and 2,2'-azino-bis(3-ethylbenzothiazoline)-6-sulphonic acid (ABTS) radicals. The antioxidant activity efficiency correlated with the number and position of hydroxyl groups. The most effective antioxidants were resveratrol analogs containing three hydroxyl groups in the benzylidene part of their molecules. These results provide new insights into the relationship between the chemical structure and biological activity of resveratrol analogs.

  5. The Scavenging of DPPH, Galvinoxyl and ABTS Radicals by Imine Analogs of Resveratrol

    Directory of Open Access Journals (Sweden)

    Peter Kotora

    2016-01-01

    Full Text Available Resveratrol (3,5,4′-trihydroxystilbene is a phytoalexin produced by plants. Resveratrol is known for its anti-cancer, antiviral and antioxidant properties. We prepared imine analogs of resveratrol ((hydroxyphenyliminomethylphenols and tested their antioxidant activity. All prepared resveratrol analogs were able to scavenge 2,2-diphenyl-1-picrylhydrazyl (DPPH, galvinoxyl radical (GOR and 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid (ABTS radicals. The antioxidant activity efficiency correlated with the number and position of hydroxyl groups. The most effective antioxidants were resveratrol analogs containing three hydroxyl groups in the benzylidene part of their molecules. These results provide new insights into the relationship between the chemical structure and biological activity of resveratrol analogs.

  6. Glycosylated aniline polymer sensor: Amine to imine conversion on protein–carbohydrate binding

    Science.gov (United States)

    Wang, Zhe; Sun, Chunyan; Vegesna, Giri; Liu, Haiying; Liu, Yang; Li, Jinghong; Zeng, Xiangqun

    2013-01-01

    In this report, functionalized mannosylated aniline polymer (manno-PANI) was investigated as an electrochemical platform to study carbohydrate–protein interactions by exploiting the conductivity change of manno-PANI when the specific lectin binding occurs. A systematic study was performed to characterize the interconversion of polyaniline content (from amine to imine) in manno-PANI by UV–vis spectroscopy during its binding with concanavalin A (Con A). Both X-ray photoelectron spectrometry (XPS) and UV–vis results suggest that Con A binding with the manno-PANI film triggers the switching of amine functionalities in the polyaniline backbone, converting them to imine forms. Electrochemical impedance spectroscopy (EIS) was used to quantify the specific interactions between Con A and mannose by measuring the impedance change of manno-PANI film for the detection of Con A. A linear relationship between the impedance and Con A concentration was obtained, and the detection limit reaches to 0.12 nM Con A in a buffer solution (pH=7.4), whereas the addition of nonspecific control lectins to the same manno-PANI film gave very little impedance variations. Stability characterization of the manno-PANI film over 20 weeks shows a maximum drift of only 3% from the original signal. Thus, the uniquely constructed carbohydrate–PANI hybrid is a promising new carbohydrate recognition moiety for studying carbohydrate-protein interactions, presumably leading to a new electrochemical method for characterization of carbohydrate–protein interactions and carbohydrate-mediated intercellular recognitions. PMID:23563436

  7. Preparation of 1,3-Disubstituted-5-cyano-4,5-dihydropyrazoles via 1,3-Dipolar Cycloaddition of Nitrile Imine with Acrylonitrile

    Institute of Scientific and Technical Information of China (English)

    SONG,Li-Ping(宋力平); ZHU,Shi-Zheng(朱士正); HUANG,Ji-Ling(黄吉玲)

    2002-01-01

    Oxidation of aldehyde 4-chloro-2, 3, 5, 6-tetrafluorophhenylhydrazones (1) with [bis(acetoxy)iodo]benzene leads to the formation of nitrile imines (2) which can react in situ with acryloniprile to produce 1-(4-chloro-2, 3, 5, 6-tetrafluorophenyl)-3-substituted-5-cyano-4, 5-dihydropyrazoles (3) in moderate to good yields. The structures of new compounds were fully confirmed by their spectral data and elemental analyses. A plausible reaction mechanism for the generation of nitrile imine is proposed.

  8. A highly enantioselective and regioselective organocatalytic direct Mannich reaction of methyl alkyl ketones with cyclic imines benzo[e][1,2,3]oxathiazine 2,2-dioxides.

    Science.gov (United States)

    Wang, You-Qing; Cui, Xiao-Yu; Ren, Yuan-Yuan; Zhang, Yongna

    2014-12-07

    A highly enantioselective direct Mannich reaction of methyl alkyl ketones with cyclic imines benzo[e][1,2,3]oxathiazine 2,2-dioxides, catalyzed by the combination of cinchona alkaloid derived primary amine and TFA, is disclosed. For unsymmetrical methyl alkyl ketones, it is favoured that specific regioselective addition to the imine substrates occurs at the less-substituted methyl group by steric control.

  9. Isotopic evidence for extraterrestrial non-racemic amino acids in the Murchison meteorite.

    Science.gov (United States)

    Engel, M H; Macko, S A

    1997-09-18

    Many amino acids contain an asymmetric centre, occurring as laevorotatory, L, or dextrorotatory, D, compounds. It is generally assumed that abiotic synthesis of amino acids on the early Earth resulted in racemic mixtures (L- and D-enantiomers in equal abundance). But the origin of life required, owing to conformational constraints, the almost exclusive selection of either L- or D-enantiomers, and the question of why living systems on the Earth consist of L-enantiomers rather than D-enantiomers is unresolved. A substantial fraction of the organic compounds on the early Earth may have been derived from comet and meteorite impacts. It has been reported previously that amino acids in the Murchison meteorite exhibit an excess of L-enantiomers, raising the possibility that a similar excess was present in the initial inventory of organic compounds on the Earth. The stable carbon isotope compositions of individual amino acids in Murchison support an extraterrestrial origin -- rather than a terrestrial overprint of biological amino acids-although reservations have persisted. Here we show that individual amino-acid enantiomers from Murchison are enriched in 15N relative to their terrestrial counterparts, so confirming an extraterrestrial source for an L-enantiomer excess in the Solar System that may predate the origin of life on the Earth.

  10. Non-racemic amino acids in the Murray and Murchison meteorites.

    Science.gov (United States)

    Pizzarello, S; Cronin, J R

    2000-01-01

    Small (1.0-9.2%) L-enantiomer excesses were found in six alpha-methyl-alpha-amino alkanoic acids from the Murchison (2.8-9.2%) and Murray (1.0-6.0%) carbonaceous chondrites by gas chromatography-mass spectroscopy of their N-trifluoroacetyl or N-pentafluoropropyl isopropyl esters. These amino acids [2-amino-2,3-dimethylpentanoic acid (both diastereomers), isovaline, alpha-methyl norvaline, alpha-methyl valine, and alpha-methyl norleucine] are either unknown or rare in the terrestrial biosphere. Enantiomeric excesses were either not observed in the four alpha-H-alpha-amino alkanoic acids analyzed (alpha-amino-n-butyric acid, norvaline, alanine, and valine) or were attributed to terrestrial contamination. The substantial excess of L-alanine reported by others was not found in the alanine in fractionated extracts of either meteorite. The enantiomeric excesses reported for the alpha-methyl amino acids may be the result of partial photoresolution of racemic mixtures caused by ultraviolet circularly polarized light in the presolar cloud. The alpha-methyl-alpha-amino alkanoic acids could have been significant in the origin of terrestrial homochirality given their resistance to racemization and the possibility for amplification of their enantiomeric excesses suggested by the strong tendency of their polymers to form chiral secondary structure.

  11. Toxicity of imine-iminium dyes and pigments: electron transfer, radicals, oxidative stress and other physiological effects.

    Science.gov (United States)

    Kovacic, Peter; Somanathan, Ratnasamy

    2014-08-01

    Although conjugation is well known as an important contributor to color, there is scant recognition concerning involvement of imine and iminium functions in the physiological effects of this class of dyes and pigments. The group includes the dyes methylene blue, rhodamine, malachite green, fuchsin, crystal violet, auramine and cyanins, in addition to the pigments consisting of pyocyanine, phthalocyanine and pheophytin. The physiological effects consist of both toxicity and beneficial aspects. The unifying theme of electron transfer-reactive oxygen species-oxidative stress is used as the rationale in both cases. Toxicity is frequently prevented or alleviated by antioxidants. The apparent dichotomy of methylene blue action as both oxidant and antioxidant is rationalized based on similar previous cases. This mechanistic approach may have practical benefit. This review is important in conveying, for the first time, a unifying mechanism for toxicity based on electron transfer-reactive oxygen species-oxidative stress arising from imine-iminium.

  12. Transition-Metal-Catalyzed C-H Bond Addition to Carbonyls, Imines, and Related Polarized π Bonds.

    Science.gov (United States)

    Hummel, Joshua R; Boerth, Jeffrey A; Ellman, Jonathan A

    2016-12-12

    The transition-metal-catalyzed addition of C-H bonds to carbonyls, imines, and related polarized π bonds has emerged as a particularly efficient and powerful approach for the construction of an incredibly diverse array of heteroatom-substituted products. Readily available and stable inputs are typically employed, and reactions often proceed with very high functional group compatibility and without the production of waste byproducts. Additionally, many transition-metal-catalyzed C-H bond additions to polarized π bonds occur within cascade reaction sequences to provide rapid access to a diverse array of different heterocyclic as well as carbocyclic products. This review highlights the diversity of transformations that have been achieved, catalysts that have been used, and types of products that have been prepared through the transition-metal-catalyzed addition of C-H bonds to carbonyls, imines, and related polarized π bonds.

  13. Catalytic Ugi-type condensation of α-isocyanoacetamide and chiral cyclic imine: access to asymmetric construction of several heterocycles.

    Science.gov (United States)

    Xia, Liang; Li, Sheng; Chen, Ruijiao; Liu, Kai; Chen, Xiaochuan

    2013-04-05

    Several novel heterocycles have been constructed asymmetrically on the basis of a catalytic Ugi-type condensation of α-isocyanoacetamide and chiral cyclic imine. The combination of phenylphosphilic acid and trifluoroethanol is exploited to promote an Ugi-type reaction with α-isocyanoacetamide for the first time. By means of this reaction, chiral 3-oxazolyl morpholin-2-one/piperazin-2-one derivatives are synthesized with high yields and excellent stereoselectivities. As electron-rich azadienes, these condensation products are further transformed to fused tricyclic frameworks by treatment with appropriate dienophiles such as maleic anhydride and unsaturated acyl chlorides via domino processes. Moreover, a one-pot, three-component synthesis of the chiral tricyclic frameworks from isocyanoacetamide, imine, and maleic anhydride is also feasible.

  14. Stereoretentive Addition of N-tert-Butylsulfonyl-α-Amido Silanes to Aldehydes, Ketones, α,β-Unsaturated Esters, and Imines.

    Science.gov (United States)

    Mita, Tsuyoshi; Saito, Keisuke; Sugawara, Masumi; Sato, Yoshihiro

    2016-05-20

    Enantioenriched N-tert-butylsulfonyl-α-amido silanes were successfully reacted with aldehydes, ketones, imines, and α,β-unsaturated esters in the presence of a sub-stoichiometric amount of CsF (0.5 equiv) in 1,2-dimethoxyethane (DME) at -20 °C to afford the corresponding coupling products with up to 89 % enantiospecificity in a retentive manner.

  15. Restricted open-shell Kohn-Sham theory for π-π* transitions. I. Polyenes, cyanines, and protonated imines

    Science.gov (United States)

    Grimm, Stephan; Nonnenberg, Christel; Frank, Irmgard

    2003-12-01

    We present a self-consistent field algorithm for the restricted open-shell Kohn-Sham method which can be used to calculate excited states that have the same spatial symmetry as the corresponding ground states. The method is applied to π-π* transitions in polyenes, cyanines, and protonated imines. Excitation energies obtained with gradient corrected functionals are found to be significantly redshifted; the shift is constant within a homologous series. Planar excited state geometries have been optimized for all systems.

  16. Theoretical investigations of the reaction between 1,4-dithiane-2,5-diol and azomethine imines: mechanisms and diastereoselectivity.

    Science.gov (United States)

    Zheng, Linjie; Qiao, Yan; Lu, Mengxue; Chang, Junbiao

    2015-07-21

    In the present study, mechanistic insights into the domino reaction between 1,4-dithiane-2,5-diol and azomethine imines were derived from the computational study with B3LYP and M06-2X functionals. On the whole, the domino process comprises two consecutive reactions: cleavage of 1,4-dithiane-2,5-diol leading to mercaptoacetaldehyde and [3 + 3] cycloaddition of mercaptoacetaldehyde with azomethine imines. The cleavage of 1,4-dithiane-2,5-diol can take place via multiple possible pathways (1A-1E), and pathway 1E in which double-methanol molecules mediate the proton transfer process is the most energetically favorable, with an energy barrier of 19.9 kcal mol(-1). For the [3 + 3] cycloaddition, three possible pathways (2F-2H) were explored. The calculated energy profiles reveal that pathway 2H with activation energies ranging from 6.9 to 10.2 kcal mol(-1) is more energetically favorable than pathways 2F and 2G. Specifically, pathway 2H comprises three reaction steps: deprotonation of mercaptoacetaldehyde by DABCO allows for the formation of the thiol anion, which subsequently launches a nucleophilic attack on azomethine imines followed by intramolecular cyclization resulting in the final products. The calculated results are in agreement with the experimental observations that the reaction can proceed most efficiently in the presence of both DABCO and methanol. Furthermore, the hydrogen bonding interaction is identified to be the main factor determining the observed diastereoselectivity The current systematic theoretical study gives a full scenario of the reaction between 1,4-dithiane-2,5-diol and azomethine imines catalyzed by DABCO, and thus provides some valuable clues for further investigation and development of this kind of important reaction.

  17. Highly efficient oxidation of amines to imines by singlet oxygen and its application in Ugi-type reactions.

    Science.gov (United States)

    Jiang, Gaoxi; Chen, Jian; Huang, Jie-Sheng; Che, Chi-Ming

    2009-10-15

    A variety of secondary benzylic amines were oxidized to imines in 90% to >99% yields by singlet oxygen generated from oxygen and a porphyrin photosensitizer. On the basis of these reactions, a protocol was developed for oxidative Ugi-type reactions with singlet oxygen as the oxidant. This protocol has been used to synthesize C1- and N-functionalized benzylic amines in up to 96% yields.

  18. Efficient approach to 4-sulfonamidoquinolines via copper(I)-catalyzed cascade reaction of sulfonyl azides with alkynyl imines.

    Science.gov (United States)

    Cheng, Guolin; Cui, Xiuling

    2013-04-05

    A novel and efficient approach to 4-sulfonamidoquinolines via copper-catalyzed cascade reaction of sulfonyl azides with alkynyl imines has been developed in which a 1,3-dipole cycloaddition/ketenimine formation/6π-electrocyclization/[1,3]-H shift cascade reaction was involved. Various 4-sulfonamidoquinolines were afforded in up to 84% yield for 19 examples. This synthetic strategy features with atom economy, concise steps, easy operation, and mild reaction conditions.

  19. [3 + 3]-Cycloaddition of Donor-Acceptor Cyclopropanes with Nitrile Imines Generated in Situ: Access to Tetrahydropyridazines.

    Science.gov (United States)

    Garve, Lennart K B; Petzold, Martin; Jones, Peter G; Werz, Daniel B

    2016-02-01

    Donor-acceptor cyclopropanes are reacted under the influence of a Lewis acid with hydrazonyl chlorides to afford tetrahydropyridazines. Formally, this transformation can be regarded as a [3 + 3]-cycloaddition of three-membered rings and nitrile imines generated in situ. This efficient method provides fast access to a variety of structurally diverse pyridazine derivatives. The structure of a typical product was confirmed by X-ray crystallography.

  20. Two-Dimensional Imine-Linked Covalent Organic Frameworks as a Platform for Selective Oxidation of Olefins.

    Science.gov (United States)

    Mu, Manman; Wang, Yanwen; Qin, Yutian; Yan, Xilong; Li, Yang; Chen, Ligong

    2017-07-12

    Two-dimensional imine-linked covalent organic frameworks with hydroxyl groups, TAPT-DHTA-COFHX and TAPT-DHTA-COFDMF, were respectively constructed by the condensation of 1,3,5-tris-(4-aminophenyl)triazine and 2,5-dihydroxyl-terephthalaldehyde under solvothermal and reflux conditions. Both COFs possess excellent thermal stability and a similar eclipsed stacking structure verified by XRD patterns. However, TAPT-DHTA-COFHX presented a larger surface area (2238 m(2)/g) and higher crystallinity than TAPT-DHTA-COFDMF. Significantly, copper ions are efficiently incorporated into the pores of these two COFs via the coordination interaction with hydroxyl groups and imine linkers. The obtained copper-containing COFs (Cu-COFHX and Cu-COFDMF) were employed in the selective oxidation of styrene to benzaldehyde. Cu-COFHX with superior surface area (1886 m(2)/g) and pore volume (1.11 cm(3)/g) exhibited excellent catalytic performance and recyclability. This strategy not only provides a convenient approach to design imine-linked 2D COFs with hydroxyl groups, but also develops their novel application for catalysis.

  1. Synthesis, structure, photophysical and catalytic properties of CuI-Iodide complexes of di-imine ligands

    Science.gov (United States)

    Mondal, Jahangir; Ghorai, Anupam; Singh, Sunil K.; Saha, Rajat; Patra, Goutam K.

    2016-03-01

    Two new multifunctional CuII based complexes [CuI(L1)] (1) and [Cu2(μ-I)2(L2)] (2) with bidentate N-N donor ligands L1 and imino-pyridyl ligand L2 have been synthesized and characterized by elemental analysis, IR, UV-Vis, NMR and single crystal X-ray crystallography. The bidentate di-imine ligand (L1) forms monomeric CuI complex (1) whereas the bis-bidentate di-imine ligand (L2) favours the formation of dimeric CuI complex (2) in association with two bridging iodides. Structural analysis reveals that in complex 1 each monomeric units are connected by π⋯π and C-H⋯π interactions to form 3D supramolecular structure whereas in complex 2 each molecules are connected by only π⋯π interactions to form 3D supramolecular structure. The photoluminescence properties of the complexes have been studied at room temperature. Theoretical analysis shows that HOMO is focused on the Cu and iodides while LUMO is focused on di-imine ligands and the luminescence behaviour arises due to metal to ligand charge transfer (MLCT) and halide to ligand charge transfer (XLCT). The complexes 1 and 2 are effective catalysts for the synthesis of 2-substituted benzoxazoles.

  2. Glial cell line-derived neurotrophic factor gene delivery via a polyethylene imine grafted chitosan carrier

    Directory of Open Access Journals (Sweden)

    Peng YS

    2014-06-01

    Full Text Available Yu-Shiang Peng,1,* Po-Liang Lai,2,* Sydney Peng,1 His-Chin Wu,3 Siang Yu,1 Tsan-Yun Tseng,4 Li-Fang Wang,5 I-Ming Chu1 1Department of Chemical Engineering, National Tsing Hua University, Hsinchu, 2Department of Orthopedic Surgery, Chang Gung Memorial Hospital at Linkou, Chang Gung University College of Medicine, Taoyuan, 3Department of Materials Engineering, Tatung University, Taipei, 4Graduate School of Biotechnology and Bioengineering, College of Engineering, Yuan Ze University, Chung-Li, 5Department of Medicinal and Applied Chemistry, Kaohsiung Medical University, Kaohsiung, Taiwan *Yu-Shiang Peng and Po-Liang Lai contributed equally to this work Abstract: Parkinson’s disease is known to result from the loss of dopaminergic neurons. Direct intracerebral injections of high doses of recombinant glial cell line-derived neurotrophic factor (GDNF have been shown to protect adult nigral dopaminergic neurons. Because GDNF does not cross the blood–brain barrier, intracerebral gene transfer is an ideal option. Chitosan (CHI is a naturally derived material that has been used for gene transfer. However, the low water solubility often leads to decreased transfection efficiency. Grafting of highly water-soluble polyethylene imines (PEI and polyethylene glycol onto polymers can increase their solubility. The purpose of this study was to design a non-viral gene carrier with improved water solubility as well as enhanced transfection efficiency for treating Parkinsonism. Two molecular weights (Mw =600 and 1,800 g/mol of PEI were grafted onto CHI (PEI600-g-CHI and PEI1800-g-CHI, respectively by opening the epoxide ring of ethylene glycol diglycidyl ether (EX-810. This modification resulted in a non-viral gene carrier with less cytotoxicity. The transfection efficiency of PEI600-g-CHI/deoxyribonucleic acid (DNA polyplexes was significantly higher than either PEI1800-g-CHI/DNA or CHI/DNA polyplexes. The maximal GDNF expression of PEI600-g-CHI/DNA was at the

  3. On the mechanism of imine elimination from Fischer tungsten carbene complexes

    Science.gov (United States)

    Veit, Philipp

    2016-01-01

    Summary (Aminoferrocenyl)(ferrocenyl)carbene(pentacarbonyl)tungsten(0) (CO)5W=C(NHFc)Fc (W(CO) 5 ( E -2)) is synthesized by nucleophilic substitution of the ethoxy group of (CO)5W=C(OEt)Fc (M(CO) 5 (1 Et )) by ferrocenyl amide Fc-NH– (Fc = ferrocenyl). W(CO) 5 ( E -2) thermally and photochemically eliminates bulky E-1,2-diferrocenylimine (E -3) via a formal 1,2-H shift from the N to the carbene C atom. Kinetic and mechanistic studies to the formation of imine E -3 are performed by NMR, IR and UV–vis spectroscopy and liquid injection field desorption ionization (LIFDI) mass spectrometry as well as by trapping experiments for low-coordinate tungsten complexes with triphenylphosphane. W(CO) 5 ( E -2) decays thermally in a first-order rate-law with a Gibbs free energy of activation of ΔG ‡ 298K = 112 kJ mol−1. Three proposed mechanistic pathways are taken into account and supported by detailed (time-dependent) densitiy functional theory [(TD)-DFT] calculations. The preferred pathway is initiated by an irreversible CO dissociation, followed by an oxidative addition/pseudorotation/reductive elimination pathway with short-lived, elusive seven-coordinate hydrido tungsten(II) intermediates cis (N,H)-W(CO) 4 (H)( Z -15) and cis (C,H)-W(CO) 4 (H)( Z -15). PMID:27559381

  4. Coverage dependent isomerisation behaviour of tetra-tert-butyl-imine on Au(111)

    Energy Technology Data Exchange (ETDEWEB)

    Leyssner, Felix; Koch, Matthias; Meyer, Stephan; Tegeder, Petra [Freie Universitaet Berlin, Fachbereich Physik, Arnimallee 14, D-14195 Berlin (Germany)

    2011-07-01

    High resolution electron energy loss spectroscopy (HREELS) is employed to analyze thermally activated changes in the geometrical structure of the photochromic molecular switch 3,3',5,5'-tetra-tert-butyl-imine (TBI) adsorbed on Au(111). Measurements have been performed for two coverage regimes: The monolayer and the bilayer regime. For both coverages all molecules are found in the trans state after deposition at sample temperatures of T=210 K, but conformational changes upon heating are observed, which are assigned to a trans to cis-isomerization. When heating the sample to T=440 K two different conformations are observed depending on the initial coverage. Annealing of a monolayer leads to an increasing number of cis isomers, pointing towards an inverted thermal isomerisation behaviour of TBI, since the trans-isomer is the more stable compound in solution. Whereas for a bilayer the temperature induced isomerization of the TBI can be monitored as well, but desorption of the second layer at T=440 K leads to the formation of a trans-monolayer. The fact that different molecular configurations are found for equal coverages annealed at the same temperature is highly surprising and shows that collective effects may govern the switching properties of molecular switches on surfaces.

  5. On the mechanism of imine elimination from Fischer tungsten carbene complexes

    Directory of Open Access Journals (Sweden)

    Philipp Veit

    2016-06-01

    Full Text Available (Aminoferrocenyl(ferrocenylcarbene(pentacarbonyltungsten(0 (CO5W=C(NHFcFc (W(CO5(E-2 is synthesized by nucleophilic substitution of the ethoxy group of (CO5W=C(OEtFc (M(CO5(1Et by ferrocenyl amide Fc-NH– (Fc = ferrocenyl. W(CO5(E-2 thermally and photochemically eliminates bulky E-1,2-diferrocenylimine (E-3 via a formal 1,2-H shift from the N to the carbene C atom. Kinetic and mechanistic studies to the formation of imine E-3 are performed by NMR, IR and UV–vis spectroscopy and liquid injection field desorption ionization (LIFDI mass spectrometry as well as by trapping experiments for low-coordinate tungsten complexes with triphenylphosphane. W(CO5(E-2 decays thermally in a first-order rate-law with a Gibbs free energy of activation of ΔG‡298K = 112 kJ mol−1. Three proposed mechanistic pathways are taken into account and supported by detailed (time-dependent densitiy functional theory [(TD-DFT] calculations. The preferred pathway is initiated by an irreversible CO dissociation, followed by an oxidative addition/pseudorotation/reductive elimination pathway with short-lived, elusive seven-coordinate hydrido tungsten(II intermediates cis(N,H-W(CO4(H(Z-15 and cis(C,H-W(CO4(H(Z-15.

  6. Zirconia-poly(propylene imine) dendrimer nanocomposite based electrochemical urea biosensor.

    Science.gov (United States)

    Shukla, Sudheesh K; Mishra, Ajay K; Mamba, Bhekie B; Arotiba, Omotayo A

    2014-11-01

    In this article we report a selective urea electrochemical biosensor based on electro-co-deposited zirconia-polypropylene imine dendrimer (ZrO2-PPI) nanocomposite modified screen printed carbon electrode (SPCE). ZrO2 nanoparticles, prepared by modified sol-gel method were dispersed in PPI solution, and electro-co-deposited by cyclic voltammetry onto a SPCE surface. The material and the modified electrodes were characterised using FTIR, electron microscopy and electrochemistry. The synergistic effect of the high active surface area of both materials, i.e. PPI and ZrO2 nanoparticles, gave rise to a remarkable improvement in the electrocatalytic properties of the biosensor and aided the immobilisation of the urease enzyme. The biosensor has an ampereometric response time of ∼4 s in urea concentration ranging from 0.01 mM to 2.99 mM with a correlation coefficient of 0.9985 and sensitivity of 3.89 μA mM(-1) cm(-2). The biosensor was selective in the presence of interferences. Photochemical study of the immobilised enzyme revealed high stability and reactivity.

  7. Harnessing chemoselective imine ligation for tethering bioactive molecules to platinum(IV) prodrugs.

    Science.gov (United States)

    Wong, Daniel Yuan Qiang; Lau, Jia Yi; Ang, Wee Han

    2012-05-28

    Platinum(II) anticancer drugs are among the most effective and often used chemotherapeutic drugs. In recent years, there has been increasing interest in exploiting inert platinum(IV) scaffolds as a prodrug strategy to mitigate the limitations of platinum(II) anticancer complexes. In this prodrug strategy, the axial ligands are released concomitantly upon intracellular reduction to the active platinum(II) congener, offering the possibility of conjugating bioactive co-drugs which may synergistically enhance cytotoxicity on cancer cells. Existing techniques of tethering bioactive molecules to the axial positions of platinum(IV) prodrugs suffer from limited scope, poor yields and low reliability. This report explores the applications of current chemoselective ligation chemistries to platinum(IV) anticancer complexes with the aim of addressing the aforementioned limitations. Here, we describe the synthesis of a platinum(IV) complex bearing an aromatic aldehyde functionality and explored the scope of imine ligation with various hydrazide and aminooxy functionalized substrates. As a proof of concept, we tethered a six sequence long peptide mimetic (AMVSEF) of the anti-inflammatory protein, ANXA1.

  8. Mesomorphic Behavior of Symmetrical and Unsymmetrical Azomethines with Two Imine Groups

    Directory of Open Access Journals (Sweden)

    Patrice Rannou

    2009-02-01

    Full Text Available Seven symmetrical azomethines with two imine groups (HC=N were synthesized by condensation of the benzene-1,4-dicarboxaldehydewith five amines (first group: A1-A5 and of the 2,5-thiophenedicarboxaldehyde with two amines (second group: AT1-AT2. Additionally, two unsymmetrical azomethines were obtained by a two step condensation of benzene-1,4-dicarboxaldehydewith pyren-1-amine(1st step (abbreviated hereinafter as AP1 and then AP1 was reacted with4-dodecylaniline or 4-hexadecylaniline (2nd step (third group: AP1A-AP1B. Liquid crystalline properties of the azomethines were studied by differential scanning calorimetry (DSC, polarizing optical microscopy (POM and UV-vis spectroscopy in the function of temperature [UV-vis(T]. The Wide-Angle X-ray Diffraction (WAXD technique was used to probe the structural properties of the azomethines. Mesomorphic behavior was observed for symmetrical and unsymmetrical azomethines, obtained from the benzene-1,4-dicarboxaldehyde and symmetrical ones prepared from 2,5-thiophenedicarboxaldehyde and different amineshaving aliphatic chains. Based on the POM and DSC measurements the following mesophases were detected: nematic, smectic A, smectic C, smectic F (I, smectic G (J.

  9. PEGylated poly(ethylene imine) copolymer-delivered siRNA inhibits HIV replication in vitro.

    Science.gov (United States)

    Weber, Nick D; Merkel, Olivia M; Kissel, Thomas; Muñoz-Fernández, María Ángeles

    2012-01-10

    RNA interference is increasingly being utilized for the specific targeting and down-regulation of disease-causing genes, including targeting viral infections such as HIV. T lymphocytes, the primary target for HIV, are very difficult to treat with gene therapy applications such as RNA interference because of issues with drug delivery. To circumvent these problems, we investigated poly(ethylene imine) (PEI) as a method of improving transfection efficiency of siRNA to T lymphocytes. Additionally, polyethylene glycol (PEG) moieties were engrafted to the PEI polymers with the goals of improving stability and reducing cytotoxicity. Initial studies on PEG-PEI/siRNA polyplex formation, size and their interaction with cell membranes demonstrated their feasibility as drug delivery agents. Assays with lymphocytes revealed low cytotoxicity profiles of the polyplexes at pharmacologically relevant concentrations with PEGylated copolymers obtaining the best results. Successful transfection of a T cell line or primary T cells with siRNA was observed via flow cytometry and confocal microscopy. Finally, the biological effect of copolymer-delivered siRNA was measured. Of particular significance, siRNA targeted to the HIV gene nef and delivered by one of the PEG-PEI copolymers in repetitive treatments every 2-3 days was observed to inhibit HIV replication to the same extent as azidothymidine over the course of 15 days. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Coarse-grained simulations of poly(propylene imine) dendrimers in solution

    Science.gov (United States)

    Smeijers, A. F.; Markvoort, A. J.; Pieterse, K.; Hilbers, P. A. J.

    2016-02-01

    The behavior of poly(propylene imine) (PPI) dendrimers in concentrated solutions has been investigated using molecular dynamics simulations containing up to a thousand PPI dendrimers of generation 4 or 5 in explicit water. To deal with large system sizes and time scales required to study the solutions over a wide range of dendrimer concentrations, a previously published coarse-grained model was applied. Simulation results on the radius of gyration, structure factor, intermolecular spacing, dendrimer interpenetration, and water penetration are compared with available experimental data, providing a clear concentration dependent molecular picture of PPI dendrimers. It is shown that with increasing concentration the dendrimer volume diminishes accompanied by a reduction of internalized water, ultimately resulting in solvent filled cavities between stacked dendrimers. Concurrently dendrimer interpenetration increases only slightly, leaving each dendrimer a separate entity also at high concentrations. Moreover, we compare apparent structure factors, as calculated in experimental studies relying on the decoupling approximation and the constant atomic form factor assumption, with directly computed structure factors. We demonstrate that these already diverge at rather low concentrations, not because of small changes in form factor, but rather because the decoupling approximation fails as monomer positions of separate dendrimers become correlated at concentrations well below the overlap concentration.

  11. A NADH-accepting imine reductase variant: Immobilization and cofactor regeneration by oxidative deamination.

    Science.gov (United States)

    Gand, Martin; Thöle, Christian; Müller, Hubertus; Brundiek, Henrike; Bashiri, Ghader; Höhne, Matthias

    2016-07-20

    Engineering cofactor specificity of enzymes is a promising approach that can expand the application of enzymes for biocatalytic production of industrially relevant chemicals. Until now, only NADPH-dependent imine reductases (IREDs) are known. This limits their applications to reactions employing whole cells as a cost-efficient cofactor regeneration system. For applications of IREDs as cell-free catalysts, (i) we created an IRED variant showing an improved activity for NADH. With rational design we were able to identify four residues in the (R)-selective IRED from Streptomyces GF3587 (IR-Sgf3587), which coordinate the 2'-phosphate moiety of the NADPH cofactor. From a set of 15 variants, the highest NADH activity was caused by the single amino acid exchange K40A resulting in a 3-fold increased acceptance of NADH. (ii) We showed its applicability using an immobilisate obtained either from purified enzyme or from lysate using the EziG(™) carriers. Applying the variant and NADH, we reached 88% conversion in a preparative scale biotransformation when employing 4% (w/v) 2-methylpyrroline. (iii) We demonstrated a one-enzyme cofactor regeneration approach using the achiral amine N-methyl-3-aminopentanone as a hydrogen donor co-substrate. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Dopamine-assisted deposition of poly (ethylene imine) for efficient heparinization.

    Science.gov (United States)

    Luo, Rifang; Wang, Xin; Deng, Jinchuan; Zhang, Hao; Maitz, Manfred F; Yang, Li; Wang, Jin; Huang, Nan; Wang, Yunbing

    2016-08-01

    Mussel-inspired self-polymerization of dopamine in the presence of catechols and amines can be used to form coatings on various substrates. In this work dopamine was co-polymerized with poly (ethylene imine) (PEI) to form coatings on 316L stainless steel (SS). The coating formation was confirmed by Fourier transform infrared spectra (FTIR) and X-ray photoelectron spectroscopy (XPS). Compared with a pure polydopamine coating, such hybrid coating presented a higher ratio of nitrogen and increased zeta potential due to the introduction of PEI components. QCM measurement showed good affinity for heparin immobilization on the amine-rich surfaces. Moreover, the heparin-binding surface significantly suppressed platelet adhesion and activation. Further, the interaction with vascular cells, like endothelial cells (ECs) and smooth muscle cells (SMCs) was also investigated. The heparin coating not only decreased the cytotoxicity of amines on ECs, but also significantly inhibited SMCs proliferation. These results showed that the hybrid coating allowed effective heparin immobilization, providing a promising platform for vascular devices modification. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Poly (ethylene imine)-modulated transport behaviors of graphene field effect transistors with double Dirac points

    Science.gov (United States)

    Sun, Yilin; Xie, Dan; Zhang, Cheng; Li, Xinming; Xu, Jianlong; Sun, Mengxing; Teng, Changjiu; Li, Xian; Zhu, Hongwei

    2017-04-01

    The bottom-gated graphene field-effect transistors (GFETs) with HfO2 as the dielectric layer are fabricated and the transport behaviors with double Dirac points defined as the right conductance minima (VDirac+) and the left one (VDirac-) are obtained, which exhibit the unique W-shaped transform characteristics rather than the typical V-shape. This observation indicates that the graphene in the channel region shows the different doping behaviors from that underlying the metal contact region. The W-shaped characteristics of GFETs are affected by the ambient environment and the time-dependence of double Dirac points has been also found. After being treated by Poly (ethylene imine) (PEI), the transport behaviors of GFETs could be modulated, especially for VDirac+ showing more obvious negative shift, indicating that PEI has a remarkable n-doping effect on the graphene in the channel region. PEI also screens the environmental influence and could protect the graphene from being p-doped to some extent. At the same time, the annealing effect has been also studied and it is found that the proper annealing process could contribute to the recovery of the graphene properties.

  14. Fluorogenic ratiometric dipodal optode containing imine-amide linkages: Exploiting subtle thorium (IV) ion sensing

    Energy Technology Data Exchange (ETDEWEB)

    Tayade, Kundan [School of Chemical Sciences, North Maharashtra University, Jalgaon (India); Kaur, Amanpreet [Centre for Nanoscience and Nanotechnology, Panjab University, Chandigarh (India); Tetgure, Sandesh [School of Chemical Sciences, North Maharashtra University, Jalgaon (India); Chaitanya, G. Krishana [School of Chemical Sciences, Swami Ramanand Tirth Marathawada University, Nanded (India); Singh, Narinder [Department of Chemistry, Indian Institute of Technology, Ropar, Punjab (India); Kuwar, Anil, E-mail: kuwaras@gmail.com [School of Chemical Sciences, North Maharashtra University, Jalgaon (India)

    2014-12-10

    Highlights: • A highly selective, simple, noncyclic, imine-amide based dipodal off–on fluorescence chemosensor for Th{sup 4+} ion is reported. • Sensing mechanism is based upon twisted plane intramolecular charge–transfer upon interaction with cations. • Th{sup 4+} ion on detection limit (as low as 0.1 μM) is reported. • This system can also be applied in real samples. - Abstract: The (13E,19E)-N1′,N3′-bis[4-(diethylamino)-2-hydroxybenzylidene]malonohydrazide (L) has been developed for the detection of Th{sup 4+} ions using dual channel signalling system. The UV–vis absorbance and fluorescence spectroscopic data revealed the formation of L–Th{sup 4+} complex in 1:1 equilibrium. The density functional theory (DFT) also confirms the optimum binding cavity for the recognition of metal ion. The binding constant computed from different mathematical models for an assembly of L–Th{sup 4+}. The detection limit of L for Th{sup 4+} recognition is to a concentration down to 0.1 μM (0.023 μg g{sup −1}). The present sensing system is also successfully applied for the detection of Th{sup 4+} ion present in soil near nuclear atomic plants.

  15. Direct liquid chromatography determination of the reactive imine SJG-136 (NSC 694501).

    Science.gov (United States)

    Cheung, Andrew; Struble, Elaine; He, Jingyi; Yang, Chun; Wang, Euphemia; Thurston, David E; Liu, Paul

    2005-08-05

    SJG-136 (NSC 694501), 8,8'-[[(propane-1,3-diyl)dioxy]bis[(11aS)-7-methoxy-2-methylidene-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one], which is being developed as a DNA-interactive antitumor agent, contains highly reactive imines in the diazepinone portions of the molecule. Water or alcohol adds readily to the imino moiety to form the corresponding carbinolamine or its alkyl ether, respectively. This sensitivity to protic substances poses a formidable challenge to the formulation and HPLC assay development for the compound. After studying the solution chemistry of SJG-136 and its potential interaction with various stationary phases, two reversed-phase liquid chromatographic assays for the compound have been developed. A direct assay that separates SJG-136 from its water or methanol adducts and an indirect assay that quantifies SJG-136 as its dihydrate adduct are reported. The latter method, which is more practical for drug development, has been validated. It is reproducible (R.S.D.<2%), linear (r2=0.9999) and accurate (within 98-102% recovery), with a lower detection limit of 2.5 ng.

  16. Modulation of biogenic amines content by poly(propylene imine) dendrimers in rats.

    Science.gov (United States)

    Ciepluch, Karol; Ziemba, Barbara; Janaszewska, Anna; Appelhans, Dietmar; Klajnert, Barbara; Bryszewska, Maria; Fogel, Wiesława Agnieszka

    2012-09-01

    Biogenic amines and polyamines participate in all vital organism functions, their levels being important function determinants. Studies were performed to check whether repeated administration of poly(propylene imine) (PPI) dendrimers, synthetic macromolecules with diaminobutane core, and peripheral primary amine groups, may influence the endogenous level of amines, as represented by the two of them: spermidine, a natural derivative of diaminobutane, and histamine. The experiment was carried out on Wistar rats. Fourth generation PPI dendrimer, as well as maltotriose-modified fourth generation PPI dendrimers with (a) cationic open sugar shell and (b) neutral dense sugar shell that possess a higher biocompatibility, was used. Applying the combination of column chromatography on Cellex P and spectrofluorimetric assays of o-phthaldialdehyde, the final amine condensation products were employed to analyze tissue spermidine and histamine outside the central nervous system. Furthermore, radioenzymatic assay was used to measure histamine levels in the brain. The obtained results indicate that in some tissues, the endogenous concentrations of histamine and spermidine may be affected by dendrimers depending on their dose and type of dendrimers.

  17. The kinetics and mechanism of the organo-iridium-catalysed enantioselective reduction of imines.

    Science.gov (United States)

    Stirling, Matthew J; Sweeney, Gemma; MacRory, Kerry; Blacker, A John; Page, Michael I

    2016-04-14

    The iridium complex of pentamethylcyclopentadiene and (S,S)-1,2-diphenyl-N'-tosylethane-1,2-diamine is an effective catalyst for the asymmetric transfer hydrogenation of imine substrates under acidic conditions. Using the Ir catalyst and a 5 : 2 ratio of formic acid : triethylamine as the hydride source for the asymmetric transfer hydrogenation of 1-methyl-3,4-dihydroisoquinoline and its 6,7-dimethoxy substituted derivative, in either acetonitrile or dichloromethane, shows unusual enantiomeric excess (ee) profiles for the product amines. The reactions initially give predominantly the (R) enantiomer of the chiral amine products with >90% ee but which then decreases significantly during the reaction. The decrease in ee is not due to racemisation of the product amine, but because the rate of formation of the (R)-enantiomer follows first-order kinetics whereas that for the (S)-enantiomer is zero-order. This difference in reaction order explains the change in selectivity as the reaction proceeds - the rate formation of the (R)-enantiomer decreases exponentially with time while that for the (S)-enantiomer remains constant. A reaction scheme is proposed which requires rate-limiting hydride transfer from the iridium hydride to the iminium ion for the first-order rate of formation of the (R)-enantiomer amine and rate-limiting dissociation of the product for the zero-order rate of formation of the (S)-enantiomer.

  18. Secondary brown carbon formation via the dicarbonyl imine pathway: nitrogen heterocycle formation and synergistic effects.

    Science.gov (United States)

    Kampf, C J; Filippi, A; Zuth, C; Hoffmann, T; Opatz, T

    2016-07-21

    Dicarbonyls are known to be important precursors of so-called atmospheric brown carbon, significantly affecting aerosol optical properties and radiative forcing. In this systematic study we report the formation of light-absorbing nitrogen containing compounds from simple 1,2-, 1,3-, 1,4-, and 1,5-dicarbonyl + amine reactions. A combination of spectrophotometric and mass spectrometric techniques was used to characterize reaction products in solutions mimicking atmospheric particulates. Experiments with individual dicarbonyls and dicarbonyl mixtures in ammonium sulfate and glycine solutions demonstrate that nitrogen heterocycles are common structural motifs of brown carbon chromophores formed in such reaction systems. 1,4- and 1,5-dicarbonyl reaction systems, which were used as surrogates for terpene ozonolysis products, showed rapid formation of light-absorbing material and products with absorbance maxima at ∼450 nm. Synergistic effects on absorbance properties were observed in mixed (di-)carbonyl experiments, as indicated by the formation of a strong absorber in ammonium sulfate solutions containing acetaldehyde and acetylacetone. This cross-reaction oligomer shows an absorbance maximum at 385 nm, relevant for the actinic flux region of the atmosphere. This study demonstrates the complexity of secondary brown carbon formation via the imine pathway and highlights that cross-reactions with synergistic effects have to be considered an important pathway for atmospheric BrC formation.

  19. Even-electron [M-H](+) ions generated by loss of AgH from argentinated peptides with N-terminal imine groups.

    Science.gov (United States)

    Plaviak, Alexandra; Osburn, Sandra; Patterson, Khiry; van Stipdonk, Michael J

    2016-01-15

    Experiments were performed to probe the creation of apparent even-electron, [M-H](+) ions by CID of Ag-cationized peptides with N-terminal imine groups (Schiff bases). Imine-modified peptides were prepared using condensation reactions with aldehydes. Ag(+) -cationized precursors were generated by electrospray ionization (ESI). Tandem mass spectrometry (MS(n) ) and collision-induced dissociation (CID) were performed using a linear ion trap mass spectrometer. Loss of AgH from peptide [M + Ag](+) ions, at the MS/MS stage, creates closed-shell [M-H](+) ions from imine-modified peptides. Isotope labeling unambiguously identifies the imine C-H group as the source of H eliminated in AgH. Subsequent CID of the [M-H](+) ions generated sequence ions that are analogous to those produced from [M + H](+) ions of the imine-modified peptides. Experiments show (a) formation of novel even-electron peptide cations by CID and (b) the extent to which sequence ions (conventional b, a and y ions) are generated from peptides with fixed charge site and thus lacking a conventional mobile proton. Copyright © 2015 John Wiley & Sons, Ltd.

  20. Arabidopsis and Maize RidA Proteins Preempt Reactive Enamine/Imine Damage to Branched-Chain Amino Acid Biosynthesis in Plastids[C][W][OPEN

    Science.gov (United States)

    Niehaus, Thomas D.; Nguyen, Thuy N.D.; Gidda, Satinder K.; ElBadawi-Sidhu, Mona; Lambrecht, Jennifer A.; McCarty, Donald R.; Downs, Diana M.; Cooper, Arthur J.L.; Fiehn, Oliver; Mullen, Robert T.; Hanson, Andrew D.

    2014-01-01

    RidA (for Reactive Intermediate Deaminase A) proteins are ubiquitous, yet their function in eukaryotes is unclear. It is known that deleting Salmonella enterica ridA causes Ser sensitivity and that S. enterica RidA and its homologs from other organisms hydrolyze the enamine/imine intermediates that Thr dehydratase forms from Ser or Thr. In S. enterica, the Ser-derived enamine/imine inactivates a branched-chain aminotransferase; RidA prevents this damage. Arabidopsis thaliana and maize (Zea mays) have a RidA homolog that is predicted to be plastidial. Expression of either homolog complemented the Ser sensitivity of the S. enterica ridA mutant. The purified proteins hydrolyzed the enamines/imines formed by Thr dehydratase from Ser or Thr and protected the Arabidopsis plastidial branched-chain aminotransferase BCAT3 from inactivation by the Ser-derived enamine/imine. In vitro chloroplast import assays and in vivo localization of green fluorescent protein fusions showed that Arabidopsis RidA and Thr dehydratase are chloroplast targeted. Disrupting Arabidopsis RidA reduced root growth and raised the root and shoot levels of the branched-chain amino acid biosynthesis intermediate 2-oxobutanoate; Ser treatment exacerbated these effects in roots. Supplying Ile reversed the root growth defect. These results indicate that plastidial RidA proteins can preempt damage to BCAT3 and Ile biosynthesis by hydrolyzing the Ser-derived enamine/imine product of Thr dehydratase. PMID:25070638

  1. Cobaltocenium-functionalized poly(propylene imine) dendrimers: redox and electromicrogravimetric studies and AFM imaging.

    Science.gov (United States)

    Takada, K; Díaz, D J; Abruña, H D; Cuadrado, I; González, B; Casado, C M; Alonso, B; Morán, M; Losada, J

    2001-03-02

    The first four generations of cobaltocenium-functionalized, diaminobutane-based poly(propylene imine) dendrimers DAB-dend-Cb,(PFb)x (x = 4, 8, 16, and 32; Cb=[Co(eta5-C5H4CONH)(eta5-C5H5)] (1-4) have been synthesized and characterized. The redox activity of the cobaltocenium centers in 1-4 has been characterized by using cyclic voltammetry and the electrochemical quartz-crystal microbalance (EQCM). All of the dendrimers exhibit reversible redox chemistry associated with the cobaltocenium/cobaltocene redox couple. Upon reduction. the dendrimers exhibit a tendency to electrodeposit onto the electrode surface, which is more pronounced for the higher generations. Pt and glassy carbon electrodes could be modified with films derived from 1-4,exhibiting a well-defined and persistent electrochemical response. EQCM measurements show that the dendrimers adsorb, at open circuit, onto platinum surfaces at monolayer or submonolayer coverage. Cathodic potential scanning past -0.75 V at which the cobaltocenium sites are reduced, gave rise to the electrodeposition of multilayer equivalents of the dendrimers. The additional material gradually desorbs upon re-oxidation so that only a monolayer equivalent remains on the electrode surface. Changes in film morphology as a function of dendrimer generation and surface coverage were studied by using admittance measurements of the quartz-crystal resonator on the basis of its electrical equivalent circuit, especially in terms of its resistance parameter. In general, we find that films of the lower dendrimer generation 1 behave rigidly, whereas those of the higher generation 4 exhibit viscoelastic behavior with an intermediate behavior being exhibited by 2 and 3. Using tapping-mode atomic force microscopy (AFM). we have been able to obtain molecularly resolved images of dendrimer 4 adsorbed on a Pt(111) electrode.

  2. Iridium-catalyzed enantioselective hydrogenation of imines in supercritical carbon dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Kainz, S.; Brinkmann, A.; Leitner, W.; Pfaltz, A.

    1999-07-14

    Supercritical carbon dioxide (scCO{sub 2}) was shown to be a reaction medium with unique properties for highly efficient iridium-catalyzed enantioselective hydrogenation of prochiral imines. Cationic iridium(I) complexes with chiral phosphinodihydrooxazoles, modified with perfluoroalkyl groups in the ligand or in the anion, were synthesized and tested in the hydrogenation of N-(1-phenylethylidene)aniline. Both the side chains and the lipophilic anions increased the solubility, but the choice of the anion also had a dramatic effect on the enantioselectivity with tetrakis-3,5-bis(trifluoromethyl)phenylborate (BARF) leading to the highest asymmetric induction. (R)-N-phenyl-1-phenylethylamine was formed quantitatively within 1 h in scCO{sub 2}[d(CO{sub 2}) = 0.75 g mL{sup {minus}1}] at 40 C and a H{sub 2} pressure of 30 bar with enantiomeric excesses of up to 81% using 0.078 mol % catalyst. The use of scCO{sub 2} instead of conventional solvents such as CH{sub 2}Cl{sub 2} allowed the catalyst loading to be lowered significantly owing to a change in the rate profile of the reaction. the homogeneous nature of the catalytically active species under the reaction conditions was demonstrated and was found to depend strongly on the composition of the reaction mixture and especially on the presence of the substrate. Utilizing the selective extractive properties of scCO{sub 2}, the product could be readily separated from the catalyst, which could be recycled several times without significant loss of activity and enantioselectivity. High-pressure FT-IR and NMR investigations revealed that the reactivity of the products to form the corresponding carbamic acids plays an important role for the application of this new methodology.

  3. Glial cell line-derived neurotrophic factor gene delivery via a polyethylene imine grafted chitosan carrier.

    Science.gov (United States)

    Peng, Yu-Shiang; Lai, Po-Liang; Peng, Sydney; Wu, His-Chin; Yu, Siang; Tseng, Tsan-Yun; Wang, Li-Fang; Chu, I-Ming

    2014-01-01

    Parkinson's disease is known to result from the loss of dopaminergic neurons. Direct intracerebral injections of high doses of recombinant glial cell line-derived neurotrophic factor (GDNF) have been shown to protect adult nigral dopaminergic neurons. Because GDNF does not cross the blood-brain barrier, intracerebral gene transfer is an ideal option. Chitosan (CHI) is a naturally derived material that has been used for gene transfer. However, the low water solubility often leads to decreased transfection efficiency. Grafting of highly water-soluble polyethylene imines (PEI) and polyethylene glycol onto polymers can increase their solubility. The purpose of this study was to design a non-viral gene carrier with improved water solubility as well as enhanced transfection efficiency for treating Parkinsonism. Two molecular weights (Mw =600 and 1,800 g/mol) of PEI were grafted onto CHI (PEI600-g-CHI and PEI1800-g-CHI, respectively) by opening the epoxide ring of ethylene glycol diglycidyl ether (EX-810). This modification resulted in a non-viral gene carrier with less cytotoxicity. The transfection efficiency of PEI600-g-CHI/deoxyribonucleic acid (DNA) polyplexes was significantly higher than either PEI1800-g-CHI/DNA or CHI/DNA polyplexes. The maximal GDNF expression of PEI600-g-CHI/DNA was at the polymer:DNA weight ratio of 10:1, which was 1.7-fold higher than the maximal GDNF expression of PEI1800-g-CHI/DNA. The low toxicity and high transfection efficiency of PEI600-g-CHI make it ideal for application to GDNF gene therapy, which has potential for the treatment of Parkinson's disease.

  4. Spectroscopic, structural and theoretical studies of novel, potentially cytotoxic 4-acridonecarboxamide imines

    Science.gov (United States)

    Fröhlichová, Zdenka; Imrich, Ján; Danihel, Ivan; Kristian, Pavol; Böhm, Stanislav; Sabolová, Danica; Kožurková, Mária; Hritzová, Ol'ga; Horváth, Branislav; Bušová, Tatiana; Klika, Karel D.

    2009-07-01

    Ten novel, potentially intercalating 4-acridonecarboxamide azomethines and ketimines have been prepared by the condensation reaction of 9-oxo-9,10-dihydroacridine-4-carboxylic acid hydrazide with various aldehydes and ketones. The structures of the compounds were characterized spectroscopically by NMR (1H, 13C, 15N nuclei and 2D experiments), UV-vis, IR and fluorescence methods and by quantum chemical calculations using DFT at the B3LYP/6-311+G(d,p) level of theory and semiempirical ZINDO and AM1 methods. NMR chemical shift variations for C-4' were assessed due to changes in the polarizability of the imine Cdbnd N bond rather than direct inductive effects arising from the C-4' substituents. In concert with this was the reversed order observed for the N-3' chemical shifts with DFT-calculated atomic charges confirming the bond polarization. Both intra- and intermolecular hydrogen bonds between the acridone NH hydrogen and the amidic carbonyl oxygen were found to exist by FT-IR spectroscopy. Quantum chemical calculations were used to evaluate the configurational, tautomeric, conformational and hydrogen bonding states of the molecules as well as predict the NMR and IR data. The hypsochromic shifts observed in the UV-vis spectra upon changing from m-cresol to DMA, DMF or methanol were evaluated in terms of solvent polarity (giving rise to solvated excited state destabilization) and solvent aromaticity (giving rise to solvated excited state stabilization). The fluorescence of the compounds were modest, except for the 2,6-dichloro derivative, with respect to 9-isothiocyanatoacridine.

  5. Peculiar reactivity of a di-imine copper(II) complex regarding its binding to albumin protein.

    Science.gov (United States)

    Silveira, Vivian C; Abbott, Mariana P; Cavicchioli, Maurício; Gonçalves, Marcos B; Petrilli, Helena M; de Rezende, Leandro; Amaral, Antonia T; Fonseca, David E P; Caramori, Giovanni F; Ferreira, Ana M da Costa

    2013-05-14

    A set of four di-imine copper(II) complexes containing pyridine, pyrazine and/or imidazole moieties, [Cu(apyhist)H2O](2+) 1 (apyhist = 2-(1H-imidazol-4-yl)-N-(1-(pyridin-2-yl)ethylidene)ethanamine), [Cu(apzhist)OH](+) 2 (apzhist = 2-(1H-imidazol-4-yl)-N-(1-(pyrazin-2-yl)ethylidene)ethanamine), [Cu(apyepy)OH](+) 3 (apyepy = 2-(pyridin-2-yl)-N-(1-(pyridin-2-yl)ethylidene)ethanamine), and [Cu(apzepy)H2O](2+) 4 (apzepy = N-(1-(pyrazin-2-yl)ethylidene)-2-(pyridin-2-yl)ethanamine), were investigated regarding their capability of interacting with serum albumin (human, HSA and bovine, BSA), by using spectroscopic techniques, CD, UV/Vis and EPR. Like other similar di-imine copper(II) complexes, most of them showed an expected preferential insertion of the metal ion at the primary N-terminal site of the protein, very selective for copper and characterized by a CD band at 560 nm. Further insertion of the copper ion at a secondary site is expected when using an excess of the metal. However, one of these studied complexes, [Cu(apyhist)H2O](2+) 1, exhibited anomalous behaviour interacting only at this secondary metal binding site of albumin, characterized by a CD band at 370 nm, and attributed to the coordination of copper at the Cys34 pocket. Analogous experiments with HSA previously treated with N-ethyl-maleimide (NEM), that oxidizes the protein Cys34 residue and obstructs the metal coordination, verified these results. Additional data obtained by EPR spectroscopy complemented those results. DFT calculations, considering some structural and electronic characteristics of such series of di-imine ligands and of the corresponding copper complexes, suggested molecular recognition of the apyhist ligand at the protein cavity as a feasible explanation for this unexpected and peculiar behaviour of complex 1.

  6. Structural optimization of quinolon-4(1H)-imines as dual-stage antimalarials: toward increased potency and metabolic stability.

    Science.gov (United States)

    Ressurreição, Ana S; Gonçalves, Daniel; Sitoe, Ana R; Albuquerque, Inês S; Gut, Jiri; Góis, Ana; Gonçalves, Lídia M; Bronze, Maria R; Hanscheid, Thomas; Biagini, Giancarlo A; Rosenthal, Philip J; Prudêncio, Miguel; O'Neill, Paul; Mota, Maria M; Lopes, Francisca; Moreira, Rui

    2013-10-10

    Discovery of novel effective and safe antimalarials has been traditionally focused on targeting erythrocytic parasite stages that cause clinical symptoms. However, elimination of malaria parasites from the human population will be facilitated by intervention at different life-cycle stages of the parasite, including the obligatory developmental phase in the liver, which precedes the erythrocytic stage. We have previously reported that N-Mannich-based quinolon-4(1H)-imines are potent antiplasmodial agents but present several stability liabilities. We now report our efforts to optimize quinolon-4(1H)-imines as dual-stage antiplasmodial agents endowed with chemical and metabolic stability. We report compounds active against both the erythrocytic and exoerythrocytic forms of malaria parasites, such as the quinolon-4(1H)-imine 5p (IC50 values of 54 and 710 nM against the erythrocytic and exoerythrocytic forms), which constitute excellent starting points for further lead optimization as dual-stage antimalarials.

  7. Intracellular siRNA delivery dynamics of integrin-targeted, PEGylated chitosan-poly(ethylene imine) hybrid nanoparticles

    DEFF Research Database (Denmark)

    Ragelle, Héloïse; Colombo, Stefano; Pourcelle, Vincent

    2015-01-01

    chitosan-poly(ethylene imine) hybrid nanoparticles. The amount of intracellular siRNA delivered by αvβ3-targeted versus non-targeted nanoparticles was quantified in the human non-small cell lung carcinoma cell line H1299 expressing enhanced green fluorescent protein (EGFP) using a stem-loop reverse...... that these nanoparticles might end up in late endosomes or lysosomes without releasing their cargo to the cell cytoplasm. Thus, the silencing efficiency of the chitosan-based nanoparticles is strongly dependent on the uptake and the intracellular trafficking in H1299 EGFP cells, which is critical information towards...

  8. Discovery of Rigidified α,β-Unsaturated Imines as New Resistance-breaking Insecticides for Malaria Vector Control.

    Science.gov (United States)

    Arlt, Alexander; Böhnke, Niels; Horstmann, Sebastian; Vermeer, Arnoldus W P; Werner, Stefan; Velten, Robert

    2016-10-01

    During our continuous search for new resistance-breaking insecticides applicable to malaria vector control, a new class of α,β-unsaturated imines was identified by applying the principle of conformational rigidification as a powerful tool for compound optimisation. Herein we describe the successful synthesis of these compounds and their biological test results. Our lead compound 16 from this insecticidal class outperforms market standards, notably for the control of mosquito strains that exhibit either metabolic or target-site resistance to these established insecticides. In our model system for insecticide-treated mosquito nets the compound reveals long-lasting efficacy for up to several months.

  9. Multifunctional imine-POSS as uncommon 3D nanobuilding blocks for supramolecular hybrid materials: synthesis, structural characterization, and properties.

    Science.gov (United States)

    Janeta, Mateusz; John, Łukasz; Ejfler, Jolanta; Lis, Tadeusz; Szafert, Sławomir

    2016-08-02

    In this article, we report on the chemistry and the spectroscopic properties of well-defined imino-functionalized polyoctahedral oligomeric silsesquioxanes (imine-POSS) with various substitutions. Our efforts were mainly focused on side chains with sizable aryl groups possessing hydroxyl, nitro, and halide moieties. Such a choice enabled us to track their reduction abilities to secondary amine-POSS, tautomerization effects, and thermal properties. We also report for the first time the solid-state structures of five imino-functionalized cage-like octasilsesquioxanes. These structures provide unique examples of the complexities of three-dimensional packing motifs and their relationship with the assembly of tunable materials from nanobuilding blocks.

  10. Diastereoselective Addition of α-Metalated Sulfoxides to Imines Revisited: Mechanism, Computational Studies, and the Effect of External Chiral Ligands

    DEFF Research Database (Denmark)

    Pedersen, Brian; Rein, Tobias; Søtofte, Inger

    2003-01-01

    six-membered "flat chair") was probed by quantum mechanical calculations, which underpinned the idea of using external chiral ligands to enhance the diastereoselectivity of otherwise moderately selective reactions. In this way, the diastereomeric ratio of the product 3a could be raised from (84 : 16......Some new results on asymmetric synthesis via the addition of a-metalated methyl tolyl sulfoxides to imines are presented. Good diastereoselectivity (up to > 98% d.e. for product 3g) can be obtained under conditions of kinetic control (short reaction time, low temperature). The transition state (a...

  11. Enantioselective Synthesis of N-PMP-1,2-dihydropyridines via Formal [4 + 2] Cycloaddition between Aqueous Glutaraldehyde and Imines.

    Science.gov (United States)

    Ramaraju, Panduga; Mir, Nisar A; Singh, Deepika; Gupta, Vivek K; Kant, Rajni; Kumar, Indresh

    2015-11-20

    A simple and highly practical one-pot formal [4 + 2] cycloaddition approach for the enantioselective synthesis of N-PMP-1,2-dihydropyridines (DHPs) is described. This chemistry involves an amino-catalytic direct Mannich reaction/cyclization followed by IBX-mediated chemo- and regioselective oxidation sequence between readily available aqueous glutaraldehyde and imines under very mild conditions. A series of N-PMP-1,2-DHPs have been prepared in high yields and excellent enantioselectivity. This method also gives access to both enantiomers of 1,2-DHPs in surplus amount by shifting the catalyst configuration.

  12. Chiral N-Phosphonyl Imine Chemistry: Asymmetric Additions of Ester Enolates for the Synthesis of β-Amino Acids

    Science.gov (United States)

    Han, Jianlin; Ai, Teng; Nguyen, Thao; Li, Guigen

    2008-01-01

    Chiral phosphonyl imines attached by 1-naphthyl protection group were found to react with lithium ester enolates smoothly and give chiral β-amino esters in good yields (70−88%) and up to excellent diastereoselectivity (>99:1 dr). Triisopropoxytitanium (IV) chloride was found to enhance diastereoseletivity when used as the Lewis acid promoter. The chiral auxiliary can be readily removed by treating with HBr to give free amino esters. The absolute structure has been unambiguously determined by converting one of the products into an authentic sample. This reaction provides an easy access to β-amino acid derivatives. PMID:18631372

  13. Enantioselective Synthesis of α-Mercapto-β-amino Esters via Rh(II)/Chiral Phosphoric Acid-Cocatalyzed Three-Component Reaction of Diazo Compounds, Thiols, and Imines.

    Science.gov (United States)

    Xiao, Guolan; Ma, Chaoqun; Xing, Dong; Hu, Wenhao

    2016-12-02

    An enantioselective method for the synthesis of α-mercapto-β-amino esters has been developed via a rhodium(II)/chiral phosphoric acid-cocatalyzed three-component reaction of diazo compounds, thiols, and imines. This transformation is proposed to proceed through enantioselective trapping of the sulfonium ylide intermediate generated in situ from the diazo compound and thiol by the phosphoric acid-activated imine. With this method, a series of α-mercapto-β-amino esters were obtained in good yields with moderate to good stereoselectivities.

  14. On-surface synthesis of two-dimensional imine polymers with a tunable band gap: a combined STM, DFT and Monte Carlo investigation

    Science.gov (United States)

    Xu, Lirong; Yu, Yanxia; Lin, Jianbin; Zhou, Xin; Tian, Wei Quan; Nieckarz, Damian; Szabelski, Pawel; Lei, Shengbin

    2016-04-01

    Two-dimensional polymers are of great interest for many potential applications in nanotechnology. The preparation of crystalline 2D polymers with a tunable band gap is critical for their applications in nano-electronics and optoelectronics. In this work, we try to tune the band gap of 2D imine polymers by expanding the conjugation of the backbone of aromatic diamines both laterally and longitudinally. STM characterization reveals that the regularity of the 2D polymers can be affected by the existence of lateral bulky groups. Density functional theory (DFT) simulations discovered a significant narrowing of the band gap of imine 2D polymers upon the expansion of the conjugation of the monomer backbone, which has been confirmed experimentally by UV absorption measurements. Monte Carlo simulations help us to gain further insight into the controlling factors of the formation of regular 2D polymers, which demonstrated that based on the all rigid assumption, the coexistence of different conformations of the imine moiety has a significant effect on the regularity of the imine 2D polymers.Two-dimensional polymers are of great interest for many potential applications in nanotechnology. The preparation of crystalline 2D polymers with a tunable band gap is critical for their applications in nano-electronics and optoelectronics. In this work, we try to tune the band gap of 2D imine polymers by expanding the conjugation of the backbone of aromatic diamines both laterally and longitudinally. STM characterization reveals that the regularity of the 2D polymers can be affected by the existence of lateral bulky groups. Density functional theory (DFT) simulations discovered a significant narrowing of the band gap of imine 2D polymers upon the expansion of the conjugation of the monomer backbone, which has been confirmed experimentally by UV absorption measurements. Monte Carlo simulations help us to gain further insight into the controlling factors of the formation of regular 2D

  15. Cu(II) catalyzed imine C-H functionalization leading to synthesis of 2,5-substituted 1,3,4-oxadiazoles.

    Science.gov (United States)

    Guin, Srimanta; Ghosh, Tuhin; Rout, Saroj Kumar; Banerjee, Arghya; Patel, Bhisma K

    2011-11-18

    A direct access to symmetrical and unsymmetrical 2,5-disubstituted [1,3,4]-oxadiazoles has been accomplished through an imine C-H functionalization of N-arylidenearoylhydrazide using a catalytic quantity of Cu(OTf)(2). This is the first example of amidic oxygen functioning as a nucleophile in a Cu-catalyzed oxidative coupling of an imine C-H bond. These reactions can be performed in air atmosphere and moisture making it exceptionally practical for application in organic synthesis.

  16. Stereoselective Construction of Spiro-Fused Tricyclic Frameworks by Sequential Reaction of Enynes, Imines, and Diazoalkenes with Rh(I) and Rh(II) Catalysts.

    Science.gov (United States)

    Hato, Yoshio; Oonishi, Yoshihiro; Yamamoto, Yasunori; Nakajima, Kiyohiko; Sato, Yoshihiro

    2016-09-02

    Stereoselective construction of spiro-fused tricyclic compounds from enynes having a tethered imine with diazoalkenes was achieved by Rh(I)- and Rh(II)-catalyzed sequential reactions. This method consists of three reactions, i.e., Rh(I)-catalyzed cyclization of enynes with a tethered imine, Rh(II)-catalyzed cyclopropanation with diazoalkenes, and Cope rearrangement. Notably, the sequential reactions can be operated in one pot, in which Rh(I) and Rh(II) catalysts work in relay without any serious catalyst deactivation to afford the spirocycles in a stereoselective manner.

  17. ULTRAMINE: a high-capacity polyethylene-imine-based polymer and its application as a scavenger resin.

    Science.gov (United States)

    Roice, Michael; Christensen, Søren F; Meldal, Morten

    2004-09-20

    The synthesis of a novel high-loading polyethylene-imine resin (ULTRAMINE) is described, and its application as a scavenger resin in various acylation reactions is demonstrated. The inverse suspension polymerization technique was used for the synthesis of well-defined spherical polymer beads. Polymer beads with different cross-linking densities were synthesized according to the degree of acryloylation of the polyethylene-imine polymer. The resin was characterized by various spectroscopic techniques. The size, shape, and morphological features of the resin were demonstrated by microscopy. The resin showed excellent swelling properties in both polar and nonpolar solvents. The chemical stability of the resin in various reagents and solvents was investigated and monitored by IR spectroscopy. The mechanical stability of the beads was determined by a single-bead compressive experiment. The ULTRAMINE beads can be used as an excellent scavenger for excess acylating reagent, as demonstrated for a variety of reactions. ULTRAMINE-red resin was derived from ULTRAMINE through exhaustive reduction of the amide carbonyl groups to yield an all-amine resin.

  18. Solid-phase receptor-based assay for the detection of cyclic imines by chemiluminescence, fluorescence, or colorimetry.

    Science.gov (United States)

    Rodríguez, Laura P; Vilariño, Natalia; Molgó, Jordi; Aráoz, Rómulo; Antelo, Alvaro; Vieytes, Mercedes R; Botana, Luis M

    2011-08-01

    The spirolides and gymnodimines are marine phycotoxins included in the group of cyclic imines. The toxicity of these compounds to humans is still unknown, although their toxicity by intraperitoneal injection in rodents is very high. A receptor-based method was developed using the competition of the 13-desmethyl spirolide C with biotin-labeled α-bungarotoxin for binding to nicotinic acetylcholine receptors and the immobilization of the α-bungarotoxin-receptor complex on streptavidin-coated surfaces. The quantification of the immobilized receptor can be achieved using a specific antibody. Finally, after the addition of a secondary antibody labeled with horseradish peroxidase, three alternative substrates of this enzyme generate a chemiluminescent, fluorescent, or colorimetric signal. The assay performs well in shellfish extracts and the detection range is 5-150 nM of 13-desmethyl spirolide C in shellfish extracts, which is at least 5 times more sensitive than the existing fluorescence polarization assay. This assay can also detect gymnodimine, although with 10 times lower sensitivity than the spirolide. The detection of cyclic imines with microplate assays would be useful for screening purposes in order to reduce the number of samples to be processed by bioassays or analytical methods.

  19. Growth-Inhibiting Activity of Resveratrol Imine Analogs on Tumor Cells In Vitro

    Science.gov (United States)

    Wang, Shan; Willenberg, Ina; Krohn, Michael; Hecker, Tanja; Meckelmann, Sven; Li, Chang; Pan, Yuanjiang; Schebb, Nils Helge; Steinberg, Pablo; Empl, Michael Telamon

    2017-01-01

    Although resveratrol exerts manifold antitumorigenic effects in vitro, its efficacy against malignancies in vivo seems limited. This has been increasingly recognized in recent years and has prompted scientists to search for structurally related compounds with more promising anticarcinogenic and/or pharmacokinetic properties. A class of structurally modified resveratrol derivatives, so-called resveratrol imine analogs (IRA’s), might meet these requirements. Therefore, the biological activity of five of these compounds was examined and compared to that of resveratrol. Firstly, the antiproliferative potency of all five IRA’s was investigated using the p53 wildtype-carrying colorectal carcinoma cell line HCT-116wt. Then, using the former and a panel of various other tumor cell lines (including the p53 knockout variant HCT-116p53-/-), the growth-inhibiting and cell cycle-disturbing effects of the most potent IRA (IRA 5, 2-[[(2-hydroxyphenyl)methylene]amino]-phenol) were studied as was its influence on cyclooxygenase-2 expression and activity. Finally, rat liver microsomes were used to determine the metabolic stability of that compound. IRA 5 was clearly the most potent compound in HCT-116wt cells, with an unusually high IC50-value of 0.6 μM. However, in the other five cell lines used, the antiproliferative activity was mostly similar to resveratrol and the effects on the cell cycle were heterogeneous. Although all cell lines were affected by treatment with IRA 5, cells expressing functional p53 seemed to react more sensitively, suggesting that this protein plays a modulating role in the induction of IRA 5-mediated biological effects. Lastly, IRA 5 led to contradictory effects on cyclooxygenase-2 expression and activity and was less glucuronidated than resveratrol. As IRA 5 is approximately 50 times more toxic towards HCT-116wt cells, exerts different effects on the cyclooxygenase-2 and is metabolized to a lesser extent, it shows certain advantages over resveratrol

  20. Ceria-Based Mixed Oxide Supported Nano-Gold as an Efficient and Durable Heterogeneous Catalyst for Oxidative Dehydrogenation of Amines to Imines Using Molecular Oxygen

    Directory of Open Access Journals (Sweden)

    Bashir Ahmad Dar

    2012-06-01

    Full Text Available The present work is intended to determine the catalytic activity of Mixed Oxide supported gold for aerobic oxidative dehydrogenation of amines to imines using Ceria as a main constituent of the each support. The model catalysts Au/CeO2:TiO2 Au/CeO2:SiO2, Au/CeO2:ZrO2 and Au/CeO2:Al2Os were prepared by deposition co-precipitation method and deposition of gold was determined by EDEX analysis. The supported nano-gold catalyzes the dehydrogenation of secondary amines to imines without loss of activity. On recycling good amount of product yield is obtained. Oxidation of secondary amines to imines is carried at 100˚C and almost 90 % conversion was obtained with >99% selectivity. © 2012 BCREC UNDIP. All rights reservedReceived: 26th December 2011; Revised: 7th June 2012; Accepted: 13rd June 2012[How to Cite: B.A. Dar, M. Sharma, B. Singh. (2012. Ceria-Based Mixed Oxide Supported Nano-Gold as an Efficient and Durable Heterogeneous Catalyst for Oxidative Dehydrogenation of Amines to Imines Using Molecular Oxygen. Bulletin of Chemical Reaction Engineering & Catalysis, 7(1: 79-84.  doi:10.9767/bcrec.7.1.1257.79-84][How to Link / DOI: http://dx.doi.org/10.9767/bcrec.7.1.1257.79-84 ] | View in 

  1. New synthesis of 1-substituted-1H-indazoles via 1,3-dipolar cycloaddition of in situ generated nitrile imines and benzyne.

    Science.gov (United States)

    Spiteri, Christian; Keeling, Steve; Moses, John E

    2010-08-06

    A new synthesis of 1-substituted-1H-indazoles via 1,3-dipolar cycloaddition of nitrile imines to benzyne is described. The reaction is completed within 5 min, affording the corresponding N(1)-C(3) disubstituted indazoles in moderate to excellent yields.

  2. Compositional analysis of nitrile terminated poly(propylene imine) dendrimers by high-performance liquid chromatography combined with electrospray mass spectrometry

    NARCIS (Netherlands)

    van der Wal, S; Mengerink, Y; Brackman, JC; de Brabander, EMM; Jeronimus-Stratingh, CM; Bruins, AP

    1998-01-01

    Separation methods for nitrile terminated poly(propylene imine) dendrimers were developed to monitor and optimize their large scale production. Detailed analyses of defects within a dendrimer generation were performed by HPLC at alkaline pH (sodium hydroxide) on a polymer-based column or at neutral

  3. A class of heterogeneous/multiphase organic reactions studied on droplets/particles levitated in a laboratory environment: aldehyde+1,8-diaminonaphthalene=imine

    Science.gov (United States)

    Haddrell, Allen E.; Agnes, George R.

    A condensation reaction between aldehydes and a primary amine on the surface of particulate matter created and suspended in a laboratory environment has been studied. The methodology developed for these studies made use of a non-volatile chromophore, 1,8-diaminonaphthalene, as the starting amine which facilitated detection of the starting and product compounds. This reactive chromophore was located on glycerol droplets, saturated salt water droplets, or salt particles that were levitated in an electrodynamic balance. Following an exposure of the levitated droplets/particles to the vapor of different aldehyde compounds, the droplets/particles were deposited onto a stainless steel plate and the reaction products, imines, were characterized using laser desorption ionization mass spectrometry. The starting compound, 1,8-diaminonaphthalene and the imine reaction product compounds were detected as molecular radical cations. The rate of the heterogeneous/multiphase reaction between the amine and benzaldehyde was measured to be 9×10 -19 cm 3 molecule -1 s -1 on glycerol droplets, which makes the rate of imine formation comparable with amine consumption via ozone or hydroxyl radical under conditions of slightly elevated aldehyde concentrations. As such, imine formation via a heterogeneous/multiphase reaction could occur under certain conditions in the troposphere. This reaction on particulate matter reduces the hydrophilic character of the product compound relative to the starting compounds, and the implications of this class of reactions with respect to the toxic properties of suspended particles in the troposphere are briefly speculated upon.

  4. On-surface synthesis of two-dimensional imine polymers with a tunable band gap: a combined STM, DFT and Monte Carlo investigation.

    Science.gov (United States)

    Xu, Lirong; Yu, Yanxia; Lin, Jianbin; Zhou, Xin; Tian, Wei Quan; Nieckarz, Damian; Szabelski, Pawel; Lei, Shengbin

    2016-04-28

    Two-dimensional polymers are of great interest for many potential applications in nanotechnology. The preparation of crystalline 2D polymers with a tunable band gap is critical for their applications in nano-electronics and optoelectronics. In this work, we try to tune the band gap of 2D imine polymers by expanding the conjugation of the backbone of aromatic diamines both laterally and longitudinally. STM characterization reveals that the regularity of the 2D polymers can be affected by the existence of lateral bulky groups. Density functional theory (DFT) simulations discovered a significant narrowing of the band gap of imine 2D polymers upon the expansion of the conjugation of the monomer backbone, which has been confirmed experimentally by UV absorption measurements. Monte Carlo simulations help us to gain further insight into the controlling factors of the formation of regular 2D polymers, which demonstrated that based on the all rigid assumption, the coexistence of different conformations of the imine moiety has a significant effect on the regularity of the imine 2D polymers.

  5. Aliphatic Imines in Titanium-Mediated Reductive Cross-Coupling: Unique Reactivity of Ti(Oi-Pr)4/n-BuLi

    Science.gov (United States)

    Tarselli, Michael A.; Micalizio, Glenn C.

    2009-01-01

    A procedure for the coupling of aliphatic imines with allylic and allenic alkoxides is described. The success of these studies was enabled by a unique reactivity profile of Ti(IV) isopropoxide/n-BuLi compared to well-known Ti(IV) isopropoxide/R-MgX systems. PMID:19810765

  6. Conserved YjgF Protein Family Deaminates Reactive Enamine/Imine Intermediates of Pyridoxal 5′-Phosphate (PLP)-dependent Enzyme Reactions*

    Science.gov (United States)

    Lambrecht, Jennifer A.; Flynn, Jeffrey M.; Downs, Diana M.

    2012-01-01

    The YjgF/YER057c/UK114 family of proteins is conserved in all domains of life, suggesting that the role of these proteins arose early and was maintained throughout evolution. Metabolic consequences of lacking this protein in Salmonella enterica and other organisms have been described, but the biochemical function of YjgF remained unknown. This work provides the first description of a conserved biochemical activity for the YjgF protein family. Our data support the conclusion that YjgF proteins have enamine/imine deaminase activity and accelerate the release of ammonia from reactive enamine/imine intermediates of the pyridoxal 5′-phosphate-dependent threonine dehydratase (IlvA). Results from structure-guided mutagenesis experiments suggest that YjgF lacks a catalytic residue and that it facilitates ammonia release by positioning a critical water molecule in the active site. YjgF is renamed RidA (reactive intermediate/imine deaminase A) to reflect the conserved activity of the protein family described here. This study, combined with previous physiological studies on yjgF mutants, suggests that intermediates of pyridoxal 5′-phosphate-mediated reactions may have metabolic consequences in vivo that were previously unappreciated. The conservation of the RidA/YjgF family suggests that reactive enamine/imine metabolites are of concern to all organisms. PMID:22094463

  7. Concise synthesis and anti-HIV activity of pyrimido[1,2-c][1,3]benzothiazin-6-imines and related tricyclic heterocycles.

    Science.gov (United States)

    Mizuhara, Tsukasa; Oishi, Shinya; Ohno, Hiroaki; Shimura, Kazuya; Matsuoka, Masao; Fujii, Nobutaka

    2012-09-07

    3,4-Dihydro-2H,6H-pyrimido[1,2-c][1,3]benzothiazin-6-imine (PD 404182) is a virucidal heterocyclic compound active against various viruses, including HCV, HIV, and simian immunodeficiency virus. Using facile synthetic approaches that we developed for the synthesis of pyrimido[1,2-c][1,3]benzothiazin-6-imines and related tricyclic derivatives, the parallel structural optimizations of the central 1,3-thiazin-2-imine core, the benzene part, and the cyclic amidine part of PD 404182 were investigated. Replacement of the 6-6-6 pyrimido[1,2-c][1,3]benzothiazin-6-imine framework with 5-6-6 or 6-6-5 derivatives led to a significant loss of anti-HIV activity, and introduction of a hydrophobic group at the 9- or 10-positions improved the potency. In addition, we demonstrated that the PD 404182 derivative exerts anti-HIV effects at an early stage of viral infection.

  8. Phosphine-Catalyzed Annulations of Azomethine Imines: Allene-Dependent [3 + 2], [3 + 3], [4 + 3], and [3 + 2 + 3] Pathways

    Science.gov (United States)

    Na, Risong; Jing, Chengfeng; Xu, Qihai; Jiang, Hui; Wu, Xi; Shi, Jiayan; Zhong, Jiangchun; Wang, Min; Benitez, Diego; Tkatchouk, Ekaterina; Goddard, William A.; Guo, Hongchao; Kwon, Ohyun

    2011-01-01

    In this paper we describe the phosphine-catalyzed [3 + 2], [3 + 3], [4 + 3], and [3 + 2 + 3] annulations of azomethine imines and allenoates. These processes mark the first use of azomethine imines in nucleophilic phosphine catalysis, producing dinitrogen-fused heterocycles, including tetrahydropyrazolo-pyrazolones, -pyridazinones, -diazepinones, and -diazocinones. Counting the two different reaction modes in the [3 + 3] cyclizations, there are five distinct reaction pathways—the choice of which depends on the structure and chemical properties of the allenoate. All reactions are operationally simple and proceed smoothly under mild reaction conditions, affording a broad range of 1,2-dinitrogen–containing heterocycles in moderate to excellent yields. A zwitterionic intermediate formed from a phosphine and two molecules of ethyl 2,3-butadienoate acted as a 1,5-dipole in the annulations of azomethine imines, leading to the [3 + 2 + 3] tetrahydropyrazolodiazocinone products. The incorporation of two molecules of an allenoate into an eight-membered-ring product represents a new application of this versatile class of molecules in nucleophilic phosphine catalysis. The salient features of this protocol—the facile access to a diverse range of nitrogen-containing heterocycles and the simple preparation of azomethine imine substrates—suggest that it might find extensive applications in heterocycle synthesis. PMID:21812448

  9. In situ generation of less accessible Boc-imines from aldehydes: construction of a quaternary carbon by the Mannich reaction or unprecedented aldol reaction.

    Science.gov (United States)

    Kano, Taichi; Homma, Chihiro; Maruoka, Keiji

    2017-05-31

    In situ generation of less accessible N-Boc-protected imines from aldehydes and their application to the direct three-component Mannich reaction with β-dicarbonyls were realized. The catalyst-free aldol reaction of ynals with β-dicarbonyls was also developed.

  10. Photocatalytic organic transformation by layered double hydroxides: highly efficient and selective oxidation of primary aromatic amines to their imines under ambient aerobic conditions.

    Science.gov (United States)

    Yang, Xiu-Jie; Chen, Bin; Li, Xu-Bing; Zheng, Li-Qiang; Wu, Li-Zhu; Tung, Chen-Ho

    2014-06-25

    We report the first application of layered double hydroxide as a photocatalyst in the transformation of primary aromatic amines to their corresponding imines with high efficiency and selectivity by using oxygen in an air atmosphere as a terminal oxidant under light irradiation.

  11. Phosphine-catalyzed annulations of azomethine imines: allene-dependent [3 + 2], [3 + 3], [4 + 3], and [3 + 2 + 3] pathways.

    Science.gov (United States)

    Na, Risong; Jing, Chengfeng; Xu, Qihai; Jiang, Hui; Wu, Xi; Shi, Jiayan; Zhong, Jiangchun; Wang, Min; Benitez, Diego; Tkatchouk, Ekaterina; Goddard, William A; Guo, Hongchao; Kwon, Ohyun

    2011-08-31

    In this paper we describe the phosphine-catalyzed [3 + 2], [3 + 3], [4 + 3], and [3 + 2 + 3] annulations of azomethine imines and allenoates. These processes mark the first use of azomethine imines in nucleophilic phosphine catalysis, producing dinitrogen-fused heterocycles, including tetrahydropyrazolo-pyrazolones, -pyridazinones, -diazepinones, and -diazocinones. Counting the two different reaction modes in the [3 + 3] cyclizations, there are five distinct reaction pathways-the choice of which depends on the structure and chemical properties of the allenoate. All reactions are operationally simple and proceed smoothly under mild reaction conditions, affording a broad range of 1,2-dinitrogen-containing heterocycles in moderate to excellent yields. A zwitterionic intermediate formed from a phosphine and two molecules of ethyl 2,3-butadienoate acted as a 1,5-dipole in the annulations of azomethine imines, leading to the [3 + 2 + 3] tetrahydropyrazolo-diazocinone products. The incorporation of two molecules of an allenoate into an eight-membered-ring product represents a new application of this versatile class of molecules in nucleophilic phosphine catalysis. The salient features of this protocol--the facile access to a diverse range of nitrogen-containing heterocycles and the simple preparation of azomethine imine substrates--suggest that it might find extensive applications in heterocycle synthesis.

  12. Rapid access to spirocylic oxindoles: application of asymmetric N-heterocyclic carbene-catalyzed [3 + 3] cycloaddition of imines to oxindole-derived enals.

    Science.gov (United States)

    Xie, Danbo; Yang, Limin; Lin, Youqiang; Zhang, Zhiming; Chen, Dongdong; Zeng, Xiaofei; Zhong, Guofu

    2015-05-15

    A chiral N-heterocyclic carbene (NHC)-catalyzed [3 + 3] cycloaddition reaction of imines and oxindole-derived enals was developed for rapid access to spirocylic oxindoles. In most cases, the desired spirocylic oxindole products were obtained in high yields and excellent enantioselectivities with less than 1 h of reaction time.

  13. Supported bimetallic nano-alloys as highly active catalysts for the one-pot tandem synthesis of imines and secondary amines from nitrobenzene and alcohols

    NARCIS (Netherlands)

    Meenakshisundaram, Sankar; He, Qian; Dawson, Simon; Nowicka, Ewa; Lu, Li; Bruijnincx, Pieter C. A.; Beale, Andrew M.; Kiely, Christopher J.; Weckhuysen, Bert M.

    2016-01-01

    The synthesis and functionalization of imines and amines are key steps in the preparation of many fine chemicals and for pharmaceuticals in particular. Traditionally, metal complexes are used as homogeneous catalysts for these organic transformations. Here we report gold-palladium and ruthenium-pall

  14. Tailor-made graphite oxide-DAB poly(propylene imine) dendrimer intercalated hybrids and their potential for efficient CO2 adsorption

    NARCIS (Netherlands)

    Tsoufis, T.; Katsaros, F.; Sideratou, Z.; Romanos, G.; Ivashenko, O.; Rudolf, P.; Kooi, B. J.; Papageorgiou, S.; Karakassides, M. A.

    2014-01-01

    We report the rational design and synthesis of DAB poly(propylene imine) dendrimer (DAB) intercalated graphite oxide (GO) hybrids with tailorable interlayer distances. The amine groups originating from the intercalated dendrimer molecules cross-link adjacent GO sheets and strongly favour CO2 adsorpt

  15. In situ generation of N-Boc-protected alkenyl imines: controlling the E/Z geometry of alkenyl moieties in the Mukaiyama-Mannich reaction.

    Science.gov (United States)

    Bai, Jian-Fei; Sasagawa, Hajime; Yurino, Taiga; Kano, Taichi; Maruoka, Keiji

    2017-07-18

    Readily available Boc-protected Z-alkenyl aminals could be used as Z-alkenyl and E-alkenyl imine precursors under acidic conditions. In the Mukaiyama-Mannich reaction of Z-alkenyl Boc-aminals, the E/Z geometry of the products was controlled by the catalyst used. The present method was also applied to asymmetric Mukaiyama-Mannich reactions.

  16. Arabidopsis and maize RidA proteins preempt reactive enamine/imine damage to branched-chain amino acid biosynthesis in plastids.

    Science.gov (United States)

    Niehaus, Thomas D; Nguyen, Thuy N D; Gidda, Satinder K; ElBadawi-Sidhu, Mona; Lambrecht, Jennifer A; McCarty, Donald R; Downs, Diana M; Cooper, Arthur J L; Fiehn, Oliver; Mullen, Robert T; Hanson, Andrew D

    2014-07-01

    RidA (for Reactive Intermediate Deaminase A) proteins are ubiquitous, yet their function in eukaryotes is unclear. It is known that deleting Salmonella enterica ridA causes Ser sensitivity and that S. enterica RidA and its homologs from other organisms hydrolyze the enamine/imine intermediates that Thr dehydratase forms from Ser or Thr. In S. enterica, the Ser-derived enamine/imine inactivates a branched-chain aminotransferase; RidA prevents this damage. Arabidopsis thaliana and maize (Zea mays) have a RidA homolog that is predicted to be plastidial. Expression of either homolog complemented the Ser sensitivity of the S. enterica ridA mutant. The purified proteins hydrolyzed the enamines/imines formed by Thr dehydratase from Ser or Thr and protected the Arabidopsis plastidial branched-chain aminotransferase BCAT3 from inactivation by the Ser-derived enamine/imine. In vitro chloroplast import assays and in vivo localization of green fluorescent protein fusions showed that Arabidopsis RidA and Thr dehydratase are chloroplast targeted. Disrupting Arabidopsis RidA reduced root growth and raised the root and shoot levels of the branched-chain amino acid biosynthesis intermediate 2-oxobutanoate; Ser treatment exacerbated these effects in roots. Supplying Ile reversed the root growth defect. These results indicate that plastidial RidA proteins can preempt damage to BCAT3 and Ile biosynthesis by hydrolyzing the Ser-derived enamine/imine product of Thr dehydratase. © 2014 American Society of Plant Biologists. All rights reserved.

  17. Self-supported chiral titanium cluster (SCTC) as a robust catalyst for the asymmetric cyanation of imines under batch and continuous flow at room temperature.

    Science.gov (United States)

    Seayad, Abdul M; Ramalingam, Balamurugan; Chai, Christina L L; Li, Chuanzhao; Garland, Marc V; Yoshinaga, Kazuhiko

    2012-04-27

    A robust heterogeneous self-supported chiral titanium cluster (SCTC) catalyst and its application in the enantioselective imine-cyanation/Strecker reaction is described under batch and continuous processes. One of the major hurdles in the asymmetric Strecker reaction is the lack of availability of efficient and reusable heterogeneous catalysts that work at room temperature. We exploited the readily hydrolyzable nature of titanium alkoxide to synthesize a self-supported chiral titanium cluster (SCTC) catalyst by the controlled hydrolysis of a preformed chiral titanium-alkoxide complex. The isolated SCTC catalysts were remarkably stable and showed up to 98 % enantioselectivity (ee) with complete conversion of the imine within 2 h for a wide variety of imines at room temperature. The heterogeneous catalysts were recyclable more than 10 times without any loss in activity or selectivity. The robustness, high performance, and recyclability of the catalyst enabled it to be used in a packed-bed reactor to carry out the cyanation under continuous flow. Up to 97 % ee and quantitative conversion with a throughput of 45 mg h(-1) were achieved under optimized flow conditions at room temperature in the case of benzhydryl imine. Furthermore, a three-component Strecker reaction was performed under continuous flow by using the corresponding aldehydes and amines instead of the preformed imines. A good product distribution was obtained for the formation of amino nitriles with ee values of up to 98 %. Synthetically useful ee values were also obtained for challenging α-branched aliphatic aldehyde by using the three-component continuous Strecker reaction. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A First Look on iMiner's Knowledge base and Detecting Hidden Hierarchy of Riyadh Bombing Terrorist Network

    DEFF Research Database (Denmark)

    Memon, Nasrullah

    2007-01-01

      - Data collection is difficult to any network analysis because it is difficult to create a complete network.  It is not easy to gain information on terrorist networks.  It is fact that terrorist organizations do not provide information on their members and the government rarely allows researchers...... to use their intelligence data (Ressler S., 2006).  Very few researchers (Krebs, V., 2002, Sageman, M., 2004 and Rodriguez, J. A., 2004) collected data from open sources, and to the best of our knowledge, no knowledge base is available in academia for the analysis of the terrorist events.   To counter...... of Investigative Data Mining (IDM). In addition, we present iMiner Information Harvesting System and describe how intelligence agencies could be benefited from detecting hierarchy in non-hierarchical terrorist networks.  In this paper we present results of detection of hidden hierarchy of Riyadh Bombing Terrorist...

  19. Stereoselective Alkylations of Chiral Nitro Imine and Nitro Hydrazone Dianions. Synthesis of Enantiomerically Enriched 3-Substituted 1-Nitrocyclohexenes†

    Science.gov (United States)

    Denmark, Scott E.; Ares, Jeffrey J.

    2011-01-01

    Dianions of chiral nitro imines (generated by a combination of LDA and s-BuLi) underwent diastereoselective alkylation with methyl, butyl, isopropyl, allyl and methallyl iodides. In contrast to the behavior of simple metalloenamines, the most selective auxiliary contained no coordinating groups, but did possess a large steric difference between the two substituents. The yield and selectivity of the alkylations were improved by the addition of HMPA or DMPU. The use of (S)-1-naphthylethylamine as the auxiliary afforded the R absolute configuration of the alkylation products. This stereochemical outcome could be rationalized by simple steric approach controlled alkylation in a conformationally fixed, internally coordinated dianion. A SAMP nitro hydrazone gave poorer yields and selectivities. PMID:18855478

  20. The Synthesis of Cyclic Poly(ethylene imine) and Exact Linear Analogues: An Evaluation of Gene Delivery Comparing Polymer Architectures.

    Science.gov (United States)

    Cortez, Mallory A; Godbey, W T; Fang, Yunlan; Payne, Molly E; Cafferty, Brian J; Kosakowska, Karolina A; Grayson, Scott M

    2015-05-27

    The delivery of genetic material to cells offers the potential to treat many genetic diseases. Cationic polymers, specifically poly(ethylene imine) (PEI), are promising gene delivery vectors due to their inherent ability to condense genetic material and successfully affect its transfection. However, PEI and many other cationic polymers also exhibit high cytotoxicity. To systematically study the effect of polymer architecture on gene delivery efficiency and cell cytotoxicity, a set of cyclic PEIs were prepared for the first time and compared to a set of linear PEIs of the exact same molecular weight. Subsequent in vitro transfection studies determined a higher transfection efficiency for each cyclic PEI sample when compared to its linear PEI analogue in addition to reduced toxicity relative to the branched PEI "gold standard" control. These results highlight the critical role that the architecture of PEI can play in both optimizing transfection and reducing cell toxicity.

  1. Synthesis, Spectroscopic, Structural and Quantum Chemical Studies of a New Imine Oxime and Its Palladium(II) Complex: Hydrolysis Mechanism.

    Science.gov (United States)

    Kaya, Yunus; Yilmaz, Veysel T; Buyukgungor, Orhan

    2016-01-21

    In this work, we report synthesis, crystallographic, spectroscopic and quantum chemical studies of a new imine oxime, namely (4-nitro-phenyl)-(1-phenyl-ethylimino)-acetaldehyde oxime (nppeieoH). Spectroscopic and X-ray diffraction studies showed that nppeieoH is hydrolyzed in aqueous solution, forming nitroisonitrosoacetophenone (ninap) and the hydrolysis product binds to Pd(II) to yield [Pd(nppeieo)(ninap)]. The mechanism of the hydrolysis reaction has been theoretically investigated in detail, using density functional theory (DFT) with the B3LYP method. The vibrational and the electronic spectra of nppeieoH and its Pd(II) complex, the HOMO and LUMO analysis, Mulliken atomic charges and molecular electrostatic potential were also performed. The predicted nonlinear optical properties of both compounds are higher than those of urea.

  2. Aminopentadiene imines from zincke salts of 3-alkylpyridines. Application to a synthesis of pyridinium salts from amino acids.

    Science.gov (United States)

    Nguyen, Tuan Minh; Sanchez-Salvatori, Maria del Rayo; Wypych, Jean-Charles; Marazano, Christian

    2007-07-20

    The reaction of Zincke salts with primary amines to give pyridinium salts generally requires rather elevated temperature to go to completion (50-100 degrees C). It is shown that the addition of 1 equiv of a secondary amine allows formation, at ambient temperature, of intermediate aminopentadiene imine salts which can be isolated and were found to cyclize in acidic medium to give pyridinium salts at temperatures which do not exceed 50 degrees C. If this process has a tendency to give lower yields of pyridinium salt than the standard Zincke procedure, it can be advantageous in some cases, as illustrated by the synthesis of pyridinium salts from amino acids, a challenging reaction which does not work starting from Zincke salt in the absence of diethylamine. More generally, the reaction can be extended to primary amines featuring polar functions, as exemplified by a pyridinium salt synthesis (75 degrees C) in 55% yield from l-carnosine.

  3. Dynamic mixtures and combinatorial libraries: imines as probes for molecular evolution at the interface between chemistry and biology.

    Science.gov (United States)

    Herrmann, Andreas

    2009-08-21

    In analogy to evolution in biological processes, "molecular evolution", based on the reversible formation of imines, has successfully been explored for drug discovery, receptor design and as a controlled-release vehicle. Multicomponent systems composed of amines and carbonyl compounds generate structural diversity by reversible reaction of the different components to form equilibrated dynamic mixtures or combinatorial libraries (DCLs). Under thermodynamic control and in the presence of an external factor which influences the equilibrium, these systems evolve by selective adaptation to the changing external conditions. This concept allows the casting of biologically or catalytically active substrates and the molding of receptors from DCLs which are composed of smaller non-active amine and carbonyl moieties. Similarly, if the amine or carbonyl compounds are the biologically active compounds of interest, the corresponding dynamic mixtures are found to be efficient delivery systems, allowing their controlled release over time.

  4. Sugar-boronate ester scaffold tethered pyridyl-imine palladium(II) complexes: synthesis and their in vitro anticancer evaluation.

    Science.gov (United States)

    Reddy, Eda Rami; Trivedi, Rajiv; Sarma, Akella Venkata Subrahmanya; Sridhar, Balasubramanian; Anantaraju, Hasitha Shilpa; Sriram, Dharmarajan; Yogeeswari, Perumal; Nagesh, Narayana

    2015-10-28

    A series of five palladium(ii) pyridyl-imine Schiff base complexes 5a-e containing boronate esters with protected sugar diols derived from d-xylose, l-sorbose and d-mannitol were designed and synthesized starting from pyridyl-imines generated in situ from 3-aminophenyl boronate ester of sugars 3a-e and 2-pyridinecarboxaldehyde, followed by the addition of Pd(cod)Cl2 in dichloromethane solvent. All the complexes are remarkably stable orange/yellow crystalline solids and were obtained in good yields. The complexes were fully characterized by FT-IR, multinuclear NMR ((1)H, (13)C and (11)B), UV-visible spectroscopy, and elemental analysis. The solid state structures of 3a and 5a were established by single crystal X-ray diffraction analysis. The complexes have been tested for their in vitro anticancer activities against human colon cancer (HT-29) and breast cancer (MDA-MB-231) cell lines. All the complexes have shown moderate to good cytotoxicity in both the cancer cell lines with IC50 values ranging from 4.27 to 34.76 μM. Strikingly, 5a displayed selective anticancer activity against both HT-29 and MDA-MB-231 cells with low IC50 values 6.71 and 8.58 μM respectively. Results also demonstrate that some of these complexes are highly potent against HT-29 cells as compared to the other cancer cell lines. In particular, 1,2:5,6-di-O-isopropylidene-d-mannitol complex 5d showed a two-fold higher toxicity against HT-29 cells in comparison with that of cisplatin. In addition, these complexes are less toxic to model non-tumorigenic human embryonic kidney cells (HEK-293T). Furthermore, the interaction of the complexes with calf thymus DNA (CT-DNA) was investigated using spectroscopy and viscosity measurements. It was found that they intercalate with DNA.

  5. Quantum chemical investigation of the electronic spectra of the keto, enol, and keto-imine tautomers of cytosine.

    Science.gov (United States)

    Tomić, Katarina; Tatchen, Jörg; Marian, Christel M

    2005-09-22

    The low-lying excited singlet states of the keto, enol, and keto-imine tautomers of cytosine have been investigated employing a combined density functional/multireference configuration interaction (DFT/MRCI) method. Unconstrained geometry optimizations have yielded out-of-plain distorted structures of the pi --> pi and n --> pi excited states of all cytosine forms. For the keto tautomer, the DFT/MRCI adiabatic excitation energy of the pi --> pi state (4.06 eV including zero-point vibrational energy corrections) supports the resonant two-photon ionization (R2PI) spectrum (Nir et al. Phys. Chem. Chem. Phys. 2002, 5, 4780). On its S1 potential energy surface, a conical intersection between the 1pipi state and the electronic ground state has been identified. The barrier height of the reaction along a constrained minimum energy path amounts to merely 0.2 eV above the origin and explains the break-off of the R2PI spectrum. The 1pipi minimum of the enol tautomer is found at considerably higher excitation energies (4.50 eV). Because of significant geometry shifts with respect to the ground state, long vibrational progressions are expected, in accord with experimental observations. For the keto-imine tautomer, a crossing of the 1pipi potential energy surface with the ground-state surface has been found, too. Its n --> pi minimum (3.27 eV) is located well below the conical intersection between the pi --> pi and S0 states, but it will be difficult to observe because of its small transition moment. The identified conical intersections of the pi --> pi excited states of the keto cytosine tautomers are made responsible for the ultrafast decay to the electronic ground states and thus may explain their subpicoseconds lifetimes.

  6. Theoretical study on the distribution of atomic charges in the Schiff bases of 3-hydroxypyridine-4-aldehyde and alanine. The effect of the protonation state of the pyridine and imine nitrogen atoms

    Energy Technology Data Exchange (ETDEWEB)

    Casasnovas, Rodrigo; Salva, Antoni; Frau, Juan; Donoso, Josefa [Institut Universitari d' Investigacio en Ciencies de la Salut (IUNICS), Departament de Quimica, Universitat de les Illes Balears, Cra. Valldemossa km 7.5, E-07122 Palma de Mallorca (Spain); Munoz, Francisco [Institut Universitari d' Investigacio en Ciencies de la Salut (IUNICS), Departament de Quimica, Universitat de les Illes Balears, Cra. Valldemossa km 7.5, E-07122 Palma de Mallorca (Spain)], E-mail: dqufmi0@uib.es

    2009-01-27

    The protonation state of the pyridine and imine nitrogen atoms on the 'electron-sink' effect was studied by DFT(B3LYP/6-31+G*) calculations in the Schiff bases formed between 3-hydroxypyridine-4-aldehyde and alanine and their C{alpha}-carbanionic counterparts. Results indicate that the protonation of pyridine nitrogen promotes the enolimine-ketoenamine tautomerism. The importance of pyridine nitrogen on the 'electron-sink' effect in the carbanionic molecules clearly depends on the protonation state of the imine nitrogen: in the enolimine tautomers, where the imine nitrogen is deprotonated, a 70% of the electron charge is delocalized on the pyridine ring, whereas in the ketoenamine type structures, where the imine nitrogen is fully protonated, just a 20% of this charge is delocalized in this molecular moiety. The results are discussed in relation to the chemistry of some PLP-dependent enzymes and the structure of their active sites.

  7. Nickel-catalyzed synthesis of N-aryl-1,2-dihydropyridines by [2+2+2] cycloaddition of imines with alkynes through T-shaped 14-electron aza-nickelacycle key intermediates.

    Science.gov (United States)

    Hoshimoto, Yoichi; Ohata, Tomoya; Ohashi, Masato; Ogoshi, Sensuke

    2014-04-01

    Despite there being a straightforward approach for the synthesis of 1,2-dihydropyridines, the transition-metal-catalyzed [2+2+2] cycloaddition reaction of imines with alkynes has been achieved only with imines containing an N-sulfonyl or -pyridyl group. Considering the importance of 1,2-dihydropyridines as useful intermediates in the preparation of a wide range of valuable organic molecules, it would be very worthwhile to provide novel strategies to expand the scope of imines. Herein we report a successful expansion of the scope of imines in nickel-catalyzed [2+2+2] cycloaddition reactions with alkynes. In the presence of a nickel(0)/PCy3 catalyst, a reaction with N-benzylidene-P,P-diphenylphosphinic amide was developed. Moreover, an application of N-aryl imines to the reaction was also achieved by adopting N-heterocyclic carbene ligands. The isolation of an (η(2)-N-aryl imine)nickel(0) complex containing a 14-electron nickel(0) center and a T-shaped 14-electron five-membered aza-nickelacycle is shown. These would be considered as key intermediates of the reaction. The structure of these complexes was unambiguously determined by NMR spectroscopy and X-ray analyses. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Iron-Carbonyl-Catalyzed Redox-Neutral [4+2] Annulation of N-H Imines and Internal Alkynes by C-H Bond Activation.

    Science.gov (United States)

    Jia, Teng; Zhao, Chongyang; He, Ruoyu; Chen, Hui; Wang, Congyang

    2016-04-18

    Stoichiometric C-H bond activation of arenes mediated by iron carbonyls was reported by Pauson as early as in 1965, yet the catalytic C-H transformations have not been developed. Herein, an iron-catalyzed annulation of N-H imines and internal alkynes to furnish cis-3,4-dihydroisoquinolines is described, and represents the first iron-carbonyl-catalyzed C-H activation reaction of arenes. Remarkablely, this is also the first redox-neutral [4+2] annulation of imines and alkynes proceeding by C-H activation. The reaction also features only cis stereoselectivity and excellent atom economy as neither base, nor external ligand, nor additive is required. Experimental and theoretical studies reveal an oxidative addition mechanism for C-H bond activation to afford a dinuclear ferracycle and a synergetic diiron-promoted H-transfer to the alkyne as the turnover-determining step.

  9. Asymmetric synthesis of α-amino-1,3-dithianes via chiral N-phosphonyl imine-based Umpolung reaction without using chromatography and recrystallization.

    Science.gov (United States)

    Kattamuri, Padmanabha V; Ai, Teng; Pindi, Suresh; Sun, Yinwei; Gu, Peng; Shi, Min; Li, Guigen

    2011-04-15

    A series of α-amino-1,3-dithianes have been synthesized via the asymmetric Umpolung reaction of 2-lithio-1,3-dithianes with chiral N-phosphonyl imines in good chemical yields (up to 82%) and good to excellent diastereoselectivities (>99:1). The manner by which chiral N-phosphonyl imines are slowly added into the solution of 2-lithio-1,3-dithiane was found to be crucial for achieving excellent diastereoselectivity. The current synthesis was proven to follow the GAP chemistry (group-assistant-purification chemistry) process, which avoids traditional purification techniques of chromatography or recrystallization, i.e., the pure chiral α-amino-1,3-dithianes attached with the chiral N-phosphonyl group were readily obtained by washing the solid crude products with hexane or a mixture of hexane-ethyl acetate.

  10. In Vitro Antibacterial Studies of Ciprofloxacin-imines and Their Complexes with Cu(II),Ni(II),Co(II), and Zn(II)

    OpenAIRE

    Imran, Muhammad; IQBAL, Javed; Iqbal, Shahid; IJAZ, Nazia

    2007-01-01

    Some new transition metal complexes of ciprofloxacin-imines derived from ciprofloxacin and p-substituted anilines were synthesized and characterized on the basis of physical properties, conductance measurements, elemental analysis, UV/Vis., infrared and nuclear magnetic resonance spectroscopy. These ligands as well as their metal complexes were also evaluated for their antibacterial activity against several bacterial strains, such as Staphylococcus aureus, Bacillus subtilus, Salmonella typhae...

  11. Development of a tailor-made bis(oxazolidine)pyridine-metal catalyst for the [3+2] cycloaddition of azomethine imines with propiolates.

    Science.gov (United States)

    Arai, Takayoshi; Ogino, Yuta; Sato, Toru

    2013-09-14

    A series of bis(oxazolidine)pyridine ligands (the PyBodines) were newly designed and synthesized for the development of a highly efficient, tailor-made catalyst for the [3+2] cycloaddition of azomethine imines with propiolates. The PyBodine(l-Ala)-Cu(OAc)2 catalyst was selected on the basis of solid-phase catalysis/CD-HTS and exhibited high efficiency, producing the (R)-adducts with excellent enantioselectivity.

  12. Computational rationalization of the selective C-H and C-F activations of fluoroaromatic imines and ketones by cobalt complexes.

    Science.gov (United States)

    Li, Jingjing; Zhang, Dongju; Sun, Hongjian; Li, Xiaoyan

    2014-03-28

    While selective C-H and C-F activations of fluoroaromatic imines and ketones with transition metal complexes supported by PMe3 have been successfully achieved in recent publications, insight into the molecular mechanism and energetics of those reactions is still lacking. Focusing on three typical substrates, 2,6-difluorobenzophenone imine (A) and 2,6-difluorobenzophenone (B), and 2,4'-difluorobenzophenone (C), the present work theoretically studied their C-H and C-F cyclometalation reactions promoted by the activator Co(PMe3)4 or CoMe(PMe3)4. It is found that reaction A + Co(PMe3)4 favors the C-F activation, reaction A + CoMe(PMe3)4 prefers the C-H activation, whereas both the C-H and C-F activation pathways may be viable for reactions B + CoMe(PMe3)4 and C + CoMe(PMe3)4. The experimentally observed C-H and C-F cyclometalation products have been rationalized by analyzing the thermodynamic and kinetic properties of two activation pathways. From calculated results combined with the experimental observations, we believe that three factors, i.e. the oxidation state of the metal center in the activators, the anchoring group of substrates, and substituted fluoroatom counts of the aromatic ring in substrates, affect the selectivity of C-H and C-F activations of fluoroaromatic ketones and imines. Calculated results are enlightening about the rational design of activators and substrates of fluoroaromatic imines and ketones to obtain the exclusive C-H or C-F bond activation product.

  13. Concerning the Potential Reversibility of Carbometalation in Alkoxide-directed Ti(Oi-Pr)4-mediated Reductive Cross-Coupling of Homoallylic Alcohols with Aromatic Imines

    Science.gov (United States)

    Takahashi, Masayuki; Micalizio, Glenn C.

    2011-01-01

    In an attempt to understand the nature of selectivity in Ti-mediated reductive cross-coupling between homoallylic alcohols and imines, we investigated whether thermodynamic equilibration of the presumed organometallic intermediate plays a role in selectivity. No evidence could be found for olefin exchange in preformed azatitanacyclopentanes – an observation that is consistent with a model based on kinetically controlled selective carbometalation. PMID:20379585

  14. Phosphine-catalyzed [3+2] cycloaddition reactions of azomethine imines with electron-deficient alkenes: a facile access to dinitrogen-fused heterocycles.

    Science.gov (United States)

    Li, Zhen; Yu, Hao; Liu, Honglei; Zhang, Lei; Jiang, Hui; Wang, Bo; Guo, Hongchao

    2014-02-03

    An efficient method for the phosphine-catalyzed [3+2] cycloaddition reaction of azomethine imines with diphenylsulfonyl alkenes to give dinitrogen-fused bi- or tricyclic heterocyclic compounds in high yields has been described. Moreover, two phenylsulfonyl groups installed on the heterocyclic products could be conveniently removed or transformed to other functional groups, making the reaction more useful. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Total Synthesis of (+)-Batzelladine A and (−)-Batzelladine D via [4 + 2]-Annulation of Vinyl Carbodiimides with N-Alkyl Imines

    Science.gov (United States)

    Arnold, Michael A.; Day, Kenneth A.; Durón, Sergio G.; Gin, David Y.

    2008-01-01

    A diastereoselective [4 + 2]-annulation of vinyl carbodiimides with chiral N-alkyl imines has been developed to access the stereochemically rich polycyclic guanidine cores of the batzelladine alkaloids. Application of this strategy, together with additional key steps such as long-range directed hydrogenation and diastereoselective intramolecular iodo-amination, led to highly convergent total syntheses of (−)-batzelladine D and (+)-batzelladine A with excellent stereocontrol. PMID:17017806

  16. Construction of functionalized 2,3-dihydro-1,4-benzoxazines via [5 + 1] annulations of 2-halo-1,3-dicarbonyl compounds with imines.

    Science.gov (United States)

    Zhang, Ya-Ru; Xie, Jian-Wu; Huang, Xu-Jiao; Zhu, Wei-Dong

    2012-08-28

    A series of functionalized 2,3-dihydro-1,4-benzoxazines were obtained in moderate to excellent yields via domino [5 + 1] annulations of 2-halo-1,3-dicarbonyl compounds 2 with imines 1 under mild conditions and the application of this method in the synthesis of bioactive analogues, such as functionalized tetracyclic-1,4-benzoxazines which contain two new heterocyclic rings and one quaternary carbon center has also been developed.

  17. One Pot Reduction of Imines Generated in-situ from Aldehydes and Amines by the NaBH4-InCl3 System

    Institute of Scientific and Technical Information of China (English)

    RAVI Varala; RAMU Enugala; VIJAY KUMAR Ponnamaneni; SRINIVAS RAO Adapa

    2006-01-01

    A combination of sodium borohydride and a catalytic amount of indium(Ⅲ) chloride in acetonitrile reduces imines formed in-situ from aldehydes and amines to the corresponding functionalised secondary and tertiary amines in moderate to good yields. Noteworthy is that highly chemoselective reactions were achieved in the presence of other functional groups such as halogens, carbon-carbon double bonds and hydroxyl groups.

  18. Synthesis of alpha-phosphorylated alpha,beta-unsaturated imines and their selective reduction to vinylogous and saturated alpha-aminophosphonates.

    Science.gov (United States)

    Palacios, Francisco; Vicario, Javier; Maliszewska, Agnieszka; Aparicio, Domitila

    2007-03-30

    An efficient synthesis of alpha,beta-unsaturated imines derived from alpha-aminophosphonates is achieved through aza-Wittig reaction of P-trimethyl phosphazenes with beta,gamma-unsaturated alpha-ketophosphonates. Selective 1,2-reduction of such 1-azadienes affords beta,gamma-unsaturated alpha-aminophosphonates, phosphorylated analogs of vinylglycines, which are hydrogenated to yield saturated alpha-aminophosphonate derivatives.

  19. Structure, Activity and Stereoselectivity of NADPH-Dependent Oxidoreductases Catalysing the S-Selective Reduction of the Imine Substrate 2-Methylpyrroline.

    Science.gov (United States)

    Man, Henry; Wells, Elizabeth; Hussain, Shahed; Leipold, Friedemann; Hart, Sam; Turkenburg, Johan P; Turner, Nicholas J; Grogan, Gideon

    2015-05-04

    Oxidoreductases from Streptomyces sp. GF3546 [3546-IRED], Bacillus cereus BAG3X2 (BcIRED) and Nocardiopsis halophila (NhIRED) each reduce prochiral 2-methylpyrroline (2MPN) to (S)-2-methylpyrrolidine with >95 % ee and also a number of other imine substrates with good selectivity. Structures of BcIRED and NhIRED have helped to identify conserved active site residues within this subgroup of imine reductases that have S selectivity towards 2MPN, including a tyrosine residue that has a possible role in catalysis and superimposes with an aspartate in related enzymes that display R selectivity towards the same substrate. Mutation of this tyrosine residue-Tyr169-in 3546-IRED to Phe resulted in a mutant of negligible activity. The data together provide structural evidence for the location and significance of the Tyr residue in this group of imine reductases, and permit a comparison of the active sites of enzymes that reduce 2MPN with either R or S selectivity. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. A metalloenzyme-like catalytic system for the chemoselective oxidative cross-coupling of primary amines to imines under ambient conditions.

    Science.gov (United States)

    Largeron, Martine; Fleury, Maurice-Bernard

    2015-02-23

    The direct oxidative cross-coupling of primary amines is a challenging transformation as homocoupling is usually preferred. We report herein the chemoselective preparation of cross-coupled imines through the synergistic combination of low loadings of Cu(II) metal-catalyst and o-iminoquinone organocatalyst under ambient conditions. This homogeneous cooperative catalytic system has been inspired by the reaction of copper amine oxidases, a family of metalloenzymes with quinone organic cofactors that mediate the selective oxidation of primary amines to aldehydes. After optimization, the desired cross-coupled imines are obtained in high yields with broad substrate scope through a transamination process that leads to the homocoupled imine intermediate, followed by dynamic transimination. The ability to carry out the reactions at room temperature and with ambient air, rather than molecular oxygen as the oxidant, and equimolar amounts of each coupling partner is particularly attractive from an environmentally viewpoint. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. A NADPH-dependent (S)-imine reductase (SIR) from Streptomyces sp. GF3546 for asymmetric synthesis of optically active amines: purification, characterization, gene cloning, and expression.

    Science.gov (United States)

    Mitsukura, Koichi; Kuramoto, Tatsuya; Yoshida, Toyokazu; Kimoto, Norihiro; Yamamoto, Hiroaki; Nagasawa, Toru

    2013-09-01

    A NADPH-dependent (S)-imine reductase (SIR) was purified to be homogeneous from the cell-free extract of Streptomyces sp. GF3546. SIR appeared to be a homodimer protein with subunits of 30.5 kDa based on SDS-polyacrylamide gel electrophoresis and HPLC gel filtration. It also catalyzed the (S)-enantioselective reduction of not only 2-methyl-1-pyrroline (2-MPN) but also 1-methyl-3,4-dihydroisoquinoline and 6,7-dimethoxy-1-methyl-3,4-dihydroisoquinoline. Specific activities for their imines were 130, 44, and 2.6 nmol min(-1) mg(-1), and their optical purities were 92.7 % ee, 96.4 % ee, and >99 % ee, respectively. Using a NADPH-regenerating system, 10 mM 2-MPN was converted to amine with 100 % conversion and 92 % ee after 24 h. The amino acid sequence analysis revealed that SIR showed about 60 % identity to 6-phosphogluconate dehydrogenase. However, it showed only 37 % identity with Streptomyces sp. GF3587 (R)-imine reductase. Expression of SIR in Escherichia coli was achieved, and specific activity of the cell-free extract was about two times higher than that of the cell-free extract of Streptomyces sp. GF3546.

  2. Stability of dendriplexes formed by anti-HIV genetic material and poly(propylene imine) dendrimers in the presence of glucosaminoglycans.

    Science.gov (United States)

    Szewczyk, Michal; Drzewinska, Joanna; Dzmitruk, Volha; Shcharbin, Dzmitry; Klajnert, Barbara; Appelhans, Dietmar; Bryszewska, Maria

    2012-12-20

    There are several barriers to the application of dendriplexes formed by poly(propylene imine) dendrimers and genetic material for gene therapy. One limitation is their interaction with extracellular matrix components such as glucosaminoglycans. These can displace the genetic material from the dendriplexes, affecting their transfection activity. In this study, we analyzed the interaction between dendriplexes and the four main glucosaminoglycans (heparin, heparan sulfate, chondroitin sulfate, and hyaluronic acid) by fluorescence polarization and gel electrophoresis. Dendriplexes were formed by combining three anti-HIV antisense oligodeoxynucleotides with three poly(propylene imine) dendrimers of the fourth generation: unmodified and partially modified with maltose and maltotriose (open shell glycodendrimers). The data showed that the effect of glucosaminoglycans on dendriplexes depends on the glucosaminoglycan type and the oligosaccharide serving as the surface group of the dendrimer. Heparin at physiological concentrations destroys dendriplexes formed by open shell glycodendrimers, but dendriplexes based on unmodified poly(propylene imine) dendrimers are stable in its presence. The other glucosaminoglycans at physiological concentrations cannot destroy dendriplexes formed by any of the dendrimers studied.

  3. Structural dependence of in vitro cytotoxicity, oxidative stress and uptake mechanisms of poly(propylene imine) dendritic nanoparticles.

    Science.gov (United States)

    Khalid, Humza; Mukherjee, Sourav Prasanna; O'Neill, Luke; Byrne, Hugh J

    2016-03-01

    The in vitro cytotoxic and intracellular oxidative stress responses to exposure to poly(propylene imine) (PPI) dendritic nanoparticles of increasing generation (number of repeated branching cycles) (G0-G4) were assessed in an immortal non-cancerous human keratinocyte cell line (HaCaT). Confocal fluorescence microscopy with organelle staining was used to explore the uptake and intracellular trafficking mechanisms. A generation- and dose-dependent cytotoxic response was observed, increasing according to generation and, therefore, number of surface amino groups. A comparison of the cytotoxic response of G4 PPI and the related G4 poly(amido amine) dendrimer indicates that the PPI with the same number of surface amino groups elicits a significantly higher cytotoxic response. The trend of cytotoxicity versus dendrimer generation and, therefore, size is discontinuous in the region of G2, however, indicating a difference in uptake mechanism for higher compared to lower generations. Whereas the higher generations elicit an oxidative stress response at short exposure times, the lower generations indicate an antioxidant response. Confocal microscopy indicates that, whereas they are prominent at early exposure times for the larger PPI dendrimers, no evidence of early stage endosomes was observed for lower generations of PPI. The results are consistent with an alternative uptake mechanism of physical diffusion across the semipermeable cell membrane for the lower generation dendrimers and are discussed in terms of their implications for predictive models for nanotoxicology and design strategies for nanomedical applications.

  4. Multifunctional WS2 @Poly(ethylene imine) Nanoplatforms for Imaging Guided Gene-Photothermal Synergistic Therapy of Cancer.

    Science.gov (United States)

    Zhang, Chunfang; Yong, Yuan; Song, Li; Dong, Xinghua; Zhang, Xiao; Liu, Xiangfeng; Gu, Zhanjun; Zhao, Yuliang; Hu, Zhongbo

    2016-11-01

    The combination of photothermal therapy (PTT) with gene therapy (GT) to improve PTT efficiency and thus eliminate cancer cells under mild hyperthermia is highly needed. Herein, multifunctional WS2 @poly(ethylene imine) (WS2 @PEI) nanoplatform has been designed and constructed for gene-photothermal synergistic therapy of tumors at mild condition. After a surface modification of WS2 with a positively charged PEI, the as-prepared WS2 @PEI nanoplatform can not only act as an efficient survivin-siRNA carrier for GT but also exhibit remarkable near-infrared (NIR) photothermal effects for PTT. On the one hand, the photothermal effects induced by WS2 @PEI upon NIR irradiation can enhance the cellular uptake owing to the increase of the cell membrane permeability, which leads to the remarkable enhancement of silencing efficiency of survivin. On the other hand, the silencing of survivin can increase the apoptosis as well as reduce the heat resistance of cancer cells by downregulating the heat shock protein 70 expressions, which greatly enhance the sensitivity of cancer cells to PTT. As a result, compared to PTT or GT treatment alone, WS2 @PEI mediated synergistic GT/PTT therapy remarkably enhances in vitro cancer cell damage and in vivo tumor elimination.

  5. Design, development, drug-likeness, and molecular docking studies of novel piperidin-4-imine derivatives as antitubercular agents.

    Science.gov (United States)

    Revathi, Rajappan; Venkatesha Perumal, Ramachandran; Pai, Karkala Sreedhara Ranganath; Arunkumar, Govindakarnavar; Sriram, Dharmarajan; Kini, Suvarna Ganesh

    2015-01-01

    Tuberculosis remains one of the major grievous diseases worldwide. The emergence of resistance to antituberculosis drugs emphasize the necessity to discover new therapeutic agents for preferential tuberculosis therapy. In this study, various novel 1-(1H-benzimidazol-2-ylmethyl) piperidin-4-imine derivatives were developed and checked for favorable pharmacokinetic parameters based on drug-likeness explained by Lipinski's rule of five. All 20 of the novel chemical entities were found to possess a favorable pharmacokinetic profile since they were not violating Lipinski's rule of five. The title compounds were also synthesized, characterized, and tested for ex vivo antitubercular activity against Mycobacterium tuberculosis H37Rv (ATCC27294). The results revealed that four compounds (2-[1-(1H-benzimidazol-2-ylmethyl)piperidin-4-ylidene] hydrazinecarbothioamide, 2-[1-(1H-benzimidazol-2-ylmethyl)piperidin-4-ylidene]-N-hydroxy-hydrazinecarbo-thioamide, 1-[1-(1H-benzimidazol-2-ylmethyl)piperidin-4-ylidene]guanidine, and 2-[1-(1H-benzimidazol-2-ylmethyl)piperidin-4-ylidene]hydrazinecarboxamide) were the most potent (minimum inhibitory concentration 6.25 µg/mL) antitubercular agents, with less toxicity (selectivity index more than 10). The molecules were also subjected to three-dimensional molecular docking on the crystal structure of enoyl-acyl carrier protein (EACP) reductase enzyme (code 1ZID, Protein Data Bank), which represents a good prediction of the interactions between the molecules and EACP reductase with minimum binding energy.

  6. Modification of poly(L-lactic acid) electrospun fibers and films with poly(propylene imine) dendrimer

    Science.gov (United States)

    Khaliliazar, Sh.; Akbari, S.; Kish, M. H.

    2016-02-01

    Poly(L-lactic acid) (PLLA) electrospun fibers and films were modified with the second generation of poly(propylene imine) dendrimer (PPI-G2) by three different approaches, namely, sodium hydroxide hydrolysis, plasma treatment and direct application of PPI-G2. For the first and the second approaches, PLLA was modified by sodium hydroxide hydrolysis or plasma treatment to produce carboxylic acid groups. Then, the carboxylic acid groups were activated by 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC) and N,N‧-dicyclohexyl carbodiimide (DCC) as a hetero bi-functional cross-linker. The cross-linkers promoted the grafting of carboxylic acid groups on the modified PLLA with NH2 groups of PPI-G2. In the third approach, the PPI-G2 dendrimer was directly used as an aminolysis agent for the functionalization of PLLA in a one step process. FTIR analysis confirmed the presence of sbnd NH2 groups of PPI-G2 on the modified PLLA samples, resulting from each one of the three modification methods. Studies by SEM shows bead free electrospun fibers. Also, FE-SEM shows nano-cracks on the surface of films after modification. Contact angle, drug release tests, antibacterial effects and the dying results confirmed that these functionalization methods increased hydrophilicity and reactive side-chains of PLLA in the wet chemical process resulted in providing host-guest properties on the PLLA surface for adsorbing various kinds of guest molecules.

  7. Intracellular degradation of multilabeled poly(ethylene imine)-mesoporous silica-silica nanoparticles: implications for drug release.

    Science.gov (United States)

    Bergman, Lotta; Kankaanpää, Pasi; Tiitta, Silja; Duchanoy, Alain; Li, Ling; Heino, Jyrki; Lindén, Mika

    2013-05-06

    Mesoporous silica nanoparticles, MSNs, have emerged as an interesting carrier for drugs in vitro and in vivo. The particles are typically used in a surface functionalized form, where functional silanes or other covalently linked surface functions are used to provide anchoring sites for additional functionalities like targeting groups, imaging agents, and drugs. Here, we report results related to extra- and intracellular degradation of silica nanoparticles using multilabeled nonporous silica core-mesoporous silica shell-surface hyperbranched poly(ethylene imine) shell nanoparticles as model particles. Different fluorophores have been selectively covalently linked to different regions of the particles in order to study the particle degradation in detail under in vitro conditions in human SAOS-2 cells. A novel, quantitative method for nanoparticle degradation evaluation based on confocal fluorescence microscopy is applied. Our results suggest that the core-shell-shell MSNs degrade at a higher rate inside cells as compared to outside cells, which is of high importance for further application of this class of drug carriers.

  8. In vivo targeted gene delivery to peripheral neurons mediated by neurotropic poly(ethylene imine)-based nanoparticles.

    Science.gov (United States)

    Lopes, Cátia Df; Oliveira, Hugo; Estevão, Inês; Pires, Liliana Raquel; Pêgo, Ana Paula

    2016-01-01

    A major challenge in neuronal gene therapy is to achieve safe, efficient, and minimally invasive transgene delivery to neurons. In this study, we report the use of a nonviral neurotropic poly(ethylene imine)-based nanoparticle that is capable of mediating neuron-specific transfection upon a subcutaneous injection. Nanoparticles were targeted to peripheral neurons by using the nontoxic carboxylic fragment of tetanus toxin (HC), which, besides being neurotropic, is capable of being retrogradely transported from neuron terminals to the cell bodies. Nontargeted particles and naked plasmid DNA were used as control. Five days after treatment by subcutaneous injection in the footpad of Wistar rats, it was observed that 56% and 64% of L4 and L5 dorsal root ganglia neurons, respectively, were expressing the reporter protein. The delivery mediated by HC-functionalized nanoparticles spatially limited the transgene expression, in comparison with the controls. Histological examination revealed no significant adverse effects in the use of the proposed delivery system. These findings demonstrate the feasibility and safety of the developed neurotropic nanoparticles for the minimally invasive delivery of genes to the peripheral nervous system, opening new avenues for the application of gene therapy strategies in the treatment of peripheral neuropathies.

  9. Microwave assisted synthesis, spectroscopic, electrochemical and DNA cleavage studies of lanthanide(III) complexes with coumarin based imines.

    Science.gov (United States)

    Kapoor, Puja; Fahmi, Nighat; Singh, R V

    2011-12-01

    The present work stems from our interest in the synthesis, characterization and biological evaluation of lanthanide(III) complexes of a class of coumarin based imines which have been prepared by the interaction of hydrated lanthanide(III) chloride with the sodium salts of 3-acetylcoumarin thiosemicarbazone (ACTSZH) and 3-acetylcoumarin semicarbazone (ACSZH) in 1:3 molar ratio using thermal as well as microwave method. Characterization of the ligands as well as the metal complexes have been carried out by elemental analysis, melting point determinations, molecular weight determinations, magnetic moment, molar conductance, IR, (1)H NMR, (13)C NMR, electronic, EPR, X-ray powder diffraction and mass spectral studies. Spectral studies confirm ligands to be monofunctional bidentate and octahedral environment around metal ions. The redox behavior of one of the synthesized metal complex was investigated by cyclic voltammetry. Further, free ligands and their metal complexes have been screened for their antimicrobial as well as DNA cleavage activity. The results of these findings have been presented and discussed.

  10. Poly(ethylene imine)-modified graphene oxide with improved colloidal stability and its adsorption of methyl orange.

    Science.gov (United States)

    Liu, Hongxi; Wu, Ting; Wu, Zhimin; Zhang, Yong; Xuan, Keqin; Zhang, Jinglin; Tan, Shaozao

    2014-01-01

    Graphene oxide (GO) was chemically modified with poly(ethylene imine) (PEI) to improve its colloidal stability and was investigated as a potential adsorbent for the removal of methyl orange (MO). The synthesis of PEI-GO was verified with a Fourier transform infrared spectrometer and thermogravimetric analysis. A series of adsorption experiments were carried out to investigate the adsorption capacity of PEI-GO. Adsorption kinetics and thermodynamics studies were performed, and the thermodynamic parameters were calculated. The results showed that PEI could improve the colloidal stability of GO in aqueous solution, and the obtained PEI-GO showed a macroscopically homogeneous dispersion after more than three months. After standing for 90 days, the Brunauer-Emmett-Teller specific surface area of GO decreased from 353 to 214 m2·g(-1), while that of PEI-GO remained almost unchanged (from 432 to 413 m2·g(-1)). The PEI-GO exhibited significantly faster kinetic and higher adsorption capacity for MO than GO. Moreover, PEI-GO had a good adsorption capacity in the acidic range, and the highest adsorption of MO occurred at pH=6.0. The adsorption of MO on PEI-GO was an endothermic, spontaneous and physisorption process.

  11. Syntheses and structures of closely related copper(I) complexes of tridentate (2-pyridylmethyl)imine and (2-pyridylmethyl)amine ligands and their use in mediating atom transfer radical polymerizations.

    Science.gov (United States)

    Turner, Sara A; Remillard, Zachary D; Gijima, Desire T; Gao, Emily; Pike, Robert D; Goh, Christopher

    2012-10-15

    A series of five copper(I) bromide complexes of tridentate (N,N,L) pyridine-imine and pyridine-amine ligands with a third amine, ether, or thioether neutral donor was synthesized and utilized in the atom transfer radical polymerization of styrene. The ligand design illustrated a systematic approach to the development of copper complexes for use in ATRP. Variations in the nature of the ligand impacted the solid state structures of the complexes. A mononuclear [CuBr(L)] complex was observed for L = pyridine-amine-amine, whereas complexes of L = pyridine-imine-amine and -thioether formed dinuclear [CuBr(L)](2) structures with a central 10-membered ring. A doubly-bromide-bridged dimer was revealed for the [CuBr(L)] complex of L = pyridine-imine-ether and a polymeric species for [CuBr(L)], where L = pyridine-imine-amine and the imine-amine spacer was extended from two to three carbon atoms. In the application of these complexes to the ATRP of styrene, the redox potentials of the complexes were found to be one indicator of ATRP efficiency. Of the series presented, two complexes in particular provided fast polymerization rates and good to excellent molecular weight control. In both of these complexes, the ligand contained all nitrogen-based donor moieties.

  12. A Highly Stable Microporous Covalent Imine Network Adsorbent for Natural Gas Upgrading and Flue Gas CO2 Capture

    KAUST Repository

    Das, Swapan Kumar

    2016-06-06

    The feasible capture and separation of CO2 and N2 from CH4 is an important task for natural gas upgrading and the control of greenhouse gas emissions. Here, we studied the microporous covalent imine networks (CIN) material prepared through Schiff base condensation and exhibited superior chemical robustness under both acidic and basic conditions and high thermal stability. The material possesses a relatively uniform nanoparticle size of approximately 70 to 100 nm. This network featured permanent porosity with a high surface area (722 m2g-1) and micropores. A single-component gas adsorption study showed enhanced CO2 and CH4 uptakes of 3.32 mmol/g and 1.14 mmol/g, respectively, at 273 K and 1 bar, coupled with high separation selectivities for CO2/CH4, CH4/N2, and CO2/N2 of 23, 11.8 and 211, respectively. The enriched Lewis basicity in the porous skeletons favours the interaction of quadrupolar CO2 and polarizable CH4, resulting in enhanced CH4 and CO2 uptake and high CH4/N2, CO2/CH4 and CO2/N2 selectivities. Breakthrough experiments showed high CO2/CH4, CH4/N2 and CO2/N2 selectivities of 7.29, 40 and 125, respectively, at 298 K and 1 bar. High heats of adsorption for CH4 and CO2 (QstCH4; 32.61 kJ mol-1 and QstCO2; 42.42 kJ mol-1) provide the ultimate validation for the high selectivity. To the best of our knowledge, such a versatile adsorbent material that displays both enhanced uptake and selectivity for a variety of binary gas mixtures, including CO2/ CH4, CO2/N2 and CH4/N2, has not been extensively explored.

  13. Conversion of a monodentate amidinate-germylene ligand into chelating imine-germanate ligands (on mononuclear manganese complexes).

    Science.gov (United States)

    Cabeza, Javier A; García-Álvarez, Pablo; Pérez-Carreño, Enrique; Polo, Diego

    2014-08-18

    The unprecedented transformation of a terminal two-electron-donor amidinate-germylene ligand into a chelating three-electron-donor κ(2)-N,Ge-imine-germanate ligand has been achieved by treating the manganese amidinate-germylene complex [MnBr{Ge((i)Pr2bzam)(t)Bu}(CO)4] (1; (i)Pr2bzam = N,N'-bis(isopropyl)benzamidinate) with LiMe or Ag[BF4]. In these reactions, which afford [Mn{κ(2)Ge,N-GeMe((i)Pr2bzam)(t)Bu}(CO)4] (2) and [Mn{κ(2)Ge,N-GeF((i)Pr2bzam)(t)Bu}(CO)4] (3), respectively, the anionic nucleophile, Me(-) or F(-), ends on the Ge atom while an arm of the amidinate fragment migrates from the Ge atom to the Mn atom. In contrast, the reaction of 1 with AgOTf (OTf = triflate) leads to [Mn(OTf){Ge((i)Pr2bzam)(t)Bu}(CO)4] (4), which maintains intact the amidinate-germylene ligand. Complex 4 is very moisture-sensitive, leading to [Mn2{μ-κ(4)Ge2,O2-Ge2(t)Bu2(OH)2O}(CO)8] (5) and [(i)Pr2bzamH2]OTf (6) in wet solvents. In 5, a novel digermanate(II) ligand, [(t)Bu(OH)GeOGe(OH)(t)Bu](2-), doubly bridges two Mn(CO)4 units. The structures of 1-6 have been characterized by spectroscopic (IR, NMR) and single-crystal X-ray diffraction methods.

  14. (Photo)physical Properties of New Molecular Glasses End-Capped with Thiophene Rings Composed of Diimide and Imine Units

    Science.gov (United States)

    2014-01-01

    New symmetrical arylene bisimide derivatives formed by using electron-donating–electron-accepting systems were synthesized. They consist of a phthalic diimide or naphthalenediimide core and imine linkages and are end-capped with thiophene, bithiophene, and (ethylenedioxy)thiophene units. Moreover, polymers were obtained from a new diamine, N,N′-bis(5-aminonaphthalenyl)naphthalene-1,4,5,8-dicarboximide and 2,5-thiophenedicarboxaldehyde or 2,2′-bithiophene-5,5′-dicarboxaldehyde. The prepared azomethine diimides exhibited glass-forming properties. The obtained compounds emitted blue light with the emission maximum at 470 nm. The value of the absorption coefficient was determined as a function of the photon energy using spectroscopic ellipsometry. All compounds are electrochemically active and undergo reversible electrochemical reduction and irreversible oxidation processes as was found in cyclic voltammetry and differential pulse voltammetry (DPV) studies. They exhibited a low electrochemically (DPV) calculated energy band gap (Eg) from 1.14 to 1.70 eV. The highest occupied molecular orbital and lowest unoccupied molecular orbital levels and Eg were additionally calculated theoretically by density functional theory at the B3LYP/6-31G(d,p) level. The photovoltaic properties of two model compounds as the active layer in organic solar cells in the configuration indium tin oxide/poly(3,4-(ethylenedioxy)thiophene):poly(styrenesulfonate)/active layer/Al under an illumination of 1.3 mW/cm2 were studied. The device comprising poly(3-hexylthiophene) with the compound end-capped with bithiophene rings showed the highest value of Voc (above 1 V). The conversion efficiency of the fabricated solar cell was in the range of 0.69–0.90%. PMID:24966893

  15. PEGylation affects cytotoxicity and cell-compatibility of poly(ethylene imine) for lung application: structure-function relationships.

    Science.gov (United States)

    Beyerle, Andrea; Merkel, Olivia; Stoeger, Tobias; Kissel, Thomas

    2010-01-15

    Poly(ethylene imine) (PEI) has widely been used as non-viral gene carrier due to its capability to form stable complexes by electrostatic interactions with nucleic acids. To reduce cytotoxicity of PEI, several studies have addressed modified PEIs such as block or graft copolymers containing cationic and hydrophilic non-ionic components. Copolymers of PEI and hydrophilic poly(ethylene glycol) (PEG) with various molecular weights and graft densities were shown to exhibit decreased cytotoxicity and potential for DNA and siRNA delivery. In this study, we evaluated the cytotoxicity and cell-compatibility of different PEGylated PEI polymers in two murine lung cell lines. We found that the degree of PEGylation correlated with both cytotoxicity and oxidative stress, but not with proinflammatory effects. AB type copolymers with long PEG blocks caused high membrane damage and significantly decreased the metabolic activity of lung cells. In addition, they significantly increased the release of two lipid mediators such as 8-isoprostanes (8-IP) and prostaglandin E(2) (PGE(2)) in a dose-dependent manner. In contrast, the cytokine profiles which indicated high levels of acute-phase cytokines such as TNF-alpha, IL-6, and G-CSF did not follow any clear structure-function relationship. In conclusion, we found that modification of PEI 25 kDa with high degree of PEGylation and low PEG chain length reduced cytotoxic and oxidative stress response in lung cells, while the proinflammatory potential remained unaffected. A degree of substitution in the range of 10 to 30 and PEG-chain lengths up to 2000 Da seem to be beneficial and merit further investigations.

  16. Amphiphilic, low molecular weight poly(ethylene imine) derivatives with enhanced stability for efficient pulmonary gene delivery.

    Science.gov (United States)

    Roesler, Susanne; Koch, Felix P V; Schmehl, Thomas; Weissmann, Norbert; Seeger, Werner; Gessler, Tobias; Kissel, Thomas

    2011-02-01

    Poly(ethylene imine) (PEI) is a widely used transfection reagent for mammalian cells, but in vivo application of PEI 25 kDa is restricted by its toxicity. Low molecular weight (LMW) PEI is less toxic, but also less efficient than its high molecular weight equivalent, and prone to aggregation. A set of polymers was synthesized by coupling poly(ethylene glycol) (PEG) that contained either C(16/18) -chains (Cx-EO) or butyl-poly(propylene oxide)-co-poly(ethylene glycol) (ButPP). Critical micelle concentration (CMC) was determined for copolymers. Polyplexes were characterized by DNA binding ability, polyplex size and aggregation, hemolysis, and cytotoxicity. Transfection efficiency was tested in vitro and in vivo in mouse lungs. Copolymers formed stable complexes with DNA, and showed enhanced complex stability in isotonic solution for at least 1 h. CMC was determined for Cx-EO-PEI 4.7 and 8.3 at 0.0019 and 0.0037 mM, respectively; membrane activity in a haemolysis assay was demonstrated for ButPP-PEI: both factors possibly enhance endosomal escape effect after PEGylation. IC(50) values of all synthesized polymers were in the range 6-33 ng/ml. Transfection efficiency of unmodified LMW-PEIs was equivalent or better than that of PEI 25 as a result of aggregation in vitro. Cells treated with polyplexes of amphiphilic polymers showed reduced transfection compared to PEI 25. After instillation in mouse lungs, highest transfection efficiency was demonstrated with Cx-EO copolymer of lowest molecular weight PEI. A new set of polymers with low toxicity and high stability was synthesized, which contains promising candidates for pulmonary gene transfer, as documented by in vivo experiments in mice. Copyright © 2011 John Wiley & Sons, Ltd.

  17. Ionic Conductivity and Potential Application for Fuel Cell of a Modified Imine-Based Covalent Organic Framework.

    Science.gov (United States)

    Montoro, Carmen; Rodríguez-San-Miguel, David; Polo, Eduardo; Escudero-Cid, Ricardo; Ruiz-González, Maria Luisa; Navarro, Jorge A R; Ocón, Pilar; Zamora, Félix

    2017-07-26

    We present the novel potential application of imine-based covalent organic frameworks (COFs), formed by the direct Schiff reaction between 1,3,5-tris(4-aminophenyl)benzene and 1,3,5-benzenetricarbaldehyde building blocks in m-cresol or acetic acid, named RT-COF-1 or RT-COF-1Ac/RT-COF-1AcB. The post-synthetic treatment of RT-COF-1 with LiCl leads to the formation of LiCl@RT-COF-1. The ionic conductivity of this series of polyimine COFs has been characterized at variable temperature and humidity, using electrochemical impedance spectroscopy. LiCl@RT-COF-1 exhibits a conductivity value of 6.45 × 10(-3) S cm(-1) (at 313 K and 100% relative humidity) which is among the highest values so far reported in proton conduction for COFs. The mechanism of conduction has been determined using (1)H and (7)Li solid-state nuclear magnetic resonance spectroscopy. Interestingly, these materials, in the presence of controlled amounts of acetic acid and under pressure, show a remarkable processability that gives rise to quasi-transparent and flexible films showing in-plane structural order as confirmed by X-ray crystallography. Finally, we prove that these films are useful for the construction of proton exchange membrane fuel cells (PEMFC) reaching values up to 12.95 mW cm(-2) and 53.1 mA cm(-2) for maximum power and current density at 323 K, respectively.

  18. Sugar-Modified Poly(propylene imine) Dendrimers Stimulate the NF-κB Pathway in a Myeloid Cell Line.

    Science.gov (United States)

    Jatczak-Pawlik, Izabela; Gorzkiewicz, Michal; Studzian, Maciej; Appelhans, Dietmar; Voit, Brigitte; Pulaski, Lukasz; Klajnert-Maculewicz, Barbara

    2017-01-01

    Fourth-generation poly(propylene imine) dendrimers fully surface-modified by maltose (dense shell, PPI-m DS) were shown to be biocompatible in cellular models, which is important for their application in drug delivery. We decided to verify also their inherent bioactivity, including immunomodulatory activity, for potential clinical applications. We tested their effects on the THP-1 monocytic cell line model of innate immunity effectors. To estimate the cytotoxicity of dendrimers the reasazurin assay was performed. The expression level of NF-κB targets: IGFBP3, TNFAIP3 and TNF was determined by quantitative real-time RT-PCR. Measurement of NF-κB p65 translocation from cytoplasm to nucleus was conducted with a high-content screening platform and binding of NF-κB to a consensus DNA probe was determined by electrophoretic mobility shift assay. The cytokine assay was performed to measure protein concentration of TNFalpha and IL-4. We found that PPI-m DS did not impact THP-1 viability and growth even at high concentrations (up to 100 μM). They also did not induce expression of genes for important signaling pathways: Jak/STAT, Keap1/Nrf2 and ER stress. However, high concentrations of 4th generation PPI-m DS (25-100 μM), but not their 3rd generation counterparts, induced nuclear translocation of p65 NF-κB protein and its DNA-binding activity, leading to NF-κB-dependent increased expression of mRNA for NF-κB targets: IGFBP3, TNFAIP3 and TNF. However, no increase in pro-inflammatory cytokine secretion was detected. We conclude that maltose-modified PPI dendrimers of specific size could exert a modest immunomodulatory effect, which may be advantageous in clinical applications (e.g. adjuvant effect in anti-cancer vaccines).

  19. The synthesis of boronic-imine structured compounds and identification of their anticancer, antimicrobial and antioxidant activities

    Directory of Open Access Journals (Sweden)

    Salih Pasa

    2016-02-01

    Full Text Available Boronic acid compounds with different substituted groups were handled to synthesize various ligands encoded as B1, B2, B3, B4, B5, B6, B7 and B8. B5 and B7 were tested for the cytotoxic activity against the prostate cancer cells and it was found that the cell viability of cancer cells was decreased while most of the healthy cells could still be viable. 5 µM solutions of B5 and B7 decreased the cell viability to 33% and 44% whereas healthy cells were 71% and 95%, respectively, after treatment. Antimicrobial properties were explored against the bacterial and fungal microorganisms with B1, B5 and B7. The inhibition zones were evaluated for all boronic structures, and the growth inhibition zones were determined in a range of 7–13 mm diameter for different microorganism species. Staphylococcus aureus was the common microorganism that three boronic compounds with imine ligands showed the activity. Antioxidant features of B2, B3, B4, B5, B6, B7 and B8 were investigated by different processes such as Beta-carotene bleaching (BCB, 2,2-diphenyl picryl hydrazyl (DPPH, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid (ABTS and CUPric reducing antioxidant capacity (CUPRAC methods. Significant antioxidant activity was achieved by the phenyl boronic based ligands and these compounds demonstrated as much activity as standards (α-Toc and BHT. In addition, all structures were applied properly without any decomposition during the experiments. They were rather stable both in aqueous media and solid state.

  20. Synthesis and plant-growth regulatory activities of novel imine derivatives containing 1H-1,2,4-triazole and thiazole rings

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Eleven new imine derivatives 6 containing 1H-1,2,4-triazole and thiazole rings were synthesized by the condensation of 5-((1H- 1,2,4-triazol-1-yl)methyl)-4-tert-butylthiazol-2-amine with various substituted benzaldehydes.The structures of the title compounds were characterized by ~1H NMR,MS and elemental analysis.The plant-growth regulatory activities of these compounds were evaluated.The primary bioassay results indicated that these target compounds exhibited promising plant-growth regulatory activities...

  1. Highly enantioselective hydrogenation of N-aryl imines derived from acetophenones by using Ru-pybox complexes under hydrogenation or transfer hydrogenation conditions in isopropanol.

    Science.gov (United States)

    Menéndez-Pedregal, Estefanía; Vaquero, Mónica; Lastra, Elena; Gamasa, Pilar; Pizzano, Antonio

    2015-01-07

    The asymmetric reduction of N-aryl imines derived from acetophenones by using Ru complexes bearing both a pybox (2,6-bis(oxazoline)pyridine) and a monodentate phosphite ligand has been described. The catalysts show good activity with a diverse range of substrates, and deliver the amine products in very high levels of enantioselectivity (up to 99 %) under both hydrogenation and transfer hydrogenation conditions in isopropanol. From deuteration studies, a very different labeling is observed under hydrogenation and transfer hydrogenation conditions, which demonstrates the different nature of the hydrogen source in both reactions.

  2. Diastereoselective synthesis of potent antimalarial cis-β-lactam agents through a [2 + 2] cycloaddition of chiral imines with a chiral ketene.

    Science.gov (United States)

    Jarrahpour, Aliasghar; Ebrahimi, Edris; Sinou, Véronique; Latour, Christine; Brunel, Jean Michel

    2014-11-24

    The effect of double asymmetric induction for the synthesis of new cis-β-lactams by [2 + 2] cycloaddition reactions of chiral imines with a chiral ketene was investigated. The cycloaddition reaction was found to be totally diastereoselective leading exclusively to the formation of the cis-β-lactam derivatives. The newly synthesized cycloadducts were evaluated for their antimalarial activities against Plasmodium falciparum K14 resistant strain with moderate to excellent IC50 values varying from 8 to 50 μM. Of the fifteen β-lactams tested, four showed IC50 ≤ 11 μM. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  3. Tethered ansa-bridged titanium complexes immobilized on 3-mercaptopropyl-functionalized silica gel and their application for the hydrosilylation of imines.

    Science.gov (United States)

    Gruber-Woelfler, Heidrun; Lichtenegger, Georg J; Neubauer, Christoph; Polo, Eleonora; Khinast, Johannes G

    2012-11-07

    Four tethered titanocene complexes were covalently immobilized onto 3-mercaptopropyl-functionalized silica gel. We have investigated the influence of the length of the tether and of the ansa-bridge on the activity in the heterogeneous hydrosilylation of the cyclic imine 2-phenylpyrroline, taken as an illustrative example. Possible metal leaching during the reaction was investigated using ICP/OES, recycling studies and the three-phase test. The novel immobilized catalysts exhibit an activity similar to their homogeneous analogues in the tested hydrosilylation reactions with a TOF of ~20 h(-1). Furthermore, our results indicate that metal leaching is negligible under the applied reaction conditions.

  4. EMR searching of quantum behavior of magnetic γ-Fe2O3 nanoparticles encapsulated into poly(propylene imine dendrimer

    Directory of Open Access Journals (Sweden)

    Vorobeva V.E., Domracheva N.E., Gruzdev M.S.

    2016-12-01

    Full Text Available The superparamagnetic γ-Fe2O3 nanoparticles (average diameter of 2.5 nm encapsulated in poly(propylene imine dendrimer have been investigated by electron magnetic resonance (EMR. EMR measurements have been recorded in perpendicular and parallel configurations in the wide temperature range (4.2-300 K. It has been shown that the model based on the spin value S = 30, corresponding to the total magnetic moment of the nanoparticle, can be used to interpret the experimental results and the proof of the quantum behavior of γ-Fe2O3 nanoparticles.

  5. One-pot synthesis of imines from nitroaromatics and alcohols by tandem photocatalytic and catalytic reactions on Degussa (Evonik) P25 titanium dioxide.

    Science.gov (United States)

    Hirakawa, Hiroaki; Katayama, Miyu; Shiraishi, Yasuhiro; Sakamoto, Hirokatsu; Wang, Kunlei; Ohtani, Bunsho; Ichikawa, Satoshi; Tanaka, Shunsuke; Hirai, Takayuki

    2015-02-18

    Photoirradiation (λ > 300 nm) of Degussa (Evonik) P25 TiO2, a mixture of anatase and rutile particles, in alcohols containing nitroaromatics at room temperature produces the corresponding imines with very high yields (80-96%). Other commercially available anatase or rutile TiO2 particles, however, exhibit very low yields (anatase and rutile particles were isolated from P25 TiO2 by the H2O2/NH3 and HF treatments to clarify the activity of these two step reactions. Photocatalysis experiments revealed that the active sites for photocatalytic reactions on P25 TiO2 are the rutile particles, promoting efficient reduction of nitrobenzene on the surface defects. In contrast, catalysis experiments showed that the anatase particles isolated from P25 TiO2 exhibit very high activity for condensation of aldehyde and aniline, because the number of Lewis acid sites on the particles (73 μmol g(-1)) is much higher than that of other commercially available anatase or rutile particles (rutile and anatase particles, thus producing imines with very high yields.

  6. Ortho-hydroxyl effect and proton transfer via ion-neutral complex: the fragmentation study of protonated imine resveratrol analogues in mass spectrometry.

    Science.gov (United States)

    Yue, Lei; Li, Jing; Xie, Xiaodong; Guo, Cheng; Yin, Xinchi; Yin, Qi; Chen, Yinjuan; Pan, Yuanjiang; Ding, Chuanfan

    2016-07-01

    The fragmentation pathways of protonated imine resveratrol analogues in the gas-phase were investigated by electrospray ionization-tandem mass spectrometry. Benzyl cations were formed in the imine resveratrol analogues that had an ortho-hydroxyl group on the benzene ring A. The specific elimination of the quinomethane neutral, CH2  = C6 H4  = O, from the two isomeric ions [M1 + H](+) and [M3 + H](+) via the corresponding ion-neutral complexes was observed. The fragmentation pathway for the related meta-isomer, ion [M2 + H](+) and the other congeners was not observed. Accurate mass measurements and additional experiments carried out with a chlorinated analogue and the trideuterated isotopolog of M1 supported the overall interpretation of the fragmentation phenomena observed. It is very helpful for understanding the intriguing roles of ortho-hydroxyl effect and ion-neutral complexes in fragmentation reactions and enriching the knowledge of the gas-phase chemistry of the benzyl cation. Copyright © 2016 John Wiley & Sons, Ltd.

  7. Structure-activity relationship study of pyrimido[1,2-c][1,3]benzothiazin-6-imine derivatives for potent anti-HIV agents.

    Science.gov (United States)

    Mizuhara, Tsukasa; Oishi, Shinya; Ohno, Hiroaki; Shimura, Kazuya; Matsuoka, Masao; Fujii, Nobutaka

    2012-11-01

    3,4-Dihydro-2H,6H-pyrimido[1,2-c][1,3]benzothiazin-6-imine (PD 404182) is an antiretroviral agent with submicromolar inhibitory activity against human immunodeficiency virus-1 (HIV-1) and HIV-2 infection. In the current study, the structure-activity relationships of accessory groups at the 3- and 9-positions of pyrimido[1,2-c][1,3]benzothiazin-6-imine were investigated for the development of more potent anti-HIV agents. Several different derivatives containing a 9-aryl group were designed and synthesized using Suzuki-Miyaura cross-coupling and Ullmann coupling reactions. Modification of the m-methoxyphenyl or benzo[d][1,3]dioxol-5-yl group resulted in improved anti-HIV activity. In addition, the 2,4-diazaspiro[5.5]undec-2-ene-fused benzo[e][1,3]thiazine derivatives were designed and tested for their anti-HIV activities. The most potent 9-(benzo[d][1,3]dioxol-5-yl) derivative was two-threefold more effective against several strains of HIV-1 and HIV-2 than the parent compound, PD 404182. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Functionalized SBA-15 supported nickel (II)–oxime–imine catalysts for liquid phase oxidation of olefins under solvent-free conditions

    Energy Technology Data Exchange (ETDEWEB)

    Paul, Luna [Department of Chemistry, Jadavpur University, Kolkata 700 032 (India); Banerjee, Biplab [Department of Materials Science, Indian Association for the Cultivation of Science, Jadavpur, Kolkata 700 032 (India); Bhaumik, Asim, E-mail: msab@iacs.res.in [Department of Materials Science, Indian Association for the Cultivation of Science, Jadavpur, Kolkata 700 032 (India); Ali, Mahammad, E-mail: m_ali2062@yahoo.com [Department of Chemistry, Jadavpur University, Kolkata 700 032 (India)

    2016-05-15

    A new oxime–imine functionalized highly ordered mesoporous SBA-15 (SBA-15-NH{sub 2}-DAMO) has been synthesized via post-synthesis functionalization of SBA-15 with 3-aminopropyl-triethoxysilane followed by the Schiff base condensation with diacetylmonooxime, which was further reacted with Ni(ClO{sub 4}){sub 2} to yield the functionalized nickel catalyst SBA-15-NH{sub 2}-DAMO-Ni. All the synthesized materials were thoroughly characterized using different characterization techniques. It was found that SBA-15-NH{sub 2}-DAMO-Ni catalyzes the one-pot oxidation of olefins like styrene, cyclohexene, cyclooctene, 1-hexene and 1-octene to the corresponding benzaldehyde, cyclohexene-1-ol and cyclooctene-oxide, respectively under solvent-free conditions by using tert-butylhydroperoxide as oxidant. - Graphical abstract: A new well characterized oxime–imine functionalized highly ordered mesoporous SBA-15-NH{sub 2}-DAMO-Ni complex catalyzes the one-pot oxidation of olefins under solvent free mild conditions.

  9. Synthesis, vibrational spectral and nonlinear optical studies of N-(4-hydroxy-phenyl)-2-hydroxybenzaldehyde-imine: A combined experimental and theoretical investigation

    Science.gov (United States)

    Wang, Yufeng; Yu, Zongxue; Sun, Yuxi; Wang, Yishi; Lu, Lude

    2011-09-01

    The study of imine-bridged organics has been the one hot spot of photo-responsive material sciences in recent years. Herein we make a study of the synthesis, characteristics and potential application of N-(4-hydroxy-phenyl)-2-hydroxy-benzaldehyde-imine (HPHBI), C 13H 11NO 2. The studied compound was synthesized in one step by the condensation reaction of salicylaldehyde and 4-aminophenol in methanol solution, and characterized by single crystal X-ray diffraction, FT-IR and FT-Raman techniques with theoretical calculations at B3LYP/6-31G(d) level. The molecule adopts trans configuration about central C dbnd6 N bond with intramolecular hydrogen bonding, and the adjacent molecules form wave-shaped structure linked by strong intermolecular hydrogen bonding mechanism along b axis. The vibrational spectra have been precisely assigned with the aid of theoretical frequencies. Furthermore, the thermodynamic properties have been obtained by the theoretical vibrational analysis for HPHBI. The total linear polarizability and first-order hyperpolarizabilities calculated on the studied compound respectively present 25.378 Å 3 and 1.655 × 10 -29 cm 5/esu, which indicates the compound has relatively good nonlinear optical property.

  10. Delivery of messenger RNA using poly(ethylene imine)-poly(ethylene glycol)-copolymer blends for polyplex formation: biophysical characterization and in vitro transfection properties.

    Science.gov (United States)

    Debus, Heiko; Baumhof, Patrick; Probst, Jochen; Kissel, Thomas

    2010-12-20

    Nucleic acid based therapies have so far mainly been focused on plasmid DNA (pDNA), small interfering RNA (siRNA), antisense and immunostimulatory oligonucleotides. Messenger RNA (mRNA) was the subject of only a few studies. The objective of this investigation was the preparation of new composite polyplexes with mRNA consisting of poly(ethylene imine) (PEI) and poly(ethylene imine)-poly(ethylene glycol)-copolymers (PEI-PEG) as blends. These complexes were designed to increase the stability of mRNA, to improve transfection efficiency and to reduce cytotoxicity. Hydrodynamic diameters of the polyplexes were measured by dynamic light scattering, polyplex stability was analyzed by gel retardation assay and transfection efficiency of luciferase (Luc) encoding mRNA was evaluated under in vitro conditions. Most of the polyplexes generated showed small particle sizes application of mRNA merit further investigation under in vitro and in vivo conditions. Copyright © 2010 Elsevier B.V. All rights reserved.

  11. Opportunities Offered by Chiral η6-Arene/N-Arylsulfonyl-diamine-RuII Catalysts in the Asymmetric Transfer Hydrogenation of Ketones and Imines

    Directory of Open Access Journals (Sweden)

    Libor Červený

    2011-06-01

    Full Text Available Methods for the asymmetric transfer hydrogenation (ATH of ketones and imines are still being intensively studied and developed. Of foremost interest is the use of Noyori’s [RuCl(η6-arene(N-TsDPEN] complexes in the presence of a hydrogen donor (i-PrOH, formic acid. These complexes have found numerous practical applications and have been extensively modified. The resulting derivatives have been heterogenized, used in ATH in water or ionic liquids and even some attempts have been made to approach the properties of biocatalysts. Therefore, an appropriate modification of the catalyst that suits the specific requirements for the reaction conditions is very often readily available. The mechanism of the reaction has also been explored to a great extent. Model substrates, acetophenone (a ketone and 6,7-dimethoxy-1-methyl-3,4-dihydroisoquinoline (an imine, are both reduced by this Ru catalytic system with almost perfect selectivity. However, in each case the major product is a different enantiomer (S- for an alcohol, R- for an amine when the S,S-catalyst is used, which demanded an in-depth mechanistic investigation. Full-scale molecular modelling of this system enabled us to visualize the plausible 3D structures of the transition states, allowing the proposition of a viable explanation of previous experimental findings.

  12. Poly-cross-linked PEI through aromatically conjugated imine linkages as a new class of pH-responsive nucleic acids packing cationic polymers

    Directory of Open Access Journals (Sweden)

    Shun eChen

    2016-02-01

    Full Text Available Cationic polyimines polymerized through aromatically conjugated bis-imine linkages and intra-molecular cross-linking were found to be a new class of effective transfection materials for their flexibility in structural optimization, responsiveness to intracellular environment, the ability to facilitate endosome escape and cytosol release of the nucleic acids, as well as self-metabolism. When three phthalaldehydes of different substitution positions were used to polymerize highly branched low molecular weight polyethylenimine (PEI-1.8K, the product through ortho-phthalimines (named PPOP showed significantly higher transfection activity than its two tere- and iso-analogues (named PPTP and PPIP. Physicochemical characterization confirmed the similarity of three polyimines in pH-responded degradability, buffer capacity, as well as the size and Zeta potential of the polyplexes formed from the polymers. A mechanistic speculation may be that the ortho-positioned bis-imine linkage of PPOP may only lead to the straight trans-configuration due to steric hindrance, resulting in larger loops of intra-polymer cross-linking and more flexible backbone.

  13. Crystal structures of three mercury(II complexes [HgCl2L] where L is a bidentate chiral imine ligand

    Directory of Open Access Journals (Sweden)

    Guadalupe Hernández

    2015-12-01

    Full Text Available The crystal structures of three complexes [HgCl2L] were determined, namely, (S-(+-dichlorido[1-phenyl-N-(pyridin-2-ylmethylideneethylamine-κ2N,N′]mercury(II, [HgCl2(C14H14N2], (S-(+-dichlorido[1-(4-methylphenyl-N-(pyridin-2-ylmethylideneethylamine-κ2N,N′]mercury(II, [HgCl2(C15H16N2], and (1S,2S,3S,5R-(+-dichlorido[N-(pyridin-2-ylmethylideneisopinocampheylamine-κ2N,N′]mercury(II, [HgCl2(C16H22N2]. The complexes consist of a bidentate chiral imine ligand coordinating to HgCl2 and crystallize with four independent molecules in the first complex and two independent molecules in the other two. The coordination geometry of mercury is tetrahedral, with strong distortion towards a disphenoidal geometry, as a consequence of the imine bite angle being close to 70°. The Cl—Hg—Cl angles span a large range, 116.0 (2–138.3 (3°, which is related to the aggregation state in the crystals. For small Cl—Hg—Cl angles, complexes have a tendency to form dimers, via intermolecular Hg...Cl contacts. These contacts become less significant in the third complex, which features the largest intramolecular Cl—Hg—Cl angles.

  14. Doxorubicin-loaded aromatic imine-contained amphiphilic branched star polymer micelles: synthesis, self-assembly, and drug delivery

    Directory of Open Access Journals (Sweden)

    Qiu L

    2015-05-01

    Full Text Available Liang Qiu, Chun-Yan Hong, Cai-Yuan Pan Chinese Academy of Sciences Key Laboratory of Soft Matter Chemistry, Department of Polymer Science and Engineering, University of Science and Technology of China, Hefei, Anhui, People’s Republic of China Abstract: Redox- and pH-sensitive branched star polymers (BSPs, BP(DMAEMA-co-MAEBA-co-DTDMA(PMAIGPns, have been successively prepared by two steps of reversible addition–fragmentation chain transfer (RAFT polymerization. The first step is RAFT polymerization of 2-(N,N-dimethylaminoethylmethacrylate (DMAEMA and p-(methacryloxyethoxybenzaldehyde (MAEBA in the presence of divinyl monomer, 2,2'-dithiodiethoxyl dimethacrylate (DTDMA. The resultant branched polymers were used as a macro-RAFT agent in the subsequent RAFT polymerization. After hydrolysis of the BSPs to form BP(DMAEMA-co-MAEBA-co-DTDMA(PMAGPns (BSP-H, the anticancer drug doxorubicin (DOX was covalently linked to branched polymer chains by reaction of primary amine of DOX and aldehyde groups in the polymer chains. Their compositions, structures, molecular weights, and molecular weight distributions were respectively characterized by nuclear magnetic resonance spectra and gel permeation chromatography measurements. The DOX-loaded micelles were fabricated by self-assembly of DOX-containing BSPs in water, which were characterized by transmission electron microscopy and dynamic light scattering. Aromatic imine linkage is stable in neutral water, but is acid-labile; controlled release of DOX from the BSP-H-DOX micelles was realized at pH values of 5 and 6, and at higher acidic solution, fast release of DOX was observed. In vitro cytotoxicity experiment results revealed low cytotoxicity of the BSPs and release of DOX from micelles in HepG2 and HeLa cells. Confocal laser fluorescence microscopy observations showed that DOX-loaded micelles have specific interaction with HepG2 cells. Thus, this type of BSP micelle is an efficient drug delivery system

  15. Diversity-oriented approach to 1,2-dihydroisoquinolin-3(4H)-imines via copper(I)-catalyzed reaction of (E)-2-ethynylphenylchalcone, sulfonyl azide and amine.

    Science.gov (United States)

    Chen, Zhiyuan; Ye, Chao; Gao, Liang; Wu, Jie

    2011-05-21

    A three-component reaction of (E)-2-ethynylphenylchalcone, sulfonyl azide, and amine catalyzed by copper(I) chloride (5 mol%), in the presence of triethylamine, under mild conditions is described. This transformation proceeds efficiently to generate 1,2-dihydroisoquinolin-3(4H)-imines in good to excellent yields. © The Royal Society of Chemistry 2011

  16. Electrostatic immobilisation of copper(I) and copper(II) bis(oxazolinyl)pyridine catalysts on silica: application to the synthesis of propargylamines via direct addition of terminal alkynes to imines

    NARCIS (Netherlands)

    McDonagh, C.; O'Conghaile, P.; Klein Gebbink, R.J.M.; O'Leary, P.F.

    2007-01-01

    Copper(I) and copper(II) complexes of two bis(oxazolinyl)pyridines were immobilized on silica via electrostatic interactions. The catalytic activity of the immobilized catalysts in the direct addition of terminal alkynes to imines leading to propargylamines was investigated under a variety of reacti

  17. Useful dual Diels-Alder behavior of 2-azetidinone-tethered aryl imines as azadienophiles or azadienes: a beta-lactam-based stereocontrolled access to optically pure highly functionalized indolizidine systems.

    Science.gov (United States)

    Alcaide, Benito; Almendros, Pedro; Alonso, Jose M; Aly, Moustafa F

    2003-07-21

    Imines derived from 4-oxoazetidine-2-carbaldehydes have been found to be versatile Diels-Alder reagents in that they exhibit two reactivity patterns. 2-Azetidinone-tethered imines undergo diastereoselective reaction with Danishefsky's diene in the presence of different Lewis acids. The effect of the amount of catalyst on the conversion rate as well as on the product ratio has been studied. Under standard reaction conditions, indium(III) chloride and zinc(II) iodide provided the best yields, and indium(III) triflate the highest diastereoselectivity in the Lewis acid promoted aza-Diels-Alder cycloaddition. Treatment of the aforementioned imines with cyclopentadiene, 2,3-dimethyl-1,3-butadiene or 3,4-dihydro-2 H-pyran led to cycloadducts arising from inverse electron-demand condensation involving the beta-lactam-tethered aryl imine as the heterodiene component. In addition, the first methodology for preparing indolizidines from beta-lactams has been developed. This process involves amide bond cleavage of the beta-lactam ring in the aza-Diels-Alder cycloadducts with concomitant cyclization. Full chirality transfer occurs when the reaction is performed with an enantiomerically pure substrate.

  18. Regenerable solid imine sorbents

    Science.gov (United States)

    Gray, McMahan; Champagne, Kenneth J.; Fauth, Daniel; Beckman, Eric

    2013-09-10

    Two new classes of amine-based sorbents are disclosed. The first class comprises new polymer-immobilized tertiary amine sorbents; the second class new polymer-bound amine sorbents. Both classes are tailored to facilitate removal of acid anhydrides, especially carbon dioxide (CO.sub.2), from effluent gases. The amines adsorb acid anhydrides in a 1:1 molar ratio. Both classes of amine sorbents adsorb in the temperature range from about 20.degree. C. upwards to 90.degree. C. and can be regenerated by heating upwards to 100.degree. C.

  19. Enhanced visible-light photocatalytic activity for selective oxidation of amines into imines over TiO{sub 2}(B)/anatase mixed-phase nanowires

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Jun [Institute of Applied Chemistry, Henan Polytechnic University, Jiaozuo 454003 (China); State Key Laboratory Cultivation Base for Gas Geology and Gas Control, School of Safety Science and Engineering, Henan Polytechnic University, Jiaozuo 454003 (China); Yang, Juan, E-mail: yangjuanhpu@yahoo.com [Institute of Applied Chemistry, Henan Polytechnic University, Jiaozuo 454003 (China); Wang, Xiaohan; Zhang, Lei; Li, Yingjie [Institute of Applied Chemistry, Henan Polytechnic University, Jiaozuo 454003 (China)

    2015-09-15

    Graphical abstract: Visible-light photocatalytic activities for selective oxidation of amines into imines are greatly affected by the crystal structure of TiO{sub 2} catalysts and mixed-phase TiO{sub 2}(B)/anatase possess higher photoactivity because of the moderate adsorption ability and efficient charge separation. - Highlights: • Visible-light photocatalytic oxidation of amines to imines is studied over different TiO{sub 2}. • Photocatalytic activities are greatly affected by the crystal structure of TiO{sub 2} nanowires. • Mixed-phase TiO{sub 2}(B)/anatase exhibits higher catalytic activity than single-phase TiO{sub 2}. • Enhanced activity is ascribed to efficient adsorption ability and interfacial charge separation. • Photoinduced charge transfer mechanism on TiO{sub 2}(B)/anatase catalysts is also proposed. - Abstract: Wirelike catalysts of mixed-phase TiO{sub 2}(B)/anatase TiO{sub 2}, bare anatase TiO{sub 2} and TiO{sub 2}(B) are synthesized via calcining precursor hydrogen titanate obtained from hydrothermal process at different temperatures between 450 and 700 °C. Under visible light irradiation, mixed-phase TiO{sub 2}(B)/anatase TiO{sub 2} catalysts exhibit enhanced photocatalytic activity in comparison with pure TiO{sub 2}(B) and anatase TiO{sub 2} toward selective oxidation of benzylamines into imines and the highest photocatalytic activity is achieved by TW-550 sample consisting of 65% TiO{sub 2}(B) and 35% anatase. The difference in photocatalytic activities of TiO{sub 2} samples can be attributed to the different adsorption abilities resulted from their crystal structures and interfacial charge separation driven by surface-phase junctions between TiO{sub 2}(B) and anatase TiO{sub 2}. Moreover, the photoinduced charge transfer mechanism of surface complex is also proposed over mixed-phase TiO{sub 2}(B)/anatase TiO{sub 2} catalysts. Advantages of this photocatalytic system include efficient utilization of solar light, general suitability to

  20. Enantioselective 1,3-dipolar cycloaddition of C,N-cyclic azomethine imines to unsaturated nitriles catalyzed by NiII-Pigiphos.

    Science.gov (United States)

    Milosevic, Sandra; Togni, Antonio

    2013-10-04

    The asymmetric 1,3-dipolar cycloaddition reaction of C,N-cyclic azomethine imines with small unsaturated nitriles using a dicationic Ni(II) complex containing the chiral triphosphine ligand bis{(R)-1-[(Sp)-2-(diphenylphosphino)ferrocenyl]ethyl}cyclohexylphosphine [(R,Sp)-Pigiphos] as a catalyst has been developed. A variety of new chiral cyanopyrazolidines were obtained regio- and diastereoselectively in good to excellent yields with moderate to excellent enantioselectivities. Thus, N-benzoylimino-3,4-dihydro-6-methylisoquinolinium betaine (1a) reacts at RT with acrylonitrile in the presence of 1-5 mol % catalyst to afford 3,4-trans-1-benzoyl-4-cyano-2,3-(tetrahydroisoquinoline)tetrahydropyrazole (2a) in up to 84% yield and 98% ee. The regio- and stereoselectivity were confirmed in the case of compound 2a and 3,4-trans-1-benzoyl-4-cyano-2,3-(6-bromotetrahydroisoquinoline)tetrahydropyrazole (2e) by X-ray crystallography.

  1. Functionalized SBA-15 supported nickel (II)-oxime-imine catalysts for liquid phase oxidation of olefins under solvent-free conditions

    Science.gov (United States)

    Paul, Luna; Banerjee, Biplab; Bhaumik, Asim; Ali, Mahammad

    2016-05-01

    A new oxime-imine functionalized highly ordered mesoporous SBA-15 (SBA-15-NH2-DAMO) has been synthesized via post-synthesis functionalization of SBA-15 with 3-aminopropyl-triethoxysilane followed by the Schiff base condensation with diacetylmonooxime, which was further reacted with Ni(ClO4)2 to yield the functionalized nickel catalyst SBA-15-NH2-DAMO-Ni. All the synthesized materials were thoroughly characterized using different characterization techniques. It was found that SBA-15-NH2-DAMO-Ni catalyzes the one-pot oxidation of olefins like styrene, cyclohexene, cyclooctene, 1-hexene and 1-octene to the corresponding benzaldehyde, cyclohexene-1-ol and cyclooctene-oxide, respectively under solvent-free conditions by using tert-butylhydroperoxide as oxidant.

  2. Ni(II)-NTA modified poly(ethylene imine) glycopolymers: physicochemical properties and first in vitro study of polyplexes formed with HIV-derived peptides.

    Science.gov (United States)

    Hauptmann, Nicole; Pion, Marjorie; Muñoz-Fernández, María-Ángeles; Komber, Hartmut; Werner, Carsten; Voit, Brigitte; Appelhans, Dietmar

    2013-05-01

    Alternative delivery entities are desirable in immunotherapies in which polyplexes are widely formed by electrostatic interactions to induce cellular uptake processes for bioactive molecules. In our study, biocompatible Ni(II)-nitrilo(triacetic acid)-modified poly(ethylene imine)-maltose (Ni-NTA-DG) is realized and evaluated as complexation agent against His-tagged peptides using fluorescence polarization and dynamic light scattering. The polyplexes are stable until a pH of 6.5-6.0, and also up to 50 mM of imidazole. A first uptake approach shows that polyplexes lead to an increase in peptide uptake in monocyte-derived immature dendritic cells. In summary, Ni-NTA-DG represents a promising (delivery) platform for forthcoming in vitro applications. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Dual Heterogeneous Catalyst Pd-Au@Mn(II)-MOF for One-Pot Tandem Synthesis of Imines from Alcohols and Amines.

    Science.gov (United States)

    Chen, Gong-Jun; Ma, Hui-Chao; Xin, Wen-Ling; Li, Xiao-Bo; Jin, Fa-Zheng; Wang, Jing-Si; Liu, Ming-Yang; Dong, Yu-Bin

    2017-01-03

    A new Mn(II) metal-organic framework (MOF) 1 was synthesized by the combination of 4,4,4-trifluoro-1-(4-(pyridin-4-yl)phenyl)butane-1,3-dione (L) and Mn(OAc)2 in solution. 1 features a threefold-interpenetrating NbO net containing honeycomb-like channels, in which the opposite Mn(II)···Mn(II) distance is 23.5075(10) Å. Furthermore, 1 can be an ideal platform to support Pd-Au bimetallic alloy nanoparticles to generate a composite catalytic system of Pd-Au@Mn(II)-MOF (2). 2 can be a highly active bifunctional heterogeneous catalyst for the one-pot tandem synthesis of imines from benzyl alcohols and anilines and from benzyl alcohols and benzylamines.

  4. Detecting a quasi-stable imine species on the reaction pathway of SHV-1 β-lactamase and 6β-(hydroxymethyl)penicillanic acid sulfone.

    Science.gov (United States)

    Che, Tao; Rodkey, Elizabeth A; Bethel, Christopher R; Shanmugam, Sivaprakash; Ding, Zhe; Pusztai-Carey, Marianne; Nottingham, Michael; Chai, Weirui; Buynak, John D; Bonomo, Robert A; van den Akker, Focco; Carey, Paul R

    2015-01-27

    For the class A β-lactamase SHV-1, the kinetic and mechanistic properties of the clinically used inhibitor sulbactam are compared with the sulbactam analog substituted in its 6β position by a CH2OH group (6β-(hydroxymethyl)penicillanic acid). The 6β substitution improves both in vitro and microbiological inhibitory properties of sulbactam. Base hydrolysis of both compounds was studied by Raman and NMR spectroscopies and showed that lactam ring opening is followed by fragmentation of the dioxothiazolidine ring leading to formation of the iminium ion within 3 min. The iminium ion slowly loses a proton and converts to cis-enamine (which is a β-aminoacrylate) in 1 h for sulbactam and in 4 h for 6β-(hydroxymethyl) sulbactam. Rapid mix-rapid freeze Raman spectroscopy was used to follow the reactions between the two sulfones and SHV-1. Within 23 ms, a 10-fold excess of sulbactam was entirely hydrolyzed to give a cis-enamine product. In contrast, the 6β-(hydroxymethyl) sulbactam formed longer-lived acyl-enzyme intermediates that are a mixture of imine and enamines. Single crystal Raman studies, soaking in and washing out unreacted substrates, revealed stable populations of imine and trans-enamine acyl enzymes. The corresponding X-ray crystallographic data are consonant with the Raman data and also reveal the role played by the 6β-hydroxymethyl group in retarding hydrolysis of the acyl enzymes. The 6β-hydroxymethyl group sterically hinders approach of the water molecule as well as restraining the side chain of E166 that facilitates hydrolysis.

  5. Highly selective probe based on imine linkage for Zn{sup 2+} and HSO{sub 3}{sup −} in mixed aqueous media

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Kamaljot; Chaudhary, Savita; Singh, Sukhjinder; Mehta, S.K., E-mail: skmehta@pu.ac.in

    2015-04-15

    A simple salicylaldehyde derived Schiff base N, N′- bis (p-chloro salicylidene)-1, 2- ethylenediamine (L) was synthesized and characterized. The receptor demonstrates simultaneous dual channel chromogenic and fluorogenic signaling towards HSO{sub 3}{sup −} and Zn{sup 2+} in mixed aqueous media. Solvatochromism was employed systematically for modulating its optoelectronic properties. The probe was successfully assessed to monitor HSO{sub 3}{sup −} detection via UV–vis spectroscopy. DFT calculations and {sup 1}H NMR spectroscopy further support the results based on shifting of equilibrium. Moreover, the sensor showed large fluorescence enhancement with blue-shift of 48 nm after addition of Zn{sup 2+}. The probe exhibits high selectivity over other competitive ions with high detection limit of 6.54×10{sup −5} M and 3.21×10{sup −6} M for HSO{sub 3}{sup −} and Zn{sup 2+}, respectively. Importantly, this is one of the rare reports in which Schiff base was utilized for the fabrication of chromogenic or fluorogenic sensor using solvent effect for multianalyte detection. - Highlights: • Easy synthesis of highly selective and sensitive Salicylideneaniline moiety. • Solvatochromism induced tautomerism between the enol-imine and keto-amine forms. • Computational studies revealing the effect of solvent on stability of NH form. • Discriminative detection of HSO{sub 3}{sup −} and Zn{sup 2+} by different spectroscopic techniques. • Optical feedbacks as absorption transitions with HSO{sub 3}{sup −} on bisulphite adduct formation. • Fluorescence enhancement for Zn{sup 2+} based on imine binding mechanism.

  6. Acetaminophen analog N-acetyl-m-aminophenol, but not its reactive metabolite, N-acetyl-p-benzoquinone imine induces CYP3A activity via inhibition of protein degradation.

    Science.gov (United States)

    Santoh, Masataka; Sanoh, Seigo; Ohtsuki, Yuya; Ejiri, Yoko; Kotake, Yaichiro; Ohta, Shigeru

    2017-05-06

    Cytochrome P450 (CYP) 3A subfamily members are known to metabolize various types of drugs, highlighting the importance of understanding drug-drug interactions (DDI) depending on CYP3A induction or inhibition. While transcriptional regulation of CYP3A members is widely understood, post-translational regulation needs to be elucidated. We previously reported that acetaminophen (APAP) induces CYP3A activity via inhibition of protein degradation and proposed a novel DDI concept. N-Acetyl-p-benzoquinone imine (NAPQI), the reactive metabolite of APAP formed by CYP, is known to cause adverse events related to depletion of intracellular reduced glutathione (GSH). We aimed to inspect whether NAPQI rather than APAP itself could cause the inhibitory effects on protein degradation. We found that N-acetyl-l-cysteine, the precursor of GSH, and 1-aminobenzotriazole, a nonselective CYP inhibitor, had no effect on CYP3A1/23 protein levels affected by APAP. Thus, we used APAP analogs to test CYP3A1/23 mRNA levels, protein levels, and CYP3A activity. We found N-acetyl-m-aminophenol (AMAP), a regioisomer of APAP, has the same inhibitory effects of CYP3A1/23 protein degradation, while p-acetamidobenzoic acid (PAcBA), a carboxy-substituted form of APAP, shows no inhibitory effects. AMAP and PAcBA cannot be oxidized to quinone imine forms such as NAPQI, so the inhibitory effects could depend on the specific chemical structure of APAP. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Detecting a Quasi-stable Imine Species on the Reaction Pathway of SHV-1 β-Lactamase and 6β-(Hydroxymethyl)penicillanic Acid Sulfone

    Science.gov (United States)

    2015-01-01

    For the class A β-lactamase SHV-1, the kinetic and mechanistic properties of the clinically used inhibitor sulbactam are compared with the sulbactam analog substituted in its 6β position by a CH2OH group (6β-(hydroxymethyl)penicillanic acid). The 6β substitution improves both in vitro and microbiological inhibitory properties of sulbactam. Base hydrolysis of both compounds was studied by Raman and NMR spectroscopies and showed that lactam ring opening is followed by fragmentation of the dioxothiazolidine ring leading to formation of the iminium ion within 3 min. The iminium ion slowly loses a proton and converts to cis-enamine (which is a β-aminoacrylate) in 1 h for sulbactam and in 4 h for 6β-(hydroxymethyl) sulbactam. Rapid mix–rapid freeze Raman spectroscopy was used to follow the reactions between the two sulfones and SHV-1. Within 23 ms, a 10-fold excess of sulbactam was entirely hydrolyzed to give a cis-enamine product. In contrast, the 6β-(hydroxymethyl) sulbactam formed longer-lived acyl–enzyme intermediates that are a mixture of imine and enamines. Single crystal Raman studies, soaking in and washing out unreacted substrates, revealed stable populations of imine and trans-enamine acyl enzymes. The corresponding X-ray crystallographic data are consonant with the Raman data and also reveal the role played by the 6β-hydroxymethyl group in retarding hydrolysis of the acyl enzymes. The 6β-hydroxymethyl group sterically hinders approach of the water molecule as well as restraining the side chain of E166 that facilitates hydrolysis. PMID:25536850

  8. Novel magnetic iron oxide nanoparticles coated with poly(ethylene imine)-g-poly(ethylene glycol) for potential biomedical application: synthesis, stability, cytotoxicity and MR imaging.

    Science.gov (United States)

    Schweiger, Christoph; Pietzonka, Clemens; Heverhagen, Johannes; Kissel, Thomas

    2011-04-15

    Magnetic iron oxide nanoparticles have found application as contrast agents for magnetic resonance imaging (MRI) and as switchable drug delivery vehicles. Their stabilization as colloidal carriers remains a challenge. The potential of poly(ethylene imine)-g-poly(ethylene glycol) (PEGPEI) as stabilizer for iron oxide (γ-Fe₂O₃) nanoparticles was studied in comparison to branched poly(ethylene imine) (PEI). Carrier systems consisting of γ-Fe₂O₃-PEI and γ-Fe₂O₃-PEGPEI were prepared and characterized regarding their physicochemical properties including magnetic resonance relaxometry. Colloidal stability of the formulations was tested in several media and cytotoxic effects in adenocarcinomic epithelial cells were investigated. Synthesized γ-Fe₂O₃ cores showed superparamagnetism and high degree of crystallinity. Diameters of polymer-coated nanoparticles γ-Fe₂O₃-PEI and γ-Fe₂O₃-PEGPEI were found to be 38.7 ± 1.0 nm and 40.4 ± 1.6 nm, respectively. No aggregation tendency was observable for γ-Fe₂O₃-PEGPEI over 12 h even in high ionic strength media. Furthermore, IC₅₀ values were significantly increased by more than 10-fold when compared to γ-Fe₂O₃-PEI. Formulations exhibited r₂ relaxivities of high numerical value, namely around 160 mM⁻¹ s⁻¹. In summary, novel carrier systems composed of γ-Fe₂O₃-PEGPEI meet key quality requirements rendering them promising for biomedical applications, e.g. as MRI contrast agents. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Thermal decomposition of methyl 2-azidopropionate studied by UV photoelectron spectroscopy and matrix isolation IR spectroscopy: heterocyclic intermediate vs imine formation.

    Science.gov (United States)

    Pinto, R M; Dias, A A; Costa, M L; Rodrigues, P; Barros, M T; Ogden, J S; Dyke, J M

    2011-08-01

    Methyl 2-azidopropionate (N(3)CH(3)CHCOOCH(3), M2AP) has been synthesized and characterized by different spectroscopic methods, and the thermal decomposition of this molecule has been investigated by matrix isolation infrared (IR) spectroscopy and ultraviolet photoelectron spectroscopy (UVPES). Computational methods have been employed in the spectral simulation of both UVPES and matrix IR spectra and in the rationalization of the thermal decomposition results. M2AP presents a HOMO vertical ionization energy (VIE) of 9.60 ± 0.03 eV and contributions from all four lowest-energy conformations of this molecule are detected in the gas phase. Its thermal decomposition starts at ca. 400 °C and is complete at ca. 650 °C, yielding N(2), CO, CO(2), CH(3)CN, and CH(3)OH as the final decomposition products. Methyl formate (MF) and CH(4) are also found during the pyrolysis process. Analysis of the potential energy surface of the decomposition of M2AP indicates that M2AP decomposes preferentially into the corresponding imine (M2IP), through a 1,2-H shift synchronous with the N(2) elimination (Type 1 mechanism), requiring an activation energy of 160.8 kJ/mol. The imine further decomposes via two competitive routes: one accounting for CO, CH(3)OH, and CH(3)CN (ΔE(G3) = 260.2 kJ/mol) and another leading to CO(2), CH(4), and CH(3)CN (ΔE(G3) = 268.6 kJ/mol). A heterocyclic intermediate (Type 2 mechanism)-4-Me-5-oxazolidone-can also be formed from M2AP via H transfer from the remote O-CH(3) group, together with the N(2) elimination (ΔE(G3) = 260.2 kJ/mol). Finally, a third pathway which accounts for the formation of MF through an M2AP isomer is envisioned.

  10. DNA interaction, antimicrobial, anticancer activities and molecular docking study of some new VO(II), Cr(III), Mn(II) and Ni(II) mononuclear chelates encompassing quaridentate imine ligand.

    Science.gov (United States)

    Abdel-Rahman, Laila H; Abu-Dief, Ahmed M; Aboelez, Moustafa O; Hassan Abdel-Mawgoud, Azza A

    2017-05-01

    The present study was conducted to synthesis of some new imine Cr(III), VO(II), Mn(II) and Ni(II) complexes derived from the condensation of 2-amino phenol with 2-hydroxynapthaldehyde were synthesized. The prepared HNPN imine ligand was analyzed by its melting point, IR, (1)H NMR and (13)C NMR spectroscopies. The investigated HNPN imine complexes were characterized by elemental analysis, FT IR, UV-vis and thermal analysis (TGA) under nitrogen atmosphere from ambient temperature to 750°C. The experimental results revealed that the investigated complexes contain hydrated water molecules. The molar conductance values of complexes are relatively low, indicating the non-electrolytic nature of these complexes. Magnetic susceptibility measurements show that the investigated complexes are paramagnetic. Moreover, the stability constants of the preparing complexes were determined spectrophotometrically. All the complexes were found to be monomeric 1:1 (M:L) stoichiometry in nature with octahedral geometry for Cr(III), tetrahedral for Mn(II), square planner for Ni(II) and square pyramidal for VO(II). Moreover, the prepared HNPN imine ligand and its complexes were evaluated for antimicrobial effect against some types of bacteria such as Bacillus subtilis (+ve), Escherichia coli(-ve) and Staphylococcus aureus (+ve) and some types of fungi such as Aspergillusniger, Candida glabrata and Trichophyton rubrum. The results of these studies indicate that the metal complexes exhibit a stronger antibacterial and antifungal efficiency compared to their corresponding imine ligand. Moreover, the interaction of the investigated complexes with CT-DNA was checked using spectral studies, viscosity measurements and gel electrophoreses. The absorption titration studies revealed that each of these complexes is an avid binder to calf thymus-DNA. Also, there was appreciable changes in the relative viscosity of DNA, which is consistent with enhanced hydrophobic interaction of the aromatic rings and

  11. Stereodivergent Mannich reaction of bis(trimethylsilyl)ketene acetals with N-tert-butanesulfinyl imines by Lewis acid or Lewis base activation, a one-pot protocol to obtain chiral β-amino acids.

    Science.gov (United States)

    Cantú-Reyes, Margarita; Alvarado-Beltrán, Isabel; Ballinas-Indilí, Ricardo; Álvarez-Toledano, Cecilio; Hernández-Rodríguez, Marcos

    2017-09-20

    We report a one-pot synthesis of chiral β(2,2,3)-amino acids by the Mannich addition of bistrimethylsilyl ketene acetals to N-tert-butanesulfinyl imines followed by the removal of the chiral auxiliary. The synthesis and isolation of pure β-amino acid hydrochlorides were conducted under mild conditions, without strong bases and this method is operationally simple. The stereoselective reaction was promoted by two different activation methods that lead to different stereoisomers: (1) Lewis Acid (LA) catalysis with boron trifluoride diethyl etherate and (2) Lewis Base (LB) catalysis with tetrabutylammonium difluorotriphenylsilicate. The reaction presented good diastereoselectivity with LB activation and moderate to good dr with LA catalysis. The exceptions in both protocols were imines with electron donating groups in the aromatic ring.

  12. An efficient one-pot multicomponent synthesis of 3,4-dihydropyrimidine-2-(1H-ones/thiones/imines via a Lewis base catalyzed Biginelli-type reaction under solvent-free conditions

    Directory of Open Access Journals (Sweden)

    S. Sheik Mansoor

    2016-09-01

    Full Text Available 3,4-Dihydropyrimidin-2(1H-one, 3,4-dihydropyrimidin-2(1H-thione, and 3,4-dihydropyrimidin-2(1H-imine derivatives were synthesized by modified Biginelli cyclocondensation reaction catalyzed by triphenylphosphine as Lewis base. The structures of the synthesized compounds have been elucidated by IR, 1H NMR and elemental analysis.

  13. Rhodium-catalyzed intermolecular [3+3] cycloaddition of vinyl aziridines with C,N-cyclic azomethine imines: stereospecific synthesis of chiral fused tricyclic 1,2,4-hexahydrotriazines.

    Science.gov (United States)

    Zhu, Chao-Ze; Feng, Jian-Jun; Zhang, Junliang

    2017-04-25

    An atom-economic route to ring-fused 1,2,4-hexahydrotriazines relying upon a new synthetic application of vinylaziridines in a rhodium-catalyzed intermolecular [3+3] cycloaddition of C,N-cyclic azomethine imines has been reported. Highly efficient chirality transfer in the present transformation was also observed, providing a new method for the synthesis of sp(3)-carbon-rich 1,2,4-hexahydrotriazines in an enantioselective manner.

  14. A computational study on the N-heterocyclic carbene-catalyzed Csp(2)-Csp(3) bond activation/[4+2] cycloaddition cascade reaction of cyclobutenones with imines: a new application of the conservation principle of molecular orbital symmetry.

    Science.gov (United States)

    Wang, Yang; Wu, Bohua; Zhang, Haoyang; Wei, Donghui; Tang, Mingsheng

    2016-07-20

    A comprehensive density functional theory (DFT) investigation has been performed to interrogate the mechanisms and stereoselectivities of the Csp(2)-Csp(3) single bond activation of cyclobutenones and their [4+2] cycloaddition reaction with imines via N-heterocyclic carbene (NHC) organocatalysis. According to our calculated results, the fundamental reaction pathway contains four steps: nucleophilic addition of NHC to cyclobutenone, C-C bond cleavage for the formation of an enolate intermediate, [4+2] cycloaddition of the enolate intermediate with isatin imine, and the elimination of the NHC catalyst. In addition, the calculated results also reveal that the second reaction step is the rate-determining step, whereas the third step is the regio- and stereo-selectivity determining step. For the regio- and stereo-selectivity determining step, all four possible attack modes were considered. The addition of the C[double bond, length as m-dash]N bond in isatin imine to the dienolate intermediate is more energy favorable than the addition of the C[double bond, length as m-dash]O bond to a dienolate intermediate. Moreover, the Re face addition of the C[double bond, length as m-dash]N bond in isatin imine to the Re face of the dienolate intermediate leading to the SS configuration N-containing product was demonstrated to be most energy favorable, which is mainly due to the stronger second-order perturbation energy value in the corresponding transition state. Furthermore, by tracking the frontier molecular orbital (FMO) changes in the rate-determining C-C bond cleavage step, we found that the reaction obeys the conservation principle of molecular orbital symmetry. We believe that the present work would provide valuable insights into this kind of reaction.

  15. Enantioselective allylation of imines catalyzed by newly developed (-)-β-pinene-based π-allylpalladium catalyst: an efficient synthesis of (R)-α-propylpiperonylamine and (R)-pipecolic acid.

    Science.gov (United States)

    Fernandes, Rodney A; Nallasivam, Jothi L

    2012-10-14

    A newly developed π-allylpalladium with a (-)-β-pinene framework and an isobutyl side chain catalyzed the enantioselective allylation of imines in good yields and enantioselectivities (20 examples, up to 98% ee). An efficient enantioselective synthesis of the (R)-α-propyl piperonylamine part of DMP 777, a human leukocyte elastase inhibitor and (R)-pipecolic acid have been achieved as a useful application of this methodology.

  16. Ligand design for enhanced stereoselectivity in the electron-transfer reactions between nickel(IV) bis(oxime-imine) complexes and (Co(edta))/sup 2 -/

    Energy Technology Data Exchange (ETDEWEB)

    Martone, D.P.; Osvath, P.; Lappin, A.G.

    1987-09-23

    A number of derivatives of the sexidentate bis(oxime-imine) ligand 3,14-dimethyl-4,7,10,13-tetraazahexadeca-3,13-diene-2,15-dione dioxime, Me/sub 2/L(1)H/sub 2/, have been prepared in which the methyl groups on the oxime-imine chromophores are replaced by more bulky phenyl groups, MePhL(1)H/sub 2/ and PhMeL(1)H/sub 2/, or chiral (S) methyl (L(2)) and benzyl (L(3)) groups are attached on the amine backbone at the 5- and 12-positions. Nickel(II) complexes of the ligands can be oxidized to the corresponding nickel(III) and nickel(IV) derivatives, and the effect of changing ligand structure on the reduction potentials of the complexes is small. Self-exchange rate constants for the nickel(IV)/nickel(III) change have been estimated from the rates of the cross-reactions between (Ni/sup III/MePhL(1))/sup +/ and (Ni/sup III/PhMeL(1))/sup +/ and their chiral (5S, 12S)-dimethyl nickel(IV) derivatives to be 8 x 10/sup 5/ and 4 x 10/sup 6/ M/sup -1/ s/sup -1/, respectively, at 25/sup 0/C and 0.1 M ionic strength. The kinetics and mechanisms of reduction of (Ni/sup IV/MePhL(1))/sup 2 +/ and (Ni/sup IV/PhMeL(1))/sup 2 +/ and (Co(edta))/sup 2 -/ have also been investigated. Stereoselectivity in the oxidation of (Co(edta))/sup 2 -/ by nickel(IV) has been investigated by using these chiral complexes, and in all cases the preferred isomer of the product (Co(edta))/sup -/ is ..delta.. with enantiomeric excesses of 7%, 21%, 22%, and 46% for the complexes (Ni/sup IV/PhMeL(2))/sup 2 +/, (Nk/sup IV/MePhL(2))/sup 2 +/, (Ni/sup IV/Me/sub 2/L(3))/sup 2 +/, and (Ni/sup IV/MePhL(3))/sup 2 +/, respectively. 32 references, 5 figures, 4 tables.

  17. Water-soluble isoindolo[2,1-a]quinoxalin-6-imines: in vitro antiproliferative activity and molecular mechanism(s) of action.

    Science.gov (United States)

    Parrino, Barbara; Carbone, Anna; Ciancimino, Cristina; Spanò, Virginia; Montalbano, Alessandra; Barraja, Paola; Cirrincione, Girolamo; Diana, Patrizia; Sissi, Claudia; Palumbo, Manlio; Pinato, Odra; Pennati, Marzia; Beretta, Giovanni; Folini, Marco; Matyus, Peter; Balogh, Balázs; Zaffaroni, Nadia

    2015-04-13

    Water-soluble isoindoloquinoxalin (IIQ) imines and the corresponding acetates were conveniently prepared from the key intermediates 2-(2'-aminophenyl)-2H-isoindole-1-carbonitriles obtained by a Strecker reaction between substituted 1,2-dicarbaldehydes and 1,2-phenylenediamines. Both series were screened by the National Cancer Institute (Bethesda, MD) and showed potent antiproliferative activity against a panel of 60 human tumor cell lines. Several of the novel compounds showed GI50 values at a nanomolar level on the majority of the tested cell lines. Among IIQ derivatives, methoxy substituents at positions 3 and 8 or/and 9 were especially effective in impairing cell cycle progression and inducing apoptosis in cancer cells. These effects were associated to IIQ-mediated impairment of tubulin polymerization at pharmacologically significant concentrations of tested compounds. In addition, impaired DNA topoisomerase I functions and perturbation in telomere architecture were observed in cells exposed to micromolar concentrations of IIQ derivatives. The above results suggest that IIQ derivatives exhibit multi-target cytotoxic activities.

  18. Potential Threats Posed by New or Emerging Marine Biotoxins in UK Waters and Examination of Detection Methodologies Used for Their Control: Cyclic Imines

    Directory of Open Access Journals (Sweden)

    Keith Davidson

    2015-11-01

    Full Text Available Cyclic imines (CIs are a group of phytoplankton produced toxins related to shellfish food products, some of which are already present in UK and European waters. Their risk to shellfish consumers is poorly understood, as while no human intoxication has been definitively related to this group, their fast acting toxicity following intraperitoneal injection in mice has led to concern over their human health implications. A request was therefore made by UK food safety authorities to examine these toxins more closely to aid possible management strategies. Of the CI producers only the spirolide producer Alexandrium ostenfeldii is known to exist in UK waters at present but trends in climate change may lead to increased risk from other organisms/CI toxins currently present elsewhere in Europe and in similar environments worldwide. This paper reviews evidence concerning the prevalence of CIs and CI-producing phytoplankton, together with testing methodologies. Chemical, biological and biomolecular methods are reviewed, including recommendations for further work to enable effective testing. Although the focus here is on the UK, from a strategic standpoint many of the topics discussed will also be of interest in other parts of the world since new and emerging marine biotoxins are of global concern.

  19. Muhammed Esed’de Dini Değişimin Psikolojik Analizi The Psychological Analysis Of Religious Conversion In Muhammad Asad

    Directory of Open Access Journals (Sweden)

    Saffet KARTOPU

    2013-07-01

    Full Text Available At this work on Which religious conversion in Muhammad Asad isstudied, in terms of religious conversion models, first of all the conceptof religious conversion, the Works in this topic and the place of religiousconversion concept in Psychology of Religion are mentioned. Then, abrief life story of Asad is mentioned, by dealing with the religiousconversion in Asad in a theoretical approach, the motives of religiousconversion, the developmental factors in religious conversion, the stagesof religious conversion and the figures of religious conversion arestudied. The religious conversion in Asad is analyzed in terms ofconversion models accepted in Psychology of Religion taking his ownWorks as a base. In this sence, while the motives of religious conversionin Asad are considered by the approaches of Snow & Phillips, Glock andGillespie, the developmental factors in religious conversion areconsidered by Erikson’s thoughts. The stages of religious conversion isconsidered by gradual classification of Lofland & Stark, Clark, Batson &Ventis and Köse. Lofland and Skonovd’s types are used while analyzingthe figures of conversion.When considered the effects of psychological factors on thereligious conversion of Asad, we see that beginning from his earlyadolescence his willing to understanding and his need to mentalsatisfaction are explicit. Asad is in need of reviewing the main pointsimposed by his cultere. He is disturbed by the ambiguities in societyand his own life and he looks for answers to the universal meaning oflife and questions ‘what is right? what is wrong?’. As a result of hisseeking, he accepts Islam as his religion and he gains a feeling ofbelonging, admission and a change of rearranging himself radically. Byaccepting Islam he feels that all his seekings finish and his desire ofdepending on a certain intellectua orbit and being a part of fellowscommunity come true. Dini değişim modelleri açısından Muhammed Esed’de dini değişimin

  20. The acetaminophen metabolite N-acetyl-p-benzoquinone imine (NAPQI) inhibits glutathione synthetase in vitro; a clue to the mechanism of 5-oxoprolinuric acidosis?

    Science.gov (United States)

    Walker, Valerie; Mills, Graham A; Anderson, Mary E; Ingle, Brandall L; Jackson, John M; Moss, Charlotte L; Sharrod-Cole, Hayley; Skipp, Paul J

    2017-02-01

    1. Metabolic acidosis due to accumulation of l-5-oxoproline is a rare, poorly understood, disorder associated with acetaminophen treatment in malnourished patients with chronic morbidity. l-5-Oxoprolinuria signals abnormal functioning of the γ-glutamyl cycle, which recycles and synthesises glutathione. Inhibition of glutathione synthetase (GS) by N-acetyl-p-benzoquinone imine (NAPQI) could contribute to 5-oxoprolinuric acidosis in such patients. We investigated the interaction of NAPQI with GS in vitro. 2. Peptide mapping of co-incubated NAPQI and GS using mass spectrometry demonstrated binding of NAPQI with cysteine-422 of GS, which is known to be essential for GS activity. Computational docking shows that NAPQI is properly positioned for covalent bonding with cysteine-422 via Michael addition and hence supports adduct formation. 3. Co-incubation of 0.77 μM of GS with NAPQI (25-400 μM) decreased enzyme activity by 16-89%. Inhibition correlated strongly with the concentration of NAPQI and was irreversible. 4. NAPQI binds covalently to GS causing irreversible enzyme inhibition in vitro. This is an important novel biochemical observation. It is the first indication that NAPQI may inhibit glutathione synthesis, which is pivotal in NAPQI detoxification. Further studies are required to investigate its biological significance and its role in 5-oxoprolinuric acidosis.

  1. A Tethered Ru-S Complex with an Axial Chiral Thiolate Ligand for Cooperative Si-H Bond Activation: Application to Enantioselective Imine Reduction.

    Science.gov (United States)

    Wübbolt, Simon; Maji, Modhu Sudan; Irran, Elisabeth; Oestreich, Martin

    2017-02-13

    An axial chiral version of the 2,6-dimesitylphenyl group attached to sulfur is reported. Its multistep preparation starts from (S)-binol, and the thiol group is established by a racemization-free thermal Newman-Kwart rearrangement. The new chiral thiolate ligand decorated with one mesityl group is used in the synthesis of a tethered ruthenium chloride complex. Its spectroscopic characterization revealed solvent-dependent epimerization at the ruthenium center. The major diastereomer is crystallographically characterized. Chloride abstraction with tetrakis[3,5-bis(trifluoromethyl)phenyl]borate (NaBArF4) yields the corresponding coordinatively unsaturated ruthenium complex with the Ru-S bond exposed. Si-H bond activation at this Ru-S bond proceeds in syn fashion but with moderate facial selectivity (d.r. = 70:30), generating diastereomeric chiral-at-ruthenium hydrosilane adducts. Their application to catalytic imine hydrosilylation led to promising enantioinduction (40% ee), thereby providing proof of concept for asymmetric catalysis involving cooperative Si-H bond activation.

  2. Multivariate analysis of DSC-XRD simultaneous measurement data: a study of multistage crystalline structure changes in a linear poly(ethylene imine) thin film.

    Science.gov (United States)

    Kakuda, Hiroyuki; Okada, Tetsuo; Otsuka, Makoto; Katsumoto, Yukiteru; Hasegawa, Takeshi

    2009-01-01

    A multivariate analytical technique has been applied to the analysis of simultaneous measurement data from differential scanning calorimetry (DSC) and X-ray diffraction (XRD) in order to study thermal changes in crystalline structure of a linear poly(ethylene imine) (LPEI) film. A large number of XRD patterns generated from the simultaneous measurements were subjected to an augmented alternative least-squares (ALS) regression analysis, and the XRD patterns were readily decomposed into chemically independent XRD patterns and their thermal profiles were also obtained at the same time. The decomposed XRD patterns and the profiles were useful in discussing the minute peaks in the DSC. The analytical results revealed the following changes of polymorphisms in detail: An LPEI film prepared by casting an aqueous solution was composed of sesquihydrate and hemihydrate crystals. The sesquihydrate one was lost at an early stage of heating, and the film changed into an amorphous state. Once the sesquihydrate was lost by heating, it was not recovered even when it was cooled back to room temperature. When the sample was heated again, structural changes were found between the hemihydrate and the amorphous components. In this manner, the simultaneous DSC-XRD measurements combined with ALS analysis proved to be powerful for obtaining a better understanding of the thermally induced changes of the crystalline structure in a polymer film.

  3. Strong ionic interactions in noncovalent complexes between poly(ethylene imine), a cationic electrolyte, and Cibacron Blue, a nucleotide mimic--implications for oligonucleotide vectors.

    Science.gov (United States)

    Çelikbıçak, Ömür; Salih, Bekir; Wesdemiotis, Chrys

    2014-07-01

    Cationic polymers can bind DNA to form polyplexes, which are noncovalent complexes used for gene delivery into the targeted cells. For more insight on such biologically relevant systems, the noncovalent complexes between the cationic polymer poly(ethylene imine) (PEI) and the nucleotide mimicking dye Cibacron Blue F3G-A (CB) were investigated using mass spectrometry methods. Two PEIs of low molecular weight were utilized (Mn  ≈ 423 and 600 Da). The different types of CB anions produced by Na(+)/H(+) exchanges on the three sulfonic acid groups of CB and their dehydrated counterparts were responsible for complex formation with PEI. The CB anions underwent noncovalent complex formation with protonated, but not with sodiated PEI. A higher proportion of cyclic oligomers were detected in PEI423 than PEI600, but both architectures formed association products with CB. Tandem mass spectrometry studies revealed a significantly stronger noncovalent interaction between PEI and dehydrated CB than between PEI and intact CB. Copyright © 2014 John Wiley & Sons, Ltd.

  4. PLLA scaffolds surface-engineered via poly (propylene imine) dendrimers for improvement on its biocompatibility/controlled pH biodegradability

    Science.gov (United States)

    Ganjalinia, Atiyeah.; Akbari, Somaye.; Solouk, Atefeh.

    2017-02-01

    Novel aminolyzed Poly (L) Lactic Acid (PLLA) films and electrospun nanofibrous scaffolds were fabricated and characterized as potential substrates for tissue engineering. The second generation polypropylene imine dendrimer (PPI-G2) was used as the aminolysis agent to functionalize the inert surface of PLLA substrates directly without any pre-modification process. The effect of the solvent type, G2 concentration, reaction temperature and time were studied by following weight reduction percentage, FTIR and contact angle measurements due to determined optimum conditions. In addition, the modified scaffolds abbreviated by PLLA/G2 were analyzed using mechanical properties, SEM images and dye assays as host-guest modeling. The results indicate that under the 0.5 (wt.%) G2 concentration, ethanol as the solvent, room temperature and 4 h of treatment, the optimum conditions were obtained. It was shown that the hydrophilic properties of PLLA/G2 were greatly enhanced. Also, pH value analysis revealed that after 4 weeks, the biodegradation of PLLA caused massive immune cells infusion and inflammation in the medium through increasing the acidic rate by secretion the lactic acid, whereas the PLLA/G2 scaffolds greatly reduced and stabilize the acidic rate through aminolysis reaction. Finally, promoted cell adhesion and viability underlined the favorable properties of PLLA/G2 scaffolds as a biodegradable biomaterial for biomedical implants.

  5. A library of strictly linear poly(ethylene glycol)-poly(ethylene imine) diblock copolymers to perform structure-function relationship of non-viral gene carriers.

    Science.gov (United States)

    Bauhuber, Sonja; Liebl, Renate; Tomasetti, Luise; Rachel, Reinhard; Goepferich, Achim; Breunig, Miriam

    2012-09-10

    A library of 39 strictly linear poly(ethylene glycol)-poly(ethylene imine) (PEG-PEI) diblock copolymers was synthesized for the delivery of plasmid DNA using PEG of 2, 5, or 10 kDa in combination with linear PEI with a molecular weight (MW) ranging from 1.5 to 10.8 kDa. In contrast to other approaches, the copolymers demonstrated a clear separation between the hydrophilic PEG and the nucleic acid condensing PEI moieties. Hence, the hypothesis was that PEG may not sterically counteract the interaction between the nucleic acid and PEI and that consequently, the copolymers are perfectly suited to build small and stable polyplexes. Analysis of the polyplexes revealed structure-function relationships and the general guideline was that the PEG domain had a greater influence on the physicochemical properties of the polyplexes than PEI. A PEG content higher than 50% led to small (application of the corresponding degradable copolymer, which involved a redox triggerable PEG domain. In conclusion, valuable design criteria for the optimization of gene delivery carriers, which is only possible through the screening of such a large library, were gained. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Origin of the chemical stability of phosphine-phosphoramidites: structural study of an UPPhos-type crystal and application of UPPhos in the asymmetric hydrogenation of imines.

    Science.gov (United States)

    Balogh, Szabolcs; Farkas, Gergely; Holczbauer, Tamás; Bakos, József

    2017-08-01

    Phosphine-phosphoramidites (PPAs) are heterobidentate ligands that have been developed in the last two decades and have been used successfully in asymmetric catalytic reactions. A single crystal of the PPA (11bS)-N-[(2S,4S)-4-(diphenylphosphanyl)pentan-2-yl]-N-methyldinaphtho[2,1-d:1',2'-f][1,3,2]dioxaphosphepin-4-amine, C38H35NO2P2, was prepared and structurally characterized by single-crystal X-ray diffraction and density functional theory (DFT) calculations. Structure elucidation revealed unique features which might have a significant effect in the excellent chemical stability of this type of molecule. The conformation of the molecule provides an optimal chelating structure. Iridium complexes of UPPhos were found to be efficient catalysts in the asymmetric hydrogenation of imines {UPPhos is (11bS)-N-[(2S,4S)-4-(diphenylphosphanyl)pentan-2-yl]-N-(propan-2-yl)dinaphtho[2,1-d:1',2'-f][1,3,2]dioxaphosphepin-4-amine}.

  7. Mechanistic investigation of poly(ethylene imine)-based siRNA delivery: disulfide bonds boost intracellular release of the cargo.

    Science.gov (United States)

    Breunig, Miriam; Hozsa, Constantin; Lungwitz, Uta; Watanabe, Kazuo; Umeda, Isao; Kato, Hiroyuki; Goepferich, Achim

    2008-08-25

    Poly(ethylene imine) (PEI) has gained increasing attention in the delivery of small interfering RNAs (siRNAs) into cells. In order to further optimize PEI for this application, the first goal of this study was to examine particular steps of siRNA delivery with various PEI derivatives as carriers. Furthermore, the hypothesis that disulfide cleavable carrier systems are favorable for the release of siRNA into the cell cytoplasm was investigated. Flow cytometry and confocal microscopy were used to assess the cellular uptake and intracellular distribution of siRNA, which were then related to gene silencing efficacy. We observed a strong correlation between cellular uptake and RNAi activity. The cellular uptake of siRNA was more efficient with increasing branching of the polymer, i.e. linear PEI (lPEI) 5 kDa < lPEI cross-linked via disulfide bonds (ssPEI) < branched PEI (bPEI) 25 kDa. However, it was also evident that the siRNA release from the carrier, which was promoted by ssPEI, played an important role in the accessibility of siRNA for the gene silencing complex. Therefore, we suggest that a combination of a high branching density and reductively cleavable bonds within the PEI-based carrier system could be one possible step towards improving siRNA delivery.

  8. Potential of Ni(II)-NTA-modified poly(ethylene imine) glycopolymers as carrier system for future dendritic cell-based immunotherapy.

    Science.gov (United States)

    Hauptmann, N; Pion, M; Wehner, R; Muñoz-Fernández, M-Á; Schmitz, M; Voit, B; Appelhans, D

    2014-03-10

    Dendritic cells (DCs) play a crucial role in the development of cell-mediated immunotherapy due to their ability to induce and maintain strong immune responses. In our study, we evaluated a biocompatible Ni(II)-NTA-modified poly(ethylene imine) dendritic glycopolymer (Ni(II)-NTA-DG) as new carrier system to increase the antigen uptake into iDCs for future DC-based immunotherapy. Ni(II)-NTA-DG led to an increase in His6-Gp160 uptake in monocytes and iDCs, where His6-Gp160 is localized in the early endosomal and lysosomal compartments. Ni(II)-NTA-DG and the formed polyplexes induced an activation of iDCs, showing an increasing expression of costimulatory molecules CD86, CD80, and proinflammatory cytokines IL-6 and IL-8. Beside no influencing effect of Ni(II)-NTA-DG and polyplexes on the maturation of antigen-bearing DCs, the mature peptide bearing DCs remained their ability to migrate along a gradient of CCR7 ligands. Thus, Ni(II)-NTA-DG with advancing biological properties is a promising carrier system for the future application in DC-based immunotherapy.

  9. The Amelioration of N-Acetyl-p-Benzoquinone Imine Toxicity by Ginsenoside Rg3: The Role of Nrf2-Mediated Detoxification and Mrp1/Mrp3 Transports

    Directory of Open Access Journals (Sweden)

    Sang Il Gum

    2013-01-01

    Full Text Available Previously, we found that Korean red ginseng suppressed acetaminophen (APAP-induced hepatotoxicity via alteration of its metabolic profile involving GSTA2 induction and that ginsenoside Rg3 was a major component of this gene induction. In the present study, therefore, we assessed the protective effect of Rg3 against N-acetyl-p-benzoquinone imine (NAPQI, a toxic metabolic intermediate of APAP. Excess NAPQI resulted in GSH depletion with increases in the ALT and AST activities in H4IIE cells. Rg3 pretreatment reversed GSH depletion by NAPQI. Rg3 resulted in increased mRNA levels of the catalytic and modulatory subunit of glutamate cysteine ligase (GCL, the rate-limiting steps in GSH synthesis and subsequently increased GSH content. Rg3 increased levels of nuclear Nrf2, an essential transcriptional factor of these genes. The knockdown or knockout of the Nrf2 gene abrogated the inductions of mRNA and protein by Rg3. Abolishment of the reversal of GSH depletion by Rg3 against NAPQI was observed in Nrf2-deficient cells. Rg3 induced multidrug resistance-associated protein (Mrp 1 and Mrp3 mRNA levels, but not in Nrf2-deficient cells. Taken together, these results demonstrate that Rg3 is efficacious in protecting hepatocytes against NAPQI insult, due to GSH repletion and coordinated gene regulations of GSH synthesis and Mrp family genes by Nrf2.

  10. Synthesis, characterization and catechol oxidase biomimetic catalytic activity of cobalt(II and copper(II complexes containing N2O2 donor sets of imine ligands

    Directory of Open Access Journals (Sweden)

    Mohamed I. Ayad

    2016-11-01

    Full Text Available New tetradentate imine ligands are derived from Schiff base condensation in a 1:2 molar ratio of the 1,2,4,5-tetra-amino benzene with 2-hydroxy benzaldehyde, (L1, 2,4-dihydroxy benzaldehyde (L2 and 2-hydroxy naphthaldehyde (L3. These ligands react with CoCl2 and CuCl2 in refluxing ethanol to yield a series of cobalt(II and copper(II complexes of the type [M2IILn] nH2O. The structure of the obtained ligands and their metal(II complexes were characterized by various physicochemical techniques, viz. elemental analysis, molar conductance, magnetic susceptibility measurements, thermal analysis (TGA & DTG, IR, electronic absorption and ESR spectral studies. Four-coordinate tetrahedral and square–planar structures were proposed for cobalt(II and copper(II complex species respectively. The ability of the synthesized complexes to catalyze the aerobic oxidation of 3,5-di-tert-butylcatechol (3,5-DTBC to the light absorbing 3,5-di-tert-butylquinone (3,5-DTBQ has been investigated. The results obtained show that all complexes catalyze this oxidation reaction and slight variations in the rate were observed. The probable mechanistic implications of the catalytic oxidation reactions are discussed.

  11. Lanthanide(III) complexes of bis-semicarbazone and bis-imine-substituted phenanthroline ligands: solid-state structures, photophysical properties, and anion sensing.

    Science.gov (United States)

    Nadella, Sandeep; Selvakumar, Paulraj M; Suresh, Eringathodi; Subramanian, Palani S; Albrecht, Markus; Giese, Michael; Fröhlich, Roland

    2012-12-21

    Phenanthroline-based hexadentate ligands L(1) and L(2) bearing two achiral semicarbazone or two chiral imine moieties as well as the respective mononuclear complexes incorporating various lanthanide ions, such as La(III), Eu(III), Tb(III), Lu(III), and Y(III) metal ions, were synthesized, and the crystal structures of [ML(1)Cl(3)] (M=La(III), Eu(III), Tb(III), Lu(III), or Y(III)) complexes were determined. Solvent or water molecules act as coligands for the rare-earth metals in addition to halide anions. The big Ln(III) ion exhibits a coordination number (CN) of 10, whereas the corresponding Eu(III), Tb(III), Lu(III), and Y(III) centers with smaller ionic radii show CN=9. Complexes of L(2), namely [ML(2)Cl(3)] (M=Eu(III), Tb(III), Lu(III), or Y(III)) ions could also be prepared. Only the complex of Eu(III) showed red luminescence, whereas all the others were nonluminescent. The emission properties of the Eu derivative can be applied as a photophysical signal for sensing various anions. The addition of phosphate anions leads to a unique change in the luminescence behavior. As a case study, the quenching behavior of adenosine-5'-triphosphate (ATP) was investigated at physiological pH value in an aqueous solvent. A specificity of the sensor for ATP relative to adenosine-5'-diphosphate (ADP) and adenosine-5'-monophosphate (AMP) was found. (31)P NMR spectroscopic studies revealed the formation of a [EuL(2)(ATP)] coordination species.

  12. Effects of aggregates on mixed adsorption layers of poly(ethylene imine) and sodium dodecyl sulfate at the air/liquid interface.

    Science.gov (United States)

    Tonigold, Katrin; Varga, Imre; Nylander, Tommy; Campbell, Richard A

    2009-04-07

    We have exploited the spatial and kinetic resolution of ellipsometry to monitor the lateral movement of inhomogeneous patches of material in mixed adsorption layers of poly(ethylene imine) and sodium dodecyl sulfate at the air/liquid interface. We show that the choice of sample preparation methods can have a profound effect on the state of the interface for chemically equivalent samples. The extent of aggregation in the bulk solution on relevant time scales is affected by specific details of the polymer/surfactant mixing process, which produces varying numbers of aggregates that can become trapped in the interfacial layer, resulting in an enhanced and fluctuating ellipsometry signal. It can be beneficial to apply the surface-cleaning method of aspiration prior to physical measurements to remove trapped aggregates through the creation of a fresh interface. At low pH, the ellipsometry signal of samples prepared with surface cleaning is remarkably constant over a factor of >500 in the bulk composition below charge equivalence, which is discussed in terms of possible adsorption mechanisms. At high pH, through observing temporal fluctuations in the ellipsometry signal of samples prepared with surface cleaning, we reveal two important processes: there is the spontaneous adsorption of aggregates > 0.2 microm in diameter into the interfacial layer, and with time there is the fusion of smaller aggregates to generate new large surface aggregates. We attribute the favorability of the adsorption and fusion processes at high pH to reduced electrostatic barriers resulting from the low surface charge density of the aggregates. It is inappropriate in this case to consider the interface to comprise a homogeneous adsorption layer that is in dynamic equilibrium with the bulk solution. Our work shows that it can be helpful to consider whether there are macroscopic particles embedded in molecular layers at the air/liquid interface for systems where there is prior knowledge of

  13. Intracellular siRNA delivery dynamics of integrin-targeted, PEGylated chitosan-poly(ethylene imine) hybrid nanoparticles: A mechanistic insight.

    Science.gov (United States)

    Ragelle, Héloïse; Colombo, Stefano; Pourcelle, Vincent; Vanvarenberg, Kevin; Vandermeulen, Gaëlle; Bouzin, Caroline; Marchand-Brynaert, Jacqueline; Feron, Olivier; Foged, Camilla; Préat, Véronique

    2015-08-10

    Integrin-targeted nanoparticles are promising for the delivery of small interfering RNA (siRNA) to tumor cells or tumor endothelium in cancer therapy aiming at silencing genes essential for tumor growth. However, during the process of optimizing and realizing their full potential, it is pertinent to gain a basic mechanistic understanding of the bottlenecks existing for nanoparticle-mediated intracellular delivery. We designed αvβ3 integrin-targeted nanoparticles by coupling arginine-glycine-aspartate (RGD) or RGD peptidomimetic (RGDp) ligands to the surface of poly(ethylene glycol) (PEG) grafted chitosan-poly(ethylene imine) hybrid nanoparticles. The amount of intracellular siRNA delivered by αvβ3-targeted versus non-targeted nanoparticles was quantified in the human non-small cell lung carcinoma cell line H1299 expressing enhanced green fluorescent protein (EGFP) using a stem-loop reverse transcription quantitative polymerase chain reaction (RT-qPCR) approach. Data demonstrated that the internalization of αvβ3-targeted nanoparticles was highly dependent on the surface concentration of the ligand. Above a certain threshold concentration, the use of targeted nanoparticles provided a two-fold increase in the number of siRNA copies/cell, subsequently resulting in as much as 90% silencing of EGFP at well-tolerated carrier concentrations. In contrast, non-targeted nanoparticles mediated low levels of gene silencing, despite relatively high intracellular siRNA concentrations, indicating that these nanoparticles might end up in late endosomes or lysosomes without releasing their cargo to the cell cytoplasm. Thus, the silencing efficiency of the chitosan-based nanoparticles is strongly dependent on the uptake and the intracellular trafficking in H1299 EGFP cells, which is critical information towards a more complete understanding of the delivery mechanism that can facilitate the future design of efficient siRNA delivery systems.

  14. Synthesis, structural characterization and theoretical approach of 3-(2,6-dichlorobenzyl)-5-methyl-N-nitro-1,3,5-oxadiazinan-4-imine.

    Science.gov (United States)

    Ni, Haiwei; Zhang, Yu; Zhang, Fang; Zhao, Jianying; Wu, Liubi; Chu, Xiaozhong

    2015-03-05

    3-(2,6-Dichlorobenzyl)-5-methyl-N-nitro-1,3,5-oxadiazinan-4-imine (DNOI) was synthesized and characterized by X-ray diffraction, FT-IR, FT-Raman and UV-Vis spectra. The X-ray diffraction study showed that DNOI has a one dimensional configuration, due to the intermolecular C9H⋯O1 and N4H⋯O2 hydrogen bonds. The benzene ring and the oxadiazine rings are tilted with respect to each other by 63.07° (C3N1C5C6). Vibrational spectra and electronic spectra measurements were made for the compound. Optimized geometrical structure and harmonic vibrational frequencies were computed with DFT (B3LYP, B3P86, and M062X) methods using 6-311++G(d,p) basis set. Assignments of the observed spectra were proposed. The equilibrium geometries computed by all of the methods were compared with X-ray diffraction results. The absorption spectra of the title compound were computed both in gas phase and in CH3OH solution using TD-B3LYP/6-311++G(d,p) and PCM-B3LYP/6-311++G(d,p) approaches, respectively. The calculated results provide a good description of positions of the bands maxima in the observed electronic spectrum. Temperature dependence of thermodynamic parameters in the range of 100-1000K were determined, entropy, heat capacity and enthalpy changes were increasing with temperature increasing, while for Gibbs free energy is decreasing with temperature increasing. The bond orbital occupancies, contribution from parent natural bond orbital (NBO), the natural atomic hybrids was calculated and discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. A quantum chemical study of the reactivity of acetaminophen (paracetamol) toxic metabolite N-acetyl-p-benzoquinone imine with deoxyguanosine and glutathione.

    Science.gov (United States)

    Klopčič, Ivana; Poberžnik, Matic; Mavri, Janez; Dolenc, Marija Sollner

    2015-12-05

    Acetaminophen (APAP) forms some reactive metabolites that can react with DNA. APAP is a potentially genotoxic drug and is classified as a Group 3 drug according to International Agency for Research on Cancer (IARC). One of the possible mechanisms of APAP genotoxicity after long term of use is that its reactive quinone imine (QI) metabolite of acetaminophen (NAPQI), can chemically react with DNA after glutathione (GSH) depletion. A quantum chemical study of the reactions between the NAPQI and deoxyguanosine (dG) or GSH was performed. Activation energies (ΔG(ǂ)) for the reactions associated with the 1, 4-Michael addition were calculated on the M062X/6-311++G (d,p) level of theory. We modeled the reaction with dG as a multi-step process. The first step is rate-limiting (ΔG(ǂ) = 26.7 kcal/mol) and consists of formation of a C-N bond between the C3 atom of the QI moiety and the N7 atom of dG. The second step involves proton transfer from the C3 moiety to the nitrogen atom of the QI with ΔG(ǂ) of 13.8 kcal/mol. The depurination reaction that follows has a ΔG(ǂ) of 25.7 kcal/mol. The calculated ΔG(ǂ) for the nucleophilic attack of the deprotonated S atom of GSH on the C3 atom of the NAPQI is 12.9 kcal/mol. Therefore, the QI will react with GSH much faster than with DNA. Our study gives mechanistic insight into the genotoxicity of the APAP metabolite and will be useful for estimating the genotoxic potential of existing drugs with a QI moiety. Our results show that clinical application of APAP is safe, while in the case of severely depleted GSH levels APAP should be administered with caution. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. Formulation of polylactide-co-glycolic acid nanospheres for encapsulation and sustained release of poly(ethylene imine-poly(ethylene glycol copolymers complexed to oligonucleotides

    Directory of Open Access Journals (Sweden)

    Wheatley Margaret A

    2009-04-01

    Full Text Available Abstract Antisense oligonucleotides (AOs have been shown to induce dystrophin expression in muscles cells of patients with Duchenne Muscular Dystrophy (DMD and in the mdx mouse, the murine model of DMD. However, ineffective delivery of AOs limits their therapeutic potential. Copolymers of cationic poly(ethylene imine (PEI and non-ionic poly(ethylene glycol (PEG form stable nanoparticles when complexed with AOs, but the positive surface charge on the resultant PEG-PEI-AO nanoparticles limits their biodistribution. We adapted a modified double emulsion procedure for encapsulating PEG-PEI-AO polyplexes into degradable polylactide-co-glycolic acid (PLGA nanospheres. Formulation parameters were varied including PLGA molecular weight, ester end-capping, and sonication energy/volume. Our results showed successful encapsulation of PEG-PEI-AO within PLGA nanospheres with average diameters ranging from 215 to 240 nm. Encapsulation efficiency ranged from 60 to 100%, and zeta potential measurements confirmed shielding of the PEG-PEI-AO cationic charge. Kinetic measurements of 17 kDa PLGA showed a rapid burst release of about 20% of the PEG-PEI-AO, followed by sustained release of up to 65% over three weeks. To evaluate functionality, PEG-PEI-AO polyplexes were loaded into PLGA nanospheres using an AO that is known to induce dystrophin expression in dystrophic mdx mice. Intramuscular injections of this compound into mdx mice resulted in over 300 dystrophin-positive muscle fibers distributed throughout the muscle cross-sections, approximately 3.4 times greater than for injections of AO alone. We conclude that PLGA nanospheres are effective compounds for the sustained release of PEG-PEI-AO polyplexes in skeletal muscle and concomitant expression of dystrophin, and may have translational potential in treating DMD.

  17. Investigation of the Electronic and pH-Sensing properties of Hydroxyl-Functionalized Imine-Linked Polymers via the UV-vis Absorption Spectra and the Density Functional Theory (DFT Calculations

    Directory of Open Access Journals (Sweden)

    Ibtesam Y. Aljaafreh

    2017-01-01

    Full Text Available In this report, a synergetic computational and experimental studies were demonstrated on examples of poly-imine polymers; P(PI-IPI and P(PIOH-IPI to explore the role of hydroxyl substituent on their sensing and electronic properties. The polymer P(PIOH-IPI bearing the OH-group on the ortho-position to the imine-bond, while the structure of the polymer P(PI-IPI reveal the imine-bond only. The sensing property of the polymers was investigated via the UV-vis absorption in different solvents, acidic and basic solutions. Both polymers have shown significant sensing behavior in the acidic medium, while unpronounced behavior was noticed in the case of the polymer P(PI-IPI in basic medium. Upon the incorporation of the OH-group, the polymer P(PIOH-IPI has indistinguishable sensing behavior, a similar blue-shift in the acidic and basic medium, which can be attributed to the presence and the position of OH-group. The optical band gap of the polymers was determined experimentally and theoretically from the UV-vis absorption spectra and DFT calculations in the DMSO solvent. Other factors that affect the band gap values such as the structural conformation and length of conjugation were explored theoretically. In general, as the length of the optimized chain increased, the spectrum is red-shifted and the band gap decreased, which is attributed to the possible loss of chain planarity and conjugation beyond the monomer structure. Interestingly, the UV-vis spectra of the monomer-optimized structures were in a good match with the experimental UV-vis spectra. However, the band gap difference can be attributed to the method of band gap determination.

  18. Synthesis and molecular docking study of some 5,6-dichloro-2-cyclopropyl-1H-benzimidazole derivatives bearing triazole, oxadiazole, and imine functionalities as potent inhibitors of urease.

    Science.gov (United States)

    Menteşe, Emre; Bektaş, Hakan; Sokmen, Bahar Bilgin; Emirik, Mustafa; Çakır, Demet; Kahveci, Bahittin

    2017-07-01

    A new series of benzimidazole compounds including hydrazinecarbothioamide, 1,2,4-triazole, 1,3,4-oxadiazole and imine function were synthesized starting from 5,6-dichloro-2-cyclopropyl-1H-benzimidazole. All of the benzimidazole derivatives exhibited good urease inhibitor activity. Compound 6a proved to be the most potent showing an enzyme inhibitory activity with an IC50=0.06µM. Molecular docking studies were also conducted on enzyme extracted from Jack bean urease to identify the binding mode of the newly synthesized compounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Study of the stereochemistry of silver(I) bis(pyridine-2-carbaldehyde-imine) triflate complexes in solution: application of INEPT109Ag and 1H-{109Ag}NMR

    NARCIS (Netherlands)

    Koten, G. van; Stein, G.C. van; Brevard, C.

    1982-01-01

    [Ag}I{L{2}](O{3}SCF{3}) complexes have been obtained from the 21 reaction of pyridine-2-carbaldehyde-imine (L) with AgO{3}SCF{3}. Inept }1{}0{}9{Ag and }1{H-{}1{}0{}9{Ag} NMR studies of [Ag{(S)(6-Me-2-C{5}H{3}N)C(H)=NC(H)PhMe}{2}](O{3}SCF{3}) reveal that the tetrahedral Ag}I{L{2} cation of this comp

  20. Marine Macrocyclic Imines, Pinnatoxins A and G: Structural Determinants and Functional Properties to Distinguish Neuronal α7 from Muscle α1(2)βγδ nAChRs.

    Science.gov (United States)

    Bourne, Yves; Sulzenbacher, Gerlind; Radić, Zoran; Aráoz, Rómulo; Reynaud, Morgane; Benoit, Evelyne; Zakarian, Armen; Servent, Denis; Molgó, Jordi; Taylor, Palmer; Marchot, Pascale

    2015-06-02

    Pinnatoxins are macrocyclic imine phycotoxins associated with algal blooms and shellfish toxicity. Functional analysis of pinnatoxin A and pinnatoxin G by binding and voltage-clamp electrophysiology on membrane-embedded neuronal α7, α4β2, α3β2, and muscle-type α12βγδ nicotinic acetylcholine receptors (nAChRs) reveals high-affinity binding and potent antagonism for the α7 and α12βγδ subtypes. The toxins also bind to the nAChR surrogate, acetylcholine-binding protein (AChBP), with low Kd values reflecting slow dissociation. Crystal structures of pinnatoxin-AChBP complexes (1.9-2.2 Å resolution) show the multiple anchoring points of the hydrophobic portion, the cyclic imine, and the substituted bis-spiroketal and cyclohexene ring systems of the pinnatoxins that dictate tight binding between the opposing loops C and F at the receptor subunit interface, as observed for the 13-desmethyl-spirolide C and gymnodimine A congeners. Uniquely, however, the bulky bridged EF-ketal ring specific to the pinnatoxins extends radially from the interfacial-binding pocket to interact with the sequence-variable loop F and govern nAChR subtype selectivity and central neurotoxicity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Bromine oxidation of a nickel(II) bis(oxime-imine) complex. Evidence for a single-step outer-sphere two-electron transfer

    Energy Technology Data Exchange (ETDEWEB)

    Lappin, A.G.; Osvath, P.; Baral, S.

    1987-09-23

    The kinetics and mechanism of the two-electron oxidation of the sexidentate bis(oxime-imine) complex of nickel(II), (Ni/sup II/L) (I), by bromine have been investigated in bromide ion media over the pH range 3.1-7.6 at 25/sup 0/C and 1.0 M ionic strength. In the presence of an excess of bromine or nickel(II), oxidation is monophasic, and the initial product is (Ni/sup IV/L)/sup 2 +/, a formal nickel(IV) species that undergoes subsequent reactions to give an unknown oxidation product with excess bromine at pH > 6 or to give (Ni/sup III/L)/sup +/ by comproportionation with excess nickel(II) at pH > 5. The sole kinetically important oxidant is Br/sub 2/, and second-order rate constants for reaction of (Ni/sup II/L) and its protonated form (Ni/sup II/LH)/sup +/ are 2.1 x 10/sup 7/ and 7.1 x 10/sup 5/ M/sup -1/ s/sup -1/, respectively. These rate constants are in line with a rate-determining single-electron-transfer reaction, and the proposed mechanism involves formation of a transient ion pair (Ni/sup III/L/sup +/,Br/sub 2//sup -/ in which the rate of subsequent electron transfer is comparable with the rate of ion-pair dissociation. In addition, the pulse-radiolysis technique has been used to investigate the reactions of nickel(II) with Br/sub 2//sup -/ to give (Ni/sup III/L)/sup +/, and rate constants for (Ni/sup II/L) and (Ni/sup II/LH)/sup +/ are 8.5 x 10/sup 8/ and 2.7 x 10/sup 8/ M/sup -1/ S/sup -1/, respectively, at 21/sup 0/C. 34 references, 3 figures, 3 tables.

  2. Higher fluorescence in platinum(iv) orthometallated complexes of perylene imine compared with their platinum(ii) or palladium(ii) analogues.

    Science.gov (United States)

    Expósito, J Emilio; Álvarez-Paíno, Marta; Aullón, Gabriel; Miguel, Jesús A; Espinet, Pablo

    2015-09-28

    The reaction of 3-perylenylmethylen-4'-ethylaniline () with [Pt2Me4(μ-SMe2)2] (and subsequent addition of PPh3) or with [Pt2(η(3)-C4H7)2(μ-Cl)2] produced cyclometallated Pt(II) complexes [Pt(C^N)Me(PPh3)] () and, respectively, [Pt2(C^N)2(μ-Cl)2] () (HC^N = 3-C20H11CH[double bond, length as m-dash]NC6H4-p-C2H5), with Pt bound to the ortho site of the perylenyl fragment. From the mononuclear complexes [Pt(C^N)L2] (L2 = acac (); S2COMe (); S2CNEt2 () are easily formed. Oxidative addition of methyl iodide to the square-planar Pt(II) complexes , , and gave the corresponding cyclometallated Pt(IV) compounds [Pt(C^N)L2MeI] , and . The X-ray structures of , , and show that the perylenyl fragment remains essentially flat in and and slightly twisted in . Comparison of the optical properties of these Pt(II) complexes with those reported for similar Pd(II) derivatives reveals that the change of metal exerts a notable influence on the UV-vis spectra. In solution at room temperature, all the Pt complexes exhibit fluorescence associated with the perylene fragment with low emission quantum yields for the Pt(II) complexes (IV) complexes: up to 29%, with emission lifetimes of 1-5 ns. Time-dependent density functional theory (TD-DFT) calculations were performed on the perylene imine and on representative complexes [M(C^N)(acac)] (M = Pd, Pt) and [Pt(C^N)(acac)MeI] to analyse the absorption spectra. These calculations support a perylene-dominated intraligand π-π*emissive state based on the HOMO and LUMO orbitals of the perylene chromophore, and a ligand-to-ligand charge-transfer (more intense for the Pt(II) complex) that explains the observed influence of the metal on the absorption properties.

  3. Synthesis, crystal structure, and H/D exchange of the inside protonated form of the cage imine 4,8,12-triaza-1-azoniatricyclo[6.6.3.2(4,12)]nonadec-1(15)-ene. A model for proton transfer through an aliphatic membrane

    DEFF Research Database (Denmark)

    Springborg, Johan; Nielsen, Bente; Olsen, Carl Erik;

    2002-01-01

    The reaction of the inside protonated form of the tricyclic amine 1,4,8,12-tetraazatricyclo[6.6.3.2(4.12)]nonadecane (1) with iron(III) affords the inside monoprotonated form of the corresponding imine 4,8,12-triaza-1-azoniatricyclo[6.6,3.2(4.12)]nonadec-1 (15)-ene (2), which was isolated...

  4. 脱氢枞基酰胺及亚胺衍生物对粘虫的拒食活性%Antifeedant Activities of Dehydroabietyl Amides and Imines Derivatives Against Mythimna separata

    Institute of Scientific and Technical Information of China (English)

    刘莉; 高艳清; 饶小平; 宋湛谦; 商士斌

    2014-01-01

    In this study,the antifeedant activities of rosin-based tricycle diterpenoids dehydroabietyl amides and imines derivatives against Mythimna separata were investigated by leaf-disc immersion method. The results showed that amide derivatives,A-1,A-3, A-4,A-8,A-10,and imine derivatives I-6 containing dehydroabietyl structure had good antifeedant activities to Mythimna separata and their antifeedant rates were all over 90% in 24 h. The antifeedant rates of A-1,A-4,A-8,A-10,and I-6 were over 80% in 48 h and 72 h. The majority of amide compounds showed antifeedant activities and some imine derivatives showed feeding attracion activities after long time. Some compounds could cause the death of armyworms during antifeedant activity test,so these compounds could be developed as insecticides.%采用叶碟浸液法,研究松香基三环二萜类脱氢枞基酰胺及亚胺衍生物对粘虫( Mythimna separata)的拒食活性。结果显示,含有脱氢枞基结构的酰胺衍生物脱氢枞基酰胺( A-1)、脱氢枞基酰苄胺( A-3)、脱氢枞基酰邻氟苯胺( A-4)、脱氢枞基酰三氟甲基苯胺(A-8)、脱氢枞基吗啉(A-10)及含有亚胺结构的衍生物脱氢枞胺对三氟甲基苯甲醛(I-6)对粘虫的拒食活性较高,24 h的拒食率均达到90%以上。A-1、A-4、A-8、A-10及I-6在48、72 h的拒食率也达到80%以上。大部分酰胺化合物表现出拒食活性,部分亚胺衍生物施药时间长的情况下表现出一定的诱食活性。部分化合物在拒食活性测试过程中发现幼虫死亡现象,可以作为杀虫剂继续开发。

  5. An easy stereoselective access to beta,gamma-aziridino alpha-amino ester derivatives via mannich reaction of benzophenone imines of glycine esters with N-sulfonyl alpha-chloroaldimines.

    Science.gov (United States)

    Kiss, Loránd; Mangelinckx, Sven; Sillanpää, Reijo; Fülöp, Ferenc; De Kimpe, Norbert

    2007-09-14

    Mannich-type addition of benzophenone imine glycinates across newly synthesized N-(p-toluenesulfonyl) alpha-chloroaldimines afforded gamma-chloro-alpha,beta-diamino ester derivatives with moderate diastereoselectivity as separable mixtures of anti and syn diastereomers. The gamma-chloro-alpha,beta-diamino esters were efficiently cyclized under basic conditions to the corresponding beta,gamma-aziridino alpha-amino ester derivatives, representing a new class of conformationally constrained heterocyclic alpha,beta-diamino acid derivatives. The relative configuration of the aziridines was determined via X-ray diffraction analysis. Mechanisms and intermediate transition states to explain the stereochemical outcome of the Mannich reaction with different substrates or under different conditions are proposed. The synthetic importance of the beta,gamma-aziridino alpha-amino ester derivatives is demonstrated by their conversion into the corresponding Boc-protected derivatives and ring opening reactions to alpha,beta-diamino esters and a gamma-amino alpha,beta-unsaturated amino ester.

  6. Triply Halide-Bridged Dinuclear Iridium(III) Complexes with Chiral Diphosphine Ligands as New Easy-to-Handle Iridium Catalysts for Asymmetric Hydrogenation of Imines and N-Heteroaromatics.

    Science.gov (United States)

    Mashima, Kazushi; Higashida, Kosuke; Iimuro, Atsuhiro; Nagae, Haruki; Kita, Yusuke

    2016-12-01

    Iridium(III) complexes bearing chiral ligands have proved to be active species in asymmetric hydrogenation of C=N bonds, though there are only a few iridium(III) precursors. We prepared triply halide-bridged dinuclear iridium complexes bearing chiral diphosphine ligands by simple treatment of the iridium(I) precursor, chiral diphosphine, and aqueous hydrogen halide. The strong advantage of these dinuclear iridium complexes is that they are air and moisture stable, leading to easy handling in asymmetric synthesis. The dinuclear iridium complexes exhibited high catalytic activity toward asymmetric hydrogenation of imines and N-heteroaromatics. Moreover, we demonstrated the application of triply halide-bridged dinuclear ruthenium(II) and rhodium(III) catalyst precursors for the asymmetric hydrogenation of ketonic substrates and simple olefins, respectively. © 2016 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Bright Fluorescence and Host-Guest Sensing with a Nanoscale M₄L₆ Tetrahedron Accessed by Self-Assembly of Zinc-Imine Chelate Vertices and Perylene Bisimide Edges.

    Science.gov (United States)

    Frischmann, Peter D; Kunz, Valentin; Würthner, Frank

    2015-06-15

    A highly luminescent Zn4L6 tetrahedron is reported with 3.8 nm perylene bisimide edges and hexadentate Zn(II)-imine chelate vertices. Replacing Fe(II) and monoamines commonly utilized in subcomponent self-assembly with Zn(II) and tris(2-aminoethyl)amine provides access to a metallosupramolecular host with the rare combination of structural integrity at concentrations <10(-7) mol L(-1) and an exceptionally high fluorescence quantum yield of Φ(em) =0.67. Encapsulation of multiple perylene or coronene guest molecules is accompanied by strong luminescence quenching. We anticipate this self-assembly strategy may be generalized to improve access to brightly fluorescent coordination cages tailored for host-guest light-harvesting, photocatalysis, and sensing.

  8. A development of motor skills in mental disability interfere?Zihinsel engel motor becerilerin gelişimine de engel mi?

    Directory of Open Access Journals (Sweden)

    Nurgül Özdemir

    2016-04-01

    engelli olmayan 20 lise öğrencisine motor becerilerin gelişimine yönelik olarak 12 hafta boyunca haftada 3 gün 2 saat antrenman yaptırılmış her iki grubun ön test son test sonuçları karşılaştırılmıştır. Öntest ve sontest ölçümlerinde deneklerin boy, yaş, esneklik, sıçrama, 50 m.sürat, durarak uzun atlama, mekik koşusu gibi değişkenlerinin ölçümleri alınarak karşılaştırmayapılmıştır. Sonuçların değerlendirilmesinde gruplar hem kendi içlerindeki hem de birbiri ile ön-test- sontest ölçümleri bakımından karşılaştırılmıştır. Araştırma verilerinin istatistiksel analizinde SPSS 17.00 İstatistik Paket Programı kullanılmıştır.Verilerinanalizinde aritmetik ortalama, Karışık Ölçüler İçin İki Faktörlü Anova Testi, Wilcoxon İşaretli Sıralar Testi istatistik teknikleri kullanılmıştır. Araştırma sonucunda 12 hafta uygulanan antrenmanların etkisiyle fiziksel gelişim özellikleri benzer fakat zeka düzeyleri farklı iki grupta yer alan deneklerin kilo oranlarında (p=.01, mekik koşusu (p=.04 ve durarak uzunu atlama (p=.04 becerilerinde anlamlı düzeyde gelişme gözlenmiştir. Ayrıca engelli olmayan deneklerin öntest ve sontest puanlarının boy (p=.00, sıçrama (p=.00, sürat (p=.00, esneklik (p=.02 becerilerinde de anlamlı düzeyde gelişme görülmüştür.

  9. Vanadium catalyzed direct synthesis of imines from amines or alcohols and amines by an aerobic oxidative reaction under mild conditions%温和条件下钒催化氧化胺、醇和胺直接合成亚胺

    Institute of Scientific and Technical Information of China (English)

    王连月; 陈波; 任兰会; 张恒耘; 吕迎; 高爽

    2015-01-01

    The direct synthesis of imines from amines or alcohols and amines by vanadium catalyzed aerobic oxidation was developed. Without an additive or promoter, various symmetrical and unsymmetrical imines were obtained in good to excellent yields under mild conditions with air as an environmen‐tally benign oxidant. The catalyst is very easy to prepare and use, and this catalytic system is also effective for the synthesis of heteroatom‐containing imines.%开发了钒催化氧化胺、醇和胺直接合成亚胺催化体系,无须额外的添加剂或促进剂,空气作为环境友好的氧源,温和条件下,能高收率地得到各种对称和非对称亚胺,并且催化剂非常容易制备和使用。该催化体系对含杂原子亚胺的合成也非常有效。

  10. Narrativas de uma equipe de enfermagem diante da iminência da morte = Narratives of a nursing team on the impending of death = Narrativas de un equipo de enfermería delante la muerte inminente

    Directory of Open Access Journals (Sweden)

    Moraes, Cleber José Aló de

    2014-01-01

    Full Text Available Tendo em vista a dor e o sofrimento que acompanham o cotidiano de pacientes e profissionais de Unidade de Terapia Intensiva, investigamos as produções imaginativas de uma equipe de enfermagem de UTI frente à iminência da morte, por meio de uma narrativa interativa. Apresentamos uma história fictícia sobre a morte de um colega de trabalho, para ser completada pelos participantes. A análise interpretativa psicanalítica das narrativas obtidas desvela o campo afetivo-emocional da Inevitabilidade da Morte, a partir do qual se organizam três subcampos. Primeiro, a Impotência, caracterizado pelo sentimento de fracasso da equipe quando não consegue subjugar a morte. Segundo, a Indiferença, expressa por reações predominantemente intelectualizadas e pelo distanciamento emocional como defesas contra o impacto emocional da morte. Terceiro, a Ausência Assimilada, o qual aponta para a integração entre uma potência relativa e a vivência da perda, resultando na aceitação da morte como parte integrante do viver

  11. Attachment and growth of fibroblasts on poly(L-lactide/epsilon-caprolactone) scaffolds prepared in supercritical CO2 and modified by polyethylene imine grafting with ethylene diamine-plasma in a glow-discharge apparatus.

    Science.gov (United States)

    Aydin, H M; Türk, M; Calimli, A; Pişkin, E

    2006-09-01

    In this study, a copolymer of L-lactide and epsilon-caprolactone (Mn: 73,523, Mw: 127,990 and PI: 1.74) was synthesized by ring-opening polymerization by using stannous octoate as the catalyst. FTIR, 1H-NMR and DSC confirmed the copolymer formation. The copolymer films were prepared and a novel method was developed to produce highly porous sponges for potential use in tissue engineering. Films were subjected to supercritical CO2 at 3300 psi and 70 degrees C to create porous structures for production of possible tissue engineering scaffolds. The pore sizes were in the range of 40-80 microm. The copolymer films were pre-wetted with polyethylene imine (PEI) and then treated with ethylene diamine (EDA)-plasma in glow-discharge apparatus. Gas plasma surface modification of three-dimensional scaffolds fabricated by supercritical carbon dioxide technique was demonstrated to enhance cell adhesion, proliferation, and differentiation over 6 days in culture using L929 fibroblast cell line. Alkaline phosphatase (ALP) activity and glucose uptake in cell culture medium were followed in the cell culture experiments. Fibroblastic cell attachment and growth on the EDA-plasma treated scaffolds were rather low. However, both cell attachment and growth were significantly increased by PEI pre-treatment before EDA-plasma. The changes in ALP activity and glucose uptake also supported the cell growth behavior on these PEI and EDA-plasma treated scaffolds.

  12. Development of a dipodal Schiff base ligand with N-imine and O-naphtholate donors: A potential chelator towards Cu(II) metal ion established through potentiometric and spectrophotometric studies

    Science.gov (United States)

    Baral, Minati; Gupta, Amit; Kanungo, B. K.

    2015-08-01

    A novel hydroxynaphthaldehyde derived Schiff base ligand N,N'-bis-[2-[(2-hydroxy-1-naphthyl)methyleneamino]ethyl]propanediamide (DOTA2HNAP) containing nitrogen and oxygen donor atoms has been developed. The lowest energy molecular structure of DOTA2HNAP and its complexes with Cu (II) metal ion were examined by molecular mechanics using MM+ force which later was re-optimized by semi-empirical method. The theoretical IR and UV spectra of the ligand were obtained using semi empirical/ZINDO/PM3 and were compared with the experimental ones. The coordinating ability of DOTA2HNAP with H+ and Cu(II) ions was investigated in 1:99 (DMSO: water) binary solvent mixture at 25±1°C by potentiometric and spectrophotometric method. The electronic spectra of the ligand show three distinct peaks (253nm, 320nm and 360nm) implicating existence of the Schiff base in quinone form that was well supported by theoretical spectral studies. Out of various complex species forming in solution, all the metal ions show higher stability of complexes when in 1:1 metal-ligand stoichiometry, binding through two N-imine and two O-naphtholate groups.

  13. Development of a dipodal Schiff base ligand with N-imine and O-naphtholate donors: A potential chelator towards Cu(II) metal ion established through potentiometric and spectrophotometric studies

    Energy Technology Data Exchange (ETDEWEB)

    Baral, Minati, E-mail: minatib@gmail.com; Gupta, Amit [Department of Chemistry, National Institute of Technology, Kurukshetra, Haryana (India); Kanungo, B. K. [Department of Chemistry, Sant Longowal Institute of Engineering and Technology, Longowal, Punjab (India)

    2015-08-28

    A novel hydroxynaphthaldehyde derived Schiff base ligand N,N’-bis-[2-[(2-hydroxy-1-naphthyl)methyleneamino]ethyl]propanediamide (DOTA2HNAP) containing nitrogen and oxygen donor atoms has been developed. The lowest energy molecular structure of DOTA2HNAP and its complexes with Cu (II) metal ion were examined by molecular mechanics using MM+ force which later was re-optimized by semi-empirical method. The theoretical IR and UV spectra of the ligand were obtained using semi empirical/ZINDO/PM3 and were compared with the experimental ones. The coordinating ability of DOTA2HNAP with H{sup +} and Cu(II) ions was investigated in 1:99 (DMSO: water) binary solvent mixture at 25±1°C by potentiometric and spectrophotometric method. The electronic spectra of the ligand show three distinct peaks (253nm, 320nm and 360nm) implicating existence of the Schiff base in quinone form that was well supported by theoretical spectral studies. Out of various complex species forming in solution, all the metal ions show higher stability of complexes when in 1:1 metal-ligand stoichiometry, binding through two N-imine and two O-naphtholate groups.

  14. Synthesis, spectral and theoretical studies of Ni(II), Pd(II) and Pt(II) complexes of 5-mercapto-1,2,4-triazole-3-imine-2‧-hydroxynaphyhaline

    Science.gov (United States)

    Gaber, Mohamed; El-Ghamry, Hoda; Atlam, Faten; Fathalla, Shaimaa

    2015-02-01

    Ni(II), Pd(II) and Pt(II) complexes of 5-mercapto-1,2,4-triazole-3-imine-2‧-hydroxynaphthaline have been isolated and characterized by elemental analysis, IR, 1H NMR, EI-mass, UV-vis, molar conductance, magnetic moment measurements and thermogravimetric analysis. The molar conductance values indicated that the complexes are non-electrolytes. The magnetic moment values of the complexes displayed diamagnetic behavior for Pd(II) and Pt(II) complexes and tetrahedral geometrical structure for Ni(II) complex. From the bioinorganic applications point of view, the interaction of the ligand and its metal complexes with CT-DNA was investigated using absorption and viscosity titration techniques. The Schiff-base ligand and its metal complexes have also been screened for their antimicrobial and antitumor activities. Also, theoretical investigation of molecular and electronic structures of the studied ligand and its metal complexes has been carried out. Molecular orbital calculations were performed using DFT (density functional theory) at B3LYP level with standard 6-31G(d,p) and LANL2DZ basis sets to access reliable results to the experimental values. The calculations were performed to obtain the optimized molecular geometry, charge density distribution, extent of distortion from regular geometry, the highest occupied molecular orbital (HOMO), the lowest unoccupied molecular orbital (LUMO), Mulliken atomic charges, reactivity index (ΔE), dipole moment (D), global hardness (η), softness (σ), electrophilicity index (ω), chemical potential and Mulliken electronegativity (χ).

  15. Synthesis, spectral and theoretical studies of Ni(II), Pd(II) and Pt(II) complexes of 5-mercapto-1,2,4-triazole-3-imine-2'-hydroxynaphthaline.

    Science.gov (United States)

    Gaber, Mohamed; El-Ghamry, Hoda; Atlam, Faten; Fathalla, Shaimaa

    2015-02-25

    Ni(II), Pd(II) and Pt(II) complexes of 5-mercapto-1,2,4-triazole-3-imine-2'-hydroxynaphthaline have been isolated and characterized by elemental analysis, IR, (1)H NMR, EI-mass, UV-vis, molar conductance, magnetic moment measurements and thermogravimetric analysis. The molar conductance values indicated that the complexes are non-electrolytes. The magnetic moment values of the complexes displayed diamagnetic behavior for Pd(II) and Pt(II) complexes and tetrahedral geometrical structure for Ni(II) complex. From the bioinorganic applications point of view, the interaction of the ligand and its metal complexes with CT-DNA was investigated using absorption and viscosity titration techniques. The Schiff-base ligand and its metal complexes have also been screened for their antimicrobial and antitumor activities. Also, theoretical investigation of molecular and electronic structures of the studied ligand and its metal complexes has been carried out. Molecular orbital calculations were performed using DFT (density functional theory) at B3LYP level with standard 6-31G(d,p) and LANL2DZ basis sets to access reliable results to the experimental values. The calculations were performed to obtain the optimized molecular geometry, charge density distribution, extent of distortion from regular geometry, the highest occupied molecular orbital (HOMO), the lowest unoccupied molecular orbital (LUMO), Mulliken atomic charges, reactivity index (ΔE), dipole moment (D), global hardness (η), softness (σ), electrophilicity index (ω), chemical potential and Mulliken electronegativity (χ).

  16. Sensitive and selective detection of trace copper in standard alloys, food and biological samples using a bulk optode based on N,N'-(4,4'-ethylene biphenyl) bis(3-methoxy salicylidine imine) as neutral carrier

    Science.gov (United States)

    Arvand, Majid; Lashkari, Zahra

    2013-04-01

    In this paper, an optical sensing film has been proposed for sensitive determination of copper (ІІ) ion in aqueous solutions. The copper sensing membrane was prepared by incorporating N,N'-(4,4'-ethylene biphenyl) bis(3-methoxy salicylidine imine) as ionophore in the plasticized PVC membrane containing bis(2-ethylhexyl) sebacate (DOS) as plasticizer. This proposed membrane works on the basis of a cation-exchange mechanism and shows a significant absorbance signal change on exposure to acetate buffer solution of pH 4.0 containing copper ion. The proposed sensing film displays a linear range of 0.01-32.0 μg mL-1 with a limit of detection 0.008 μg mL-1. Moreover, upon the introduction of a negatively charged lipophilic additive (oleic acid) into the membrane, the optode displayed enhanced sensitivity. In addition, satisfactory analytical sensing characteristics for determining copper (II) ion were obtained in terms of the selectivity, stability and reproducibility. The response time of the optode was less than 3 min, depending on the concentration of Cu(ІІ) ions. The optode membrane has been applied to determine Cu(II) in various real samples.

  17. Novel and High Affinity 2-[(Diphenylmethyl)sulfinyl]acetamide (Modafinil) Analogues as Atypical Dopamine Transporter Inhibitors

    DEFF Research Database (Denmark)

    Cao, Jianjing; Slack, Rachel D.; Bakare, Oluyomi M.

    2016-01-01

    pharmacological profiles in animal models of cocaine and methamphetamine abuse. Herein, we report a series of modafinil analogues that have an atypical DAT inhibitor profile. We extended SAR by chemically manipulating the oxidation states of the sulfoxide and the amide functional groups, halogenating the phenyl...

  18. Camelina sativa defatted seed meal contains both alkyl sulfinyl glucosinolates and quercetin that synergize bioactivity

    Science.gov (United States)

    Camelina sativa L. Crantz is under development as a novel oil-seed crop, yet bioefficacy of camelina phytochemicals is unknown. Defatted camelina seed meal contains two major aliphatic glucosinolates (GSL), glucoarabin (9-(methylsulfinyl)nonylglucosinolate; GSL 9) and glucocamelinin (10-(methylsulfi...

  19. Sulfinylated Azadecalins act as functional mimics of a pollen germination stimulant in Arabidopsis pistils

    OpenAIRE

    Qin, Yuan; Wysocki, Ronald J.; Somogyi, Arpad; Feinstein, Yelena; Franco, Jessica Y.; Tsukamoto, Tatsuya; Dunatunga, Damayanthi; Levy, Clara; Smith, Steven; Simpson, Robert; Gang, David; Johnson, Mark A.; Palanivelu, Ravishankar

    2011-01-01

    Polarized cell elongation is triggered by small molecule cues during development of diverse organisms. During plant reproduction, pollen interactions with the stigma result in the polar outgrowth of a pollen tube, which delivers sperm cells to the female gametophyte to effect double fertilization. In many plants, pistils stimulate pollen germination. However, in Arabidopsis, the effect of pistils on pollen germination and the pistil factors that stimulate pollen germination remain poorly char...

  20. Sulfinylated azadecalins act as functional mimics of a pollen germination stimulant in Arabidopsis pistils.

    Science.gov (United States)

    Qin, Yuan; Wysocki, Ronald J; Somogyi, Arpad; Feinstein, Yelena; Franco, Jessica Y; Tsukamoto, Tatsuya; Dunatunga, Damayanthi; Levy, Clara; Smith, Steven; Simpson, Robert; Gang, David; Johnson, Mark A; Palanivelu, Ravishankar

    2011-12-01

    Polarized cell elongation is triggered by small molecule cues during development of diverse organisms. During plant reproduction, pollen interactions with the stigma result in the polar outgrowth of a pollen tube, which delivers sperm cells to the female gametophyte to effect double fertilization. In many plants, pistils stimulate pollen germination. However, in Arabidopsis, the effect of pistils on pollen germination and the pistil factors that stimulate pollen germination remain poorly characterized. Here, we demonstrate that stigma, style, and ovules in Arabidopsis pistils stimulate pollen germination. We isolated an Arabidopsis pistil extract fraction that stimulates Arabidopsis pollen germination, and employed ultra-high resolution electrospray ionization (ESI), Fourier-transform ion cyclotron resonance (FT-ICR) and MS/MS techniques to accurately determine the mass (202.126 Da) of a compound that is specifically present in this pistil extract fraction. Using the molecular formula (C10H19NOS) and tandem mass spectral fragmentation patterns of the m/z (mass to charge ratio) 202.126 ion, we postulated chemical structures, devised protocols, synthesized N-methanesulfinyl 1- and 2-azadecalins that are close structural mimics of the m/z 202.126 ion, and showed that they are sufficient to stimulate Arabidopsis pollen germination in vitro (30 μm stimulated approximately 50% germination) and elicit accession-specific response. Although N-methanesulfinyl 2-azadecalin stimulated pollen germination in three species of Lineage I of Brassicaceae, it did not induce a germination response in Sisymbrium irio (Lineage II of Brassicaceae) and tobacco, indicating that activity of the compound is not random. Our results show that Arabidopsis pistils promote germination by producing azadecalin-like molecules to ensure rapid fertilization by the appropriate pollen.

  1. In vivo parameters influencing 2-Cys Prx oligomerization: The role of enzyme sulfinylation.

    Science.gov (United States)

    Noichri, Y; Palais, G; Ruby, V; D'Autreaux, B; Delaunay-Moisan, A; Nyström, T; Molin, M; Toledano, M B

    2015-12-01

    2-Cys Prxs are H2O2-specific antioxidants that become inactivated by enzyme hyperoxidation at elevated H2O2 levels. Although hyperoxidation restricts the antioxidant physiological role of these enzymes, it also allows the enzyme to become an efficient chaperone holdase. The critical molecular event allowing the peroxidase to chaperone switch is thought to be the enzyme assembly into high molecular weight (HMW) structures brought about by enzyme hyperoxidation. How hyperoxidation promotes HMW assembly is not well understood and Prx mutants allowing disentangling its peroxidase and chaperone functions are lacking. To begin addressing the link between enzyme hyperoxidation and HMW structures formation, we have evaluated the in vivo 2-Cys Prxs quaternary structure changes induced by H2O2 by size exclusion chromatography (SEC) on crude lysates, using wild type (Wt) untagged and Myc-tagged S. cerevisiae 2-Cys Prx Tsa1 and derivative Tsa1 mutants or genetic conditions known to inactivate peroxidase or chaperone activity or altering the enzyme sensitivity to hyperoxidation. Our data confirm the strict causative link between H2O2-induced hyperoxidation and HMW formation/stabilization, also raising the question of whether CP hyperoxidation triggers the assembly of HMW structures by the stacking of decamers, which is the prevalent view of the literature, or rather, the stabilization of preassembled stacked decamers.

  2. Single-Site Cobalt Catalysts at New Zr8(μ2-O)8(μ2-OH)4 Metal-Organic Framework Nodes for Highly Active Hydrogenation of Alkenes, Imines, Carbonyls, and Heterocycles.

    Science.gov (United States)

    Ji, Pengfei; Manna, Kuntal; Lin, Zekai; Urban, Ania; Greene, Francis X; Lan, Guangxu; Lin, Wenbin

    2016-09-21

    We report here the synthesis of robust and porous metal-organic frameworks (MOFs), M-MTBC (M = Zr or Hf), constructed from the tetrahedral linker methane-tetrakis(p-biphenylcarboxylate) (MTBC) and two types of secondary building units (SBUs): cubic M8(μ2-O)8(μ2-OH)4 and octahedral M6(μ3-O)4(μ3-OH)4. While the M6-SBU is isostructural with the 12-connected octahedral SBUs of UiO-type MOFs, the M8-SBU is composed of eight M(IV) ions in a cubic fashion linked by eight μ2-oxo and four μ2-OH groups. The metalation of Zr-MTBC SBUs with CoCl2, followed by treatment with NaBEt3H, afforded highly active and reusable solid Zr-MTBC-CoH catalysts for the hydrogenation of alkenes, imines, carbonyls, and heterocycles. Zr-MTBC-CoH was impressively tolerant of a range of functional groups and displayed high activity in the hydrogenation of tri- and tetra-substituted alkenes with TON > 8000 for the hydrogenation of 2,3-dimethyl-2-butene. Our structural and spectroscopic studies show that site isolation of and open environments around the cobalt-hydride catalytic species at Zr8-SBUs are responsible for high catalytic activity in the hydrogenation of a wide range of challenging substrates. MOFs thus provide a novel platform for discovering and studying new single-site base-metal solid catalysts with enormous potential for sustainable chemical synthesis.

  3. Nitrile imines and nitrile ylides: rearrangements of benzonitrile N-methylimine and benzonitrile dimethylmethylide to azabutadienes, carbodiimides, and ketenimines. Chemical activation in thermolysis of azirenes, tetrazoles, oxazolones, isoxazolones, and oxadiazolones.

    Science.gov (United States)

    Bégué, Didier; Dargelos, Alain; Berstermann, Hans M; Netsch, Klaus P; Bednarek, Pawel; Wentrup, Curt

    2014-02-07

    Flash vacuum thermolysis (FVT) of 1-methyl-5-phenyltetrazole (5b), 2-methyl-5-phenyltetrazole (1b), and 3-methyl-5-phenyl-1,3,4-oxadiazol-2(3H)-one (3b) affords the nitrile imine (2b), which rearranges in part to N-methyl-N'-phenylcarbodiimide (7b). Another part of 2b undergoes a 1,4-H shift to the diazabutadiene (13). 13 undergoes two chemically activated decompositions, to benzonitrile and CH2═NH and to styrene and N2. FVT of 2,2-dimethyl-4-phenyl-oxazol-5(2H)-one (16) at 400 °C yields 3-methyl-1-phenyl-2-azabutadiene (18) in high yield. In contrast, FVT of 3,3-dimethyl-2-phenyl-1-azirene (21) at 600 °C or 4,4-dimethyl-3-phenyl-isoxazolone (20) at 600 °C affords only a low yield of azabutadiene (18) due to chemically activated decomposition of 18 to styrene and acetonitrile. There are two reaction paths from azirene (21): one (path a) leading to nitrile ylide (17) and the major products styrene and acetonitrile and the other (path b) leading to the vinylnitrene (22) and ketenimine (23). The nitrile ylide PhC(-)═N(+)═C(CH3)2 (17) is implicated as the immediate precursor of azabutadiene (18). FVT of either 3-phenylisoxazol-5(4H)one (25) or 2-phenylazirene (26) at 600 °C affords N-phenylketenimine (28). The nitrile ylide PhC(-)═N(+)═CH2 (30) is postulated as a reversibly formed intermediate. N-Phenylketenimine (28) undergoes chemically activated free radical rearrangement to benzyl cyanide. The mechanistic interpretations are supported by calculations of the energies of key intermediates and transition states.

  4. Polyethylene imine-grafted ACF@BiOI0.5Cl0.5 as a recyclable photocatalyst for high-efficient dye removal by adsorption-combined degradation

    Science.gov (United States)

    Li, Hongyan; Li, Najun; Chen, Dongyun; Xu, Qingfeng; Lu, Jianmei

    2017-05-01

    A recyclable photocatalyst with adsorption property was prepared for high-efficient complete removal of anionic dyes from water by synergetic adsorption and photocatalytic degradation. Firstly, binary bismuth oxyhalide composed as BiOI0.5Cl0.5 was immobilized on activated carbon fibers (ACF) to get a recyclable photocatalyst (ACF@BiOI0.5Cl0.5) via one-step solvothermal method. Then it was modified with branched polyethylene imine (PEI) whose abundant amino groups can adsorb contaminants from water by electrostatic interaction. SEM images showed that the nanosheets-based flower-like photocatalytic microspheres uniformly distributed on the ACF surface after grafting of small amount of PEI. But from TGA results we can deduce that the percentage of PEI grafted onto ACF@BiOI0.5Cl0.5 is about 18 wt%. During the synergistic process, the grafted PEI and immobilized BiOI0.5Cl0.5 are worked as the adsorbent and the photocatalyst, respectively. In addition, ACF, as flexible, conductive and corrosion-resistant supports, are beneficial to the photocatalytic degradation process. So the obtained composite PEI-g-ACF@BiOI0.5Cl0.5 has a high removal efficiency of contaminants under visible light irradiation with the synergistic effect of adsorption and photocatalytic degradation. And after facial separation without centrifuge, it can be reused without regeneration because of the real-time complete degradation of the adsorbed contaminants on the surface of the composite photocatalyst.

  5. Synthesis of poly(ethylene glycol)-g-chitosan-g-poly(ethylene imine) co-polymer and in vitro study of its suitability as a gene-delivery vector.

    Science.gov (United States)

    Zhang, Wei; Pan, Shirong; Wen, Yuting; Luo, Xin; Zhang, Xuan

    2010-01-01

    There are two main hindrances for the application of chitosan (CS) as a gene-delivery vector: poor water solubility and low transfection efficiency. To address these problems, we modified chitosan with poly(ethylene glycol) (PEG) and poly(ethylene imine) (PEI). As previously described, PEG was grafted onto CS by a reaction between the activated PEG and CS amine. This increased the solubility of CS in neutral or basic solution. Then, monomers of PEI (i.e., aziridine) were polymerized on the CS chain of the PEG(40k)-CS(50k) co-polymer obtained in the previous step. The resulting PEG-CS-PEI (PCP) co-polymer was characterized by (1)H-NMR, (13)C-NMR and gel-permeation chromatography (GPC). It was found in the preliminary experiments that, amongst the series of PEG-CS-PEI co-polymers with various PEI molecular weights, PEG(40k)-CS(50k)-PEI(20k) was the most efficient one; therefore, it was chosen for the study. The PCP co-polymer showed lower cytotoxicity compared to PEI (25k) by MTT assay. Particle size and zeta potential of PCP/DNA complexes were measured by dynamic light scattering (DLS) and were shown to be predominantly affected by N/P ratios. PCP/DNA complexes at N/P ratio 20 were observed under a transmission electron microscope (TEM) as spherical particles with a mean diameter of about 50 nm. Plasmid DNA could be efficiently protected by PCP co-polymer from DNase I. The in vitro gene-transfection efficiency of PCP/pEGFP was higher than that of PEI(25k)/pEGFP and was markedly facilitated by serum.

  6. Comparison of DC and AC Transport in 1.5-7.5 nm Oligophenylene Imine Molecular Wires across Two Junction Platforms: Eutectic Ga-In versus Conducting Probe Atomic Force Microscope Junctions.

    Science.gov (United States)

    Sangeeth, C S Suchand; Demissie, Abel T; Yuan, Li; Wang, Tao; Frisbie, C Daniel; Nijhuis, Christian A

    2016-06-15

    We have utilized DC and AC transport measurements to measure the resistance and capacitance of thin films of conjugated oligophenyleneimine (OPI) molecules ranging from 1.5 to 7.5 nm in length. These films were synthesized on Au surfaces utilizing the imine condensation chemistry between terephthalaldehyde and 1,4-benzenediamine. Near edge X-ray absorption fine structure (NEXAFS) spectroscopy yielded molecular tilt angles of 33-43°. To probe DC and AC transport, we employed Au-S-OPI//GaOx/EGaIn junctions having contact areas of 9.6 × 10(2) μm(2) (10(9) nm(2)) and compared to previously reported DC results on the same OPI system obtained using Au-S-OPI//Au conducting probe atomic force microscopy (CP-AFM) junctions with 50 nm(2) areas. We found that intensive observables agreed very well across the two junction platforms. Specifically, the EGaIn-based junctions showed: (i) a crossover from tunneling to hopping transport at molecular lengths near 4 nm; (ii) activated transport for wires >4 nm in length with an activation energy of 0.245 ± 0.008 eV for OPI-7; (iii) exponential dependence of conductance with molecular length with a decay constant β = 2.84 ± 0.18 nm(-1) (DC) and 2.92 ± 0.13 nm(-1) (AC) in the tunneling regime, and an apparent β = 1.01 ± 0.08 nm(-1) (DC) and 0.99 ± 0.11 nm(-1) (AC) in the hopping regime; (iv) previously unreported dielectric constant of 4.3 ± 0.2 along the OPI wires. However, the absolute resistances of Au-S-OPI//GaOx/EGaIn junctions were approximately 100 times higher than the corresponding CP-AFM junctions due to differences in metal-molecule contact resistances between the two platforms.

  7. SYNTHESIS OF pH RESPONSIBLE DRUG DELIVERY SYSTEMS BY THE INCLUSION OF A DYNAMIC COVALENT BOND,BENZOIC-IMINE%苯甲酰亚胺动态化学键在构筑pH响应药物载体中的应用

    Institute of Scientific and Technical Information of China (English)

    屈小中; 杨振忠

    2011-01-01

    介绍了作者近期利用苯甲酰亚胺化学结构构筑对生理环境pH值响应的药物输送体系的工作进展.亚胺(Schiff碱)作为动态共价键早已为人们所熟知,但其在pH敏感药物输送载体领域的应用并不多.苯甲酰亚胺由于苯环与碳氮双键共轭作用使其在生理pH值下的稳定性更好,同时具有在弱酸环境下(如固态肿瘤细胞外环境、内涵体环境等)的水解特性,适合作为pH响应性单元构筑药物控制释放载体,如聚合物胶束、纳米颗粒等.此外,利用Schiff碱反应随pH值改变的可逆性还可制备可注射凝胶等药物输送体系.%The article highlights the recent approaches on the design and synthesis of drug delivery systems with a dynamic covalent bond,I. E. Benzoic-imine, that renders the responsiveness of the vehicles to the pH changes under physiological conditions. Although the characteristics of Schiff base in chemical compounds and polymers have been well documented, recent reports demonstrate the advantages of the derivative benzoic-imine bond on the construction of pH sensitive polymeric micelles, nanoparticles and injectable hydrogels for pharmaceutical applications. In those systems,the benzoic-imine linkage is stable at physiological pH (7.4) , and hydrolyzes following a pH drop to mild acidic, which covers the extracellular pH of solid tumor (6. 5) , endosome and lysosome environments (5 ~6.5). Therefore the benzoic-imine containing delivery systems are promising in tumor-targeting and intracellular delivery.

  8. An investigation of the effects of CeO2 crystal planes on the aerobic oxidative synthesis of imines from alcohols and amines%纳米二氧化铈催化制备亚胺

    Institute of Scientific and Technical Information of China (English)

    张志鑫; 王业红; 王敏; 吕建民; 李利花; 张哲; 李名润; 蒋景阳; 王峰

    2015-01-01

    化合物的转化率可达89%以上,亚胺类化合物的选择性可达90%以上.通过水热合成法分别制备了棒状CeO2、立方体CeO2和八面体CeO2,并通过X射线衍射、透射电子显微镜和高分辨透射电子显微镜确证了其结构和形貌,结果表明三种形貌的CeO2均为纯相的CeO2,其中棒状CeO2暴露(110)和(100)晶面,立方体CeO2暴露(100)晶面,八面体CeO2暴露(111)晶面.并以苯甲醇氧化反应和苯甲醇与苯胺反应为探针研究了其催化性能.结果发现:不同形貌的CeO2具有显著不同的催化活性,其中棒状CeO2表现出最优异的催化性能,立方体CeO2和八面体CeO2次之.通过Raman光谱表征了不同形貌CeO2的氧空位性质并比较了它们的氧空位浓度.结果发现:棒状CeO2的氧空位浓度相对值(A595/A462)为0.077,高于立方体CeO2和八面体CeO2.通过比较分析计算可知,在CeO2(110),(100)和(111)三种晶面中,(110)晶面因其具有最多的氧空位而表现出最高的催化活性和优异的氧化还原性质,(110)晶面上亚胺的生成速率为4.618 mmol/(g·h),分别为(100)晶面和(111)晶面上的32倍和49倍.该研究有助于提高认识CeO2基催化材料的低温氧化还原性质.%We herein report the effects of CeO2 crystal planes on the oxidative coupling of alcohols and amines to form imines. CeO2 exhibits significant catalytic activity under mild reaction conditions (60 °C) during the synthesis of 13 different imines, giving>89%conversions and>90%selectivities. The crystal planes of CeO2 greatly affect the catalytic performance. Among the crystal planes investigat-ed (the (110), (100) and (111) planes), the (110) plane shows the strongest redox ability and thus the best catalytic activity, generating a 97%yield of the imine at 60 °C in 2 h, because it contains the highest concentration of oxygen vacancies.

  9. In-source formation of N-acetyl-p-benzoquinone imine (NAPQI), the putatively toxic acetaminophen (paracetamol) metabolite, after derivatization with pentafluorobenzyl bromide and GC-ECNICI-MS analysis.

    Science.gov (United States)

    Tsikas, Dimitrios; Trettin, Arne; Zörner, Alexander A; Gutzki, Frank-Mathias

    2011-05-15

    Pentafluorobenzyl (PFB) bromide (PFB-Br) is a versatile derivatization reagent for numerous classes of compounds. Under electron-capture negative-ion chemical ionization (ECNICI) conditions PFB derivatives of acidic compounds readily and abundantly ionize to produce intense anions due to [M-PFB](-). In the present article we investigated the PFB-Br derivatization of unlabelled acetaminophen (N-acetyl-p-aminophenol, NAPAP-d(0); paracetamol; MW 151) and tetradeuterated acetaminophen (NAPAP-d(4); MW 155) in anhydrous acetonitrile and their GC-ECNICI-MS behavior using methane as the buffer gas. In addition to the expected anions [M-PFB](-) at m/z 150 from NAPAP-d(0) and m/z 154 from NAPAP-d(4), we observed highly reproducibly almost equally intense anions at m/z 149 and m/z 153, respectively. Selected ion monitoring of these ions is suitable for specific and sensitive quantification of acetaminophen in human plasma and urine. Detailed investigations suggest in-source formation of N-acetyl-p-benzoquinone imine (NAPQI; MW 149), the putatively toxic acetaminophen metabolite, from the PFB ether derivative of NAPAP. GC-ECNICI-MS of non-derivatized NAPAP did not produce NAPQI. The peak area ratio of m/z 149 to m/z 150 and of m/z 153 to m/z 154 decreased with increasing ion-source temperature in the range 100-250°C. Most likely, NAPQI formed in the ion-source captures secondary electrons to become negatively charged (i.e., [NAPQI](-)) and thus detectable. Formation of NAPQI was not observed under electron ionization (EI) conditions, i.e., by GC-EI-MS, from derivatized and non-derivatized NAPAP. NAPQI was not detectable in flow injection analysis LC-MS of native NAPAP in positive electrospray ionization (ESI) mode, whereas in negative ESI mode low extent NAPQI formation was observed (ion-sources of mass spectrometers may form intermediates that are produced from activated drugs in enzyme-catalyzed reactions.

  10. Efficient resolution of (±)-rans-2,3-diphenylpiperazine using (1)-(+)-10-camphorsulfonic acid and enrichment of enantiomeric purity of non-racemic 2,3-diphenylpiperazine using different achiral acids

    Indian Academy of Sciences (India)

    Pothiappan Vairaprakash; Mariappan Periasamy

    2008-01-01

    Enantiomerically pure (,)-(+)-2,3-diphenylpiperazine with 98% was obtained by resolution of the corresponding racemic mixture using (1)-(+)-10-camphorsulfonic acid. The partially resolved enriched sample of (,)-(-)-2,3-diphenylpiperazine with 73% ee was purified to obtain samples of 97% ee using different achiral acids via the preparation of either homochiral or heterochiral hydrogen bonded aggregates.

  11. Intramolecular Cycloaddition of Imines of Cysteine Derivatives

    Directory of Open Access Journals (Sweden)

    Teresa M. V. D. Pinho e Melo

    1998-02-01

    Full Text Available Azomethine ylides were generated from Schiffs bases of S-allylcysteine methyl ester and their intramolecular 1,3-dipolar cycloadditions were studied. These reactions led to the synthesis of thieno[3,4-b]pyrrole derivatives in good yield.

  12. Polyethylene imine-metal salt solid electrolyte

    Science.gov (United States)

    Davis, G. T.; Chiang, C. K.; Takahashi, T.

    1985-02-01

    This research pertains to the development of new solid battery electrolytes. An object of this invention is to provide polymeric electrolytes using a wider variety of metal salts. These and other objects of this invention are accomplished by providing: (1) a solid polymer electrolyte comprising: a matrix of linear poly(ethylene amine) having the formula (-CH2CH2NH-)n; and (2) a metal salt which is LiI, LiClO4, NaI, NaBr, KI, CsSCN, AgNO3, CuCl1, CoCl2, or Mg(ClO4)2, wherein the salt is dissolved in and distributed throughout the poly(ethylene amine) matrix and from more than zero to 0.10 moles of salt are used per mole of monomer repeat unit, (-CH2CH2NH-).

  13. Syntheses and Biological Activities of Novel Imine and Imide Derivatives Bearing 1,2,4-Triazole Moiety%含1,2,4-三唑环的亚胺及酰亚胺类化合物的合成及生物活性

    Institute of Scientific and Technical Information of China (English)

    杨海葵; 许万福; 段安娜; 游文玮; 赵培亮

    2014-01-01

    According to active groups combination principle, a series of novel imine and imide derivatives bearing 1,2,4-triazole moiety was designed and synthesized. The key intermediate 3-substituted phenyl-4-ami-no-1,2,4-triazole-5-thiones was synthesized by esterification, hydrazinolysis, salt and cyclization reactions, and then was condensed with aromatic aldehydes and isobenzofuran-1 , 3-dione to obtain imine and imide derivatives, which were subjected to the thioetherification with suitable halides ( RX ) to produce the corre-sponding 24 novel imine and imide derivatives bearing 1,2,4-triazole moiety. The structures of target com-pounds were fully characterized by 1 H NMR, IR, mass spectroscopy and elemental analysis. The preliminary bioassay results showed that most of the compounds possessed certain fungicidal activities. At the concentration of 150 mg/L, the inhibition rates of compounds 9a, 9d and 9e against Rhizoctonia solani were very similar with the commercial fungicide Flusilazole. Meanwhile, the preliminary structure-activity relationships( SAR) were discussed in order to investigate the essential structures required for their bioactivities. In addition, their in vitro antitumor activities were evaluated against three cancer cell lines [ human alveolar epithelial cells ( A549 ) , human breast cancer cells ( MD-MBA-231 ) and human prostate cancer cells ( PC-3 M ) ] by the methyl thiazolyl tetrazolium(MTT) chromatometry method with Fluorouracil as a positive contrast drug. The bioassay data indicated that compounds 7c, 7f and 9k showed similar antiproliferation with Fluorouracil against A549 cell lines with IC50 values of 38.3, 44.6 and 36.7μmol/L, respectively. Most interestingly, compound 9k also exhibited a broad spectrum of antitumor activity against MCF-7 and MKN45 with IC50 values of 147.5 and 60.7 μmol/L, respectively.%以取代苯甲酸为原料,经酯化、肼解、成盐和环化反应得到关键中间体4-氨基-3-芳基-1,2,4-三唑-5-硫酮,再

  14. Single-Site Cobalt Catalysts at New Zr 82 -O) 82 -OH) 4 Metal-Organic Framework Nodes for Highly Active Hydrogenation of Alkenes, Imines, Carbonyls, and Heterocycles

    Energy Technology Data Exchange (ETDEWEB)

    Ji, Pengfei; Manna, Kuntal; Lin, Zekai; Urban, Ania; Greene, Francis X.; Lan, Guangxu; Lin, Wenbin

    2016-09-21

    We report here the synthesis of robust and porous metal–organic frameworks (MOFs), M-MTBC (M = Zr or Hf), constructed from the tetrahedral linker methane-tetrakis(p-biphenylcarboxylate) (MTBC) and two types of secondary building units (SBUs): cubic M82-O)82-OH)4 and octahedral M6(μ3-O)43-OH)4. While the M6-SBU is isostructural with the 12-connected octahedral SBUs of UiO-type MOFs, the M8-SBU is composed of eight MIV ions in a cubic fashion linked by eight μ2-oxo and four μ2-OH groups. The metalation of Zr-MTBC SBUs with CoCl2, followed by treatment with NaBEt3H, afforded highly active and reusable solid Zr-MTBC-CoH catalysts for the hydrogenation of alkenes, imines, carbonyls, and heterocycles. Zr-MTBC-CoH was impressively tolerant of a range of functional groups and displayed high activity in the hydrogenation of tri- and tetra-substituted alkenes with TON > 8000 for the hydrogenation of 2,3-dimethyl-2-butene. Our structural and spectroscopic studies show that site isolation of and open environments around the cobalt-hydride catalytic species at Zr8-SBUs are responsible for high catalytic activity in the hydrogenation of a wide range of challenging substrates. MOFs thus provide a novel platform for discovering and studying new single-site base-metal solid catalysts with enormous potential for sustainable chemical synthesis.

  15. The effects of 8-week core training on the development of some motoric features among 18 year-old footballers18 yaş grubu futbolcularda 8 haftalik merkez bölge (core antrenmanlarının bazı motorik özelliklerin gelişimine etkisi

    Directory of Open Access Journals (Sweden)

    Yakup Akif Afyon

    2016-11-01

    Full Text Available The purpose of the present research is investigating the effects of core trainings on some motoric features (strength and speed among 18 year-old footballers. In the present research, 20 experiment group (age =18 years, body weight =71,66±6,61 kg, height =171,75±5,86 cm and 20 control group (age =18 years, body weight =70,66±5,74 kg, height =171,75±2,99 cm, the total of 40 certified footballers, who played in 2013-2014 season, participated in the present research. Before the trainings, pre-test scores (sit-up, push-up, plank, vertical jump, medicine ball throwing, 30 m speed were recorded. 30-35 minute core trainings, 2 days a week, for 8 weeks were conducted on the control group in addition to their regular training. Control group participants followed their regular yearly training program. At the end of the trainings, post-test scores of both groups were recorded by two experts in the field in accordance with the protocol. In order to evaluate the effects of 8-week core trainings of the strength development of footballers, paired t test was utilized for in-group comparisons and independent samples t test was utilized for inter-group comparisons. Consequently, it was observed that 8-week core training in addition to football trainings contributed to the strength and speed development among footballers. Accordingly, core trainings can be advised for football trainers, who work for youth teams of football clubs.   Özet Bu araştırmanın amacı 18 yaş grubu futbolcularda bölgesel (core antrenmanların bazı motorik özelliklerin (kuvvet ve sürat gelişimine etkisinin incelenmesidir. Araştırmaya 2013-2014 sezonunda lisanslı olarak futbol oynayan 20 denek grubundan (yaş =18 yıl, vücut ağırlığı =71,66±6,61 kg, boy =171,75±5,86 cm ve 20 kontrol grubundan (yaş =18 yıl, vücut ağırlığı =70,66±5,74 kg, boy =171,75±2,99 cm olmak üzere 40 futbolcu katıldı. Antrenmanlar öncesi grupların ön testleri (mekik,

  16. Applications of N-heterocyclic imines in main group chemistry.

    Science.gov (United States)

    Ochiai, Tatsumi; Franz, Daniel; Inoue, Shigeyoshi

    2016-11-07

    The imidazolin-2-imino group is an N-heterocyclic imino functionality that derives from the class of compounds known as guanidines. The exocyclic nitrogen atom preferably bonds to electrophiles and its electron-donating character is markedly enhanced by efficient delocalization of cationic charge density into the five-membered imidazoline ring. Thus, this imino group is an excellent choice for thermodynamic stabilization of electron-deficient species. Due to the variety of available imidazoline-based precursors to this ligand, its steric demand can be tailored to meet the requirements for kinetic stabilization of otherwise highly reactive species. Consequently, it does not come as a surprise that the imidazolin-2-iminato ligand has found widespread applications in transition-metal chemistry to furnish pincer complexes or "pogo stick" type compounds. In comparison, the field of main-group metal compounds of this ligand is still in its infancy; however, it has received growing attention in recent years. A considerable number of electron-poor main-group element species have been described today which are stabilized by N-heterocyclic iminato ligands. These include low-valent metal cations and species that are marked by formerly unknown bonding modes. In this article we provide an overview on the present chemistry of main-group element compounds of the imidazolin-2-iminato ligand, as well as selected examples for the related imidazolidin- and benzimidazolin-2-imino system.

  17. Dynamic Combinatorial Chemistry with Diselenides, Disulfides, Imines and Metal Coordination

    DEFF Research Database (Denmark)

    Sørensen, Anne

    The design and preparation of strong and selective artificial receptors, especially biomi-metic receptors that function in aqueous solution, has proved truly challenging. In this thesis it will be described how the strengths of dynamic combinatorial chemistry can be used to great advantage...... in this field. The aim of this project has therefore been to develop new ways of using dynamic combinatorial libraries for molecular recognition in aqueous media. The focus has been on using what has been learned from the well-established di-sulfide exchange chemistry to incorporate a new reaction into dynamic...... combinatorial chemistry, namely the reversible diselenide exchange reaction. The first part of the thesis describes the development of a thermally induced OAr → SeAr migration reaction. Here, it was proven possible to rearrange a variety of substituted O-aryl selenocarbamates into the corresponding Se...

  18. Dynamic Combinatorial Chemistry with Diselenides, Disulfides, Imines and Metal Coordination

    DEFF Research Database (Denmark)

    Sørensen, Anne

    experimentally and theoretically and found to be unique in organoselenium chemistry by proceeding through a four-membered cyclic transition state following first-order kinetics. Subsequently, this thesis illustrates how an aliphatic diselenide could be used to catalyse the formation of a disulfide based dynamic...

  19. Neftjanoi resurs estonskihh slantsev / Jevgeni Ašimin

    Index Scriptorium Estoniae

    Ašimin, Jevgeni

    2008-01-01

    Narva Õlitehas laiendab tootmist seoses nõudluse suurenemisega põlevkiviõli järele maailmaturul, uuendab seadmeid ning investeerib keskkonnasäästlikku tehnoloogiasse. Lisa: Andmed Narva Õlitehase kohta

  20. Catalytic Properties of Polymer-bound Imine Copper(

    Institute of Scientific and Technical Information of China (English)

    WANG; YunPu

    2001-01-01

    As heterogeneous catalyst, polymer metal complexes is stable in air, low corrosive, low toxic, easy to separate and reclaim,1,2 which superior than organic metal low-molecular complexes, so be paid close attention since 1960' and apply in industry gradually. There are many reports in polymer metal catalyst which is used in oxidation and hydrogenation3  In this paper, complexes of Cu(II) with polymer schiff base ligand: poly (dinitrobenzaldehyde aminating styrene)-Cu(PDNBA-Cu), poly(m-nitrobenzaldehyde aminating styrene)-Cu(PMNBA-Cu), poly(dihydroxybenzaldehyde aminating styrene)Cu(PDHBA-Cu), PDNBA-Cu-Phen were synthesized and characterized by FT-IR, XPS, GC-MS and element analysis. The results show that oxygen atom of hydroxide radical and nitrogen atom are both coordinating with Cu2+ and N:Cu≈ 1: 1. The results also show the complexes are well stability.  ……

  1. Orff Yaklaşımı İle Yapılan Okul Öncesi Müzik Eğitiminin Öğrencilerin Sosyal Becerilerinin Gelişimine Etkileri The Influences Of Orff Preschool Music Education Approach On The Improvement Of Social Skills Of Students

    Directory of Open Access Journals (Sweden)

    Bahar GÜDEK

    2013-03-01

    ştırmanın amacı, Orff yaklaşımı ile yapılan okul öncesimüzik eğitiminin öğrencilerin sosyal becerilerinin gelişimine etkilerininincelenmesidir. Araştırmanın çalışma grubunu, 2009-2010 eğitimöğretimyılında Samsun ili, Canik Yavuz Selim Yatılı İlköğretim BölgeOkulu, okul öncesi 6 yaş grubu öğrencileri arasında deney ve kontrolgrupları için rasgele seçilen 40 kişi oluşturmuştur. AraştırmadaAvcıoğlu (2005 tarafından geliştirilen „Sosyal Becerileri DeğerlendirmeÖlçeği (4-6 yaş‟ın “Kişiler Arası İletişim Becerileri, Akran Baskısı İleBaşa Çıkma Becerileri, Sözel Açıklama Becerileri, Kendini Kontrol EtmeBecerileri, Hedef Belirleme Becerileri, Dinleme Becerileri, GörevleriTamamlama Becerileri, Sonuçları Kabul Etme Becerileri” başlıklarıaltındaki dokuz alt ölçeği alınarak, 40 öğrencinin her biri için müzikeğitimi öncesi ve sonrasında çocukların okul öncesi öğretmenleritarafından doldurulmuştur. Uygulanan ön test aşamasından sonradeney grubu öğrencileri ile 10 hafta boyunca; Pazartesi ve Çarşambagünleri 60‟ar dakika, Orff Schulwerk yaklaşımı ile okul öncesi müzik,hareket ve dans eğitimi verilmiştir. Kontrol grubunu oluşturanöğrencilere müzik eğitimi verilmemiş, bu öğrenciler okuldaki geneleğitimlerine devam etmişlerdir. Tüm çalışmaların sonunda, deney vekontrol grupları için son testler uygulanmıştır. Elde edilen verilerinişlenmesi sonucunda; Orff Schulwerk yaklaşımı ile verilen okul öncesimüzik eğitiminin, bu eğitimin verilmediği okul öncesi 6 yaş grubuçocuklara göre “Kişiler Arası İletişim, Kızgınlık Davranışlarını KontrolEtme ve Değişikliklere Uyum Sağlama, Sözel Açıklama, AmaçOluşturma, Görevleri Tamamlama Becerileri” sosyal becerilerinin dahafazla geliştikleri saptanmış ve elde edilen sonuçlara dayanarak çeşitliönerilerde bulunulmuştur.

  2. An empirical research about the effect of intercultural communication on education processKültürlerarası iletişimin eğitim sürecine etkisine yönelik ampirik bir araştırma

    Directory of Open Access Journals (Sweden)

    Deniz Keba Ekinci

    2016-02-01

    , multicultural education in higher education institutions by enabling the formation of cultural environment they are to create awareness have been observed. In addition, this educational environments, with the acquisitions of intercultural communication and competence, bias by getting rid of the molds, are expected to develop awareness of the coexistence of different cultures.   Özet Kültürlerarası iletişim, farklı kültürlere mensup insanlar arasında iletişim, kültürel farklılıkların ortaya çıkması ve korunması, yabancının algılanması gibi konuları inceleyen disiplinler arası bir bilim dalıdır. Küreselleşme ile birlikte; ülkeler arasındaki sınırların yapaylaştığı, kültürel farklılıkların ortaya çıktığı, kültürlerarası iletişim ve etkileşimin arttığı görülmektedir. Böyle bir ortamda; çokkültürlülük, kültürlerarası iletişim süreci ve kültürlerarası iletişim yeterliliği olguları önem kazanmaktadır. Çokkültürlülük, çoğulcu toplumlarda farklı kültürlerin varlığını ifade etmektedir. Kültürlerarası iletişim, farklı kültürler arasındaki iletişim ve etkileşimi göstermektedir. Kültürlerarası yeterlilik ise, farklılıkların kabulü ve birlikte yaşama isteği ile gerçekleşmektedir. Bu bağlamda; ülkeler arasındaki birliktelikler ve kültürel anlaşmalar sonucunda, Yüksek Öğretim Kurumlar’ı arasında, çeşitli uluslararası öğrenci programları gerçekleşmektedir. Bu eğitim programlarının görüldüğü, Yüksek Öğretim Kurumları’ndaki uygulamaları çalışmanın temelini oluşturmaktadır. Farklı programlarla Kocaeli Üniversitesi İletişim Fakültesi’nde eğitim görmek amacıyla gelen yabancı öğrencilerin eğitim sürecinde karşılaştıkları kültürel problemler, kültürlerarası iletişim çerçevesinde ele alınmıştır. Çalışmada, nitel araştırma yöntemi kullanılmıştır. Öğrencilere yönelik açık uçlu sorulardan oluşan bir g

  3. Preparation and Use of Aziridino Alcohols as Promoters for the Enantioselective Addition of Dialkylzinc Reagents to N-(Diphenylphosphinoyl) IminesImines

    DEFF Research Database (Denmark)

    Tanner, David Ackland; Guijarro, David; Andersson, Pher G.

    1997-01-01

    A set of chiral aziridino alcohols has been synthesised, either from amino acids (serine, threonine or allo-threonine) or via Sharpless asymmetric aminohydroxylation/dihydroxylation of simple prochiral olefins. The ligands mediate the addition of diethylzinc to N-phosphinoylimines, with up to 94...

  4. Thermal curing of an epoxy-anhydride system modified with hyperbranched poly(ethylene imine)s with different terminal groups

    OpenAIRE

    Morancho Llena, José María; Fernández Francos, Xavier; Acebo Gorostiza, Cristina; Ramis Juan, Xavier; Salla Tarragó, José María; Serra Albet, Àngels

    2015-01-01

    Epoxy resins are widely used in applications such as adhesives, coatings, electric laminates, encapsulation of semiconductor devices, matrix material for composites, structural components and cryogenic engineering because of their mechanical properties, adhesion and chemical resistance. However, epoxy resins are inherently brittle due to their high cross-link density. To increase their toughness different modifiers such as rubber, thermoplastic and glass particles can be added, but they al...

  5. Ni(ii)-catalyzed asymmetric addition of arylboronic acids to cyclic imines.

    Science.gov (United States)

    Quan, Mao; Tang, Liang; Shen, Jiaqi; Yang, Guoqiang; Zhang, Wanbin

    2017-01-03

    A Ni(ii)-catalyzed asymmetric addition of arylboronic acids to cyclic aldimines and ketimines is reported. Our tropos phosphine-oxazoline biphenyl ligand is crucial for the high catalytic activity, which coordinates to Ni(ii) to form a complex with a single axial configuration. The desired chiral amine products could be prepared with excellent yields (up to 99%) and enantioselectivities (up to 99.8%) under mild reaction conditions.

  6. Density functional theory study on the formation of reactive benzoquinone imines by hydrogen abstraction

    DEFF Research Database (Denmark)

    Leth, Rasmus; Rydberg, Patrik; Jørgensen, Flemming Steen;

    2015-01-01

    Many drug compounds are oxidized by cytochrome P450 (CYP) enzymes to form reactive metabolites. This study presents density functional theory calculations of the CYP-mediated metabolism of acetaminophen and a series of related compounds that can form reactive metabolites by hydrogen abstraction...

  7. Synthesis of Dihydropyridines and Pyridines from Imines and Alkynes via C-H Activation

    Energy Technology Data Exchange (ETDEWEB)

    Ellman, Jonathan A.; Colby, Denise; Bergman, Robert

    2007-11-20

    A convenient one-pot C-H alkenylation/electrocyclization/aromatization sequence has been developed for the synthesis of highly substituted pyridine derivatives from alkynes and {alpha},{beta}-unsaturated N-benzyl aldimines and ketimines that proceeds through dihydropyridine intermediates. A new class of ligands for C-H activation was developed, providing broader scope for the alkenylation step than could be achieved with previously reported ligands. Substantial information was obtained about the mechanism of the reaction. This included the isolation of a C-H activated complex and its structure determination by X-ray analysis; in addition, kinetic simulations using the Copasi software were employed to determine rate constants for this transformation, implicating facile C-H oxidative addition and slow reductive elimination steps.

  8. Characterization and evaluation of amphotericin B loaded MDP conjugated poly(propylene imine) dendrimers.

    Science.gov (United States)

    Jain, Keerti; Verma, Ashwni Kumar; Mishra, Prabhat Ranjan; Jain, Narendra Kumar

    2015-04-01

    This paper describes a novel strategy for targeted delivery of amphotericin B (AmB) to macrophages with muramyl dipeptide (MDP) conjugated multimeric poly(propyleneimine) (PPI) dendrimers. Synergistic antiparasitic activity due to immunostimulation by multimeric presentation of MDP on dendrimers was anticipated. MDP conjugated 5.0G PPI (MdPPI) dendrimers were synthesized and characterized. Therapeutic activity and toxicity of dendrimeric formulation of AmB (MdPPIA) were compared with marketed formulations of AmB. Highly significant (PMDP conjugated dendrimeric formulation of AmB as a promising immunostimulant targeted drug delivery system and a safer alternative to marketed formulations. From the clinical editor: Parasitic infections remain a significant issue in the clinical setting. The authors in this article studied the use of ligand anchored dendrimeric formulation of Amphotericin B to target infected macrophages and showed reduced toxicity, high anti-leishmanial activity. This may add another treatment option to available formulations in the future.

  9. Novel imines with tunable nucleophilicity and steric properties through metal coordination: applications as ligands and metalloorganocatalysts

    KAUST Repository

    Huang, Kuo-Wei

    2016-03-17

    The invention describes phospho-amino pincer-type ligands, metal complexes thereof, and catalytic methods comprising such metal complexes for conversion of carbon dioxide to methanol, conversion of aldehydes into alcohols, conversion of aldehydes in the presence of a trifluoromethylation agent into trifluorinated secondary alcohols, cycloaddition of carbon dioxide to an epoxide to provide cyclic carbonates or preparation of an amide from the combination of an alcohol and an amine.

  10. Diene-ligated iridium catalyst for allylation reactions of ketones and imines.

    Science.gov (United States)

    Barker, Timothy J; Jarvo, Elizabeth R

    2009-03-05

    [Ir(cod)Cl](2) is a highly reactive catalyst for allylation reactions of ketones using allylboronic ester. Mechanistic experiments are consistent with formation of a nucleophilic allyliridium(I) complex that is activated by the diene ligand toward attack of a ketone. Aryl and alkyl ketones react smoothly at room temperature. Aldimines also undergo allylation under these reaction conditions, requiring increased reaction times relative to the corresponding ketones.

  11. (4E-N-[(2-Bromophenylmethoxy]-1,3-dimethyl-2,6-diphenylpiperidin-4-imine

    Directory of Open Access Journals (Sweden)

    Chennan Ramalingan

    2012-07-01

    Full Text Available In the title compound, C26H27BrN2O, the piperidine ring has a chair conformation and all ring substituents occupy equatorial positions, apart from the double-bonded N atom, which occupies a bisectional position. The dihedral angle formed between the phenyl rings is 61.18 (19°, and the phenyl rings form dihedral angles of 49.78 (19 and 69.2 (18° with the bromobenzene ring. The latter is coplanar with the methoxy(methylideneamine fragment [N—O—C—C torsion angle = −171.7 (2°]. Linear supramolecular chains, approximately along [112], sustained by C—H...π interactions, feature in the crystal packing.

  12. Fluorogenic ratiometric dipodal optode containing imine-amide linkages: exploiting subtle thorium (IV) ion sensing.

    Science.gov (United States)

    Tayade, Kundan; Kaur, Amanpreet; Tetgure, Sandesh; Chaitanya, G Krishana; Singh, Narinder; Kuwar, Anil

    2014-12-10

    The (13E,19E)-N1',N3'-bis[4-(diethylamino)-2-hydroxybenzylidene]malonohydrazide (L) has been developed for the detection of Th(4+) ions using dual channel signalling system. The UV-vis absorbance and fluorescence spectroscopic data revealed the formation of L-Th(4+) complex in 1:1 equilibrium. The density functional theory (DFT) also confirms the optimum binding cavity for the recognition of metal ion. The binding constant computed from different mathematical models for an assembly of L-Th(4+). The detection limit of L for Th(4+) recognition is to a concentration down to 0.1 μM (0.023 μg g(-1)). The present sensing system is also successfully applied for the detection of Th(4+) ion present in soil near nuclear atomic plants.

  13. Catalytic α-arylation of imines leading to N-unprotected indoles and azaindoles

    KAUST Repository

    Marelli, Enrico

    2016-03-30

    A Palladium-N-heterocyclic carbene-catalyzed methodology for the synthesis of substituted, N-unprotected indoles and azaindoles is reported. The protocol permits access to various, highly substituted members of these classes of compounds. Although two possible reactions pathways (deprotonative and Heck-like) can be proposed, control experiments, supported by computational studies, point towards a deprotonative mechanism being operative.

  14. Asymmetric cyanation of imines via dipeptide-derived organophosphine dual-reagent catalysis

    Science.gov (United States)

    Wang, Hong-Yu; Zheng, Chang-Wu; Chai, Zhuo; Zhang, Jia-Xing; Zhao, Gang

    2016-09-01

    Over the past few decades, enantioselective phosphine organocatalysis has evolved rapidly into a highly efficient catalytic strategy for a range of useful reactions. However, as restricted by the traditional catalytic modes, some important reactions, such as asymmetric Strecker-type reactions, have thus far been out of reach of this strategy. Reported herein is an application of enantioselective phosphine organocatalysis for asymmetric Strecker-type reactions, enabled by a dual-reagent catalyst system in which the key organophosphorus zwitterion intermediate, generated in situ by mixing a chiral dipeptide-derived multifunctional organophosphine with methyl acrylate, is used as a highly efficient chiral Lewis base catalyst. The high efficiency of this catalytic system is demonstrated in the asymmetric cyanation of isatin-derived ketimines and azomethine aldimines as well as in the kinetic resolution of racemic 3-substituted azomethines. Mechanistic studies provide experimental evidence for the intermediacy of the putative zwitterion and its role as a catalytically active Lewis base.

  15. Improving Enantioselectivity by Using a Mono-Sulphonated Diphosphine as Ligand for Homogeneous Imine Hydrogenation

    NARCIS (Netherlands)

    Lansink, Cornelis; Vries, Johannes G. de

    1992-01-01

    The Rhodium catalysed hydrogenation of acetophenone N-benzylimine using mono-sulphonated (2S,4S)-bis-(diphenylphosphino)pentane as ligand gives the corresponding amine with 94% e.e., whereas use of the di-sulphonated ligand yields product with 2% e.e.

  16. New Cu(I)-ethylene complexes based on tridentate imine ligands: synthesis and structure.

    Science.gov (United States)

    Ebrahimpour, Parisa; Haddow, Mairi F; Wass, Duncan F

    2013-04-01

    A new bulky facially coordinating N3-donor tach-based ligand (tach: cis,cis-1,3,5-triaminocyclohexane) [1: cis,cis-1,3,5-tris(2-fluoro-6-(trifluoromethyl)benzylideneamino)cyclohexane] has been obtained from the condensation of tach with 3 equiv of the appropriate benzaldehyde. Reaction of 1 with [Cu(NCMe)4][PF6] gave the complex [(1)Cu(NCMe)][PF6]. Displacement of the acetonitrile ligand is possible with CO and C2H4 (3-5 bar). Cu(I)-ethylene complexes of ligands 1 and 2 [2: cis,cis-1,3,5-(mesitylideneamino)cyclohexane] were prepared successfully by treatment of the ligands with CuBr and AgSbF6 in the presence of ethylene. These complexes display reversible complexation of the ethylene molecule under mild changes to pressure, suggesting possible application in olefin separation and extraction.

  17. Organocatalysts immobilised onto gold nanoparticles: application in the asymmetric reduction of imines with trichlorosilane.

    Science.gov (United States)

    Malkov, Andrei V; Figlus, Marek; Cooke, Graeme; Caldwell, Stuart T; Rabani, Gouher; Prestly, Mark R; Kocovský, Pavel

    2009-05-07

    Gold nanoparticles functionalised with a valine-derived formamide have been developed as effective homogenous catalysts for the asymmetric reduction of ketimine 1 with trichlorosilane (< or = 84% ee) in toluene. This methodology both simplifies the recovery of the catalyst and its separation from the product, as the nanoparticles can be readily removed and subsequently recycled by precipitation from the reaction mixture.

  18. Synthesis of Novel Heterocyclic Imine Type UV Absorbers for Application on Cotton Based Textile Materials

    Directory of Open Access Journals (Sweden)

    Nuket Ocal

    2016-01-01

    Full Text Available Novel Schiff bases with the potential to exhibit biologically active and UV absorption properties were synthesized. Their application on cotton based textile materials was performed and the UV protection factor (UPF values and the antibacterial features of the treated fabrics were measured.

  19. Catalytic Properties of Polymer-bound Imine Copper(Ⅱ) Complex

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    @@ As heterogeneous catalyst, polymer metal complexes is stable in air, low corrosive, low toxic, easy to separate and reclaim,1,2 which superior than organic metal low-molecular complexes, so be paid close attention since 1960' and apply in industry gradually. There are many reports in polymer metal catalyst which is used in oxidation and hydrogenation3 In this paper, complexes of Cu(II) with polymer schiff base ligand: poly (dinitrobenzaldehyde aminating styrene)-Cu(PDNBA-Cu), poly(m-nitrobenzaldehyde aminating styrene)-Cu(PMNBA-Cu), poly(dihydroxybenzaldehyde aminating styrene)Cu(PDHBA-Cu), PDNBA-Cu-Phen were synthesized and characterized by FT-IR, XPS, GC-MS and element analysis. The results show that oxygen atom of hydroxide radical and nitrogen atom are both coordinating with Cu2+ and N:Cu≈ 1: 1. The results also show the complexes are well stability.

  20. LANTHANIDE TRIFLATES CATALYZED REACTIONS OF IMINES WITH INDOLE IN PROTIC MEDIA. (R826123)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  1. High Selective and Catalyst-directed Addition of Diazo Compounds to Imines

    Institute of Scientific and Technical Information of China (English)

    YAN Ming; HU Wen-Hao; Groneberg Luisa S.; Doyle Michael P.

    2003-01-01

    @@ Transition metal-catalyzed decomposition of diazo compounds and subsequent transformations constitute vast synthetically useful reactions. Recently the catalytic approaches to ylide generation and reaction leading to heterocycle compounds from diazo compounds have achieved remarkable successes.

  2. Synthesis of 2, 6-(substituded) pyridine Derivatives Using Amide and Imine Groups

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    A new ‘two-armed' acyclic diamide Ⅰa 2, 6-bis(1-ethanecarbozamido-2-amino)pyridine,and a new series of aromatic aldehyde schiff bases containing pyridine ring and amide bridge, Ⅱa-f,were prepared. The compounds were characterized by elemental analysis, IR, 1HNMR and MS.The bioactivity half inhibitory concentration C1/2 is given.

  3. Synthesis, Characterization, and Biotoxicity of NN ⌢ Donor Sulphonamide Imine Silicon(IV Complexes

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available The organosilicon derivatives of 2 -[ 1 -( 2 -furaylethyledene]sulphathiazole with organosilicon chlorides have been synthesised and characterized on the basis of analytical, conductance, and spectroscopic techniques. Probable trigonal bipyramidal and octahedral structures for the resulting derivatives have been proposed on the basis of electronic, IR, 1 H , 13 C NMR, and 29 Si NMR spectral studies. In the search for better fungicides, bactericides, nematicides, and insecticides studies were conducted to assess the growth-inhibiting potential of the synthesized complexes against various pathogenic fungal, bacterial strains, root-knot nematode Meloidogyne incognita, and insect Trogoderma granarium These studies demonstrate that the concentrations reached levels which are sufficient to inhibit and kill the pathogens, nematode, and insect.

  4. X-ray diffraction, DFT, spectroscopic study and insecticidal activity of (3-cyano-1-(2,6-dichloro-4-(trifluoromethyl)phenyl)-4-((trifluoromethyl)sulfinyl)-1 H-pyrazol-5- yl)(2-(triethylammonio)acetyl)amide inner salt

    Science.gov (United States)

    Jiang, D. X.; Zheng, X. H.; Xu, H. H.; Wong, N. B.

    2014-12-01

    In the title compound, C20H19Cl2F6N5O2S, an inner salt derivative of fipronil was synthesized and characterized by X-ray diffraction, 1H NMR, 13C NMR, IR, ESI-MS, EI-HRMS. The crystal is monoclinic, space group P21/ n, with a = 15.1655(7) Å, b = 15.0465(7) Å, c = 21.0713(9) Å, V = 4754.7(4) Å3 and Z = 8 (at 173(2) K), and its phenyl pyrazole ring together with bond C-N-O form a big π bond while bonds C-N-C and N-C-H form an inner salt molecular. Crystal stacking scheme indicates the crystal consists of two different molecules. The two molecules are nonplanar with the torsion angles between the pyrazole rings and benzene rings of -99.7(7)° and 88.1(7)°, respectively, and linked by intermolecular C-H⋯O, C-H⋯F hydrogen bonds. By DFT calculations, molecular electrostatic potential clearly shows that the formation of hydrogen bonding interaction, which F5⋯H'42 and F6⋯H'41 are intermolecular hydrogen bonds, and F7⋯H44 is an intramolecular hydrogen bond in the crystal structure, is between the positive and negative regions. In addition, molecular geometry optimized by DFT methods is in good agreement with the experimental values. In the optimized structure, the O-S, S-C, C-F and C-Cl bonds are slightly longer in comparison with those in the crystal. The intermolecular interaction energy for the dimmer was calculated to be 4.96 kcal mol-1. The results reveal that the two monomers are slightly combined with each other through two weak F⋯H hydrogen bonds. The compound and fipronil exhibited high insecticidal activity against the third instar larvae of Asian Corn Borer ( Ostrinia furnacalis (Guenée)) at 48 h after treatment with LC50 values of 4.17 μg/mL ( r 2 = 0.9974) and 5.36 μg/mL ( r 2 = 0.9970), respectively.

  5. Interim Policy for Evaluation of Stereoisomeric Pesticides

    Science.gov (United States)

    An interim approach for determining data requirements for non-racemic mixtures of stereoisomeric pesticides. These data are needed in order to assess the risk posed to ecosystems and drinking water sources by these mixtures.

  6. Miniaturized Lab-on-a-Chip Polarimeter Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Life on Earth is unique in many ways; one of its great mysteries is that all the biomolecules of Earth's life are chiral and non-racemic. In our pursuit of life on...

  7. Synthesis and antifungal evaluation of imines derived from 3-Amino-2-isopropyl-3H-quinazolin-4-one

    Directory of Open Access Journals (Sweden)

    Idris Karakaya

    2013-12-01

    Full Text Available Novel Schiff bases were synthesised using 3-aminoquinazolinone (1 and a variety of aldehydes in the presence of acetic acid as solvent. Antifungal evaluation of the compounds was carried out by the agar dilution method. Among the all compounds prepared, quinazolinone itself showed the best fungiostatic activity against all filamentous fungi.

  8. O sublime na tragédia grega: odem e desordem na iminência do ritual

    OpenAIRE

    2008-01-01

    Qualquer um que leia tragédias gregas encontra momentos de elevação especial, de grandeza ou transcendência nos quais o texto parece transportar o leitor/espectador para fora de si mesmo, a uma esfera de emoção e significação extremas. Geralmente, como resultado de uma série de fatores, inclusive cênicos, esses momentos da ação dramática criam um efeito de assombro, surpresa e medo. Os personagens no palco e a platéia compartilham uma sensação do que pode ser chamado de sublimidade. São momen...

  9. A First Look on iMiner's Knowledge base and Detecting Hidden Hierarchy of Riyadh Bombing Terrorist Network

    DEFF Research Database (Denmark)

    Memon, Nasrullah

    2007-01-01

      - Data collection is difficult to any network analysis because it is difficult to create a complete network.  It is not easy to gain information on terrorist networks.  It is fact that terrorist organizations do not provide information on their members and the government rarely allows researchers...... to use their intelligence data (Ressler S., 2006).  Very few researchers (Krebs, V., 2002, Sageman, M., 2004 and Rodriguez, J. A., 2004) collected data from open sources, and to the best of our knowledge, no knowledge base is available in academia for the analysis of the terrorist events.   To counter...... the information scarcity, we at Software Intelligence Security Research Center, Aalborg University Esbjerg Denmark designed and developed terrorism knowledge base by harvesting information from authenticated websites.   In this paper we discuss data collection and analysis results on our on-going research...

  10. Imine-Linked Polymer Based Nitrogen-Doped Porous Activated Carbon for Efficient and Selective CO2 Capture

    Science.gov (United States)

    Alabadi, Akram; Abbood, Hayder A.; Li, Qingyin; Jing, Ni; Tan, Bien

    2016-12-01

    The preparation of nitrogen-doped activated carbon (NACs) has received significant attention because of their applications in CO2 capture and sequestration (CCS) owing to abundant nitrogen atoms on their surface and controllable pore structures by carefully controlled carbonization. We report high-surface-area porous N-doped activated carbons (NAC) by using soft-template-assisted self-assembly followed by thermal decomposition and KOH activation. The activation process was carried out under different temperature conditions (600–800 °C) using polyimine as precursor. The NAC-800 was found to have a high specific surface area (1900 m2 g‑1), a desirable micropore size below 1 nm and, more importantly, a large micropore volume (0.98 cm3 g‑1). NAC-800 also exhibits a significant capacity of CO2 capture i.e., over 6. 25 and 4.87 mmol g‑1 at 273 K and 298 K respectively at 1.13 bar, which is one of among the highest values reported for porous carbons so far. Moreover, NAC also shows an excellent separation selectivity for CO2 over N2.

  11. Osmium and cobalt complexes incorporating facially coordinated N,N,O donor azo-imine ligands: Redox and catalytic properties

    Indian Academy of Sciences (India)

    Poulami Pattanayak; Debprasad Patra; Jahar Lal Pratihar; Andrew Burrows; Mary F Mahon; Surajit Chattopadhyay

    2013-01-01

    Reactions of 1-{[2-(arylazo)phenyl]iminomethyl}-2-phenol, HL [where H represents the dissociable phenolic protons of ligands and aryl groups of HL are C6H5 (HL1), -CH3C6H5 (HL2), -ClC6H5 (HL3)] with Os(H)(CO)(Br)(PPh3)3 in toluene and with Co(ClO4)3.6H2O in methanol afforded new facially coordinated complexes of composition [(L)Os(CO)(Br)(PPh3)] and [(L)2Co]ClO4. The anionic ligand (L)−, binds the metal in tridentate (N, N, O) manner in [(L)Os(CO)(Br)(PPh3)] and [(L)2Co]ClO4 complexes. All the Os(II) and Co(III) complexes are diamagnetic and show characteristic 1H NMR signals and intense MLCT transitions in the visible region. The cyclic voltammograms exhibited one quasi reversible oxidative response near 0.10 V vs SCE for [(L)Os(CO)(Br)(PPh3)] and [(L)2Co]ClO4 complexes displayed serial reductive responses within −0.06 to −1.61 V vs SCE. Single point DFT calculation was carried out to examine the nature of redox orbitals. Conversion of ketones to corresponding alcohols has been studied using [(L)Os(CO)(Br)(PPh3)] as catalyst.

  12. 环亚胺毒素gymnodimine的研究进展%Cyclic imine toxin gymnodimine: A review

    Institute of Scientific and Technical Information of China (English)

    刘仁沿; 梁玉波

    2009-01-01

    Gymnodimine(GYM)是1994年从新西兰牡蛎中被鉴定出的藻毒素.其由凯伦藻(Karenia selliformis)产生,结构中含有一个位于螺环上的亚胺氮,属于环亚胺毒素.亚胺是GYM的毒理功能基团,具有很高的小鼠腹腔注射急性致死毒性,口服毒性很小,但详细的毒理作用机制尚不清楚.本文基于有限的研究资料,系统综述了GYM的结构、来源生物、毒性机理、携带生物、地理分布、降解代谢、剂量响应关系及风险评估等研究现状,并对今后藻毒素的重点研究方向进行了展望.

  13. rac-1-(Furan-2-ylmethyl-N-nitro-5-(oxolan-2-ylmethyl-1,3,5-triazinan-2-imine

    Directory of Open Access Journals (Sweden)

    Hong-Fei Bu

    2010-10-01

    Full Text Available In the title compound C13H19N5O4, which belongs to the insecticidally active neonicotinoid group of compounds, the triazane ring exhibits a half-chair conformation. The large discrepancy between the two nitro O—N—N bond angles [116.1 (2 and 123.98 (19°] may be attributed to intramolecular N—H...O hydrogen bonding involving one of the nitro O atoms as the acceptor. The delocalization of the electrons extends as far as the nitro group, forming coplanar π-electron networks. In the crystal, inversion dimers lined by pairs of N—H...O hydrogen bonds occur.

  14. Comparison of the Electronic Transitions of Unconjugated Thiones and Imines: An Exercise in the Application of Symmetry Selection Rules

    Science.gov (United States)

    Worman, James J.; And Others

    1978-01-01

    The purpose of this paper is to show how symmetry selection rules can be used to determine whether certain of the electronic transitions exhibited by the title compounds are allowed or forbidden by symmetry. (Author/CP)

  15. Flow synthesis of organic azides and the multistep synthesis of imines and amines using a new monolithic triphenylphosphine reagent.

    Science.gov (United States)

    Smith, Catherine J; Smith, Christopher D; Nikbin, Nikzad; Ley, Steven V; Baxendale, Ian R

    2011-03-21

    Here we describe general flow processes for the synthesis of alkyl and aryl azides, and the development of a new monolithic triphenylphosphine reagent, which provides a convenient format for the use of this versatile reagent in flow. The utility of these new tools was demonstrated by their application to a flow Staudinger aza-Wittig reaction sequence. Finally, a multistep aza-Wittig, reduction and purification flow process was designed, allowing access to amine products in an automated fashion.

  16. Imine-Linked Polymer Based Nitrogen-Doped Porous Activated Carbon for Efficient and Selective CO2 Capture

    Science.gov (United States)

    Alabadi, Akram; Abbood, Hayder A.; Li, Qingyin; Jing, Ni; Tan, Bien

    2016-01-01

    The preparation of nitrogen-doped activated carbon (NACs) has received significant attention because of their applications in CO2 capture and sequestration (CCS) owing to abundant nitrogen atoms on their surface and controllable pore structures by carefully controlled carbonization. We report high-surface-area porous N-doped activated carbons (NAC) by using soft-template-assisted self-assembly followed by thermal decomposition and KOH activation. The activation process was carried out under different temperature conditions (600–800 °C) using polyimine as precursor. The NAC-800 was found to have a high specific surface area (1900 m2 g−1), a desirable micropore size below 1 nm and, more importantly, a large micropore volume (0.98 cm3 g−1). NAC-800 also exhibits a significant capacity of CO2 capture i.e., over 6. 25 and 4.87 mmol g−1 at 273 K and 298 K respectively at 1.13 bar, which is one of among the highest values reported for porous carbons so far. Moreover, NAC also shows an excellent separation selectivity for CO2 over N2. PMID:27958305

  17. Accidents - Policy and Punishment Are there boundar ies to the effectiveness of cr iminal sanctions in preventing accidental conduct?

    Science.gov (United States)

    Fisher, Alan

    This paper discusses recent and impending changes in Health and Safety law, questions the utility and supposed justification of tougher criminal sanctions and appeals for greater clarity in health and safety law as to what is truly a criminal offence. It also questions the use of the ‘reverse burden of proof’ and warns against unintended consequences if responsible people are made to feel that they are being treated unfairly.

  18. N,N-Dimethylbenzimidazolium iodide as a green catalyst for cross-coupling of aromatic aldehydeswith unactivated imines

    Directory of Open Access Journals (Sweden)

    Viwat Hahnvajana wong

    2016-03-01

    Full Text Available Cross-coupling of aromatic aldehydes with unactivated iminescatalyzed by N,N-dimethylbenzimidazolium iodide in ethanolic sodium hydroxide solution gave α-amino ketonesin satisfactory yields. Benzoin condensation and further oxidation of the resulted aroins also occurred as side reactions.

  19. Sulforaphane inhibits pancreatic cancer through disrupting Hsp90-p50Cdc37complex and direct interactions with amino acids residues of Hsp90

    NARCIS (Netherlands)

    Li, Yanyan; Karagöz, G. Elif; Seo, Young Ho; Zhang, Tao; Jiang, Yiqun; Yu, Yanke; Duarte, Afonso M.S.; Schwartz, Steven J.; Boelens, Rolf; Carroll, Kate; Rüdiger, Stefan G.D.; Sun, Duxin

    2012-01-01

    Sulforaphane [1-isothiocyanato-4-(methyl-sulfinyl) butane)], an isothiocyanate derived from cruciferous vegetables, has been shown to possess potent chemopreventive activity. We analyzed the effect of sulforaphane on the proliferation of pancreatic cancer cells. Sulforaphane inhibited pancreatic can

  20. Sulforaphane inhibits pancreatic cancer through disrupting Hsp90-p50Cdc37complex and direct interactions with amino acids residues of Hsp90

    NARCIS (Netherlands)

    Li, Yanyan; Karagöz, G. Elif; Seo, Young Ho; Zhang, Tao; Jiang, Yiqun; Yu, Yanke; Duarte, Afonso M.S.; Schwartz, Steven J.; Boelens, Rolf|info:eu-repo/dai/nl/070151407; Carroll, Kate; Rüdiger, Stefan G.D.|info:eu-repo/dai/nl/314076662; Sun, Duxin

    2012-01-01

    Sulforaphane [1-isothiocyanato-4-(methyl-sulfinyl) butane)], an isothiocyanate derived from cruciferous vegetables, has been shown to possess potent chemopreventive activity. We analyzed the effect of sulforaphane on the proliferation of pancreatic cancer cells. Sulforaphane inhibited pancreatic

  1. [Design and synthesis of imine compound for metal cation logical gates recognition and setup of double-control fluorescent molecule switch].

    Science.gov (United States)

    Huang, Tao; Zhu, Yu-lian; Dai, Xue-qin; Zhang, Qi; Huang, Yan

    2011-07-01

    The Schiff base's reduced product N,N-bis(4-methoxybenzyl) ethane-1,2-diamine, which was used as a receptor L, was designed and synthesized for the first time in the present article. It was found that Cu2+ and Fe3+ could quench L in fluorescence observably and Zn2+ and Cd2+ could enhance L remarkably. So the two pair metal cation could set up "OR" logical gate relation with the receptor molecule L, then a logical recognition system be formed. The data of resolved ZnL's single crystal indicated that ZnL belonged to monoclinic (CCDC No. 747994). Integrated spectrum instrument was used to characterize the structure of its alike series of complex compound. According to ZnL's excellent fluorescence character and the ability to exchange with contiguous metal cation, ZnZ+/ZnL/Co2+, Zn2+/ZnL/Nit+ fluorescent molecule switch was designed. It is hoped that the work above could be positive for the development of molecule computer, bio-intellectualized inspection technology (therapy) and instrument.

  2. Synthesis of Imine-Naphthol Tripodal Ligand and Study of Its Coordination Behaviour towards Fe(III, Al(III, and Cr(III Metal Ions

    Directory of Open Access Journals (Sweden)

    Kirandeep Kaur

    2014-01-01

    Full Text Available A hexadentate Schiff base tripodal ligand is synthesized by the condensation of tris (2-aminoethyl amine with 2-hydroxy-1-naphthaldehyde and characterized by various spectroscopic techniques like UV-VIS, IR, NMR, MASS, and elemental analysis. The solution studies by potentiometric and spectrophotometric methods are done at 25 ± 1°C, µ=0.1 M KCl, to calculate the protonation constants of the ligand and formation constants of metal complexes formed by the ligand with Fe(III, Al(III, and Cr(III metal ions. The affinity of the ligand towards Fe(III is compared with deferiprone (a drug applied for iron intoxication and transferrin (the main Fe(III binding protein in plasma. Structural analysis of the ligand and the metal complexes was done using semiempirical PM6 method. Electronic and IR spectra are calculated by semiempirical methods and compared with experimental one.

  3. Synthesis of Imine-Naphthol Tripodal Ligand and Study of Its Coordination Behaviour towards Fe(III), Al(III), and Cr(III) Metal Ions.

    Science.gov (United States)

    Kaur, Kirandeep; Baral, Minati

    2014-01-01

    A hexadentate Schiff base tripodal ligand is synthesized by the condensation of tris (2-aminoethyl) amine with 2-hydroxy-1-naphthaldehyde and characterized by various spectroscopic techniques like UV-VIS, IR, NMR, MASS, and elemental analysis. The solution studies by potentiometric and spectrophotometric methods are done at 25 ± 1°C, µ = 0.1 M KCl, to calculate the protonation constants of the ligand and formation constants of metal complexes formed by the ligand with Fe(III), Al(III), and Cr(III) metal ions. The affinity of the ligand towards Fe(III) is compared with deferiprone (a drug applied for iron intoxication) and transferrin (the main Fe(III) binding protein in plasma). Structural analysis of the ligand and the metal complexes was done using semiempirical PM6 method. Electronic and IR spectra are calculated by semiempirical methods and compared with experimental one.

  4. Reductive heterocyclizations via indium-iodine-promoted conversion of 2-nitroaryl imines or 2-nitroarenes to 2,3-diaryl-substituted indazoles.

    Science.gov (United States)

    Ahn, Gil Hwan; Lee, Jung June; Jun, Young Moo; Lee, Byung Min; Kim, Byeong Hyo

    2007-08-07

    While N-(2-nitrobenzylidene)anilines produced mixtures of 2,1-benzisoxazoles and 3-anilino-2-aryl-2H-indazoles in the presence of indium and iodine in MeOH, N-(2-nitrobenzylidene)anilines were transformed into 3-anilino-2-aryl-2H-indazoles as the predominant major product through the change of the solvent from protic MeOH to aprotic THF. In an indium-mediated one-pot reductive reaction, 2-benzaldehydes and anilines in THF were also successfully transformed into the corresponding indazoles.

  5. Ulrich Beck : ostmine võib olla sama mõjus poliitiline osalusvorm kui valimaskäimine / Ulrich Beck ; interv. Indrek Ibrus

    Index Scriptorium Estoniae

    Beck, Ulrich

    2005-01-01

    Sotsioloog on seisukohal, et tänapäeval, kus teadusest ja majandusest on kujunenud poliitika, saab erasektorit ja teadlasi mõjutada tarbijakäitumise ning riikidevahelise koostöö suurendamisega. Lisa: Ulrich Beck

  6. Synthesis, structure elucidation, biological screening, molecular modeling and DNA binding of some Cu(II) chelates incorporating imines derived from amino acids

    Science.gov (United States)

    Abdel-Rahman, Laila H.; Abu-Dief, Ahmed M.; Ismael, Mohammed; Mohamed, Mounir A. A.; Hashem, Nahla Ali

    2016-01-01

    Three tridentate Schiff bases amino acids were prepared by direct condensation of 3-methoxysalicylaldehyde (MS) or 4-diethylaminosalicylaldehyde (DS) with α-amino acid ligands [L-phenylalanine (P), L-histidine (H) and DL-tryptophan (T)]. The prepared Schiff bases amino acids were investigated by melting points, elemental analysis, 1HNMR and 13CNMR, IR, UV-Vis spectra, conductivity and magnetic measurements analyses. Subsequently, copper was introduced and Cu(II) complexes formed. These complexes were analyzed by thermal and elemental analyses and further investigated by FT-IR and UV/Vis spectroscopies. The experimental results indicating that all Cu(II) complexes contain hydrated water molecules (except DSPCu complex) and don't contain coordinated water molecules. The kinetic and thermal parameters were extracted from the thermal data using Coast and Redfern method. The molar conductance values of the Schiff base amino acid ligands and their Cu(II) complexes were relatively low, showing that these compounds have non-electrolytic nature. Magnetic susceptibility measurements showed the diamagnetic nature of the Schiff base amino acid ligands and paramagnetic nature of their complexes. Additionally, a spectrophotometric method was determined to extract their stability constants. It was found that the complexes possess 1:2 (M:L) stoichiometry. The results suggested that 3-methoxysalicylaldehyde and 4-diethylaminosalicylaldehyde amino acid Schiff bases behave as monobasic tridentate ONO ligands and coordinate Cu(II) ions in octahedral geometry according to the general formula [Cu(HL)2]·nH2O. To further understanding the structural and electronic properties of these complexes, Density Functional Theory (DFT) calculations were employed and provided a satisfactory description. The optimized structures of MST Schiff base ligand and its complex were calculated using DFT. The antimicrobial activity of the Schiff base ligands and their complexes were screened against some types of bacteria such as Bacillus subtilis (+ve), Escherichia coli (-ve) and Micrococcus luteus (+ve) and some types of fungi such as Asperagillus niger, Candida glabrata and Saccharomyces cerevisiae. The results of these studies indicated that the metal complexes exhibit a stronger antibacterial and antifungal efficiency compared to their corresponding ligands. The complexes were screened for antiviral activity against a panel of DNA and RNA viruses. Minimum cytotoxic and minimum virus inhibitory concentrations of these complexes were determined. The mode of interaction between complexes and CT-DNA was monitored using absorption spectra, viscosity measurements and gel electrophoreses.

  7. Synthesis, structure and stability of a chiral imine-based Schiff-based ligand derived from L-glutamic acid and its [Cu4] complex

    Science.gov (United States)

    Muche, Simon; Levacheva, Irina; Samsonova, Olga; Biernasiuk, Anna; Malm, Anna; Lonsdale, Richard; Popiołek, Łukasz; Bakowsky, Udo; Hołyńska, Małgorzata

    2017-01-01

    Studies of the stability of a ligand derived from L-glutamic acid and ortho-vanillin and its new [Cu4] complex are presented. The [Cu4] complex contains a heterocubane [CuII4O4] core and pendant carboxylic groups increasing its solubility in water, also under basic conditions. The stability of the complex in different solvents is confirmed with ESI-MS studies and such experiments as successful recrystallization. The complex is stable also under physiological conditions whereas the ligand is partly decomposed to L-glutamic acid and ortho-vanillin.

  8. (Z)-3-Methyl-N-(7-nitroacridin-3-yl)-2,3-dihydro-1,3-benzothiazol-2-imine from laboratory powder diffraction data.

    Science.gov (United States)

    Vallcorba, Oriol; Latorre, Sonia; Alcobé, Xavier; Miravitlles, Carles; Rius, Jordi

    2011-11-01

    The title compound, C(21)H(14)N(4)O(2)S, belongs to a family of molecules possessing nonlinear optical properties in solution. Its structure has been solved from laboratory X-ray powder diffraction data using a new direct-space structure solution method, where the atomic coordinates are directly used as parameters and the molecular geometry is described by restraints. The molecular packing is controlled by two systems of π-π interactions and one weak edge-to-face interaction.

  9. I-Min: An Intelligent Fermat Point Based Energy Efficient Geographic Packet Forwarding Technique for Wireless Sensor and Ad Hoc Networks

    CERN Document Server

    Ghosh, Kaushik; Das, and Pradip K; 10.5121/jgraphoc.2010.2204

    2010-01-01

    Energy consumption and delay incurred in packet delivery are the two important metrics for measuring the performance of geographic routing protocols for Wireless Adhoc and Sensor Networks (WASN). A protocol capable of ensuring both lesser energy consumption and experiencing lesser delay in packet delivery is thus suitable for networks which are delay sensitive and energy hungry at the same time. Thus a smart packet forwarding technique addressing both the issues is thus the one looked for by any geographic routing protocol. In the present paper we have proposed a Fermat point based forwarding technique which reduces the delay experienced during packet delivery as well as the energy consumed for transmission and reception of data packets.

  10. Spectroscopic and X-ray crystallographic evidence for electrostatic effects in 4-substituted cyclohexanone-derived hydrazones, imines, and corresponding salts.

    Science.gov (United States)

    Dibble, David J; Ziller, Joseph W; Woerpel, K A

    2011-10-07

    The axial conformer of several 4-substituted cyclohexanone hydrazone salts was found to predominate in solution. Changes in the charge of the molecule and the polarity of the solvent led to changes in the conformational preference of each molecule that were consistent with electrostatic stabilization of the axial conformer. (1)H NMR spectroscopic analysis was utilized to determine the structure of cyclohexanone-derived substrates by comparison to conformationally restricted trans-decalone derivatives and computational models. X-ray crystallography demonstrated that the axial configuration of a pendant benzyloxy group is the preferred conformation of an iminium ion in the solid state. The structure of a neutral hydrazone was also determined to favor the axial configuration for a pendant benzyloxy group in the solid state.

  11. Nazofarenks kanserli hastalarda geç yan etki olarak ortaya çıkan trismus gelişimine etkili faktörler

    OpenAIRE

    ÖZYAR, Enis; KARAKAYA, Ebru; YILDIZ, Ferah; ATAHAN, İ. Lale

    2006-01-01

    OBJECTIVES Our objective is to analyse the rate of trismus induced after treatment for nonmetastatic nasopharyngeal cancer patients and to assess the factors on development of it. METHODS The files of 292 patients with more than two years follow-up between November 1993-2001 were investigated retrospect ively. The patient related factors (gender, age), tumor related factors (stage, histopathological diagnosis, trismus at the time of diagnosis, cranial nerve involvement), tretment related fac...

  12. Synthesis, characterization, spectroscopic and theoretical studies of new zinc(II), copper(II) and nickel(II) complexes based on imine ligand containing 2-aminothiophenol moiety

    Science.gov (United States)

    Shafaatian, Bita; Mousavi, S. Sedighe; Afshari, Sadegh

    2016-11-01

    New dimer complexes of zinc(II), copper(II) and nickel(II) were synthesized using the Schiff base ligand which was formed by the condensation of 2-aminothiophenol and 2-hydroxy-5-methyl benzaldehyde. This tridentate Schiff base ligand was coordinated to the metal ions through the NSO donor atoms. In order to prevent the oxidation of the thiole group during the formation of Schiff base and its complexes, all of the reactions were carried out under an inert atmosphere of argon. The X-ray structure of the Schiff base ligand showed that in the crystalline form the SH groups were oxidized to produce a disulfide Schiff base as a new double Schiff base ligand. The molar conductivity values of the complexes in dichloromethane implied the presence of non-electrolyte species. The fluorescence properties of the Schiff base ligand and its complexes were also studied in dichloromethane. The products were characterized by FT-IR, 1H NMR, UV/Vis spectroscopies, elemental analysis, and conductometry. The crystal structure of the double Schiff base was determined by single crystal X-ray diffraction. Furthermore, the density functional theory (DFT) calculations were performed at the B3LYP/6-31G(d,p) level of theory for the determination of the optimized structures of Schiff base complexes.

  13. HIGHLY EFFICIENT GRIGNARD-TYPE IMINE ADDITIONS VIA C-H ACTIVATION IN WATER AND UNDER SOLVENT-FREE CONDITIONS. (R828129)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  14. Vibrational spectroscopic and thermo dynamical property studies, Fukui functions, HOMO-LUMO, NLO, NBO and crystal structure analysis of a new Schiff base bearing phenoxy-imine group

    Science.gov (United States)

    Ceylan, Ümit; Çapan, Ali; Yalçın, Şerife Pınar; Sönmez, Mehmet; Aygün, Muhittin

    2017-05-01

    This study covers the synthesis, structural characterization by experimental FT-IR, 1H NMR and 13C NMR, UV-Vis and single crystal XRD and comparison with theoretical calculations of a Schiff base compound bearing phenoxy group, C34H28N2O4 by using the DFT method 6-311G(d,p) basis set. The molecular geometry, the dipole moments, electrostatic potential, vibrational frequencies, HOMO-LUMO energy were calculated. NBO, NLO, thermodynamic properties and Fukui function were studied. In this work, theoretical values show good agreement with experimental values.

  15. A green and facile approach for synthesizing imine to develop optical biosensor for wide range detection of bilirubin in human biofluids.

    Science.gov (United States)

    Ellairaja, Sundaram; Shenbagavalli, Kathiravan; Ponmariappan, Sarkaraisamy; Vasantha, Vairathevar Sivasamy

    2017-05-15

    Bilirubin, a key biomarker for the jaundice and its clinical diagnosis needs a better analytical tool. A novel and simple fluorescent platform based on (2,2'-((1E,1'E)-((6-bromopyridine-2,3-diyl) bis(azanylylidene)) bis(methanylylidene diphenol) (BAMD) was designed. BAMD showed a remarkable fluorescent intensity with a very good quantum yield of 0.85 and lifetime of 870ps. Hence, it was applied for the determination of bilirubin using both colorimetric and fluorimetric techniques in physiological and basic pH. Under optimized experimental conditions, the probe detects bilirubin selectively in the presence of other interfering biomolecules and metal ions. The linear range of detection is 1pM-500µM at pH=7.4 and LOD is 2.8 and 3.3 pM at pH=7.4 and 9.0, respectively, which were reported so far. The probe detects the bilirubin through FRET mechanism. The practical application of the probe was successfully tested in the human blood and urine samples. Based on all above advantages, this simple idea can be applied to design a simple clinical diagnostic tool for jaundice. Copyright © 2016. Published by Elsevier B.V.

  16. Synthesis of air- and moisture-stable, storable chiral oxorhenium complexes and their application as catalysts for the enantioselective imine reduction.

    Science.gov (United States)

    Das, Braja Gopal; Nallagonda, Rajender; Dey, Dhananjay; Ghorai, Prasanta

    2015-09-01

    Air-/moisture-stable, crystalline, and storable chiral salicyloxazoline based oxorhenium(V) complexes have been synthesized and their catalytic application for the asymmetric reduction of ketimines using hydrosilane as hydride source is disclosed. A broad substrate scope, high yields, and excellent enantioselectivities (up to 99 %) are attained. Furthermore, the syntheses of enantiopure α-amino esters, γ- and δ-lactams, and isoindolinones have also been carried out using this methodology. Finally, the method has been applied to synthetic targets of pharmaceutical relevance, such as R-(+)-salsolidine and R-(+)-crispine A. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Comunicação na iminência da morte: percepções e estratégia adotada para humanizar o cuidar em enfermagem

    Directory of Open Access Journals (Sweden)

    Fabiana Medeiros de Brito

    2014-04-01

    Full Text Available O objetivo deste estudo foi investigar a percepção de enfermeiros em relação a conceitos de comunicação ao paciente terminal e as estratégias adotadas por eles para se comunicar com o paciente na terminalidade. Métodos: Pesquisa qualitativa, realizada com sete enfermeiros na unidade de terapia intensiva de um hospital público da cidade de João Pessoa, Paraíba. Os dados foram coletados em entrevistas gravadas, de dezembro de 2011 a janeiro de 2012, e submetidos à técnica de análise de conteúdo. Resultados: As categorias identificadas foram: Percepção de enfermeiros sobre comunicação com o paciente terminal e estratégias adotadas por enfermeiros para uma boa comunicação com o paciente terminal. Tais categorias indicaram que os profissionais passam a valorizar a comunicação na prática clínica, utilizando-a como estratégia para auxiliar o cuidar ao paciente terminal. Conclusão: Espera-se que este estudo subsidie novas investigações, pois ainda são incipientes as pesquisas que abordam a comunicação na assistência ao paciente terminal.

  18. Design, synthesis and DNA binding activities of late first row transition metal(II) complexes of bi- functional tri - and tetratopic imines.

    Science.gov (United States)

    Netalkar, Priya P; Kamath, Anupama; Netalkar, Sandeep P; Revankar, Vidyanand K

    2012-11-01

    A series of novel Co(II), Ni(II), Cu(II) and Zn(II) complexes of tri and tetratopic hydrazones have been prepared. Ligands L(1)H(2) and L(2)H(2) were synthesized by the condensation of 2-formylphenoxyacetic acid with 2-hydrazinobenzothiazole and 2-hydroxy-3-hydrazinebenzopyrazine, respectively. The prepared complexes were characterized by the analytical and spectral techniques. All the complexes were found to be monomeric in nature with octahedral geometry. Both ligands were found to be electrochemically active in the working potential range showing single electron transfer process attributed to the deprotonation of carboxylic group of the 2-formylphenoxyacetic acid. The potency of the ligand and its complexes as antimicrobial agents has been investigated and made to interact with Escherichia coli DNA to investigate the binding/cleaving ability by absorption, hydrodynamic and electrophoresis studies.

  19. Highly efficient catalytic enantioselective Mannich reaction of malonates with N-tert-butoxycarbonyl imines by using Yb(OTf)3/pybox catalysts at room temperature.

    Science.gov (United States)

    Karimi, Babak; Jafari, Ehsan; Enders, Dieter

    2013-07-29

    Go Mannich! A highly efficient and enantioselective method for the direct asymmetric reaction of dibenzyl malonate with N-tert-butoxycarbonyl aldimines in the presence of Yb(OTf)3 and iPr-pybox complexes is described (see scheme; pybox = pyridine bisoxazoline).

  20. Benzenoid-quinonoid tautomerism of azomethines and their structural analogs. XXXVI. 5-Hydroxy-2,3-tetramethylenebenzo(b)furan-4-carbaldehyde imines

    Energy Technology Data Exchange (ETDEWEB)

    Rybalkin, V.P.; Bushkov, A.Ya.; Bren' , V.A.; Minkin, V.I.

    1986-03-01

    The N-aryl- and N-alkylamines of 5-hydroxy-2,3-tetramethylenebenzo(b)furan-4-carbaldehyde were synthesized. In solutions they exist in two equilibrium forms (hydroxyvinylimine (benzenoid) and aminovinyl ketone (quinonoid)). Substitution of the N-aryl group by an N-alkyl group, increase in the polarity of the solvent, and decrease in the temperature of the solutions shift the tautomeric equilibrium toward the quinonoid form.

  1. Dendron-anchored organocatalysts: the asymmetric reduction of imines with trichlorosilane, catalysed by an amino acid-derived formamide appended to a dendron.

    Science.gov (United States)

    Figlus, Marek; Caldwell, Stuart T; Walas, Dawid; Yesilbag, Gulen; Cooke, Graeme; Kocovský, Pavel; Malkov, Andrei V; Sanyal, Amitav

    2010-01-07

    Asymmetric reduction of ketimines with trichlorosilane can be catalysed by the Lewis-basic N-methylvaline-derived formamide anchored to a soluble dendron () with good enantioselectivity (

  2. Ulrich Beck : ostmine võib olla sama mõjus poliitiline osalusvorm kui valimaskäimine / Ulrich Beck ; interv. Indrek Ibrus

    Index Scriptorium Estoniae

    Beck, Ulrich

    2005-01-01

    Sotsioloog on seisukohal, et tänapäeval, kus teadusest ja majandusest on kujunenud poliitika, saab erasektorit ja teadlasi mõjutada tarbijakäitumise ning riikidevahelise koostöö suurendamisega. Lisa: Ulrich Beck

  3. Plaklı Bir Damar İle Nıtınol Stent Etkileşimin Sonlu Elemanlar Yöntemiyle İncelenmesi

    OpenAIRE

    GÜNEŞ, Recep; Çam, Ömer; Apalak, M. Kemal

    2012-01-01

    In this study, the interaction between the Nitinol stent and the artery with plaque was investigated using finite element method. The occurring pressure values during the cardiac contraction (systolic) and loosening (diastolic) were applied as loading to the modeled system with Nitinol stent. In the light of the stress values, the suitability of the Nitinol stent in an artery with plaque was investigated. In the analysis, Nitinol stent was assumed to be shape memory alloy, and artery and plaq...

  4. Versatile cooperative ligand effects in group 9 transition metal catalysis: Applications in transfer hydrogenation & hydrogen autotransfer reactions, ketene & ketene imine synthesis and hydroformylation

    NARCIS (Netherlands)

    Tang, Z.

    2015-01-01

    Cooperative ligand effects of transition metal complexes have a profound impact on the reaction outcome of catalytic reactions, and development of (new) cooperative metal-ligand systems is a hot topic in current catalysis research. Conventional ligands with hydride-accepting/delivering activities ar

  5. Stereoselective [3+2] Carbocyclization of Indole-Derived Imines and Electron-Rich Alkenes: A Divergent Synthesis of Cyclopenta[b]indole or Tetrahydroquinoline Derivatives.

    Science.gov (United States)

    Galván, Alicia; Calleja, Jonás; González-Pérez, Adán B; Álvarez, Rosana; de Lera, Angel R; Fañanás, Francisco J; Rodríguez, Félix

    2015-11-16

    An unprecedented stereoselective [3+2] carbocyclization reaction of indole-2-carboxaldehydes, anilines, and electron-rich alkenes to obtain cyclopenta[b]indoles is disclosed. This pathway is different from the well-established Povarov reaction: the formal [4+2] cycloaddition involving the same components, which affords tetrahydroquinolines. Moreover, by simply changing the Brønsted acid catalyst, this multicomponent coupling process could be divergently directed towards the conventional Povarov pathway to produce tetrahydroquinolines or to the new pathway (anti-Povarov) to generate cyclopenta[b]indoles. Supported by computational studies, a stepwise Mannich/Friedel-Crafts cascade is proposed for the new anti-Povarov reaction, whereas a concerted [4+2] cycloaddition mechanism is proposed for the Povarov reaction.

  6. Facile syntheses of dissymmetric ferrocene-functionalized Lewis acids and acid-base pairs.

    Science.gov (United States)

    Morgan, Ian R; Di Paolo, Angela; Vidovic, Dragoslav; Fallis, Ian A; Aldridge, Simon

    2009-12-21

    A facile synthetic approach is reported for the synthesis of dissymmetric 1,2-ferrocenediyl Lewis acids and mixed acid-base pairs including the first example of a 1-phosphino-2-borylferrocene; the use of non-racemic electrophiles allows for the isolation of single diastereomer products.

  7. Enantioselective synthesis of helicenequinones and -bisquinones.

    Science.gov (United States)

    Urbano, Antonio; Carreño, M Carmen

    2013-02-07

    A convergent approach based on Diels-Alder reactions between polycyclic dienes and benzoquinones has emerged as a powerful tool for the construction of helicenequinones and bisquinones. Chemical resolution and asymmetric Diels-Alder reactions with sulfinyl quinones provide direct access to enantiopure derivatives. Biaryl or ferrocenyl dienes can be resolved leading to helicenequinones having additional axial or planar chirality.

  8. 2-(4-Methoxyphenylsulfinylcyclohexan-1-one

    Directory of Open Access Journals (Sweden)

    Paulo R. Olivato

    2009-05-01

    Full Text Available The cyclohexanone ring in the title compound, C13H16O3S, is in a distorted chair conformation. The intramolecular S...Ocarbonyl distance is 2.814 (2 Å. Molecules are connected into a two-dimensional array via C—H...O contacts involving the carbonyl and sulfinyl O atoms.

  9. Unusual nickel-mediated C-S cleavage of alkyl and aryl sulfoxides.

    Science.gov (United States)

    Schaub, Thomas; Backes, Marc; Radius, Udo

    2007-05-28

    The first examples of transition metal mediated C-S cleavage of sulfoxides containing sp2- and sp3-hybridized carbon bonds attached to the sulfur atom and the first example of a structurally characterized complex featuring an oxygen-bound sulfinyl ligand are presented.

  10. Formation of Chiral a-Monofluorinated-.8-amino Esters through Organocatalytic Asymmetric Reduction of a-Fluoro-j3-enamino Esters by Trichlorosilane

    Institute of Scientific and Technical Information of China (English)

    张鹏; 王超; 周莉; 孙健

    2012-01-01

    A concise method was developed to prepare chiral a-monofluorinated-β-amino esters through N-sulfinyl urea catalyzed asymmetric hydrosilylation of a-fluoro-β-enamino esters, which affords high yields, good to high di- astereoselectivities (up to〉99/1), and moderate to good enantioselectivities (up to 83% ee).

  11. (Z-2-[(2-Hydroxy-1-naphthylmethyleneamino]benzonitrile

    Directory of Open Access Journals (Sweden)

    Jian-Cheng Zhou

    2009-07-01

    Full Text Available The title compound, C18H12N2O, crystallizes in a phenol–imine tautomeric form with a Z conformation for the imine functionality. The dihedral angle between the aromatic rings is 8.98 (9°. A strong intramolecular O—H...N hydrogen-bond interaction between the hydroxyl group and imine N atom occurs.

  12. An investigation of the observed, but counter-intuitive, stereoselectivity noted during chiral amine synthesis via N-chiral-ketimines

    Directory of Open Access Journals (Sweden)

    Thomas C. Nugent

    2013-10-01

    Full Text Available The default explanation for good to high diastereomeric excess when reducing N-chiral imines possessing only mediocre cis/trans-imine ratios (>15% cis-imine has invariably been in situ cis-to-trans isomerization before reduction; but until now no study unequivocally supported this conclusion. The present study co-examines an alternative hypothesis, namely that some classes of cis-imines may hold conformations that erode the inherent facial bias of the chiral auxiliary, providing more of the trans-imine reduction product than would otherwise be expected. The ensuing experimental and computational (DFT results favor the former, pre-existing, explanation.

  13. Class 220 and 240 of HT1170 Imine-type Solventless Impregnating Resin%220、240级亚胺型无溶剂浸渍树脂的研究

    Institute of Scientific and Technical Information of China (English)

    王祖德; 金品梅

    2008-01-01

    耐高温绝缘浸渍漆是当前绝缘行业主要的研究对象.通过独特的分子设计研制成功综合性能良好的耐高温HT-1170无溶剂浸渍树脂.HT-1170无溶剂浸渍树脂经过美国老化试验室的耐热指数评定达到240级.

  14. Eğitim Seviyesindeki Yükselmenin Geleneksel Aile Anlayışının Değişimine Etkisi: Karabük Üniversitesi Örneği

    Directory of Open Access Journals (Sweden)

    Sinan YILMAZ

    2012-09-01

    Full Text Available Günümüzde aile ile ilgili yeni yaklaşımlar ortaya çıkmış ve geleneksel aile anlayışları değişmeye başlamıştır. Evlilik yaşının yükselmesi, boşanmaların artması, nikâhsız birlikte yaşama anlayışının yaygınlaşmaya başlaması, hanehalkı sayısının küçülmesi, çocuk sayısının azalması vb. yeni yaklaşım ve anlayışlar, sıradan bir insanın bile gözlemleyebileceği ölçüde yaygınlaşmıştır. Aile ile ilgili yeni anlayışların ortaya çıkmasını tetikleyen elbette pek çok neden vardır. Bu araştırmada, aile ile ilgili bu yeni anlayışların ortaya çıkmasında eğitimin rolünün ne olduğu araştırılmaktadır. Araştırmada, aile anlayışında meydana gelen değişmelerle ilgili olarak TÜİK verilerinden yararlanıldığı gibi üniversite öğrencileri üzerinde yapmış olduğumuz bir araştırmanın sonuçlarına da yer verilmiştir. İstatistiksel veriler eğitim seviyesinin düşük olduğu dönemlerle karşılaştırılmış, böylece eğitim seviyesindeki yükselmenin nasıl bir değişim ve dönüşüme neden olduğu tespit edilmeye çalışılmıştır. Özellikle ikinci dünya savaşı sonrasında aile ile ilgili olarak Avrupa ve Amerika’da yaşanan gelişmeler de incelenmiş ve Türk ailesindeki gelişmelerle karşılaştırılarak benzer dönüşümlerin yaşanıp yaşanmayacağı tartışılmıştır. Anahtar Kelimeler: Aile, Türk Ailesi, Geleneksel aile, Yeni aile anlayışları, Eğitim ve aile. The Effect of Increasing Education Level on Changes in Traditional Family Patterns: The Case of Karabuk University Today, new approaches about the family have emerged, and traditional family patterns have started to change. The increase of marriage age, the increase in the number of divorces, the tendency for cohabitation, the decrease in the number of family members and the decline in the number of offspring have become so wide-spread that these changes could be easily observed even by ordinary people. There are, of course, a lot of reasons that stimulate these new approaches about the family, yet this study focuses upon the role of education concerning the emergence of these new concepts about the family. In the study, the data taken from TUIK, as well as the results of a survey about the changes in the family patterns carried out on the university students are used. The statistical data are compared with the data of the previous periods in which the level of education was low. Additionally, the study examines how the increase in the level of education has brought about transformation in the traditional family patterns. Moreover, the transformations of family patterns in Europe and America, particularly after the Second World War, are studied, and these transformations are compared with the similar changes in the Turkish family patterns. The study also discusses whether the same transformations could be seen in Turkish family. Effet de l’élévation du niveau/grade d’études au changement de la conception de la famille traditionnelle : Le Cas de l’Université de Karabük Aujourd’hui, de nouvelles approches ont vu le jour sur la famille et les conceptions de la famille traditionnelle ont commencé à changer. L’augmentation de l’âge du mariage, le nombre croissant de divorces, de personnes vivant en couple sans contrat de mariage, la diminution du nombre d’habitants au sein d’un ménage, la réduction du nombre d’enfants etc… sont des événements que l’on peut observer de plus en plus. Il existe bien sûr de nombreuses raisons qui déclenchent l’émergence de ces nouvelles conceptions au sujet de la famille. Dans cette étude, nous avons étudié le rôle de l’éducation dans l’émergence de ces nouvelles conceptions de la famille moderne. Dans cette étude, en ce qui concerne les changements relatifs à la conception familiale nous avons utilisé les données de TÜİK et aussi celles de notre recherche portant sur les étudiants universitaires. Les données statistiques sont comparées avec les donn

  15. Preparation of 14-C-labelled 1,4-Dideoxy-1,4-imino-D-arabinitol: Cyanosilylation of Cyclic Imines using KCN in a One-Pot Synthesis

    DEFF Research Database (Denmark)

    Lundt, Inge; Malle, Birgitte Mølholm; Foged, Christian;

    1999-01-01

    A new method for C-C bond formation was developed based on in situ cyanosilylation of cyclic Schiff bases using KCN, TMSCl, KI and ZnI2. This method was used to prepare the potent -glucosidase inhibitor 1,4-dideoxy-1,4-imino-D-arabinitol 14-C labelled at C-5.Keywords: in situ cyanosilylation; 14-C...

  16. Preparation and Characterization of Silica-Supported Imine Palladacycle Complex and Its Catalytic Performance%硅胶负载的亚胺环钯催化剂的制备、表征及催化性能

    Institute of Scientific and Technical Information of China (English)

    杨新丽; 张成军; 戴维林; 刘建平; 韦梅生

    2012-01-01

    The silica-supported inline palladacycle complex was synthesized by the following procedure as, first, NH2-modified silica was obtained by grafting with organosilane; second, the as-obtained silica compound was treated with o-methoxybenzaldehyde to form SiO2-NH2-Schiff base; at last, the catalyst was attained after being reacted with Ii2PdCl4-methanol solution. The as-prepared complex was characterized by Fourier transform infrared spectroscopy, X-ray powder diffraction, and X-ray photoelectron spectroscopy techniques. The catalytic activity test was carried out in Heck reaction of iodobenzene with acrylamide to the trans-cinnamamide. The effect of reaction parameters on the product yield was investigated, such as solvent, reaction temperature, molar ratio of iodobenzene to acrylamide, kinds and amount of base, amount of catalyst, and reaction time. The optimum reaction conditions were established and the possible reaction mechanism was discussed.%利用SiO2表面硅羟基与有机硅烷作用制得氨基化SiO2,再与邻甲氧基苯甲醛反应,可得到键合在SiO2微粒表面的席夫碱配体,该配体与Li2PdCl4甲醇溶液反应得到SiO2负载的亚胺环钯催化剂.采用傅里叶变换红外光谱、X射线固体粉末衍射和X射线光电子能谱等手段对催化剂进行了表征,并用于催化碘代苯(PhI)与丙烯酰胺(AM)反应生成反式-肉桂酰胺的反应中,考察了溶剂、温度、原料比、缚酸剂及其用量、催化剂用量和反应时间对催化性能的影响,从而得到适宜的反应条件,并探讨了反应机理.

  17. Eğitim Seviyesindeki Yükselmenin Geleneksel Aile Anlayışının Değişimine Etkisi: Karabük Üniversitesi Örneği

    Directory of Open Access Journals (Sweden)

    Sinan Yılmaz

    2012-09-01

    Full Text Available ÖzetGünümüzde aile ile ilgili yeni yaklaşımlar ortaya çıkmış ve geleneksel aile anlayışları değişmeye başlamıştır. Evlilik yaşının yükselmesi, boşanmaların artması, nikâhsız birlikte yaşama anlayışının yaygınlaşmaya başlaması, hanehalkı sayısının küçülmesi, çocuk sayısının azalması vb. yeni yaklaşım ve anlayışlar, sıradan bir insanın bile gözlemleyebileceği ölçüde yaygınlaşmıştır. Aile ile ilgili yeni anlayışların ortaya çıkmasını tetikleyen elbette pek çok neden vardır. Bu araştırmada, aile ile ilgili bu yeni anlayışların ortaya çıkmasında eğitimin rolünün ne olduğu araştırılmaktadır. Araştırmada, aile anlayışında meydana gelen değişmelerle ilgili olarak TÜİK verilerinden yararlanıldığı gibi üniversite öğrencileri üzerinde yapmış olduğumuz bir araştırmanın sonuçlarına da yer verilmiştir. İstatistiksel veriler eğitim seviyesinin düşük olduğu dönemlerle karşılaştırılmış, böylece eğitim seviyesindeki yükselmenin nasıl bir değişim ve dönüşüme neden olduğu tespit edilmeye çalışılmıştır. Özellikle ikinci dünya savaşı sonrasında aile ile ilgili olarak Avrupa ve Amerika’da yaşanan gelişmeler de incelenmiş ve Türk ailesindeki gelişmelerle karşılaştırılarak benzer dönüşümlerin yaşanıp yaşanmayacağı tartışılmıştır. AbstractToday, new approaches about the family have emerged, and traditional family patterns have started to change. The increase of marriage age, the increase in the number of divorces, the tendency for cohabitation, the decrease in the number of family members and the decline in the number of offspring have become so wide-spread that these changes could be easily observed even by ordinary people. There are, of course, a lot of reasons that stimulate these new approaches about the family, yet this study focuses upon the role of education concerning the emergence of these new concepts about the family.In the study, the data taken from TUIK, as well as the results of a survey about the changes in the family patterns carried out on the university students are used. The statistical data are compared with the data of the previous periods in which the level of education was low. Additionally, the study examines how the increase in the level of education has brought about transformation in the traditional family patterns. Moreover, the transformations of family patterns in Europe and America, particularly after the Second World War, are studied, and these transformations are compared with the similar changes in the Turkish family patterns. The study also discusses whether the same transformations could be seen in Turkish family.RésuméAujourd’hui, de nouvelles approches ont vu le jour sur la famille et les conceptions de la famille traditionnelle ont commencé à changer. L’augmentation de l’âge du mariage, le nombre croissant de divorces, de personnes vivant en couple sans contrat de mariage, la diminution du nombre d’habitants au sein d’un ménage, la réduction du nombre d’enfants etc… sont des événements que l’on peut observer de plus en plus. Il existe bien sûr de nombreuses raisons qui déclenchent l’émergence de ces nouvelles conceptions au sujet de la famille. Dans cette étude, nous avons étudié le rôle de l’éducation dans l’émergence de ces nouvelles conceptions de la famille moderne.Dans cette étude, en ce qui concerne les changements relatifs à la conception familiale nous avons utilisé les données de TÜİK et aussi celles de notre recherche portant sur les étudiants universitaires. Les données statistiques sont comparées avec les données où le niveau d’éducation est bas dans le but de déterminer comment l’élévation du niveau d’études suscite un changement et une transformation en ce qui concerne la famille. Plus particulièrement, nous avons aussi examiné l' évolutions de la famille en Europe et aux Etats-Unis après la deuxième guerre mondiale et nous avons fait des comparaisons avec l’évolution de la famille Turque pour voir s’il existe des changements et transformations similaires.الملخص:في يومنا الحاضر ظهرت أساليب جديدة حول الأسرة و بدأت مفاهيم "الأسرة التقليدية" تتغير. ارتفاع سن الزواج وزيادة الطلاق، وانتشار مفهوم الاختلاط بين الشباب والشابات بدون نكاح، وتقليل عدد أفراد الأسرة، وتقليل عدد الأطفال في الأسرة، وغير ذلك من المفاهيم الجديدة؛ قد شاعت في المجتمع بقدر حتى يترصدها أي إنسان عادي. لا شك أن هناك أسباب عديدة في تحريك ظهور مفاهيم جديدة تتعلق بالأسرة. في هذه الدراسة، تم البحث عن مدى دور التعليم في ظهور هذه المفاهيم الجديدة المتعلقة بالأسرة... في الدراسة؛ كما تمت الاستفادة من معطيات مؤسسة إحصائيات تركيا، تترق إليه الباحث إلى نتائج البحث الذي قمنا بتطبيقه على طلاب الجامعة أيضًا. و تمت مقارنة البيانات الإحصائية الجديدة بفترات كان فيها مستوى التعليم منخفضًا؛ لذلك حاول الباحث تحديد مدى تأثير مستوى التعليم المرتفع على سبب التغيّر و التحوّل الإجتماعي. ولاسيما، التطوّرات التي شاهدت أوروبا وأمريكا إثر الحرب العالمية الثانية حول الأسرة؛ تمت دراستها ومقارنتها بينها وبين التطوّرات التي شاهدتها الأسرة التركية و نوقشت؛ هل ستعيش نفس المراحل أم لا؟

  18. Tüketim Mekanlarının Dönüşümünde Görsel İletişimin Rolü: Küresel Kahve Dükkanları

    Directory of Open Access Journals (Sweden)

    Özlen ÖZGEN

    2014-02-01

    Full Text Available Kapitalizmin varlığını sürdürmesinin önemli bir koşulu mekanın yeniden düzenlenmesidir. Mekanın  hem  iç ve hem de dış yapılanması bu düzenlemede ayırt edici olmakta, kapitalizmin tüketim mekanlarından küresel kahve dükkanları ise bu farklılaşmanın önemli örnekleri arasında yer almaktadır.Yüzyıllar içinde tüm kıtalara yayılarak küreselleşen kahve, günümüzde farklı markalar altında çağımız insanının gündelik yaşamının başat içeceklerinden biri haline gelmiştir. Çalışmada Starbucks, Gloria Jeans, Lavazza, Illy ve Kahve Dünyası gibi küresel kahve markalarının kahve dükkanlarından örneklere yer verilmektedir. Bu markaların kahve dükkanlarının tasarımlarında çoğunlukla  kahveye ilişkin görsellerin kullanıldığı,  Lavazza’nın ise mekan tasarımı açısından diğer markalardan farklılaştığı görülmektedir. Lavazza bu farklılaşmayı, dünyaca ünlü fotoğraf sanatçıları tarafından çekilen takvim fotoğraflarını kahve dükkanlarının tasarımında kullanarak yaratmaktadır. Markanın görsel iletişiminde kullanılan özel fotoğraflar ile Lavazza arasında kurulan özdeşlik mekan aracılığıyla da pekiştirilmektedir. 

  19. SN2-type ring opening of substituted--tosylaziridines with zinc (II) halides: Control of racemization by quaternary ammonium salt

    Indian Academy of Sciences (India)

    Manas K Ghorai; Deo Prakash Tiwari; Amit Kumar; Kalpataru Das

    2011-11-01

    Quaternary ammonium salt mediated highly regioselective ring opening of aziridines with zinc(II) halides to racemic and non-racemic -halo amines in excellent yield and selectivity is described. The reaction proceeds via an SN2-type pathway and the partial racemization of the starting substrate and the product was effectively controlled by using quaternary ammonium salts to afford the enantioenriched products (er up to 95:5).

  20. Special Issue of "Asymmetric Synthesis"%Special Issue of "Asymmetric Synthesis"

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    Organic chemistry exploring the world at a molecu- lar level remains essential for our society in the 21st century. Asymmetric synthesis, particularly those em- ploying catalytic approach, is one of the most important research fields in organic synthesis providing chiral compounds in an enantiopure form. The latter is critical since the two enantiomers of one chiral compound, in many cases, have a different response in biological sys- tems. The huge markets of non-racemic chiral com- pounds as synthetic intermediates, pharmaceuticals,